WorldWideScience

Sample records for aseptic conditions

  1. Biosurfactant production using mixed cultures under non-aseptic conditions

    International Nuclear Information System (INIS)

    The use of surfactants is of increasing interest for remediation of petroleum hydrocarbons in groundwater and soil. Surfactants increase the accessibility of adsorbed hydrocarbons and mobilize immiscible petroleum hydrocarbons for treatment. Biosurfactants have the advantage of biodegradability and non-toxicity over their synthetic counterparts, and can be produced from renewable sources. In this study the production of biosurfactant from molasses was investigated in continuously stirred batch reactors. The effects of substrate concentration, yeast extract and peptone on biomass accumulation and biosurfactant production were investigated. Biosurfactant production was quantified by surface tension reduction and critical micelle dilution (CMD). Biosurfactant production was directly correlated with biomass production, and was improved with the addition of yeast extract. Centrifugation of the whole broth reduced surface tension. The performance of the biosurfactant produced from molasses under non-aseptic condition is comparable to other published results

  2. Aseptic technique for cell culture.

    Science.gov (United States)

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  3. Syphilitic aseptic meningitis

    Science.gov (United States)

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  4. Severe aseptic meningitis with hydrocephalus following iotrolan myelography: A case report

    International Nuclear Information System (INIS)

    A case of severe aseptic meningitis with communicating hydrocephalus following iotrolan myelography is presented. The patient's condition improved very quickly after corticosteroid therapy. Rapid improvement and absence of pathogenic organisms in the CSF culture strongly favor an aseptic meningitis. This is the first reported case of aseptic meningitis with the secondary development of hydrocephalus caused by iotrolan myelography

  5. Radiation sterilization of plastic packing materials and aseptic packaging

    International Nuclear Information System (INIS)

    In the present day of 'satiation', quality, not quantity, is emphasized for foods, the consumers being oriented toward raw and healthy foodstuff. Aseptic Packaging is excellent means of conservation. While conventionally chemicals have been used for sterilization of packing materials for aseptic packaging, the sterilization by radiation is used in part recently. The following are described : history of aseptic packaging and its features, sterilization by radiation, γ-ray sterilization of large-sized containers, the development of an aseptic packaging system using electron rays, the occurrence of offensive odors from packing materials (comparison of odors from various materials, volatile substances occurring in irradiated polyethylene, influence of film grade upon the formation of carboxylic acid, influence of the irradiation conditions upon the occurrences of volatile substances, volatile substances occurring in the irradiation of bag-in-box packing materials), changes in properties of the packing materials. (Mori, K.)

  6. Aseptic technique in microgravity.

    Science.gov (United States)

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  7. The biology of aseptic osteolysis.

    Science.gov (United States)

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  8. Co-trimoxazole induced aseptic meningitis.

    OpenAIRE

    PASHANKAR, D.; McArdle, M.; A. Robinson

    1995-01-01

    A 15 year old boy presented with two episodes of aseptic meningitis-like reactions after ingestion of co-trimoxazole. The diagnosis of co-trimoxazole induced aseptic meningitis was made. This syndrome should be considered in the differential diagnosis of aseptic meningitis.

  9. Amoxicillin-induced aseptic meningoencephalitis

    OpenAIRE

    Radi Shahien; Vetaly Vieksler; Abdalla Bowirrat

    2010-01-01

    Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM) is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of asepti...

  10. Cat scratch disease complicated with aseptic meningitis and neuroretinitis

    Directory of Open Access Journals (Sweden)

    Vitor Laerte Pinto Jr.

    2008-04-01

    Full Text Available Cat scratch disease (CSD is a self limited condition characterized by fever, lymph node enlargement and less often eye involvement. Central nervous system involvement by Bartonella henselae infection is possibly an important cause of morbidity; its role as an agent of aseptic meningitis is unknown. We report a case of a 40 years-old man with CSD accompanied by aseptic meningitis and neuroretinitis. Serum indirect immmunofluorescence (IFI assays for B. henselae were positive and the cerebrospinal fluid (CSF analysis showed mononuclear pleocytosis and increased level of protein. Serological tests for other etiologies were negative. The patient responded well to antibiotic therapy with oral doxycicline plus rifampin and in the 12th day of hospitalization evolved to total regression of the headache and partial regression of the visual loss. Clinicians should consider CSD as a differential diagnosis when assessing previously healthy patients with aseptic meningitis associated with regional lymphadenopathy and epidemiological history of feline contact.

  11. Amoxicillin-induced aseptic meningoencephalitis

    Directory of Open Access Journals (Sweden)

    Radi Shahien

    2010-06-01

    Full Text Available Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of aseptic meningitis due to amoxicillin, and then review the literature on this rare idiosyncratic event which may occur after local or systemic drug administration. A 77-year-old man was admitted to our hospital with fever, headache, and neck stiffness. Seven days before admission he had a dental and gingival inflammation. He was treated with two oral doses of 500 mg daily of amoxicillin for one week. The seventh day he awoke with the complaints that prompted hospital admittance. Amoxicillin was stopped 1 day before his admission. From his history we knew of two similar episodes: The first episode was after a dental procedure 3 months before this incident. He had received a 1-week course of postprocedure amoxicillin of 500 mg daily and had similar headache, fever, and chills during the entire course of treatment. He wasn’t admitted to the hospital, because he stopped taking amoxicillin and he felt spontaneous pain relief after taking symptomatic pain treatment. The second episodes was 6 months after his first admission, he had been admitted to our hospital with the same symptoms. Amoxicillin was stopped and changed with intravenous (IV ceftriaxone (CTRX for 10 days due to suspected partial untreated meningitis. The patient improved rapidly within 2 days and was discharged from the hospital. On the basis of these three confirmed episodes of meningitis after recurrent exposure to amoxicillin, with repetitive negative testing for viral, bacterial, and mycobacterial

  12. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research, and in vegetative propagation of many plant species. The development...

  13. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research and in vegetative propagation of many plant species. The development...

  14. CT scan of bacterial and aseptic meningitis

    International Nuclear Information System (INIS)

    CT scans of the patients with aseptic and bacterial meningitis were reviewed and compared to previous reports. In aseptic meningitis, no abnormal CT findings were observed. In bacterial meningitis, CT findings were ventricular dilatation, subdural fluid collection, parenchymal low density, intracerebral hematoma and meningeal enhancement after contrast injection. Three patients among 48 suffered from status epileptics during the course of the illness. All of 3 patients developed parenchymal inhomogeneous low density and progressive ventricular dilatation which did not improve after ventricular peritoneal shunt surgery. We believe that these changes are most likely due to hypoxic hypoxemia during epileptic seizure and meningitis itself seems to play a little role. (author)

  15. Septic and aseptic arthritis: a continuum?

    Science.gov (United States)

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  16. Recurrent aseptic meningitis in association with Kikuchi-Fujimoto disease: case report and literature review

    Directory of Open Access Journals (Sweden)

    Komagamine Tomoko

    2012-09-01

    Full Text Available Abstract Background Kikuchi Fujimoto disease (KFD, or histiocytic necrotising lymphadenitis, is a benign and self-limiting condition characterised by primarily affecting the cervical lymph nodes. Recurrent aseptic meningitis in association with KFD is extremely rare and remains a diagnostic challenge. Case presentation We report a 28-year-old man who presented 7 episodes of aseptic meningitis associated with KFD over the course of 7 years. Histopathological findings of enlarged lymph nodes led to the diagnosis of KFD. The patient’s headache and lymphadenopathy spontaneously resolved without any sequelae. Conclusions A diagnosis of KFD should be considered when enlarged cervical lymph nodes are observed in patients with recurrent aseptic meningitis. A long-term prognosis remains uncertain, and careful follow-up is preferred.

  17. [A case of recurrent aseptic meningitis induced by ergot agents].

    Science.gov (United States)

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  18. Sterility testing of a dispensing valve for aseptic function in food service applications.

    Science.gov (United States)

    Stopforth, J D; Kottapalli, B; Samadpour, M

    2008-03-01

    aseptically filled products following initial dispensation and continued use under unrefrigerated conditions. PMID:18389718

  19. Aseptic meningitis caused by human parvovirus B19.

    OpenAIRE

    Okumura, A.; Ichikawa, T

    1993-01-01

    Reports on aseptic meningitis caused by human parvovirus B19 are extremely rare. A case of aseptic meningitis is described in which human parvovirus B19 DNA was detected in the acute phase in cerebrospinal fluid by the polymerase chain reaction.

  20. Possible Tick-Borne Human Enterovirus Resulting in Aseptic Meningitis

    OpenAIRE

    Freundt, Eric C.; Beatty, Douglas C.; Stegall-Faulk, Teresa; Wright, Stephen M.

    2005-01-01

    Enterovirus-specific genetic sequences were isolated from two Amblyomma americanum tick pools. Identical genetic sequences were later obtained from cerebrospinal fluid of a patient with aseptic meningitis and a recent history of tick attachment. These observations suggest the possibility of an emerging tick-borne human enterovirus associated with aseptic meningitis.

  1. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    Directory of Open Access Journals (Sweden)

    Rodrigo Rodrigues PETRUS

    2011-12-01

    Full Text Available Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE. Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and storage at 9ºC, simulating a deficient cold chain scenario as found in the Brazilian market. Microbiological stability evaluation was based on mesophilic and psychrotrophic counts. Sensory shelf-life was estimated according to the ratings assigned to the attributes appearance, aroma, flavor and overall appreciation of milk samples. The pasteurization temperature, in the range investigated, did not affect the shelf-life of milk, which lasted up to 11 days for the three processed batches. The aseptic filling, associated to the employed thermal treatments, did not extend the shelf-life of milk stored under the abuse condition of 9°C, considering that the commercial product shelf-life in Brazil is of about 10 days.

  2. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    Directory of Open Access Journals (Sweden)

    Daniel Aruscavage

    2013-08-01

    Full Text Available Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, thus determining if aseptic technique was observed. Instructors can quickly check for the presence of cross-contamination. After implementing this procedure, a quantifiable improvement in my students’ aseptic technique throughout the semester was observed. It was noted that between the middle and end of the semester there was a slight increase in the amount of cross-contamination but still well below the contamination observed at the beginning of the semester. This procedure was a valuable way to assess aseptic technique during the course of a semester. A search for “aseptic technique” on the American Society of Microbiology website reveals that several lab experiments and job opportunities mention the importance of aseptic technique. It is a skill that must be used for all laboratory procedures when working with microorganisms. It is important for both the safety of the students and for the proper handling of microorganisms. There are several good explanations of aseptic technique on the Internet, and the Nuffield Foundation provides a very good description of techniques (1. The goal of this project is to provide instructors with a tool to assess the aseptic technique of their students by using simple transfers of bacteria to fresh media to identify cross-contamination. When class experiments do not work students may not understand how poor aseptic technique impacted the project. This tool would work best for undergraduate students in an

  3. Giant Leaking Colloid Cyst Presenting with Aseptic Meningitis

    DEFF Research Database (Denmark)

    Bakhtevari, Mehrdad Hosseinzadeh; Sharifi, Guive; Jabbari, Reza;

    2015-01-01

    BACKGROUND: Colloid cysts are benign third ventricle lesions that need to be diagnosed correctly because of their association with sudden death. Chemical or aseptic meningitis is a rare presentation of a colloid cyst. METHODS: We present a case of a 69-year-old man with fever, alteration of mental...... status, and meningismus. Microbiological examination of the cerebrospinal fluid revealed aseptic meningitis. Brain imaging revealed a third ventricular colloid cyst with hydrocephalus. RESULTS: The tumor was resected via endoscopic intervention. There were no persistent operative complications related to...... the endoscopic procedure. CONCLUSIONS: Chemical or aseptic meningitis is an unusual clinical manifestation of a colloid cyst, complicating the differential diagnosis, especially in the elderly....

  4. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    OpenAIRE

    Daniel Aruscavage

    2013-01-01

    Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, ...

  5. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    Science.gov (United States)

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  6. ASEPTIC INSTABILITY OF HIP ENDOPROSTHESIS IN PATIENTS WITH COXARTHROSIS

    Directory of Open Access Journals (Sweden)

    E.A. Persova

    2009-09-01

    Full Text Available Research Objective — study of bone tissue remodeling features at aseptic instability (Al of the femoral endoprosthesis in patients with coxarthrosis according to a level of biomechanical markers of bone resorption and formation. 41 patients with coxarthrosis have been examined, a primary total hip replacement was carried out in 27 patients of them (the comparison group, the endoprosthesis re-replacement was performed in 14 patients of the basic group with endoprosthesis Al. Among the examined patients there were 20 men and 21 women aged from 46 to 67. The control group contained 13 donors. All the patients were made double-energy x-ray absorptiometry, formation markers (osteo-calcin and alkaline phosphatase bone isoenzyme and bone resorption (C-terminal first type collagen telopeptide and calcium — phosphoric metabolism state were determined. The significant data were considered to be the data with probability index p<0,05. Bone tissue remodeling imbalance at Al of the femoral endoprosthesis in patients with coxarthrosis was characterized by the expressed prevalence of resorption processes over the osteogenesis, and higher speed of metabolic processes were expressed more in the group of the men with Al. The hip re-replacement at implant Al is carried out in metabolically unfavorable conditions of bone remodeling. The impartial assessment of Al features at the presurgical stage will allow to fulfil the adequate medicamentous correction of available abnormalities

  7. MR features in patients with residual paralysis following aseptic meningitis

    International Nuclear Information System (INIS)

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord

  8. MR features in patients with residual paralysis following aseptic meningitis

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Dae Chul; Park, Young Seo [College of Medicine, Asan Meidcal Center, University of Ulsan, Seoul (Korea, Republic of)

    1991-01-15

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord.

  9. Degradation of aromatic compounds in plants grown under aseptic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Mithaishvili, T.; Ugrekhelidze, D.; Tsereteli, B.; Sadunishvili, T.; Kvesitadze, G. [Durmishidze Inst. of Biochemistry and Biotechnology, Academy of Sciences of Georgia, Tbilisi (Georgia); Scalla, R. [Lab. des Xenobiotiques, INRA, Toulouse (France)

    2005-02-01

    The aim of the work is to investigate the ability of higher plants to absorb and detoxify environmental pollutants - aromatic compounds via aromatic ring cleavage. Transformation of {sup 14}C specifically labelled benzene derivatives, [1-6-{sup 14}C]-nitrobenzene, [1-6-{sup 14}C]-aniline, [1-{sup 14}C]- and [7-{sup 14}C]-benzoic acid, in axenic seedlings of maize (Zea mays L.), kidney bean (Phaseolus vulgaris L.), pea (Pisum sativum L.) and pumpkin (Cucurbita pepo L.) were studied. After penetration in plants, the above xenobiotics are transformed by oxidative or reductive reactions, conjugation with cell endogenous compounds, and binding to biopolymers. The initial stage of oxidative degradation consists in hydroxylation reactions. The aromatic ring can then be cleaved and degraded into organic acids of the Krebs cycle. Ring cleavage is accompanied by {sup 14}CO{sub 2} evolution. Aromatic ring cleavage in plants has thus been demonstrated for different xenobiotics carrying different substitutions on their benzene ring. Conjugation with low molecular peptides is the main pathway of aromatic xenobiotics detoxification. Peptide conjugates are formed both by the initial xenobiotics (except nitrobenzene) and by intermediate transformation products. The chemical nature of the radioactive fragment and the amino acid composition of peptides participating in conjugation were identified. (orig.)

  10. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    International Nuclear Information System (INIS)

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  11. Aseptic procedure in the ambulant wound management – legal and practical issues

    OpenAIRE

    Schwarzkopf, Andreas

    2007-01-01

    A greater part of the care of chronic wounds takes place in private homes in Germany. Not in every case it is possible to perform hygiene control of the environment. Personal hygiene ideas of patients may differ in a wide range. Teamwork together with surgeons is not always easy for wound managers. Aseptic care of wounds is possible under nearly every condition, if well elaborated processes are engaged. Hygiene in home care is defined by laws to protect nursing persons (BiostoffV, TRBA 250) a...

  12. Study regarding to Asparagus officinalis L. calus reaction, subcultured on aseptic medium with various growth regulators

    Directory of Open Access Journals (Sweden)

    Floare HURGOIU

    2008-05-01

    Full Text Available In our studies, we investigated the effects of some growth regulators, in aseptic conditions, on obtaining Asparagus officinalis plantlets from calus, after 12 weeks of its inoculation.The most recomanded culture media, for obtaining a high number of multimodal stems was MS basal medium, with a mixture of 1mg/l BA and 1 mg/l IBA, which inducing a considerably calusogenesis, and a lot of regenerated plantlets from it, but finally, this medium-after 12 weeks of culture initiation, induced plantlets vitrification.

  13. Studies on aseptic higher plants, (4)

    International Nuclear Information System (INIS)

    The relationship between sterilized soil and plant growth was discussed in the last report, and it was recognized that γ-ray sterilization was more advantageous than autoclave sterilization. Therefore, radishes were cultured under sterile condition in the γ-ray sterilized soil in an acrylamide isolator. After completing their reproductive growth, the possibility of completion of the next generation was investigated. Fighttron was applied for culture environment. The life cycle was completed, and sterilized seeds of the first generation were obtained after fructification. These seeds were cultivated in the acrylamide isolator under exactly the same conditions. They bloomed, fructified and produced the sterilized seeds of the second generation. Flowering, fructification and generation inheritance were thus proved to be possible even under the sterile condition. (Kobatake, H.)

  14. Irradiation as a means of sterilizing packaging materials for aseptic systems

    International Nuclear Information System (INIS)

    Long shelf life of foodstuffs is essential in order to feed the nations of the world. For 'wet' products which quickly deteriorate in air, the use of refrigeration, retort processing and preservatives can be considered. For example, the metal can will continue to be a reliable means of keeping meat and vegetable products in good condition for long periods at ambient conditons. Today, people require food items to be free of preservatives and with a flavour and texture very close to the original, at all times of the year, at lowest cost. Minimal heat processing and immediate filling into a pre-sterilised container without any possibility of contact with the atmosphere, is the logical route to take to meet these requirements and constitutes an aseptic system. The filled product remains in prime condition for many months without the need for refrigeration and preservatives. Irradiation is a convenient and cheap means of pre-sterilising plastic bags for Bag-in-Box systems and the writer will describe how fruit juices and fruit purees are now being packaged aseptically in South Africa and overseas

  15. An efficient and aseptic preparation of 'sodium fluoride (18F) injection' in a GMP compliant facility

    International Nuclear Information System (INIS)

    'Sodium fluoride (18F) injection' is an isotonic NaCl solution containing [18F]NaF to be used as bone imaging agent. Although its new drug application (NDA) was approved by the United States (US) Food and Drug Administration (FDA) in 1972, it has not been commercially available since 1975 due to mostly the popularity of 99mTc-methylene diphosphonate (MDP). Recently, advances in positron emission tomography (PET)/CT technology and the often interrupted 99mTc supply have led to the renewed interest in the use of [18F]NaF to detect bone metastases in cancer patients. This report introduces an efficient, low-cost and aseptic preparation of 'Sodium fluoride (18F) injection' for PET scan. 18F-fluoride in target water from cyclotron was adsorbed onto four different forms of anion-exchange resins then desorbed by isotonic NaCl solution into the product vial. One of the resins that yielded the product at the suitable pH was used for the aseptic preparation. The components for this setup, including stopcocks, extension tubes, etc., were all single-use, individually packed and sterile. The process was done in a lead-line isolator maintained in grade A (PIC/S) aseptic condition. The quality of the obtained 'Sodium fluoride (18F) injection' was analyzed according to its monograph in the European Pharmacopoeia (EP). The resin in the chloride form yielded the product of pH 6.7 and was chosen for the subsequent preparation. The radiochemical yield was quantitative. The product met all criteria specified in EP, including biological, physical and chemical specifications. This method is an efficient, space-saving and extremely low-cost operation that easily performed in an aseptic environment meeting Good Manufacturing Practice (GMP) standard. The quality of the 'Sodium fluoride (18F) injection' so yielded meets EP specifications. This setup provides hospital with facility meeting GMP standard a cost effective and efficient method for ''Sodium fluoride (18F) injection'' production

  16. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    OpenAIRE

    Rodrigo Rodrigues PETRUS; Maria Teresa de Alvarenga FREIRE; Leone de Camargo SETOGUTE; Viviane Midori HIGAJO

    2011-01-01

    Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE). Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and st...

  17. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH MD

    2010-04-01

    Full Text Available ObjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old  children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.Keywords: Hyponatremia; Meningitis; SIADH, Septic, Aseptic

  18. Clinical application of mesenchymal stem cells for aseptic bone necrosis

    Directory of Open Access Journals (Sweden)

    Tomoki Aoyama

    2008-11-01

    Full Text Available Since 2007, we had started clinical trial using mesenchymal stem cell (MSCs for the treatment of aseptic bone necrosis as a first clinical trial permitted by Japanese Health, Labour and Welfare Ministry.Aseptic bone necrosis of the femoral head commonly occurs in patients with two to four decades, causing severe musculoskeletal disability. Although its diagnosis is easy with X-ray and MRI, there has been no gold standard invented for treatment of this disease. MSCs represent a stem cell population in adult tissues that can be isolated and expanded in culture, and differentiate into cells with different nature. Combination with β-tri-calcium phosphate and vascularized bone graft, we succeeded to treat bone necrosis of the femoral head.Regenerative medicine using stem cells is hopeful and shed a light on intractable disease. To become widespread, Basic, Translational, Application, and Developmental study is needed.? From an experience of cell therapy using MSCs, we started to research induced pluripotent stem cell (iPS for clinical application.

  19. Aseptic meningitis in Germany associated with echovirus type 13

    Directory of Open Access Journals (Sweden)

    Schreier Eckart

    2001-09-01

    Full Text Available Abstract Background Echoviruses are the commonest cause of aseptic meningitis. Echovirus type 13 which has not been isolated in Germany over a long period of time was the predominant enterovirus serotype associated with different local outbreaks of aseptic meningitis in Germany in 2000. Methods Virus isolation was performed from cerebrospinal fluid and stools. In order to study the genetic relationship of echovirus type 13 isolates, sequence analysis of a part of VP1 (~300 nt was carried out. Isolates from different geographic regions were compared to each other as well as to elder viruses (prototype strain from 1953, four isolates from 1965–1986. Results Overall, 55 isolates of echovirus type 13 were obtained from different parts of Germany. It was shown that the new isolated strains have a very high degree of homology on the nucleotide level (> 98% but differ significantly from the old strains (76–85%. Conclusions a Rare enterovirus serotypes can cause serious illness. b The molecular drift has also been shown for other enterovirus serotypes.

  20. The pathobiology and pathology of aseptic implant failure

    Science.gov (United States)

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  1. Endotoxin as a cause of aseptic meningitis after radionuclide cisternography

    International Nuclear Information System (INIS)

    The role of pyrogens in aseptic meningitis after radionuclide cisternography was studied by means of the Limulus test, a sensitive detector of endotoxin. During a 15-month period, 39 reactions associated with cisternography were reported. Ten samples of specific lots of the radioactive drugs implicated in 20 of these reactions were tested and all reacted strongly positive to the Limulus test. The less sensitive rabbit pyrogen test was negative for these preparations when tested on a dose-per-weight basis. Our findings apparently provide clinical evidence for the observation made in animals that endotoxin is at least 1,000 times more toxic intrathecally than intravenously. The data implicate endotoxin contamination as a cause of adverse reactions to radionuclide cisternography. We conclude that the USP pyrogen test is insufficiently sensitive for intrathecal injectables and should be supplemented by the Limulus test. (auth)

  2. Developmental dysplasia of the hip, age, BMI, place of residence and tobacco abuse increase the odds of aseptic loosening in Chinese patients.

    Directory of Open Access Journals (Sweden)

    Chuanlong Wu

    Full Text Available PURPOSE: The purpose of this hospital-based case-control study was to evaluate the patient-related risk factors for aseptic loosening after total hip arthroplasty (THA and total knee arthroplasty (TKA in Chinese patients. METHODS: From January 2000 to December 2012, 67 patients undergoing THA and TKA who developed aseptic loosening were detected as case subjects and 336 patients without aseptic loosening, matched by the year of index surgery and type of surgery, were selected as controls. Conditional logistic regression was used to compute odds ratios (ORs and 95% confidence intervals (CIs. RESULTS: The demographic factors and comorbid conditions associated with a risk-adjusted increase in aseptic loosening (in decreasing order of significance were a rural place of residence (OR = 2.28; 95% CI: 1.21-4.30; p = 0.011, body mass index (BMI ≥ 28 kg/m(2 (vs. 18.5-28 kg/m(2 (OR = 2.29; 95% CI: 1.19-4.41; p = 0.013, developmental dysplasia of the hip (DDH (OR = 2.91; 95% CI: 1.11-7.66; p = 0.030, tobacco abuse (OR = 2.88; 95% CI: 1.05-7.89; p = 0.039, and age <45 years (vs. 45-65 years (OR = 2.63; 95% CI: 1.01-6.80; p = 0.047. CONCLUSIONS: Patients aged <45 years and those with a BMI of ≥ 28 kg/m(2, a preoperative diagnosis of DDH, history of tobacco abuse, or living in rural areas are at increased risk for aseptic loosening after THA and TKA in Chinese population. Additional systematic large-scale studies are needed to verify these results.

  3. Analysis of hip perfusion at early and reversible stages of aseptic hip necrosis

    International Nuclear Information System (INIS)

    Aim: A proper early diagnosis of aseptic hip necrosis is very important for further therapy.Since there has always been a question of the amount of perfusion in hips at different stages of aseptic hip necrosis we tried to impartially examine the perfusion in hips at early and reversible stages of aseptic hip necrosis. Material and Methods:Study included 143 patients with aseptic hip necrosis.The 550-740 MBq of Tc-99m-DPD were on bolus injected.All patients were subjected to 3-phase scintigraphy of hips and quantitative calculation of relative perfusion in the artery phase (3T) at early and repeated at reversible stages of aseptic hip necrosis. Results: At the early stage of aseptic hip necrosis the obtained 3T was decreased from 0.94-0.69 (3T=0.80).Scintigrams showed a moderate increase or diffuse accumulation. At the reversible stages we obtained 3T decreased from 0.92-0.71 (3T=0.79) thus evidencing hypoperfusion.Scintigrams showed an diffuse increased accumulation. Conclusion: With the aseptic hip necrosis quantitative analysis of perfusion in the artery phase-3T indicates that the perfusion is decreased at all stages of the process which however shows a significantly falling trend with the progress of the disease

  4. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm2 with a range of 0.5 to 50 cm2. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm2 more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.)

  5. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Science.gov (United States)

    2011-09-30

    ... media fill is the performance of an aseptic manufacturing procedure using a sterile microbiological... issued consistent with FDA's good guidance practices regulation (21 CFR 10.115). The draft guidance,...

  6. Enterovirus-D68 in the Cerebrospinal Fluid of Two Children with Aseptic Meningitis.

    Science.gov (United States)

    Esposito, Susanna; Lunghi, Giovanna; Zampiero, Alberto; Tagliabue, Claudia; Orlandi, Anna; Torresani, Erminio; Niesters, Hubert; Principi, Nicola

    2016-05-01

    This case report describes two previously healthy children with aseptic meningitis whose cerebrospinal fluid was positive for enterovirus-D68, which indicates direct involvement of this infectious agent in the development of this neurologic disease. PMID:26859634

  7. Magnetic resonance imaging in the evaluation of patients with aseptic meningoencephalitis and connective tissue disorders

    Directory of Open Access Journals (Sweden)

    APPENZELLER SIMONE

    2000-01-01

    Full Text Available OBJECTIVE: To describe the role of magnetic resonance imaging (MRI in the evaluation of patients with chronic and recurrent aseptic meningitis.METHOD: A retrospective study of five patients with aseptic meningoencefalitis diagnosed by clinical and CSF findings. CT scans showed without no relevant findings. RESULTS: MRI showed small multifocal lesions hyperintense on T2 weighted images and FLAIR, with mild or no gadolinium enhancement, mainly in periventricular and subcortical regions. Meningoencephalitis preceded the diagnosis of the underlying disease in four patients (Behçet´s disease or systemic lupus erythematosus. After the introduction of adequate treatment for the rheumatic disease, they did not present further symptoms of aseptic meningoencephalitis. CONCLUSION: Aseptic meningoencephalitis can be an early presentation of an autoimmune disease. It is important to emphasize the role of MRI in the diagnosis and follow-up of these patients.

  8. Scrub typhus meningitis: An under-recognized cause of aseptic meningitis in India

    Directory of Open Access Journals (Sweden)

    Kundavaram Paul Prabhakar Abhilash

    2015-01-01

    Conclusions: In endemic regions, scrub typhus should be considered in the differential diagnosis of aseptic meningitis. Modest elevation of cells in the CSF with lymphocytic pleocytosis and multi-organ involvement may indicate scrub typhus meningitis/meningo-encephalitis.

  9. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    OpenAIRE

    Alonso, Angelika; Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    OBJECTIVE To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. METHODS In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. RESULTS Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barr...

  10. The changing epidemiology of pediatric aseptic meningitis in Daejeon, Korea from 1987 to 2003

    Directory of Open Access Journals (Sweden)

    Lee Mi-Hee

    2005-11-01

    Full Text Available Abstract Background Aseptic meningitis is a relatively frequent childhood disease and virologic data suggest that enteroviruses are the commonest etiologic agents. We evaluated the epidemiologic characteristics of aseptic meningitis in Daejeon, South Korea from 1987 to 2003. Methods 2201 medical records of children with aseptic meningitis admitted to The Catholic University of Korea, Daejeon St Mary's Hospital were retrospectively analyzed. Results Outbreaks of aseptic meningitis were observed in 1990, 1993, 1996, 1997, 2001 and 2002. The age distribution of cases was relatively uniform, with a higher incidence in those aged P = 0.001. Neurologic sequelae were observed in 0.7% of the patients. Conclusion Aseptic meningitis, rare before the 1980s in Korea, has since become a common clinical entity. Since 1990, outbreaks of aseptic meningitis have occurred every 1 to 3 years in Daejeon in keeping with Korea-wide epidemics. The frequency of disease affecting children less than one year of age may reflect herd immunity to the epidemic strain.

  11. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH

    2010-03-01

    Full Text Available bjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity < 280 mOs/L and 100% of the patients with BUN < 10 mg%.ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.

  12. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis

    International Nuclear Information System (INIS)

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  13. Dual infection with hepatitis A and E virus presenting with aseptic meningitis:A case report

    Institute of Scientific and Technical Information of China (English)

    Kushal Naha; Suman Karanth; Mukhyaprana Prabhu; Manpreet Singh Sidhu

    2012-01-01

    ABSTRACT We report the case of a young male who presented with features of aseptic meningitis and elevated serum liver enzymes, but no symptoms or signs suggestive of an acute hepatitis. Subsequently, he was diagnosed with dual infection with hepatitisA andE viruses, and recovered completely with symptomatic therapy.Isolated aseptic meningitis, unaccompanied by hepatitic features is an unusual presentation of a hepatotrophic viral infection, and is yet to be reported with hepatitisA andE virus co-infection.

  14. Excacerbation of systemic lupus erythematodes, aseptic meningitis and acute mental symptoms, following metrizamide lumbar myelography

    International Nuclear Information System (INIS)

    A clinical constellation of excacerbation of systemic lupus erythematodes (SLE), together with aseptic meningitis, and acutre mental symptoms occurred following lumbar myelography with metrizamide. Excacerbation of SLE has not been previously described following myelography with any contrast agent. Meningeal reactions and acute mental symptoms have been reported earlier, but this clinical constellation is new. (orig.)

  15. Aseptic osteonecrosis of femoral head and pregnancy. Report on two cases with MR imaging results

    International Nuclear Information System (INIS)

    Two further cases of aseptic osteonecrosis of femoral head during pregnancy are reported, and the literature reviewed of this rare etiology of debatable etiopathogenicity. The value of MR imaging is demonstrated both for early positive diagnosis and for the differential diagnosis from decalcifying algo -dystrophy

  16. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Science.gov (United States)

    2012-04-11

    ... the same title was announced in the Federal Register on September 30, 2011 (76 FR 60847), and Docket... Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration, HHS... guidance entitled ``Media Fills for Validation of Aseptic Preparations for Positron Emission...

  17. MICROBIO : A web-based program for processing and evaluation of microbiological controls on aseptic dispensing

    NARCIS (Netherlands)

    Postma, D.J.; Boom, F.A.; Bijleveld, Y.A.; Touw, D.J.; Veenbaas, T.; Essink-Tjebbes, C.M.; Verbrugge, P.

    2012-01-01

    Background: According to the Dutch GMP-hospital pharmacy directive (1) three types of microbiological controls are required when aseptic dispensing is performed: 1. microbiological monitoring of the air in the working area, the gloved hands of the operator and the work surface at the critical place

  18. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    International Nuclear Information System (INIS)

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work

  19. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Haydary, J., E-mail: juma.haydary@stuba.sk [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia); Susa, D.; Dudáš, J. [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia)

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  20. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    Science.gov (United States)

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  1. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients

    International Nuclear Information System (INIS)

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovering immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be ''market-tested'' by the targeted patient population before inclusion in the menu

  2. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis

    OpenAIRE

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K.; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was dia...

  3. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    OpenAIRE

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In su...

  4. Role of the NFkB subunit p50 in particle induced, aseptic lung inflammation

    OpenAIRE

    Yin, Renfu

    2013-01-01

    We tested the hypothesis that pulmonary exposure to sterile carbon nanoparticles (CNP), a main constituent of urban air pollution, generates an acute inflammatory response by involving the p50 subunit of NFkB1, a pathway generally crucial for inflammatory gene expression in sepsis. Exposing wt and p50-deficinet mice to CNP caused an acute, aseptic neutrophilic alveolitis. While the storm of acute phase cytokines was much more pronounced in p50 mice, no genotype related difference in the numbe...

  5. Combination Gene Therapy Targeting On Interleukin-1β and Rankl for Wear Debris Induced Aseptic Loosening

    OpenAIRE

    Wang, Hao; Jia, Tang-Hong; Zacharias, Nora; Du, Hong-Xia; Wooley, Paul H; Yang, Shang-You

    2012-01-01

    This study investigated the efficacy of a combination gene therapy to repress IL-1 and RANKL for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra and AAV-OPG individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by ELISA, and gene expressions of RANK, IL-1β,...

  6. Stability of aseptically packaged food as a function of oxidation initiated by a polymer contact surface

    OpenAIRE

    Berends, Corey L

    1996-01-01

    In this study, low density polyethylene (LDPE) and polyethylene terephalate (PETE) resin beads were ground to a coarse powder and exposed to sterilization treatments applied to the food contact surface of packaging materials used in aseptically processed and packaged food. Electron paranlagnetic resonance (EPR) analyzed free radical (-CH2CHCH=CHCHz-) production on the surface of LDPE exposed to heat (107°C) and treatments of heat (107°C) + 30% hydrogen peroxide solution (H20 2). As the tem...

  7. Dynamics of neutrophil extravasation and vascular permeability are uncoupled during aseptic cutaneous wounding

    OpenAIRE

    Kim, Min-Ho; Curry, Fitz-Roy E.; Simon, Scott I.

    2009-01-01

    Transport of macromolecules and transmigration of leukocytes across vascular endothelium are regulated by a tight molecular junction, but the mechanisms by which these two inflammatory events are differentially controlled in time and magnitude during aseptic cutaneous wounding remain elusive. A real-time fluorescence imaging technique was developed to simultaneously track influx of Alexa 680-labeled albumin and genetically tagged enhanced green fluorescent protein-neutrophils [polymorphonucle...

  8. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    International Nuclear Information System (INIS)

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  9. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    Science.gov (United States)

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  10. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Sung Hee; Park, Young Chan; Lee, Young Hwan [Catholic University of Daegu, College of Medicine, Daegu (Korea, Republic of)

    2006-09-15

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  11. Novel strategies for evaluating the effectiveness of aseptic sterilisation processes by means of a multi-sensor set-up

    OpenAIRE

    Reisert, Steffen

    2014-01-01

    The aseptic processing and packaging of food, in combination with the possibilities of aseptic storage, transport and packaging recycling, represents one of the most sustainable technologies in modern food processing and contributes significantly to reducing the losses of fruits, vegetables and milk and to increase the availability of this food all over the world. In contrast to conventional food processing methods, product and container are continuously sterilised separately and brought toge...

  12. Exchanging reamed nailing versus augmentative compression plating with autogenous bone grafting for aseptic femoral shaft nonunion: a retrospective cohort study

    OpenAIRE

    Jiang-ying, Ru; Yun-fei, Niu; Yu, Cong; Wen-bo, Kang; Hai-bin, Cang; Jian-ning, Zhao

    2015-01-01

    Objective: The purpose of this study was to compare the outcomes of exchanging reamed nailing (ERN) and augmentative compression plating (ACP) with autogenous bone grafting (BG) for the treatment of aseptic femoral shaft nonunion secondary to the treatment of intramedullary nailing (IMN).Methods: A multicenter retrospective study was performed for 178 patients (180 cases) of aseptic femoral shaft nonunion secondary to first treatment of IMN. All cases were fixed with either ERN (n=87) or ACP ...

  13. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    Science.gov (United States)

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  14. Effects of low dosage Co-60 irradiation in the course of aseptic arthritis of the knee joint of rabbits

    International Nuclear Information System (INIS)

    Purpose: Numerous clinical observations demonstrate the efficacy of low radiation doses in the treatment of painful osteoarthritis. Experimental investigations remain scarce. We investigated the effects of locally daily 5 times 1.0 Gy 60-Co irradiation on an artificially induced aseptic gonarthritis in rabbits. Material and methods: Three separate experiments (EV) were performed (10 rabbits per experiment, 5 treated/5 controls; duration: EV1: 18 days; EV2: 6 days; EV3: 29 days). An aseptic arthritis in the right knee joint of rabbits was induced by intraarticular injection of 0.5 ml papain solution (3%, 30,000 USP/mg) on day 0. The arthritic knee joint of the anesthesized animals was irradiated daily from day 1 to 5 with 5 times 1.0 Gy. The controls were sham-irradiated under the same conditions. The time course of arthritis in treated animals and sham-treated controls was evaluated by clinical, laboratory-chemical and histological criteria. The clinical investigation was performed daily, the puncture of the knee-joints was carried out several times in EV1, and at the end of experiments in EV2 and EV3. At the end of the observation period, animals were killed and the knee joints excised for histological analysis. Results: The intraarticular injection of papain caused a peracute inflammatory response in all animals. After 1 week the chronical stage was reached, and the experimental arthritis resolved slowly within several weeks. Local irradiation accelerated the decrease of inflammatory joint swelling, being significant by day 4. On day 6 the volume of synovial fluid in irradiated knee-joints was significantly smaller. The morphometric data indicated a reduction in thickness of synovial membrane, a decrease in number of synovial cell layers, and a decrease in distance between capillaries and the synovial membrane surface following irradiation of arthritic joints. Due to considerable individual variability, the morphometric data partially did not reach statistically

  15. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    Science.gov (United States)

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  16. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    Science.gov (United States)

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  17. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    Science.gov (United States)

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  18. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    OpenAIRE

    Lostak Jiri; Zapletalova Jana; Havranek Vitezslav; Gallo Jiri

    2010-01-01

    Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE) wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of p...

  19. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    Directory of Open Access Journals (Sweden)

    Marc E. Wolf

    2016-01-01

    Full Text Available We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient.

  20. Influence of recycling rate increase of aseptic carton for long-life milk on GWP reduction

    International Nuclear Information System (INIS)

    Tetra Pak, through intensive cooperation with its supply chain, increased the post-consumer recycling rate of the aseptic packaging for long-life milk in the last 10 years. In continuation of a previous study that presented a superior overall performance in terms of reduction of the consumption of natural resources, air emissions and most of the water emissions, the objective of the present work was to apply life cycle assessment (LCA) to measure the global warming potential (GWP). The system was assessed using as functional unit 1000 liters of milk packaged in Tetra Pak Aseptic containers. The reduction of greenhouse gas emissions was calculated for recycling rates of 2%, 22%, 30%, 40% and 70% of the post-consumer residues in Scenarios I (only cardboard recycling) and II (total aseptic laminate recycling). Scenario I showed a 14% reduction in GWP, representing 26 kg of avoided CO2 equiv. emitted due to the efforts of Tetra Pak to increase the recycling rate from 2% (2000) to 22% (2004). If it will be possible to increase the recycling rate to 70% of post-consumer packages in the future, a 48% reduction of GWP could be attained. Methane exhibited the greatest mass reduction among the greenhouse emissions, since it is emitted during the production of cardboard and also as a result of anaerobic degradation in landfills. The total reduction of the energy requirements of the system due to the increase of the recycling rate (from 2% to 22%) is 154 MJ/1000 liters, a saving of 7%. Scenario II (which considers additional polyethylene and aluminum recycling) has a smaller effect on GWP reduction than Scenario I, since PE/AL represent only 25% of the total mass of the container. The major benefit of the recycling of aseptic cartons is the reduction of the amounts of virgin materials required and the consequent reduction of air emissions. The results of this study can be used to encourage the collection of post-consumer milk cartons as part of environmental education programs

  1. A case of aseptic vertebral necrosis in the context of metastatic lumbar disease

    Energy Technology Data Exchange (ETDEWEB)

    Panow, C. [Radiologie Florissant, Geneva (Switzerland); Valavanis, A. [Institut fuer Neuroradiologie, Universitaetsspital Zuerich (Switzerland)

    2002-03-01

    Aseptic bone necrosis has many well recognized etiologies: caisson disease, corticosteroids, alcohol, Gaucher's disease and sickle cell anemia being a few of a long list. Little attention has been paid to metastatic disease as a possible cause and we were unable to find reference in the literature to this association. We present imaging features of metastatic Ewing's sarcoma involving the vertebral spine, which, in certain aspects, mimics other well-known entities of this region, such as Kuemmell's and Scheuermann's diseases. (orig.)

  2. Triphase scintigraphy with osteotropic radiopharmaceuticals in aseptic necrosis of tight bone

    International Nuclear Information System (INIS)

    Three-phase scintigraphy with 99mTc-diphosphonate complexes (pyrophosphate and diphosphonate) of hip joints has been carried out in patients with Perthes' and Chandler's diseases by investigation of selected zones from the pathologically altered and symmetric intact joints. Semiquantitative indices have been derived for perfusion, tissue and mineral metabolism and the ratio perfusion/mineral metabolism. The combination of decreased perfusion with slightly to moderately increased mineral metabolism is a typical indication of aseptic necrosis of the femoral head. The method allows early diagnosis of the disease in about 64% of the cases. 1 tab., 1 fig., 5 refs

  3. Ionizing radiations in aseptic bottling: a comparison between technologies and safety requirements [beverages

    International Nuclear Information System (INIS)

    Ionizing radiations, commonly adopted in the medical field, are recently experiencing a wide diffusion in industrials applications. One of the most widespread uses of ionizing radiations refers to foodstuffs and packaging sterilization. In the aseptic bottling area, the application of this technology on polymeric caps is quickly developing. In such application, sterilization could be obtained with beta-rays, generated by an electron beam, or with gamma-rays, emitted by a radioactive source. After a brief explanation of physical properties of ionizing radiations, the aim of this paper is to discuss the use of radiations in aseptic bottling. Based on results available in literature, radiations effects on treated materials are discussed, as well as safety requirements aiming at reducing risks related to radiation exposure. Finally, sterilization plants with gamma and beta radiation are compared, with the aim of examining functioning principles and management complexity. As a result of the comparison between the two technologies, the electron beam (beta-rays) adoption for caps sterilization process proves to be preferable

  4. A Fuzzy Expert System for Distinguishing between Bacterial and Aseptic Meningitis

    Directory of Open Access Journals (Sweden)

    Mostafa Langarizadeh

    2015-05-01

    Full Text Available Introduction Bacterial meningitis is a known infectious disease which occurs at early ages and should be promptly diagnosed and treated. Bacterial and aseptic meningitis are hard to be distinguished. Therefore, physicians should be highly informed and experienced in this area. The main aim of this study was to suggest a system for distinguishing between bacterial and aseptic meningitis, using fuzzy logic.    Materials and Methods In the first step, proper attributes were selected using Weka 3.6.7 software. Six attributes were selected using Attribute Evaluator, InfoGainAttributeEval, and Ranker search method items. Then, a fuzzy inference engine was designed using MATLAB software, based on Mamdani’s fuzzy logic method with max-min composition, prod-probor, and centroid defuzzification. The rule base consisted of eight rules, based on the experience of three specialists and information extracted from textbooks. Results Data were extracted from 106 records of patients with meningitis (42 cases with bacterial meningitis in order to evaluate the proposed system. The system accuracy, specificity, and sensitivity were 89%, 92 %, and 97%, respectively. The area under the ROC curve was 0.93, and Kappa test revealed a good level of agreement (k=0.84, P

  5. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    Science.gov (United States)

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (medianAI positivity. PMID:27538636

  6. A diagnostic dilemma: drug-induced aseptic meningitis in a 45-year-old HIV-positive man.

    LENUS (Irish Health Repository)

    Rowley, D

    2014-03-01

    We describe a case of aseptic meningitis following the administration of moxifloxacin in a 45-year-old man with human immunodeficiency virus (HIV). At presentation he was receiving tuberculosis treatment on a modified regimen following severe hepatotoxicity; this included moxifloxacin, started 8 days previously. Initial cerebrospinal fluid (CSF) analysis was grossly abnormal. Anti-viral and -bacterial treatments were started. All microbiological tests proved negative and his moxifloxacin was withheld resulting in a complete normalisation of CSF. Drug-induced aseptic meningitis is a diagnosis of exclusion and presents a serious diagnostic dilemma. The decision to withhold medication cannot be taken lightly.

  7. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    Science.gov (United States)

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  8. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Lostak Jiri

    2010-10-01

    Full Text Available Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of patient, implant, surgery, and wear related factors on the rate of aseptic loosening at the site of the cup. This was calculated by stepwise logistic regression analysis. The stability of the implant and severity of bone defects were evaluated intraoperatively. Results We found that men (odds ratio, OR = 5.6; p = 0.004, patients with Charnley class C (OR = 6.71; p = 0.013, those having more severe acetabular bone defects (OR = 4 for each degree of severity; p = 0.002, and longer time to revision surgery (OR = 1.51 for each additional year; p = 0.012 had a greater chance of aseptic loosening of the cup. However, aseptic loosening was not directly predicted by polyethylene wear rate in our patients. Conclusion Severity of bone defects predicts the risk for aseptic loosening in ABG I cup. Factors potentially associated with the quality of bone bed and biomechanics of the hip might influence on the risk of aseptic loosening in this implant.

  9. Non-Polio Enteroviruses Aseptic Meningitis:Embaba Fever Hospital Admissions 2010-2011

    Directory of Open Access Journals (Sweden)

    Raafat A. Abdel-Twab¹, Kouka S. Abdel-Wahab2. Ahmed O. El-Kafrawi3, Moustafa A. Aly3, Laila A. EL-Bassiony4, May EL-Maamoun4, Caroline Fayez5

    2013-07-01

    Full Text Available Human enteroviruses (EV cause a wide spectrum of both common and uncommon illnesses among all age groups. Enterically transmitted. The objective of this study was to identify non-poliovirus EV as a cause of viral aseptic meningitis (VAM by two methods (cell culture and Real time PCR. From October 2010 to August 2011 cerebrospinal fluid (CSF samples were collected from 85 patients Embaba fever hospital admitted with symptoms of aseptic meningitis of any age and both sexes. The 85 CSF samples were inoculated into RD (human rhabdomyosarcoma cell line in three blind passages to amplify isolates producing EV-like CPE. A total of 14 (16.5% out of 85 CSF samples showed EV-like CPE. By Real time PCR 11 out of the 14 culture positive samples and 5 out of the 14 source of virus isolation original CSF were non polio EV positive. The frequency of non-polio EV meningitis hospital admissions was in the summer season (50%, spring (25%, late autumn (16.6% and least frequency in winter (8.4%. non-polio EV meningitis was detected in 6 out of 41 male patients (14.5% and in 6 out of 44 female patients (13.5%. Also non-polio EV meningitis was detected in all ages with marked increase of incidence in young children (41.6% and old age (50% and less in adult (8.4%. . In conclusionOur data showed that the non-polioviruses EV was associated with the majority of VAM during 2010 – 2011 at the Embaba fever hospital which serves Embaba, Shoubra Elkheema, Qualyba and neighbors localities in Egypt. Rapid detection of non-polio EV meningitis is essential for making decisions about patient management and treatment

  10. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    Science.gov (United States)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  11. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    Science.gov (United States)

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  12. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    Energy Technology Data Exchange (ETDEWEB)

    Scherer, A.; Engelbrecht, V.; May, P.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bernbeck, B.; Goebel, U. [Duesseldorf Univ. (Germany). Dept. of Pediatric Hematology and Oncology; Willers, R. [Duesseldorf Univ. (Germany). Inst. of Statistics

    2000-10-01

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  13. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    International Nuclear Information System (INIS)

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  14. Utilization of Aseptic Seedling Explants for In vitro Propagation of Indian Red Wood

    Directory of Open Access Journals (Sweden)

    Kishore Kumar CHIRUVELLA

    2013-12-01

    Full Text Available Micropropagation has been advocated as one of the most viable biotechnological tool for ex situ conservation of rare, endangered endemic medicinal plants germplasm. Rapid clonal micropropagation protocol for large-scale multiplication of an endemic medicinal plant Soymida febrifuga (Meliaceae was established from 15-day aseptic seedling cotyledonary node and shoot tip explants. High frequency of sprouting and shoot differentiation was observed from cotyledonary node explants compared to shoot tip, on Murashige and Skoog (MS medium fortified with BA, KN, 2-iP and CM. Of the cytokinins used, BA (3.0 mgl-1 supported highest average number and maximum multiple shoot differentiation (16.6. In vitro proliferated shoots were multiplied rapidly by culturing nodal segments as microcuttings, further subcultured on the same media for elongation. Elongated shoots upon transfer to MS medium fortified with IBA showed rooting within two weeks of culture. Rooted plantlets were successfully hardened and 75% of rooted shoots successfully survived on establishment to the soil. Plants looked healthy with no visually detectable phenotypic variations. This protocol provides a successful and rapid technique that can be used for ex situ conservation minimizing the pressure on wild populations and contributes to the conservation of this endemic medicinally potent flora.

  15. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    Science.gov (United States)

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  16. Successful human infection with P. falciparum using three aseptic Anopheles stephensi mosquitoes: a new model for controlled human malaria infection.

    Directory of Open Access Journals (Sweden)

    Matthew B Laurens

    Full Text Available Controlled human malaria infection (CHMI is a powerful method for assessing the efficacy of anti-malaria vaccines and drugs targeting pre-erythrocytic and erythrocytic stages of the parasite. CHMI has heretofore required the bites of 5 Plasmodium falciparum (Pf sporozoite (SPZ-infected mosquitoes to reliably induce Pf malaria. We reported that CHMI using the bites of 3 PfSPZ-infected mosquitoes reared aseptically in compliance with current good manufacturing practices (cGMP was successful in 6 participants. Here, we report results from a subsequent CHMI study using 3 PfSPZ-infected mosquitoes reared aseptically to validate the initial clinical trial. We also compare results of safety, tolerability, and transmission dynamics in participants undergoing CHMI using 3 PfSPZ-infected mosquitoes reared aseptically to published studies of CHMI using 5 mosquitoes. Nineteen adults aged 18-40 years were bitten by 3 Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of Pf. All 19 participants developed malaria (100%; 12 of 19 (63% on Day 11. The mean pre-patent period was 258.3 hours (range 210.5-333.8. The geometric mean parasitemia at first diagnosis by microscopy was 9.5 parasites/µL (range 2-44. Quantitative polymerase chain reaction (qPCR detected parasites an average of 79.8 hours (range 43.8-116.7 before microscopy. The mosquitoes had a geometric mean of 37,894 PfSPZ/mosquito (range 3,500-152,200. Exposure to the bites of 3 aseptically-raised, PfSPZ-infected mosquitoes is a safe, effective procedure for CHMI in malaria-naïve adults. The aseptic model should be considered as a new standard for CHMI trials in non-endemic areas. Microscopy is the gold standard used for the diagnosis of Pf malaria after CHMI, but qPCR identifies parasites earlier. If qPCR continues to be shown to be highly specific, and can be made to be practical, rapid, and standardized, it should be considered as an alternative for diagnosis

  17. Disinfection of packaging materials during aseptic packing. Studies on the microbicidal effect of uv-C radiation

    Energy Technology Data Exchange (ETDEWEB)

    Cerny, G. (Technische Univ. Muenchen (Germany, F.R.). Inst. fuer Lebensmitteltechnologie und Verpackung)

    1977-10-01

    Experiments were performed in order to determine the microbicidal effect of ultraviolet irradiation using a high intensity uv lamp recently developed by BBC, Baden (Switzerland). Conidiae of molds, Bacillus spores, and vegetative cells of yeasts were killed within a few seconds. The germicidal effect of uv rays upon B. subtilis spores was further studied in dependence of the distance from the uv lamp, the angle of inclination of the irradiated plane, and the humidity of air. The efficiency of the tested uv lamp seems to be sufficient for its use in aseptic plants provided that the irradiated packaging materials are smooth, uv-resistant, and rather free of dust particles.

  18. An improved, low-cost, hydroponic system for growing Arabidopsis and other plant species under aseptic conditions

    OpenAIRE

    Alatorre-Cobos, Fulgencio; Calderón-Vázquez, Carlos; Ibarra-Laclette, Enrique; Yong-Villalobos, Lenin; Pérez-Torres, Claudia-Anahí; Oropeza-Aburto, Araceli; Méndez-Bravo, Alfonso; González-Morales, Sandra-Isabel; Gutiérrez-Alanís, Dolores; Chacón-López, Alejandra; Peña-Ocaña, Betsy-Anaid; Herrera-Estrella, Luis

    2014-01-01

    Background Hydroponics is a plant growth system that provides a more precise control of growth media composition. Several hydroponic systems have been reported for Arabidopsis and other model plants. The ease of system set up, cost of the growth system and flexibility to characterize and harvest plant material are features continually improved in new hydroponic system reported. Results We developed a hydroponic culture system for Arabidopsis and other model plants. This low cost, proficient, ...

  19. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    Energy Technology Data Exchange (ETDEWEB)

    Malan, Daniel F. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Intelligent Systems, Delft (Netherlands); Valstar, Edward R. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Biomechanical Engineering, Delft (Netherlands); Nelissen, Rob G.H.H. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands)

    2014-11-15

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  20. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    International Nuclear Information System (INIS)

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  1. Clinical and experimental study of the time course of X-ray and morphological changes in the femoral head aseptic necrosis

    International Nuclear Information System (INIS)

    X-ray and morphological data of 24 adult patients with the femoral head aseptic necrosis and the results of roentgenologic, pathohistologic and histochemical examination in the case of a given pathology in an experiment on 100 adult rabbits, are analyzed. The earliest (roentgenonegative) structural alterations in the case of aseptic osteonecrosis are established using histochemical methods. An important role of a complex X-ray examination including tomography and roentgenography with a direct image increase in the diagnosis of the femoral head aseptic necrosis and the decrease of the degree of the hip joint affection is noted. The results of investigations point to the value in the pathogenesis of the given disease of violations of the local lood circulation

  2. Treatment of Aseptic Hypertrophic Nonunion of the Lower Extremity with Less Invasive Stabilization System (New Approach to Hypertrophic Nonunion Treatment

    Directory of Open Access Journals (Sweden)

    Metin Uzun

    2015-01-01

    Full Text Available Aim. To evaluate whether aseptic hypertrophic nonunion in the long bones of the lower extremity can be treated successfully with LISS applied with closed methods without grafting. Materials and Methods. The study included 7 tibias and 9 femurs of 16 patients. All cases had hypertrophic nonunion. Initial surgical treatment was with intramedullary nailing in 14 cases, 6 of which had required an exchange of intramedullary nail. All the patients were treated with LISS plate with closed methods. Results. Union was obtained at mean 7 months in all patients. No implant loosening or breakage of the implant was observed and there was no requirement for secondary surgery. Conclusion. Cases of hypertrophic nonunion have excellent blood supply and biological potential. Therefore, there is no need for bone grafting and the addition of fracture stability is enough to achieve full union. Using a limited approach and percutaneous screw insertion, LISS provides fracture stabilization with soft tissue protection.

  3. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    Science.gov (United States)

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  4. Re-admissions, re-operations and length of stay in hospital after aseptic revision knee replacement in Denmark

    DEFF Research Database (Denmark)

    Lindberg-Larsen, M.; Jørgensen, C. C.; Hansen, Torben Bæk; Solgaard, S.; Odgaard, A.; Kehlet, H.

    information from the Danish Knee Arthroplasty Registry. The 1218 revisions involving 1165 patients were subdivided into total revisions, large partial revisions, partial revisions and revisions of unicondylar replacements (UKR revisions). The mean age was 65.0 years (27 to 94) and the median length of......-admission. The age ranges of 76 to 80 years (p = 0.018) and the large partial revision subgroup (p = 0.073) were related to an increased risk of re-operation. The ages from 76 to 80 years (p < 0.001), age ≥ 81 years (p < 0.001) and surgical time > 120 min (p < 0.001) were related to increased length of hospital...... suggests that a length of hospital stay ≤ four days and discharge home at that time is safe following aseptic knee revision surgery in Denmark....

  5. Development of a handheld sensor system system for the online measurement of hydrogen peroxide in aseptic filling systems

    Energy Technology Data Exchange (ETDEWEB)

    Reisert, Steffen; Schoening, Michael J. [Institute of Nano- and Biotechnologies, Aachen University of Applied Sciences, Juelich (Germany); Henkel, Hartmut; Schneider, Andreas; Schaefer, Daniel [von Hoerner and Sulger GmbH, Schwetzingen (Germany); Friedrich, Peter [Aseptiksysteme and Foodtechnologie, Linnich (Germany); Berger, Joerg [Filldesign GmbH, Moenchengladbach (Germany)

    2010-04-15

    A handheld sensor system for the online measurement of hydrogen peroxide (H{sub 2}O{sub 2}) in aseptic sterilisation processes has been developed. It is based on a calorimetric-type gas sensor that consists of a differential set-up of two temperature sensors, of which one is catalytically activated and the second one is passivated and used as reference. The sensor principle relies in detecting a rise in temperature on the active sensor due to the exothermic reaction of H{sub 2}O{sub 2} on the catalytic surface. To characterise the sensor system towards H{sub 2}O{sub 2} sensitivity and other influencing factors, measurements have been carried out both at an experimental set-up and a manufacturer's sterilisation machine. Physical sensor characterisation was done by means of the optical microscopy. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  6. Why does it take so long? ‘Lean processing’ in the aseptic compounding unit at the Midland Regional Hospital Tullamore

    LENUS (Irish Health Repository)

    Greene, C

    2011-06-01

    Increasing numbers of oncology\\/haematology patients attending Midland Regional Hospital Tullamore (MRHT) has increased the workload of the Regional Oncology Haematology Pharmacy (ROHP) compounding unit. Staff restrictions require optimisation of current workflow practices. This audit (November 2010 and June 2011) focused on workflow in the aseptic compounding unit.\\r\

  7. Plasmodium falciparum malaria challenge by the bite of aseptic Anopheles stephensi mosquitoes: results of a randomized infectivity trial.

    Directory of Open Access Journals (Sweden)

    Kirsten E Lyke

    Full Text Available BACKGROUND: Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs. METHODS AND FINDINGS: Eighteen adults aged 18-40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9-12 days. The geometric mean parasitemia was 15.7 parasites/µL (range: 4-70 by microscopy. Polymerase chain reaction (PCR detected parasites 3.1 (range: 0-4 days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000-57,500. A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. CONCLUSIONS: The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6 of volunteers exposed to three mosquito bites and 83% (5/6 of volunteers exposed to one mosquito bite. TRIAL REGISTRATION: ClinicalTrials.gov NCT00744133.

  8. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    Science.gov (United States)

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  9. Aseptic meningitis in a large MMR vaccine campaign (590,609 people in Curitiba, Paraná, Brazil, 1998

    Directory of Open Access Journals (Sweden)

    ARRUDA Walter Oleschko

    2001-01-01

    Full Text Available The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998 in Curitiba, Southern Brazil (590,609 people, admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total number of 87 cases were reported, resulting in a incidence of 1.7 cases per 10,000 given doses . The mean age was 23.7 ± 12.8 years. The female:male ratio was 1.35:1. Severe headache with meningismus (92.5%, fever (87.5%, nausea/vomiting (82.5% were the most common clinical findings. Three cases (7.5% developed mild mumps. All patients underwent cerebrospinal fluid (CSF tap with the following findings: mononuclear pleocytosis from 100 to 500 cells/mm³ in 17 cases (42.5%; 257.5 ± 260.6 cells/mm³; increased protein 28 cases (67.5%; 92.1 ± 76.9 mg/dL; glucose was normal in all cases (56.8 ± 11.2 mg/dL except in 4 (10% cases, which presented less than 44 mg/dL. All serological tests (latex to bacterial meningitis, Cryptococcus, cysticercosis, VDRL and bacteriological cultures were negative. Virus identification were also negative in 8 samples. None of the patients had neurological deficits or related symptoms after one year of onset. We believe the benefit of vaccination clearly outweights the incidence of benign vaccine-associated meningitis.

  10. Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of acute aseptic peritoneal inflammation

    Directory of Open Access Journals (Sweden)

    Shepitko K.V.

    2015-06-01

    Full Text Available Background. Modern conceptions about mechanisms of inflammation of the small intestine could not be formed without an understanding of intercellular relationships that are realized by biologically active signaling molecules produced by endocrine cells. Methods. The experimental study has been carried out on the small intestine extracted from 140 adult male rats. Electron and light microscopy methods were used. Acute aseptic inflammation was modeled by intraperitoneal carrageenan injection; influence of subcutaneously cryopreserved placenta injection was analyzed. Results. After modeling of the acute aseptic peritoneal inflammation the maximal increase of ECL-cells was noted on the 21st day. The slowest restoration of endocrine cells number occurred on all measured parameters and was observed on day 30th of the observation. In case of administration of cryopreserved placenta at the early stages (days 3rd – 7th the increase of average number of EC- and ECL-cells promoted the enhanced permeability of vessels in the lamina propria. The decrease in number of P-cells prevented the development of hyperacid gastritis. Reduction in the average number of D1- cells prevented the excessive vasodilatation and facilitated the excretion of excess fluid from the foci of inflammation. In simultaneous subcutaneous administration of cryopreserved placenta and modeling of acute aseptic peritoneal inflammation the number of ЕС- and ЕСL-cells increased, accelerating the vascular response to inflammation. Conclusion. Active appearance of low-differentiated cells including those with “shapes of mitosis” on the day 14th indicates restoration of structural components of the small intestine mucosa and processes of absorption and parietal digestion after placenta administration during acute aseptic inflammation. Citation: Shepitko KV. [Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of

  11. 3种植物无菌苗增殖与生根一体化技术研究%Studies on the Technology of Proliferation and Rooting Integration with Aseptic Seedlings in Three Species

    Institute of Scientific and Technical Information of China (English)

    梁称福

    2011-01-01

    Under conventional culture conditions ((25 ±3)℃, relative humidity 60%-70%, 1500-2000 lx for 10-12 h/d), aseptic buds or leaves from the plants of Aloe vera var.chinensis, Pelargonium citrosum vanleenii and triploid Populus tomentosa were respectively used to research the technology of proliferation and rooting integration.The results showed that: after 50 days when aseptic buds of Aloe vera var.chinensis were transferred in MS + 6-BA 2.0 mg/L+ NAA 0.1 mg/L+ AC 0.1%, the average number of differentiated buds reached 3.4 and the rooting rate reached 100% with 6.1 roots which were sturdy, long and yellow-white and 52.0 cm length of all roots per plant.After 45 days transferred in MS + 6-BA 3.0 mg/L + NAA 0.2 mg/L + AC 0.05%, aseptic buds of Pelargonium citrosum vanleenii proliferated most fastest with the average number of differentiated buds reaching 10.2, and the rooting rate amounted to 100% with dark-green leaves.After 55 days when aseptic leaves of triploid Populus tomentosa were transferred in MS + 6-BA 0.5 mg/L + KT 0.4 mg/L + NAA 0.2 mg/L + Ad 25.0 mg/L + AC 0.05%, differentiated buds arrived at an average of 8.6 and the rooting rate achieved 92% with more and longer, light-white roots.%在常规培养环境条件(温度(25士3)℃、湿度60%~70%、光强1500~2000lx,10-12h/天),以中华芦荟、驱蚊香草、三倍体毛杨无菌芽或叶片为材料,研究不同培养基对其无菌苗增殖、生根的影响,探讨其一体化成苗技术.结果表明:中华芦荟无菌芽转接在MS+6-BA2.0 mg/L+NAA 0.1 mg/L+AC 0.1%培养基中50天,分化芽数平均达3.4个;生根率达100%,单株根数达6.1条,单株总根长达52.0 cm,且根系粗长、黄白色.驱蚊香草无菌芽在MS+6-BA 3.0 mg/L+NAA 0.2 mg/L+AC 0.05%培养基中增殖速度最快,转接后45天分化芽数平均为10.2个;生根率为100%,生根苗叶片呈深绿色,生根质量好.三倍体毛白杨无菌叶片接种在MS+6-BA 0.5 mg/L+KT 0.4 mg/L+NAA 0.2 mg/L+Ad 25

  12. Aseptic germination and rapid propagation by tissue culture from space returned seeds of Rehmannia glutinosa f. hueiching ensis (Chan et Sehih) Hsiao

    International Nuclear Information System (INIS)

    Aseptic germination of Rehmannia glutinosa f. hueichingensis (Chan et Sehih) Hsiao seeds space returned and rapid propagation of plantlets were studied. The results were as follows: (1) When the sterilization time of 0.05% HgCl2 was 5 s, both the germination rate and the germination energy of the seeds reached the maximum, which were 68.33% and 53.33% respectively; (2) The best aseptic germination medium of the seeds was 1/4MS, the germination rate and the germination energy of the seeds were 76.67% and 65.08%; (3) The optimum rapid propagation medium of the plantlets was MS + 6-BA 1mg/L + NAA 0.002 mg/L, after grew in the medium for 28 d, height of the plantlets increased 7.85 cm, the propagation coefficient could achieve 6.56. (authors)

  13. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    Science.gov (United States)

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  14. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    Science.gov (United States)

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  15. 人工关节假体植入后无菌性松动的发病机制%Pathogenesis of aseptic prosthesis loosening after artificial prosthesis implantation

    Institute of Scientific and Technical Information of China (English)

    马玉超; 田京

    2012-01-01

    BACKGROUND: There are many clinical researches on aseptic loosening of artificial prosthesis, but the exact pathogenesis is still unclear.OBJECTIVE: To review the pathogenesis of prosthesis aseptic loosening after artificial prosthesis implantation.METHODS: A computer-based online search of PubMed and CNKI was performed to search related articles published between 2006 and 2011 with the key words of “artificial prosthesis, aseptic loosening” both in English and Chinese. A total of 77 articles were obtained, and finally 38 articles were included.RESULTS AND CONCLUSION: Aseptic loosening after long-term total hip replacement is one of the main failure reasons. In the recent years, analysis of revision total hip replacement for failed hip arthroplasty showed that aseptic loosening is the chief reason. The mechanism of aseptic loosening mainly includes mechanical mechanisms, biological and other mechanisms. With further research and the improvement of implantation method and prosthetic materials, aseptic loosening will eventually be minimized, so that the service life of prosthesis will be longer.%背景:对于人工关节无菌性松动的基础和临床研究很多,但其确切机制仍不甚明确.目的:综述人工关节假体植入后无菌性松动的发病机制.方法:由第一作者应用计算机检索PubMed和中国期刊全文数据库2006/2011相关文献.在标题、摘要、关键词中以"artificial prosthesis,aseptic loosening"或"人工关节、无菌性松动"为检索词进行检索.共检索到77篇文献,最终纳入符合标准的文献38篇.结果与结论:无菌性松动已成为人工关节置换后远期失败的主要原因之一.近年来对人工全髋关节置换后翻修病例回顾性分析的统计显示,无菌性松动位于翻修原因第1位.关于人工关节无菌性松动的机制主要分为机械机制、生物机制及其他机制,它们的共同结果是造成骨吸收、骨溶解,最终导致假体松动.随着研究

  16. Is the technetium-99m-fluoroquinolone complex discriminates between septic and aseptic inflammatory foci? in -vitro evaluation

    International Nuclear Information System (INIS)

    Aim: in-vitro evaluation of 99mTc-L-Flox and 99mTc-Cipro complexes. Method: four steps technique was used: 1-determination of the complexion capability of the tracers with the free purified DNA of both e. coli and s. aureus . 2- estimation the binding efficiency of the tracers to live and heat killed bacteria of different standard .3- comparing the bioactivity of the labeled and the non labeled fluoroquinolones using dick diffusion test.4- determination of the percent binding of the labeled fluoroquinolones to the plasma proteins using trichloroacetic acid (TCA) precipitation method. Results:the gathered results revealed the effective binding of the labeled fluoroquinolones to the purified DNA with high percent (65-68% for each species). High localization and binding of the tracers to the DNA of the live bacterial cell, which is the site of action of topoisomerase ll and IV, were observed, and not to the DNA of the dead one. High uptake of the tracers by the live resistant bacterial strain was noticed with low localization in their DNA. high bioavailability and plasma protein binding were observed. Conclusion: 99mTc- fluoroquinolones, in the present study, retained their antimicrobial activities and exhibited high targeting to the DNA of live sensitive bacteria and not to dead or resistant strains. These results lead to the ability of the labeled fluoroquinolones to image and identify septic foci from aseptic one

  17. Aseptic loosening of the femoral implant after cemented total hip arthroplasty in dogs: 11 cases in 10 dogs (1991-1995)

    International Nuclear Information System (INIS)

    Objective-To determine clinical signs, radiographic findings, results of surgical management, and potential causes of aseptic loosening of the femoral implant (ALFI) in dogs that have undergone cemented total hip arthroplasty (THA). Design-Retrospective study. Animals-11 cases of ALFI in 10 dogs. Procedure-Medical records of all dogs undergoing THA revision surgery were reviewed. Only dogs with ALFI were included. The prosthesis and cement were removed by creating a longitudinal osteotomy of the cranial femoral cortex. Postoperative radiographs of all dogs that underwent THA during the study period were reviewed. Results-The most common clinical sign was intermittent, subtle. or non-weight-bearing lameness. On radiographs obtained after THA, contact of the distal stem tip with cortical endosteum was evident in all dogs. Radiographic changes at the time of diagnosis of ALFI included asymmetric periosteal reaction along the femoral diaphysis, radiolucent lines between the prosthesis and cement, altered implant position, and femoral fracture. Surgical revision yielded good or excellent results in 9 cases. In 1 dog. the implant became infected; in another, aseptic loosening recurred. Aseptic loosening was significantly more common in dogs in which there was contact between the distal stem tip and cortical endosteum than in dogs in which there was no contact. Clinical Implications-ALFI is an uncommon, but important, complication of THA, and radiography is warranted in dogs with clinical signs of ALFI. Initial centering of the prosthetic stem within the femoral shaft may reduce the incidence of ALFI

  18. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    Science.gov (United States)

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening. PMID:26838880

  19. Aseptic suppurative meningitis in juvenile boxer dogs: retrospective study of 12 cases.

    Science.gov (United States)

    Behr, Sebastien; Cauzinille, Laurent

    2006-01-01

    Immune-mediated central nervous system inflammation is described in a series of 12 juvenile boxer dogs. A diagnosis of steroid-responsive meningitis-arteritis was made based on the clinical presentation and on diagnostic findings. The boxer breed was at a higher risk for this inflammatory condition than other breeds. Long-term follow-up (>2 years) confirmed a better prognosis in this breed than in the beagle and the Bernese mountain dog. Complete resolution of clinical signs without significant deficits or recurrences was obtained in all cases. Early clinical recognition and immunosuppressive treatment resulted in a better response and complete resolution of the disorder. PMID:16822766

  20. Estabilidade dos carotenoides,antocianinas e vitamina C presentes no suco tropical de acerola (Malpighia emarginata DC. adoçado envasado pelos processos Hot-Fill e asséptico Stability of carotenoids, anthocyanins and vitamin C presents in acerola sweetened tropical juice preserved by hot fill and aseptic processes

    Directory of Open Access Journals (Sweden)

    Claisa Andréa Silva de Freitas

    2006-10-01

    Full Text Available As frutas tropicais são muito aceitas pelos consumidores, e são importantes fontes de componentes antioxidantes. A acerola, conhecida por conter grandes quantidades de vitamina C, é também rica em antocianinas e carotenóides. O presente trabalho teve por objetivo avaliar a estabilidade dos carotenóides totais, antocianinas totais e vitamina C do suco tropical de acerola adoçado, elaborado pelos processos Hot Fill (garrafas de vidro e asséptico (embalagens cartonadas, durante 350 dias de armazenamento em condições similares às de comercialização (28ºC ± 2ºC. Ao final do experimento observou-se que não houve perdas de antocianinas totais para o processo Hot Fill, no entanto, para o processo asséptico constatou-se uma redução de 86,89% dos teores iniciais. Os valores de carotenóides totais permaneceram inalterados nas amostras do processo asséptico, enquanto nas do Hot Fill houve uma redução de 12,5%. Constatou-se redução nos teores de vitamina C da ordem de 23,61% para o processo Hot Fill e de 35,95% para o processo asséptico.Tropical fruits are widely accepted by consumers, and important sources of antioxidant compounds. Acerola, known to have high vitamin C levels, is also rich in anthocyanins and carotenoids. The purpose of this work was to evaluate the stability of the total carotenoids, total anthocyanins and ascorbic acid of the acerola sweetened tropical juice produced by the Hot Fill (glass bottles and aseptic (packings carton process during 350 days of storage in similar conditions of trade (28ºC ± 2ºC. It was observed that there were not losses of total anthocyanins for the process Hot Fill, however for the aseptic process a reduction of 86.89% of the initial values was observed. The values of total corotenoids stayed unaffected in the samples of the aseptic process, while in the one of the Hot Fill there was a reduction of 12.5%. A reduction in the values of ascorbic acid of 23.61% was observed for the Hot

  1. Progress of Aseptic Purification Technique of Cyanobacteria%蓝藻无菌化方法研究进展

    Institute of Scientific and Technical Information of China (English)

    李天丽; 郑凌凌; 张琪; 宋立荣

    2015-01-01

    随着微藻产业的蓬勃发展,蓝藻作为具有重要经济价值的资源受到人们越来越多的关注,其多糖和蛋白的开发已被应用于多个领域。为了更深入清晰地挖掘蓝藻的特性和功能,研究者首先需获得无菌的纯种藻株,这是深入开展蓝藻生理生化、遗传和毒性等研究的基础。重点综述了如何根据蓝藻的结构及生理特性选择合适的无菌化方法,介绍了基于蓝藻与污染菌之间差异性的无菌化方法,以期为蓝藻的无菌化工作提供参考。%With the vigorous development of the microalgae industry, people are paying much more attention to cyanobacteria according to its important economic value, as its polysaccharide and protein are applied in many fields.In order to excavate the characteristics and function of cyanobacteria more in-depth and clearly, it is necessary to obtain axenic cultures of cyanobacteria, which is also regarded as the foundation for the further research on physiological, biochemical, genetic and taxonomic characteristics of cyanobacteria.This paper mainly reviewed the chosen of appropriate aseptic purification methods based on their structures and physiological characteristics.Furthermore, the methods based on the differences between cyanobacteria and contaminated bacteria were introduced.The paper was expected to provide useful information for the works on purification of cyanobacteria.

  2. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    Science.gov (United States)

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  3. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    Science.gov (United States)

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  4. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    Science.gov (United States)

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  5. Syphilitic aseptic meningitis

    Science.gov (United States)

    ... done to confirm the diagnosis. Tests include: FTA-ABS MHA-TP TP-PA TP-EIA Treatment The ... syphilis . Alternative Names Meningitis - syphilitic Images Central nervous system and peripheral nervous system References Hook EW III. ...

  6. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    Directory of Open Access Journals (Sweden)

    Camille Orion

    2016-07-01

    Full Text Available Idiopathic facial aseptic granuloma (IFAG is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea.

  7. An experimental animal model of aseptic loosening of hip prostheses in sheep to study early biochemical changes at the interface membrane

    Directory of Open Access Journals (Sweden)

    Akens Margarete K

    2004-03-01

    Full Text Available Abstract Background Aseptic loosening of hip prosthesis as it occurs in clinical cases in human patients was attributed to wear particles of the implants, the response of the tissue dominated by macrophages and the production of inflammatory mediators and matrix degrading enzymes; however, the cascade of events initiating the process and their interaction regarding the time course is still open and discussed controversially. Therefore, the goal of this study was to establish an experimental animal model in sheep allowing to follow the cascade of early mechanical and biochemical events within the interface membrane and study the sequence of how they contribute to the pathological bone resorption necessary for aseptic loosening of the implant. Methods A cemented modular system (Biomedtrix was used as a hip replacement in 24 adult Swiss Alpine sheep, with one group receiving a complete cement mantle as controls (n = 12, and the other group a cement mantle with a standardized, lateral, primary defect in the cement mantle (n = 12. Animals were followed over time for 2 and 8.5 months (n = 6 each. After sacrifice, samples from the interface membranes were harvested from five different regions of the femur and joint capsule. Explant cell cultures were performed and supernatant of cultures were tested and assayed for nitric oxide, prostaglandin E2, caseinolytic and collagenolytic activity. RNA extraction and quantification were performed for inducible nitric oxide synthase, cyclooxygenase-2, interleukin 1, and interleukin 6. Overall differences between groups and time periods and interactions thereof were calculated using a factorial analysis of variance (ANOVA. Results The development of an interface membrane was noticed in both groups at both time points. However, in the controls the interface membrane regressed in thickness and biological activity, while both variables increased in the experimental group with the primary cement mantle defect over time

  8. Attempts at establishing the culture conditions for Lemna minor L.

    Directory of Open Access Journals (Sweden)

    M. Krzychowska

    2015-05-01

    Full Text Available The influence of the concentration, composition and pH of the substrate as well as of light intensity on the growth and vegetative propagation of Lemna minor L. was investigated. The media of Hutner, Hoagland and Pirson and Seidel were used. At first the experiments were carried out under unsterile conditions. Later sterilized duckweed was cultured in aseptic conditions. The dry matter was determined. Surface area increment and an increase in the number of fronds were evaluated by the planimetric method. For total protein determination in Lemna minor L. from unsterile and sterile cultures Lowry's method was used.

  9. Validation of an aseptic process for live attenuated varicella vaccine%水痘减毒活疫苗的无菌生产工艺验证

    Institute of Scientific and Technical Information of China (English)

    马相虎; 陈哲文; 晏子厚

    2015-01-01

    Objective To validate the effectiveness of the aseptic production process of live attenuated varicella vaccine (chickenpox vaccine) by media fill test.Methods The aseptic filling of the vaccine was simulated using Trypticase Soy Broth (TSB,3.2%),with filling volume of 0.6 ml per vial.The vials were incubated after filling,and the sterility of current production process was evaluated by the contamination situation of the media inside the vials.Results The filling batch numbers of 3 media fill tests were 10 160,10 181 and 10 175 vials,respectively.After successive incubation at 20-25 ℃ and 30-35 ℃,contamination rates of TSB all were 0.≥0.5μm airborne particulates were less than 70 per cubic meter at each sampling point in the production area.No ≥ 5.0 μm airborne particulate was detected.There was no colony of settle plate and surface microbial.The growth promotion test and microbial challenging test of TSB were both qualified.Conclusion The aseptic production process of chickenpox vaccine is conformed with good manufacture practice,which can assure its sterility.%目的 通过培养基模拟灌装试验,验证水痘减毒活疫苗(水痘疫苗)无菌生产工艺的有效性.方法 模拟水痘疫苗的无菌灌装工艺,对胰酪胨大豆肉汤培养基(TSB)按0.6 ml/瓶进行模拟灌装,对灌装后小瓶进行培养,根据小瓶内培养基的污染情况,评估现行水痘疫苗无菌生产工艺的有效性.结果 3次TSB模拟灌装试验的灌装批量分别为10 160、10 181和10 175瓶,经20~25℃和30~35℃先后培养后,均未出现TSB污染.在水痘疫苗生产区域的各监测点,≥0.5μm悬浮粒子均≤70粒/m3,≥5.0 μm悬浮粒子均为0;沉降菌和表面微生物的菌落计数均为0;培养基灵敏度检查和微生物挑战试验均合格.结论 水痘疫苗的无菌生产工艺符合药品生产质量管理规范的要求,可确保产品的无菌性.

  10. The preparation of aseptic rabbit tissue cage infection model%兔组织笼无菌感染模型的制备

    Institute of Scientific and Technical Information of China (English)

    刘树玲; 丁丽; 邢昆

    2015-01-01

    目的:制备兔组织笼无菌感染模型,为药物药动学-药效学结合模型(pharmacokinetic‐pharmaco‐dynamic modeling ,PK‐PD)研究提供在体动物实验载体。方法选取健康家兔28只,耳缘静脉注射盐酸赛拉嗪注射液0.15ml/kg麻醉,每只分别背部备皮、切开皮肤,然后在皮下植入长约5cm的无菌中空胸腔引流管1个,继而在无菌操作下手术缝合。术后应用青霉素肌肉注射3d以预防感染。结果5只家兔先后因不同原因死亡,23只家兔均获得清亮的无菌组织液,成功建立兔组织模型,成功率为82.14%。结论通过严格控制无菌操作,选择合适的麻醉剂,手术刀口选择在兔背部,术后及时预防感染,可以成功制备兔组织笼无菌感染模型,并获得清亮的无菌组织液。%Objective To prepare a rabbit tissue cage model so as to provide drug animal carrier in vivo for drug PK‐PD modeling study .Methods 28 healthy rabbits were selected and injected with the anesthesia xylazine iv respectively .The back hair was cut in each rabbit ,and then the skin was cut open .A 5cm of sterile hollow chest tube drainage was implanted subcutaneously .In the end the wound was sewed up with aseptic technique .After op‐eration penicillin im was injected for 3 days to prevent infection .Results Among the 28 rabbits ,5 rabbits were dead due to different causes .Clear and sterile tissue fluid were gotten from other 23 rabbits .A rabbit tissue model was established successfully ,and the success rate was 82 .14% .Conclusion By stricted controlling aseptic opera‐tion ,selecting the appropriate anesthesia and surgical incision in the back of the rabbit ,timely postoperative anti‐infection ,a rabbit tissue cage model can be successfully established ,so does clear tissue fluid .

  11. Marked MMP-2 transcriptional up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic suppurative steroid-responsive meningitis-arteritis in dogs.

    Science.gov (United States)

    Schwartz, M; Puff, C; Stein, V M; Baumgärtner, W; Tipold, A

    2010-02-15

    Canine Steroid-Responsive Meningitis-Arteritis (SRMA) is a suitable animal model for studies on the development of neutrophilic pleocytosis in aseptic meningitis. Samples of dogs in the acute phase of SRMA (n=16) were examined for gene expression of matrix metalloproteinases (MMP)-2 and -9 and tissue inhibitors of metalloproteinases (TIMP)-1 and -2. Results were compared to those of dogs under glucocorticosteroid treatment for SRMA (n=16) and dogs with other inflammatory and neoplastic diseases of the central nervous system (CNS) (n=19). Samples included mononuclear (PBMCs) and polymorphonuclear cells (PBPMNs) of peripheral blood and cerebrospinal fluid white blood cells (CSF WBCs). In the acute phase of SRMA CSF WBCs showed mRNA expression for MMP-2 and -9 and TIMP-1 and -2, highlighting a contribution of these cells to the overall content of MMPs and TIMPs in CSF. MMP-2 mRNA levels in CSF WBCs were significantly up-regulated in comparison to PBMC expression levels, suggesting that MMP-2 is relevant for PBMC invasion into the subarachnoidal space and that the expression is influenced by migratory activity through the blood-CSF-barrier. PMID:19733404

  12. Sensory characteristics and consumer acceptance of frozen cooked rice by a rapid freezing process compared to homemade and aseptic packaged cooked rice.

    Science.gov (United States)

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-03-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars-IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  13. 101例儿童无菌性脑炎的临床特点分析%The clinical features of 101 cases of children with aseptic encephalitis

    Institute of Scientific and Technical Information of China (English)

    王贤柱; 李玖军

    2015-01-01

    Objective To observe and discus the clinical features and outcome of aseptic encephali-tis in children. Methods One hundred and one cases treated in PICU of Shengjing Hospital of China Medi-cal University and diagnosed with aseptic encephalitis from December 2009 to December 2012 were enrolled. Results The clinical manifestations, signs, laboratory examinations and outcome were analyzed retrospec-tively. Among them, 54 cases were male,47 cases were female,12 cases aged from 1 month old to 6 months old,12 cases aged from 7 months old to 1 year old,36 cases aged from 2 years old to 3 years old,12 cases aged from 4 years old to 6 years old,19 cases aged from 7 years old to 14 years old. The fever was the most common clinical manifestation, a total of 92 cases ( 91. 1%) , followed by convulsions, a total of 79 cases (78. 2%),63 cases with meningeal irritation or pathological signs positive(62. 4%). The sensitivity of elec-troencephalography( EEG) was the highest for diagnosis of aseptic encephalitis,89 cases underwent EEG with abnormal rate of 84. 3%(75/101). Followed by head MRI scan,97 cases underwent head MRI scan with ab-normal rate of 55. 7%(54/101). All cases underwent cerebrospinal fluid examination,50 cases with white blood cells and(or) protein increased(49. 5%). The sensitivity of head CT scan was the lowest,the abnor-malities were found in 11 cases ( 17. 5%) among 63 cases underwent head CT scan. All cases were given comprehensive treatment of sedation, antifebrile, reducing intracranial pressure and nerve nutrational treat-ment. Seventy cases were cured,20 cases left neurological sequelae,7 cases gave up treatment,4 cases died. Conclusion The children aseptic encephalitis occurs in infants and young children,the incidence of male and female are equal. The clinical manifestations are diverse,the most common manifestations are fever and con-vulsion,EEG and MRI are with high sensitivity. Most patients have good outcome if received symptomatic treatment early

  14. The value of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip prostheses: A meta-analysis

    International Nuclear Information System (INIS)

    Objective: To summarize and compare the diagnostic accuracy of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip arthroplasties. Design: This meta-analysis was performed using methods described by the Cochrane Methods Group on Systematic Reviews of Screening and Diagnostic Tests. We included original, English-language papers published between January 1975 to October 2004 that examined contrast-enhanced arthrography with or without subtraction for diagnosis of loosening of total hip prostheses. A qualitative and quantitative analysis was performed by two investigators. Results: With regard to the acetabular component, pooled sensitivity and specificity for contrast arthrography was 70% (95% confidence interval, 52-84) and 74% (95% CI, 53-87), respectively. Subtraction arthrography had a significantly higher sensitivity of 89% (95% CI, 84-93) (p = 0.01), with a similar specificity of 76% (95% CI, 68-82). For the femoral component, pooled sensitivity and specificity for contrast arthrography were 63% (95% CI, 53-72) and 78% (95% CI, 68-86). Pooled estimates for subtraction arthrography revealed a significantly higher sensitivity of 86% (95% CI, 74-93) (p = 0.003). Specificity was 85% (95% CI, 77-91) and was similar to the data of contrast arthrography (p = 0.23). Conclusion: Using the present data we found that the subtraction arthrography is a sensitive technique for detection of loosening of total hip prostheses, offering added value over contrast arthrography, especially for evaluation of the femoral component

  15. 托盘包装和无菌包装在冷鲜羊肉贮藏中的对比%Comparison of pallet packaging and aseptic packaging in chilled mutton storage

    Institute of Scientific and Technical Information of China (English)

    王永刚; 王长明

    2015-01-01

    The pallet packaging and aseptic packaging were taken to do experiment respectively. The total number of colonies, pH and TVB -N of mutton in the process of storage under 3 ± 1℃were measured to research the effect of natural preservatives combined with pallet packing or aseptic packaging on extending mutton preservation. The results showed that the effect of aseptic packaging was better than the pallet packaging. Combined with the leaf,wild chrysanthemum flowers,and plum extract,mutton could keep second freshness in 15 days.%分别采用托盘包装和无菌包装进行试验,通过测定在3±1℃下贮存过程中菌落总数、pH值及TVB-N,了解天然防腐剂结合托盘包装或无菌包装对延长羊肉保鲜的效果。结果表明:无菌包装的包装效果优于托盘包装,结合大青叶、野菊花、乌梅提取液可使冷鲜羊肉15d内保持在二级鲜度。

  16. 肿瘤型假体无菌性松动的治疗现状%Current status of the treatment of aseptic loosening in tumor prostheses

    Institute of Scientific and Technical Information of China (English)

    高明; 张清; 牛晓辉

    2014-01-01

    Aseptic loosening ( AL ) is one of the most common complications in tumor prostheses. Loss of bone quantity and decline of bone quality are the main challenges that orthopedists encounter when they deal with AL. Based on the latest reports, prosthesis revision is the primary choice in the treatment of AL, and it can provide relatively satisfactory outcomes when compared with other methods. While it needs enough bone quantity and good bone quality for prosthetic stability. In some reports, it can get a median Musculoskeletal Tumor Society ( MSTS ) functional score of 96% ( range: 50%-100% ) after an average follow-up of 101 months ( range: 47-155 months ) after the surgery. Besides this, allograft-prosthesis composites ( APCs ) are another choice. Allograft segments are used to construct a certain ifxation arm to get a more stable ifxation. However, its outcomes are not as satisfactory as that of prosthesis revision. According to some reports, after an average follow-up of 59 months after the surgery, it can provide an average MSTS functional score of 62% ( range: 57%-67% ). While we must take account that these patients receiving APCs always have less bone quantity and worse bone quality, when compared with those only receiving prosthetic treatment. In recent years, a new type of prosthesis based on extra-cortical plate ifxation has been used in the revision, which is superior to the conventional intramedullary stem prosthesis. The current results illustrate that it has certain application prospects, but high-quality studies are needed to further demonstrate it. When the loss of bone quantity and decline of bone quality are too serious to perform limb salvage treatment, rotationplasty and amputation may be a choice. However, great attention must be paid to their indications.

  17. Effects of low dosage Co-60 irradiation in the course of aseptic arthritis of the knee joint of rabbits; Effekte einer niedrig dosierten Co-60-Bestrahlung auf den Verlauf einer aseptischen Arthritis am Kniegelenk des Kaninchens

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, U.; Koch, F.; Ludewig, E. [Univ. Leipzig (Germany). Veterinaermedizinische Fakultaet; Kamprad, F.; Melzer, R.; Hildebrandt, G. [Leipzig Univ. (Germany). Klinik fuer Strahlentherapie und Radioonkologie

    1998-12-01

    Purpose: Numerous clinical observations demonstrate the efficacy of low radiation doses in the treatment of painful osteoarthritis. Experimental investigations remain scarce. We investigated the effects of locally daily 5 times 1.0 Gy 60-Co irradiation on an artificially induced aseptic gonarthritis in rabbits. Material and methods: Three separate experiments (EV) were performed (10 rabbits per experiment, 5 treated/5 controls; duration: EV1: 18 days; EV2: 6 days; EV3: 29 days). An aseptic arthritis in the right knee joint of rabbits was induced by intraarticular injection of 0.5 ml papain solution (3%, 30,000 USP/mg) on day 0. The arthritic knee joint of the anesthesized animals was irradiated daily from day 1 to 5 with 5 times 1.0 Gy. The controls were sham-irradiated under the same conditions. The time course of arthritis in treated animals and sham-treated controls was evaluated by clinical, laboratory-chemical and histological criteria. The clinical investigation was performed daily, the puncture of the knee-joints was carried out several times in EV1, and at the end of experiments in EV2 and EV3. At the end of the observation period, animals were killed and the knee joints excised for histological analysis. Results: The intraarticular injection of papain caused a peracute inflammatory response in all animals. After 1 week the chronical stage was reached, and the experimental arthritis resolved slowly within several weeks. Local irradiation accelerated the decrease of inflammatory joint swelling, being significant by day 4. On day 6 the volume of synovial fluid in irradiated knee-joints was significantly smaller. The morphometric data indicated a reduction in thickness of synovial membrane, a decrease in number of synovial cell layers, and a decrease in distance between capillaries and the synovial membrane surface following irradiation of arthritic joints. Due to considerable individual variability, the morphometric data partially did not reach statistically

  18. Is cementing technique the cause of early aseptic loosening of the tibial component in total knee arthroplasty? A report of 22 failed tibial components

    Directory of Open Access Journals (Sweden)

    Stefan Endres

    2011-05-01

    whether early aseptic loosening is still acceptable nowadays from the medical economic aspects also warrants discussion.

  19. The effect of Lipoxin A4 on the interaction between macrophage and osteoblast: possible role in the treatment of aseptic loosening

    Directory of Open Access Journals (Sweden)

    Sun Li

    2009-06-01

    Full Text Available Abstract Background Aseptic loosening (AL is the main problem of total joints replacement (TJR by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs are endogenous eicosanoids synthesized locally from arachidonate acid (AA at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Methods Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4 on polymethylmethacrylate (PMMA induced inflammation, pro-inflammatory cytokines including TNF-α, IL-1β, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. Results 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0–100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked

  20. 自制编号牌在骨科手术无菌包中的应用%Application of Aseptic Package with Self-made Numbered plate in Orthopedics Operation

    Institute of Scientific and Technical Information of China (English)

    梁佳佳; 廖涛

    2013-01-01

    Objective: To explore the application effect of self-made numbered plate in orthopedics operation sterile package. Meth-ods: Based on section of management time, aseptic package from January 2010 to August 2010 was divided into the control group and experimental group, working time of nurses, numbers of expired packages, effective usage rate of aseptic package and satisfac-tion degree of nursing were compared between two groups. Results: The experimental group working time of nurses shortened, the number of expired package minimized, the effective utilization rate of aseptic package was improved, and satisfaction degree of nurs-ing was better. Conclusion: The management of numbered aseptic package can greatly save the working time of nurses, improve work efficiency, avoid repeating sterilization that shortened equipment life, and reduce the cost of running hospital.%  目的:探讨自制编号牌在骨科手术无菌包中的应用效果。方法:将2010年1月至2010年8月的无菌包按照管理时间段分为对照组和实验组,对比两组护士工作时间、过期包个数、无菌包的有效使用率及护士满意度。结果:实验组护士的工作时间缩短,过期包数量减少,无菌包的有效使用率提高,护士满意度高。结论:对无菌包的编号管理大大节约了护士工作时间,提高了工作效率,避免了无菌包的重复灭菌而缩短器械使用寿命,降低了医院经济成本。

  1. Analysis of {sup 18} F-FDG uptake patterns in PET for diagnosis of septic and aseptic loosening after total hip arthroplasty

    Energy Technology Data Exchange (ETDEWEB)

    Cremerius, U.; Niethard, F.U. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Klinik fuer Nuklearmedizin; Mumme, T.; Reinartz, P.; Wirtz, D. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Orthopaedische Klinik; Buell, U.

    2003-12-01

    Aim: Identification of typical patterns for fluorodeoxyglucose (FDG) uptake in positron emission tomography (PET) to detect aseptic loosening of hip prosthesis (acetabular and/or femoral component) and prosthetic infection. Methods: 18 patients with painful hip prosthesis underwent PET using a dedicated full ring scanner after application of 200-300 MBq FDG. The interface between bone and surrounding soft tissue or bone as displayed on coronal slices was divided into 12 segments in accordance with the classifications of Delee and Gruen. FDG uptake in each of the segments was scored (0-3) by two independent observers. Intraoperative findings were regarded as the gold standard. Results: After surgical revision 14 acetabular components and 9 femoral components were found to be loose and prosthetic infection was present in 7 prostheses. Loosening of the acetabular component was correlated to enhanced uptake in the middle of the acetabular interface, while loosening of the femoral component was correlated to enhanced uptake in the proximal and middle segment of the lateral femoral interface and the proximal segment of the medial femoral interface. A similar pattern was found in prosthetic infection with high uptake along the middle portion of the lateral femoral interface. In 6 of 7 infected prostheses loosening of the acetabular and of the femoral component was present. Taking the typical uptake patterns as criteria for loosening and grade 3 uptake as an additional criterion for septic loosening the accuracy of PET imaging in the detection of loosening of the acetabular or the femoral component and of prosthetic infection was 72, 78 and 89%, respectively. Conclusion: This pilot study presents FDG-PET as a promising diagnostic tool for patients with painful hip prostheses. Its clinical value should be evaluated in a larger patient population. (orig.) [German] Ziel: Identifikation von Befundmustern in der Positronenemissionstomographie (PET) mit {sup 18}F

  2. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia; Kernspintomographie von aseptischen Osteonekrosen bei Kindern und Jugendlichen mit einer akuten lymphoblastischen Leukaemie

    Energy Technology Data Exchange (ETDEWEB)

    Engelbrecht, V.; Scherer, A.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bruder, M. [Duesseldorf Univ. (Germany). Kinderklinik; Koerholz, D. [Leipzig Univ. (Germany). Kinderonkologie

    2000-04-01

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm{sup 2} with a range of 0.5 to 50 cm{sup 2}. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm{sup 2} more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.) [German] Ziel: Erfassung von Haeufigkeit, Lokalisation und Verlauf von symptomatischen aseptischen Osteonekrosen (AON) bei Kindern und Jugendlichen unter der Therapie einer akuten lymphoblastischen Leukaemie (ALL). Methoden: In einer Gruppe von 121 Kindern mit ALL (Alter 1-17 Jahre) wurden retrospektiv 72 MRT der Extremitaeten bei 26 Kindern mit Knochenschmerzen bezueglich der Zahl, Groesse und Lokalisation von AON ausgewertet. Die Flaeche von AON wurde planimetrisch bestimmt. Verlaufskontrollen erstreckten sich ueber 2-5 Jahre. Ergebnisse: 10/121 (8,3%) der Kinder wiesen

  3. Effects of Colchicine Treatment on Aseptic Seedling Growth of Arnebia euchroma (Royle)Johnst%秋水仙素处理对新疆紫草无菌苗生长的影响

    Institute of Scientific and Technical Information of China (English)

    潘颀; 魏欢; 王芳; 郝爱花; 班娜

    2014-01-01

    The method of colchicine solution soaking was adopted to treat Arnebia euchroma (Royle) Johnst aseptic seedling.The results showed that the hypocotyl expands (42.1%-52.6%)promoted obvi-ously and inhibited the roots formation when Arnebia euchroma (Royle)Johnst seeds were soaked in col-chicine concentration of 100 mg/L,but it is not much effect on seeds germination.The aseptic seedling soa-king time shoulds not be more than 48 h.The germination rate was 66%~80% and the mutation rate was 12.50%-28.78%,Mutated with 25 mg/L colchicine at the temperature of 20 ℃ for 12 h to 24 h.After soaking by colchicine treatment produced abundant morphological variation.%采用秋水仙素溶液浸泡方法处理新疆紫草无菌苗.结果表明,秋水仙素浓度为100 mg/L时浸泡新疆紫草5子,明显促进下胚轴的膨大(42.1%~52.6%),抑制根的形成,但对5子萌发影响不大;无菌苗浸泡时$不宜超过48 h;苗龄为25 d、处理温度为20℃、秋水仙素浓度为25 mg/L、浸泡12~24 h时的萌发率为66%~80%,变异率为12.50%~28.78%;通过秋水仙素浸泡处理产生了丰富的形态变异.

  4. A Study to Assess the Association of Aseptic Practices Being Followed and its Effect on the Overall Outcome of Selected Special Care Newborn Units (SCNUs of Madhya Pradesh at Different Levels.

    Directory of Open Access Journals (Sweden)

    Mahore RK

    2015-04-01

    Full Text Available The neonatal mortality rate in India is high and stagnant. Special Care Newborn Units (SCNUs have been set up at different levels of Health Care Delivery System to provide quality newborn-care services in several hospitals to meet this challenge. Many units are located in the districts where the burden of neonatal deaths is high, and access to special newborn care is poor. The study was conducted to assess the functioning of SCNUs in six centers of India. The evaluation was based on an analysis of secondary data from the six units that had been functioning for at least three year. A cross-sectional survey was also conducted to assess the availability of Quality care and Aseptic practices implemented at different levels of SNCUs. Descriptive statistics were used for analyzing the inputs (Quality care and aseptic practices and outcomes (morbidity and mortality. The rate of mortality among admitted neonates was taken as the key outcome variable to assess the performance of the units. Chi-square test was used for analyzing the trend of case-fatality rate over a period of 3 years considering the first year of operationalization as the base. Correlation coefficients were estimated to understand the possible association of case-fatality rate with factors, such as bed:doctor ratio, bed:nurse ratio, average duration of stay, and bed occupancy rate, and the asepsis score was determined. The rates of admission increased from a median of 16.7 per 100 deliveries in 2012 to 19.5 per 100 deliveries in 2014. The case-fatality rate shows progressive decline in all the units in Last 3 years. Proportional mortality due to sepsis and low birthweight (LBW declined significantly over two years (LBW <2.5 kg. The major reasons for admission and the major causes of deaths were birth asphyxia, sepsis, and LBW/prematurity. The units had a varying nurse:bed ratio (1:1-1:2.14. The bed occupancy rate ranged from 83% to 121% (median 115%, and the average duration of stay

  5. Avaliação da qualidade de caldo de cana envasado a quente e por sistema asséptico Quality of sugarcane (Sacharum ssp. juice packed by hot fill and aseptic processes

    Directory of Open Access Journals (Sweden)

    Karin Samorano da Silva

    2006-12-01

    Full Text Available Dois processos térmicos foram aplicados ao caldo de cana com o objetivo de se obter um produto estável à temperatura ambiente. A variedade de cana de açúcar (Sacharum ssp. utilizada foi a RB72 - 454. A metodologia de planejamento fatorial foi aplicada a fim de se verificar a melhor combinação entre acidez (pH e doçura (°Brix. Houve uma tendência para melhor aceitação sensorial quando o pH foi maior que 4,0 e °Brix maior que 15. Primeiramente, o caldo foi submetido a 141 °C /10 s e envasado assepticamente em garrafas de vidro previamente esterilizadas. No segundo processo, o caldo foi submetido ao tratamento térmico a 110 °C /10 s e envasado a quente (90 ± 5 °C em garrafas de vidro. Análises físico-químicas, microbiológicas e sensoriais foram realizadas durante a estocagem dos lotes à temperatura ambiente. O lote processado assepticamente apresentou vida útil de 30 dias e o envasado a quente, 60 dias, não apresentando diferença estatística (p The objective of this work is to evaluate two thermal processes in order to obtain sugarcane (Sacharum ssp. juice stable at room temperature in glass bottles. An experimental methodology was applied to obtain the best combination between pH and °Brix based on the sensory results. There was a tendency for a better sensory acceptance for pH > 4.0 and °Brix > 15. Two thermal processes were applied to sterilize the juice. Firstly, the juice was submitted to 141 °C /10 s, and then aseptically filled in glass bottles previously sterilized. In the second process, the juice was submitted to 110 °C /10 s and filled into glass bottles at 90 ± 5 °C. Physical-chemical changes, microbiological counts and sensory acceptance were evaluated during the storage at room temperature. The shelf life of aseptically processed juice was 30 days and 60 days for the hot filled juice based on the sensory evaluation. These results indicated that the hot fill process was more efficient for sugarcane

  6. Colagenopatía y meningitis aséptica recurrente en una paciente de 88 años Colagenopathy and recurrent aseptic meningitis in an 88 year old patient

    Directory of Open Access Journals (Sweden)

    Fernando J. VAzquez

    2004-02-01

    Full Text Available La meningitis aséptica recurrente (MAR en ancianos es rara y generalmente es secundaria a drogas. Su asociación a colagenopatías en ancianos ha sido raramente informada. El Síndrome de Sjögren (SS en ocasiones afecta el sistema nervioso central, pero la MAR asociada a SS es rara en este grupo etario. Se presenta una paciente de 88 años, autoválida, con antecedentes de xerostomía, xeroftalmos, Raynaud, disfagia y agrandamiento parotídeo recurrente autolimitado. En el año 2001 cursó una meningitis linfocítica y evolucionó con recuperación completa. Un año después volvió a presentar una meningitis linfocítica aséptica. Se descartaron causas infecciosas. Se demostró FAN 1/160 con patrón nucleolar moteado, Ac anti Ro y anti RNP positivos y anticoagulante lúpico positivo. Se confirmó sequedad ocular y la biopsia de labio fue compatible con SS. Evolucionó con resolución completa en 10 días sin tratamiento. Se interpretó como una enfermedad mixta del tejido conectivo (EMTC con síntomas predominantemente de SS, que cursó una MAR en su forma pura. La EMTC y el SS deberían ser considerados entre los diagnósticos diferenciales de la MAR, inclusive en ancianos.Recurrent aseptic meningitis (RAM infrequent in elderly patients and generally secondary to drugs. Its association with rheumatologic diseases is also seldom reported in the elderly. Sjögren Syndrome (SS sometimes affects the central nevous system, but the association between recurrent meningitis and SS is rare, specially in this age-group. We present an 88 year-old autovalid patient, with a history of xerostomia, xerophthalmia, Raynaud, dysphagia, and recurrent parotid enlargement. In 2001 she developed a lymphocytic meningitis with a complete remission. A year later, she developed again an aseptic lymphocytic meningitis. We ruled out infeccious causes. We found a FAN titer 1/160 with a nucleolar-mottled pattern, positive anti Ro and anti RNP antibodies and a positive

  7. Chromosomal Conditions

    Science.gov (United States)

    ... labor & premature birth The newborn intensive care unit (NICU) Birth defects & other health conditions Loss & grief Tools & ... labor & premature birth The newborn intensive care unit (NICU) Birth defects & other health conditions Loss & grief Ask ...

  8. Storage stability of cashew apple juice preserved by hot fill and aseptic processes Estabilidade do suco de caju preservado pelo método ''hot fill'' e processo asséptico

    Directory of Open Access Journals (Sweden)

    Maria Cecília Oliveira Costa

    2003-12-01

    Full Text Available Cashew (Anacardium occidentale L. apples from Pacajus, Ceará State, Brazil, were processed into high pulp content juice. The juice was packed either by hot fill or an aseptic process and evaluated for physical, physical-chemical, and sensorial changes during a 12-month storage period at room temperature. The results indicated that pH, soluble solids, total acidity, total sugar content and color did not change significantly during storage nor were affected by the type of filling. The sensorial analysis showed that juice acceptance remained high throughout the storage period regardless of the filling system. Differences in juice viscosity persisted between both processes.Pedúnculos de caju (Anacardium occidentale L. de Pacajus, Estado do Ceará, Brasil, foram processados na forma de suco com alto teor de polpa. O suco foi acondicionado através do processo hot fill ou asséptico e verificada as alterações físicas, físico-químicas e sensoriais durante armazenagem por doze meses à temperatura ambiente. Os resultados indicaram que pH, sólidos solúveis, acidez total, conteúdo de açúcar e cor não mudaram de modo significativo durante a armazenagem nem foram afetadas pelo modo de acondicionamento. Análise sensorial mostrou que a aceitação do suco foi mantida alta durante o período de armazenagem a despeito do sistema de enchimento. Diferenças na viscosidade dos sucos persistiram entre ambos processos.

  9. Conditional Comonotonicity

    OpenAIRE

    Napp, Clotilde; Jouini, Elyès

    2005-01-01

    In this paper we propose a generalization of the comonotonicity notion by introducing and exploring the concept of conditional comonotonicity. We characterize this notion and we show on examples that conditional comonotonicity is the natural extension of the concept of comonotonicity to dynamic settings.

  10. CONDITIONED SUPERPROCESSES

    Institute of Scientific and Technical Information of China (English)

    LICUNHANG; WURONG

    1997-01-01

    A class of superprocesses which dies out is investigated. Under the condition of norextinction, a new superprocess is COnstructed, its life time is infinite, and its distribution isdetermined by the moment function. Several limit theorems about this superprocess and its occulpation time process are obtained.

  11. Gibbs conditioning extended, Boltzmann conditioning introduced

    OpenAIRE

    Grendar, Marian

    2004-01-01

    Conditional Equi-concentration of Types on I-projections (ICET) and Extended Gibbs Conditioning Principle (EGCP) provide an extension of Conditioned Weak Law of Large Numbers and of Gibbs Conditioning Principle to the case of non-unique Relative Entropy Maximizing (REM) distribution (aka I-projection). ICET and EGCP give a probabilistic justification to REM under rather general conditions. mu-projection variants of the results are introduced. They provide a probabilistic justification to Maxi...

  12. Serum lipid profile in patients with oral cancer and oral precancerous conditions

    Directory of Open Access Journals (Sweden)

    Rajul Mehta

    2014-01-01

    Full Text Available Background: The present study was undertaken to estimate and compare the levels of plasma total cholesterol (TC, low density lipoprotein (LDL, high density lipoprotein (HDL, very low density lipoprotein (VLDL and triglycerides in patients with oral precancerous lesions/conditions, oral cancer and normal subjects. Materials and Methods: The study comprised of 60 patients with oral precancerous lesions/conditions, 60 patients with oral cancer and a control group of 60 healthy individuals. The diagnosis of oral precancerous lesions/conditions and oral cancer was confirmed histopathologically. Under aseptic condition 5 ml venous blood of overnight fasting patient was withdrawn from each individual. Serum was separated by centrifugation and plasma levels of TC, LDL, HDL, VLDL and triglycerides were estimated. Descriptive statistical analysis has been carried out in the present study. Analysis of variance has been used to find the significance of study parameters between three or more groups of patients, Post-hoc test as Tukey has been used to find the pair wise significance. Significance is assessed at 5% level of significance. Results: Statistically significant decrease in levels of plasma TC, LDL, HDL, VLDL and triglycerides was observed in the precancerous and cancerous groups as compared to the control group. On comparison between precancerous and cancerous groups, significant decrease was observed in cancerous group. Conclusion: The change in lipid levels may have an early diagnostic or prognostic role in the oral premalignant lesions/conditions and oral cancer. The presence of decreased plasma lipid profile should increase the suspicion of these lesions to be investigated further.

  13. REACH. Air Conditioning Units.

    Science.gov (United States)

    Garrison, Joe; And Others

    As a part of the REACH (Refrigeration, Electro-Mechanical, Air-Conditioning, Heating) electromechanical cluster, this student manual contains individualized instructional units in the area of air conditioning. The instructional units focus on air conditioning fundamentals, window air conditioning, system and installation, troubleshooting and…

  14. IC Associated Conditions

    Science.gov (United States)

    ... Intimacy & IC Support for Men Children & IC La Cistitis Intersticial IC in Other Languages Associated Conditions Allergies and ... Intimacy & IC Support for Men Children & IC La Cistitis Intersticial IC in Other Languages Associated Conditions Allergies and ...

  15. Energetics Conditioning Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Energetics Conditioning Facility is used for long term and short term aging studies of energetic materials. The facility has 10 conditioning chambers of which 2...

  16. Quasilocal energy conditions

    OpenAIRE

    Hayward, Geoff

    1994-01-01

    The classical value of the Hamiltonian for a system with timelike boundary has been interpreted as a quasilocal energy. This quasilocal energy is not positive definite. However, we derive a `quasilocal dominant energy condition' which is the natural consequence of the local dominant energy condition. We discuss some implications of this quasilocal energy condition. In particular, we find that it implies a `quasilocal weak energy condition'.

  17. Modelling classroom conditions with different boundary conditions

    DEFF Research Database (Denmark)

    Marbjerg, Gerd Høy; Jeong, Cheol-Ho; Brunskog, Jonas;

    2014-01-01

    both specular and diffuse reflections with complex-valued acoustical descriptions of the surfaces. In this paper the PARISM model is used to simulate a rectangular room with most of the absorption located in the ceiling. This room configuration is typical for classroom conditions. The simulations are...... measures which are important for evaluation of the acoustics in classrooms....

  18. Oligophilic Bacteria as Tools To Monitor Aseptic Pharmaceutical Production Units

    OpenAIRE

    Nagarkar, Parag P.; Ravetkar, Satish D.; Watve, Milind G

    2001-01-01

    The bacterial loads of air, surfaces, and personnel in clean rooms are routinely monitored using a set of standard media. Bacteria that can grow on these media are a tiny fraction of the total numbers in any environment. A substantial proportion of bacteria long thought to be unculturable were recently shown to be oligophilic. Oligophile counts in clean rooms in our studies exceeded the standard plate counts by up to 2 orders of magnitude. They responded to disinfection routines in ways simil...

  19. Atypical leptospirosis: an overlooked cause of aseptic meningitis

    OpenAIRE

    Wang, Ning; Han, Yu-Hsuan; Sung, Jia-Ying; Lee, Wen-Sen; Ou, Tsong-Yih

    2016-01-01

    Background Leptospirosis, probably the most common zoonosis in the world, is caused by pathogenic Leptospira species. Clinical presentations range from nonspecific fevers to fulminant diseases such as Weil’s syndrome. Neurological forms of leptospirosis (neuroleptospirosis) are usually underestimated, and many cases of leptospirosis are overlooked because of the lack of specificity of signs and symptoms. Diagnosis confirmation is difficult because of the challenges associated with isolating t...

  20. Low energy electrons for pasteurization and aseptic practice

    International Nuclear Information System (INIS)

    The enhanced stopping power of matter for electrons in the energy range under 300 kiloelectronvolts renders them particularly effective for the 'non-chemical' pasteurization of raw produce, as well as for the high speed sterilization of container material. Performance data for electron sterilizers operating in the 130 to 250 kilovolt regime will be presented along with a discussion of the thin film dosimetry techniques used for their characterization. This process is particularly attractive for citrus processing as the energy need only be delivered to the upper epidermis with a depth of penetration of 100 μ. The inner mesocarp or albedo, and the endocarp or edible pulp of the fruit, are unaffected by the process. The lethality of 100 keV electrons for some typical fruit pathogens has been studied in this laboratory. These include typical penicillin molds (P. chrysogenum) and the common brown stem rot (Phyt. citrophthora). D values for these, both on the outer surface of the orange flavedo and on specimens of controlled geometry, are reported. These results indicate that 100 keV electron treatment at surface levels of 0.2 megarads is adequate for in vitro control of these pathogens. (author)

  1. Lossless Conditional Schema Evolution

    DEFF Research Database (Denmark)

    Jensen, Ole Guttorm; Bøhlen, Michael Hanspeter

    2003-01-01

    The paper considers conditional schema evolution, where schema changes change the schema of the tuples that satisfy the change condition. When the schema of a relation change some tuples may no longer fit the current schema. Handling the mismatch between the intended schema of tuples and the...... recorded schema of tuples is at the core of a DBMS that supports schema evolution. We propose to keep track of schema mismatches at the level of individual tuples, and prove that conditionally evolving schemas, in contrast to current commercial database systems, are lossless when the schema evolves. The...

  2. Multidimensional HAM-conditions

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    Heat, Air and Moisture (HAM) conditions, experimental data are needed. Tests were performed in the large climate simulator at SBi involving full-scale wall elements. The elements were exposed for steady-state conditions, and temperature cycles simulating April and September climate in Denmark. The...... effect on the moisture and temperature conditions of the addition of a vapour barrier and an outer cladding on timber frame walls was studied. The report contains comprehensive appendices documenting the full-scale tests. The tests were performed as a part of the project 'Model for Multidimensional Heat......, Air and Moisture Conditions in Building Envelope Components' carried out as a co-project between DTU Byg and SBi....

  3. Chronic Conditions Dashboard

    Data.gov (United States)

    U.S. Department of Health & Human Services — The CMS Chronic Conditions Dashboard presents statistical views of information on the prevalence, utilization and Medicare spending for Medicare beneficiaries with...

  4. Chronic Conditions PUF

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Chronic Conditions PUFs are aggregated files in which each record is a profile or cell defined by the characteristics of Medicare beneficiaries. A profile is...

  5. Conditioning Probabilistic Databases

    CERN Document Server

    Koch, Christoph

    2008-01-01

    Past research on probabilistic databases has studied the problem of answering queries on a static database. Application scenarios of probabilistic databases however often involve the conditioning of a database using additional information in the form of new evidence. The conditioning problem is thus to transform a probabilistic database of priors into a posterior probabilistic database which is materialized for subsequent query processing or further refinement. It turns out that the conditioning problem is closely related to the problem of computing exact tuple confidence values. It is known that exact confidence computation is an NP-hard problem. This has lead researchers to consider approximation techniques for confidence computation. However, neither conditioning nor exact confidence computation can be solved using such techniques. In this paper we present efficient techniques for both problems. We study several problem decomposition methods and heuristics that are based on the most successful search techn...

  6. Common Conditions in Newborns

    Science.gov (United States)

    ... Prenatal Baby Bathing & Skin Care Breastfeeding Crying & Colic Diapers & Clothing Feeding & Nutrition Preemie Sleep Teething & Tooth Care Toddler Preschool Gradeschool Teen Young Adult Healthy Children > Ages & Stages > Baby > Common Conditions in ...

  7. Chronic Conditions Chartbook

    Data.gov (United States)

    U.S. Department of Health & Human Services — Chronic Conditions among Medicare Beneficiaries is a chartbook prepared by the Centers for Medicare and Medicaid Services and created to provide an overview of...

  8. Climatic Conditions in Classrooms.

    Science.gov (United States)

    Kevan, Simon M.; Howes, John D.

    1980-01-01

    Presents an overview of research on the ways in which classroom thermal environment, lighting conditions, ion state, and electromagnetic and air pollution affect learning and the performance of students and teachers. (SJL)

  9. Lung Diseases and Conditions

    Science.gov (United States)

    ... Share this page from the NHLBI on Twitter. Lung Diseases and Conditions Breathing is a complex process. If ... lead to a disease called COPD (chronic obstructive pulmonary disease). COPD prevents proper airflow in and out of ...

  10. Chronic Condition Data Warehouse

    Data.gov (United States)

    U.S. Department of Health & Human Services — The CMS Chronic Condition Data Warehouse (CCW) provides researchers with Medicare and Medicaid beneficiary, claims, and assessment data linked by beneficiary across...

  11. Conditional data watchpoint management

    Science.gov (United States)

    Burdick, Dean Joseph; Vaidyanathan, Basu

    2010-08-24

    A method, system and computer program product for managing a conditional data watchpoint in a set of instructions being traced is shown in accordance with illustrative embodiments. In one particular embodiment, the method comprises initializing a conditional data watchpoint and determining the watchpoint has been encountered. Upon that determination, examining a current instruction context associated with the encountered watchpoint prior to completion of the current instruction execution, further determining a first action responsive to a positive context examination; otherwise, determining a second action.

  12. Reasoning with conditionals

    OpenAIRE

    Politzer, Guy

    2007-01-01

    This paper reviews the psychological investigation of reasoning with conditionals, putting an emphasis on recent work. In the first part, a few methodological remarks are presented. In the second part, the main theories of deductive reasoning (mental rules, mental models, and the probabilistic approach) are considered in turn; their content is summarised and the semantics they assume for if and the way they explain formal conditional reasoning are discussed, in particular in the light of expe...

  13. From context to condition

    DEFF Research Database (Denmark)

    Larsen, Niels Martin; Peder Pedersen, Claus

    Based on studies at Morphogenetic Studio, the article discusses how the term context in relation to generative design techniques can be understood as conditions integrated in both the form development and the production process.......Based on studies at Morphogenetic Studio, the article discusses how the term context in relation to generative design techniques can be understood as conditions integrated in both the form development and the production process....

  14. Conditioning Institutions and Renegotiation

    OpenAIRE

    Ramey, Garey; Watson, Joel

    2000-01-01

    We propose a theory of contracting in long-term relationships, emphasizing the role of social institutions in conditioning players' joint selection of Equilibria. Players adopt a social conditioning system in order to place boundaries on their recurrent negotiation and thereby sustain a desirable joint selection of equilibrium. Social conventions have value because players cannot freely reinterpret the labels attached to histories, in contrast to labels that the players might assign internall...

  15. Conditioning Institutions and Renegotiation

    OpenAIRE

    Ramey, Garey; Watson, Joel

    2000-01-01

    We propose a theory of contracting in long-term relationships, emphasizing the role of social institutions in conditioning players' joint selection of equilibria. Players adopt a social conditioning system in order to place boundaries on their recurrent negotiation and thereby sustain a desirable joint selection of equilibrium. Social conventions have value because players cannot freely reinterpret the labels attached to histories, in contrast to labels that the players might assign internall...

  16. Choice and conditioned reinforcement.

    OpenAIRE

    Fantino, E; Freed, D; Preston, R. A.; Williams, W A

    1991-01-01

    A potential weakness of one formulation of delay-reduction theory is its failure to include a term for rate of conditioned reinforcement, that is, the rate at which the terminal-link stimuli occur in concurrent-chains schedules. The present studies assessed whether or not rate of conditioned reinforcement has an independent effect upon choice. Pigeons responded on either modified concurrent-chains schedules or on comparable concurrent-tandem schedules. The initial link was shortened on only o...

  17. Chemical conditioning of sludge

    Energy Technology Data Exchange (ETDEWEB)

    Novak, John T.; Park, Chul

    2003-07-01

    With all the advances made in understanding the structure and composition of sewage sludges, chemical conditioning remains a trial and error process, both with regard to the type and dose of conditioner needed. Recent studies at Virginia Tech have found that biological floc consists of two types of biopolymer, material associated with iron and aluminum and material associated with calcium and magnesium. These materials behave differently when sludges undergo digestion. This results in very different material being released into solution during digestion and very different conditioning requirements. This study shows that the primary materials released during anaerobic digestion are proteins and coagulation of the colloidal protein fraction in solution is the primary mechanism for conditioning. For aerobically digested sludges, both proteins and polysaccharides make up the colloid fraction that interferes with dewatering. This research also shows that the effectiveness of the digestion process as characterized by volatile solids destruction is directly related to the chemical dose required for conditioning. That is, as the solids destruction increases, the conditioning chemical requirement also increases. Well-digested sludges dewater more poorly and require more conditioning chemical that those with less volatile solids destruction. (author)

  18. Chemical conditioning of sludge.

    Science.gov (United States)

    Novak, J T; Park, C

    2004-01-01

    With all the advances made in understanding the structure and composition of sewage sludges, chemical conditioning remains a trial and error process, both with regard to the type and dose of conditioner needed. Recent studies at Virginia Tech have found that biological floc consists of two types of biopolymer, material associated with iron and aluminium and material associated with calcium and magnesium. These materials behave differently when sludges undergo digestion. This results in very different material being released into solution during digestion and very different conditioning requirements. This study shows that the primary materials released during anaerobic digestion are proteins and coagulation of the colloidal protein fraction in solution is the primary mechanism for conditioning. For aerobically digested sludges, both proteins and polysaccharides make up the colloid fraction, which interferes with dewatering. This research also shows that the effectiveness of the digestion process as characterized by volatile solids destruction is directly related to the chemical dose required for conditioning. That is, as the solids destruction increases, the conditioning chemical requirement also increases. Well digested sludges dewater more poorly and require more conditioning chemical than those with less volatile solids destruction. PMID:15259940

  19. LHCb distributed conditions database

    International Nuclear Information System (INIS)

    The LHCb Conditions Database project provides the necessary tools to handle non-event time-varying data. The main users of conditions are reconstruction and analysis processes, which are running on the Grid. To allow efficient access to the data, we need to use a synchronized replica of the content of the database located at the same site as the event data file, i.e. the LHCb Tier1. The replica to be accessed is selected from information stored on LFC (LCG File Catalog) and managed with the interface provided by the LCG developed library CORAL. The plan to limit the submission of jobs to those sites where the required conditions are available will also be presented. LHCb applications are using the Conditions Database framework on a production basis since March 2007. We have been able to collect statistics on the performance and effectiveness of both the LCG library COOL (the library providing conditions handling functionalities) and the distribution framework itself. Stress tests on the CNAF hosted replica of the Conditions Database have been performed and the results will be summarized here

  20. LHCb distributed conditions database

    Science.gov (United States)

    Clemencic, M.

    2008-07-01

    The LHCb Conditions Database project provides the necessary tools to handle non-event time-varying data. The main users of conditions are reconstruction and analysis processes, which are running on the Grid. To allow efficient access to the data, we need to use a synchronized replica of the content of the database located at the same site as the event data file, i.e. the LHCb Tier1. The replica to be accessed is selected from information stored on LFC (LCG File Catalog) and managed with the interface provided by the LCG developed library CORAL. The plan to limit the submission of jobs to those sites where the required conditions are available will also be presented. LHCb applications are using the Conditions Database framework on a production basis since March 2007. We have been able to collect statistics on the performance and effectiveness of both the LCG library COOL (the library providing conditions handling functionalities) and the distribution framework itself. Stress tests on the CNAF hosted replica of the Conditions Database have been performed and the results will be summarized here.

  1. LHCb Distributed Conditions Database

    CERN Document Server

    Clemencic, Marco

    2007-01-01

    The LHCb Conditions Database project provides the necessary tools to handle non-event time-varying data. The main users of conditions are reconstruction and analysis processes, which are running on the Grid. To allow efficient access to the data, we need to use a synchronized replica of the content of the database located at the same site as the event data file, i.e. the LHCb Tier1. The replica to be accessed is selected from information stored on LFC (LCG File Catalog) and managed with the interface provided by the LCG developed library CORAL. The plan to limit the submission of jobs to those sites where the required conditions are available will also be presented. LHCb applications are using the Conditions Database framework on a production basis since March 2007. We have been able to collect statistics on the performance and effectiveness of both the LCB library COOL (the library providing conditions handling functionalities) and the distribution framework itself. Stress tests on the CNAF hosted replica o...

  2. Conditional Aid Effectiveness

    DEFF Research Database (Denmark)

    Doucouliagos, Hristos; Paldam, Martin

    The AEL (aid effectiveness literature) studies the effect of development aid using econometrics on macro data. It contains about 100 papers of which a third analyzes conditional models where aid effectiveness depends upon z, so that aid only works for a certain range of the variable. The key term...... in this family of AEL models is thus an interaction term of z times aid. The leading candidates for z are a good policy index and aid itself. In this paper, meta-analysis techniques are used (i) to determine whether the AEL has established the said interaction terms, and (ii) to identify some of the...... determinants of the differences in results between studies. Taking all available studies in consideration, we find no support for conditionality with respect to policy, while conditionality regarding aid itself is dubious. However, the results differ depending on the authors’ institutional affiliation....

  3. Conditioning experiences and phobias.

    Science.gov (United States)

    Merckelbach, H; de Ruiter, C; van den Hout, M A; Hoekstra, R

    1989-01-01

    A retrospective study was conducted to examine the extent to which phobias are associated with a conditioning pathway to fear. The Phobic Origin Questionnaire (Ost and Hugdahl, Behav. Res. Ther. 19, 439-477, 1981) was administered to a sample of 91 phobic outpatients (patients with panic disorder with agoraphobia, social phobics, simple phobics). Results show clearly that conditioning experiences occur more frequently than either vicarious or informational, learning experiences, which confirms the findings previously reported by Rimm, Janda, Lancaster, Nahl and Dittmar (Behav. Res. Ther. 15, 231-238, 1977) and by Ost and Hugdahl (1981; Behav. Res. Ther. 21, 623-631, 1983). Yet, conditioning experiences consist mainly of panic attacks in confirmed environments. The findings also suggest that a considerable number of phobias are based on a combination of different pathways to fear. PMID:2610660

  4. Stochastic conditional intensity processes

    DEFF Research Database (Denmark)

    Bauwens, Luc; Hautsch, Nikolaus

    2006-01-01

    model allows for a wide range of (cross-)autocorrelation structures in multivariate point processes. The model is estimated by simulated maximum likelihood (SML) using the efficient importance sampling (EIS) technique. By modeling price intensities based on NYSE trading, we provide significant evidence......In this article, we introduce the so-called stochastic conditional intensity (SCI) model by extending Russell’s (1999) autoregressive conditional intensity (ACI) model by a latent common dynamic factor that jointly drives the individual intensity components. We show by simulations that the proposed...... for a joint latent factor and show that its inclusion allows for an improved and more parsimonious specification of the multivariate intensity process...

  5. Electronic signal conditioning

    CERN Document Server

    NEWBY, BRUCE

    1994-01-01

    At technician level, brief references to signal conditioning crop up in a fragmented way in various textbooks, but there has been no single textbook, until now!More advanced texts do exist but they are more mathematical and presuppose a higher level of understanding of electronics and statistics. Electronic Signal Conditioning is designed for HNC/D students and City & Guilds Electronics Servicing 2240 Parts 2 & 3. It will also be useful for BTEC National, Advanced GNVQ, A-level electronics and introductory courses at degree level.

  6. On Quantum Conditional Probability

    Directory of Open Access Journals (Sweden)

    Isabel Guerra Bobo

    2013-02-01

    Full Text Available We argue that quantum theory does not allow for a generalization of the notion of classical conditional probability by showing that the probability defined by the Lüders rule, standardly interpreted in the literature as the quantum-mechanical conditionalization rule, cannot be interpreted as such.

  7. PERIODONTAL CONDITIONS IN EUROPE

    NARCIS (Netherlands)

    PILOT, T; MIYAZAKI, H

    1991-01-01

    The aim of the present overview is to evaluate the periodontal conditions in European populations. Study was made of a number of extensive surveys of periodontal diseases carried out in a number of European countries, primarily North West Europe. These surveys often provide considerable detail. Howe

  8. Operant Conditioning - Token Economy.

    Science.gov (United States)

    Montgomery, Jacqueline; McBurney, Raymond D.

    Described is an Operant Conditioning-Token Economy Program, teaching patients to be responsible for their own behavior, to make choices, and to be motivated to change. The program was instigated with mentally ill patients in a state hospital and was later used with institutionalized mentally handicapped groups. After two years, only four of the…

  9. Condition for tripartite entanglement

    International Nuclear Information System (INIS)

    We propose a scheme for classifying the entanglement of a tripartite pure qubit state. This classification scheme consists of an ordered list of seven elements. These elements are the Cayley hyper-determinant, and its six associated 2 × 2 subdeterminants. In particular we show that this classification provides a necessary and sufficient condition for separability.

  10. Lossless conditional schema evolution

    DEFF Research Database (Denmark)

    Jensen, Ole Guttorm; Böhlen, Michael

    2004-01-01

    DBMS that supports schema evolution. We propose to keep track of schema mismatches at the level of individual tuples, and prove that evolving schemas with conditional schema changes, in contrast to database systems relying on data migration, are lossless when the schema evolves. The lossless property...

  11. Genetics Home Reference: Genetic Conditions

    Science.gov (United States)

    Skip to main content Your Guide to Understanding Genetic Conditions Enable Javascript for addthis links to activate. ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions Health Conditions Explore the signs ...

  12. Biomechanical conditions of walking

    CERN Document Server

    Fan, Y F; Luo, L P; Li, Z Y; Han, S Y; Lv, C S; Zhang, B

    2015-01-01

    The development of rehabilitation training program for lower limb injury does not usually include gait pattern design. This paper introduced a gait pattern design by using equations (conditions of walking). Following the requirements of reducing force to the injured side to avoid further injury, we developed a lower limb gait pattern to shorten the stride length so as to reduce walking speed, to delay the stance phase of the uninjured side and to reduce step length of the uninjured side. This gait pattern was then verified by the practice of a rehabilitation training of an Achilles tendon rupture patient, whose two-year rehabilitation training (with 24 tests) has proven that this pattern worked as intended. This indicates that rehabilitation training program for lower limb injury can rest on biomechanical conditions of walking based on experimental evidence.

  13. Persistent facial pain conditions

    DEFF Research Database (Denmark)

    Forssell, Heli; Alstergren, Per; Bakke, Merete;

    2016-01-01

    Persistent facial pains, especially temporomandibular disorders (TMD), are common conditions. As dentists are responsible for the treatment of most of these disorders, up-to date knowledge on the latest advances in the field is essential for successful diagnosis and management. The review covers...... TMD, and different neuropathic or putative neuropathic facial pains such as persistent idiopathic facial pain and atypical odontalgia, trigeminal neuralgia and painful posttraumatic trigeminal neuropathy. The article presents an overview of TMD pain as a biopsychosocial condition, its prevalence......, clinical features, consequences, central and peripheral mechanisms, diagnostic criteria (DC/TMD), and principles of management. For each of the neuropathic facial pain entities, the definitions, prevalence, clinical features, and diagnostics are described. The current understanding of the pathophysiology...

  14. On conditional decomposability

    Czech Academy of Sciences Publication Activity Database

    Komenda, Jan; Masopust, Tomáš; van Schuppen, J. H.

    2012-01-01

    Roč. 61, č. 12 (2012), s. 1260-1268. ISSN 0167-6911 R&D Projects: GA ČR(CZ) GPP202/11/P028; GA ČR(CZ) GAP103/11/0517 Institutional support: RVO:67985840 Keywords : discrete-event system * coordination control * conditional decomposability Subject RIV: BA - General Mathematics Impact factor: 1.667, year: 2012 http://www.sciencedirect.com/science/article/pii/S0167691112001612

  15. Conditions for European Solidarity

    OpenAIRE

    Böckenförde, Ernst-Wolfgang

    2013-01-01

    I To answer the question as to what are the conditions for European solidarity, we first need to clarify and understand what is meant by solidarity and what it involves. a) In general, solidarity means first of all a certain attachment among people and reliance upon one another, because human beings cannot lead meaningful lives alone. That is the empirical aspect. Related to this, solidarity signifies at the same time a form of assuming responsibility for one another, associated with positive...

  16. Fuel gas conditioning process

    Science.gov (United States)

    Lokhandwala, Kaaeid A.

    2000-01-01

    A process for conditioning natural gas containing C.sub.3+ hydrocarbons and/or acid gas, so that it can be used as combustion fuel to run gas-powered equipment, including compressors, in the gas field or the gas processing plant. Compared with prior art processes, the invention creates lesser quantities of low-pressure gas per unit volume of fuel gas produced. Optionally, the process can also produce an NGL product.

  17. High voltage pulse conditioning

    Science.gov (United States)

    Springfield, Ray M.; Wheat, Jr., Robert M.

    1990-01-01

    Apparatus for conditioning high voltage pulses from particle accelerators in order to shorten the rise times of the pulses. Flashover switches in the cathode stalk of the transmission line hold off conduction for a determinable period of time, reflecting the early portion of the pulses. Diodes upstream of the switches divert energy into the magnetic and electrostatic storage of the capacitance and inductance inherent to the transmission line until the switches close.

  18. Cumulative Conditional Expectation Index

    OpenAIRE

    Fernández, M; González-López, V. A.

    2015-01-01

    In this paper we study the cumulative conditional expectation function (CCEF) in the copula context. It is shown how to compute CCEF in terms of the cumulative copula function, this natural representation allows to deduce some useful properties, for instance with applications to convex combination of copulas. We introduce approximations of CCEF based on Bernstein polynomial copulas. We introduce estimators for CCEF, which were constructed through Bernstein polynomial estimators for copulas. T...

  19. Taxation and Conditional Taxation

    OpenAIRE

    Frey, Bruno S.; Benno Torgler

    2004-01-01

    Why so many people pay their taxes, although fines and audit probability are low, has become a central question in the tax compliance literature. Concepts of Homo Economicus, endowed with a more refined motivation structure, help to shed light on the tax compliance puzzle. This paper provides empirical evidence for the relevance of conditional cooperation, using survey data from 30 European countries. The findings suggest that a higher perceived tax evasion leads to a lower tax morale, also w...

  20. Do Conditional Reinforcers Count?

    OpenAIRE

    Davison, Michael; Baum, William M.

    2006-01-01

    Six pigeons were trained on a procedure in which seven components arranged different food-delivery ratios on concurrent variable-interval schedules each session. The components were unsignaled, lasted for 10 food deliveries, and occurred in random order with a 60-s blackout between components. The schedules were arranged using a switching-key procedure in which two responses on a center key changed the schedules and associated stimuli on two side keys. In Experiment 1, over five conditions, a...

  1. Diagnostics in critical conditions

    OpenAIRE

    SadchikovD.V.; PrigorodovM.V.; IvanovR.V.

    2011-01-01

    The purpose of research: improvement of quality of diagnostics at the patients in a critical condition in intensive care unit. Material and methods. In total have analyzed 1957 medical cards of the patients who have died in ICU»s. At the first stage studied the factors influencing on diagnostics of critically ill patients (medical cards of 1557 patients); at the second stage investigated influence of the diagnostic standards in ICU»s practice on improvement of quality of diag- nostics of crit...

  2. Pathologic conditions in pregnancy

    International Nuclear Information System (INIS)

    Soma authors suggested that MR imaging could rapresent an effective diagnostic alternative in the study of pathologic conditions of mother and fetus during pregnancy. To verify the actual role of MR imaging, we examined 20 patients in the 2nd and 3rd trimester of gestation, after a preliminary US examination. Fifteen patients presented fetal or placental pathologies; in 4 patients the onset of the pathologic condition occurred during pregnancy; in 1 case of US diagnosis of fetal ascites, MR findings were nornal and the newborn was healty. As for placental pathologies, our series included a case of placental cyst, two hematomas between placenta and uterine wall, and two cases of partial placenta previa. As for fetal malformation, we evaluated a case of omphalocele, one of Prune-Belly syndrome, a case of femoral asimmetry, one of thanatophoric dwarfism, a case of thoracopagus twins with cardiovascular abnormalities, two fetal hydrocephali, and three cases of pyelo-ureteral stenosis. As for maternal pathologies during pregnancy, we observed a case of subserous uterine fibromyoma, one of of right hydronephrosis, one of protrusion of lumbar invertebral disk, and a large ovarian cyst. In our experience, MR imaging exhibited high sensitivity and a large field of view, which were both useful in the investigation of the different conditions occurring during pregnancy. In the evaluation of fetal and placental abnormalities, especially during the 3rd trimester, the diagnostic yieldof MR imaging suggested it as a complementary technique to US for the evaluation of fetal malformation and of intrauterine growth retardation

  3. Advanced scale conditioning agents

    International Nuclear Information System (INIS)

    A technical description of Advanced Scale Conditioning Agents (ASCA) technology was published in the May-June 2003 edition of the Nuclear Plant Journal. That article described the development of programs of advanced scale conditioning agents and specific types to maintain the secondary side of steam generators within a pressurized water reactor free of deposited corrosion products and corrosion-inducing contaminants to ensure their long-term operation. This article describes the first two plant applications of advanced scale conditioning agents implemented at Southern Nuclear Operating Company's Vogtle Units 1 and 2 during their 2002 scheduled outages to minimize tube degradation and maintain full power operation using the most effective techniques while minimizing outage costs. The goal was to remove three to four fuel cycles of deposits from each steam generator so that after future chemical cleaning activities, ASCAs could be used to maintain the cleanliness of the steam generators without the need for additional chemical cleaning efforts. The goal was achieved as well as several other benefits that resulted in cost savings to the plant

  4. Conditions simulating androgenetic alopecia.

    Science.gov (United States)

    Rossi, A; Iorio, A; Di Nunno, D; Priolo, L; Fortuna, M C; Garelli, V; Carlesimo, M; Calvieri, S; Mari, E

    2015-07-01

    Androgenetic alopecia is a common form of hair loss, characterized by a progressive hair follicular miniaturization, caused by androgen hormones on a genetically susceptible hair follicle, in androgenic-dependent areas. Characteristic phenotype of androgenetic alopecia is also observed in many other hair disorders. These disorders are androgenetic-like diseases that cause many differential diagnosis or therapeutic error problems. The objective of this review was to systematically analyse the greatest number of conditions that mimic the AGA pattern and explain their disease pathogenesis. PMID:25571781

  5. Complementarity and Stability Conditions

    CERN Document Server

    Georgi, Howard

    2016-01-01

    We discuss the issue of complementarity between the confining phase and the Higgs phase for gauge theories in which there are no light particles below the scale of confinement or spontaneous symmetry breaking. We show with a number of examples that even though the low energy effective theories are the same (and trivial), we can sometimes argue that the two phases have different heavy stable particles and thus cannot be complementary. We suggest that such "stability conditions" can be a useful physical check for complementarity.

  6. MRI of vaginal conditions

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, C. [Department of Radiology, Birmingham Women' s Hospital, Birmingham (United Kingdom)]. E-mail: carolina.lopez@bwhct.nhs.uk; Balogun, M. [Department of Radiology, Birmingham Women' s Hospital, Birmingham (United Kingdom); Ganesan, R. [Department of Histopathology, Birmingham Women' s Hospital, Birmingham (United Kingdom); Olliff, J.F. [University Hospital Birmingham, Birmingham (United Kingdom)

    2005-06-01

    Magnetic resonance imaging (MRI) has become an important part of the assessment of suspected vaginal pathology. This pictorial review demonstrates the MRI features and some of the histopathological findings of a variety of vaginal conditions. These may be congenital (total vaginal agenesis, partial vaginal agenesis, longitudinal vaginal septum, transverse vaginal septum), benign (Bartholin's cyst, diffuse vaginal inflammation, invasive endometriosis, ureterovaginal fistula, post-surgical appearances with the formation of a neovagina and adhesions) or malignant, usually due to extension or recurrence from another pelvic malignancy. In this paper, examples of the above are described and illustrated together with examples of the much rarer primary vaginal malignancies.

  7. Learning conditional Gaussian networks

    DEFF Research Database (Denmark)

    Bøttcher, Susanne Gammelgaard

    This paper considers conditional Gaussian networks. The parameters in the network are learned by using conjugate Bayesian analysis. As conjugate local priors, we apply the Dirichlet distribution for discrete variables and the Gaussian-inverse gamma distribution for continuous variables, given...... a configuration of the discrete parents. We assume parameter independence and complete data. Further, to learn the structure of the network, the network score is deduced. We then develop a local master prior procedure, for deriving parameter priors in these networks. This procedure satisfies parameter...

  8. Mining Conditional Phosphorylation Motifs.

    Science.gov (United States)

    Liu, Xiaoqing; Wu, Jun; Gong, Haipeng; Deng, Shengchun; He, Zengyou

    2014-01-01

    Phosphorylation motifs represent position-specific amino acid patterns around the phosphorylation sites in the set of phosphopeptides. Several algorithms have been proposed to uncover phosphorylation motifs, whereas the problem of efficiently discovering a set of significant motifs with sufficiently high coverage and non-redundancy still remains unsolved. Here we present a novel notion called conditional phosphorylation motifs. Through this new concept, the motifs whose over-expressiveness mainly benefits from its constituting parts can be filtered out effectively. To discover conditional phosphorylation motifs, we propose an algorithm called C-Motif for a non-redundant identification of significant phosphorylation motifs. C-Motif is implemented under the Apriori framework, and it tests the statistical significance together with the frequency of candidate motifs in a single stage. Experiments demonstrate that C-Motif outperforms some current algorithms such as MMFPh and Motif-All in terms of coverage and non-redundancy of the results and efficiency of the execution. The source code of C-Motif is available at: https://sourceforge. net/projects/cmotif/. PMID:26356863

  9. Conditional Epistemic Planning

    DEFF Research Database (Denmark)

    Andersen, Mikkel Birkegaard; Bolander, Thomas; Jensen, Martin Holm

    2012-01-01

    Recent work has shown that Dynamic Epistemic Logic (DEL) offers a solid foundation for automated planning under partial observability and non-determinism. Under such circumstances, a plan must branch if it is to guarantee achieving the goal under all contingencies (strong planning). Without...... branching, plans can offer only the possibility of achieving the goal (weak planning). We show how to formulate planning in uncertain domains using DEL and give a language of conditional plans. Translating this language to standard DEL gives verification of both strong and weak plans via model checking. In...... addition to plan verification, we provide a tableau-inspired algorithm for synthesising plans, and show this algorithm to be terminating, sound and complete....

  10. Conditional sterility in plants

    Science.gov (United States)

    Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung

    2010-02-23

    The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.

  11. Initial Cladding Condition

    International Nuclear Information System (INIS)

    The purpose of this analysis is to describe the condition of commercial Zircaloy clad fuel as it is received at the Yucca Mountain Project (YMP) site. Most commercial nuclear fuel is encased in Zircaloy cladding. This analysis is developed to describe cladding degradation from the expected failure modes. This includes reactor operation impacts including incipient failures, potential degradation after reactor operation during spent fuel storage in pool and dry storage and impacts due to transportation. Degradation modes include cladding creep, and delayed hydride cracking during dry storage and transportation. Mechanical stresses from fuel handling and transportation vibrations are also included. This Analysis and Model Report (AMR) does not address any potential damage to assemblies that might occur at the YMP surface facilities. Ranges and uncertainties have been defined. This analysis will be the initial boundary condition for the analysis of cladding degradation inside the repository. In accordance with AP-2.13Q, ''Technical Product Development Planning'', a work plan (CRWMS M andO 2000c) was developed, issued, and utilized in the preparation of this document. There are constraints, caveats and limitations to this analysis. This cladding degradation analysis is based on commercial Pressurized Water Reactor (PWR) fuel with Zircaloy cladding but is applicable to Boiling Water Reactor (BWR) fuel. Reactor operating experience for both PWRs and BWRs is used to establish fuel reliability from reactor operation. It is limited to fuel exposed to normal operation and anticipated operational occurrences (i.e. events which are anticipated to occur within a reactor lifetime), and not to fuel that has been exposed to severe accidents. Fuel burnup projections have been limited to the current commercial reactor licensing environment with restrictions on fuel enrichment, oxide coating thickness and rod plenum pressures. The information provided in this analysis will be used in

  12. Magnetic conditioning in superfluid

    Energy Technology Data Exchange (ETDEWEB)

    Caspi, S.

    1988-08-01

    Improvements in superconducting magnet technology have reduced to a handful the number of training quenches typical of dipole magnets. The number of training quenches in long (17 m) and short (1--2 m) SSC magnets are now about the same (operating at 6.6 tesla and 4.4 K). Yet the steps necessary to totally eliminate training are in the future RandD plans for magnet construction and conductor motion prevention. The accepted hypothesis is that Lorentz forces and poor mechanical properties of superconducting cables are the cause of conductor motion. Conductor motion reduces the stored energy in the cable by converting it into heat. The small amount of heat generated (millijoules) during motion is usually enough to quench the magnet when it is close to short sample. During training, the magnet performance normally improves with the number of quenches. It is not the quench itself that improves magnet performance but rather the fact that once conductor motion has occurred it will probably not repeat itself unless subjected to higher forces. Conditioning is a process that enables the magnet to reduce its stored energy without causing a premature quench. During the conditioning process the magnet is further cooled from its operating temperature of 4.4 K to 1.8 K by converting He I into He II. As a result the magnet is placed in a state where it has excess stability as well as excellent heat transfer capabilities. Although this does not eliminate motion, if the magnet is now cycled to /approximately/10% above its operating field at 4.4 K (which is above short sample) the excess stability should be enough to prevent quenching and reduce the probability of conductor motion and training once the magnet has been warmed back up to its operating temperature of 4.4 K. 3 refs., 5 figs.

  13. Initial Cladding Condition

    Energy Technology Data Exchange (ETDEWEB)

    E. Siegmann

    2000-08-22

    The purpose of this analysis is to describe the condition of commercial Zircaloy clad fuel as it is received at the Yucca Mountain Project (YMP) site. Most commercial nuclear fuel is encased in Zircaloy cladding. This analysis is developed to describe cladding degradation from the expected failure modes. This includes reactor operation impacts including incipient failures, potential degradation after reactor operation during spent fuel storage in pool and dry storage and impacts due to transportation. Degradation modes include cladding creep, and delayed hydride cracking during dry storage and transportation. Mechanical stresses from fuel handling and transportation vibrations are also included. This Analysis and Model Report (AMR) does not address any potential damage to assemblies that might occur at the YMP surface facilities. Ranges and uncertainties have been defined. This analysis will be the initial boundary condition for the analysis of cladding degradation inside the repository. In accordance with AP-2.13Q, ''Technical Product Development Planning'', a work plan (CRWMS M&O 2000c) was developed, issued, and utilized in the preparation of this document. There are constraints, caveats and limitations to this analysis. This cladding degradation analysis is based on commercial Pressurized Water Reactor (PWR) fuel with Zircaloy cladding but is applicable to Boiling Water Reactor (BWR) fuel. Reactor operating experience for both PWRs and BWRs is used to establish fuel reliability from reactor operation. It is limited to fuel exposed to normal operation and anticipated operational occurrences (i.e. events which are anticipated to occur within a reactor lifetime), and not to fuel that has been exposed to severe accidents. Fuel burnup projections have been limited to the current commercial reactor licensing environment with restrictions on fuel enrichment, oxide coating thickness and rod plenum pressures. The information provided in this analysis

  14. Laboratory and field studies on BTEX biodegradation in a fuel-contaminated aquifer under denitrifying conditions. Book chapter, May 88-Dec 92

    International Nuclear Information System (INIS)

    Leaking underground storage tanks are a major source of groundwater contamination by petroleum hydrocarbons. Of the approximately 1.4 million underground tanks storing gasoline in the United States, some petroleum experts estimate that 75,000 to 100,000 are leaking (Feliciano 1984). Gasoline and other fuels contain benzene, toluene, ethylbenzene, and xylenes (collectively known as BTEX), which are hazardous compounds regulated by the U.S. Environmental Protection Agency (EPA 1977). Laboratory studies were conducted in conjunction with a field demonstration project on nitrate-mediated biorestoration of a fuel-contaminated aquifer at a U.S. Coast Guard facility in Traverse City, MI. Microcosms were prepared under either aerobic or strictly anaerobic, denitrifying conditions using core samples aseptically obtained from the aquifer. The microcosms were spiked with aromatic hydrocarbons (BTEX) and incubated as 12 C. Virtually all of the aromatic hydrocarbons, including benzene, were degraded to below detection limits within seven days under aerobic conditions, although o-xylene was somewhat more recalcitrant. Under denitrifying conditions, toluene, ethylbenzene, m-xylene, and 1,2,4-trimethylbenzene were also degraded to below detection limits, although this occurred between two to three weeks. o-Xylene was only slowly degraded and benzene was recalcitrant under denitrifying conditions. In the field demonstration project, an infiltration gallery was used to recirculate water at a rate sufficient to create a water table mound encompassing the contaminated interval. After hydraulic equilbrium was achieved nitrate and nutrients were added to the recharge water. Benzene removal occurred before nitrate addition; mass balances indicated that sufficient oxygen was recirculated to account for complete biodegradation aerobically

  15. Supersymmetry from boundary conditions

    International Nuclear Information System (INIS)

    We study breaking and restoration of supersymmetry in five-dimensional theories by determining the mass spectrum of fermions from their equations of motion. Boundary conditions can be obtained from either the action principle by extremizing an appropriate boundary action (interval approach) or by assigning parities to the fields (orbifold approach). In the former, fields extend continuously from the bulk to the boundaries, while in the latter the presence of brane mass-terms cause fields to jump when one moves across the branes. We compare the two approaches and in particular we carefully compute the non-trivial jump profiles of the wavefunctions in the orbifold picture for very general brane mass terms. We also include the effect of the Scherk-Schwarz mechanism in either approach and point out that for a suitable tuning of the boundary actions supersymmetry is present for arbitrary values of the Scherk-Schwarz parameter. As an application of the interval formalism we construct bulk and boundary actions for super-Yang-Mills theory. Finally we extend our results to the warped Randall-Sundrum background

  16. Diagnostics in critical conditions

    Directory of Open Access Journals (Sweden)

    SadchikovD.V.

    2011-09-01

    Full Text Available The purpose of research: improvement of quality of diagnostics at the patients in a critical condition in intensive care unit. Material and methods. In total have analyzed 1957 medical cards of the patients who have died in ICU»s. At the first stage studied the factors influencing on diagnostics of critically ill patients (medical cards of 1557 patients; at the second stage investigated influence of the diagnostic standards in ICU»s practice on improvement of quality of diag- nostics of critically ill patients (400 medical cards of the patients who have died. Entry criterions were standards and algorithm of diagnostics. Techniques of research: average bed-day in groups, first-day lethality, quantity of the carried out laboratory tests and tool methods of research, level of consciousness of the patients (Glasgow come score, severity of disease by ICU»s patients (APACHE II scores. Results. Quality of diagnostics depend on carried out laboratory tests and tool methods of research, level of consciousness of the patients (Glasgow come score, severity of disease by ICU»s patients (APACHE II score. The conclusion. The laboratory tests and tool methods of research conforming to the standards of diagnostics are necessary for improvement of quality of diagnostics, it is necessary to take into account an altered level of consciousness (Glasgow come score and severity of disease by ICU»s patients (APACHE II scores

  17. Universal Signal Conditioning Amplifier

    Science.gov (United States)

    Kinney, Frank

    1997-01-01

    The Technological Research and Development Authority (TRDA) and NASA-KSC entered into a cooperative agreement in March of 1994 to achieve the utilization and commercialization of a technology development for benefiting both the Space Program and U.S. industry on a "dual-use basis". The technology involved in this transfer is a new, unique Universal Conditioning Amplifier (USCA) used in connection with various types of transducers. The project was initiated in partnership with I-Net Corporation, Lockheed Martin Telemetry & Instrumentation (formerly Loral Test and Information Systems) and Brevard Community College. The project consists of designing, miniaturizing, manufacturing, and testing an existing prototype of USCA that was developed for NASA-KSC by the I-Net Corporation. The USCA is a rugged and field-installable self (or remotely)- programmable amplifier that works in combination with a tag random access memory (RAM) attached to various types of transducers. This summary report comprises performance evaluations, TRDA partnership tasks, a project summary, project milestones and results.

  18. Flue gas conditioning today

    Energy Technology Data Exchange (ETDEWEB)

    Southam, B.J.; Coe, E.L. Jr. [Wahlco Engineering International Ltd., Santa Ana, CA (United States)

    1995-12-01

    Many relatively small electrostatic precipitators (ESP`s) exist which collect fly ash at remarkably high efficiencies and have been tested consistently at correspondingly high migration velocities. But the majority of the world`s coal supplies produce ashes which are collected at much lower migration velocities for a given efficiency and therefore require correspondingly large specific collection areas to achieve acceptable results. Early trials of flue gas conditioning (FGC) showed benefits in maximizing ESP performance and minimizing expense which justified continued experimentation. Trials of several dozen ways of doing it wrong eventually developed a set of reliable rules for doing it right. One result is that the use of sulfur trioxide (SO{sub 3}) for adjustment of the resistivity of fly ash from low sulfur coal has been widely applied and has become an automatically accepted part of the option of burning low sulfur coal for compliance with the Clean Air Act of l990 in the U.S.A. Currently, over 100,000 MW of generating capacity is using FGC, and it is estimated that approximately 45,800 MW will utilize coal-switching with FGC for Clean Air Act emission compliance. Guarantees that this equipment will be available to operate at least 98 percent of the time it is called upon are routinely fulfilled.

  19. Assessing the planet's condition.

    Science.gov (United States)

    Brown, L R

    1990-01-01

    The destruction of the environment has accelerated since the Earth Day of 1970, the world's population has increased by another 1.6 billion, and over 500 million acres of forest have been lost. Carbon dioxide levels, greenhouse gases, and chlorofluorocarbons have increased in the atmosphere with evidence that global warming has started. The ozone hole has appeared, acid rain has destroyed forests, air pollution in major northern hemisphere cities has worsened, and species are disappearing, while toxic chemicals have been dumped indiscriminately. World grain production has fallen while population has increased. In Europe 14 countries have stabilized their population, and Japan, France, and Finland are on the way to zero growth. Reduction of high fertility in 1/2 could halt the deterioration of living conditions. Japan and China achieved this within a decade. Energy efficiency has to be attained; US cars still consume too much gas. Solar energy with photovoltaic cells to provide power, fuel alcohol from plants, and solar thermal power plants have potential. Semiarid regions, such as northern Africa, could become major producers of solar energy. Various measures are mandatory to cut down on waste: to recycle paper bags, to use standardized glasses for beverages, and to utilize scrap metal in electric arc steel furnaces. Reforestation is also on the agenda, as major deforestation has occurred in the Brazilian Amazon region, in India, and in Europe because of acid rain. Australia's national plan envisions planting 1 billion trees, and the US project is of similar magnitude during the 1990s. Only the US has succeeded in erosion control and topsoil stabilization when it converted erodible cropland into grassland or woodland during 1986-90. PMID:12285798

  20. The temporal calculus of conditional objects and conditional events

    OpenAIRE

    Tyszkiewicz, Jerzy; Ramer, Arthur; Hoffmann, Achim

    2001-01-01

    We consider the problem of defining conditional objects (a|b), which would allow one to regard the conditional probability Pr(a|b) as a probability of a well-defined event rather than as a shorthand for Pr(ab)/Pr(b). The next issue is to define boolean combinations of conditional objects, and possibly also the operator of further conditioning. These questions have been investigated at least since the times of George Boole, leading to a number of formalisms proposed for conditional objects, mo...

  1. Conditioning, Conditional Independence and Irrelevance in Evidence Theory

    Czech Academy of Sciences Publication Activity Database

    Vejnarová, Jiřina

    Insbruck : SIPTA, 2011 - (Coolen, F.; de Cooman, G.; Fetz, T.; Oberguggenberger, M.), s. 381-390 ISBN 978-3-902652-40-9. [ISIPTA 2011. International Symposium on Imprecise Probability /7./. Innsbruck (AT), 25.07.2011-28.07.2011] R&D Projects: GA ČR GA201/09/1891 Institutional research plan: CEZ:AV0Z10750506 Keywords : Evidence theory * multidimensional models * conditioning rules * conditional independence * conditional irrelevance Subject RIV: BA - General Mathematics http://library.utia.cas.cz/separaty/2012/MTR/vejnarova-conditioning, conditional independence and irrelevance in evidence theory .pdf

  2. 南药巴戟天毛状根诱导条件优化研究%Optimization of Inducement Conditions for Hairy Roots of Morinda officinalis How

    Institute of Scientific and Technical Information of China (English)

    郑传进; 吴小勇; 王志江

    2014-01-01

    为探索巴戟天毛状根的诱导条件,该研究选择不同发根农杆菌ATCC15834、AR10、Msu440菌株诱导巴戟天无菌苗的幼芽、叶片、叶柄、茎段等外植体形成毛状根,并研究了共培养时间和乙酰丁香酮(AS)浓度等因素对巴戟天毛状根转化率的影响。结果表明:巴戟天毛状根的最佳诱导条件为:以幼芽为外植体,ATCC15834为转化菌,侵染时间20 min,并在培养基中添加300μmol/L乙酰丁香酮条件下,巴戟天毛状根的诱导转化率最高,可达36.7%。%To establish the inducement conditions for hairy roots of Morinda officinalis How,A grobacterium rhizogene strains of ATCC15834,AR10,Msu440 were selected to induce the transformation ration of explants of buds,leaf,leafstalk and stem of Morinda officinalis How aseptic seedling into hairy root.The effect of infection time and concentrations of acetosyringone(AS)on the transformation ratio were also studied in this paper.The results showed that the better conditions for inducing hairy roots was as followsyoung buds as explant,infected by strain ATCC15834 for 20 min and then cultured in MS with 300μmol/L acetosyringone,in this conditions,the inducting rate reached 36.7%.

  3. Petroleum investment conditions in Peru

    International Nuclear Information System (INIS)

    This report focuses on the current petroleum investment conditions in Peru, and Peru's hydrocarbon potential. Investment conditions are examined, and political risk, internal security, the economic environment, and the legal framework for investment are considered. (UK)

  4. Unbounded weighted conditional expectation operators

    OpenAIRE

    Estaremi, Yousef

    2014-01-01

    In this note basic properties of unbounded weighted conditional expectation operators are investigated. A description of polar decomposition and quasinormality in this context are provided. Also, we study hyperexpan- sive weighted conditional expectation operators.

  5. Childhood Eye Diseases and Conditions

    Science.gov (United States)

    ... Things College Students Should Do For Their Eyes Childhood Eye Diseases and Conditions Nov. 01, 2013 The ... cataract or eye disorder that needs treatment. Common Childhood Eye Diseases & Conditions When the following diseases are ...

  6. Reconstruction of boundary conditions from internal conditions using viability theory

    KAUST Repository

    Hofleitner, Aude

    2012-06-01

    This article presents a method for reconstructing downstream boundary conditions to a HamiltonJacobi partial differential equation for which initial and upstream boundary conditions are prescribed as piecewise affine functions and an internal condition is prescribed as an affine function. Based on viability theory, we reconstruct the downstream boundary condition such that the solution of the Hamilton-Jacobi equation with the prescribed initial and upstream conditions and reconstructed downstream boundary condition satisfies the internal value condition. This work has important applications for estimation in flow networks with unknown capacity reductions. It is applied to urban traffic, to reconstruct signal timings and temporary capacity reductions at intersections, using Lagrangian sensing such as GPS devices onboard vehicles.

  7. Deductive reasoning from uncertain conditionals

    OpenAIRE

    Politzer, Guy; Bourmaud, Gaëtan

    2002-01-01

    This paper begins with a review of the literature on plausible reasoning with deductive arguments containing a conditional premise. There is concurring evidence that people presented with valid conditional arguments such as Modus Ponens and Modus Tollens generally do not endorse the conclusion, but rather find it uncertain, in case (i) the plausibility of the major conditional premise is debatable, (ii) the major conditional premise is formulated in frequentist or probabilistic terms, or (iii...

  8. Fear Conditioning Increases NREM Sleep

    OpenAIRE

    HELLMAN, Kevin; Abel, Ted

    2007-01-01

    To understand the role that sleep may play in memory storage, the authors investigated how fear conditioning affects sleep–wake states by performing electroencephalographic (EEG) and electromyographic recordings of C57BL/6J mice receiving fear conditioning, exposure to conditioning stimuli, or immediate shock treatment. This experimental design allowed us to examine the effects of associative learning, presentation of the conditioning stimuli, and presentation of the unconditioned stimuli on ...

  9. Conditional and Unconditional Statistical Independence

    OpenAIRE

    Phillips, Peter C. B.

    1987-01-01

    Conditional independence almost everywhere in the space of the conditioning variates does not imply unconditional independence, although it may well imply unconditional independence of certain functions of the variables. An example that is important in linear regression theory is discussed in detail. This involves orthogonal projections on random linear manifolds, which are conditionally independent but not unconditionally independent under normality. Necessary and sufficient conditions are o...

  10. Operant Conditioning for Special Educators.

    Science.gov (United States)

    Pedrini, Bonnie C.; Pedrini, D. T.

    The paper briefly explains operant conditioning as it pertains to special educators. Operant conditioning is thought to be an efficient method for modifying student behavior. Using the B. F. Skinner frame of reference, operant conditioning is said to include behavior modification and therapy, programed instruction, and computer assisted and…

  11. Evaluative conditioning of food technologies

    DEFF Research Database (Denmark)

    Loebnitz, Natascha; Grunert, Klaus G

    2015-01-01

    prevails in a product-related context. Within an evaluative conditioning paradigm including between-subjects control groups in addition to standard within-subjects control conditions, participants were presented with three food technologies (conventional, enzyme, and genetic technology) paired with...... attitudes toward food technologies. The present study tests how evaluative conditioning can affect consumer acceptance of new food technologies. Furthermore, authors investigate whether evaluative conditioning is resistant to extinction after a two-month period and whether the evaluative conditioning effect......Consumer attitudes play an important role in the acceptance of new technologies. The success of food innovations depends on understanding how consumers form and change attitudes toward food technologies. Earlier post hoc explanations suggest that evaluative conditioning can change consumer...

  12. Evolutions of Yang Phase Under Cyclic Condition and Adiabatic Condition

    Institute of Scientific and Technical Information of China (English)

    QIAN Shang-Wu; GU Zhi-Yu

    2005-01-01

    There are three non-integrable phases in literatures: Berry phase, Aharonov-Anandan phase, and Yang phase. This article discusses the evolutions of Yang phase under the cyclic condition and the adiabatic condition for the generaltime-dependent harmonic oscillator, thus reveals the intimate relations between these three non-integrable phases.

  13. Evolutions of Yang Phase Under Cyclic Condition and Adiabatic Condition

    International Nuclear Information System (INIS)

    There are three non-integrable phases in literatures: Berry phase, Aharonov-Anandan phase, and Yang phase. This article discusses the evolutions of Yang phase under the cyclic condition and the adiabatic condition for the general time-dependent harmonic oscillator, thus reveals the intimate relations between these three non-integrable phases.

  14. Extinction in human fear conditioning

    OpenAIRE

    Hermans, Dirk; Craske, Michelle G.; Mineka, Susan; Lovibond, Peter F.

    2006-01-01

    Although most extinction research is conducted in animal laboratories, the study of extinction learning in human fear conditioning has gained increasing attention over the last decade. The most important findings from human fear extinction are reviewed in this article. Specifically, we review experimental investigations of the impact of conditioned inhibitors, conditioned exciters, context renewal, and reinstatement on fear extinction in human samples. We discuss data from laboratory studies ...

  15. Conditional Eddies in Plasma Turbulence

    DEFF Research Database (Denmark)

    Johnsen, H.; Pécseli, H.L.; Trulsen, J.

    1987-01-01

    Low‐frequency electrostatic turbulence generated by the ion–ion beam instability was investigated experimentally in a double‐plasma device. Real time signals were recorded and examined by a conditional statistical analysis. Conditionally averaged potential distributions reveal the formation and...... propagation of structures with a relatively long lifetime. Various methods for making a conditional analysis are discussed and compared. The results are discussed with reference to ion phase space vortices and clump formation in collisionless plasmas....

  16. Conditional Independence in Uncertainty Theories

    OpenAIRE

    Shenoy, Prakash P.

    2013-01-01

    This paper introduces the notions of independence and conditional independence in valuation-based systems (VBS). VBS is an axiomatic framework capable of representing many different uncertainty calculi. We define independence and conditional independence in terms of factorization of the joint valuation. The definitions of independence and conditional independence in VBS generalize the corresponding definitions in probability theory. Our definitions apply not only to probability theory, but al...

  17. Working memory and fear conditioning

    OpenAIRE

    Carter, Ronald McKell; Hofstötter, Constanze; Tsuchiya, Naotsugu; Koch, Christof

    2003-01-01

    Previous studies of associative learning implicate higher-level cognitive processes in some forms of classical conditioning. An ongoing debate is concerned with the extent to which attention and awareness are necessary for trace but not delay eye-blink conditioning [Clark, R. E. & Squire, L. R. (1998) Science 280, 77-81; Lovibond, P. F. & Shanks, D. (2002) J. Exp. Psychol. Anim. Behav. Processes 28, 38-42]. In trace conditioning, a short interval is interposed between the termination of the c...

  18. Conditioned Reinforcement and Response Strength

    OpenAIRE

    Shahan, Timothy A

    2010-01-01

    Stimuli associated with primary reinforcers appear themselves to acquire the capacity to strengthen behavior. This paper reviews research on the strengthening effects of conditioned reinforcers within the context of contemporary quantitative choice theories and behavioral momentum theory. Based partially on the finding that variations in parameters of conditioned reinforcement appear not to affect response strength as measured by resistance to change, long-standing assertions that conditioned...

  19. Trace Fear Conditioning in Mice

    OpenAIRE

    Lugo, Joaquin N.; Smith, Gregory D; Holley, Andrew J.

    2014-01-01

    In this experiment we present a technique to measure learning and memory. In the trace fear conditioning protocol presented here there are five pairings between a neutral stimulus and an unconditioned stimulus. There is a 20 sec trace period that separates each conditioning trial. On the following day freezing is measured during presentation of the conditioned stimulus (CS) and trace period. On the third day there is an 8 min test to measure contextual memory. The representative results are f...

  20. Scaling of interfacial jump conditions

    International Nuclear Information System (INIS)

    To model the behavior of a nuclear reactor accurately is needed to have balance models that take into account the different phenomena occurring in the reactor. These balances have to be coupled together through boundary conditions. The boundary conditions have been studied and different treatments have been given to the interface. In this paper is a brief description of some of the interfacial jump conditions that have been proposed in recent years. Also, the scaling of an interfacial jump condition is proposed, for coupling the different materials that are in contact within a nuclear reactor. (Author)

  1. FPC conditioning cart at BNL

    International Nuclear Information System (INIS)

    The 703 MHz superconducting gun for the BNL Energy Recovery Linac (ERL) prototype has two fundamental power couplers (FPCs), and each of them will deliver up to 500 kW of CW RF power. In order to prepare the couplers for high power RF service and process multipacting, the FPCs should be conditioned prior to installation into the gun cryomodule. A conditioning cart based test stand, which includes a vacuum pumping system, controllable bake-out system, diagnostics, interlocks and data log system has been designed, constructed and commissioned by collaboration of BNL and AES. This paper presents FPC conditioning cart systems and the conditioning process.

  2. 77 FR 4469 - Dental Conditions

    Science.gov (United States)

    2012-01-30

    ... published in the Federal Register on March 17, 2011 (76 FR 14600), VA proposed to amend 38 CFR 3.381, which... AFFAIRS 38 CFR Part 3 RIN 2900-AN28 Dental Conditions AGENCY: Department of Veterans Affairs. ACTION... amend its adjudication regulations regarding service connection of dental conditions for...

  3. Lp continuity of conditional expectations

    International Nuclear Information System (INIS)

    A necessary and sufficient condition over a sequence {An}n is an element of N of σ-subalgebras that assures Lp-convergence of the conditional expectations will be given. The result generalizes the Lp-martingales, O'Reilly-Fetter and Boylan (equiconvergence) theorems. (author). 5 refs

  4. Conditional entropy of glueball states

    CERN Document Server

    Bernardini, Alex E; da Rocha, Roldao

    2016-01-01

    The conditional entropy of glueball states is calculated using a holographic description. Glueball states are represented by a supergravity dual picture, consisting of a 5-dimensional graviton-dilaton action of a dynamical holographic AdS/QCD model. The conditional entropy is studied as a function of the glueball spin and of the mass, providing information about the stability of the glueball states.

  5. Entanglement conditions and polynomial identities

    International Nuclear Information System (INIS)

    We develop a rather general approach to entanglement characterization based on convexity properties and polynomial identities. This approach is applied to obtain simple and efficient entanglement conditions that work equally well in both discrete as well as continuous-variable environments. Examples of violations of our conditions are presented.

  6. Optimising Extinction of Conditioned Disgust

    NARCIS (Netherlands)

    Bosman, Renske C.; Borg, Charmaine; de Jong, Peter J.

    2016-01-01

    Maladaptive disgust responses are tenacious and resistant to exposure-based interventions. In a similar vein, laboratory studies have shown that conditioned disgust is relatively insensitive to Conditioned Stimulus (CS)-only extinction procedures. The relatively strong resistance to extinction might

  7. Loading Conditions and Longitudinal Strength

    DEFF Research Database (Denmark)

    Sørensen, Herman

    1995-01-01

    Methods for the calculation of the lightweight of the ship.Loading conditions satisfying draught, trim and intact stability requirements and analysis of the corresponding stillwater longitudinal strength.......Methods for the calculation of the lightweight of the ship.Loading conditions satisfying draught, trim and intact stability requirements and analysis of the corresponding stillwater longitudinal strength....

  8. Logic of primary-conditionals and secondary conditionals

    Institute of Scientific and Technical Information of China (English)

    Liu Zhuanghu; Li Xiaowu

    2006-01-01

    Firstly,the authors analyzed the properties of primary-onditionals and secondary-conditionals,establish the minimum system C2Lm of primary-conditionals and secondary-conditionals,and then prove some of the formal theorems of the system which have important intuitive meanings.Secondly,the authors constructed the neighborhood semantics,prove the soundness of C2Lm,introduce a general concept of canonical model by the neighborhood semantics,and then prove the completeness of C2Lm by the canonical model.Finally,according to the technical results of the minimum system C2Lm,the authors discuss some of the important problems concerning primary-conditionals and secondary-onditionals.

  9. Defeasible reasoning with legal conditionals.

    Science.gov (United States)

    Gazzo Castañeda, Lupita Estefania; Knauff, Markus

    2016-04-01

    Valid conclusions can be defeated if people can think of conditions that prevent the consequent to occur although the antecedent is given. The goal of the present research was to investigate how people consider these conditions when reasoning with legal conditionals such as "If a person kills another human, then this person should be punished for manslaughter." In Experiments 1 and 2 legal conditionals were presented to participants together with exculpatory circumstances, i.e., counterexamples. The participants' task was to decide whether they would adhere to the legal conditional rule and punish the offender. Participants were either lawyers (i.e., advanced law students and graduate lawyers) or legal laypeople. We found that laypeople often ignore exculpatory circumstances and adhere to the conditional rule when offences evoked high levels of moral outrage. Lawyers did not show this effect. In Experiment 3 laypeople showed difficulties even when asked to simply imagine exculpatory circumstances for highly morally outrageous offences. Results provide new evidence for the role of emotions - like moral outrage - in the consideration of counterexamples to legal conditionals. PMID:26689704

  10. Conditional Eddies in Plasma Turbulence

    DEFF Research Database (Denmark)

    Johnsen, Helene; Pécseli, Hans; Trulsen, J.

    1986-01-01

    Conditional structures, or eddies, in turbulent flows are discussed with special attention to electrostatic turbulence in plasmas. The potential variation of these eddies is obtained by sampling the fluctuations only when a certain condition is satisfied in a reference point. The resulting...... structure has a simple physical interpretation. It is here demonstrated that correlation functions of the type ( phi n(x1,t1) phi (x2,t2)) for n=1, 2, . . ., which are relatively easy to obtain, contain sufficient information to construct the conditional eddies. Experimentally obtained correlation functions...

  11. Eigenvalue Conditions for Induced Subgraphs

    Directory of Open Access Journals (Sweden)

    Harant Jochen

    2015-05-01

    Full Text Available Necessary conditions for an undirected graph G to contain a graph H as induced subgraph involving the smallest ordinary or the largest normalized Laplacian eigenvalue of G are presented.

  12. Bayesian Sampling using Condition Indicators

    DEFF Research Database (Denmark)

    Faber, Michael H.; Sørensen, John Dalsgaard

    2002-01-01

    allows for a Bayesian formulation of the indicators whereby the experience and expertise of the inspection personnel may be fully utilized and consistently updated as frequentistic information is collected. The approach is illustrated on an example considering a concrete structure subject to corrosion......The problem of control quality of components is considered for the special case where the acceptable failure rate is low, the test costs are high and where it may be difficult or impossible to test the condition of interest directly. Based on the classical control theory and the concept of...... condition indicators introduced by Benjamin and Cornell (1970) a Bayesian approach to quality control is formulated. The formulation is then extended to the case where the quality control is based on sampling of indirect information about the condition of the components, i.e. condition indicators. This...

  13. Inflation with generalized initial conditions

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht, A.; Brandenberger, R.; Matzner, R.

    1987-01-15

    In many current models of the early Universe a scalar field phi which is only very weakly coupled to other quantum fields is used to generate inflation. In such models there are no forces which could thermalize the scalar field, and previous assumptions about its preinflation ''initial'' conditions must be abandoned. In this paper the onset of inflation is studied classically for more general initial conditions of the scalar field configuration. In particular, initial conditions with a nonvanishing spatial average of phi, with phi chosen at random in each initial horizon volume, and with random initial momenta are considered. We identify and discuss several mechanisms that can drive these more general initial conditions toward an inflationary state. The analysis is done in one spatial dimension.

  14. Chronic Conditions among Medicare Beneficiaries

    Data.gov (United States)

    U.S. Department of Health & Human Services — The data used in the chronic condition reports are based upon CMS administrative enrollment and claims data for Medicare beneficiaries enrolled in the...

  15. National Coastal Condition Assessment (NCCA)

    Data.gov (United States)

    U.S. Environmental Protection Agency — During the summer of 2010, state and EPA crews conducted field sampling for the fifth National Coastal Condition Assessment (NCCA). The assessment is in the data...

  16. Health Conditions Associated with Psoriasis

    Science.gov (United States)

    ... Zipcode Comorbidities Associated with Psoriatic Disease People with psoriasis and psoriatic arthritis are at an elevated risk ... conditions. Psoriasis and Psoriatic Arthritis Psoriasis Psoriatic Arthritis Psoriasis and Psoriatic Arthritis Cancer A number of studies ...

  17. Conditioning biomass for microbial growth

    Energy Technology Data Exchange (ETDEWEB)

    Bodie, Elizabeth A; England, George

    2015-03-31

    The present invention relates to methods for improving the yield of microbial processes that use lignocellulose biomass as a nutrient source. The methods comprise conditioning a composition comprising lignocellulose biomass with an enzyme composition that comprises a phenol oxidizing enzyme. The conditioned composition can support a higher rate of growth of microorganisms in a process. In one embodiment, a laccase composition is used to condition lignocellulose biomass derived from non-woody plants, such as corn and sugar cane. The invention also encompasses methods for culturing microorganisms that are sensitive to inhibitory compounds in lignocellulose biomass. The invention further provides methods of making a product by culturing the production microorganisms in conditioned lignocellulose biomass.

  18. Conditioning processes for incinerator ashes

    International Nuclear Information System (INIS)

    Three conditioning processes for alpha-bearing solid waste incineration ashes were investigated and compared according to technical and economic criteria: isostatic pressing, cold-crucible direct-induction melting and cement-resin matrix embedding

  19. End conditions of piano strings

    OpenAIRE

    EGE, Kerem; Chaigne, Antoine

    2007-01-01

    The research of a trade-off between loudness and sustain (duration) is a major issue for piano designers and manufacturers. The way the energy of vibration is transferred from the piano string to the soundboard depends on the end conditions of the strings at the bridge: these conditions can be approximated by the input admittance at the connecting point between the string and the resonator. Therefore, proper measurements of this value are needed. Given this, we propose here a method of valida...

  20. Boundary Conditions of Weyl Semimetals

    CERN Document Server

    Hashimoto, Koji; Wu, Xi

    2016-01-01

    We find that generic boundary conditions of Weyl semimetal is dictated by only a single real parameter, in the continuum limit. We determine how the energy dispersions (the Fermi arcs) and the wave functions of edge states depend on this parameter. Lattice models are found to be consistent with our generic observation. Furthermore, the enhanced parameter space of the boundary condition is shown to support a novel topological number.

  1. The Estimation of Conditional Densities

    OpenAIRE

    Xiaohong Chen; Oliver Linton; Robinson, Peter M.

    2001-01-01

    We discuss a number of issues in the smoothed nonparametric estimation of kernel conditional probability density functions for stationary processes. The kernel conditional density estimate is a ratio of joint and marginal density estimates. We point out the different implications of leading choices of bandwidths in numerator and denominator for the ability of the estimate to integrate to one and to have finite moments. Again bearing in mind different bandwidth possibilities, we discuss asympt...

  2. Conditional Expectation as Quantile Derivative

    OpenAIRE

    Dirk Tasche

    2001-01-01

    For a linear combination of random variables, fix some confidence level and consider the quantile of the combination at this level. We are interested in the partial derivatives of the quantile with respect to the weights of the random variables in the combination. It turns out that under suitable conditions on the joint distribution of the random variables the derivatives exist and coincide with the conditional expectations of the variables given that their combination just equals the quantil...

  3. NASA Astronaut Urinary Conditions Associated with Spaceflight

    Science.gov (United States)

    Law, Jennifer; Cole, Richard; Young, Millennia H.; Mason, Sara

    2016-01-01

    medications with a known side effect of urinary retention are also associated with urinary retention during flight. However, not all cases of urinary retention surrounded medication use inflight. It is also known that UTI is a terrestrial cause of urinary retention. Furthermore, the treatment of urinary retention with a urinary catheter may be more likely to initiate a UTI in space than on the ground, as aseptic techniques can be particularly challenging with an inexperienced provider in a free-floating environment. Inflight urinary retention and UTI have proven to be highly associated and urinary risks should be considered collectively when planning for space flight.

  4. Covariant jump conditions in electromagnetism

    International Nuclear Information System (INIS)

    A generally covariant four-dimensional representation of Maxwell’s electrodynamics in a generic material medium can be achieved straightforwardly in the metric-free formulation of electromagnetism. In this setup, the electromagnetic phenomena are described by two tensor fields, which satisfy Maxwell’s equations. A generic tensorial constitutive relation between these fields is an independent ingredient of the theory. By use of different constitutive relations (local and non-local, linear and non-linear, etc.), a wide area of applications can be covered. In the current paper, we present the jump conditions for the fields and for the energy–momentum tensor on an arbitrarily moving surface between two media. From the differential and integral Maxwell equations, we derive the covariant boundary conditions, which are independent of any metric and connection. These conditions include the covariantly defined surface current and are applicable to an arbitrarily moving smooth curved boundary surface. As an application of the presented jump formulas, we derive a Lorentzian type metric as a condition for existence of the wave front in isotropic media. This result holds for ordinary materials as well as for metamaterials with negative material constants. - Highlights: ► Covariant metric-free jump conditions for the electromagnetic field are derived. ► Covariantly defined surface current is considered. ► Lorentzian type metric from existence of the wave front in isotropic media. ► The result holds for ordinary materials as well as for metamaterials.

  5. The CMS Condition Database system

    CERN Document Server

    Govi, Giacomo Maria; Ojeda-Sandonis, Miguel; Pfeiffer, Andreas; Sipos, Roland

    2015-01-01

    The Condition Database plays a key role in the CMS computing infrastructure. The complexity of the detector and the variety of the sub-systems involved are setting tight requirements for handling the Conditions. In the last two years the collaboration has put an effort in the re-design of the Condition Database system, with the aim to improve the scalability and the operability for the data taking starting in 2015. The re-design has focused in simplifying the architecture, using the lessons learned during the operation of the previous data-taking period. In the new system the relational features of the database schema are mainly exploited to handle the metadata ( Tag and Interval of Validity ), allowing for a limited and controlled set of queries. The bulk condition data ( Payloads ) are stored as unstructured binary data, allowing the storage in a single table with a common layout for all of the condition data types. In this presentation, we describe the full architecture of the system, including the serv...

  6. The CMS Condition Database System

    Science.gov (United States)

    Di Guida, S.; Govi, G.; Ojeda, M.; Pfeiffer, A.; Sipos, R.

    2015-12-01

    The Condition Database plays a key role in the CMS computing infrastructure. The complexity of the detector and the variety of the sub-systems involved are setting tight requirements for handling the Conditions. In the last two years the collaboration has put a substantial effort in the re-design of the Condition Database system, with the aim at improving the scalability and the operability for the data taking starting in 2015. The re-design has focused on simplifying the architecture, using the lessons learned during the operation of the Run I data-taking period (20092013). In the new system the relational features of the database schema are mainly exploited to handle the metadata (Tag and Interval of Validity), allowing for a limited and controlled set of queries. The bulk condition data (Payloads) are stored as unstructured binary data, allowing the storage in a single table with a common layout for all of the condition data types. In this paper, we describe the full architecture of the system, including the services implemented for uploading payloads and the tools for browsing the database. Furthermore, the implementation choices for the core software will be discussed.

  7. Condition with Caution: Think Thrice Before Conditioning. (Rough Draft).

    Science.gov (United States)

    Katz, Lilian G.

    1971-01-01

    Innovative models for education are often quickly adopted. Behavior modification, or operant conditioning, is an example of a technique which has been widely used because, when properly applied in the classroom, it "works." However, the application of a technique should be carefully thought through in terms of the meaning of the behavior in…

  8. Structural lubricity under ambient conditions

    Science.gov (United States)

    Cihan, Ebru; İpek, Semran; Durgun, Engin; Baykara, Mehmet Z.

    2016-01-01

    Despite its fundamental importance, physical mechanisms that govern friction are poorly understood. While a state of ultra-low friction, termed structural lubricity, is expected for any clean, atomically flat interface consisting of two different materials with incommensurate structures, some associated predictions could only be quantitatively confirmed under ultra-high vacuum (UHV) conditions so far. Here, we report structurally lubric sliding under ambient conditions at mesoscopic (∼4,000–130,000 nm2) interfaces formed by gold islands on graphite. Ab initio calculations reveal that the gold–graphite interface is expected to remain largely free from contaminant molecules, leading to structurally lubric sliding. The experiments reported here demonstrate the potential for practical lubrication schemes for micro- and nano-electromechanical systems, which would mainly rely on an atomic-scale structural mismatch between the slider and substrate components, via the utilization of material systems featuring clean, atomically flat interfaces under ambient conditions. PMID:27350035

  9. Quantum Measurement and Initial Conditions

    Science.gov (United States)

    Stoica, Ovidiu Cristinel

    2016-03-01

    Quantum measurement finds the observed system in a collapsed state, rather than in the state predicted by the Schrödinger equation. Yet there is a relatively spread opinion that the wavefunction collapse can be explained by unitary evolution (for instance in the decoherence approach, if we take into account the environment). In this article it is proven a mathematical result which severely restricts the initial conditions for which measurements have definite outcomes, if pure unitary evolution is assumed. This no-go theorem remains true even if we take the environment into account. The result does not forbid a unitary description of the measurement process, it only shows that such a description is possible only for very restricted initial conditions. The existence of such restrictions of the initial conditions can be understood in the four-dimensional block universe perspective, as a requirement of global self-consistency of the solutions of the Schrödinger equation.

  10. Covariant jump conditions in electromagnetism

    CERN Document Server

    Itin, Yakov

    2014-01-01

    A generally covariant four-dimensional representation of Maxwell's electrodynamics in a generic material medium can be achieved straightforwardly in the metric-free formulation of electromagnetism. In this setup, the electromagnetic phenomena described by two tensor fields, which satisfy Maxwell's equations. A generic tensorial constitutive relation between these fields is an independent ingredient of the theory. By use of different constitutive relations (local and non-local, linear and non-linear, etc.), a wide area of applications can be covered. In the current paper, we present the jump conditions for the fields and for the energy-momentum tensor on an arbitrarily moving surface between two media. From the differential and integral Maxwell equations, we derive the covariant boundary conditions, which are independent of any metric and connection. These conditions include the covariantly defined surface current and are applicable to an arbitrarily moving smooth curved boundary surface. As an application of ...

  11. Working Conditions, Lifestyles and Health

    DEFF Research Database (Denmark)

    Cottini, Elena; Ghinetti, Paolo

    The aim of this paper is to investigate whether employee health is affected by the environment in which the individual works - in terms of both physical and psychosocial working conditions - and by his or her lifestyle. Health measures are computed from Danish data, and refer to both self assessed...... general health and two more objective health measures: mental health specific to work-related problems, and physical health. We find that both bad working conditions and bad lifestyles reduce health, especially in its self-assessed component. The impact of lifetsyle indicators have a more modest health...

  12. Lorentzian Condition in Holographic Cosmology

    CERN Document Server

    Hertog, Thomas; Vreys, Yannick

    2016-01-01

    We derive a sufficient set of conditions on the Euclidean boundary theory in dS/CFT for it to predict classical, Lorentzian bulk evolution at large spatial volumes. Our derivation makes use of a canonical transformation to express the bulk wave function at large volume in terms of the sources of the dual partition function. This enables a sharper formulation of dS/CFT. The conditions under which the boundary theory predicts classical bulk evolution are stronger than the criteria usually employed in quantum cosmology. We illustrate this in a homogeneous isotropic minisuperspace model of gravity coupled to a scalar field in which we identify the ensemble of classical histories explicitly.

  13. Making chromosome abnormalities treatable conditions.

    Science.gov (United States)

    Cody, Jannine DeMars; Hale, Daniel Esten

    2015-09-01

    Individuals affected by the classic chromosome deletion syndromes which were first identified at the beginning of the genetic age, are now positioned to benefit from genomic advances. This issue highlights five of these conditions (4p-, 5p-, 11q-, 18p-, and 18q-). It focuses on the increased in understanding of the molecular underpinnings and envisions how these can be transformed into effective treatments. While it is scientifically exciting to see the phenotypic manifestations of hemizygosity being increasingly understood at the molecular and cellular level, it is even more amazing to consider that we are now on the road to making chromosome abnormalities treatable conditions. PMID:26351122

  14. Hygienic diagnosis in extreme conditions

    International Nuclear Information System (INIS)

    Review for book by M.P. Zakharchenko, S.A. Lopatin, G.N. Novozhilov, V.I. Zakharov Hygienic diagnosis in extreme conditions is presented discussing the problem of people health preservation under extreme conditions. Hygienic diagnosis is considered illustrated by cases of hostilities (Afghan War), earthquake response in Armenia (1988) and Chernobyl accident response. Attention is paid to the estimation of radiation doses to people and characteristics of main types of dosimeters. The high scientific level of the book is marked

  15. Flow in air conditioned rooms

    DEFF Research Database (Denmark)

    Nielsen, Peter V.

    1974-01-01

    Flow in air conditioned r ooms is examined by means of model experiments . The different gearnetries giving unsteady, steady three- dimensional and steady twodimensional flow are determined . Velacity profiles and temperature profiles are measured in some of the geometries. A numerical solution...... of the flow equations is demonstrated and the flow in air conditioned rooms in case of steady two dimensional flow is predi cted. Compari son with measured results is shown i n the case of small Archimedes numbers, and predictions are shown at high Archimedes numbers. A numerical prediction of f low and heat...

  16. Extreme Conditions Modeling Workshop Report

    Energy Technology Data Exchange (ETDEWEB)

    Coe, R. G.; Neary, V. S.; Lawson, M. J.; Yu, Y.; Weber, J.

    2014-07-01

    Sandia National Laboratories (SNL) and the National Renewable Energy Laboratory (NREL) hosted the Wave Energy Converter (WEC) Extreme Conditions Modeling (ECM) Workshop in Albuquerque, NM on May 13th-14th, 2014. The objective of the workshop was to review the current state of knowledge on how to model WECs in extreme conditions (e.g. hurricanes and other large storms) and to suggest how U.S. Department of Energy (DOE) and national laboratory resources could be used to improve ECM methods for the benefit of the wave energy industry.

  17. Problems in monitoring oxidizing conditions

    International Nuclear Information System (INIS)

    One of the three factors required to obtain intergranular stress corrosion cracking (IGSCC) is an oxidizing condition. For many years only oxygen was considered important in giving this oxidizing condition in BWR (boiling water reactor) water during operation. During the last three years, however, hydrogen peroxide has been found to be present also at high temperatures. An increasing interest in this compound has therefore grown recently. In this presentation some results from measurements in BWRs and in the laboratory and the consequences of these new results on the use of ECP as a materials monitoring method are discussed

  18. Octonionic Lorenz-like condition

    Indian Academy of Sciences (India)

    Murat Tanişli; Bernard Jancewicz

    2012-02-01

    In this study, the octonion algebra and its general properties are defined by the Cayley–Dickson’s multiplication rules for octonion units. The field equations, potential equations and Maxwell equations for electromagnetism are investigated with the octonionic equations and these equations can be compared with their vectorial representations. The potential and wave equations for fields with sources are also provided. By using Maxwell equations, a Lorenz-like condition is newly suggested for electromagnetism. The existing equations including the photon mass provide the most acknowledged Lorenz condition for the magnetic monopole and the source.

  19. Distributed Dynamic Condition Response Structures

    DEFF Research Database (Denmark)

    Hildebrandt, Thomas; Mukkamala, Raghava Rao

    repeated, possibly infinite behavior, 2) finitely specify fine-grained acceptance conditions for (possibly infinite) runs based on the notion of responses and 3) distribute events via roles. We give a graphical notation inspired by related work by van der Aalst et al and formalize the execution semantics......We present distributed dynamic condition response structures as a declarative process model inspired by the workflow language employed by our industrial partner and conservatively generalizing labelled event structures. The model adds to event structures the possibility to 1) finitely specify...

  20. Admission Conditions and Graduates' Employability

    Science.gov (United States)

    Alexandre, Fernando; Portela, Miguel; Sa, Carla

    2009-01-01

    In a context of increasing competition for students, admission conditions have been used as an instrument in a strategy of differentiation. Such a strategy is guided by short-run concerns, that is, the immediate need to attract more students. This article takes a longer term view, by examining graduates' employability. The authors find that…

  1. Critical conditions of pressurized pipes

    Czech Academy of Sciences Publication Activity Database

    Gajdoš, Lubomír; Šperl, Martin

    2013-01-01

    Roč. 20, č. 5 (2013), s. 401-412. ISSN 1802-1484 R&D Projects: GA ČR(CZ) GAP105/10/2052 Institutional support: RVO:68378297 Keywords : pressurized pipe * J-integral * C factor * critical conditions Subject RIV: JL - Materials Fatigue, Friction Mechanics http://www.engineeringmechanics.cz/obsahy.html?R=20&C=5

  2. Conditioning in spatial point processes

    DEFF Research Database (Denmark)

    Coeurjolly, Jean-Francois; Møller, Jesper; Waagepetersen, Rasmus

    This tutorial provides an introduction to conditioning in spatial point processes or so-called Palm distributions. Initially, in the context of finite point processes, we give an explicit definition of Palm distributions in terms of their density functions. Then we review Palm distributions in the...

  3. Covariant jump conditions in electromagnetism

    Science.gov (United States)

    Itin, Yakov

    2012-02-01

    A generally covariant four-dimensional representation of Maxwell's electrodynamics in a generic material medium can be achieved straightforwardly in the metric-free formulation of electromagnetism. In this setup, the electromagnetic phenomena are described by two tensor fields, which satisfy Maxwell's equations. A generic tensorial constitutive relation between these fields is an independent ingredient of the theory. By use of different constitutive relations (local and non-local, linear and non-linear, etc.), a wide area of applications can be covered. In the current paper, we present the jump conditions for the fields and for the energy-momentum tensor on an arbitrarily moving surface between two media. From the differential and integral Maxwell equations, we derive the covariant boundary conditions, which are independent of any metric and connection. These conditions include the covariantly defined surface current and are applicable to an arbitrarily moving smooth curved boundary surface. As an application of the presented jump formulas, we derive a Lorentzian type metric as a condition for existence of the wave front in isotropic media. This result holds for ordinary materials as well as for metamaterials with negative material constants.

  4. Extreme conditions (p, T, H)

    Energy Technology Data Exchange (ETDEWEB)

    Mesot, J. [Lab. for Neutron Scattering ETH Zurich, Zurich (Switzerland) and Paul Scherrer Institute, Villigen (Switzerland)

    1996-11-01

    The aim of this paper is to summarize the sample environment which will be accessible at the SINQ. In order to illustrate the type of experiments which will be feasible under extreme conditions of temperature, magnetic field and pressure at the SINQ a few selected examples are also given. (author) 7 figs., 14 refs.

  5. Conditioned Reinforcement and Response Strength

    Science.gov (United States)

    Shahan, Timothy A.

    2010-01-01

    Stimuli associated with primary reinforcers appear themselves to acquire the capacity to strengthen behavior. This paper reviews research on the strengthening effects of conditioned reinforcers within the context of contemporary quantitative choice theories and behavioral momentum theory. Based partially on the finding that variations in…

  6. Conditioning of alpha bearing wastes

    International Nuclear Information System (INIS)

    Alpha bearing wastes are generated during the reprocessing of spent fuel, mixed oxide fuel fabrication, decommissioning and other activities. The safe and effective management of these wastes is of particular importance owing to the radiotoxicity and long lived characteristics of certain transuranic (TRU) elements. The management of alpha bearing wastes involves a number of stages which include collection, characterization, segregation, treatment, conditioning, transport, storage and disposal. This report describes the currently available matrices and technologies for the conditioning of alpha wastes and relates them to their compatibility with the other stages of the waste management process. The selection of a specific immobilization process is dependent on the waste treatment state and the subsequent handling, transport, storage and disposal requirements. The overall objectives of immobilization are similar for all waste producers and processors, which are to produce: (a) Waste forms with sufficient mechanical, physical and chemical stability to satisfy all stages of handling, transport and storage (referred to as the short term requirements), and (b) Waste forms which will satisfy disposal requirements and inhibit the release of radionuclides to the biosphere (referred to as the long term requirements). Cement and bitumen processes have already been successfully applied to alpha waste conditioning on the industrial scale in many of the IAEA Member States. Cement systems based on BFS and pozzolanic cements have emerged as the principal encapsulation matrices for the full range of alpha bearing wastes. Alternative technologies, such as polymers and ceramics, are being developed for specific waste streams but are unlikely to meet widespread application owing to cost and process complexity. The merits of alpha waste conditioning are improved performance in transport, storage and disposal combined with enhanced public perception of waste management operations. These

  7. Appetitive vs. Aversive conditioning in humans

    OpenAIRE

    Andreatta, Marta; Pauli, Paul

    2015-01-01

    In classical conditioning, an initially neutral stimulus (conditioned stimulus, CS) becomes associated with a biologically salient event (unconditioned stimulus, US), which might be pain (aversive conditioning) or food (appetitive conditioning). After a few associations, the CS is able to initiate either defensive or consummatory responses, respectively. Contrary to aversive conditioning, appetitive conditioning is rarely investigated in humans, although its importance for normal and patholog...

  8. Appetitive vs. Aversive Conditioning in Humans

    OpenAIRE

    Marta Andreatta

    2015-01-01

    In classical conditioning, an initially neutral stimulus (conditioned stimulus, CS) becomes associated with a biologically salient event (unconditioned stimulus, US), which might be pain (aversive conditioning) or food (appetitive conditioning). After a few associations, the CS is able to initiate either defensive or consummatory responses, respectively. Contrary to aversive conditioning, appetitive conditioning is rarely investigated in humans, although its importance for normal and patholog...

  9. Acoustic multivariate condition monitoring - AMCM

    Energy Technology Data Exchange (ETDEWEB)

    Rosenhave, P.E. [Vestfold College, Maritime Dept., Toensberg (Norway)

    1997-12-31

    In Norway, Vestfold College, Maritime Department presents new opportunities for non-invasive, on- or off-line acoustic monitoring of rotating machinery such as off-shore pumps and diesel engines. New developments within acoustic sensor technology coupled with chemometric data analysis of complex signals now allow condition monitoring of hitherto unavailable flexibility and diagnostic specificity. Chemometrics paired with existing knowledge yields a new and powerful tool for condition monitoring. By the use of multivariate techniques and acoustics it is possible to quantify wear and tear as well as predict the performance of working components in complex machinery. This presentation describes the AMCM method and one result of a feasibility study conducted onboard the LPG/C `Norgas Mariner` owned by Norwegian Gas Carriers as (NGC), Oslo. (orig.) 6 refs.

  10. Conditional Independence in Evidence Theory

    Czech Academy of Sciences Publication Activity Database

    Vejnarová, Jiřina

    Malaga: Universidad de Malaga, 2008 - (Magdalena, L.; Ojeda-Aciego, N.; Verdegay, J.), s. 938-945 ISBN 978-84-612-3061-7. [12th International Conference on Information Processing and Management of Uncertainty in Knowledge-Based Systems IPMU'08. Malaga (ES), 22.06.2008-27.06.2008] R&D Projects: GA AV ČR IAA100750603; GA ČR GA201/08/0539 Grant ostatní: GA MŠk(CZ) 2C06019 Institutional research plan: CEZ:AV0Z10750506 Keywords : Conditional independence * Evidence theory * Probability theory * Possibility theory * Credalsets Subject RIV: IN - Informatics, Computer Science http://library.utia.cas.cz/separaty/2008/MTR/vejnarova-conditional%20independence%20in%20evidence%20theory.pdf

  11. Energy conditions and galaxy formation

    CERN Document Server

    Visser, M

    1997-01-01

    This note summarizes a model-independent analysis of the age of the universe problem that trades off precision in favour of robustness: The energy conditions of Einstein gravity are designed to extract as much information as possible from classical general relativity without specifying a particular equation of state. This is particularly useful in a cosmological setting, where the equation of state for the cosmological fluid is extremely uncertain. The strong energy condition (SEC) provides a simple and robust bound on the behaviour of the look-back time as a function of red-shift. Observation suggests that the SEC may be violated sometime between the epoch of galaxy formation and the present.

  12. Hydrodynamics from Landau initial conditions

    Energy Technology Data Exchange (ETDEWEB)

    Sen, Abhisek [University of Tennessee, Knoxville (UTK); Gerhard, Jochen [Frankfurt Institute for Advanced Studies (FIAS), Germany; Torrieri, Giorgio [Universidade Estadual de Campinas, Instituto de Física " Gleb Wataghin" (IFGW), Sao Paulo, Brazil; Read jr, Kenneth F. [University of Tennessee (UTK) and Oak Ridge National Laboratory (ORNL); Wong, Cheuk-Yin [ORNL

    2015-01-01

    We investigate ideal hydrodynamic evolution, with Landau initial conditions, both in a semi-analytical 1+1D approach and in a numerical code incorporating event-by-event variation with many events and transverse density inhomogeneities. The object of the calculation is to test how fast would a Landau initial condition transition to a commonly used boost-invariant expansion. We show that the transition to boost-invariant flow occurs too late for realistic setups, with corrections of O (20 - 30%) expected at freezeout for most scenarios. Moreover, the deviation from boost-invariance is correlated with both transverse flow and elliptic flow, with the more highly transversely flowing regions also showing the most violation of boost invariance. Therefore, if longitudinal flow is not fully developed at the early stages of heavy ion collisions, 2+1 dimensional hydrodynamics is inadequate to extract transport coefficients of the quark-gluon plasma. Based on [1, 2

  13. PFP transition final condition definition

    International Nuclear Information System (INIS)

    The purpose of this document is to describe the end state of the PFP Complex following completion of the PFP Stabilization and Deactivation Project. This document assumes that completion of DNFSB 94-1 Recommendation material stabilization activities is a pre-condition for completion in a given area of PFP. The current planning case assumes that all above ground buildings and structures will be deactivated and dismantled to a clean ''slab-on-grade.''

  14. Defining and Measuring Chronic Conditions

    Centers for Disease Control (CDC) Podcasts

    2013-05-20

    This podcast is an interview with Dr. Anand Parekh, U.S. Department of Health and Human Services Deputy Assistant Secretary for Health, and Dr. Samuel Posner, Preventing Chronic Disease Editor in Chief, about the definition and burden of multiple chronic conditions in the United States.  Created: 5/20/2013 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/20/2013.

  15. Conditions of contract for construction

    CERN Document Server

    1999-01-01

    Conditions of Contract for Construction, which are recommended for building or engineering works designed by the Employer or by his representative, the Engineer. Under the usual arrangements for this type of contract, the Contractor constructs the works in accordance with a design provided by the Employer. However, the works may include some elements of Contractor-designed civil, mechanical, electrical and/or construction works.

  16. Sleep Behavior and Unemployment Conditions

    OpenAIRE

    Antillón, Marina; Lauderdale, Diane S.; Mullahy, John

    2014-01-01

    Recent research has reported that habitually short sleep duration is a risk factor for declining health, including increased risk of obesity, diabetes and coronary heart disease. In this study we investigate whether macroeconomic conditions are associated with variation in mean sleep time in the United States, and if so, whether the effect is procyclical or countercyclical. We merge state unemployment rates from 2003 through 2012 with the American Time Use Survey, a nationally representative ...

  17. Valuation Networks and Conditional Independence

    OpenAIRE

    Shenoy, Prakash P.

    2013-01-01

    Valuation networks have been proposed as graphical representations of valuation-based systems (VBSs). The VBS framework is able to capture many uncertainty calculi including probability theory, Dempster-Shafer's belief-function theory, Spohn's epistemic belief theory, and Zadeh's possibility theory. In this paper, we show how valuation networks encode conditional independence relations. For the probabilistic case, the class of probability models encoded by valuation networks includes undirect...

  18. End conditions of piano strings

    CERN Document Server

    Ege, Kerem

    2011-01-01

    The end conditions of piano strings can be approximated by the input admittance at the bridge. Proper measurements of this value are therefore required. A method of validation of admittance measurements on simple structures is proposed in this paper. High resolution signal analysis performed on string's vibrations yields an estimate for the input admittance. This method is implemented on a simplified device composed of a piano string coupled to a thin steel beam.

  19. Analytical methods under emergency conditions

    International Nuclear Information System (INIS)

    This lecture discusses methods for the radiochemical determination of internal contamination of the body under emergency conditions, here defined as a situation in which results on internal radioactive contamination are needed quickly. The purpose of speed is to determine the necessity for medical treatment to increase the natural elimination rate. Analytical methods discussed include whole-body counting, organ counting, wound monitoring, and excreta analysis. 12 references

  20. Multivariate mixed normal conditional heteroskedasticity

    OpenAIRE

    Bauwens, Luc; Hafner, Christian; ROMBOUTS, Jeroen

    2006-01-01

    We propose a new multivariate volatility model where the conditional distribution of a vector time series is given by a mixture of multivariate normal distributions. Each of these distributions is allowed to have a time-varying covariance matrix. The process can be globally covariance- stationary even though some components are not covariance-stationary. We derive some theo- retical properties of the model such as the unconditional covariance matrix and autocorrelations of squared returns. Th...

  1. Major RFI conditions effecting TDRSS

    Science.gov (United States)

    Lyttle, J. D.

    1974-01-01

    An evaluation of the radio frequency interference (RFI) conditions which would affect operating frequency band selections and data communications equipment design approaches for the Tracking Data Relay Satellite System (TDRSS) is presented. The subjects discussed are: (1) the scope of the investigation, (2) relative RFI in the frequency bands considered, (3) radar RFI power and duty factor, (4) radio relay communications RFI, (5) radio frequency band usage recommendations, and (6) radar RFI impact areas.

  2. Repulsive Casimir Force: Sufficient Conditions

    OpenAIRE

    Rosa, Luigi; Lambrecht, Astrid

    2010-01-01

    In this paper the Casimir energy of two parallel plates made by materials of different penetration depth and no medium in between is derived. We study the Casimir force density and derive analytical constraints on the two penetration depths which are sufficient conditions to ensure repulsion. Compared to other methods our approach needs no specific model for dielectric or magnetic material properties and constitutes a complementary analysis.

  3. Economic Conditions and SSI Applications

    OpenAIRE

    Austin Nichols; Lucie Schmidt; Purvi Sevak

    2014-01-01

    The Supplemental Security Income (SSI) program provides federally-funded income support for individuals with disabilities, and has become one of the most important means-tested transfer programs in the United States. Previous studies have examined the effects of economic conditions on growth in disability caseloads, but most focus on the Social Security Disability Insurance (SSDI) program. Most work on SSI dates from before welfare reform, which had both direct and indirect effects on the com...

  4. Conditions for Peace and Conflict

    OpenAIRE

    Judith M. Bretthauer

    2015-01-01

    This study applies fuzzy-set Qualitative Comparative Analysis (fsQCA) to the debate on links between resource scarcity and armed conflict. Previous studies on this relationship have reached contradictory results. This study aims to solve this contradiction by arguing that social, economic, and political conditions play an important role in determining whether armed conflict erupts over resource scarcity. I test three theoretic hypotheses, focusing on weak states, economic situations of househ...

  5. Monilethrix: A rare hereditary condition

    Directory of Open Access Journals (Sweden)

    Adaikalampillai Ganapathy Vikramkumar

    2013-01-01

    Full Text Available Monilethrix is a rare hereditary condition generally considered to be an autosomal-dominant disorder with variable penetrance. Here, we report a case of monilethrix in a 13-year-old boy with an affected sibling. A therapeutic trial with oral N-acetyl cysteine was attempted. There was slight improvement after 2 months of therapy. The hair density, however, did not show any further improvement subsequently. Monilethrix remains as a therapeutic challenge for dermatologists.

  6. Pavlovian conditioning with proximal stimuli.

    Science.gov (United States)

    Lachnit, H; Bohn, A

    1986-01-01

    This experiment was conducted with the objective of demonstrating that the effective stimuli in Pavlovian Conditioning are not environmental stimuli but internal physiological processes elicited by environmental input (proximal stimuli). In order to achieve the objective, afterimages in color vision were used: looking at a diffuse lightened circle after seeing a red circle yields an image of a green circle. A differential conditioning paradigm with two sequential compounds was run. In one group (G+B-: n1 = 10), a red circle followed by a green circle was paired with shock, whereas a red circle followed by a blue circle remained unpaired. A second group (G-B+: n2 = 10) received red-blue paired trials and unpaired red-green trials. Immediately after that training, subjects were tested with a new, never trained sequential compound: a red circle followed by a diffuse lightened circle. Furthermore, they were tested with the already trained compounds. Taking the environmental point of view, the never trained stimulus should elicit an orienting response lying in between the excitatory reaction to the paired stimulus and the inhibitory reaction to the unpaired stimulus. From the proximal point of view, the diffuse light should elicit an excitatory reaction in group G+B- and an inhibitory reaction in group G-B+. Electrodermal conditioned anticipatory and omission responses were measured. The results supported the proximal hypothesis. Hence, defining input in environmental terms may be the wrong way. Instead, in conceptualizing the stimulus in conditioning, the following should be considered: the processing organism itself is creating the effective stimuli. PMID:3785989

  7. A Primer on Energy Conditions

    CERN Document Server

    Curiel, Erik

    2014-01-01

    An energy condition, in the context of a wide class of spacetime theories (including general relativity), is, crudely speaking, a relation one demands the stress-energy tensor of matter satisfy in order to try to capture the idea that "energy should be positive". The remarkable fact I will discuss in this paper is that such simple, general, almost trivial seeming propositions have profound and far-reaching import for our understanding of the structure of relativistic spacetimes. It is therefore especially surprising when one also learns that we have no clear understanding of the nature of these conditions, what theoretical status they have with respect to fundamental physics, what epistemic status they may have, when we should and should not expect them to be satisfied, and even in many cases how they and their consequences should be interpreted physically. Or so I shall argue, by a detailed analysis of the technical and conceptual character of all the standard conditions used in physics today, including exam...

  8. Effective dynamics using conditional expectations

    International Nuclear Information System (INIS)

    The question of coarse-graining is ubiquitous in molecular dynamics. In this paper, we are interested in deriving effective properties for the dynamics of a coarse-grained variable ξ(x), where x describes the configuration of the system in a high-dimensional space Rn, and ξ is a given smooth function with value in R (typically a reaction coordinate). It is well known that, given a Boltzmann–Gibbs distribution on x element of Rn, the equilibrium properties on ξ(x) are completely determined by the free energy. On the other hand, the question of the effective dynamics on ξ(x) is much more difficult to address. Starting from an overdamped Langevin equation on x element of Rn, we propose an effective dynamics for ξ(x) element of R using conditional expectations. Using entropy methods, we give sufficient conditions for the time marginals of the effective dynamics to be close to the original ones, with precise error bounds. We check numerically on several examples that these sufficient conditions yield an effective dynamics which accurately reproduces the residence times in the potential energy wells. We also discuss the accuracy of the effective dynamics in a pathwise sense, and the relevance of the free energy to build a coarse-grained dynamics

  9. Ventilation-air conditioning system

    International Nuclear Information System (INIS)

    Heretofore, in ventilation-air conditioning systems in a nuclear power plant, exhaust gases from each of the ventilation-air conditioning systems of a reactor building, a turbine building, a waste processing building are joined and they are released into atmosphere from the top of a high main exhaustion stack. In order to build such a high main exhaustion stack, a considerable construction cost is required and, in addition, there is a worry of lacking balance with surrounding scenery. Then, in the present invention, exhaust gases are heated by waste heat in a turbine during their introduction from the ventilation-air conditioning facility in the building of a power plant to the main exhaust stack. With such a constitution, since the exhaust gases are heated and their temperature is elevated, they uprise by natural convection when they are released from the top of the main exhaustion stack to the atmosphere. Accordingly, they are released to a level higher than the conventional case in view of the volume of the blower which sends the exhaust gases under pressure, to diffuse them to the atmosphere more sufficiently compared with a conventional case. Further, the height of the main exhaustion stack can be reduced, enabling to minimize the cost for moving the blower. (T.M.)

  10. Testing the Conditional Mean Function of Autoregressive Conditional Duration Models

    DEFF Research Database (Denmark)

    Hautsch, Nikolaus

    order to capture persistent serial dependence in the duration process, we extend the model by an observation driven ARMA dynamic based on generalized errors. We illustrate the maximum likelihood estimation of both the model parameters and discrete points of the underlying unspecified baseline survivor...... subject to censoring structures. In an empirical study based on financial transaction data we present an application of the model to estimate conditional asset price change probabilities. Evaluating the forecasting properties of the model, it is shown that the proposed approach is a promising competitor...

  11. Solar air-conditioning. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-07-01

    Within the 3rd International Conference on solar air-conditioning in Palermo (Italy) at 30th September to 2nd October, 2009 the following lectures were held: (1) Removal of non-technological barriers to solar cooling technology across Southern European islands (Stefano Rugginenti); (2) The added economic and environmental value of solar thermal systems in microgrids with combined heat and power (Chris Marney); (3) Australian solar cooling interest group (Paul Kohlenbach); (4) Designing of a technology roadmap for solar assisted air conditioning in Austria (Hilbert Focke); (5) Solar cooling in the new context of renewable policies at European level (Raffaele Piria); (6) Prototype of a solar driven steam jet ejector chiller (Clemens Pollerberg); (7) New integrated solar air conditioning system (Joan Carlos Bruno); (8) Primary energy optimised operation of solar driven desiccant evaporative cooling systems through innovative control strategies; (9) Green chiller association (Uli Jakob); (10) Climate Well {sup registered} (Olof Hallstrom); (11) Low capacity absorption chillers for solar cooling applications (Gregor Weidner); (12) Solar cooling in residential, small scale commercial and industrial applications with adsorption technology (Walter Mittelbach); (13) French solar heating and cooling development programme based on energy performance (Daniel Mugnier); (14) Mirrox fresnel process heat collectors for industrial applications and solar cooling (Christian Zahler); (15) Modelling and analyzing solar cooling systems in polysun (Seyen Hossein Rezaei); (16) Solar cooling application in Valle Susa Italy (Sufia Jung); (17) Virtual case study on small solar cooling systems within the SolarCombi+Project (Bjoern Nienborg); (18) Design of solar cooling plants under uncertainty (Fernando Dominguez-Munoz); (19) Fast pre-design of systems using solar thermally driven chillers (Hans-Martin Henning); (20) Design of a high fraction solar heating and cooling plant in southern

  12. Vacuum conditioning at the ESRF

    International Nuclear Information System (INIS)

    The ESRF 6 GeV storage ring has accumulated 600 ampere hours of beam conditioning. In the multi bunch mode the dynamic pressure measured at 100 mA stored beam decreased from 3.10-8 to 1.10-9 mbar. Cardinal vacuum development presently lies with insertion device vessels: to date, five metre long. 20 mm high stainless steel vessels have been used and serious dust pollution from the distributed NEG ribbon has been observed. Present development involves mini gap chambers, 14 mm gap aluminium and attempts to modify distributed pumping in the five metre chambers. 15 figs

  13. Ensemble teleportation under suboptimal conditions

    International Nuclear Information System (INIS)

    The possibility of teleportation is certainly the most interesting consequence of quantum non-separability. In the present paper, the feasibility of teleportation is examined on the basis of the rigorous ensemble interpretation of quantum mechanics if non-ideal constraints are imposed on the teleportation scheme. Importance is attached both to the case of noisy Einstein-Podolsky-Rosen (EPR) ensembles and to the conditions under which automatic teleportation is still possible. The success of teleportation is discussed using a new fidelity measure which avoids the weaknesses of previous proposals

  14. Working conditions in international seafaring

    DEFF Research Database (Denmark)

    Jensen, Olaf C; Sørensen, Jens F L; Thomas, Michelle;

    2006-01-01

    BACKGROUND: Seafaring is a global profession and seafarers have their second home on board and live there for several months at a time. AIM: To assess self-rated health status and the main characteristics of seafarers' working conditions. METHODS: Questionnaire study concerning the most recent tour...... of duty. RESULTS: A total of 6,461 seafarers in 11 countries responded. In general, the seafarers' self-rated health was good, but it declined significantly with age. Seafarers from South-East Asian countries spent longer time periods at sea, and had lower numbers of officers and older seafarers than...

  15. Conditioning of primates for experiments

    International Nuclear Information System (INIS)

    The preparation of the monkey for experiments is one branch of zootechny applied to laboratory animals. The construction of a monkey-house at the Saclay Nuclear Research Centre has made it possible to study the hygiene rules necessary for obtaining subjects with relatively stable biological parameters. This hygiene includes: - prophylactic treatment, because the animals received lived originally in the wild state, - a balanced diet according to modern dietetic standards, - a habitat hygiene which recreates the original living conditions of the species. The possibility of reproduction has been used as a criterion of the efficiency of the methods applied. (authors)

  16. CONDITIONS FOR IMPLEMENTING ORGANIZATIONAL CHANGES

    Directory of Open Access Journals (Sweden)

    Renata Winkler

    2015-12-01

    Full Text Available Changes are one of the most typical phenomena experienced by contemporary organizations and are an inherent element of their functioning. The change introduction process is complex and it is often accompanied by a phenomenon of resistance to change on the part of the employees in an organization, which is considered as the main cause of failure in the change implementation process. The purpose of the article is to discuss the basic conditions for implementing changes related both to their adequate defining and overcoming resistance to change.

  17. RF structure: fabrication and conditioning

    International Nuclear Information System (INIS)

    Some key issues in the fabrication of RF accelerating cavities are described in this lecture. In order to discuss those issues, two extremes are presented: a continuous-wave standing-wave cavity for storage-ring use, and a pulsed-wave traveling-wave structure for linear-accelerator use. Simple and tedious but very important issues, tuning the cavity frequency and minimizing the RF loss, are discussed in detail. Some characteristics appearing in the conditioning stage are then presented to show the significant influence of cleanness in the fabrication stage on performance in high field operation. (author)

  18. Nested Dynamic Condition Response Graphs

    DEFF Research Database (Denmark)

    Hildebrandt, Thomas; Mukkamala, Raghava Rao; Slaats, Tijs

    2012-01-01

    We present an extension of the recently introduced declarative process model Dynamic Condition Response Graphs ( DCR Graphs) to allow nested subgraphs and a new milestone relation between events. The extension was developed during a case study carried out jointly with our industrial partner...... Exformatics, a danish provider of case and workflow management systems. We formalize the semantics by giving first a map from Nested to (flat) DCR Graphs with milestones, and then extending the previously given mapping from DCR Graphs to Buchi-automata to include the milestone relation....

  19. Conditionally Optimal Weights of Evidence

    Institute of Scientific and Technical Information of China (English)

    Stephan Morgenthaler; Robert G. Staudte

    2005-01-01

    A weight of evidence is a calibrated statistic whose wlues in [0, 1] indicate the degree of agreement between the data and either of two hypothesis, one being treated as the null (H0) and the other as the alternative (H1). A wlue of zero means perfect agreement with the null, whereas a value of one means perfect agreement with the alternative. The optimality we consider is minimal mean squared error (MSE) under the alternative while keeping the MSE under the null below a fixed bound. This paper studies such statistics from a conditional point of view, in particular for location and scale models.

  20. Budget support, conditionality and poverty.

    OpenAIRE

    Mosley, P.; Suleiman, A.

    2005-01-01

    This paper examines the effectiveness of budget support aid as an anti-poverty instrument. We argue that a major determinant of this effectiveness is the element of trust – or `social capital´, as it may be seen – which builds up between representatives of the donor and recipient. Thus we model the conditionality processes attending budget support aid, not purely in the conventional way as a non-cooperative two-person game, but rather as a non-cooperative game which may mutate into a collabor...

  1. Pharmacologic Therapies in Musculoskeletal Conditions.

    Science.gov (United States)

    Loveless, Melinda S; Fry, Adrielle L

    2016-07-01

    Musculoskeletal conditions are common, and there are many options for pharmacologic therapy. Unfortunately, there is not strong evidence for the use of many of these medications. Acetaminophen and nonsteroidal anti-inflammatory drugs (NSAIDs) are generally first-line medications for most musculoskeletal pain, but there is more evidence these medications are not as safe as once thought. Other analgesic and antispasmodic medications can be effective for acute pain but generally are not as effective for chronic pain. Antidepressants and anticonvulsants can be more effective for chronic or neuropathic pain. Topical formulations of NSAIDs can be effective for pain with fewer side effects. PMID:27235619

  2. Pavlovian conditioning and multiple chemical sensitivity.

    OpenAIRE

    Siegel, S.; Kreutzer, R

    1997-01-01

    Pavlovian conditioning processes may contribute to some symptoms of multiple chemical sensitivity (MCS). This review summarizes the potential relevance of the literature on conditional taste and olfactory aversions, conditional sensitization, and conditional immunomodulation to understanding MCS. A conditioning-based perspective on MCS suggests novel research and treatment strategies.

  3. Directionality Effect in Double Conditionals.

    Science.gov (United States)

    Espino, Orlando; Sánchez-Curbelo, Isana; Bolaños-Medina, Alicia

    2015-01-01

    Directionality effect in deductive reasoning is a very well-known phenomenon that shows that the percentage of forward or backward inferences that participants make depends on the conditional form used. A new extension of the semantic hypothesis (Oberauer & Wilhelm, 2000) is presented to explain the directionality effect in double conditionals with different directionality. This hypothesis claims that the directional effect depends on which term plays the role of relatum. It also makes several novel claims which have been confirmed in three experiments: Experiments 1 and 2 showed there were more forward than backward inferences when the end-term that played the role of relatum was in the first premise, experiment 1: t (45) = 2.73, p < .01, experiment 2: t (38) = 12.06, p < .05, but there were more backward than forward inferences when the end-term that played the role of relatum was in the second premise, experiment 1: t (45) = 2.84, p < .01, experiment 2: t (38) = 2.21, p < .04. Experiment 3 showed that there was no directional effect when both end-terms played the role of relatum, t (34) = 1.39, p = .17, or when both middle-terms (or neither of the end-terms) played the role of relatum, t (34) = .78, p = .44. These experiments confirmed the predictions of the new extension of the semantic hypothesis. PMID:26239471

  4. Geosynchronous magnetopause crossings: upstream conditions

    CERN Document Server

    Suvorova, A; Chao, J -K; Thomsen, M; Yang, Y -H

    2011-01-01

    The experimental data on GOES magnetic measurements and plasma measurements on LANL geosynchronous satellites is used for selection of 169 case events containing 638 geosynchronous magnetopause crossings (GMCs) in 1995 to 2001. We study the necessary conditions for the geosynchronous magnetopause crossings using scatter plot of the GMCs in the coordinate space of Psw versus Bz. In such representation the upstream solar wind conditions demonstrate sharp envelope boundary under which no GMCs are occurred. The boundary has two strait horizontal branches where Bz does not influence on the magnetopause location. The first branch is located in the range of Psw=21 nPa for large positive Bz and is associated with an asymptotic regime of the pressure balance. The second branch asymptotically approaches to the range of Psw=4.8 nPa under very strong negative Bz and it is associated with a regime of the Bz influence saturation. We suggest that the saturation is caused by relatively high contribution of the magnetosphere ...

  5. Careers in conditions of instability

    Directory of Open Access Journals (Sweden)

    Hohlova Valentina Vasil'evna

    2016-04-01

    Full Text Available The purpose of this work is the research of the social-economic phenomenon of a career as a result of conscious human position and behaviour in the field of employment, which is connected with job and professional growth, as a chain of events which are components of life, the sequence of professional activities and other biographical roles, which all together express the commitment of a person’s activity according to his generalized model of self-development. On the basis of the theoretical analysis the dependence of making a career in the condition of instability and indefiniteness on job market flexibility, erosion and even the destruction of the usual way of life and labor relations. The career concepts under the conditions of flexible capitalism and of career policy as the typology of empiric differences of job biographic models are considered. The peculiarity of the proposed career policy concept is that its individual alternatives of career making oppose to organization management and personal demands: the difference between a professional’s wishes and a specific strategy of the development phases are quite noticeable. According to the results of empiric research carried out through the methods of interview, polling, expert assessment, the analysis of the received results, the mathematical data processing the basic types of the career policy and its connection with the organization’s personal development are revealed.

  6. Coordination of Conditional Poisson Samples

    Directory of Open Access Journals (Sweden)

    Grafström Anton

    2015-12-01

    Full Text Available Sample coordination seeks to maximize or to minimize the overlap of two or more samples. The former is known as positive coordination, and the latter as negative coordination. Positive coordination is mainly used for estimation purposes and to reduce data collection costs. Negative coordination is mainly performed to diminish the response burden of the sampled units. Poisson sampling design with permanent random numbers provides an optimum coordination degree of two or more samples. The size of a Poisson sample is, however, random. Conditional Poisson (CP sampling is a modification of the classical Poisson sampling that produces a fixed-size πps sample. We introduce two methods to coordinate Conditional Poisson samples over time or simultaneously. The first one uses permanent random numbers and the list-sequential implementation of CP sampling. The second method uses a CP sample in the first selection and provides an approximate one in the second selection because the prescribed inclusion probabilities are not respected exactly. The methods are evaluated using the size of the expected sample overlap, and are compared with their competitors using Monte Carlo simulation. The new methods provide a good coordination degree of two samples, close to the performance of Poisson sampling with permanent random numbers.

  7. A Class of DSm Conditional Rules

    OpenAIRE

    Smarandache, Florentin; Alford, Mark

    2009-01-01

    In this paper we introduce two new DSm fusion conditioning rules with example, and as a generalization of them a class of DSm fusion conditioning rules, and then extend them to a class of DSm conditioning rules.

  8. 42 CFR 65.9 - Additional conditions.

    Science.gov (United States)

    2010-10-01

    ... conditions. The Director may with respect to any award impose additional conditions prior to, or at the time of, any award when, in the Director's judgment, such conditions are necessary to assure the...

  9. Uncertain deduction and conditional reasoning

    Directory of Open Access Journals (Sweden)

    Jonathan St B T Evans

    2015-04-01

    Full Text Available There has been a paradigm shift in the psychology of deductive reasoning. Many researchers no longer think it is appropriate to ask people to assume premises and decide what necessarily follows, with the results evaluated by binary extensional logic. Most every day and scientific inference is made from more or less confidently held beliefs and not assumptions, and the relevant normative standard is Bayesian probability theory. We argue that the study of uncertain deduction should directly ask people to assign probabilities to both premises and conclusions, and report an experiment using this method. We assess this reasoning by two Bayesian metrics: probabilistic validity and coherence according to probability theory. On both measures, participants perform above chance in conditional reasoning, but they do much better when statements are grouped as inferences, rather than evaluated in separate tasks.

  10. Uncertain deduction and conditional reasoning.

    Science.gov (United States)

    Evans, Jonathan St B T; Thompson, Valerie A; Over, David E

    2015-01-01

    There has been a paradigm shift in the psychology of deductive reasoning. Many researchers no longer think it is appropriate to ask people to assume premises and decide what necessarily follows, with the results evaluated by binary extensional logic. Most every day and scientific inference is made from more or less confidently held beliefs and not assumptions, and the relevant normative standard is Bayesian probability theory. We argue that the study of "uncertain deduction" should directly ask people to assign probabilities to both premises and conclusions, and report an experiment using this method. We assess this reasoning by two Bayesian metrics: probabilistic validity and coherence according to probability theory. On both measures, participants perform above chance in conditional reasoning, but they do much better when statements are grouped as inferences, rather than evaluated in separate tasks. PMID:25904888

  11. Thermal boundary conditions as constraints

    CERN Document Server

    Fosco, C D; Roditi, I

    2006-01-01

    We introduce the boundary conditions corresponding to the imaginary-time (Matsubara) formalism for the finite-temperature partition function in $d+1$ dimensions as {\\em constraints} in the path integral for the vacuum amplitude (the zero-temperature partition function). We implement those constraints by using Lagrange multipliers, which are static fields, two of them associated to each physical degree of freedom. After integrating out the original, physical fields, we obtain an effective representation for the partition function, depending only on the Lagrange multipliers. The resulting functional integral has the appealing property of involving only $d$-dimensional, {\\em time independent} fields, looking like a non local version of the classical partition function. We analyze the main properties of this novel representation for the partition function, developing the formalism within the context of two concrete examples: the real scalar and Dirac fields.

  12. Conditioning of HLW-calcines

    International Nuclear Information System (INIS)

    Our program on waste conditioning alternatives includes the study of coatings of simulated highly radioactive waste granules with nickel. From pyrolytical decomposed nickeltetracarbonyl nickel was deposited by chemical vapor deposition in a fluidized bed. Advantages of this method are the low coating temperatures (at about 470 K), at which suitable coatings could obtained by a special adaption of the performance. Pure nickel layers were deposited, of which the tightness, thickness, mechanical stability, crystallite size and its characterization in optical and microoptical examinations were tested. The results of the quality control showed a remarkable increase in mechanical stability, leach resistance and thermal conductivity of the coated waste granules. Therefore the obtained ductile and well adherent nickel-coatings are preferably applicable as one of protective shells in a multibarrier waste concept. (author)

  13. INDIVIDUAL AGENCY AND LIFE CONDITIONS

    Directory of Open Access Journals (Sweden)

    SERGIO TRUJILLO GARCÍA

    2005-07-01

    Full Text Available As a result of the project Interpretación desde la Psicología de la calidad de vida y sus dimensiones en adultos mayores de losmunicipios de Soacha y Sibaté (Cundinamarca, Colombia [Interpretation from the psychology of the Quality of Life and itsdimensions in old age adults from the Soacha and Sibaté municipalities (Cundinamarca, Colombia] which had a theoretical modelcomposed for three axels (epistemological, ecological and temporal, emerged some tensions which constitute thequality of life dimensions of the elderly. In the present article one of those tensions is discussed: the one shaped bythe contradictions among the possibilities of the individual agency exercise and the precarious life conditions whichhad characterized the context of development of the old age participants.

  14. Large errors and severe conditions

    CERN Document Server

    Smith, D L; Van Wormer, L A

    2002-01-01

    Physical parameters that can assume real-number values over a continuous range are generally represented by inherently positive random variables. However, if the uncertainties in these parameters are significant (large errors), conventional means of representing and manipulating the associated variables can lead to erroneous results. Instead, all analyses involving them must be conducted in a probabilistic framework. Several issues must be considered: First, non-linear functional relations between primary and derived variables may lead to significant 'error amplification' (severe conditions). Second, the commonly used normal (Gaussian) probability distribution must be replaced by a more appropriate function that avoids the occurrence of negative sampling results. Third, both primary random variables and those derived through well-defined functions must be dealt with entirely in terms of their probability distributions. Parameter 'values' and 'errors' should be interpreted as specific moments of these probabil...

  15. On the local equilibrium condition

    International Nuclear Information System (INIS)

    A physical system is in local equilibrium if it cannot be distinguished from a global equilibrium by ''infinitesimally localized measurements''. This should be a natural characterization of local equilibrium, but the problem is to give a precise meaning to the qualitative phrase ''infinitesimally localized measurements''. A solution is suggested in form of a Local Equilibrium Condition (LEC), which can be applied to linear relativistic quantum field theories but not directly to selfinteracting quantum fields. The concept of local temperature resulting from LEC is compared to an old approach to local temperature based on the principle of maximal entropy. It is shown that the principle of maximal entropy does not always lead to physical states if it is applied to relativistic quantum field theories. (orig.)

  16. Life conditions of Sicilian centenarians.

    Science.gov (United States)

    Receputo, G; Rapisarda, R; Mazzoleni, G; Fornaro, D; Tomasello, F B; Di Stefano, S; Savia, S; Cilmi, V; Malacuarnera, M

    1996-01-01

    Aim of the study was at furnishing a description of the socio-economic reality of Sicilian centenarians. Informations were taken from the records of Italian Multicentric Study on Centenarians. Randomly selected 28 centenarians (8 males, 20 females), in the age range 100-108 years from Eastern Sicily were examined. The following average socioeconomic profile of the centenarians was established: they are widows or widowers with 4 children; have primary education, mediocre socioeconomic conditions, have worked in the fields or had been housewives; their hobbies were before gardening or embroidering and sewing and now is watching TV; they live in their own salubrious 4 roomed house in small center in the hills. These observations reveal that the social and intellectual quality of life is better in cases of centenarian subjects living at home, in their family environment, surrounded by their children and grandchildren as they receive greater affection and physical care than those living in old peoples' homes. PMID:18653069

  17. Astrophysical Conditions for Planetary Habitability

    CERN Document Server

    Guedel, M; Erkaev, N; Kasting, J; Khodachenko, M; Lammer, H; Pilat-Lohinger, E; Rauer, H; Ribas, I; Wood, B E

    2014-01-01

    With the discovery of hundreds of exoplanets and a potentially huge number of Earth-like planets waiting to be discovered, the conditions for their habitability have become a focal point in exoplanetary research. The classical picture of habitable zones primarily relies on the stellar flux allowing liquid water to exist on the surface of an Earth-like planet with a suitable atmosphere. However, numerous further stellar and planetary properties constrain habitability. Apart from "geophysical" processes depending on the internal structure and composition of a planet, a complex array of astrophysical factors additionally determine habitability. Among these, variable stellar UV, EUV, and X-ray radiation, stellar and interplanetary magnetic fields, ionized winds, and energetic particles control the constitution of upper planetary atmospheres and their physical and chemical evolution. Short- and long-term stellar variability necessitates full time-dependent studies to understand planetary habitability at any point ...

  18. LDA measurements under plasma conditions

    International Nuclear Information System (INIS)

    A study was made of the application of Laser Doppler Anemometry (LDA) for the measurement of the fluid and particle velocities under plasma conditions. The flow configuration, is that of a dc plasma jet called the principal jet, in which an alumina powder of a mean particle diameter of 115 μm and a standard deviation of 11.3 μm was injected using a secondary jet. The plasma jet immerged from a 7.1 mm ID nozzle while that of the secondary jet was 2 nm in diameter. The secondary jet was introduced at the nozzle level of the plasma jet directed 900 to its axis. Details of the nozzle and the gas flow system are shown in Figure 2

  19. Thermodynamic condition for ''Gamma'' flotation

    International Nuclear Information System (INIS)

    Using the definition of the critical surface tension of wetting solids (Γc) and Gibb's adsorption isotherm, coupled with Young-Dupre's equation, the equilibrium thermodynamic condition for 'GAMMA' flotation has been derived. It is defined by the relation, Cos Oe=Γc/Γlg. At equilibrium for 'Gamma' flotation to occur, the liquid/gas interfacial tension (9γlg) should be larger than the critical surface tension of wetting of the solid surface, meaning that the equilibrium contact angle (Oe) should be greater than Zero, or cos Oe < 1, a Pre- requisite for the solid/gas bubble attachment. This definition holds for solid surfaces in the absence of any specific adsorption at the solid/liquid and solid/gas inter faces. Contact angle and flotation data are presented to sustain this definition. (author)., 15 refs., 9 figs

  20. Carbon tetrachloride under extreme conditions

    Energy Technology Data Exchange (ETDEWEB)

    Pravica, Michael, E-mail: pravica@physics.unlv.edu; Sneed, Daniel; Wang, Yonggang; Smith, Quinlan [High Pressure Science and Engineering Center (HiPSEC) and Department of Physics, University of Nevada Las Vegas (UNLV), Las Vegas, Nevada 89154-4002 (United States); Subrahmanyam, Garimella [Canadian Light Source, Department of Physics, University of Saskatchewan, Saskatoon, Saskatchewan S7N 2V3 (Canada)

    2014-05-21

    We report on three experiments on carbon tetrachloride subjected to extreme conditions. In the first experiment, Raman spectra of CCl{sub 4} were acquired up to 28 GPa. Evidence was observed for at least two new phases of CCl{sub 4} above 14 GPa (phase VI) and above 22 GPa (phase VII). Decompression of the sample showed no evidence of pressure-induced decomposition. In the second experiment, a synchrotron x-ray diffraction study was performed up to 30 GPa verifying phase V and potential phases above 14 (VI) and 22 GPa (VII), respectively. In the third study, we examined irradiated CCl{sub 4} using synchrotron infrared spectroscopy to reduce fluorescent contamination. Some sort of carbon allotrope appears as a byproduct suggesting the following reaction with hard x-rays: CCl{sub 4}+ hν → C + 2Cl{sub 2}.

  1. LDA measurements under plasma conditions

    Energy Technology Data Exchange (ETDEWEB)

    Lesinski, J.; Mizera-Lesinska, B.; Fanton, J.C.; Boulos, M.I.

    1979-01-01

    A study was made of the application of Laser Doppler Anemometry (LDA) for the measurement of the fluid and particle velocities under plasma conditions. The flow configuration, is that of a dc plasma jet called the principal jet, in which an alumina powder of a mean particle diameter of 115 ..mu..m and a standard deviation of 11.3 ..mu..m was injected using a secondary jet. The plasma jet immerged from a 7.1 mm ID nozzle while that of the secondary jet was 2 nm in diameter. The secondary jet was introduced at the nozzle level of the plasma jet directed 90/sup 0/ to its axis. Details of the nozzle and the gas flow system are shown in Figure 2.

  2. Bacterial survival in Martian conditions

    CERN Document Server

    D'Alessandro, Giuseppe Galletta; Giulio Bertoloni; Maurizio

    2010-01-01

    We shortly discuss the observable consequences of the two hypotheses about the origin of life on Earth and Mars: the Lithopanspermia (Mars to Earth or viceversa) and the origin from a unique progenitor, that for Earth is called LUCA (the LUCA hypothesis). To test the possibility that some lifeforms similar to the terrestrial ones may survive on Mars, we designed and built two simulators of Martian environments where to perform experiments with different bacterial strains: LISA and mini-LISA. Our LISA environmental chambers can reproduce the conditions of many Martian locations near the surface trough changes of temperature, pressure, UV fluence and atmospheric composition. Both simulators are open to collaboration with other laboratories interested in performing experiments on many kind of samples (biological, minerals, electronic) in situations similar to that of the red planet. Inside LISA we have studied the survival of several bacterial strains and endospores. We verified that the UV light is the major re...

  3. Radioisotope studies under pathologic conditions

    International Nuclear Information System (INIS)

    This article presents a general discussion on salivary pathology, before dealing with the various salivary gland diseases which can draw real advantage from radioisotope studies. Clinical problems related to the salivary glands first concern diffuse or focal glandular swelling. Focal swelling includes inflammatory or metastatic deposits in preauricular or submandibular lymph nodes, cysts, abscesses, foci of inflammation, benign and malignant neoplasms of the salivary glands themselves or of surrounding blood or lymph vessels, nerves, connective tissue, and oral mucosa. Primary tumors of the salivary glands are rare and usually benign. The combination of a systemic disease with dry mouth and dry eyes due to inflamed conjunctiva and cornea because of decreased fluid production, forms Sjogren syndrome. It may also cause diffuse glandular swelling. Chronic alcoholism, cirrhosis, diabetes mellitus, hyperlipoproteinemia, and malnutrition are other pathologic conditions sometimes associated with diffuse salivary gland swelling

  4. Topcolor breaking through boundary conditions

    International Nuclear Information System (INIS)

    The nontrivial boundary conditions (BC's) for the topcolor breaking are investigated in the context of the TeV-scale extra dimension scenario. In the gauge symmetry breaking mechanism via the BC's we do not need to incorporate a dynamical mechanism for the topcolor breaking into the model. Moreover, the topcolor breaking can be realized without introducing explicitly a (composite) scalar field. We present a six dimensional model where the top and bottom quarks in the bulk have the topcolor charge while the other quarks in the bulk do not. We also put the electroweak gauge interaction in the six dimensional bulk. The bottom quark condensation is naturally suppressed owing to the powerlike running of the bulk U(1)Y interaction, so that only the top condensation is expected to take place. We explore such a possibility based on the ladder Schwinger-Dyson equation and show the cutoff to make the model viable

  5. Ocean climate and seal condition

    Directory of Open Access Journals (Sweden)

    Crocker Daniel E

    2005-03-01

    Full Text Available Abstract Background The condition of many marine mammals varies with fluctuations in productivity and food supply in the ocean basin where they forage. Prey is impacted by physical environmental variables such as cyclic warming trends. The weaning weight of northern elephant seal pups, Mirounga angustirostris, being closely linked to maternal condition, indirectly reflects prey availability and foraging success of pregnant females in deep waters of the northeastern Pacific. The aim of this study was to examine the effect of ocean climate on foraging success in this deep-diving marine mammal over the course of three decades, using cohort weaning weight as the principal metric of successful resource accrual. Results The mean annual weaning weight of pups declined from 1975 to the late 1990s, a period characterized by a large-scale, basin-wide warm decadal regime that included multiple strong or long-duration El Niños; and increased with a return to a cool decadal regime from about 1999 to 2004. Increased foraging effort and decreased mass gain of adult females, indicative of reduced foraging success and nutritional stress, were associated with high ocean temperatures. Conclusion Despite ranging widely and foraging deeply in cold waters beyond coastal thermoclines in the northeastern Pacific, elephant seals are impacted significantly by ocean thermal dynamics. Ocean warming redistributes prey decreasing foraging success of females, which in turn leads to lower weaning mass of pups. Annual fluctuations in weaning mass, in turn, reflect the foraging success of females during the year prior to giving birth and signals changes in ocean temperature cycles.

  6. Radiation safety under extreme conditions

    International Nuclear Information System (INIS)

    A description is given of the main radiation safety provisions implemented during the erection of the encapsulation of Unit 4 of the Chernobyl nuclear power plant after the accident on 26 April 1986. The radiation situation at the site during the work was characterized by high radiation levels and radioactive contamination of the area and the buildings. The situation was highly complex and developments were difficult to forecast. In view of the extremely dangerous radiation conditions, the large volume of construction and assembly work had to be carried out within a very limited period of time. Work in the vicinity of the destroyed unit was carried out only after radiation reconnaissance had been performed, the main radiation sources determined, and safe working regulations formulated. Both traditional and specially developed methods were used to monitor the radiation situation. On the basis of radiation reconnaissance and radiation situation monitoring results, organizational and technical measures were developed and implemented to ensure the radiation safety of personnel. During the construction work, extensive use was made of remote controlled machinery and technology and various types of radiation protection cabins and screens were employed. Great emphasis was placed on the implementation of technical health precautions. A health checkpoint regime was instituted in the exclusion zone around the plant with changing areas, radiation monitoring areas, and shower rooms. Staff were equipped with special clothing, special footwear, and apparatus to protect the respiratory organs. By November 1986 the destroyed unit had been rendered safe and conditions restored for continued operation of the three remaining units. Radiation safety requirements were complied with during the work. (author). 6 refs, 5 figs, 1 tab

  7. Hot conditioning equipment conceptual design report

    Energy Technology Data Exchange (ETDEWEB)

    Bradshaw, F.W., Westinghouse Hanford

    1996-08-06

    This report documents the conceptual design of the Hot Conditioning System Equipment. The Hot conditioning System will consist of two separate designs: the Hot Conditioning System Equipment; and the Hot Conditioning System Annex. The Hot Conditioning System Equipment Design includes the equipment such as ovens, vacuum pumps, inert gas delivery systems, etc.necessary to condition spent nuclear fuel currently in storage in the K Basins of the Hanford Site. The Hot Conditioning System Annex consists of the facility of house the Hot Conditioning System. The Hot Conditioning System will be housed in an annex to the Canister Storage Building. The Hot Conditioning System will consist of pits in the floor which contain ovens in which the spent nuclear will be conditioned prior to interim storage.

  8. Hot conditioning equipment conceptual design report

    International Nuclear Information System (INIS)

    This report documents the conceptual design of the Hot Conditioning System Equipment. The Hot conditioning System will consist of two separate designs: the Hot Conditioning System Equipment; and the Hot Conditioning System Annex. The Hot Conditioning System Equipment Design includes the equipment such as ovens, vacuum pumps, inert gas delivery systems, etc.necessary to condition spent nuclear fuel currently in storage in the K Basins of the Hanford Site. The Hot Conditioning System Annex consists of the facility of house the Hot Conditioning System. The Hot Conditioning System will be housed in an annex to the Canister Storage Building. The Hot Conditioning System will consist of pits in the floor which contain ovens in which the spent nuclear will be conditioned prior to interim storage

  9. Conditional Generation of Monthly Precipitation

    Science.gov (United States)

    Kim, U.; Kaluarachchi, J. J.

    2006-12-01

    Monthly precipitation models can be used in basin-wide modeling to develop long-term strategies for water resources planning and management and to estimate the change of water yield due to climate change. Such precipitation models are especially important for effective management of river basins in developing countries such as the upper Blue Nile River basin of Ethiopia where the water resource utilization is limited. Many studies have been previously performed to preserve historical temporal and spatial structures when generating precipitation series. The main focus of those studies was to preserve the historical statistics. Other important factors to be considered are transition and spatial correlations. A few recent studies attempted to preserve transition as well as the statistics of historical record. These studies provided satisfactory results while showing the difficulty and complexity of computations in their methods. The conditional generation method (CGM) that can preserve both historical temporal and spatial structures is presented in this study. Because the CGM is driven from the historical conditional probabilities occurring given amounts of precipitation between two successive months or two stations, it is computationally simple and reliable, i.e., parameterization, inverse matrix, or optimum band width is not required. The CGM was applied to reproducing the precipitation pattern of the upper Blue Nile River basin in Ethiopia using monthly precipitation data of 10 stations to demonstrate its applicability. Comparing to the method of inverse transformation of cumulative distribution functions of the gamma distribution and nonparametric kernel estimator with variable band width selected from the goodness-of-fit tests, the CGM showed improved performance, especially in representing the transition characteristics. The CGM also generated the historical spatial correlations between the stations with acceptable accuracy. The results suggested that the CGM

  10. Inspection of environmental conditions 1991

    International Nuclear Information System (INIS)

    A comprehensive survey of environmentally protective activities (including inspections or surveillance, planning, the giving of guidelines and approvals) carried out by Danish local authorities and municipalities on pollutive/environmental conditions related to public services, companies and agriculture during 1991. Administrative details are given. The survey is based on the accounts of the inspections produced by the individual authorities. Information is given on the extent of these projects, the nature of the activities involved and the evaluation of them made by the (Danish) National Agency for Environmental Protection. In the appendices data is presented on the percentage of companies visited, the amounts of oil and chemical industrial wastes, the visited farms, the average number of domestic animals held, the nitrate content of drinking water in a number of specified waterworks, the number of objects of inspection, the number of enforcements in relation to the number of inspections and organic substances discharged from sewage works. Other related data, for example on the management of wastes, illustrate the detailed text. (AB)

  11. The ATLAS beam conditions monitor

    CERN Document Server

    Mikuz, M; Dolenc, I; Kagan, H; Kramberger, G; Frais-Kölbl, H; Gorisek, A; Griesmayer, E; Mandic, I; Pernegger, H; Trischuk, W; Weilhammer, P; Zavrtanik, M

    2006-01-01

    The ATLAS beam conditions monitor is being developed as a stand-alone device allowing to separate LHC collisions from background events induced either on beam gas or by beam accidents, for example scraping at the collimators upstream the spectrometer. This separation can be achieved by timing coincidences between two stations placed symmetric around the interaction point. The 25 ns repetition of collisions poses very stringent requirements on the timing resolution. The optimum separation between collision and background events is just 12.5 ns implying a distance of 3.8 m between the two stations. 3 ns wide pulses are required with 1 ns rise time and baseline restoration in 10 ns. Combined with the radiation field of 10/sup 15/ cm/sup -2/ in 10 years of LHC operation only diamond detectors are considered suitable for this task. pCVD diamond pad detectors of 1 cm/sup 2/ and around 500 mum thickness were assembled with a two-stage RF current amplifier and tested in proton beam at MGH, Boston and SPS pion beam at...

  12. Large errors and severe conditions

    International Nuclear Information System (INIS)

    Physical parameters that can assume real-number values over a continuous range are generally represented by inherently positive random variables. However, if the uncertainties in these parameters are significant (large errors), conventional means of representing and manipulating the associated variables can lead to erroneous results. Instead, all analyses involving them must be conducted in a probabilistic framework. Several issues must be considered: First, non-linear functional relations between primary and derived variables may lead to significant 'error amplification' (severe conditions). Second, the commonly used normal (Gaussian) probability distribution must be replaced by a more appropriate function that avoids the occurrence of negative sampling results. Third, both primary random variables and those derived through well-defined functions must be dealt with entirely in terms of their probability distributions. Parameter 'values' and 'errors' should be interpreted as specific moments of these probability distributions. Fourth, there are pragmatic reasons for seeking convenient analytical formulas to approximate the 'true' probability distributions of derived parameters generated by Monte Carlo simulation. This paper discusses each of these issues and illustrates the main concepts with realistic examples involving radioactivity decay and nuclear astrophysics

  13. WORK CONDITIONS OF CHAINSAW OPERATORS

    Directory of Open Access Journals (Sweden)

    Jorge Roberto Malinovski

    2002-01-01

    Full Text Available The objective of this research was to analyze the human factors and the work conditions in clear-cutting operations using chainsaws in mountainous areas. Data were colected in a forestry company in Minas Gerais, Brazil, by interviews with 29 chainsaw operators. The results indicated that the operators average age was 32.3 years, height 1.68m and body weight 64.4Kg. The average job time in the company was 112 months and the average time of chainsaw operation experience was 81.5 months. Most (93.1% were dexterous and 6.9% were left-handed. The high incidence of backache (41.4% indicated that the task demands an overload of lumbar column, so that the company should take preventive measures to avoid backaches, using educational strategies or changing the opera-tional system. The high level of accidents (44.8% indicated that some precautions are needed to im-prove work safety.

  14. Noise exposure under hyperbaric conditions

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-03-01

    Objective evidence exists that divers demonstrate a hearing deficit greater than would be expected from ageing effects alone. Deafness in divers may be caused by a number of factors other than exposure to excessive noise levels, eg barotrauma, ear infection etc. This review concentrates on the concern that exposure of commercial divers to noise while at work may cause a hearing deficit. Sound pressure levels recorded both underwater and in diving chambers often exceed those allowable to workers onshore. However, the sound perceived by the diver is modified both in amplitude and in frequency when he is either underwater or in pressurised chambers. Broadly the effect of this modification is to attenuate the sound and thus offer some protection from high noise levels. The degree of attentuation varies with the frequency of the sound, however it is also possible under specific conditions associated with gas density for the sensitivity to particular frequencies to be amplified above that for normal atmospheric air. The levels of sound observed from some underwater tools are of concern even after allowing for a significant de-sensitisation of the divers` hearing. Reports of tinnitus and temporary hearing loss following a dive are sure signs that the noise levels have been harmful. It is not possible at present to describe risk criteria for hearing damage due to noise exposure associated with diving. (author)

  15. Facility engineering for Arctic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, D.M.; McClusky, K.R.; Shirley, R.; Spitzenberger, R. [Mustang Engineering Inc., Houston, TX (United States)

    2001-07-01

    The Northstar Development Project is located on Seal Island in the Beaufort Sea, north of Prudhoe Bay. The design and engineering of the facilities for the Northstar Development Project was fraught with challenges. Mustang Engineering Incorporated was involved in the design and engineering of the pipe rack, pump house, process and compressor modules. All the characteristics of an offshore facility are present, even though the project is land-based on a man-made island. A number of the strategies developed for offshore platforms of the Gulf of Mexico were adapted to the fabrication, logistics and installation of the modules. To reduce yard fabrication time, a modularized design concept was adopted. Cost savings and onsite fabrication efficiencies were realized through open communication with the operator, early discussions with vendors, regulatory agencies, and local fabrication and installation contractors. Some improvisation and deviations were required to meet the stringent requirements for operation under Arctic conditions. The lessons learned on this project will be of use in future Arctic projects. 1 tab., 6 figs.

  16. Kinetic Initial Conditions for Inflation

    CERN Document Server

    Handley, W J; Lasenby, A N; Hobson, M P

    2014-01-01

    We consider the classical evolution of the inflaton field $\\phi(t)$ and the Hubble parameter $H(t)$ in homogeneous and isotropic single-field inflation models. Under an extremely broad assumption, we show that the universe generically emerges from an initial singularity in a non-inflating state where the kinetic energy of the inflaton dominates its potential energy, $\\dot{\\phi}^2 \\gg V(\\phi)$. In this kinetically-dominated regime, the dynamical equations admit simple analytic solutions for $\\phi(t)$ and $H(t)$, which are independent of the form of $V(\\phi)$. In such models, these analytic solutions thus provide a simple way of setting the initial conditions from which to start the (usually numerical) integration of the coupled equations of motion for $\\phi(t)$ and $H(t)$. We illustrate this procedure by applying it to spatially-flat models with polynomial and exponential potentials, and determine the background evolution in each case; generically $H(t)$ and $|\\phi(t)|$ as well as their time derivatives decrea...

  17. Efficient robust conditional random fields.

    Science.gov (United States)

    Song, Dongjin; Liu, Wei; Zhou, Tianyi; Tao, Dacheng; Meyer, David A

    2015-10-01

    Conditional random fields (CRFs) are a flexible yet powerful probabilistic approach and have shown advantages for popular applications in various areas, including text analysis, bioinformatics, and computer vision. Traditional CRF models, however, are incapable of selecting relevant features as well as suppressing noise from noisy original features. Moreover, conventional optimization methods often converge slowly in solving the training procedure of CRFs, and will degrade significantly for tasks with a large number of samples and features. In this paper, we propose robust CRFs (RCRFs) to simultaneously select relevant features. An optimal gradient method (OGM) is further designed to train RCRFs efficiently. Specifically, the proposed RCRFs employ the l1 norm of the model parameters to regularize the objective used by traditional CRFs, therefore enabling discovery of the relevant unary features and pairwise features of CRFs. In each iteration of OGM, the gradient direction is determined jointly by the current gradient together with the historical gradients, and the Lipschitz constant is leveraged to specify the proper step size. We show that an OGM can tackle the RCRF model training very efficiently, achieving the optimal convergence rate [Formula: see text] (where k is the number of iterations). This convergence rate is theoretically superior to the convergence rate O(1/k) of previous first-order optimization methods. Extensive experiments performed on three practical image segmentation tasks demonstrate the efficacy of OGM in training our proposed RCRFs. PMID:26080050

  18. 14 CFR 25.349 - Rolling conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Rolling conditions. 25.349 Section 25.349... STANDARDS: TRANSPORT CATEGORY AIRPLANES Structure Flight Maneuver and Gust Conditions § 25.349 Rolling conditions. The airplane must be designed for loads resulting from the rolling conditions specified...

  19. 14 CFR 23.349 - Rolling conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Rolling conditions. 23.349 Section 23.349... Rolling conditions. The wing and wing bracing must be designed for the following loading conditions: (a..., the rolling accelerations may be obtained by modifying the symmetrical flight conditions in §...

  20. Boundary Conditions in an Electric Current Contact

    OpenAIRE

    Titov, O. Yu.; Giraldo, J.; Gurevich, Yu. G.

    2002-01-01

    In most electronic devices, electric current of both types (electrons and holes) flows through a junction. Usually the boundary conditions have been formulated exclusively for open circuit. The boundary conditions proposed here bypass this limitation by the first time, as far as we are aware. Besides, these new boundary conditions correctly describe current flow in a circuit, i.e., closed circuit conditions, which are the usual operation conditions for electronic devices and for the measureme...

  1. Musculus gastrocnemius tetanus kinetics in alcohol-intoxicated rats with experimentally-induced hindlimb vascular ischemia under conditions of low-frequence muscle fatigue

    Directory of Open Access Journals (Sweden)

    O. A. Melnychuk

    2014-04-01

    Full Text Available Alcohol intoxication and ischemic injury of skeletal muscles often accompany each other. It is shown that patients hospitalized with chronic alcoholism develop muscle fatigue. Skeletal muscle dysfunction in alcohol-dependent patients is caused by ethanol-associated myofibrillar atrophy and metabolic disbalance, while compression-ischemic lesions result from unconsciousness of the patient, in case of taking the critical alcohol dose. Therefore, the aim of this study is to discover typical m. gastrocnemius (cap. med. tetanic kinetics changes in alcohol intoxicated rats with experimentally induced vascular ischemia of hindlimb muscles under conditions of low-frequency progressive muscle fatigue. Experiments were carried out on 10 young male Wistar rats (149.5 ± 5.8 g kept under standard vivarium conditions and diet. The investigation was conducted in two phases: chronic (30 days and acute (3 hours experiment. All surgical procedures were carried out aseptically under general anesthesia. Ishemic m. gastrocnemius (cap. med. tetanic kinetic changes and force productivity in alcohol intoxicated rats were investigated in the isometric mode, with direct electrical stimulation. The fatigue of m. gastrocnemius (cap. med. was evaluated by three characteristic criteria: the first sag effect, the secondary force rise, the second sag effect. There have been 10 similar experiments: 5 series in each study group with 10 tetanic runs in each series. The highest amplitude of the native m. gastrocnemius (cap. med. tetanus relative to isoline was taken as 100% force response. The same pattern of m. gastrocnemius (cap. med. low-frequency fatigue development was found in both rat groups under study. It is evidenced by the absence of substantial m. gastrocnemius (cap. med. tetanus kinetics differences in alcohol intoxicated rats, compared with non-alcohol intoxicated rats during fatigue test. However, the appreciable m. gastrocnemius (cap. med. tetanic force reduction

  2. Aseptic osteonecrosis of the hip in the adult: current evidence on conservative treatment.

    Science.gov (United States)

    Klumpp, Raymond; Trevisan, Carlo

    2015-01-01

    Treatment of Avascular Osteonecrosis (AVN) of the femoral head to prevent progression to an arthritic hip is a challenging subject. Many conservative treatment options have been proposed in the literature. Weight bearing restriction as a stand-alone therapy is insufficient in preventing disease progression but it may be useful when combined with pharmacological agents or surgery. Bisphosphonate treatment in AVN might be efficient in early stages of disease, however there are no clear recommendations on length of treatment and therapeutic dosage and, considered the limited evidence and potential side effects of treatment, it could be considered in a pre-collapse stage in selected cases. Current literature suggests that low molecular weight heparin could lower disease progression in idiopathic AVN with quality of evidence being very low. Also the evidence to support the use of statins or vasodilators in the treatment of osteonecrosis is very low and their use cannot be recommended. Extracorporeal shock wave therapy may improve pain and function in early stages of disease with a low evidence, but there doesn't seem to be a significant change in time to the occurrence of femoral head collapse. Only one study has been conducted with pulsed electromagnetic fields therefore no recommendation can be given on clinical use of PEF in AVN. Evidence on hyperbaric oxygen therapy in the treatment of AVN is very limited and the high cost of treatment and the limited availability of structures that can provide the service poses other concerns about its feasibility. Based on current evidence, conservative treatment may be considered in early stages of asymptomatic AVN instead of observation only. PMID:27134631

  3. Decision-making support system based on LCA for aseptic packaging recycling.

    Science.gov (United States)

    Varžinskas, Visvaldas; Staniškis, Jurgis K; Knašyte, Milda

    2012-09-01

    In Europe post-consumer beverage carton packages are treated in three ways: dumped in a landfill, incinerated for energy recovery, and recycled. In recent years new technologies for beverage carton recycling have been developed and tested. At the same time in Europe the collection of second-hand raw materials is becoming more efficient. In order to facilitate and justify the decision-making process, different possibilities of poly-aluminium handling were analysed. For this reason, the objective of this study was to compare carbon footprints in the whole life cycle of selected technologies and to provide decision-making with data for beverage carton recycling. The paper is based on some of the results of the project 'Sustainable Production through Innovations in small- and medium-sized enterprises (SPIN)'. The SPIN project is providing small- and medium-sized enterprises with a whole set of instruments that put entrepreneurs in a position to innovate their production processes and products leading to improved business and public benefits. PMID:22778144

  4. Echovirus 30 associated with cases of aseptic meningitis in state of Pará, Northern Brazil

    Directory of Open Access Journals (Sweden)

    Ceyla Maria Oeiras de Castro

    2009-05-01

    Full Text Available Investigation of the aetiology of viral meningitis in Brazil is most often restricted to cases that occur in the Southern and Southeastern Regions; therefore, the purpose of this study is to describe the viral meningitis cases that occurred in state of Pará, Northern Brazil, from January 2005-December 2006. The detection of enterovirus (EV in cerebrospinal fluid was performed using cell culture techniques, RT-PCR, nested PCR and nucleotide sequencing. The ages of the 91 patients ranged from 60 years old (median age 15.90 years. Fever (87.1%, headache (77.0%, vomiting (61.5% and stiffness (61.5% were the most frequent symptoms. Of 91 samples analyzed, 18 (19.8% were positive for EV. Twelve were detected only by RT- PCR followed by nested PCR, whereas six were found by both cell culture and RT-PCR. From the last group, five were sequenced and classified as echovirus 30 (Echo 30. Phylogenetic analyses revealed that Echo 30 detected in Northern Brazil clustered within a unique group with a bootstrap value of 100% and could constitute a new subgroup (4c according to the phylogenetic tree described by Oberste et al. (1999. This study described the first molecular characterization of Echo 30 in Brazil and this will certainly contribute to future molecular analyses involving strains detected in other regions of Brazil.

  5. Subsurface Organics in Aseptic Cores From the MARTE Robotic Drilling Experiment: Ground truth and Contamination Issues

    Science.gov (United States)

    Bonaccorsi, R.; Stoker, C. R.

    2006-12-01

    The subsurface is the key environment for searching for life on planets lacking surface life. This includes the search for past/present life on Mars where possible subsurface life could exist [1]. The Mars-Analog-Rio-Tinto-Experiment (MARTE) performed a simulation of a Mars robotic drilling at the RT Borehole#7 Site ~6.07m, atop a massive-pyrite deposit from the Iberian Pyritic Belt. The RT site is considered an important analog of Sinus Meridiani on Mars, an ideal model analog for a subsurface Martian setting [2], and a relevant example of deep subsurface microbial community including aerobic and anaerobic chemoautotrophs [4-5]. Searching for microbes or bulk organics of biological origin in a subsurface sample from a planet is a key scientific objective of Robotic drilling missions. During the 2005 Field experiment 28 minicores were robotically handled and subsampled for life detection experiments under anti-contamination protocols. Ground truth included visual observation of cores and lab based Elemental and Isotope Ratios Mass Spectrometry analysis (EA-IRMS) of bulk organics in Hematite and Gohetite-rich gossanized tuffs, gossan and clay layers within 0-6m-depth. C-org and N-tot vary up to four orders of magnitude among the litter (~11Wt%, 0-1cm) and the mineralized (~3Wt%, 1-3cm) layers, and the first 6 m-depth (C-org=0.02-0.38Wt%). Overall, the distribution/ preservation of plant and soil-derived organics (d13C-org = 26 per mil to 24 per mil) is ten times higher (C-org=0.33Wt%) that in hematite-poor clays, or where rootlets are present, than in hematite- rich samples (C-org=marte.arc.nasa.gov; [3] Stoker, C., et al., 2006 AbSciCon, [4] Stoker et al., submitted; [5] Bonaccorsi., et al., 2006 AbSciCon.

  6. Scrub typhus meningitis: An under-recognized cause of aseptic meningitis in India

    OpenAIRE

    Kundavaram Paul Prabhakar Abhilash; Karthik Gunasekaran; Shubhanker Mitra; Shalom Patole; Sowmya Sathyendra; Sudha Jasmine; G M Varghese

    2015-01-01

    Background: Central nervous system (CNS) involvement in scrub typhus is seen in up to a quarter of patients. However, the literature on cerebrospinal fluid (CSF) analysis and outcome in meningitis/meningo-encephalitis due to scrub typhus is scant. Materials and Methods: This retrospective study included patients who were admitted to a medical college hospital with scrub typhus meningitis/meningo-encephalitis between 2005 and 2011. The clinical and laboratory profile, details of CSF analys...

  7. Idiopathic, aseptic, effusive, fibrinous, nonconstrictive pericarditis with tamponade in a standardbred filly.

    Science.gov (United States)

    Robinson, J A; Marr, C M; Reef, V B; Sweeney, R W

    1992-11-15

    A Standardbred filly was admitted for evaluation of pleuritis and pneumonia. Heart rate was 80 to 120 beats/min, and the pulse was barely palpable. Thoracic and abdominal ultrasonography and echocardiography revealed substantial pericardial effusion with cardiac tamponade, fibrinous pericarditis, pleural effusion, and ascites. Initial electrocardiography revealed normal sinus rhythm with decreased amplitude of the QRS complexes consistent with pericardial effusion. Following thoracentesis, echocardiogram-guided pericardiocentesis was performed. Bacterial culture yielded no growth from any of the fluids, and bacteria were not seen on cytologic examination. Initial treatment included broad-spectrum antibiotic treatments, IV fluid therapy, and anti-inflammatory agent administration. On the basis of negative culture results, an immune-mediated cause was considered, and dexamethasone was instituted in a decreasing dosage regimen. Pericardial effusion, ventral edema, and ascites began to resolve within 3 days after beginning dexamethasone treatment. Thirty days following discharge, the filly was reexamined, and at that time, the prognosis for athletic performance was considered good so the horse was returned to race training. The final diagnosis in this case was idiopathic, effusive, nonconstrictive pericarditis with tamponade. Early identification, clinical understanding, and application of knowledge of the pathophysiologic mechanisms of pericarditis in horses, combined with use of diagnostic aids such as ultrasonography and aggressive therapy consisting of effusion drainage, pericardial lavage, antibiotics that penetrate the pericardium, and corticosteroids when indicated are critical for a successful outcome in horses with pericarditis. PMID:1289343

  8. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease

    Science.gov (United States)

    Hieken, Tina J.; Chen, Jun; Hoskin, Tanya L.; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C.; Knutson, Keith L.; Kalari, Krishna R.; Yao, Janet Z.; Baddour, Larry M.; Chia, Nicholas; Degnim, Amy C.

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  9. Hand hygiene and aseptic techniques during routine anesthetic care - observations in the operating room

    OpenAIRE

    Megeus, Veronika; Nilsson, Kerstin; Karlsson, Jon; Eriksson, Bengt I.; Andersson, Annette Erichsen

    2015-01-01

    Background More knowledge is needed about task intensity in relation to hand hygiene in the operating room during anesthetic care in order to choose effective improvement strategies. The aim of this study was to explore the indications and occurrence of hand hygiene opportunities and the adherence to hand hygiene guidelines during routine anesthetic care in the operating room. Methods Structured observational data on hand hygiene during anesthetic care during 94 surgical procedures was collec...

  10. Thin-film calorimetric gas sensors for hydrogen peroxide monitoring in aseptic food processes

    OpenAIRE

    Kirchner, Patrick

    2013-01-01

    In der aseptischen Lebensmittelindustrie stellt die Entkeimung von Packstoffen einen Schlüsselprozess dar, um eine möglichst lange Haltbarkeit des abgefüllten Lebensmittels zu gewährleisten und um eine Übertragung von pathogenen Mikroorgansimen auf den Endverbraucher zu verhindern. Zur Inaktivierung lebensfähiger Mikroorganismen auf dem Packstoff wird zunehmend gasförmiges Wasserstoffperoxid bei erhöhten Prozesstemperatur...

  11. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease.

    Science.gov (United States)

    Hieken, Tina J; Chen, Jun; Hoskin, Tanya L; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C; Knutson, Keith L; Kalari, Krishna R; Yao, Janet Z; Baddour, Larry M; Chia, Nicholas; Degnim, Amy C

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  12. Turbines : remote condition based monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Graves, S. [Azima Inc., Woburn, MA (United States)

    2005-07-01

    One of the most expensive and critical pieces of equipment at a electric power plant is the turbine which operates at high pressure and high speeds. Even a small misalignment of the shaft, bearing wear or other breakdowns can lead to damage to the turbine and other nearby equipment, extensive downtime for repair and purchase of replacement power. In order to address these risks, all turbines have built-in protection systems that monitor peak to peak displacement of the shaft through proximity probes. When the peak to peak motion exceeds a predetermined value, the protection device sends a signal to shutdown the turbine. An impending failure generally develops over time from a degrading component that creates abnormal movement in the system resulting in vibration, shaft orbit, or direct current gap voltage. Although the protection device provides information on the general vibration trend of the turbine, this has limited value. Information on other key parameters besides vibration trend are needed to monitor the health of a turbine. This includes information on spectrum displacement as a function of frequency at a specific point in time; time wave or amount of motion and symmetry of a wave shape; orbits or cross sectional views of shaft movement; and, DC gap voltage that is the distance between the shaft and the proximity probes. Daily monitoring of these parameters can warn of impending failure and provide information regarding the cause and expected time of failure. The information can be used for faster problem resolution and time to restart the turbine. Azima has developed a remote condition based monitoring system to collect and trend these parameters on a daily basis. The Azima system gathers analog data from the proximity probes mounted on the turbine at a sensor hub which digitizes the data and then sends it wirelessly via internet to a hosted server. The data can be accessed anytime through a standard web browser, allowing for daily remote monitoring of

  13. Wind Turbine Drivetrain Condition Monitoring - An Overview

    Energy Technology Data Exchange (ETDEWEB)

    Sheng, S; Veers, P.

    2011-10-01

    This paper provides an overview of wind turbine drivetrain condition monitoring based on presentations from a condition monitoring workshop organized by the National Renewable Energy Laboratory in 2009 and on additional references.

  14. Chronic Condition Public Use File (PUF)

    Data.gov (United States)

    U.S. Department of Health & Human Services — This release contains the Chronic Conditions Public Use Files (PUF) with information from Medicare claims. The CMS Chronic Conditions PUF is an aggregated file in...

  15. Assessing Body Condition from Fat on Carcass

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — SOP guiding assessment of body condition based on carcass fat. Provides stepwise instructions and photos on how to assess body condition from carcass fat

  16. Do conditional benefits reduce equilibrium unemployment?

    NARCIS (Netherlands)

    F. van der Ploeg

    2006-01-01

    Although unconditional unemployment benefits destroy jobs in competitive and noncompetitive labor markets, conditional benefits can spur job growth in noncompetitive labor markets. Unconditional benefits reduce the penalty of shirking and misconduct, while conditional benefits increase this penalty.

  17. Electron beam conditioning by Thomson scattering

    OpenAIRE

    Schroeder, C. B.; Esarey, E.; Leemans, W. P.

    2003-01-01

    A method is proposed for conditioning electron beams via Thomson scattering. The conditioning provides a quadratic correlation between the electron energy deviation and the betatron amplitude of the electrons, which results in enhanced gain in free-electron lasers. Quantum effects imply conditioning must occur at high laser fluence and moderate electron energy. Conditioning of x-ray free-electron lasers should be achievable with present laser technology, leading to significant size and c...

  18. The epistemic account of ceteris paribus conditions

    OpenAIRE

    Spohn, Wolfgang

    2014-01-01

    The paper focuses on interpreting ceteris paribus conditions as normal conditions. After discussing six basic problems for the explication of normal conditions and seven interpretations that do not well solve those problems I turn to what I call the epistemic account. According to it the normal is, roughly, the not unexpected. This is developed into a rigorous constructive account of normal conditions, which makes essential use of ranking theory and in particular allows to explain the phenome...

  19. Ceteris paribus conditionals and comparative normalcy

    OpenAIRE

    Smith, M.

    2007-01-01

    Our understanding of subjunctive conditionals has been greatly enhanced through the use of possible world semantics and, more precisely, by the idea that they involve variably strict quantification over possible worlds. I propose to extend this treatment to ceteris paribus conditionals – that is, conditionals that incorporate a ceteris paribus or ‘other things being equal’ clause. Although such conditionals are commonly invoked in scientific theorising, they traditionally arouse suspicion and...

  20. Construction of Maximal Hypersurfaces with Boundary Conditions

    OpenAIRE

    Lambert, Ben

    2014-01-01

    We construct maximal hypersurfaces with a Neumann boundary condition in Minkowski space via mean curvature flow. In doing this we give general conditions for long time existence of the flow with boundary conditions with assumptions on the curvature of a the Lorentz boundary manifold.

  1. Maximum Likelihood Learning of Conditional MTE Distributions

    DEFF Research Database (Denmark)

    Langseth, Helge; Nielsen, Thomas Dyhre; Rumí, Rafael; Salmerón, Antonio

    2009-01-01

    We describe a procedure for inducing conditional densities within the mixtures of truncated exponentials (MTE) framework. We analyse possible conditional MTE specifications and propose a model selection scheme, based on the BIC score, for partitioning the domain of the conditioning variables...

  2. Variational Infinite Hidden Conditional Random Fields

    NARCIS (Netherlands)

    Bousmalis, Konstantinos; Zafeiriou, Stefanos; Morency, Louis-Philippe; Pantic, Maja; Ghahramani, Zoubin

    2015-01-01

    Hidden conditional random fields (HCRFs) are discriminative latent variable models which have been shown to successfully learn the hidden structure of a given classification problem. An Infinite hidden conditional random field is a hidden conditional random field with a countably infinite number of

  3. Thermodynamic origin of the null energy condition

    OpenAIRE

    Parikh, Maulik; Svesko, Andrew

    2016-01-01

    We derive the classical null energy condition, understood as a constraint on the Ricci tensor, from the second law of thermodynamics applied to Bekenstein-Hawking entropy. The derivation provides evidence that the null energy condition, which has usually been regarded as a condition on matter, is fundamentally a property of gravity.

  4. Thermodynamic Origin of the Null Energy Condition

    CERN Document Server

    Parikh, Maulik

    2015-01-01

    We derive the classical null energy condition, understood as a constraint on the Ricci tensor, from the second law of thermodynamics applied to Bekenstein-Hawking entropy. The derivation provides evidence that the null energy condition, which has usually been regarded as a condition on matter, is fundamentally a property of gravity.

  5. The conditioning of human sexual arousal.

    Science.gov (United States)

    O'Donohue, W; Plaud, J J

    1994-06-01

    Although most theories of human sexual behavior claim that much normal sexual behavior is learned, and theories of the etiology and modification of paraphilic and dysfunctional sexual behavior also claim that abnormal sexual behavior is learned and can be counterconditioned, there is no systematic review examining the relationship between conditioning and human sexual behavior. We review research addressing whether habituation, sensitization, classical conditioning, and operant conditioning processes are involved in human sexual behavior. We conclude that, due to the methodological problems of extant studies, the basis for asserting the existence of relationships between habituation, sensitization, classical conditioning, operant conditioning, and sexual behavior is tenuous. PMID:8024444

  6. Beam Conditioning for FELs: Consequences and Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wolski, Andrzej; Penn, Gregory; Sessler, Andrew; Wurtele, Jonathan

    2003-10-09

    The consequences of beam conditioning in four example cases (VISA, a Soft X-Ray FEL, LCLS and a ''Greenfield'' FEL) are examined. It is shown that in emittance limited cases, proper conditioning reduces sensitivity to the transverse emittance, and allows stronger focusing in the undulator. Simulations show higher saturation power, with gain lengths reduced up to a factor of two. The beam dynamics in a general conditioning system are studied, with ''matching conditions'' derived for achieving conditioning without growth in effective emittance. Various conditioners are considered, and expressions derived for the amount of conditioning provided in each case when the matching conditions are satisfied. We discuss the prospects for conditioners based on laser and plasma systems.

  7. Cues of maternal condition influence offspring selfishness.

    Directory of Open Access Journals (Sweden)

    Janine W Y Wong

    Full Text Available The evolution of parent-offspring communication was mostly studied from the perspective of parents responding to begging signals conveying information about offspring condition. Parents should respond to begging because of the differential fitness returns obtained from their investment in offspring that differ in condition. For analogous reasons, offspring should adjust their behavior to cues/signals of parental condition: parents that differ in condition pay differential costs of care and, hence, should provide different amounts of food. In this study, we experimentally tested in the European earwig (Forficula auricularia if cues of maternal condition affect offspring behavior in terms of sibling cannibalism. We experimentally manipulated female condition by providing them with different amounts of food, kept nymph condition constant, allowed for nymph exposure to chemical maternal cues over extended time, quantified nymph survival (deaths being due to cannibalism and extracted and analyzed the females' cuticular hydrocarbons (CHC. Nymph survival was significantly affected by chemical cues of maternal condition, and this effect depended on the timing of breeding. Cues of poor maternal condition enhanced nymph survival in early broods, but reduced nymph survival in late broods, and vice versa for cues of good condition. Furthermore, female condition affected the quantitative composition of their CHC profile which in turn predicted nymph survival patterns. Thus, earwig offspring are sensitive to chemical cues of maternal condition and nymphs from early and late broods show opposite reactions to the same chemical cues. Together with former evidence on maternal sensitivities to condition-dependent nymph chemical cues, our study shows context-dependent reciprocal information exchange about condition between earwig mothers and their offspring, potentially mediated by cuticular hydrocarbons.

  8. Cues of maternal condition influence offspring selfishness.

    Science.gov (United States)

    Wong, Janine W Y; Lucas, Christophe; Kölliker, Mathias

    2014-01-01

    The evolution of parent-offspring communication was mostly studied from the perspective of parents responding to begging signals conveying information about offspring condition. Parents should respond to begging because of the differential fitness returns obtained from their investment in offspring that differ in condition. For analogous reasons, offspring should adjust their behavior to cues/signals of parental condition: parents that differ in condition pay differential costs of care and, hence, should provide different amounts of food. In this study, we experimentally tested in the European earwig (Forficula auricularia) if cues of maternal condition affect offspring behavior in terms of sibling cannibalism. We experimentally manipulated female condition by providing them with different amounts of food, kept nymph condition constant, allowed for nymph exposure to chemical maternal cues over extended time, quantified nymph survival (deaths being due to cannibalism) and extracted and analyzed the females' cuticular hydrocarbons (CHC). Nymph survival was significantly affected by chemical cues of maternal condition, and this effect depended on the timing of breeding. Cues of poor maternal condition enhanced nymph survival in early broods, but reduced nymph survival in late broods, and vice versa for cues of good condition. Furthermore, female condition affected the quantitative composition of their CHC profile which in turn predicted nymph survival patterns. Thus, earwig offspring are sensitive to chemical cues of maternal condition and nymphs from early and late broods show opposite reactions to the same chemical cues. Together with former evidence on maternal sensitivities to condition-dependent nymph chemical cues, our study shows context-dependent reciprocal information exchange about condition between earwig mothers and their offspring, potentially mediated by cuticular hydrocarbons. PMID:24498046

  9. Towards a unified model of pavlovian conditioning: short review of trace conditioning models

    OpenAIRE

    Kryukov, V. I.

    2012-01-01

    There are three basic paradigms of classical conditioning: delay, trace and context conditioning where presentation of a conditioned stimulus (CS) or a context typically predicts an unconditioned stimulus (US). In delay conditioning CS and US normally coterminate, whereas in trace conditioning an interval of time exists between CS termination and US onset. The modeling of trace conditioning is a rather difficult computational problem and is a challenge to the behavior and connectionist approa...

  10. Stability conditions for spatially modulated phases

    CERN Document Server

    Domokos, Sophia K; Sonnenschein, Jacob

    2013-01-01

    We introduce a novel set of stability conditions for vacua with broken Lorentz symmetry. The first class of conditions require that the energy be minimized under small geometric deformations, which translates into requiring the positivity of a "stiffness" four-tensor. The second class of conditions requires that stress forces be restoring under small deformations. We then apply these conditions to examples of recently-discovered spatially modulated (or "striped") phases in holographic models of superconductors and high-density QCD. For backreacted solutions we find that the pressure condition is equivalent to thermodynamic stability. For probe solutions, however, these conditions are in conflict with the minimization of the free energy. This suggests that either the solutions are unstable or the definition of the free energy in the probe approximation must be revised for these solutions.

  11. Application of Chitosan Flocculant to Conditioning Sludge

    Institute of Scientific and Technical Information of China (English)

    李步祥; 陈亮; 陈东辉; 张印堂

    2003-01-01

    The dewaterability of activated sludge conditioned by chitosan fiocculant was studied. The effects of chitasan characteristics such as molecular weight,degree of deacetylation, and dose on the dewaterability were investigated. The sludge dewaterability is evaluated in terms of specific resistance to filtration, residual turbidity of supernatant, moisture content of cake, and settling rate. Sludge dehydrating behaviors conditioned with CTS, PAM and PAC fiocculants were compared. The conditioning was also carried out with dual flocculants in two stages. It is found that the sludge conditioned with CTS has better dewaterability than that with PAC. The optimum conditions with chitosan are: dose 0.8~1.2 g per 100 g dry cake, molecular weight 300,000, and degree of deacetylation 70%. The conditioning in two stages with dual flocculants is found to be more effective than that with single flocculant.

  12. Maintenance and Condition-Based Maintenance

    Institute of Scientific and Technical Information of China (English)

    DING Jin-hua; WANG Xue-Jun; ZHOU Rong; LIN Min; Olsson Erland

    2005-01-01

    The evolution of maintenance management is briefly introduced in this paper, from corrective maintenance to preventive maintenance. First, a range of condition monitoring and fault diagnosis techniques developed in different industries are surveyed; Second, many methods of condition monitoring are presented; Third, mathematical methods used in condition monitoring are given; Then the merits and shortcomings are discussed.Efficient maintenance policies are of fundamental importance in system engineering because of their fallbacks into the safety and economics of plant operation. Applying condition-based maintenance to a system can reduce the cost and extend the availability of facilities. With the advent of personal computers as fast and cost effective machines for data acquisition and processing of multiple signals some shortcomings mentioned in condition monitoring could be solved or reduced to some extent. These PCs can be a solution as a condition monitoring based maintenance system.

  13. Multiple chronic conditions and life expectancy

    DEFF Research Database (Denmark)

    DuGoff, Eva H; Canudas-Romo, Vladimir; Buttorff, Christine; Leff, Bruce; Anderson, Gerard F

    2014-01-01

    BACKGROUND: The number of people living with multiple chronic conditions is increasing, but we know little about the impact of multimorbidity on life expectancy. OBJECTIVE: We analyze life expectancy in Medicare beneficiaries by number of chronic conditions. RESEARCH DESIGN: A retrospective cohort...... study using single-decrement period life tables. SUBJECTS: Medicare fee-for-service beneficiaries (N=1,372,272) aged 67 and older as of January 1, 2008. MEASURES: Our primary outcome measure is life expectancy. We categorize study subjects by sex, race, selected chronic conditions (heart disease, cancer......, chronic obstructive pulmonary disease, stroke, and Alzheimer disease), and number of comorbid conditions. Comorbidity was measured as a count of conditions collected by Chronic Conditions Warehouse and the Charlson Comorbidity Index. RESULTS: Life expectancy decreases with each additional chronic...

  14. Periodic boundary conditions on the pseudosphere

    OpenAIRE

    Sausset, François; Tarjus, Gilles

    2007-01-01

    30 pages, minor corrections, accepted to J. Phys. A International audience We provide a framework to build periodic boundary conditions on the pseudosphere (or hyperbolic plane), the infinite two-dimensional Riemannian space of constant negative curvature. Starting from the common case of periodic boundary conditions in the Euclidean plane, we introduce all the needed mathematical notions and sketch a classification of periodic boundary conditions on the hyperbolic plane. We stress the ...

  15. Trends in the Study of Pavlovian Conditioning

    OpenAIRE

    Timberlake, William

    2004-01-01

    These introductory comments for the special issue on Pavlovian conditioning begin with a brief review of Rescorla’s (1988) influential paper outlining how trends in the study of Pavlovian conditioning changed the dominant view from an analysis of simple associations to an information seeking approach. I argue that current research trends in Pavlovian conditioning suggest possible ways of integrating the information-seeking approach with a more embodied, evolutionary approach. I briefly consid...

  16. Necessary Condition Hypotheses in Operations Management

    OpenAIRE

    Dul, Jan; Hak, Tony; Goertz, Gary; Voss, Chris

    2010-01-01

    textabstractPurpose – To show that necessary condition hypotheses are important in operations management, and to present a consistent methodology for building and testing them. Necessary condition hypotheses (“X is necessary for Y”) express conditions that must be present in order to have a desired outcome (e.g. “success”), and to prevent guaranteed failure. These hypotheses differ fundamentally from the common co-variational hypotheses (“more X results in more Y”) and require another methodo...

  17. The Roles of Conditioning in Inference

    OpenAIRE

    Reid, N.

    1995-01-01

    This paper reviews the use of sufficient and ancillary statistics in constructing conditional distributions for inference about a parameter. Special emphasis is given to recent developments in accurate approximation of densities, distribution functions and likelihood functions, and to the role of conditioning in these approximations. Exact conditional or marginal inference is available for essentially two classes of models, exponential family models and transformation family models. The appro...

  18. The Pauli equation with complex boundary conditions

    CERN Document Server

    Kochan, D; Novak, R; Siegl, P

    2012-01-01

    We consider one-dimensional Pauli Hamiltonians in a bounded interval with possibly non-self-adjoint Robin-type boundary conditions. We study the influence of the spin-magnetic interaction on the interplay between the type of boundary conditions and the spectrum. A special attention is paid to PT-symmetric boundary conditions with the physical choice of the time-reversal operator T.

  19. Eyeblink conditioning in the developing rabbit

    OpenAIRE

    Brown, Kevin L.; Woodruff-Pak, Diana S.

    2011-01-01

    Eyeblink classical conditioning in pre-weanling rabbits was examined in the present study. Using a custom lightweight headpiece and restrainer, New Zealand white littermates were trained once daily in 400 ms delay eyeblink classical conditioning from postnatal days (PD) 17–21 or PD 24–28. These ages were chosen because eyeblink conditioning emerges gradually over PD 17–24 in rats (Stanton, Freeman, & Skelton, 1992), another altricial species with neurodevelopmental features similar to those o...

  20. Do Poor Economic Conditions Affect Terrorism?

    OpenAIRE

    Berrebi, Claude; Klor, Esteban F.

    2012-01-01

    While the existing empirical literature shows that poverty and economic conditions are not correlated with the quantity of terror, theory predicts that poverty and poor economic conditions may affect the quality of terror. Poor economic conditions may lead more able individuals to participate in terror attacks, allowing terror organizations to send betterqualified terrorists to more complex, high-impact terror missions. Using data on Palestinian suicideterrorists, we provide evidence of the c...

  1. A Conditional Saddlepoint Approximation for Testing Problems

    OpenAIRE

    Gatto, R.; Jammalamadaka, SR

    1999-01-01

    A saddlepoint approximation is provided for the distribution function of one M statistic conditional on another M statistic. Many interesting statistics based on dependent quantities (e.g., spacings, multinomial frequencies, rank differences) can be expressed in terms of independent identically distributed random variables conditioned on their sum, so that this conditional saddlepoint approximation yields accurate approximations for the distribution of such statistics. This saddlepoint approx...

  2. Novel quantum initial conditions for inflation

    CERN Document Server

    Handley, W J; Hobson, M P

    2016-01-01

    We present a novel approach for setting initial conditions on the mode functions of the Mukhanov Sazaki equation. These conditions are motivated by minimisation of the renormalised stress-energy tensor, and are valid for setting a vacuum state even in a context where the spacetime is changing rapidly. Moreover, these alternative conditions are potentially observationally distinguishable. We apply this to the kinetically dominated universe, and compare with the more traditional approach.

  3. Dispositional Mindfulness, Meditation, and Conditional Goal Setting

    OpenAIRE

    Crane, Catherine; Jandric, Danka; Barnhofer, Thorsten; Williams, J. Mark G.

    2010-01-01

    Conditional goal setting (CGS, the tendency to regard high order goals such as happiness, as conditional upon the achievement of lower order goals) is observed in individuals with depression and recent research has suggested a link between levels of dispositional mindfulness and conditional goal setting in depressed patients. Since interventions which aim to increase mindfulness through training in meditation are used with patients suffering from depression it is of interest to examine whethe...

  4. Local Tensor Radiation Conditions For Elastic Waves

    DEFF Research Database (Denmark)

    Krenk, S.; Kirkegaard, Poul Henning

    2001-01-01

    A local boundary condition is formulated, representing radiation of elastic waves from an arbitrary point source. The boundary condition takes the form of a tensor relation between the stress at a point on an arbitrarily oriented section and the velocity and displacement vectors at the point....... The tensor relation generalizes the traditional normal incidence impedance condition by accounting for the angle between wave propagation and the surface normal and by including a generalized stiffness term due to spreading of the waves. The effectiveness of the local tensor radiation condition...

  5. Periodic boundary conditions on the pseudosphere

    Energy Technology Data Exchange (ETDEWEB)

    Sausset, F; Tarjus, G [Laboratoire de Physique Theorique de la Matiere Condensee, Universite Pierre et Marie Curie, Paris 6, UMR CNRS 7600, 4 place Jussieu, 75252 Paris Cedex 05 (France)

    2007-10-26

    We provide a framework for building periodic boundary conditions on the pseudosphere (or hyperbolic plane), the infinite two-dimensional Riemannian space of constant negative curvature. Starting from the common case of periodic boundary conditions in the Euclidean plane, we introduce all the required mathematical notions and sketch a classification of periodic boundary conditions on the hyperbolic plane. We stress the possible applications in statistical mechanics for studying the bulk behavior of physical systems, and illustrate how to implement such periodic boundary conditions in two examples, the dynamics of particles on the pseudosphere and the study of classical spins on hyperbolic lattices.

  6. Energy conditions and their cosmological implications

    CERN Document Server

    Visser, M; Visser, Matt; Barcelo, Carlos

    2000-01-01

    The energy conditions of general relativity permit one to deduce very powerful and general theorems about the behaviour of strong gravitational fields and cosmological geometries. However, the energy conditions these theorems are based on are beginning to look a lot less secure than they once seemed: (1) there are subtle quantum effects that violate all of the energy conditions, and more tellingly (2), there are also relatively benign looking classical systems that violate all the energy conditions. This opens up a Pandora's box of rather disquieting possibilities --- everything from negative asymptotic mass, to traversable wormholes, to warp drives, up to and including time machines.

  7. Evaluative Conditioning is Insensitive to Blocking

    Directory of Open Access Journals (Sweden)

    Tom Beckers

    2009-01-01

    Full Text Available Evaluative conditioning has been claimed to have a number of functional characteristics that set it apart from other forms of associative learning in humans, such as insensitivity to extinction and contingency, independence of contingency awareness, and insensitivity to modulation. Despite its potential theoretical importance, until now few data are available concerning the susceptibility of evaluative conditioning to cue competition effects such as blocking. In the present study, we assessed the susceptibility of acquired preferences and evaluations to blocking in a candy game. Results suggest that evaluative conditioning is not susceptible to blocking. We discuss this observation in the light of theoretical accounts of evaluative conditioning and associative learning in humans.

  8. Examples of conditional SIC-POVMs

    Science.gov (United States)

    Ohno, Hiromichi; Petz, Dénes

    2015-10-01

    The state of a quantum system is a density matrix with several parameters. The concern herein is how to recover the parameters. Several possibilities exist for the optimal recovery method, and we consider some special cases. We assume that a few parameters are known and that the others are to be recovered. The optimal positive-operator-valued measure (POVM) for recovering unknown parameters with an additional condition is called a conditional symmetric informationally complete POVM (SIC-POVM). In this paper, we study the existence or nonexistence of conditional SIC-POVMs. We provide a necessary condition for existence and some examples.

  9. Human reliability analysis under fire condition

    International Nuclear Information System (INIS)

    It is identified in the fire probabilistic safety assessment (PSA) of nuclear power plants that human action has important effect on the risk of plant under fire condition. So it's necessary to assess human error probability under fire condition by the systemic methodology. The HCR/ORE and CBDTM models and specific considerations under fire condition were described in this paper. The combination of HCR/ORE, CBDTM and THERP was applied to human reliability analysis (HRA) under fire condition with an example given for demonstration. The basement of setting up the more practical fire PSA models for engineering is established. (authors)

  10. Range conditions for a spherical mean transform

    KAUST Repository

    Agranovsky, Mark

    2009-07-01

    The paper is devoted to the range description of the Radon type transform that averages a function over all spheres centered on a given sphere. Such transforms arise naturally in thermoacoustic tomography, a novel method of medical imaging. Range descriptions have recently been obtained for such transforms, and consisted of smoothness and support conditions, moment conditions, and some additional orthogonality conditions of spectral nature. It has been noticed that in odd dimensions, surprisingly, the moment conditions are superfluous and can be eliminated. It is shown in this text that in fact the same happens in any dimension.

  11. Convergence conditions for the Seidel process

    Energy Technology Data Exchange (ETDEWEB)

    Rapin, V.V. [Ukrainian External Polytechnical Institute, Khar`kov (Ukraine)

    1994-11-10

    The convergence condition of the successive approximation process based on the Seidel method is derived for a system of two transcendental equations with allowance for specific functional dependences.

  12. The influence of classical-conditioning procedures on subsequent attention to the conditioned brand

    OpenAIRE

    Janiszewski, C; Warlop, Luk

    1993-01-01

    Three experiments are used to investigate the influence of conditioning procedures on attention to a conditioned stimulus. In experiment 1, scenes presented in a sequence that is consistent with prescribed conditioning procedures are shown to encourage attention to the advertised brands in subsequent product displays. Experiment 2 suggests that differential attention to conditioned brands can be attributed to the signaling properties the brand acquires as a consequence of conditioning. Eviden...

  13. 42 CFR 493.1205 - Condition: Virology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Virology. 493.1205 Section 493.1205 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES....1205 Condition: Virology. If the laboratory provides services in the subspecialty of Virology,...

  14. 40 CFR 35.935 - Grant conditions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Grant conditions. 35.935 Section 35.935 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Grants for Construction of Treatment Works-Clean Water Act § 35.935 Grant conditions. In...

  15. 10 CFR 72.44 - License conditions.

    Science.gov (United States)

    2010-01-01

    ..., construction and operation. The Commission may also include additional license conditions as it finds... materials of construction and geometric arrangements. (5) Administrative controls. Administrative controls... conditions: (1) Construction of the MRS may not begin until the Commission has authorized the construction...

  16. 42 CFR 52b.13 - Additional conditions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Additional conditions. 52b.13 Section 52b.13 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.13 Additional conditions. The Director may with respect to any...

  17. 40 CFR 35.2200 - Grant conditions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Grant conditions. 35.2200 Section 35.2200 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Grants for Construction of Treatment Works § 35.2200 Grant conditions....

  18. PSA Applications for Shutdown Condition of CEFR

    Institute of Scientific and Technical Information of China (English)

    WANG; Tian-xi; GAO; Ji-ning; CHEN; Shu-ming

    2012-01-01

    <正>China Experimental Fast Reactor (CEFR) is the first sodium cooled experimental fast reactor in China. CEFR is in a low-power or shutdown operating condition in most of its life time, and the reactorsafety risks remain in the low-power or shutdown operating condition. At design phase, there is little

  19. Green's functions for Neumann boundary conditions

    CERN Document Server

    Franklin, Jerrold

    2012-01-01

    Green's functions for Neumann boundary conditions have been considered in Math Physics and Electromagnetism textbooks, but special constraints and other properties required for Neumann boundary conditions have generally not been noticed or treated correctly. In this paper, we derive an appropriate Neumann Green's function with these constraints and properties incorporated.

  20. UNIFORM QUASINILPOTENCY: DEFINITIONS, CONDITIONS, EXAMPLES OF APPLICATIONS

    OpenAIRE

    Sumin, Vladimir

    2010-01-01

    Definition of uniform quasinilpotent family of the operators and definition of superuniform quasinilpotent family of the operators are introduced. Corresponding conditions for functional operators are formulated. Applications of these definititions and conditions in the theory of controllable Volterra functional-operator equations are discussed. Financial support of Russian Fundamental Researches Fund (project 07-01-00495), analytical aimed departmental program "Development of Scientific Pote...

  1. 42 CFR 493.849 - Condition: Hematology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Hematology. 493.849 Section 493.849 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... These Tests § 493.849 Condition: Hematology. The specialty of hematology, for the purpose of...

  2. 42 CFR 493.1215 - Condition: Hematology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Hematology. 493.1215 Section 493.1215 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES....1215 Condition: Hematology. If the laboratory provides services in the specialty of Hematology,...

  3. Transport boundary conditions for solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Volovichev, I.N.; Velazquez-Perez, J.E. [Departamento Fisica Aplicada, Universidad de Salamanca, Plaza de la Merced, E-37008 Salamanca (Spain); Gurevich, Yu.G. [Departamento de Fisica, CINVESTAV-IPN, Av. IPN 2508, Apartado Postal 14 740, Mexico DF 07000 (Mexico)

    2009-01-15

    Boundary conditions (BCs) to the Poisson and transport equations for stationary transport processes of nonequilibrium carriers in semiconductor structures, including solar cells, are formulated. The applicability of the resulting BCs for solar cells consisting of several various materials (metals, bipolar semiconductors, including ones in the quasineutrality approach) and their structures are analyzed for both closed and open circuit conditions. (author)

  4. Conditions of Practice in Perceptual Skill Learning

    Science.gov (United States)

    Memmert, D.; Hagemann, N.; Althoetmar, R.; Geppert, S.; Seiler, D.

    2009-01-01

    This study uses three experiments with different kinds of training conditions to investigate the "easy-to-hard" principle, context interference conditions, and feedback effects for learning anticipatory skills in badminton. Experiment 1 (N = 60) showed that a training program that gradually increases the difficulty level has no advantage over the…

  5. 42 CFR 494.180 - Condition: Governance.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Governance. 494.180 Section 494.180... Administration § 494.180 Condition: Governance. The ESRD facility is under the control of an identifiable governing body, or designated person(s) with full legal authority and responsibility for the governance...

  6. 14 CFR 23.351 - Yawing conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Yawing conditions. 23.351 Section 23.351 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS... Yawing conditions. The airplane must be designed for yawing loads on the vertical surfaces resulting...

  7. 14 CFR 29.351 - Yawing conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Yawing conditions. 29.351 Section 29.351... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Strength Requirements Flight Loads § 29.351 Yawing conditions. (a... paragraph (a) of this section, in unaccelerated flight with zero yaw, at forward speeds from zero up to...

  8. 14 CFR 27.351 - Yawing conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Yawing conditions. 27.351 Section 27.351... STANDARDS: NORMAL CATEGORY ROTORCRAFT Strength Requirements Flight Loads § 27.351 Yawing conditions. (a...) of this section, in unaccelerated flight with zero yaw, at forward speeds from zero up to 0.6 VNE—...

  9. 42 CFR 493.1204 - Condition: Parasitology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Parasitology. 493.1204 Section 493.1204 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES....1204 Condition: Parasitology. If the laboratory provides services in the subspecialty of...

  10. 42 CFR 493.821 - Condition: Microbiology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Microbiology. 493.821 Section 493.821 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... These Tests § 493.821 Condition: Microbiology. The specialty of microbiology includes, for purposes...

  11. 42 CFR 493.853 - Condition: Pathology.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Pathology. 493.853 Section 493.853 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... These Tests § 493.853 Condition: Pathology. The specialty of pathology includes, for purposes...

  12. Reconnection conditions for a coaxial plasma gun

    International Nuclear Information System (INIS)

    A fluid model for the flow conditions necessary to form a compact torus from the plasma ejected by a coaxial plasma gun is developed. This is done by finding the conditions for which the steady-flow equations break down. Results are found for two cases; variable external flux and variable outer-wall radius

  13. Goal Relevance Moderates Evaluative Conditioning Effects

    Science.gov (United States)

    Verwijmeren, Thijs; Karremans, Johan C.; Stroebe, Wolfgang; Wigboldus, Daniel H. J.

    2012-01-01

    An important process by which preferences emerge is evaluative conditioning, defined as a change in the evaluation of a stimulus by pairing it repeatedly and consistently with an affective stimulus. The current research focuses on the role of motivation in this learning process. Specifically, it was investigated whether a conditioning procedure…

  14. Second-Order Conditioning in "Drosophila"

    Science.gov (United States)

    Tabone, Christopher J.; de Belle, J. Steven

    2011-01-01

    Associative conditioning in "Drosophila melanogaster" has been well documented for several decades. However, most studies report only simple associations of conditioned stimuli (CS, e.g., odor) with unconditioned stimuli (US, e.g., electric shock) to measure learning or establish memory. Here we describe a straightforward second-order conditioning…

  15. On incremental 2-norm condition estimators

    Czech Academy of Sciences Publication Activity Database

    Duintjer Tebbens, Jurjen; Tůma, Miroslav

    Bergische Universität Wuppertal, 2013. [GAMM Workshop on Applied and Numerical Linear Algebra /13./. 09.09.2013-10.09.2013, Wuppertal] Institutional support: RVO:67985807 Keywords : condition number estimation * matrix inverses * incremental condition estimator * incremental norm estimator Subject RIV: BA - General Math ematics http://www-ai. math .uni-wuppertal.de/gammanla2013/index.php?page=main

  16. 7 CFR 1822.267 - Special conditions.

    Science.gov (United States)

    2010-01-01

    ... with the following: (1) The requirements of 7 CFR 3550.70 must be met and a conditional commitment... Board of Directors or similar governing body using a form entitled, “((Rural Housing Site) Loan to... be used if permitted by State law. (l) Conditional commitments for construction of homes on...

  17. Teaching Operant Conditioning at the Zoo.

    Science.gov (United States)

    Lukas, Kristen E.; Marr, M. Jackson; Maple, Terry L.

    1998-01-01

    Describes a partnership between Zoo Atlanta and the Georgia Institute of Technology in teaching the principles of operant conditioning to students in an experimental psychology class. Maintains that the positive training techniques used in zoos are models of applied operant conditioning. Includes a discussion of zoo training goals. (MJP)

  18. Subjects' Hypotheses, Experimental Instructions and Autonomic "Conditioning".

    Science.gov (United States)

    Eriksen, Charles W.

    Research on learning and conditioning suggests that verbal response modification does not occur in the absence of the subject's ability to define verbally (1) the response-reinforcement relationships and (2) his intention to change his behavior in the direction of reinforcement. This seems to be true for operant conditioning of verbal behavior,…

  19. Wind conditions for wind turbine design

    Energy Technology Data Exchange (ETDEWEB)

    Maribo Pedersen, B.

    1999-04-01

    Delegates from Europe and USA attended the meeting and discussed general aspects of wind conditions for wind turbine design. The subjects and the presented papers covered a very broad range of aspects of wind conditions and related influence on the wind turbine. (EHS)

  20. 42 CFR 493.839 - Condition: Chemistry.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Condition: Chemistry. 493.839 Section 493.839... These Tests § 493.839 Condition: Chemistry. The specialty of chemistry includes for the purposes of proficiency testing the subspecialties of routine chemistry, endocrinology, and toxicology....

  1. Effective stress coefficient for uniaxial strain condition

    DEFF Research Database (Denmark)

    Alam, Mohammad Monzurul; Fabricius, Ida Lykke

    2012-01-01

    coefficient from one dimensional rock mechanical deformation. We further investigated the effect of boundary condition on the stress dependency of effective stress coefficient and discussed its application in reservoir study. As stress field in the reservoirs are most unlikely to be hydrostatic, effective...... stress determined under uniaxial strain condition will be more relevant in reservoir studies....

  2. HEATING AND AIR CONDITIONING EDUCATIONAL PROGRAM.

    Science.gov (United States)

    Lennox Industries, Inc., Marshalltown, IA.

    INCREASED MOTIVATION, INCREASED INITIAL COMPREHENSION, AND INCREASED RETENTION ARE THE PRIME GOALS OF THE LENNOX HEATING AND AIR CONDITIONING EDUCATION PROGRAM. IT IS A COMPLETE PROGRAM WITH ALL THE TEACHING TOOLS REQUIRED TO PRODUCE A KNOWLEDGEABLE HEATING AND AIR-CONDITIONING INSTALLER OR SERVICE MAN. THIS INSTRUCTIONAL PROGRAM IS DESIGNED…

  3. Air Conditioning. Performance Objectives. Intermediate Course.

    Science.gov (United States)

    Long, William

    Several intermediate performance objectives and corresponding criterion measures are listed for each of seven terminal objectives for an intermediate air conditioning course. The titles of the seven terminal objectives are Refrigeration Cycle, Job Requirement Skills, Air Conditioning, Trouble Shooting, Performance Test, Shop Management, and S.I.E.…

  4. Some existence and sufficient conditions of optimality

    Science.gov (United States)

    Assefi, T.

    1976-01-01

    The role of the existence and sufficiency conditions in the field of optimal control was briefly described. The existence theorems are discussed for general nonlinear systems. However, the sufficiency conditions pertain to "nearly" linear systems with integral convex costs. Moreover, a brief discussion of linear systems with multiple-cost functions is presented.

  5. 13 CFR 108.370 - Conditional approval.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Conditional approval. 108.370 Section 108.370 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Evaluation and Selection of NMVC Companies § 108.370 Conditional approval....

  6. Effective stress coefficient for uniaxial strain condition

    DEFF Research Database (Denmark)

    Alam, M.M.; Fabricius, I.L.

    2012-01-01

    coefficient from one dimensional rock mechanical deformation. We further investigated the effect of boundary condition on the stress dependency of effective stress coefficient and discussed its application in reservoir study. As stress field in the reservoirs are most unlikely to be hydrostatic, effective...... stress determined under uniaxial strain condition will be more relevant in reservoir studies. Copyright 2012 ARMA, American Rock Mechanics Association....

  7. SMES cooperate to meet social procurement conditions

    NARCIS (Netherlands)

    Oden, Petra

    2015-01-01

    A growing amount of (semi) public organizations in the Netherlands write tenders with mandatory social conditions. It is important for SMEs to focus on social procurement in their business strategy. SMEs should be proactive and try to affect the conditions (semi) public organizations write in their

  8. 42 CFR 59.12 - Additional conditions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Additional conditions. 59.12 Section 59.12 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS GRANTS FOR FAMILY PLANNING SERVICES Project Grants for Family Planning Services § 59.12 Additional conditions. The Secretary may,...

  9. The bootstrap conditions for the gluon Reggeization

    International Nuclear Information System (INIS)

    Compatibility of gluon Reggeization with s-channel unitarity requires the vertices of the Reggeon interactions to satisfy a series of bootstrap conditions. In order to derive, in the next-to-leading order (NLO), conditions related to the gluon production amplitudes, we calculate the s-channel discontinuities of these amplitudes and compare them with those required by the Reggeization. It turns out that these conditions include the so called strong bootstrap conditions for the kernel and for the impact factors of scattering particles, which were proposed earlier without derivation, and recently were proved to be satisfied. Besides this, there is a new bootstrap condition, which relates a number of Reggeon vertices and the gluon trajectory. (orig.)

  10. Numerical implementation of isolated horizon boundary conditions

    International Nuclear Information System (INIS)

    We study the numerical implementation of a set of boundary conditions derived from the isolated horizon formalism, and which characterize a black hole whose horizon is in quasiequilibrium. More precisely, we enforce these geometrical prescriptions as inner boundary conditions on an excised sphere, in the numerical resolution of the conformal thin sandwich equations. As main results, we first establish the consistency of including in the set of boundary conditions a constant surface gravity prescription, interpretable as a lapse boundary condition, and second we assess how the prescriptions presented recently by Dain et al. for guaranteeing the well-posedness of the conformal transverse traceless equations with quasiequilibrium horizon conditions extend to the conformal thin sandwich elliptic system. As a consequence of the latter analysis, we discuss the freedom of prescribing the expansion associated with the ingoing null normal at the horizon

  11. Geographical National Condition and Complex System

    Directory of Open Access Journals (Sweden)

    WANG Jiayao

    2016-01-01

    Full Text Available The significance of studying the complex system of geographical national conditions lies in rationally expressing the complex relationships of the “resources-environment-ecology-economy-society” system. Aiming to the problems faced by the statistical analysis of geographical national conditions, including the disunity of research contents, the inconsistency of range, the uncertainty of goals, etc.the present paper conducted a range of discussions from the perspectives of concept, theory and method, and designed some solutions based on the complex system theory and coordination degree analysis methods.By analyzing the concepts of geographical national conditions, geographical national conditions survey and geographical national conditions statistical analysis, as well as investigating the relationships between theirs, the statistical contents and the analytical range of geographical national conditions are clarified and defined. This investigation also clarifies the goals of the statistical analysis by analyzing the basic characteristics of the geographical national conditions and the complex system, and the consistency between the analysis of the degree of coordination and statistical analyses. It outlines their goals, proposes a concept for the complex system of geographical national conditions, and it describes the concept. The complex system theory provides new theoretical guidance for the statistical analysis of geographical national conditions. The degree of coordination offers new approaches on how to undertake the analysis based on the measurement method and decision-making analysis scheme upon which the complex system of geographical national conditions is based. It analyzes the overall trend via the degree of coordination of the complex system on a macro level, and it determines the direction of remediation on a micro level based on the degree of coordination among various subsystems and of single systems. These results establish

  12. Orthogonality and Boundary Conditions in Quantum Mechanics

    International Nuclear Information System (INIS)

    One dimensional particle states are constructed according to orthogonality conditions, without requiring boundary conditions. Flee particle states are constructed using Dirac's delta function orthogonality conditions. The states (doublets) de- pend on two quantum numbers: energy and parity ('+' or '-'). With the aid of projection operators the particles are confined to a constrained region -ajxja, in a way similar to the action of an infinite well potential. From the resulting over complete basis only the mutually orthogonal states are selected. Pour solutions are Sound, corresponding to different non-commuting Hamiltonians. Their energy eigen- states are labeled with the main quantum number n and parity ('+' or '-') . The energy eigenvalues are functions of n only. The four cases correspond to different boundary conditions: (I) the wave function vanishes on the boundary (energy levels: 1+,2-,3+,4-,) , (II) the derivative of the wavefunction vanishes on the boundary (energy levels 0+, 1-, 2+, 3-,) , (III) periodic, symmetric boundary conditions (energy levels: 0+,2+,2-,4+,4-6+,6-,) , (IV) periodic, antisymmetric boundary conditions (energy levels: 1+, 1-, 3+, 3-, 5+, 5-,). Orthogonality seems to be a more basic requirement than boundary conditions. By using projection operators, confinement of the particle to a definite region can be achieved in a simple and unambiguous way, and physical operators can be written so that they act only in the confined region

  13. Fungal colonization of air-conditioning systems

    Directory of Open Access Journals (Sweden)

    Ljaljević-Grbić Milica

    2008-01-01

    Full Text Available Fungi have been implicated as quantitatively the most important bioaerosol component of indoor air associated with contaminated air-conditioning systems. rarely, indoor fungi may cause human infections, but more commonly allergenic responses ranging from pneumonitis to asthma-like symptoms. From all air conditioner filters analyzed, 16 fungal taxa were isolated and identified. Aspergillus fumigatus causes more lethal infections worldwide than any other mold. Air-conditioning filters that adsorb moisture and volatile organics appear to provide suitable substrates for fungal colonization. It is important to stress that fungal colonization of air-conditioning systems should not be ignored, especially in hospital environments.

  14. IMF conditionality – a better way

    Directory of Open Access Journals (Sweden)

    J. SPRAOS

    2013-12-01

    Full Text Available The article looks at IMF conditions for upper credit tranche stand-by arrangements. The IMF must face the criticism that its recent actions have transgressed on private banks' territory because of banks' errors in lending to third world countries - a matter that could have been left to free market forces. Conditions for IMF aid should focus not on policy instruments but on policy targets, such as growth, employment, inflation and, ultimately, restoration of countries' balance of payments positions. Conditions for IMF help should be centred squarely on the balance of payments of aid-seeking countries if a backwards trend is to be avoided.

  15. Machinery condition monitoring principles and practices

    CERN Document Server

    Mohanty, Amiya Ranjan

    2015-01-01

    Find the Fault in the MachinesDrawing on the author's more than two decades of experience with machinery condition monitoring and consulting for industries in India and abroad, Machinery Condition Monitoring: Principles and Practices introduces the practicing engineer to the techniques used to effectively detect and diagnose faults in machines. Providing the working principle behind the instruments, the important elements of machines as well as the technique to understand their conditions, this text presents every available method of machine fault detection occurring in machines in general, an

  16. Expected Business Conditions and Bond Risk Premia

    DEFF Research Database (Denmark)

    Eriksen, Jonas Nygaard

    2015-01-01

    This paper studies the predictability of bond risk premia by means of expectations to future business conditions using survey forecasts from the Survey of Professional Forecasters. We show that expected business conditions consistently affect excess bond returns and that the inclusion of expected...... business conditions in standard predictive regressions improve forecast performance relative to models using information derived from the current term structure or macroeconomic variables. The results are confirmed in a real-time out-of-sample exercise, where the models predictive accuracy are evaluated...

  17. Expected Business Conditions and Bond Risk Premia

    DEFF Research Database (Denmark)

    Eriksen, Jonas Nygaard

    This paper studies the predictability of bond risk premia by means of expectations to future business conditions using survey forecasts from the Survey of Professional Forecasters. We show that expected business conditions consistently affect excess bond returns and that the inclusion of expected...... business conditions in standard predictive regressions improve forecast performance relative to models using information derived from the current term structure or macroeconomic variables. The results are confirmed in a real-time out-of-sample exercise, where the predictive accuracy of the models...

  18. The Pauli equation with complex boundary conditions

    International Nuclear Information System (INIS)

    We consider one-dimensional Pauli Hamiltonians in a bounded interval with possibly non-self-adjoint Robin-type boundary conditions. We study the influence of the spin–magnetic interaction on the interplay between the type of boundary conditions and the spectrum. Special attention is paid to PT-symmetric boundary conditions with the physical choice of the time-reversal operator T. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Quantum physics with non-Hermitian operators’. (paper)

  19. The Pauli equation with complex boundary conditions

    Science.gov (United States)

    Kochan, D.; Krejčiřík, D.; Novák, R.; Siegl, P.

    2012-11-01

    We consider one-dimensional Pauli Hamiltonians in a bounded interval with possibly non-self-adjoint Robin-type boundary conditions. We study the influence of the spin-magnetic interaction on the interplay between the type of boundary conditions and the spectrum. Special attention is paid to {PT}-symmetric boundary conditions with the physical choice of the time-reversal operator {T}. This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Quantum physics with non-Hermitian operators’.

  20. Gearbox Condition Monitoring Using Advanced Classifiers

    Directory of Open Access Journals (Sweden)

    P. Večeř

    2010-01-01

    Full Text Available New efficient and reliable methods for gearbox diagnostics are needed in automotive industry because of growing demand for production quality. This paper presents the application of two different classifiers for gearbox diagnostics – Kohonen Neural Networks and the Adaptive-Network-based Fuzzy Interface System (ANFIS. Two different practical applications are presented. In the first application, the tested gearboxes are separated into two classes according to their condition indicators. In the second example, ANFIS is applied to label the tested gearboxes with a Quality Index according to the condition indicators. In both applications, the condition indicators were computed from the vibration of the gearbox housing. 

  1. An eigenelement method and two homogenization conditions

    Institute of Scientific and Technical Information of China (English)

    Yufeng Xing; Xingming Wang

    2009-01-01

    Under inspiration from the structure-preserving property of symplectic difference schemes for Hamiltonian systems, two homogenization conditions for a representa-tive unit cell of the periodical composites are proposed, one condition is the equivalence of strain energy, and the other is the deformation similarity. Based on these two homoge-nization conditions, an eigenelement method is presented, which is characteristic of structure-preserving property. It follows from the frequency comparisons that the eigenel-ement method is more accurate than the stiffness average method and the compliance average method.

  2. Sea conditions off Tokai-mura

    International Nuclear Information System (INIS)

    The result of investigation on the conditions of oceanic diffusion off Tokai-mura is presented. The diffusion phenomena are very complicated. The turbulent diffusion was analyzed by statistical method used with the data of sea current. The meteorological conditions, geographical feature and sea conditions effect considerably in oceanic diffusion in coastal area. By separating into short range and long range, the dye diffusion experiment and the river water diffusion were analyzed with several diffusion models. The author also describes on the behavior of nuclides connected with the deposition. (auth.)

  3. Contact conditions in skin-pass rolling

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2007-01-01

    The special contact conditions in skin-pass rolling of steel strip is analysed by studying plane strain upsetting of thin sheet with low reduction applying long narrow tools and dry friction conditions. An extended sticking region is estimated by an elasto-plastic FEM analysis of the plane strain...... upsetting. This sticking region causes a highly inhomogeneous elasto-plastic deformation with large influence of work-hardening and friction. A numerical analysis of skin-pass rolling shows the same contact conditions, i.e. an extended sticking region around the center of the contact zone. The calculated...

  4. Noiseless Conditional Teleportation of a Single Photon.

    Science.gov (United States)

    Fuwa, Maria; Toba, Shunsuke; Takeda, Shuntaro; Marek, Petr; Mišta, Ladislav; Filip, Radim; van Loock, Peter; Yoshikawa, Jun-Ichi; Furusawa, Akira

    2014-11-28

    We experimentally demonstrate the noiseless teleportation of a single photon by conditioning on quadrature Bell measurement results near the origin in phase space and thereby circumventing the photon loss that otherwise occurs even in optimal gain-tuned continuous-variable quantum teleportation. In general, thanks to this loss suppression, the noiseless conditional teleportation can preserve the negativity of the Wigner function for an arbitrary pure input state and an arbitrary pure entangled resource state. In our experiment, the positive value of the Wigner function at the origin for the unconditional output state, W(0,0)=0.015±0.001, becomes clearly negative after conditioning, W(0,0)=-0.025±0.005, illustrating the advantage of noiseless conditional teleportation. PMID:25494071

  5. Absorbing boundary conditions for linear gravity waves

    OpenAIRE

    Dgaygui, Kebir; Joly, Patrick

    1992-01-01

    In this article, we construct, analyze and implement a family of absorbing boundary conditions for linear gravity waves in dimension 2. The main difficulty consists in taking into account the dispersive nature of these waves.

  6. Fundamental mechanisms in flue gas conditioning

    Energy Technology Data Exchange (ETDEWEB)

    Bush, P.V.; Snyder, T.R.

    1992-01-09

    The overall goal of this research project is to formulate a mathematical model of flue gas conditioning. This model will be based on an understanding of why ask properties, such as cohesivity and resistivity, are changed by conditioning. Such a model could serve as a component of the performance models of particulate control devices where flue gas conditioning is used. There are two specific objectives of this research project, which divide the planned research into two main parts. One part of the project is designed to determine how ash particles are modified by interactions with sorbent injection processes and to describe the mechanisms by which these interactions affect fine particle collection. The objective of the other part of the project is to identify the mechanisms by which conditioning agents, including chemically active compounds, modify the key properties of fine fly ash particles.

  7. Asset Condition, Information Systems and Decision Models

    CERN Document Server

    Willett, Roger; Brown, Kerry; Mathew, Joseph

    2012-01-01

    Asset Condition, Information Systems and Decision Models, is the second volume of the Engineering Asset Management Review Series. The manuscripts provide examples of implementations of asset information systems as well as some practical applications of condition data for diagnostics and prognostics. The increasing trend is towards prognostics rather than diagnostics, hence the need for assessment and decision models that promote the conversion of condition data into prognostic information to improve life-cycle planning for engineered assets. The research papers included here serve to support the on-going development of Condition Monitoring standards. This volume comprises selected papers from the 1st, 2nd, and 3rd World Congresses on Engineering Asset Management, which were convened under the auspices of ISEAM in collaboration with a number of organisations, including CIEAM Australia, Asset Management Council Australia, BINDT UK, and Chinese Academy of Sciences, Beijing University of Chemical Technology, Chin...

  8. Dream Skepticism and the Conditionality Problem

    DEFF Research Database (Denmark)

    Ahlström, Kristoffer

    2011-01-01

    Recently, Ernest Sosa (2007) has proposed two novel solutions to the problem of dream skepticism. In the present paper, I argue that Sosa's first solution falls prey to what I will refer to as the conditionality problem, i.e., the problem of only establishing a conditional---in this case, "if x......, then I am awake," x being a placeholder for a condition incompatible with dreaming---in a context where it also needs to be established that we can know that the antecedent holds, and as such can infer the consequent, i.e., "I am awake." Sosa's second solution in terms of so-called reflective knowledge......, is shown to land him in the dilemma of either facing yet another conditionality problem, or violating an internalist constraint that he explicitly grants the skeptic with respect to what kind of factors can be legitimately invoked in our account of how we may know the relevant antecedent. For these...

  9. Junction conditions in extended Teleparallel gravities

    International Nuclear Information System (INIS)

    In the context of extended Teleparallel gravity theories, we address the issue of junction conditions required to guarantee the correct matching of different regions of spacetime. In the absence of shells/branes, these conditions turn out to be more restrictive than their counterparts in General Relativity as in other extended theories of gravity. In fact, the general junction conditions on the matching hypersurfaces depend on the underlying theory and a new condition on the induced tetrads in order to avoid delta-like distributions in the field equations. This result imposes strict consequences on the viability of standard solutions such as the Einstein-Straus-like construction. We find that the continuity of the scalar torsion is required in order to recover the usual General Relativity results

  10. High order sufficient conditions for tracking

    CERN Document Server

    Barbero-Liñán, María

    2009-01-01

    In this paper, we study under which conditions the trajectories of a mechanical control system can track any curve on the configuration manifold. We focus on systems that can be represented as forced affine connection control systems and we generalize the sufficient conditions for tracking known in the literature. The sufficient conditions are expressed in terms of convex cones of vector fields defined through particular brackets of the control vector fields of the system. The tracking control laws obtained by our constructions depend on several parameters. By imposing suitable asymptotic conditions on such parameters, we construct algorithmically one-parameter tracking control laws. The theory is supported by examples of control systems associated with elliptic hovercrafts and ellipsoidal submarines.

  11. Neutron transport with periodic boundary conditions

    Energy Technology Data Exchange (ETDEWEB)

    Angelescu, N.; Marinescu, N.; Protopopescu, V.

    1976-01-01

    The initial value problem for monoenergetic neutron transport in homogeneous nonmultiplying, nonabsorbing medium with isotropic scattering and periodic boundary conditions. One completely determines the structure of the spectrum of the transport operator both in plane and parallelepipedic geometries.

  12. Sufficient Conditions of Nonsingular H-matrices

    Institute of Scientific and Technical Information of China (English)

    王广彬; 洪振杰; 高中喜

    2004-01-01

    From the concept of a diagonally dominant matrix, two sufficient conditions of nonsingular H-matrices were obtained in this paper. An example was given to show that these results improve the known results.

  13. Matching Conditions on Capillary Ripples Polarization

    CERN Document Server

    Rodríguez, A H; Rodríguez-Coppola, H; Rodriguez, Arezky H.

    2000-01-01

    The matching conditions at the interface between two non-mixed fluids at rest are obtained directly using the equation of movement of the whole media. This is a non-usual point of view in hydrodynamics courses and our aim is to fix ideas about the intrinsic information contained in the matching conditions, on fluids in this case. Afterward, it is analyzed the polarization of the normal modes at the interface and it is shown that this information can be achieved through a physical analysis and reinforced later by the matching conditions. A detailed analysis of the matching conditions is given to understand the role that plays the continuity of the stress tensor through the interface on the physics of the surface particle movement. The main importance of the viscosity of each medium is deduced.

  14. Fuel-cell engine stream conditioning system

    Science.gov (United States)

    DuBose, Ronald Arthur

    2002-01-01

    A stream conditioning system for a fuel cell gas management system or fuel cell engine. The stream conditioning system manages species potential in at least one fuel cell reactant stream. A species transfer device is located in the path of at least one reactant stream of a fuel cell's inlet or outlet, which transfer device conditions that stream to improve the efficiency of the fuel cell. The species transfer device incorporates an exchange media and a sorbent. The fuel cell gas management system can include a cathode loop with the stream conditioning system transferring latent and sensible heat from an exhaust stream to the cathode inlet stream of the fuel cell; an anode humidity retention system for maintaining the total enthalpy of the anode stream exiting the fuel cell related to the total enthalpy of the anode inlet stream; and a cooling water management system having segregated deionized water and cooling water loops interconnected by means of a brazed plate heat exchanger.

  15. Savings under formal and informal conditions

    OpenAIRE

    Mariano Bosch; Angel Melguizo; Ximena Peña; David Tuesta

    2015-01-01

    This study analyzes different individual\\'s factors that impact savings conditions, based on two innovative surveys performed by the Inter-American Development Bank (IDB) for the cities of Lima and Mexico D.F.

  16. Enhancing Medicares Hospital Acquired Conditions Policy

    Data.gov (United States)

    U.S. Department of Health & Human Services — The current Medicare policy of non-payment to hospitals for Hospital Acquired Conditions (HAC) seeks to avoid payment for preventable complications identified...

  17. Multiple Chronic Conditions Among Medicare Beneficiaries...

    Data.gov (United States)

    U.S. Department of Health & Human Services — Individuals with multiple chronic conditions (MCC) present many challenges to the health care system, such as effective coordination of care and cost containment....

  18. Probability of Boundary Conditions in Quantum Cosmology

    CERN Document Server

    Suenobu, Hiroshi

    2016-01-01

    One of the main interest in quantum cosmology is to determine which type of boundary conditions for the wave function of the universe can predict observational data of our universe. For this purpose, we solve the Wheeler-DeWitt equation numerically and evaluate probabilities for an observable representing evolution of the classical universe, especially, the number of e-foldings of the inflation. To express boundary conditions of the wave function, we use exact solutions of the Wheeler-DeWitt equation with constant scalar field potential. These exact solutions include wave functions with well known boundary condition proposals, the no-boundary proposal and the tunneling proposal. We specify them introducing two real parameters which discriminate boundary conditions and estimate values of these parameters resulting in observationally preferable predictions. We obtain the probability for these parameters under the requirement of the sufficient e-foldings of the inflation.

  19. Frailty and Pain: Two Related Conditions.

    Science.gov (United States)

    Nessighaoui, H; Lilamand, M; Patel, K V; Vellas, B; Laroche, M L; Dantoine, T; Cesari, M

    2015-01-01

    Frailty is a multidimensional syndrome, involving functional, nutritional, biological and psychological aspects. This condition, defined as a decreased resistance to internal and external stressors, is predictive of adverse health outcomes, including disability and mortality. Importantly, the frailty syndrome is usually considered a reversible condition, thus amenable of specific preventive interventions. Persistent pain in older adults is very common and has multiple determinants. This symptom represents a determinant of accelerated aging. In the present paper, we discuss available evidence examining the association between these two conditions. Despite the high prevalence of these two conditions and their shared underlying mechanisms, our search only retrieved few relevant studies. Most of them reported a relationship between pain (or analgesics consumption) and different operational definitions of frailty. Pain may represent a relevant risk factor as well as a potential target for interventions against the frailty syndrome, but further studies are needed. PMID:27030942

  20. 7 CFR 29.3511 - Condition.

    Science.gov (United States)

    2010-01-01

    ... INSPECTION Standards Official Standard Grades for Dark Air-Cured Tobacco (u.s. Types 35, 36, 37 and Foreign... the degree of fermentation. Words used to describe the condition of tobacco are: Undried,...

  1. Pre-Existing Condition Insurance Plan Data

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Affordable Care Act created the new Pre-Existing Condition Insurance Plan (PCIP) program to make health insurance available to Americans denied coverage by...

  2. Sequential monitoring with conditional randomization tests

    CERN Document Server

    Plamadeala, Victoria; 10.1214/11-AOS941

    2012-01-01

    Sequential monitoring in clinical trials is often employed to allow for early stopping and other interim decisions, while maintaining the type I error rate. However, sequential monitoring is typically described only in the context of a population model. We describe a computational method to implement sequential monitoring in a randomization-based context. In particular, we discuss a new technique for the computation of approximate conditional tests following restricted randomization procedures and then apply this technique to approximate the joint distribution of sequentially computed conditional randomization tests. We also describe the computation of a randomization-based analog of the information fraction. We apply these techniques to a restricted randomization procedure, Efron's [Biometrika 58 (1971) 403--417] biased coin design. These techniques require derivation of certain conditional probabilities and conditional covariances of the randomization procedure. We employ combinatoric techniques to derive t...

  3. Junction conditions in extended Teleparallel gravities

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz-Dombriz, Álvaro [Departamento de Física Teórica I, Ciudad Universitaria, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Dunsby, Peter K.S.; Sáez-Gómez, Diego, E-mail: dombriz@fis.ucm.es, E-mail: peter.dunsby@uct.ac.za, E-mail: diego.saezgomez@uct.ac.za [Astrophysics, Cosmology and Gravity Centre (ACGC), Department of Mathematics and Applied Mathematics, University of Cape Town, Rondebosch 7701, Cape Town (South Africa)

    2014-12-01

    In the context of extended Teleparallel gravity theories, we address the issue of junction conditions required to guarantee the correct matching of different regions of spacetime. In the absence of shells/branes, these conditions turn out to be more restrictive than their counterparts in General Relativity as in other extended theories of gravity. In fact, the general junction conditions on the matching hypersurfaces depend on the underlying theory and a new condition on the induced tetrads in order to avoid delta-like distributions in the field equations. This result imposes strict consequences on the viability of standard solutions such as the Einstein-Straus-like construction. We find that the continuity of the scalar torsion is required in order to recover the usual General Relativity results.

  4. Comment on Li pellet Conditioning in TFTR

    International Nuclear Information System (INIS)

    Li pellet conditioning in TFTR results in a reduction of the edge electron density which allows increased neutral beam penetration, central heating, and fueling. Consequently the temperature profiles became more peaked with higher central Ti, Te, and neutron emission rates.

  5. MICROBIAL BIOFILMS AS INDICATORS OF ESTUARINE CONDITION

    Science.gov (United States)

    Microbial biofilms are complex communities of bacteria, protozoa, microalgae, and micrometazoa which exist in a polymer matrix on submerged surfaces. Their development is integrative of environmental conditions and is affected by local biodiversity, the availability of organic ma...

  6. Air Conditioning Does Reduce Air Pollution Indoors

    Science.gov (United States)

    Healy, Bud

    1970-01-01

    Report of the winter meeting of the American Society of Heating, Refrigerating and Air-Conditioning Engineers. Subjects covered are--(1) title subject, (2) predictions for the human habitat in 1994, (3) fans, and (4) fire safety in buildings. (JW)

  7. Molecular Mechanisms of Renal Ischemic Conditioning Strategies.

    Science.gov (United States)

    Kierulf-Lassen, Casper; Nieuwenhuijs-Moeke, Gertrude J; Krogstrup, Nicoline V; Oltean, Mihai; Jespersen, Bente; Dor, Frank J M F

    2015-01-01

    Ischemia-reperfusion injury is the leading cause of acute kidney injury in a variety of clinical settings such as renal transplantation and hypovolemic and/or septic shock. Strategies to reduce ischemia-reperfusion injury are obviously clinically relevant. Ischemic conditioning is an inherent part of the renal defense mechanism against ischemia and can be triggered by short periods of intermittent ischemia and reperfusion. Understanding the signaling transduction pathways of renal ischemic conditioning can promote further clinical translation and pharmacological advancements in this era. This review summarizes research on the molecular mechanisms underlying both local and remote ischemic pre-, per- and postconditioning of the kidney. The different types of conditioning strategies in the kidney recruit similar powerful pro-survival mechanisms. Likewise, renal ischemic conditioning mobilizes many of the same protective signaling pathways as in other organs, but differences are recognized. PMID:26330099

  8. Evaluation of the International coffee market conditions

    OpenAIRE

    FISAKOVA O.S.

    2014-01-01

    This article includes analysis of coffee market and its conditions for coffee companies. Also, coffee export amounts and prices are compared and analyzed. Statistics were collected over few last years to present accurate research

  9. Constant conditional entropy and related hypotheses

    International Nuclear Information System (INIS)

    Constant entropy rate (conditional entropies must remain constant as the sequence length increases) and uniform information density (conditional probabilities must remain constant as the sequence length increases) are two information theoretic principles that are argued to underlie a wide range of linguistic phenomena. Here we revise the predictions of these principles in the light of Hilberg’s law on the scaling of conditional entropy in language and related laws. We show that constant entropy rate (CER) and two interpretations for uniform information density (UID), full UID and strong UID, are inconsistent with these laws. Strong UID implies CER but the reverse is not true. Full UID, a particular case of UID, leads to costly uncorrelated sequences that are totally unrealistic. We conclude that CER and its particular cases are incomplete hypotheses about the scaling of conditional entropies. (letter)

  10. Possible interrelations among chemical freezeout conditions

    CERN Document Server

    Tawfik, A; Habashy, D M; Mohamed, M T; Abbas, E

    2016-01-01

    At thermal equilibrium, different chemical freezeout conditions have been proposed so far. They have an ultimate aim of proposing a universal description for the chemical freezeout parameters ($T_{ch}$ and $\\mu_b$), which are to be extracted from the statistical fitting of different particle ratios measured at various collision energies with calculations from thermal models. A systematic comparison between these conditions is presented. The physical meaning of each of them and their sensitivity to the hadron mass cuts are discussed. Based on availability, some of them are compared with recent lattice calculations. We found that most of these conditions are thermodynamically equivalent, especially at small baryon chemical potential. We propose that further crucial consistency tests should be performed at low energies. The fireball thermodynamics is another way of guessing conditions describing the chemical freezeout parameters extracted from high-energy experiments. We endorse the possibility that the various ...

  11. Student difficulties with Boundary Conditions in electrodynamics

    CERN Document Server

    Ryan, Qing X; Wilcox, Bethany R

    2015-01-01

    Boundary conditions (BCs) are considered as an important topic that advanced physics under- graduates are expected to understand and apply. We report findings from an investigation of student difficulties using boundary conditions (BCs) in electrodynamics. Our data sources include student responses to traditional exam questions, conceptual survey questions, and think-aloud interviews. The analysis was guided by an analytical framework that characterizes how students activate, con- struct, execute, and reflect on boundary conditions. Common student difficulties include: activating boundary conditions in appropriate contexts; constructing a complex expression for the E&M waves; mathematically simplifying complex exponentials and checking if the reflection and transmission co- efficient are physical. We also present potential pedagogical implications based on our observations.

  12. Two roads to the null energy condition

    Science.gov (United States)

    Parikh, Maulik

    2015-11-01

    The null energy condition has sweeping consequences in general relativity. I argue here that it has been misunderstood as a property exclusively of matter, when in fact it arises only in a theory of both matter and gravity. I then derive an equivalent geometric formulation of the null energy condition from worldsheet string theory, where it arises beautifully as simple Einstein’s equations in two dimensions. But further, I show that this condition also has a thermodynamic origin, following from a local version of the second law of thermodynamics, applied to gravitational entropy. Thus, far from being an incidental property of matter, the validity of the null energy condition hints at the deep dual origins of gravity.

  13. Two Roads to the Null Energy Condition

    CERN Document Server

    Parikh, Maulik

    2015-01-01

    The null energy condition has sweeping consequences in general relativity. I argue here that it has been misunderstood as a property exclusively of matter, when in fact it arises only in a theory of both matter and gravity. I then derive an equivalent geometric formulation of the null energy condition from worldsheet string theory, where it arises beautifully as simply Einstein's equations in two dimensions. But further, I show that this condition also has a thermodynamic origin, following from a local version of the second law of thermodynamics, applied to gravitational entropy. Thus, far from being an incidental property of matter, the validity of the null energy condition hints at the deep dual origins of gravity.

  14. Scalar Boundary Conditions in Hyperscaling Violating Geometry

    CERN Document Server

    Wu, Jian-Pin

    2015-01-01

    We study the possible boundary conditions of scalar field modes in a hyperscaling violation(HV) geometry with Lifshitz dynamical exponent $z (z\\geqslant1)$ and hyperscaling violation exponent $\\theta (\\theta\

  15. Initial conditions and sampling for multifield inflation

    CERN Document Server

    Easther, Richard

    2013-01-01

    We investigate the initial conditions problem for multifield inflation. In these scenarios the pre-inflationary dynamics can be chaotic, increasing the sensitivity of the onset of inflation to the initial data even in the homogeneous limit. To analyze physically equivalent scenarios we compare initial conditions at fixed energy. This ensures that each trajectory is counted once and only once, since the energy density decreases monotonically. We present a full analysis of hybrid inflation that reveals a greater degree of long range order in the set of "successful" initial conditions than was previously apparent. We explore the effective smoothing scale for the fractal set of successful initial conditions induced by the finite duration of the pre-inflationary phase. The role of the prior information used to specify the initial data is discussed in terms of Bayesian sampling.

  16. Rural population growth and living conditions.

    Science.gov (United States)

    Li, N; Zhu, C

    1991-01-01

    The problem of the effect of population growth on subsistence conditions is addressed by developing generalized premises, principles, and methods for quantifying standards or conditions for growth. This method is applied to 1989 data for Nanzheng Country, China. Background information is provided on an experiment made public in 1985 and implemented in 1986 by the Family Planning (FP) Department of Nanzheng County of Shaanxi Province in Hongmiao District in which the following conditions were placed on bearing a second child: 1) income must be 20% higher than the average village income level, and breeders must have an average income of not 400 yuan/year, crop planters not 300 yuan/year, textile weavers not 200 yuan/year, and industrial and subsidiary production workers not 400 yuan/year (generally 4 pigs or 100 chickens or ducks) or 2) 100 income-producing trees must be planted around he residential area/family plot or stony fields must be transformed into arable land under the contract responsibility system, or groves, orchards, or tea plantations must be planted. These conditions must be met one year prior to proposing to have a second child. The approval rate in 1986-88 was 88.7%, and the second parity rate was 78.4%. Deteriorated conditions had not yet occurred in this country when this proposal was made. The premises considered important in preparing assistance conditions were determined. 1) Conditions for population growth should be resolved within the area. 2) Subsistence conditions should be taken care of by the family. 3) There should be a centralized standard, not a family standard, such that living conditions/capita should not decrease because of population growth. Quantification is made expressing the relationship between subsistence and growth. The application of these conditions for households in Hongmiao District is that the average subsistence conditions need to be higher than other households by 12.3% for new population growth. The assumption is

  17. Efficient algorithms for conditional independence inference

    Czech Academy of Sciences Publication Activity Database

    Bouckaert, R.; Hemmecke, R.; Lindner, S.; Studený, Milan

    2010-01-01

    Roč. 11, č. 1 (2010), s. 3453-3479. ISSN 1532-4435 R&D Projects: GA ČR GA201/08/0539; GA MŠk 1M0572 Institutional research plan: CEZ:AV0Z10750506 Keywords : conditional independence inference * linear programming approach Subject RIV: BA - General Mathematics Impact factor: 2.949, year: 2010 http://library.utia.cas.cz/separaty/2010/MTR/studeny-efficient algorithms for conditional independence inference.pdf

  18. A Monetary Conditions Index for Mainland China

    OpenAIRE

    Wensheng Peng; Frank Leung

    2005-01-01

    Economic and financial developments on the Mainland have important implications for Hong Kong. This paper presents an empirical framework for assessing monetary and financial conditions on the Mainland by estimating a monetary conditions index (MCI). An MCI is usually defined as a weighted sum of some measures of real interest rate and the real effective exchange rate (REER). Because bank credit is an important channel of monetary policy transmission mechanism in Mainland China, this study ex...

  19. Conditional Moment Models under Weak Identification

    OpenAIRE

    Antoine, Bertille; Lavergne, Pascal

    2011-01-01

    We consider models defined by a set of conditional moment restrictions where weak identification may arise. Weak identification is directly defined through the conditional moments that are allowed to flatten as the sample size increases. We propose a minimum distance estimator of the structural parameters that is robust to potential weak identification and that uses neither instrumental variables nor smoothing. Hence, its properties only depend upon identification weakness, and not on the int...

  20. Modeling fear-conditioned bradycardia in humans

    OpenAIRE

    Castegnetti, G.; Tzovara, A.; Staib, M.; Paulus, P. C.; Hofer, N.; Bach, D R

    2016-01-01

    Across species, cued fear conditioning is a common experimental paradigm to investigate aversive Pavlovian learning. While fear-conditioned stimuli (CS+) elicit overt behavior in many mammals, this is not the case in humans. Typically, autonomic nervous system activity is used to quantify fear memory in humans, measured by skin conductance responses (SCR). Here, we investigate whether heart period responses (HPR) evoked by the CS, often observed in humans and small mammals, are suitable to co...