Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

Science.gov (United States)

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Effects of sodium arsenite on the survival of UV-irradiated Escherichia coli: inhibition of a recA-dependent function

Energy Technology Data Exchange (ETDEWEB)

Rossman, T; Meyn, M S; Troll, W [New York Univ., N.Y. (USA). Dept. of Environmental Medicine

1975-11-01

Epidemiological studies and clinical observations suggesting potential hazards of arsenic compounds in increasing the incidence of cancer have been in complete contradiction with experimental findings in animals. Because of the predominance of skin cancers in the epidemiological reports, it was decided to investigate the possibility that arsenic compounds might interfere with DNA repair. Using Escherichia coli as a test system, it is shown that this is indeed the case. Sodium arsenite, at concentrations of 0.1mM and higher, decreases the survival of ultraviolet-irradiated E.coli WP2, a strain which possesses the full complement of repair genes. The effect of the arsenite increases with increasing ultraviolet dose. Similar results were obtained with the excision repair deficient strains WWP2 (uvrA) and WP6(polA). Sodium arsenite had no effect on the survival of recA mutant, WP10. Survival of ultraviolet-irradiated WP5(exrA) was enhanced by sodium arsenite, the effect being greatest at low ultraviolet doses. It is postulated that arsenite inhibits a recA-dependent step in DNA repair. To account for the increased survival of the exrA mutant, it is suggested that in the absence of the exr/sup +/ gene, the arsenite-sensitive recA-dependent function is deleterious. The ability of arsenite to inhibit DNA repair may account for the clinical and epidemiological reports linking arsenicals with an increased incidence of cancer.

Embryotoxicity of arsenite and arsenate

International Nuclear Information System (INIS)

Lindgren, A.; Danielsson, R.G.; Dencker, L.; Vahter, M.

1984-01-01

The distribution of 74 As-labelled and arsenite in pregnant mice and a monkey has been studied by autoradiography and gamma counting of isolated tissues, and their in vitro toxicity to a chondrogenic system has been investigated. With both arsenic forms, given as single intravenous injections to the mother, the 74 As-arsenic appeared to pass the mouse placenta relatively freely and approximately to the same extent. The retention time in material tissues including the placenta was, however, around three times longer with arsenite than with arsenate. In early gestation, high activity was registered in the embryonic neuroepithelium, which correlates well with reported CNS malformations in rodents. In late gestation, the distribution pattern was more like that in the adults. Accumulation in skin and squamous epithelia of the upper gastrointestinal tract (oral cavity, oesophagus and oesophageal region of stomach) dominated the distribution pucture, especially at a long survival interval. Arsenate, but not arsenite, showed affinity for the calcified areas of the skeleton. A marmoset monkey in late gestation receiving arsenite showed a somewhat lower rate of placental transfer than the mice. Skin and liver had the highest concentrations (at 8 hrs), both in mother and foetuses. This species is known not to methylate arsenic, resulting in stronger binding and longer retention times of arsenic as compared with other species. The stronger binding in maternal tissues may possibly explain the lower rate of placental transfer. Arsenite was shown to inhibit cartilage formation in a chick limb bud mesenchymal spot culture system (ED50 approximately 5-10μM) while arsenate seemed to be without effect at concentrations up to 200 μM (highest tested). Arsenate, however, showed a potential of the arsenite toxicity. (author)

Facultative anoxygenic photosynthesis in cyanobacteria driven by arsenite and sulfide with evidence for the support of nitrogen fixation

Science.gov (United States)

Wolfe-Simon, F.; Hoeft, S. E.; Baesman, S. M.; Oremland, R. S.

2010-12-01

The rise in atmospheric oxygen (O2) over geologic time is attributed to the evolution and widespread proliferation of oxygenic photosynthesis in cyanobacteria. However, cyanobacteria maintain a metabolic flexibility that may not always result in O2 release. In the environment, cyanobacteria may use a variety of alternative electron donors rather than water that are known to be used by other anoxygenic phototrophs (eg. purple sulfur bacteria) including reduced forms of sulfur, iron, nitrogen, and arsenic. Recent evidence suggests cyanobacteria actively take advantage of at least a few of these alternatives. We used a classical Winogradsky approach to enrich for cyanobacteria from the high salinity, elevated pH and arsenic-enriched waters of Mono Lake (CA). Experiments, optimized for cyanobacteria, revealed light-dependent, anaerobic arsenite-oxidation in sub-cultured sediment-free enrichments dominated by a filamentous cyanobacteria. We isolated and identified the dominant member of this enrichment to be a member of the Oscillatoriales by 16S rDNA. Addition of 1 mM arsenite induced facultative anoxygenic photosynthesis under continuous and circadian light. This isolate also oxidized sulfide under the same light-based conditions. Aerobic conditions elicited no arsenite oxidation in the light or dark and the isolate grew as a typical cyanobacterium using oxygenic photosynthesis. Under near-infrared light (700 nm) there was a direct correlation of enhanced growth with an increase in the rate arsenite or sulfide oxidation suggesting the use of photosystem I. Additionally, to test the wide-spread nature of this metabolism in the Oscillatoriales, we followed similar arsenite- and sulfide-driven facultative anoxygenic photosynthesis as well as nitrogen fixation (C2H2 reduction) in the axenic isolate Oscillatoria sp. CCMP 1731. Future characterization includes axenic isolation of the Mono Lake Oscillatoria sp. as well as the arsenite oxidase responsible for electron

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

NARCIS (Netherlands)

Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

1989-01-01

We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

Photoinduced Oxidation of Arsenite to Arsenate on Ferrihydrite

Energy Technology Data Exchange (ETDEWEB)

N Bhandari; R Reeder; D Strongin

2011-12-31

The photochemistry of an aqueous suspension of the iron oxyhydroxide, ferrihydrite, in the presence of arsenite has been investigated using attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR), X-ray absorption near edge structure (XANES), and solution phase analysis. Both ATR-FTIR and XANES show that the exposure of ferrihydrite to arsenite in the dark leads to no change in the As oxidation state, but the exposure of this arsenite-bearing surface, which is in contact with pH 5 water, to light leads to the conversion of the majority of the adsorbed arsenite to the As(V) bearing species, arsenate. Analysis of the solution phase shows that ferrous iron is released into solution during the oxidation of arsenite. The photochemical reaction, however, shows the characteristics of a self-terminating reaction in that there is a significant suppression of this redox chemistry before 10% of the total iron making up the ferrihydrite partitions into solution as ferrous iron. The self-terminating behavior exhibited by this photochemical arsenite/ferrihydrite system is likely due to the passivation of the ferrihydrite surface by the strongly bound arsenate product.

Genome sequence of the photoarsenotrophic bacterium Ectothiorhodospira sp. strain BSL-9, isolated from a hypersaline alkaline arsenic-rich extreme environment

Science.gov (United States)

Hernandez-Maldonado, Jaime; Stoneburner, Brendon; Boren, Alison; Miller, Laurence; Rosen, Michael R.; Oremland, Ronald S.; Saltikov, Chad W

2016-01-01

The full genome sequence of Ectothiorhodospira sp. strain BSL-9 is reported here. This purple sulfur bacterium encodes an arxA-type arsenite oxidase within the arxB2AB1CD gene island and is capable of carrying out “photoarsenotrophy” anoxygenic photosynthetic arsenite oxidation. Its genome is composed of 3.5 Mb and has approximately 63% G+C content.

Do Si/As ratios in growth medium affect arsenic uptake, arsenite efflux and translocation of arsenite in rice (Oryza sativa)?

Science.gov (United States)

Zhang, Min; Zhao, Quanli; Xue, Peiying; Zhang, Shijie; Li, Bowen; Liu, Wenju

2017-10-01

Silicon (Si) may decrease the uptake and accumulation of arsenic (As) in rice. However, the effects of Si/As ratios in growth medium on arsenic uptake, arsenite efflux to the external medium and translocation of arsenite in rice are currently unclear. Rice seedlings (Oryza sativa L.) were exposed to nutrient solutions with 10 μM arsenite [As(III)] or 10 μM arsenate [As(V)] to explore the influence of different silicic acid concentrations (0, 10, 100, 1000 μM) on arsenic uptake and translocation of arsenite with or without 91 μM phosphate for 24 h. Arsenic speciation was determined in nutrient solutions, roots, and shoots. In the arsenite treatments, different Si/As ratios (1:1, 10:1, 100:1) did not affect As(III) uptake by rice roots, however they did inhibit translocation of As(III) from roots to shoots significantly (P rice roots and shoots. A Si/As ratio of 100:1 reduced As(III) translocation from roots to shoots markedly without phosphate. When phosphate was supplied, As(III) translocation from roots to shoots was significantly inhibited by Si/As ratios of 10:1 and 100:1. The results indicated that in the presence of P, different silicic acid concentrations did not impact arsenite uptake and transport in rice when arsenite was supplied. However, a Si/As ratio of 100:1 inhibited As(V) uptake, as well as As(III) efflux and translocation from roots to shoots when arsenate was supplied. Copyright © 2017 Elsevier Ltd. All rights reserved.

The metalloid arsenite induces nuclear export of Id3 possibly via binding to the N-terminal cysteine residues

International Nuclear Information System (INIS)

Kurooka, Hisanori; Sugai, Manabu; Mori, Kentaro; Yokota, Yoshifumi

2013-01-01

Highlights: •Sodium arsenite induces cytoplasmic accumulation of Id3. •Arsenite binds to closely spaced N-terminal cysteine residues of Id3. •N-terminal cysteines are essential for arsenite-induced nuclear export of Id3. •Nuclear export of Id3 counteracts its transcriptional repression activity. -- Abstract: Ids are versatile transcriptional repressors that regulate cell proliferation and differentiation, and appropriate subcellular localization of the Id proteins is important for their functions. We previously identified distinct functional nuclear export signals (NESs) in Id1 and Id2, but no active NES has been reported in Id3. In this study, we found that treatment with the stress-inducing metalloid arsenite led to the accumulation of GFP-tagged Id3 in the cytoplasm. Cytoplasmic accumulation was impaired by a mutation in the Id3 NES-like sequence resembling the Id1 NES, located at the end of the HLH domain. It was also blocked by co-treatment with the CRM1-specific nuclear export inhibitor leptomycin B (LMB), but not with the inhibitors for mitogen-activated protein kinases (MAPKs). Importantly, we showed that the closely spaced N-terminal cysteine residues of Id3 interacted with the arsenic derivative phenylarsine oxide (PAO) and were essential for the arsenite-induced cytoplasmic accumulation, suggesting that arsenite induces the CRM1-dependent nuclear export of Id3 via binding to the N-terminal cysteines. Finally, we demonstrated that Id3 significantly repressed arsenite-stimulated transcription of the immediate-early gene Egr-1 and that this repression activity was inversely correlated with the arsenite-induced nuclear export. Our results imply that Id3 may be involved in the biological action of arsenite

p52-Bcl3 complex promotes cyclin D1 expression in BEAS-2B cells in response to low concentration arsenite

International Nuclear Information System (INIS)

Wang, Feng; Shi, Yongli; Yadav, Santosh; Wang, He

2010-01-01

Arsenic is a well-recognized human carcinogen that causes a number of malignant diseases, including lung cancer. Previous studies have indicated that cyclin D1 is frequently over-expressed in many cancer types. It is also known that arsenite exposure enhances cyclin D1 expression, which involves NF-κB activation. However, the mechanism between cyclin D1 and the NF-κB pathway has not been well studied. This study was designed to characterize the underlying mechanism of induced cell growth and cyclin D1 expression in response to low concentration sodium arsenic (NaAsO 2 ) exposure through the NF-κB pathway. Cultured human bronchial epithelial cells, BEAS-2B, were exposed to low concentration sodium arsenite for the indicated durations, and cytotoxicity, gene expression, and protein activity were assessed. To profile the canonical and non-canonical NF-κB pathways involved in cell growth and cyclin D1 expression induced by low concentration arsenite, the NF-κB-specific inhibitor-phenethyl caffeate (CAPE) and NF-κB2 mRNA target sequences were used, and cyclin D1 expression in BEAS-2B cells was assessed. Our results demonstrated that exposure to low concentration arsenite enhanced BEAS-2B cells growth and cyclin D1 mRNA and protein expression. Activation and nuclear localization of p52 and Bcl3 in response to low concentration arsenite indicated that the non-canonical NF-κB pathway was involved in arsenite-induced cyclin D1 expression. Moreover, we further demonstrated that p52/Bcl3 complex formation enhanced cyclin D1 expression through the cyclin D1 gene promoter via its κB site. The up-regulation of cyclin D1 mediated by the p52-Bcl3 complex in response to low concentration arsenite might be important in assessing the health risk of low concentration arsenite and understanding the mechanisms of the harmful effects of arsenite.

Effects upon metabolic pathways and energy production by Sb(III and As(III/Sb(III-oxidase gene aioA in Agrobacterium tumefaciens GW4.

Directory of Open Access Journals (Sweden)

Jingxin Li

Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

Science.gov (United States)

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Enzyme phylogenies as markers for the oxidation state of the environment: the case of respiratory arsenate reductase and related enzymes.

Science.gov (United States)

Duval, Simon; Ducluzeau, Anne-Lise; Nitschke, Wolfgang; Schoepp-Cothenet, Barbara

2008-07-16

Phylogenies of certain bioenergetic enzymes have proved to be useful tools for deducing evolutionary ancestry of bioenergetic pathways and their relationship to geochemical parameters of the environment. Our previous phylogenetic analysis of arsenite oxidase, the molybdopterin enzyme responsible for the biological oxidation of arsenite to arsenate, indicated its probable emergence prior to the Archaea/Bacteria split more than 3 billion years ago, in line with the geochemical fact that arsenite was present in biological habitats on the early Earth. Respiratory arsenate reductase (Arr), another molybdopterin enzyme involved in microbial arsenic metabolism, serves as terminal oxidase, and is thus situated at the opposite end of bioenergetic electron transfer chains as compared to arsenite oxidase. The evolutionary history of the Arr-enzyme has not been studied in detail so far. We performed a genomic search of genes related to arrA coding for the molybdopterin subunit. The multiple alignment of the retrieved sequences served to reconstruct a neighbor-joining phylogeny of Arr and closely related enzymes. Our analysis confirmed the previously proposed proximity of Arr to the cluster of polysulfide/thiosulfate reductases but also unravels a hitherto unrecognized clade even more closely related to Arr. The obtained phylogeny strongly suggests that Arr originated after the Bacteria/Archaea divergence in the domain Bacteria, and was subsequently laterally distributed within this domain. It further more indicates that, as a result of accumulation of arsenate in the environment, an enzyme related to polysulfide reductase and not to arsenite oxidase has evolved into Arr. These findings are paleogeochemically rationalized by the fact that the accumulation of arsenate over arsenite required the increase in oxidation state of the environment brought about by oxygenic photosynthesis.

Endoplasmic reticulum stress is involved in arsenite-induced oxidative injury in rat brain

International Nuclear Information System (INIS)

Lin, Anya M.Y.; Chao, P.L.; Fang, S.F.; Chi, C.W.; Yang, C.H.

2007-01-01

The mechanism underlying sodium arsenite (arsenite)-induced neurotoxicity was investigated in rat brain. Arsenite was locally infused in the substantia nigra (SN) of anesthetized rat. Seven days after infusion, lipid peroxidation in the infused SN was elevated and dopamine level in the ipsilateral striatum was reduced in a concentration-dependent manner (0.3-5 nmol). Furthermore, local infusion of arsenite (5 nmol) decreased GSH content and increased expression of heat shock protein 70 and heme oxygenase-1 in the infused SN. Aggregation of α-synuclein, a putative pathological protein involved in several CNS neurodegenerative diseases, was elevated in the arsenite-infused SN. From the breakdown pattern of α-spectrin, both necrosis and apoptosis were involved in the arsenite-induced neurotoxicity. Pyknotic nuclei, cellular shrinkage and cytoplasmic disintegration, indicating necrosis, and TUNEL-positive cells and DNA ladder, indicating apoptosis was observed in the arsenite-infused SN. Arsenite-induced apoptosis was mediated via two different organelle pathways, mitochondria and endoplasmic reticulum (ER). For mitochondrial activation, cytosolic cytochrome c and caspase-3 levels were elevated in the arsenite-infused SN. In ER pathway, arsenite increased activating transcription factor-4, X-box binding protein 1, C/EBP homologues protein (CHOP) and cytosolic immunoglobulin binding protein levels. Moreover, arsenite reduced procaspase 12 levels, an ER-specific enzyme in the infused SN. Taken together, our study suggests that arsenite is capable of inducing oxidative injury in CNS. In addition to mitochondria, ER stress was involved in the arsenite-induced apoptosis. Arsenite-induced neurotoxicity clinically implies a pathophysiological role of arsenite in CNS neurodegeneration

An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

Energy Technology Data Exchange (ETDEWEB)

Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

1997-03-01

An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

Directory of Open Access Journals (Sweden)

O.I. Grabelnych

2017-02-01

Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

Energy Technology Data Exchange (ETDEWEB)

Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G., E-mail: lhudson@salud.unm.edu

2013-06-01

Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

Draft genome sequence of the arsenite-oxidizing strain Aliihoeflea sp. 2WW, isolated from arsenic-contaminated groundwater

NARCIS (Netherlands)

Cavalca, L.; Corsini, A.; Andreoni, V.; Muyzer, G.

2013-01-01

Here, we report the draft genome sequence of the arsenite-oxidizing bacterium Aliihoeflea sp. strain 2WW, which consists of a 4.15-Mb chromosome and contains different genes that are involved in arsenic transformations.

Effect of arsenite on the DNA repair of UV-irradiated Chinese hamster ovary cells

International Nuclear Information System (INIS)

Lee-Chen, S.F.; Yu, C.T.; Jan, K.Y.

1992-01-01

Arsenite, an ubiquitous human carcinogen, has been shown to enhance the cytotoxicity, mutagenicity and clastogenicity of UV light in mammalian cells. Arsenite may exert its co-genotoxic effects by inhibiting DNA repair. Results from alkaline sucrose gradient sedimentation show that arsenite did not accumulate UV-induced DNA strand breaks in Chinese hamster ovary (CHO) K1 cells as aphidicolin plus hydroxyurea (HU) did. These data indicate that arsenite did not inhibit the activity of DNA polymerase α in UV repair. Treatment with arsenite before UV irradiation slightly reduced the DNA strand breaks accumulated by cytosine β-D-arabinofuranoside (AraC) plus HU. This effect implies that arsenite only slightly inhibited the incision of UV-induced DNA adducts. The low molecular weight DNA accumulated by post-UV incubation with AraC plus HU shifted to high molecular weight upon the incubation of cells in drug-free medium, but this shifting was prohibited by the presence of arsenite. This suggests that arsenite inhibited the rejoining of DNA strand breaks. When a pulse-chase labelling procedure was applied on UV-irradiated cells, the chain elongation of nascent DNA was strongly inhibited by post-incubation with arsenite. These data show that arsenite inhibited post-replication repair in UV-irradiated cells. Therefore, the steps inhibited by arsenite in UV-induced cells. Therefore, the steps inhibited by arsenite in UV-induced DNA repair in CHO K1 cells are different from human fibroblasts. (author)

Effect of arsenite on the DNA repair of UV-irradiated Chinese hamster ovary cells

Energy Technology Data Exchange (ETDEWEB)

Lee-Chen, S.F.; Yu, C.T.; Jan, K.Y. (Academia Sinica, Taipei, (Taiwan). Institute of Zoology)

1992-01-01

Arsenite, an ubiquitous human carcinogen, has been shown to enhance the cytotoxicity, mutagenicity and clastogenicity of UV light in mammalian cells. Arsenite may exert its co-genotoxic effects by inhibiting DNA repair. Results from alkaline sucrose gradient sedimentation show that arsenite did not accumulate UV-induced DNA strand breaks in Chinese hamster ovary (CHO) K1 cells as aphidicolin plus hydroxyurea (HU) did. These data indicate that arsenite did not inhibit the activity of DNA polymerase [alpha] in UV repair. Treatment with arsenite before UV irradiation slightly reduced the DNA strand breaks accumulated by cytosine [beta]-D-arabinofuranoside (AraC) plus HU. This effect implies that arsenite only slightly inhibited the incision of UV-induced DNA adducts. The low molecular weight DNA accumulated by post-UV incubation with AraC plus HU shifted to high molecular weight upon the incubation of cells in drug-free medium, but this shifting was prohibited by the presence of arsenite. This suggests that arsenite inhibited the rejoining of DNA strand breaks. When a pulse-chase labelling procedure was applied on UV-irradiated cells, the chain elongation of nascent DNA was strongly inhibited by post-incubation with arsenite. These data show that arsenite inhibited post-replication repair in UV-irradiated cells. Therefore, the steps inhibited by arsenite in UV-induced cells. Therefore, the steps inhibited by arsenite in UV-induced DNA repair in CHO K1 cells are different from human fibroblasts. (author).

Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish.

Science.gov (United States)

Sun, Hong-Jie; Li, Hong-Bo; Xiang, Ping; Zhang, Xiaowei; Ma, Lena Q

2015-10-01

Arsenic (As) pollution in aquatic environment may adversely impact fish health by disrupting their thyroid hormone homeostasis. In this study, we explored the effect of short-term exposure of arsenite (AsIII) on thyroid endocrine system in zebrafish. We measured As concentrations, As speciation, and thyroid hormone thyroxine levels in whole zebrafish, oxidative stress (H2O2) and damage (MDA) in the liver, and gene transcription in hypothalamic-pituitary-thyroid (HPT) axis in the brain and liver tissues of zebrafish after exposing to different AsIII concentrations for 48 h. Result indicated that exposure to AsIII increased inorganic As in zebrafish to 0.46-0.72 mg kg(-1), induced oxidative stress with H2O2 being increased by 1.4-2.5 times and caused oxidative damage with MDA being augmented by 1.6 times. AsIII exposure increased thyroxine levels by 1.3-1.4 times and modulated gene transcription in HPT axis. Our study showed AsIII caused oxidative damage, affected thyroid endocrine system and altered gene transcription in HPT axis in zebrafish. Published by Elsevier Ltd.

Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

International Nuclear Information System (INIS)

Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

2008-01-01

Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers

Sodium arsenite-induced inhibition of cell proliferation is related to inhibition of IL-2 mRNA expression in mouse activated T cells

Energy Technology Data Exchange (ETDEWEB)

Conde, Patricia; Acosta-Saavedra, Leonor C.; Calderon-Aranda, Emma S. [Centro de Investigacion y de Estudios Avanzados, CINVESTAV, Seccion Toxicologia, P.O. Box 14-740, Mexico, D.F. (Mexico); Goytia-Acevedo, Raquel C. [Universidad Juarez del Estado de Durango, Facultad de Medicina, Gomez Palacio, Durango (Mexico)

2007-04-15

A proposed mechanism for the As-induced inhibition of cell proliferation is the inhibition of IL-2 secretion. However, the effects of arsenite on IL-2 mRNA expression or on the ERK pathway in activated-T cells have not yet been described. We examined the effect of arsenite on IL-2 mRNA expression, cell activation and proliferation in PHA-stimulated murine lymphocytes. Arsenite (1 and 10 {mu}M) decreased IL-2 mRNA expression, IL-2 secretion and cell proliferation. Arsenite (10 {mu}M) strongly inhibited ERK-phosphorylation. However, the partial inhibition (50%) of IL-2 mRNA produced by 1 {mu}M, consistent with the effects on IL-2 secretion and cell proliferation, could not be explained by the inhibition of ERK-phosphorylation, which was not affected at this concentration. The inhibition of IL-2 mRNA expression caused by 1 {mu}M could be associated to effects on pathways located downstream or parallel to ERK. Arsenite also decreased early activation (surface CD69{sup +} expression) in both CD4{sup +} and CD8{sup +}, and decreased total CD8{sup +} count without significantly affecting CD4{sup +}, supporting that the cellular immune response mediated by cytotoxic T cells is an arsenic target. Thus, our results suggest that arsenite decreases IL-2 mRNA levels and T-cell activation and proliferation. However, further studies on the effects of arsenite on IL-2 gene transcription and IL-2 mRNA stability are needed. (orig.)

Diversity Surveys and Evolutionary Relationships of aoxB Genes in Aerobic Arsenite-Oxidizing Bacteria▿ †

Science.gov (United States)

Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N.; Garrido, Francis; Joulian, Catherine

2008-01-01

A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers. PMID:18502920

Effect of Zingiber Officinale (Ginger) on Sodium Arsenite- Induced ...

African Journals Online (AJOL)

Arsenite is a major environmental chemical and a known reproductive toxicant via the depression of spermatogenesis and androgenesis in males. The possibility of sodium arsenite reproductive toxicity been caused by autooxidation was investigated in this study taking advantage of the anti-oxidant properties of ginger and ...

The terminal oxidases of Paracoccus denitrificans

NARCIS (Netherlands)

de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

OpenAIRE

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

Sodium arsenite accelerates TRAIL-mediated apoptosis in melanoma cells through upregulation of TRAIL-R1/R2 surface levels and downregulation of cFLIP expression

International Nuclear Information System (INIS)

Ivanov, Vladimir N.; Hei, Tom K.

2006-01-01

AP-1/cJun, NF-κB and STAT3 transcription factors control expression of numerous genes, which regulate critical cell functions including proliferation, survival and apoptosis. Sodium arsenite is known to suppress both the IKK-NF-κB and JAK2-STAT3 signaling pathways and to activate the MAPK/JNK-cJun pathways, thereby committing some cancers to undergo apoptosis. Indeed, sodium arsenite is an effective drug for the treatment of acute promyelocytic leukemia with little nonspecific toxicity. Malignant melanoma is highly refractory to conventional radio- and chemotherapy. In the present study, we observed strong effects of sodium arsenite treatment on upregulation of TRAIL-mediated apoptosis in human and mouse melanomas. Arsenite treatment upregulated surface levels of death receptors, TRAIL-R1 and TRAIL-R2, through increased translocation of these proteins from cytoplasm to the cell surface. Furthermore, activation of cJun and suppression of NF-κB by sodium arsenite resulted in upregulation of the endogenous TRAIL and downregulation of the cFLIP gene expression (which encodes one of the main anti-apoptotic proteins in melanomas) followed by cFLIP protein degradation and, finally, by acceleration of TRAIL-induced apoptosis. Direct suppression of cFLIP expression by cFLIP RNAi also accelerated TRAIL-induced apoptosis in these melanomas, while COX-2 suppression substantially increased levels of both TRAIL-induced and arsenite-induced apoptosis. In contrast, overexpression of permanently active AKTmyr inhibited TRAIL-mediated apoptosis via downregulation of TRAIL-R1 levels. Finally, AKT overactivation increased melanoma survival in cell culture and dramatically accelerated growth of melanoma transplant in vivo, highlighting a role of AKT suppression for effective anticancer treatment

Population Structure and Abundance of Arsenite-Oxidizing Bacteria along an Arsenic Pollution Gradient in Waters of the Upper Isle River Basin, France▿ †

Science.gov (United States)

Quéméneur, Marianne; Cébron, Aurélie; Billard, Patrick; Battaglia-Brunet, Fabienne; Garrido, Francis; Leyval, Corinne; Joulian, Catherine

2010-01-01

Denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR) were successfully developed to monitor functional aoxB genes as markers of aerobic arsenite oxidizers. DGGE profiles showed a shift in the structure of the aoxB-carrying bacterial population, composed of members of the Alpha-, Beta- and Gammaproteobacteria, depending on arsenic (As) and Eh levels in Upper Isle River Basin waters. The highest aoxB gene densities were found in the most As-polluted oxic surface waters but without any significant correlation with environmental factors. Arsenite oxidizers seem to play a key role in As mobility in As-impacted waters. PMID:20453153

Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav

International Nuclear Information System (INIS)

Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.

2017-01-01

ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)

Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

Science.gov (United States)

Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

2017-09-15

Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Arsenite Oxidation and Arsenite Resistance by Bacillus sp. PNKP-S2

Directory of Open Access Journals (Sweden)

Pranee Pattanapipitpaisal

2015-01-01

Full Text Available Arsenic causes human health problems after accumulate in the body for 10-15 years and arsenite [As(III] is generally regarded as being more mobile and toxic than other oxidation states. In this study, two-hundred and three bacterial strains were isolated from groundwater and soil samples collecting in Ubon Ratchathani Province, Thailand. All strains were screened for arsenic tolerant efficiency at 1-10 mM of sodium arsenite. Eighteen selected strains which had the highest resistance to 10 mM of As(III were further studied for their As(III-oxidizing activity and growth in enrichment and growth medium (EG medium supplemented with 0.58 mM of As(III. It was found that strain PNKP-S2 was able to grow in the medium with As(III as a sole energy source and had 89.11% As(III removal within 48 h. The PCR-based 16S rDNA sequencing analysis revealed that the strain PNKP-S2 was closed relative to Bacillus sp. This is the first report on Bacillus sp. chemolithoautotrophic As(III-oxidizer and this strain could be a potential candidate for application in arsenic remediation of contaminated water.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

Science.gov (United States)

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Label-free signal-on aptasensor for sensitive electrochemical detection of arsenite.

Science.gov (United States)

Cui, Lin; Wu, Jie; Ju, Huangxian

2016-05-15

A signal-on aptasensor was fabricated for highly sensitive and selective electrochemical detection of arsenite with a label-free Ars-3 aptamer self-assembled on a screen-printed carbon electrode (SPCE) via Au-S bond. The Ars-3 aptamer could adsorb cationic polydiallyldimethylammonium (PDDA) via electrostatic interaction to repel other cationic species. In the presence of arsenite, the change of Ars-3 conformation due to the formation of Ars-3/arsenite complex led to less adsorption of PDDA, and the complex could adsorb more positively charged [Ru(NH3)6](3+) as an electrochemically active indicator on the aptasensor surface, which produced a sensitive "turn-on" response. The target-induced structure switching could be used for sensitive detection of arsenite with a linear range from 0.2 nM to 100 nM and a detection limit down to 0.15 nM. Benefiting from Ars-3 aptamer, the proposed system exhibited excellent specificity against other heavy metal ions. The SPCE-based aptasensor exhibited the advantages of low cost and simple fabrication, providing potential application of arsenite detection in environment. Copyright © 2016 Elsevier B.V. All rights reserved.

Arsenite Effects on Mitochondrial Bioenergetics in Human and Mouse Primary Hepatocytes Follow a Nonlinear Dose Response

Directory of Open Access Journals (Sweden)

Hemantkumar Chavan

2017-01-01

Full Text Available Arsenite is a known carcinogen and its exposure has been implicated in a variety of noncarcinogenic health concerns. Increased oxidative stress is thought to be the primary cause of arsenite toxicity and the toxic effect is thought to be linear with detrimental effects reported at all concentrations of arsenite. But the paradigm of linear dose response in arsenite toxicity is shifting. In the present study we demonstrate that arsenite effects on mitochondrial respiration in primary hepatocytes follow a nonlinear dose response. In vitro exposure of primary hepatocytes to an environmentally relevant, moderate level of arsenite results in increased oxidant production that appears to arise from changes in the expression and activity of respiratory Complex I of the mitochondrial proton circuit. In primary hepatocytes the excess oxidant production appears to elicit adaptive responses that promote resistance to oxidative stress and a propensity to increased proliferation. Taken together, these results suggest a nonlinear dose-response characteristic of arsenite with low-dose arsenite promoting adaptive responses in a process known as mitohormesis, with transient increase in ROS levels acting as transducers of arsenite-induced mitohormesis.

Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

Science.gov (United States)

Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

2017-09-15

Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

Evidence that arsenite acts as a cocarcinogen in skin cancer

International Nuclear Information System (INIS)

Rossman, Toby G.; Uddin, Ahmed N.; Burns, Fredric J.

2004-01-01

Inorganic arsenic (arsenite and arsenate) in drinking water has been associated with skin cancers in several countries such as Taiwan, Chile, Argentina, Bangladesh, and Mexico. This association has not been established in the United States. In addition, inorganic arsenic alone in drinking water does not cause skin cancers in animals. We recently showed that concentrations as low as 1.25 mg/l sodium arsenite were able to enhance the tumorigenicity of solar UV irradiation in mice. The tumors were almost all squamous cell carcinomas (SCCs). These data suggest that arsenic in drinking water may need a carcinogenic partner, such as sunlight, in the induction of skin cancers. Arsenite may enhance tumorigenicity via effects on DNA repair and DNA damage-induced cell cycle effects, leading to genomic instability. Others have found that dimethlyarsinic acid (DMA), a metabolite of arsenite, can induce bladder cancers at high concentrations in drinking water. In those experiments, skin cancers were not produced. Taken together, these data suggest that arsenite (or possibly an earlier metabolite), and not DMA, is responsible for the skin cancers, but a second genotoxic agent may be a requirement. The differences between the US and the other arsenic-exposed populations with regard to skin cancers might be explained by the lower levels of arsenic in the US, less sun exposure, better nutrition, or perhaps genetic susceptibility differences

NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis

Science.gov (United States)

Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.

2003-01-01

Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

Science.gov (United States)

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Sodium arsenite alters cell cycle and MTHFR, MT1/2, and c-Myc protein levels in MCF-7 cells

International Nuclear Information System (INIS)

Ruiz-Ramos, Ruben; Lopez-Carrillo, Lizbeth; Albores, Arnulfo; Hernandez-Ramirez, Raul U.; Cebrian, Mariano E.

2009-01-01

There is limited available information on the effects of arsenic on enzymes participating in the folate cycle. Therefore, our aim was to evaluate the effects of sodium arsenite on the protein levels of methylenetetrahydrofolate reductase (MTHFR) and dihydrofolate reductase (DHFR) and its further relationship with the expression MT1/2 and c-myc in MCF-7 cells. Arsenite treatment (0-10 μM) for 4 h decreased MTHFR levels in a concentration-dependent fashion without significant effects on DHFR. The effects on MTHFR were observed at arsenite concentrations not significantly affecting cell viability. We also observed an increase in S-phase recruitment at all concentrations probed. Lower concentrations (< 5 μM) induced cell proliferation, showing a high proportion of BrdU-stained cells, indicating a higher DNA synthesis rate. However, higher concentrations (≥ 5 μM) or longer treatment periods induced apoptosis. Arsenite also induced dose-dependent increases in MT1/2 and c-Myc protein levels. The levels of MTHFR were inversely correlated to MT1/2 and c-Myc overexpression and increased S-phase recruitment. Our findings indicate that breast epithelial cells are responsive to arsenite and suggest that exposure may pose a risk for breast cancer. The reductions in MTHFR protein levels contribute to understand the mechanisms underlying the induction of genes influencing growth regulation, such as c-myc and MT1/2. However, further research is needed to ascertain if the effects here reported following short-time and high-dose exposure are relevant for human populations chronically exposed to low arsenic concentrations.

Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

2012-01-01

PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

Science.gov (United States)

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Induction of apoptotic death and retardation of neuronal differentiation of human neural stem cells by sodium arsenite treatment

Energy Technology Data Exchange (ETDEWEB)

Ivanov, Vladimir N., E-mail: vni3@columbia.edu [Center for Radiological Research, Department of Radiation Oncology, College of Physicians and Surgeons, Columbia University, 630 West 168th Street, NY 10032 (United States); Hei, Tom K. [Center for Radiological Research, Department of Radiation Oncology, College of Physicians and Surgeons, Columbia University, 630 West 168th Street, NY 10032 (United States)

2013-04-01

Chronic arsenic toxicity is a global health problem that affects more than 100 million people worldwide. Long-term health effects of inorganic sodium arsenite in drinking water may result in skin, lung and liver cancers and in severe neurological abnormalities. We investigated in the present study whether sodium arsenite affects signaling pathways that control cell survival, proliferation and neuronal differentiation of human neural stem cells (NSC). We demonstrated that the critical signaling pathway, which was suppressed by sodium arsenite in NSC, was the protective PI3K–AKT pathway. Sodium arsenite (2–4 μM) also caused down-regulation of Nanog, one of the key transcription factors that control pluripotency and self-renewal of stem cells. Mitochondrial damage and cytochrome-c release induced by sodium arsenite exposure was followed by initiation of the mitochondrial apoptotic pathway in NSC. Beside caspase-9 and caspase-3 inhibitors, suppression of JNK activity decreased levels of arsenite-induced apoptosis in NSC. Neuronal differentiation of NSC was substantially inhibited by sodium arsenite exposure. Overactivation of JNK1 and ERK1/2 and down-regulation of PI3K–AKT activity induced by sodium arsenite were critical factors that strongly affected neuronal differentiation. In conclusion, sodium arsenite exposure of human NSC induces the mitochondrial apoptotic pathway, which is substantially accelerated due to the simultaneous suppression of PI3K–AKT. Sodium arsenite also negatively affects neuronal differentiation of NSC through overactivation of MEK–ERK and suppression of PI3K–AKT. - Highlights: ► Arsenite induces the mitochondrial apoptotic pathway in human neural stem cells. ► Arsenite-induced apoptosis is strongly upregulated by suppression of PI3K–AKT. ► Arsenite-induced apoptosis is strongly down-regulated by inhibition of JNK–cJun. ► Arsenite negatively affects neuronal differentiation by inhibition of PI3K–AKT.

Induction of apoptotic death and retardation of neuronal differentiation of human neural stem cells by sodium arsenite treatment

International Nuclear Information System (INIS)

Ivanov, Vladimir N.; Hei, Tom K.

2013-01-01

Chronic arsenic toxicity is a global health problem that affects more than 100 million people worldwide. Long-term health effects of inorganic sodium arsenite in drinking water may result in skin, lung and liver cancers and in severe neurological abnormalities. We investigated in the present study whether sodium arsenite affects signaling pathways that control cell survival, proliferation and neuronal differentiation of human neural stem cells (NSC). We demonstrated that the critical signaling pathway, which was suppressed by sodium arsenite in NSC, was the protective PI3K–AKT pathway. Sodium arsenite (2–4 μM) also caused down-regulation of Nanog, one of the key transcription factors that control pluripotency and self-renewal of stem cells. Mitochondrial damage and cytochrome-c release induced by sodium arsenite exposure was followed by initiation of the mitochondrial apoptotic pathway in NSC. Beside caspase-9 and caspase-3 inhibitors, suppression of JNK activity decreased levels of arsenite-induced apoptosis in NSC. Neuronal differentiation of NSC was substantially inhibited by sodium arsenite exposure. Overactivation of JNK1 and ERK1/2 and down-regulation of PI3K–AKT activity induced by sodium arsenite were critical factors that strongly affected neuronal differentiation. In conclusion, sodium arsenite exposure of human NSC induces the mitochondrial apoptotic pathway, which is substantially accelerated due to the simultaneous suppression of PI3K–AKT. Sodium arsenite also negatively affects neuronal differentiation of NSC through overactivation of MEK–ERK and suppression of PI3K–AKT. - Highlights: ► Arsenite induces the mitochondrial apoptotic pathway in human neural stem cells. ► Arsenite-induced apoptosis is strongly upregulated by suppression of PI3K–AKT. ► Arsenite-induced apoptosis is strongly down-regulated by inhibition of JNK–cJun. ► Arsenite negatively affects neuronal differentiation by inhibition of PI3K–AKT

Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

Science.gov (United States)

Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

1999-10-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

Sodium arsenite impairs insulin secretion and transcription in pancreatic β-cells

International Nuclear Information System (INIS)

Diaz-Villasenor, Andrea; Sanchez-Soto, M. Carmen; Cebrian, Mariano E.; Ostrosky-Wegman, Patricia; Hiriart, Marcia

2006-01-01

Human studies have shown that chronic inorganic arsenic (iAs) exposure is associated with a high prevalence and incidence of type 2 diabetes. However, the mechanism(s) underlying this effect are not well understood, and practically, there is no information available on the effects of arsenic on pancreatic β-cells functions. Thus, since insulin secreted by the pancreas plays a crucial role in maintaining glucose homeostasis, our aim was to determine if sodium arsenite impairs insulin secretion and mRNA expression in single adult rat pancreatic β-cells. Cells were treated with 0.5, 1, 2, 5 and 10 μM sodium arsenite and incubated for 72 and 144 h. The highest dose tested (10 μM) decreased β-cell viability, by 33% and 83%, respectively. Insulin secretion and mRNA expression were evaluated in the presence of 1 and 5 μM sodium arsenite. Basal insulin secretion, in 5.6 mM glucose, was not significantly affected by 1 or 5 μM treatment for 72 h, but basal secretion was reduced when cells were exposed to 5 μM sodium arsenite for 144 h. On the other hand, insulin secretion in response to 15.6 mM glucose decreased with sodium arsenite in a dose-dependent manner in such a way that cells were no longer able to distinguish between different glucose concentrations. We also showed a significant decrease in insulin mRNA expression of cells exposed to 5 μM sodium arsenite during 72 h. Our data suggest that arsenic may contribute to the development of diabetes mellitus by impairing pancreatic β-cell functions, particularly insulin synthesis and secretion

Inhibition of mitotic-specific histone phophorylation by sodium arsenite

Energy Technology Data Exchange (ETDEWEB)

Cobo, J.M. [Universidad de Alcala de Henares, Madrid (Spain); Valdez, J.G.; Gurley, L.R. [Los Alamos National Lab., NM (United States)

1994-10-01

Synchronized cultures of Chinese hamster cells (line CHO) were used to measure the effects of 10{mu}M sodium arsenite on histone phosphorylation. This treatment caused cell proliferation to be temporarily arrested, after which the cells spontaneously resumed cell proliferation in a radiomimetric manner. Immediately following treatment, it was found that sodium arsenite affected only mitotic-specific HI and H3 phosphorylations. Neither interphase, nor mitotic, H2A and H4 phosphorylations were affected, nor was interphase HI Phosphorylation affected. The phosphorylation of HI was inhibited only in mitosis, reducing HI phosphorylation to 38.1% of control levels, which was the level of interphase HI phosphorylation. The phosphorylation of both H3 variants was inhibited in mitosis, the less hydrophobic H3 to 19% and the more hydrophobic H3 to 24% of control levels. These results suggest that sodium arsenite may inhibite cell proliferation by interfering with the cyclin B/p34{sup cdc2} histone kinase activity which is thought to play a key role in regulating the cell cycle. It has been proposed by our laboratory that HI and H3 phosphorylations play a role in restructuring interphase chromatin into metaphase chromosomes. Interference of this process by sodium arsenite may lead to structurally damaged chromosomes resulting in the increased cancer risks known to be produced by arsenic exposure from the environment.

The defensive effect of benfotiamine in sodium arsenite-induced experimental vascular endothelial dysfunction.

Science.gov (United States)

Verma, Sanjali; Reddy, Krishna; Balakumar, Pitchai

2010-10-01

The present study has been designed to investigate the effect of benfotiamine, a thiamine derivative, in sodium arsenite-induced vascular endothelial dysfunction (VED) in rats. Sodium arsenite (1.5 mg(-1) kg(-1) day(-1) i.p., 2 weeks) was administered in rats to produce VED. The development of VED was assessed by employing isolated aortic ring preparation and estimating the serum and aortic concentrations of nitrite/nitrate. Further, the integrity of vascular endothelium in thoracic aorta was assessed by scanning electron microscopy. Moreover, the oxidative stress was assessed by estimating serum thiobarbituric acid reactive substances (TBARS) and aortic superoxide anion generation. The administration of sodium arsenite markedly produced VED by attenuating acetylcholine-induced endothelium-dependent relaxation, decreasing serum and aortic concentrations of nitrite/nitrate, and impairing the integrity of vascular endothelium. Further, sodium arsenite produced oxidative stress by increasing serum TBARS and aortic superoxide generation. The treatment with benfotiamine (25, 50, and 100 mg(-1) kg(-1) day(-1) p.o.) or atorvastatin (30 mg(-1) kg(-1) day(-1) p.o., a standard agent) prevented sodium arsenite-induced VED and oxidative stress. However, the beneficial effects of benfotiamine in preventing the sodium arsenite-induced VED were attenuated by co-administration with N-omega-nitro-L: -arginine methyl ester (L: -NAME) (25 mg(-1) kg(-1) day(-1), i.p.), an inhibitor of NOS. Thus, it may be concluded that benfotiamine reduces oxidative stress and activates endothelial nitric oxide synthase to enhance the generation and bioavailability of NO and subsequently improves the integrity of vascular endothelium to prevent sodium arsenite-induced experimental VED.

Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

Czech Academy of Sciences Publication Activity Database

Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef

2012-01-01

Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

Directory of Open Access Journals (Sweden)

Jagna Chmielowska-Bąk

2017-06-01

Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

Science.gov (United States)

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

Science.gov (United States)

Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

1999-01-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

Aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) protect against sodium arsenite-induced hepatotoxicity in Wistar rats.

Science.gov (United States)

Gbadegesin, M A; Odunola, O A

2010-11-25

We evaluated the effects of aqueous and ethanolic leaf extracts of Ocimum basilicum (sweet basil) on sodium arsenite-induced hepatotoxicity in Wistar rats. We observed that treatment of the animals with the extracts before or just after sodium arsenite administration significantly (p < 0.05) reduced mean liver and serum γ-Glutamyl transferase (γGT), and serum alkaline phosphatase (ALP) activities when compared with the group administered the toxin alone. In addition, treatments of the animals with aqueous or ethanolic extract of O. basilicum before the administration of sodium arsenite resulted in the attenuation of the sodium arsenite-induced aspartate and alanine aminotransferase activities: ALT (from 282.6% to 167.7% and 157.8%), AST (from 325.1% to 173.5% and 164.2%) for the group administered sodium arsenite alone, the aqueous extracts plus sodium arsenite, and ethanolic extracts plus sodium arsenite respectively, expressed as percentage of the negative control. These findings support the presence of hepatoprotective activity in the O.basilicum extracts.

Characterization of the arsenite oxidizer Aliihoeflea sp. strain 2WW and its potential application in the removal of arsenic from groundwater in combination with Pf-ferritin.

Science.gov (United States)

Corsini, Anna; Colombo, Milena; Muyzer, Gerard; Cavalca, Lucia

2015-09-01

A heterotrophic arsenite-oxidizing bacterium, strain 2WW, was isolated from a biofilter treating arsenic-rich groundwater. Comparative analysis of 16S rRNA gene sequences showed that it was closely related (98.7 %) to the alphaproteobacterium Aliihoeflea aesturari strain N8(T). However, it was physiologically different by its ability to grow at relatively low substrate concentrations, low temperatures and by its ability to oxidize arsenite. Here we describe the physiological features of strain 2WW and compare these to its most closely related relative, A. aestuari strain N8(T). In addition, we tested its efficiency to remove arsenic from groundwater in combination with Pf-ferritin. Strain 2WW oxidized arsenite to arsenate between pH 5.0 and 8.0, and from 4 to 30 °C. When the strain was used in combination with a Pf-ferritin-based material for arsenic removal from natural groundwater, the removal efficiency was significantly higher (73 %) than for Pf-ferritin alone (64 %). These results showed that arsenite oxidation by strain 2WW combined with Pf-ferritin-based material has a potential in arsenic removal from contaminated groundwater.

Pharmacokinetic and Genomic Effects of Arsenite in Drinking Water on Mouse Lung in a 30-Day Exposure

Directory of Open Access Journals (Sweden)

Jaya Chilakapati

2015-06-01

Full Text Available The 2 objectives of this subchronic study were to determine the arsenite drinking water exposure dependent increases in female C3H mouse liver and lung tissue arsenicals and to characterize the dose response (to 0, 0.05, 0.25, 1, 10, and 85 ppm arsenite in drinking water for 30 days and a purified AIN-93M diet for genomic mouse lung expression patterns. Mouse lungs were analyzed for inorganic arsenic, monomethylated, and dimethylated arsenicals by hydride generation atomic absorption spectroscopy. The total lung mean arsenical levels were 1.4, 22.5, 30.1, 50.9, 105.3, and 316.4 ng/g lung tissue after 0, 0.05, 0.25, 1, 10, and 85 ppm, respectively. At 85 ppm, the total mean lung arsenical levels increased 14-fold and 131-fold when compared to either the lowest noncontrol dose (0.05 ppm or the control dose, respectively. We found that arsenic exposure elicited minimal numbers of differentially expressed genes (DEGs; 77, 38, 90, 87, and 87 DEGs after 0.05, 0.25, 1, 10, and 85 ppm, respectively, which were associated with cardiovascular disease, development, differentiation, apoptosis, proliferation, and stress response. After 30 days of arsenite exposure, this study showed monotonic increases in mouse lung arsenical (total arsenic and dimethylarsinic acid concentrations but no clear dose-related increases in DEG numbers.

Isolated sulfite oxidase deficiency.

Science.gov (United States)

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

Directory of Open Access Journals (Sweden)

Hamed Esmaeil Lashgarian

2016-10-01

Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

Arsenite induced oxidative damage in mouse liver is associated with increased cytokeratin 18 expression

Energy Technology Data Exchange (ETDEWEB)

Gonsebatt, M.E. [UNAM, Ciudad Universitaria, Dept. Medicina Genomica y Toxicologia Ambiental, Instituto de Investigaciones Biomedicas, Mexico (Mexico); Razo, L.M. del; Sanchez-Pena, L.C. [Seccion de Toxicologia, CINVESTAV, Mexico (Mexico); Cerbon, M.A. [Facultad de Quimica, UNAM, Departamento de Biologia, Mexico (Mexico); Zuniga, O.; Ramirez, P. [Facultad de Estudios Superiores Cuautitlan, UNAM, Laboratorio de Toxicologia Celular, Coordinacion General de Estudios de Posgrado e Investigacion, Cuautitlan Izcalli, Estado de Mexico (Mexico)

2007-09-15

Cytokeratins (CK) constitute a family of cytoskeletal intermediate filament proteins that are typically expressed in epithelial cells. An abnormal structure and function are effects that are clearly related to liver diseases as non-alcoholic steatohepatitis, cirrhosis and hepatocellular carcinoma. We have previously observed that sodium arsenite (SA) induced the synthesis of CK18 protein and promotes a dose-related disruption of cytoplasmic CK18 filaments in a human hepatic cell line. Both abnormal gene expression and disturbance of structural organization are toxic effects that are likely to cause liver disease by interfering with normal hepatocyte function. To investigate if a disruption in the CK18 expression pattern is associated with arsenite liver damage, we investigated CK18 mRNA and protein levels in liver slices treated with low levels of SA. Organotypic cultures were incubated with 0.01, 1 and 10 {mu}M of SA in the absence and presence of N-acetyl cysteine (NAC). Cell viability and inorganic arsenic metabolism were determined. Increased expression of CK18 was observed after exposure to SA. The addition of NAC impeded the oxidative effects of SA exposure, decreasing the production of thiobarbituric acid-reactive substances and significantly diminishing the up regulation of CK18 mRNA and protein. Liver arsenic levels correlated with increased levels of mRNA. Mice treated with intragastric single doses of 2.5 and 5 mg/kg of SA showed an increased expression of CK18. Results suggest that CK18 expression may be a sensible early biomarker of oxidative stress and damage induced by arsenite in vitro and in vivo. Then, during SA exposure, altered CK expression may compromise liver function. (orig.)

Arsenite promotes centrosome abnormalities under a p53 compromised status induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)

International Nuclear Information System (INIS)

Liao, W.-T.; Yu, H.-S.; Lin Pinpin; Chang, Louis W.

2010-01-01

Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 μM. Under NNK exposure, arsenite was able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.

Arsenite enhances tumor necrosis factor-α-induced expression of vascular cell adhesion molecule-1

International Nuclear Information System (INIS)

Tsou, T.-C.; Yeh, Szu Ching; Tsai, E.-M.; Tsai, F.-Y.; Chao, H.-R.; Chang, Louis W.

2005-01-01

Epidemiological studies demonstrated a high association of vascular diseases with arsenite exposure. We hypothesize that arsenite potentiates the effect of proinflammatory cytokines on vascular endothelial cells, and hence contributes to atherosclerosis. In this study, we investigated the effect of arsenite and its induction of glutathione (GSH) on vascular cell adhesion molecule-1 (VCAM-1) protein expression in human umbilical vein endothelial cells (HUVECs) in response to tumor necrosis factor-α (TNF-α), a typical proinflammatory cytokine. Our study demonstrated that arsenite pretreatment potentiated the TNF-α-induced VCAM-1 expression with up-regulations of both activator protein-1 (AP-1) and nuclear factor-κB (NF-κB). To elucidate the role of GSH in regulation of AP-1, NF-κB, and VCAM-1 expression, we employed L-buthionine (S,R)-sulfoximine (BSO), a specific γ-glutamylcysteine synthetase (γ-GCS) inhibitor, to block intracellular GSH synthesis. Our investigation revealed that, by depleting GSH, arsenite attenuated the TNF-α-induced VCAM-1 expression as well as a potentiation of AP-1 and an attenuation of NF-κB activations by TNF-α. Moreover, we found that depletion of GSH would also attenuate the TNF-α-induced VCAM-1 expression with a down-regulation of the TNF-α-induced NF-κB activation and without significant effect on AP-1. On the other hand, the TNF-α-induced VCAM-1 expression could be completely abolished by inhibition of AP-1 or NF-κB activity, suggesting that activation of both AP-1 and NF-κB was necessary for VCAM-1 expression. In summary, we demonstrate that arsenite enhances the TNF-α-induced VCAM-1 expression in HUVECs via regulation of AP-1 and NF-κB activities in a GSH-sensitive manner. Our present study suggested a potential mechanism for arsenite in the induction of vascular inflammation and vascular diseases via modulating the actions of proinflammatory cytokines

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

Energy Technology Data Exchange (ETDEWEB)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

A role for NADPH oxidase in antigen presentation

Directory of Open Access Journals (Sweden)

Gail J Gardiner

2013-09-01

Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

Science.gov (United States)

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

Science.gov (United States)

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Science.gov (United States)

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Developmental mechanisms of arsenite toxicity in zebrafish (Danio rerio) embryos

International Nuclear Information System (INIS)

Li Dan; Lu Cailing; Wang Ju; Hu Wei; Cao Zongfu; Sun Daguang; Xia Hongfei; Ma Xu

2009-01-01

Arsenic usually accumulates in soil, water and airborne particles, from which it is taken up by various organisms. Exposure to arsenic through food and drinking water is a major public health problem affecting some countries. At present there are limited laboratory data on the effects of arsenic exposure on early embryonic development and the mechanisms behind its toxicity. In this study, we used zebrafish as a model system to investigate the effects of arsenite on early development. Zebrafish embryos were exposed to a range of sodium arsenite concentrations (0-10.0 mM) between 4 and 120 h post-fertilization (hpf). Survival and early development of the embryos were not obviously influenced by arsenite concentrations below 0.5 mM. However, embryos exposed to higher concentrations (0.5-10.0 mM) displayed reduced survival and abnormal development including delayed hatching, retarded growth and changed morphology. Alterations in neural development included weak tactile responses to light (2.0-5.0 mM, 30 hpf), malformation of the spinal cord and disordered motor axon projections (2.0 mM, 48 hpf). Abnormal cardiac function was observed as bradycardia (0.5-2.0 mM, 60 hpf) and altered ventricular shape (2.0 mM, 48 hpf). Furthermore, altered cell proliferation (2.0 mM, 24 hpf) and apoptosis status (2.0 mM, 24 and 48 hpf), as well as abnormal genomic DNA methylation patterning (2.0 mM, 24 and 48 hpf) were detected in the arsenite-treated embryos. All of these indicate a possible relationship between arsenic exposure and developmental failure in early embryogenesis. Our studies suggest that the negative effects of arsenic on vertebrate embryogenesis are substantial

Arsenite reduces insulin secretion in rat pancreatic β-cells by decreasing the calcium-dependent calpain-10 proteolysis of SNAP-25

International Nuclear Information System (INIS)

Diaz-Villasenor, Andrea; Burns, Anna L.; Salazar, Ana Maria; Sordo, Monserrat; Hiriart, Marcia; Cebrian, Mariano E.; Ostrosky-Wegman, Patricia

2008-01-01

An increase in the prevalence of type 2 diabetes has been consistently observed among residents of high arsenic exposure areas. We have previously shown that in rat pancreatic β-cells, low arsenite doses impair the secretion of insulin without altering its synthesis. To further study the mechanism by which arsenite reduces insulin secretion, we evaluated the effects of arsenite on the calcium-calpain pathway that triggers insulin exocytosis in RINm5F cells. Cell cycle and proliferation analysis were also performed to complement the characterization. Free [Ca 2+ ]i oscillations needed for glucose-stimulated insulin secretion were abated in the presence of subchronic low arsenite doses (0.5-2 μM). The global activity of calpains increased with 2 μM arsenite. However, during the secretion of insulin stimulated with glucose (15.6 mM), 1 μM arsenite decreased the activity of calpain-10, measured as SNAP-25 proteolysis. Both proteins are needed to fuse insulin granules with the membrane to produce insulin exocytosis. Arsenite also induced a slowdown in the β cell line proliferation in a dose-dependent manner, reflected by a reduction of dividing cells and in their arrest in G2/M. Data obtained showed that one of the mechanisms by which arsenite impairs insulin secretion is by decreasing the oscillations of free [Ca 2+ ]i, thus reducing calcium-dependent calpain-10 partial proteolysis of SNAP-25. The effects in cell division and proliferation observed with arsenite exposure can be an indirect consequence of the decrease in insulin secretion

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

Science.gov (United States)

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

Science.gov (United States)

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

N6-methyladenosine mediates the cellular proliferation and apoptosis via microRNAs in arsenite-transformed cells.

Science.gov (United States)

Gu, Shiyan; Sun, Donglei; Dai, Huangmei; Zhang, Zunzhen

2018-04-20

N 6 -methyladenosine (m 6 A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO 2 ) for about 13 weeks and these cells were identified with malignant phenotype which was demonstrated by increased levels of cellular proliferation, percentages of plate colony formation and soft agar clone formation, and high potential of resistance to apoptotic induction. Our results firstly demonstrated that m 6 A modification on RNA was significantly increased in arsenite-transformed cells and this modification may be synergistically regulated by methyltransferase-like 3 (METTL3), methyltransferase-like 14 (METTL14), Wilms tumor 1-associated protein (WTAP) and Fat mass and obesity-associated protein (FTO). In addition, knocking down of METTL3 in arsenite-transformed cells can dramatically reverse the malignant phenotype, which was manifested by lower percentages of clone and colony formation as well as higher rates of apoptotic induction. Given the critical roles of miRNAs in cellular proliferation and apoptosis, miRNAs regulated by m 6 A in arsenite-transformed cells were analyzed by Venn diagram and KEGG pathway in this study. The results showed that these m 6 A-mediated miRNAs can regulate pathways which are closely associated with cellular proliferation and apoptosis, implicating that these miRNAs may be the critical bridge by which m 6 A mediates dysregulation of cell survival and apoptosis in arsenite-transformed cells. Taken together, our results firstly demonstrated the significant role of m 6 A in the prevention of tumor occurrence and progression induced by arsenite. Copyright © 2018 Elsevier B.V. All rights reserved.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

Science.gov (United States)

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

Science.gov (United States)

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

A bacterial view of the periodic table: genes and proteins for toxic inorganic ions.

Science.gov (United States)

Silver, Simon; Phung, Le T

2005-12-01

Essentially all bacteria have genes for toxic metal ion resistances and these include those for Ag+, AsO2-, AsO4(3-), Cd2+ Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. The largest group of resistance systems functions by energy-dependent efflux of toxic ions. Fewer involve enzymatic transformations (oxidation, reduction, methylation, and demethylation) or metal-binding proteins (for example, metallothionein SmtA, chaperone CopZ and periplasmic silver binding protein SilE). Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. For example, Cd2+-efflux pumps of bacteria are either inner membrane P-type ATPases or three polypeptide RND chemiosmotic complexes consisting of an inner membrane pump, a periplasmic-bridging protein and an outer membrane channel. In addition to the best studied three-polypeptide chemiosmotic system, Czc (Cd2+, Zn2+, and Co2), others are known that efflux Ag+, Cu+, Ni2+, and Zn2+. Resistance to inorganic mercury, Hg2+ (and to organomercurials, such as CH3Hg+ and phenylmercury) involve a series of metal-binding and membrane transport proteins as well as the enzymes mercuric reductase and organomercurial lyase, which overall convert more toxic to less toxic forms. Arsenic resistance and metabolizing systems occur in three patterns, the widely-found ars operon that is present in most bacterial genomes and many plasmids, the more recently recognized arr genes for the periplasmic arsenate reductase that functions in anaerobic respiration as a terminal electron acceptor, and the aso genes for the periplasmic arsenite oxidase that functions as an initial electron donor in aerobic resistance to arsenite.

Involvement of c-Met- and phosphatidylinositol 3-kinase dependent pathways in arsenite-induced downregulation of catalase in hepatoma cells.

Science.gov (United States)

Kim, Soohee; Lee, Seung Heon; Kang, Sukmo; Lee, Lyon; Park, Jung-Duck; Ryu, Doug-Young

2011-01-01

Catalase protects cells from reactive oxygen species-induced damage by catalyzing the breakdown of hydrogen peroxide to oxygen and water. Arsenite decreases catalase activity; it activates phosphatidylinositol 3-kinase (PI3K) and its key downstream effector Akt in a variety of cells. The PI3K pathway is known to inhibit catalase expression. c-Met, an upstream regulator of PI3K and Akt, is also involved in the regulation of catalase expression. To examine the involvement of c-Met and PI3K pathways in the arsenite-induced downregulation of catalase, catalase mRNA and protein expression were analyzed in the human hepatoma cell line HepG2 treated with arsenite and either an inhibitor of c-Met (PHA665752 (PHA)) or of PI3K (LY294002 (LY)). Arsenite treatment markedly activated Akt and decreased the levels of both catalase mRNA and protein. Both PHA and LY attenuated arsenite-induced activation of Akt. PHA and LY treatment also prevented the inhibitory effect of arsenite on catalase protein expression but did not affect the level of catalase mRNA. These findings suggest that arsenite-induced inhibition of catalase expression is regulated at the mRNA and post-transcriptional levels in HepG2 cells, and that the post-transcriptional regulation is mediated via c-Met- and PI3K-dependent mechanisms.

Arsenite adsorption on goethite at elevated temperatures

International Nuclear Information System (INIS)

Kersten, Michael; Vlasova, Nataliya

2009-01-01

Experimental closed-system ΔT acid-base titrations between 10 deg. C and 75 deg. C were used to constrain a temperature-dependent 1-pK basic Stern model of the goethite surface complexation reactions. Experimental data for the temperature dependence of pH PZC determined by the one-term Van't Hoff extrapolation yield a value for goethite surface protonation enthalpy of -49.6 kJ mol -1 in good agreement with literature data. Batch titration data between 10 deg. C and 75 deg. C with arsenite concentrations between 10 μM and 100 μM yield adsorption curves, which increases with pH, peak at a pH of 9, and decrease at higher pH values. The slope of this bend becomes steeper with increasing temperature. A 1-pK charge distribution model in combination with a basic Stern layer option could be established for the pH-dependent arsenite adsorption. Formation of two inner-sphere bidentate surface complexes best matched the experimental data in agreement with published EXAFS spectroscopic information. The temperature behaviour of the thus derived intrinsic equilibrium constants can be well represented by the linear Van't Hoff logK T int vs. 1/T plot. Adsorption of arsenite on the goethite surface is exothermic (negative Δ r H 298 values) and therefore becomes weaker with increasing temperature. Application of the new constants with the aqueous speciation code VMINTEQ predicts that the As(III) concentration in presence of goethite sorbent decreases by 10 times once the hydrothermal solution is cooled from 99 deg. C to 1 deg. C. The model curve matches data from a natural thermal water spring system. The increase of adsorption efficiency for As along the temperature gradient may well serve as an additional process to prevent ecosystem contamination by As-rich water seepage from geothermal energy generation facilities

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

Science.gov (United States)

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

A “Turn-On” thiol functionalized fluorescent carbon quantum dot based chemosensory system for arsenite detection

Energy Technology Data Exchange (ETDEWEB)

Pooja, D., E-mail: poojaiitr@csio.res.in [Academy of Scientific and Innovative Research (AcSIR), Council of Scientific and Industrial Research, New Delhi (India); Central Scientific Instruments Organisation, Sectro-30 C, Chandigarh 160030 (India); Saini, Sonia; Thakur, Anupma; Kumar, Baban; Tyagi, Sachin [Central Scientific Instruments Organisation, Sectro-30 C, Chandigarh 160030 (India); Nayak, Manoj K. [Academy of Scientific and Innovative Research (AcSIR), Council of Scientific and Industrial Research, New Delhi (India); Central Scientific Instruments Organisation, Sectro-30 C, Chandigarh 160030 (India)

2017-04-15

Highlights: • Environmental friendly carbon quantum dots grafted with thiol moieties. • The functionalized CQDs demonstrated for optical detection of arsenite in water. • High analytical performance in terms of sensitivity, selectivity and detection limit (0.086 ppb). - Abstract: Carbon quantum dots (CQDs) have emerged out as promising fluorescent probes for hazardous heavy metals detection in recent past. In this study, water soluble CQDs were synthesized by facile microwave pyrolysis of citric acid & cysteamine, and functionalized with ditheritheritol to impart thiol functionalities at surface for selective detection of toxic arsenite in water. Microscopic analysis reveals that the synthesized CQDs are of uniform size (diameter ∼5 nm) and confirmed to have surface −SH groups by FT-IR. The functionalized probe is then demonstrated for arsenite detection in water by “Turn-On” read out mechanism, which reduces the possibility of false positive signals associated with “turn off’ probes reported earlier. The blue luminescent functionalized CQDs exhibit increase in fluorescence intensity on arsenite addition in 5–100 ppb wide detection range. The probe can be used for sensitive detection of arsenite in environmental water to a theoretical detection limit (3s) of 0.086 ppb (R{sup 2} = 0.9547) with good reproducibility at 2.6% relative standard deviation. The presented reliable, sensitive, rapid fCQDs probe demonstrated to exhibit high selectivity towards arsenite and exemplified for real water samples as well. The analytical performance of the presented probe is comparable to existing organic & semiconductor based optical probes.

Respiratory arsenate reductase as a bidirectional enzyme

Science.gov (United States)

Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

2009-01-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

Science.gov (United States)

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Characterization of the arsenite oxidizer Aliihoeflea sp. strain 2WW and its potential application in the removal of arsenic from groundwater in combination with Pf-ferritin

NARCIS (Netherlands)

Corsini, A.; Colombo, M.; Muyzer, G.; Cavalca, L.

2015-01-01

A heterotrophic arsenite-oxidizing bacterium, strain 2WW, was isolated from a biofilter treating arsenic-rich groundwater. Comparative analysis of 16S rRNA gene sequences showed that it was closely related (98.7 %) to the alphaproteobacterium Aliihoeflea aesturari strain N8T. However, it was

Effects of cultivation conditions on the uptake of arsenite and arsenic chemical species accumulated by Pteris vittata in hydroponics.

Science.gov (United States)

Hatayama, Masayoshi; Sato, Takahiko; Shinoda, Kozo; Inoue, Chihiro

2011-03-01

The physiological responses of the arsenic-hyperaccumulator, Pteris vittata, such as arsenic uptake and chemical transformation in the fern, have been investigated. However, a few questions remain regarding arsenic treatment in hydroponics. Incubation conditions such as aeration, arsenic concentration, and incubation period might affect those responses of P. vittata in hydroponics. Arsenite uptake was low under anaerobic conditions, as previously reported. However, in an arsenite uptake experiment, phosphorous (P) starvation-dependent uptake of arsenate was observed under aerobic conditions. Time course-dependent analysis of arsenite oxidation showed that arsenite was gradually oxidized to arsenate during incubation. Arsenite oxidation was not observed in any of the control conditions, such as exposure to a nutrient solution or to culture medium only, or with the use of dried root; arsenite oxidation was only observed when live root was used. This result suggests that sufficient aeration allows the rhizosphere system to oxidize arsenite and enables the fern to efficiently take up arsenite as arsenate. X-ray absorption near edge structure (XANES) analyses showed that long-duration exposure to arsenic using a hydroponic system led to the accumulation of arsenate as the dominant species in the root tips, but not in the whole roots, partly because up-regulation of arsenate uptake by P starvation of the fern was caused and retained by long-time incubation. Analysis of concentration-dependent arsenate uptake by P. vittata showed that the uptake switched from a high-affinity transport system to a low-affinity system at high arsenate concentrations, which partially explains the increased arsenate abundance in the whole root. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

use

2011-12-07

Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

The Genotoxicity of Sodium Arsenite in Human Lymphocyte Culture

International Nuclear Information System (INIS)

El-Habit Ola, H.M.

1998-01-01

Sodium arsenite was tested for its clastogenic effect alone and on isolated lymphocyte culture. The results showed a significant difference in the yield of chromosome aberrations induced with respect to the culture time 48 h. Whole blood culture showed significant increase in gaps and breaks whereas isolated lymphocyte culture showed significant inhibition of cell cycle and 75% of the lymphocytes were in their first cell cycle at 72 hr. Arsenite showed co-mutagenicity with different doses of x-ray delivered immediately or few hours after treatment of the culture with S A. The results suggest that S A is also mutagenic at the dose level used and provide support for the indispensability of whole blood culture for evaluation of the in vivo effect of any suspected mustagen using isolated lymphocytes appear to have problems leading to extensive cell cycle delay

Genetics Home Reference: isolated sulfite oxidase deficiency

Science.gov (United States)

... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

Directory of Open Access Journals (Sweden)

Yan Zhao

Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Yang, Xu [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Wang, Dapeng [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Department of Toxicology, School of Public Health, Guizhou Medical University, Guiyang, Guizhou (China); Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Yamanaka, Kenzo [Laboratory of Environmental Toxicology and Carcinogenesis, School of Pharmacy, Nihon University, Chiba (Japan); An, Yan, E-mail: dranyan@126.com [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China)

2015-12-01

Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

International Nuclear Information System (INIS)

Yang, Xu; Wang, Dapeng; Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian; Yamanaka, Kenzo; An, Yan

2015-01-01

Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

Science.gov (United States)

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

The Arsenite Oxidation Potential of Native Microbial Communities from Arsenic-Rich Freshwaters.

Science.gov (United States)

Fazi, Stefano; Crognale, Simona; Casentini, Barbara; Amalfitano, Stefano; Lotti, Francesca; Rossetti, Simona

2016-07-01

Microorganisms play an important role in speciation and mobility of arsenic in the environment, by mediating redox transformations of both inorganic and organic species. Since arsenite [As(III)] is more toxic than arsenate [As(V)] to the biota, the microbial driven processes of As(V) reduction and As(III) oxidation may play a prominent role in mediating the environmental impact of arsenic contamination. However, little is known about the ecology and dynamics of As(III)-oxidizing populations within native microbial communities exposed to natural high levels of As. In this study, two techniques for single cell quantification (i.e., flow cytometry, CARD-FISH) were used to analyze the structure of aquatic microbial communities across a gradient of arsenic (As) contamination in different freshwater environments (i.e., groundwaters, surface and thermal waters). Moreover, we followed the structural evolution of these communities and their capacity to oxidize arsenite, when experimentally exposed to high As(III) concentrations in experimental microcosms. Betaproteobacteria and Deltaproteobacteria were the main groups retrieved in groundwaters and surface waters, while Beta and Gammaproteobacteria dominated the bacteria community in thermal waters. At the end of microcosm incubations, the communities were able to oxidize up to 95 % of arsenite, with an increase of Alphaproteobacteria in most of the experimental conditions. Finally, heterotrophic As(III)-oxidizing strains (one Alphaproteobacteria and two Gammaproteobacteria) were isolated from As rich waters. Our findings underlined that native microbial communities from different arsenic-contaminated freshwaters can efficiently perform arsenite oxidation, thus contributing to reduce the overall As toxicity to the aquatic biota.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

OpenAIRE

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-01-01

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

Treatment of Arsenite Intoxication-Induced Peripheral Vasculopathy with Mesenchymal Stem Cells

Directory of Open Access Journals (Sweden)

Yi-Hung Chiang

2018-03-01

Full Text Available Arsenite (As, a notorious toxic metal, is ubiquitously distributed in the earth and poses a serious threat to human health. Histopathological lesions of As intoxication are known as thromboangiitis obliterans, which are resistant to current treatment and often lead to lower limb amputation. In this study, we attempt to find that treatment with mesenchymal stem cells (MSCs may be effective for As-induced vasculopathy. We first conducted an in vitro study with a co-culture system containing human MSCs and human umbilical vein endothelial cells (HUVECs and treated individual and co-cultured cells with various concentrations of arsenite. We also designed an in vivo study in which Sprague Dawley (SD rats received periodic intraperitoneal (IP injections of 16 ppm arsenite for 12 weeks. MSCs were harvested from BALB/c mice that were transplanted via tail vein injection. We found that there was significantly higher cellular viability in human mesenchymal stem cells (hMSCs than in HUVECs under concentrations of arsenite between 15 and 25 μM. The Annexin V apoptosis assay further confirmed this finding. Cytokine array assay for As-conditioned media revealed an elevated vascular endothelial growth factor (VEGF level secreted by MSCs, which is crucial for HUVEC survival and was evaluated by an siRNA VEGF knockdown test. In the in vivo study, we demonstrated early apoptotic changes in the anterior tibial vessels of As-injected SD rats with a Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay, but these apoptotic changes were less frequently observed upon MSCs transplantation, indicating that the cytoprotective effect of MSCs successfully protected against As-induced peripheral vasculopathy. The feasibility of MSCs to treat and /or prevent the progression of As-induced vasculopathy is justified. Further clinical studies are required to demonstrate the therapeutic efficacy of MSCs in patients suffering from As intoxication with

The genotoxicity of sodium arsenite in human lymphocyte culture

International Nuclear Information System (INIS)

Elhabit, O.H.M.

1995-01-01

Sodium arsenite was tested for its clastogenic effect alone and in combination with x-irradiation on whole blood culture and on isolated lymphocyte culture. The results showed a significant difference in the yield of aberrations induced with respect to the culture time 48 hr whole blood culture showed significant increase in gaps and breaks whereas isolated lymphocytes culture showed significant inhibition of cell cycle and 75% of the lymphocytes were in first cell cycle at 72 hr. Arsenite showed co-mutagenicity with different doses of x-ray delivered immediately or few hours after treatment of the culture with SA. The results suggest that SA also is mutagenic at the dose level used and provide support for the indispensability of whole blood culture for evaluation of the in vivo effect any suspected mutagen. Using isolated lymphocytes appear to have problems leading to extensive cell cycle delay

Arsenite adsorption on goethite at elevated temperatures

Energy Technology Data Exchange (ETDEWEB)

Kersten, Michael [Environmental Geochemistry Group, Institute of Geosciences, Johannes Gutenberg-University, Mainz 55099 (Germany)], E-mail: kersten@uni-mainz.de; Vlasova, Nataliya [Environmental Geochemistry Group, Institute of Geosciences, Johannes Gutenberg-University, Mainz 55099 (Germany)

2009-01-15

Experimental closed-system {delta}T acid-base titrations between 10 deg. C and 75 deg. C were used to constrain a temperature-dependent 1-pK basic Stern model of the goethite surface complexation reactions. Experimental data for the temperature dependence of pH{sub PZC} determined by the one-term Van't Hoff extrapolation yield a value for goethite surface protonation enthalpy of -49.6 kJ mol{sup -1} in good agreement with literature data. Batch titration data between 10 deg. C and 75 deg. C with arsenite concentrations between 10 {mu}M and 100 {mu}M yield adsorption curves, which increases with pH, peak at a pH of 9, and decrease at higher pH values. The slope of this bend becomes steeper with increasing temperature. A 1-pK charge distribution model in combination with a basic Stern layer option could be established for the pH-dependent arsenite adsorption. Formation of two inner-sphere bidentate surface complexes best matched the experimental data in agreement with published EXAFS spectroscopic information. The temperature behaviour of the thus derived intrinsic equilibrium constants can be well represented by the linear Van't Hoff logK{sub T}{sup int} vs. 1/T plot. Adsorption of arsenite on the goethite surface is exothermic (negative {delta}{sub r}H{sub 298} values) and therefore becomes weaker with increasing temperature. Application of the new constants with the aqueous speciation code VMINTEQ predicts that the As(III) concentration in presence of goethite sorbent decreases by 10 times once the hydrothermal solution is cooled from 99 deg. C to 1 deg. C. The model curve matches data from a natural thermal water spring system. The increase of adsorption efficiency for As along the temperature gradient may well serve as an additional process to prevent ecosystem contamination by As-rich water seepage from geothermal energy generation facilities.

Arsenite-oxidizing and arsenate-reducing bacteria associated with arsenic-rich groundwater in Taiwan

Science.gov (United States)

Liao, Vivian Hsiu-Chuan; Chu, Yu-Ju; Su, Yu-Chen; Hsiao, Sung-Yun; Wei, Chia-Cheng; Liu, Chen-Wuing; Liao, Chung-Min; Shen, Wei-Chiang; Chang, Fi-John

2011-04-01

Drinking highly arsenic-contaminated groundwater is a likely cause of blackfoot disease in Taiwan, but microorganisms that potentially control arsenic mobility in the subsurface remain unstudied. The objective of this study was to investigate the relevant arsenite-oxidizing and arsenate-reducing microbial community that exists in highly arsenic-contaminated groundwater in Taiwan. We cultured and identified arsenic-transforming bacteria, analyzed arsenic resistance and transformation, and determined the presence of genetic markers for arsenic transformation. In total, 11 arsenic-transforming bacterial strains with different colony morphologies and varying arsenic transformation abilities were isolated, including 10 facultative anaerobic arsenate-reducing bacteria and one strictly aerobic arsenite-oxidizing bacterium. All of the isolates exhibited high levels of arsenic resistance with minimum inhibitory concentrations of arsenic ranging from 2 to 200 mM. Strain AR-11 was able to rapidly oxidize arsenite to arsenate at concentrations relevant to environmental groundwater samples without the addition of any electron donors or acceptors. We provide evidence that arsenic-reduction activity may be conferred by the ars operon(s) that were not amplified by the designed primers currently in use. The 16S rRNA sequence analysis grouped the isolates into the following genera: Pseudomonas, Bacillus, Psychrobacter, Vibrio, Citrobacter, Enterobacter, and Bosea. Among these genera, we present the first report of the genus Psychrobacter being involved in arsenic reduction. Our results further support the hypothesis that bacteria capable of either oxidizing arsenite or reducing arsenate coexist and are ubiquitous in arsenic-contaminated groundwater.

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

Science.gov (United States)

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Biosorption and toxicity responses to arsenite (As[III]) in Scenedesmus quadricauda.

Science.gov (United States)

Zhang, Jianying; Ding, Tengda; Zhang, Chunlong

2013-08-01

Toxicity and biosorption responses to arsenite (As[III]) were examined in a 96-h exposure study using Scenedesmus quadricauda, one of the most popular green algae distributed in freshwaters in China. Results indicated that the pH-dependent distribution of two arsenite species (H2AsO3(-) and H3AsO3) played an important role in biosorption and toxicity. The undissociated H3AsO3 was more toxic than its monoanionic H2AsO3(-) through comparison of algal cell numbers, chlorophyll-a contents, and algal ultrastructural changes observed with transmission electron microscopy. An effective biosorption of 89.0mgg(-1) at 100mgL(-1) As[III] was found in the treatments with an initial pH of 9.3 and 25.2μgg(-1) at 0.03mgL(-1) As[III] at an initial pH of 8.2 as a result of the predominant species of H2AsO3(-) under the ambient pH and Eh conditions. Our results imply that S. quadricauda may provide a new means for the removal of toxic arsenite species present in contaminated surface water. Copyright © 2013 Elsevier Ltd. All rights reserved.

Sorption and desorption of arsenate and arsenite on calcite

DEFF Research Database (Denmark)

Sø, Helle Ugilt; Postma, Diederik Jan; Jakobsen, Rasmus

2008-01-01

The adsorption and desorption of arsenate (As(V)) and arsenite (As(111)) oil calcite was investigated in a series of batch experiments in calcite-equilibrated solutions. The solutions covered a broad range of pH, alkalinity, calcium concentration and ionic strength. The initial arsenic...

Arsenite induces cell transformation by reactive oxygen species, AKT, ERK1/2, and p70S6K1

International Nuclear Information System (INIS)

Carpenter, Richard L.; Jiang, Yue; Jing, Yi; He, Jun; Rojanasakul, Yon; Liu, Ling-Zhi; Jiang, Bing-Hua

2011-01-01

Highlights: ► Chronic exposure to arsenite induces cell proliferation and transformation. ► Arsenite-induced transformation increases ROS production and downstream signalings. ► Inhibition of ROS levels via catalase reduces arsenite-induced cell transformation. ► Interruption of AKT, ERK, or p70S6K1 inhibits arsenite-induced cell transformation. -- Abstract: Arsenic is naturally occurring element that exists in both organic and inorganic formulations. The inorganic form arsenite has a positive association with development of multiple cancer types. There are significant populations throughout the world with high exposure to arsenite via drinking water. Thus, human exposure to arsenic has become a significant public health problem. Recent evidence suggests that reactive oxygen species (ROS) mediate multiple changes to cell behavior after acute arsenic exposure, including activation of proliferative signaling and angiogenesis. However, the role of ROS in mediating cell transformation by chronic arsenic exposure is unknown. We found that cells chronically exposed to sodium arsenite increased proliferation and gained anchorage-independent growth. This cell transformation phenotype required constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. We also observed these cells constitutively produce ROS, which was required for the constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. Suppression of ROS levels by forced expression of catalase also reduced cell proliferation and anchorage-independent growth. These results indicate cell transformation induced by chronic arsenic exposure is mediated by increased cellular levels of ROS, which mediates activation of AKT, ERK1/2, and p70S6K1.

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

Science.gov (United States)

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

The accumulations of HIF-1α and HIF-2α by JNK and ERK are involved in biphasic effects induced by different levels of arsenite in human bronchial epithelial cells

International Nuclear Information System (INIS)

Xu, Yuan; Li, Yuan; Li, Huiqiao; Pang, Ying; Zhao, Yue; Jiang, Rongrong; Shen, Lu; Zhou, Jianwei; Wang, Xinru; Liu, Qizhan

2013-01-01

The biphasic effects of arsenite, in which low levels of arsenite induce cell proliferation and high levels of arsenite induce DNA damage and apoptosis, apparently contribute to arsenite-induced carcinogenesis. However, the mechanisms underlying this phenomenon are not well understood. In this study, we investigated the effects of different levels of arsenite on cell proliferation, DNA damage and apoptosis as well as on signal transduction pathways in human bronchial epithelial (HBE) cells. Our results show that a low level of arsenite activates extracellular signal-regulated kinases (ERK), which probably mediate arsenite-inhibited degradation of ubiquitinated hypoxia-inducible factor-2α (HIF-2α) in HBE cells. ERK inhibition blocks cell proliferation induced by a low level of arsenite, in part via HIF-2α. In contrast, a high level of arsenite activates c-Jun N-terminal kinases (JNK), which provoke a response to suppress ubiquitinated HIF-1α degradation. Down-regulation of HIF-1α by inhibiting JNK, however, increases the DNA damage but decreases the apoptosis induced by a high level of arsenite. Thus, data in the present study suggest that the accumulations of HIF-1α and HIF-2α by JNK and ERK are involved in different levels of arsenite-induced biphasic effects, with low levels of arsenite inducing cell proliferation and high levels of arsenite inducing DNA damage and apoptosis in HBE cells. -- Highlights: ► Biphasic effects induced by different concentrations of arsenite. ► Different regulation of ERK or JNK signal pathway by arsenite. ► Different regulation of HIF1α or HIF 2α by arsenite.

Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli.

Science.gov (United States)

Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito

2009-01-01

Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite

International Nuclear Information System (INIS)

Keyse, S.M.; Tyrrell, R.M.

1989-01-01

We have shown that UVA (320-380 nm) radiation, hydrogen peroxide, and sodium arsenite induce a stress protein of approximately 32 kDa in human skin fibroblasts. The synthesis and cloning of cDNA from arsenite-induced mRNA populations have now allowed us to unequivocally identify the 32-kDa protein as heme oxygenase. By mRNA analysis we have shown that the heme oxygenase gene is also induced in cultured human skin fibroblasts by UVA radiation, hydrogen peroxide, cadmium chloride, iodoacetamide, and menadione. The known antioxidant properties of heme catabolites taken together with the observation of a high level of induction of the enzyme in cells from an organ not involved in hemoglobin breakdown strongly supports the proposal that the induction of heme oxygenase may be a general response to oxidant stress and constitutes an important cellular defense mechanism against oxidative damage

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

Science.gov (United States)

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

PIXE study on absorption of arsenate and arsenite by arsenic hyperaccumulating fern (Pteris vittata)

International Nuclear Information System (INIS)

Yamazaki, H.; Ishii, K.; Matsuyama, S.

2008-01-01

Pytoremediation using an arsenic hyperaccumulator, Petris vittata L., has generated an increasing interest worldwide due to both environmentally sound and cost effectiveness. However the mechanism of arsenic accumulation by this fern is not clear at this time. This study examined the uptake of arsenate (As(V)) and arsenite (As(III)) by a hydroponic culture of Pteris vittata using both in-air submilli-PIXE for different parts of the fern and in-air micro-PIXE for the tissue cells. These PIXE analysis systems used 3 MeV proton beams from a 4.5-MV single-ended Dynamitron accelerator at Tohoku University, Japan. The fern took up both arsenate and arsenite from hydroponic solutions which were spiked with 50 mg of arsenic per litter. Final amount of arsenic accumulation in the fern is 1,500 mg per kg (wet weight) of the plant biomass in arsenite treatment and 1,100 mg per kg in arsenate treatment. Arsenic accumulation was not observed at the root parts of the ferns. The in-vivo mapping of elements by submilli-PIXE analyses on the fern laminas showed the arsenic accumulation in the edges of a pinna. The micro-PIXE analyses revealed arsenic maps homogeneously distributed in cells of the lamina, stem and rhizome of the fern. These results indicate that arsenic, both arsenate and arsenite in a contaminated medium are translocated quickly from roots to fronds of Pteris vittata, and distributes homogeneously into tissue cells of the fern laminas. (author)

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

Directory of Open Access Journals (Sweden)

Dinesh Kumar

2015-10-01

Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

Science.gov (United States)

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

Science.gov (United States)

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1.

Science.gov (United States)

Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke

2013-08-01

Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

Adsorption of Arsenite onto Kemiron in a batch system

African Journals Online (AJOL)

doti

This study investigated the effect of pH and coexisting ions on As(III) adsorption using batch experiment and discovered that pH strongly influenced As(III) adsorption. However, differences ... contamination by such heavy metals as arsenic (As). Arsenite ..... and then transition through point of zero charge (PZC) and then into ...

Sodium arsenite-induced reproductive toxicities in male Wistar rats ...

African Journals Online (AJOL)

Sodium arsenite-induced reproductive toxicities in male Wistar rats: role of Tridax procumbens leaf extract. ... Bulletin of Animal Health and Production in Africa ... In the present study, the effects of ethanol leaf extract of Tridax procumbens ... in Groups B to D as compared to Group A was significantly reduced (p<0.05).

Fe/Ti co-pillared clay for enhanced arsenite removal and photo oxidation under UV irradiation

Energy Technology Data Exchange (ETDEWEB)

Li, Yuan [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Guang Dong Electric Power Design Institute, China Energy Engineering Group Co. Ltd., Guangzhou 510663 (China); Cai, Xiaojiao [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Guo, Jingwei [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); The 718th Research Institute of CSIC, Handan 056027 (China); Zhou, Shimin [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Na, Ping, E-mail: naping@tju.edu.cn [School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China)

2015-01-01

Graphical abstract: - Highlights: • An iron and titanium co-pillared montmorillonite (Fe-Ti/MMT) was synthesized for arsenite removal. • Variety of characterization results indicated that Fe and Ti species were pillared in MMT. • A possible mechanism of arsenite adsorption/oxidation with UV light was established. • The participation of Fe component can promote the process of photocatalytic oxidation in Fe-Ti/MMT + As(III) system. • Fe-Ti/MMT can function as both photocatalyst and adsorbent for arsenite removal. - Abstract: A series of iron and titanium co-pillared montmorillonites (Fe-Ti/MMT) were prepared using hydrolysis of inserted titanium and different iron content in montmorillonite (MMT). The Fe-Ti/MMT were characterized by X-ray fluorescence, N{sub 2} adsorption and desorption, X-ray diffraction, scanning electron microscopy (SEM) and transmission electron microscopy (TEM), confirming the effective insertion of Fe species and TiO{sub 2} in the MMT. The Fe-Ti/MMT was used to remove arsenite (As(III)) from aqueous solutions under different conditions. The result of As(III) adsorption under UV irradiation showed that the photo activity can be enhanced by incorporating Fe and Ti in MMT. Fourier-transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS) analysis indicated that the hydroxyl groups bonded to metal oxide (M–OH) played an important role in the adsorption of As(III)

c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

International Nuclear Information System (INIS)

Zhang Dongyun; Li Jingxia; Gao Jimin; Huang Chuanshu

2009-01-01

Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cell transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure

Embryotoxicity of arsenite and arsenate. Distribution in pregnant mice and monkeys and effects on embryonic cells in vitro

Energy Technology Data Exchange (ETDEWEB)

Lindgren, A; Danielsson, R G; Dencker, L [Department of Toxicology, Biomedical Center, Uppsala University, Sweden; Vahter, M [National Institute of Environmental Medicine, Stockholm, Sweden

1984-01-01

The distribution of /sup 74/As-labelled arsenate and arsenite in pregnant mice and a monkey has been studied by autoradiography and gamma counting of isolated tissues, and their in vitro toxicity to a chondrogenic system has been investigated. With both arsenic forms, given as single intravenous injections to the mother, the /sup 74/As-arsenic appeared to pass the mouse placenta relatively freely and approximately to the same extent. The retention time in material tissues including the placenta was, however, around three times longer with arsenite than with arsenate. In early gestation, high activity was registered in the embryonic neuroepithelium, which correlates well with reported CNS malformations in rodents. In late gestation, the distribution pattern was more like that in the adults. Accumulation in skin and squamous epithelia of the upper gastrointestinal tract (oral cavity, oesophagus and oesophageal region of stomach) dominated the distribution pucture, especially at a long survival interval. Arsenate, but not arsenite, showed affinity for the calcified areas of the skeleton. A marmoset monkey in late gestation receiving arsenite showed a somewhat lower rate of placental transfer than the mice. Skin and liver had the highest concentrations (at 8 hrs), both in mother and foetuses. This species is known not to methylate arsenic, resulting in stronger binding and longer retention times of arsenic as compared with other species. The stronger binding in maternal tissues may possibly explain the lower rate of placental transfer. Arsenite was shown to inhibit cartilage formation in a chick limb bud mesenchymal spot culture system (ED50 approximately 5-10..mu..M) while arsenate seemed to be without effect at concentrations up to 200 ..mu..M (highest tested). Arsenate, however, showed a potential of the arsenite toxicity.

Embryotoxicity of arsenite and arsenate. Distribution in pregnant mice and monkeys and effects on embryonic cells in vitro

Energy Technology Data Exchange (ETDEWEB)

Lindgren, A; Danielsson, R G; Dencker, L [Department of Toxicology, Biomedical Center, Uppsala University, Sweden; Vahter, M [National Institute of Environmental Medicine, Stockholm, Sweden

1984-01-01

The distribution of /sup 74/As-labelled and arsenite in pregnant mice and a monkey has been studied by autoradiography and gamma counting of isolated tissues, and their in vitro toxicity to a chondrogenic system has been investigated. With both arsenic forms, given as single intravenous injections to the mother, the /sup 74/As-arsenic appeared to pass the mouse placenta relatively freely and approximately to the same extent. The retention time in material tissues including the placenta was, however, around three times longer with arsenite than with arsenate. In early gestation, high activity was registered in the embryonic neuroepithelium, which correlates well with reported CNS malformations in rodents. In late gestation, the distribution pattern was more like that in the adults. Accumulation in skin and squamous epithelia of the upper gastrointestinal tract (oral cavity, oesophagus and oesophageal region of stomach) dominated the distribution picture, especially at a long survival interval. Arsenate, but not arsenite, showed affinity for the calcified areas of the skeleton. A marmoset monkey in late gestation receiving arsenite showed a somewhat lower rate of placental transfer than the mice. Skin and liver had the highest concentrations (at 8 hrs), both in mother and foetuses. This species is known not to methylate arsenic, resulting in stronger binding and longer retention times of arsenic as compared with other species. The stronger binding in maternal tissues may possibly explain the lower rate of placental transfer. Arsenite was shown to inhibit cartilage formation in a chick limb bud mesenchymal spot culture system (ED50 approximately 5-10..mu..M) while arsenate seemed to be without effect at concentrations up to 200 ..mu..M (highest tested). Arsenate, however, showed a potential of the arsenite toxicity.

Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

Energy Technology Data Exchange (ETDEWEB)

Sun, Xi; Zhou, Xixi [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Du, Libo [Center for Molecular Science, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Liu, Wenlan [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Liu, Yang [Center for Molecular Science, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Hudson, Laurie G. [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Liu, Ke Jian, E-mail: kliu@salud.unm.edu [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States)

2014-01-15

Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects of arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger

Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

International Nuclear Information System (INIS)

Sun, Xi; Zhou, Xixi; Du, Libo; Liu, Wenlan; Liu, Yang; Hudson, Laurie G.; Liu, Ke Jian

2014-01-01

Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects of arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger

Arsenite evokes IL-6 secretion, autocrine regulation of STAT3 signaling, and miR-21 expression, processes involved in the EMT and malignant transformation of human bronchial epithelial cells

International Nuclear Information System (INIS)

Luo, Fei; Xu, Yuan; Ling, Min; Zhao, Yue; Xu, Wenchao; Liang, Xiao; Jiang, Rongrong; Wang, Bairu; Bian, Qian; Liu, Qizhan

2013-01-01

Arsenite is an established human carcinogen, and arsenite-induced inflammation contributes to malignant transformation of cells, but the molecular mechanisms by which cancers are produced remain to be established. The present results showed that, evoked by arsenite, secretion of interleukin-6 (IL-6), a pro-inflammatory cytokine, led to the activation of STAT3, a transcription activator, and to increased levels of a microRNA, miR-21. Blocking IL-6 with anti-IL-6 antibody and inhibiting STAT3 activation reduced miR-21 expression. For human bronchial epithelial cells, cultured in the presence of anti-IL-6 antibody for 3 days, the arsenite-induced EMT and malignant transformation were reversed. Thus, IL-6, acting on STAT3 signaling, which up-regulates miR-21in an autocrine manner, contributes to the EMT induced by arsenite. These data define a link from inflammation to EMT in the arsenite-induced malignant transformation of HBE cells. This link, mediated through miRNAs, establishes a mechanism for arsenite-induced lung carcinogenesis. - Highlights: • Arsenite evokes IL-6 secretion. • IL-6 autocrine mediates STAT3 signaling and up-regulates miR-21expression. • Inflammation is involved in arsenite-induced EMT

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

NARCIS (Netherlands)

Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.

2007-01-01

A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

Science.gov (United States)

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase.

Science.gov (United States)

Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T

2005-04-15

In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

Science.gov (United States)

Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

2015-10-01

A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

Science.gov (United States)

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Microbial contributions to coupled arsenic and sulfur cycling in the acid-sulfide hot spring Champagne Pool, New Zealand

Directory of Open Access Journals (Sweden)

Katrin eHug

2014-11-01

Full Text Available Acid-sulfide hot springs are analogs of early Earth geothermal systems where microbial metal(loid resistance likely first evolved. Arsenic is a metalloid enriched in the acid-sulfide hot spring Champagne Pool (Waiotapu, New Zealand. Arsenic speciation in Champagne Pool follows reaction paths not yet fully understood with respect to biotic contributions and coupling to biogeochemical sulfur cycling. Here we present quantitative arsenic speciation from Champagne Pool, finding arsenite dominant in the pool, rim and outflow channel (55-75% total arsenic, and dithio- and trithioarsenates ubiquitously present as 18-25% total arsenic. In the outflow channel, dimethylmonothioarsenate comprised ≤9% total arsenic, while on the outflow terrace thioarsenates were present at 55% total arsenic. We also quantified sulfide, thiosulfate, sulfate and elemental sulfur, finding sulfide and sulfate as major species in the pool and outflow terrace, respectively. Elemental sulfur reached a maximum at the terrace. Phylogenetic analysis of 16S rRNA genes from metagenomic sequencing revealed the dominance of Sulfurihydrogenibium at all sites and an increased archaeal population at the rim and outflow channel. Several phylotypes were found closely related to known sulfur- and sulfide-oxidizers, as well as sulfur- and sulfate-reducers. Bioinformatic analysis revealed genes underpinning sulfur redox transformations, consistent with sulfur speciation data, and illustrating a microbial role in sulfur-dependent transformation of arsenite to thioarsenate. Metagenomic analysis also revealed genes encoding for arsenate reductase at all sites, reflecting the ubiquity of thioarsenate and a need for microbial arsenate resistance despite anoxic conditions. Absence of the arsenite oxidase gene, aio, at all sites suggests prioritization of arsenite detoxification over coupling to energy conservation. Finally, detection of methyl arsenic in the outflow channel, in conjunction with

Immobilization of Ochrobactrum tritici As5 on PTFE thin films for arsenite biofiltration.

Science.gov (United States)

Branco, Rita; Sousa, Tânia; Piedade, Ana P; Morais, Paula V

2016-03-01

Ochrobactrum tritici SCII24T bacteria is an environmental strain with high capacity to resist to arsenic (As) toxicity, which makes it able to grow in the presence of As(III). The inactivation of the two functional arsenite efflux pumps, ArsB and ACR3_1, resulted in the mutant O. tritici As5 exhibiting a high accumulation of arsenite. This work describes a method for the immobilization of the mutant cells O. tritici As5, on a commercial polymeric net after sputtered modified by the deposition of poly(tetrafluoroethylene) (PTFE) thin films, and demonstrates the capacity of immobilized cells to accumulate arsenic from solutions. Six different set of deposition parameters for PTFE thin films were developed and tested in vitro regarding their ability to immobilize the bacterial cells. The surface that exhibited a mild zeta potential value, hydrophobic characteristics, the lowest surface free energy but with a high polar component and the appropriate ratio of chemical reactive groups allowed cells to proliferate and to grow as a biofilm. These immobilized cells maintained their ability to accumulate the surrounding arsenite, making it a great arsenic biofilter to be used in bioremediation processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Could vitamin C and zinc chloride protect the germ cells against sodium arsenite?

Science.gov (United States)

Altoé, L S; Reis, I B; Gomes, Mlm; Dolder, H; Pirovani, Jc Monteiro

2017-10-01

Arsenic (As) is commonly associated with natural and human processes such as volcanic emissions, mining and herbicides production, being an important pollutant. Several studies have associated As intake with male fertility reduction, thus the aim of the present study was to evaluate whether vitamin C and/or zinc would counteract As side effects within the testicles. Adult male Wistar rats were divided into six experimental groups: control, sodium arsenite (5 mg/kg/day), vitamin C (100 mg/kg/day), zinc chloride (ZnCl 2 ; 20 mg/kg/day), sodium arsenite + vitamin C and sodium arsenite + ZnCl 2 . Testicles and epididymis were harvested and either frozen or routinely processed to be embedded in glycol methacrylate resin. As reduced the seminiferous epithelium and tubules diameter due to germ cell loss. In addition, both the round spermatids population and the daily sperm production were reduced. However, ZnCl 2 and vitamin C showed to be effective against such side effects, mainly regarding to sperm morphology. Long-term As intake increased the proportions of abnormal sperm, whereas the concomitant intake of As with zinc or vitamin C enhanced the proportions of normal sperm, showing that such compounds could be used to protect this cell type against morphological defects.

Acetylacetone as an efficient electron shuttle for concerted redox conversion of arsenite and nitrate in the opposite direction.

Science.gov (United States)

Chen, Zhihao; Song, Xiaojie; Zhang, Shujuan; Wu, Bingdang; Zhang, Guoyang; Pan, Bingcai

2017-11-01

The redox conversion of arsenite and nitrate has direct effects on their potential environment risks. Due to the similar reduction potentials, there are few technologies that can simultaneously oxidize arsenite and reduce nitrate in one process. Here, we demonstrate that a diketone-mediated photochemical process could efficiently do this. A combined experimental and theoretical investigation was conducted to elucidate the mechanisms behind the redox conversion in the UV/acetylacetone (AA) process. Our key finding is that UV irradiation significantly changed the redox potential of AA. The excited AA, 3 (AA)*, acted as a semiquinone radical-like electron shuttle. For arsenite oxidation, the efficiency of 3 (AA)* was 1-2 orders of magnitude higher than those of quinone-type electron shuttles, whereas the consumption of AA was 2-4 orders of magnitude less than those of benzonquinones. The oxidation of arsenite and reduction of nitrate could be both accelerated when they existed together in UV/AA process. The results indicate that small diketones are some neglected but potent electron shuttles of great application potential in regulating aquatic redox reactions with the combination of UV irradiation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

Science.gov (United States)

Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun

2017-11-01

Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

Directory of Open Access Journals (Sweden)

Xiuchun Ge

Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Efthimios A. Andronis

2014-04-01

Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

Arsenite stimulated glucose transport in 3T3-L1 adipocytes involves both Glut4 translocation and p38 MAPK activity

NARCIS (Netherlands)

Bazuine, Merlijn; Ouwens, D. Margriet; Gomes de Mesquita, Daan S.; Maassen, J. Antonie

2003-01-01

The protein-modifying agent arsenite stimulates glucose uptake in 3T3-L1 adipocytes. In the current study we have analysed the signalling pathways that contribute to this response. By subcellular fractionation we observed that arsenite, like insulin, induces translocation of the GLUT1 and GLUT4

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

Science.gov (United States)

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

Science.gov (United States)

Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

2017-01-01

Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

Directory of Open Access Journals (Sweden)

Li Sheng-Bin

2011-10-01

Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

[Purification of arsenic-binding proteins in hamster plasma after oral administration of arsenite].

Science.gov (United States)

Wang, Wenwen; Zhang, Min; Li, Chunhui; Qin, Yingjie; Hua, Naranmandura

2013-01-01

To purify the arsenic-binding proteins (As-BP) in hamster plasma after a single oral administration of arsenite (iAs(III)). Arsenite was given to hamsters in a single dose. Three types of HPLC columns, size exclusion, gel filtration and anion exchange columns, combined with an inductively coupled argon plasma mass spectrometer (ICP MS) were used to purify the As-BP in hamster plasma. SDS-PAGE was used to confirm the arsenic-binding proteins at each purification step. The three-step purification process successfully separated As-BP from other proteins (ie, arsenic unbound proteins) in hamster plasma. The molecular mass of purified As-BP in plasma was approximately 40-50 kD on SDS-PAGE. The three-step purification method is a simple and fast approach to purify the As-BP in plasma samples.

Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

Directory of Open Access Journals (Sweden)

Yuange Wang

2014-08-01

Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

Directory of Open Access Journals (Sweden)

Buades-Rotger M

2014-07-01

Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

NARCIS (Netherlands)

Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

COMPARATIVE GENOTOXIC RESPONSES TO ARSENITE IN GUINEA PIG, MOUSE, RAT AND HUMAN LYMPHOCYTES

Science.gov (United States)

Comparative genotoxic responses to arsenite in guinea pig, mouse, rat and human lymphocytes.Inorganic arsenic is a known human carcinogen causing skin, lung, and bladder cancer following chronic exposures. Yet, long-term laboratory animal carcinogenicity studies have ...

Biphasic effect of arsenite on cell proliferation and apoptosis is associated with the activation of JNK and ERK1/2 in human embryo lung fibroblast cells

International Nuclear Information System (INIS)

He Xiaoqing; Chen Rui; Yang Ping; Li Aiping; Zhou Jianwei; Liu Qizhan

2007-01-01

Biphasic dose-response relationship induced by environmental agents is often characterized with the effect of low-dose stimulation and high-dose inhibition. Some studies showed that arsenite may induce cell proliferation and apoptosis via biphasic dose-response relationship in human cells; however, mechanisms underlying this phenomenon are not well understood. In the present study, we aimed at investigating the relationship between biphasic effect of arsenite on cell proliferation and apoptosis and activation of JNK and ERK1/2 in human embryo lung fibroblast (HELF) cells. Our results demonstrated that cell proliferation may be stimulated at lower concentrations (0.1 and 0.5 μM) arsenite but inhibited at higher concentrations (5 and 10 μM). When cell apoptosis was used as the endpoint, the concentration-response curves were changed to U-shapes. During stimulation phospho-JNK levels were significantly increased at 3, 6, and 12 h after 0.1 or 0.5 μM arsenite exposure. Phospho-ERK1/2 levels were increased with different concentrations (0.1-10 μM) of arsenite at 6, 12, and 24 h. Blocking of JNK pathway with 20 μM SP600125 or ERK1/2 by 100 μM PD98059 significantly inhibited biphasic effect of arsenite in cells. Data in the present study suggest that activation of JNK and ERK1/2 may be involved in biphasic effect of arsenite when measuring cell proliferation and apoptosis in HELF cells. JNK activation seems to play a more critical role than ERK1/2 activation in the biphasic process

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

Science.gov (United States)

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

African Journals Online (AJOL)

Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

Evaluation of the toxic effects of arsenite, chromate, cadmium, and copper using a battery of four bioassays

Energy Technology Data Exchange (ETDEWEB)

Ko, Kyung-Seok; Lee, Pyeong-Koo [Korea Institute of Geoscience and Mineral Resources (KIGAM), Daejeon (Korea, Republic of). Geologic Environment Div.; Kong, In Chul [Yeungnam Univ., Kyungbuk (Korea, Republic of). Dept. of Environmental Engineering

2012-09-15

The sensitivities of four different kinds of bioassays to the toxicities of arsenite, chromate, cadmium, and copper were compared. The different bioassays exhibited different sensitivities, i.e., they responded to different levels of toxicity of each of the different metals. However, with the exception of the {alpha}-glucosidase enzyme activity, arsenite was the most toxic compound towards all the tested organisms, exhibiting the highest toxic effect on the seeds of Lactuca, with an EC{sub 50} value of 0.63 mg/L. The sensitivities of Lactuca and Raphanus were greater than the sensitivities of two other kinds of seeds tested. Therefore, these were the seeds appropriate for use in a seed germination assay. A high revertant mutagenic ratio (5:1) of Salmonella typhimurium was observed with an arsenite concentration of 0.1 {mu}g/plate, indicative of a high possibility of mutagenicity. These different results suggested that a battery of bioassays, rather than one bioassay alone, is needed as a more accurate and better tool for the bioassessment of environmental pollutants. (orig.)

A small quantity of sodium arsenite will kill large cull hardwoods

Science.gov (United States)

Francis M. Rushmore

1956-01-01

Although it is well known that sodium arsenite is an effective silvicide, forestry literature contains little information about the minimum quantities of this chemical that are required to kill large cull trees. Such information would be of value because if small quantities of a chemical will produce satisfactory results, small holes or frills in the tree will hold it...

RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

Directory of Open Access Journals (Sweden)

Rogayah Sekeli

2014-06-01

Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

Science.gov (United States)

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

Science.gov (United States)

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

Science.gov (United States)

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

Directory of Open Access Journals (Sweden)

Deepak Verma

2017-10-01

Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

Science.gov (United States)

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Microbial contributions to coupled arsenic and sulfur cycling in the acid-sulfide hot spring Champagne Pool, New Zealand.

Science.gov (United States)

Hug, Katrin; Maher, William A; Stott, Matthew B; Krikowa, Frank; Foster, Simon; Moreau, John W

2014-01-01

Acid-sulfide hot springs are analogs of early Earth geothermal systems where microbial metal(loid) resistance likely first evolved. Arsenic is a metalloid enriched in the acid-sulfide hot spring Champagne Pool (Waiotapu, New Zealand). Arsenic speciation in Champagne Pool follows reaction paths not yet fully understood with respect to biotic contributions and coupling to biogeochemical sulfur cycling. Here we present quantitative arsenic speciation from Champagne Pool, finding arsenite dominant in the pool, rim and outflow channel (55-75% total arsenic), and dithio- and trithioarsenates ubiquitously present as 18-25% total arsenic. In the outflow channel, dimethylmonothioarsenate comprised ≤9% total arsenic, while on the outflow terrace thioarsenates were present at 55% total arsenic. We also quantified sulfide, thiosulfate, sulfate and elemental sulfur, finding sulfide and sulfate as major species in the pool and outflow terrace, respectively. Elemental sulfur concentration reached a maximum at the terrace. Phylogenetic analysis of 16S rRNA genes from metagenomic sequencing revealed the dominance of Sulfurihydrogenibium at all sites and an increased archaeal population at the rim and outflow channel. Several phylotypes were found closely related to known sulfur- and sulfide-oxidizers, as well as sulfur- and sulfate-reducers. Bioinformatic analysis revealed genes underpinning sulfur redox transformations, consistent with sulfur speciation data, and illustrating a microbial role in sulfur-dependent transformation of arsenite to thioarsenate. Metagenomic analysis also revealed genes encoding for arsenate reductase at all sites, reflecting the ubiquity of thioarsenate and a need for microbial arsenate resistance despite anoxic conditions. Absence of the arsenite oxidase gene, aio, at all sites suggests prioritization of arsenite detoxification over coupling to energy conservation. Finally, detection of methyl arsenic in the outflow channel, in conjunction with

Influence of titanium dioxide nanoparticles on speciation and bioavailability of arsenite

International Nuclear Information System (INIS)

Sun Hongwen; Zhang Xuezhi; Zhang Zhiyan; Chen Yongsheng; Crittenden, John C.

2009-01-01

In this study, the influence of the co-existence of TiO 2 nanoparticles on the speciation of arsenite [As(III)] was studied by observing its adsorption and valence changing. Moreover, the influence of TiO 2 nanoparticles on the bioavailability of As(III) was examined by bioaccumulation test using carp (Cyprinus carpio). The results showed that TiO 2 nanoparticles have a significant adsorption capacity for As (III). Equilibrium was established within 30 min, with about 30% of the initial As (III) being adsorbed onto TiO 2 nanoparticles. Most of aqueous As (III) was oxidized to As(V) in the presence of TiO 2 nanoparticles under sunlight. The carp accumulated considerably more As in the presence of TiO 2 nanoparticles than in the absence of TiO 2 nanoparticles, and after 25-day exposure, As concentration in carp increased by 44%. Accumulation of As in viscera, gills and muscle of the carp was significantly enhanced by the presence of TiO 2 nanoparticles. - The co-existence of TiO 2 nanoparticles could change the speciation of arsenite by adsorption and photo-oxidation, and enhance its bioaccumulation to carp

A complex effect of arsenite on the formation of alpha-ketoglutarate in rat liver mitochondria.

Science.gov (United States)

Lenartowicz, E

1990-12-01

This investigation presents disturbances of the mitochondrial metabolism by arsenite, a hydrophilic dithiol reagent known as an inhibitor of mitochondrial alpha-keto acid dehydrogenases. Arsenite at concentrations of 0.1-1.0 mM was shown to induce a considerable oxidation of intramitochondrial NADPH, NADH, and glutathione without decreasing the mitochondrial membrane potential. The oxidation of NAD(P)H required the presence of phosphate and was sensitive to ruthenium red, but occurred without the addition of calcium salts. Mitochondrial reactions producing alpha-ketoglutarate from glutamate and isocitrate were modulated by arsenite through various mechanisms: (i) both glutamate transaminations, with oxaloacetate and with pyruvate, were inhibited by accumulating alpha-ketoglutarate; however, at low concentrations of alpha-ketoglutarate the aspartate aminotransferase reaction was stimulated due to the increase of NAD+ content; (ii) the oxidation of isocitrate was stimulated at its low concentration only, due to the oxidation of NADPH and NADH; this oxidation was prevented by concentrations of citrate or isocitrate greater than 1 mM; (iii) the conversion of isocitrate to citrate was suppressed, presumably as a result of the decrease of Mg2+ concentration in mitochondria. Thus the depletion of mitochondrial vicinal thiol groups in hydrophilic domains disturbs the mitochondrial metabolism not only by the inhibition of alpha-keto acid dehydrogenases but also by the oxidation of NAD(P)H and, possibly, by the change in the ion concentrations.

Synthesis of Nano- alumina Powder from Impure Kaolin and its Application for Arsenite Removal from Aqueous Solutions

Directory of Open Access Journals (Sweden)

Ahmad Khodadadi Darban

2013-07-01

Full Text Available Adsorption is considered a cost-effective procedure, safer to handle with high removal efficiency. Activated alumina is the most commonly used adsorbent for the removal of arsenic from aqueous solutions. However, activated alumina has a low adsorption capacity and acts kinetically in a slow manner. An ideal adsorbent should have a high surface area, physical and/or chemical stability and be inexpensive. To meet this requirement, nanomeso porous γ-alumina with a high surface area (201.53 m2/g and small particle size (22–36 nm was prepared from inexpensive kaolin as the raw material, by precipitation method. The research results showed that adsorbent has the high adsorption capacity (for initial arsenite concentration up to 10 mg/L, in which 97.65% recovery was achieved. Optimal experimental conditions including pH, initial arsenite concentration and contact time were determined. Langmuir, Freundlich and Dubinin– Radushkevich isotherm models were applied to analyze the experimental data. The best interpretation for the experimental data was given by Langmuir adsorption isotherm equation and the maximum arsenite adsorbed by synthesized nano γ–alumina (qe was found to be 40 (mg/g.

Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

DEFF Research Database (Denmark)

Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid

2009-01-01

-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

Science.gov (United States)

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Co-delivery of doxorubicin and arsenite with reduction and pH dual-sensitive vesicle for synergistic cancer therapy

Science.gov (United States)

Zhang, Lu; Xiao, Hong; Li, Jingguo; Cheng, Du; Shuai, Xintao

2016-06-01

Drug resistance is the underlying cause for therapeutic failure in clinical cancer chemotherapy. A prodrug copolymer mPEG-PAsp(DIP-co-BZA-co-DOX) (PDBD) was synthesized and assembled into a nanoscale vesicle comprising a PEG corona, a reduction and pH dual-sensitive hydrophobic membrane and an aqueous lumen encapsulating doxorubicin hydrochloride (DOX.HCl) and arsenite (As). The dual stimulation-sensitive design of the vesicle gave rise to rapid release of the physically entrapped DOX.HCl and arsenite inside acidic lysosomes, and chemically conjugated DOX inside the cytosol with high glutathione (GSH) concentration. In the optimized concentration range, arsenite previously recognized as a promising anticancer agent from traditional Chinese medicine can down-regulate the expressions of anti-apoptotic and multidrug resistance proteins to sensitize cancer cells to chemotherapy. Consequently, the DOX-As-co-loaded vesicle demonstrated potent anticancer activity. Compared to the only DOX-loaded vesicle, the DOX-As-co-loaded one induced more than twice the apoptotic ratio of MCF-7/ADR breast cancer cells at a low As concentration (0.5 μM), due to the synergistic effects of DOX and As. The drug loading strategy integrating chemical conjugation and physical encapsulation in stimulation-sensitive carriers enabled efficient drug loading in the formulation.Drug resistance is the underlying cause for therapeutic failure in clinical cancer chemotherapy. A prodrug copolymer mPEG-PAsp(DIP-co-BZA-co-DOX) (PDBD) was synthesized and assembled into a nanoscale vesicle comprising a PEG corona, a reduction and pH dual-sensitive hydrophobic membrane and an aqueous lumen encapsulating doxorubicin hydrochloride (DOX.HCl) and arsenite (As). The dual stimulation-sensitive design of the vesicle gave rise to rapid release of the physically entrapped DOX.HCl and arsenite inside acidic lysosomes, and chemically conjugated DOX inside the cytosol with high glutathione (GSH) concentration. In the

Autecology of an Arsenite Chemolithotroph: Sulfide Constraints on Function and Distribution in a Geothermal Spring▿

Science.gov (United States)

D'Imperio, Seth; Lehr, Corinne R.; Breary, Michele; McDermott, Timothy R.

2007-01-01

Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H2S exceeds ∼5 μM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H2S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H2S is removed. Cultivation experiments initiated with mat samples taken from along the H2S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H2S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H2S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H2S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H2S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs. PMID:17827309

Autecology of an arsenite chemolithotroph: sulfide constraints on function and distribution in a geothermal spring.

Science.gov (United States)

D'Imperio, Seth; Lehr, Corinne R; Breary, Michele; McDermott, Timothy R

2007-11-01

Previous studies in an acid-sulfate-chloride spring in Yellowstone National Park found that microbial arsenite [As(III)] oxidation is absent in regions of the spring outflow channel where H(2)S exceeds approximately 5 microM and served as a backdrop for continued efforts in the present study. Ex situ assays with microbial mat samples demonstrated immediate As(III) oxidation activity when H(2)S was absent or at low concentrations, suggesting the presence of As(III) oxidase enzymes that could be reactivated if H(2)S is removed. Cultivation experiments initiated with mat samples taken from along the H(2)S gradient in the outflow channel resulted in the isolation of an As(III)-oxidizing chemolithotroph from the low-H(2)S region of the gradient. The isolate was phylogenetically related to Acidicaldus and was characterized in vitro for spring-relevant properties, which were then compared to its distribution pattern in the spring as determined by denaturing gradient gel electrophoresis and quantitative PCR. While neither temperature nor oxygen requirements appeared to be related to the occurrence of this organism within the outflow channel, H(2)S concentration appeared to be an important constraint. This was verified by in vitro pure-culture modeling and kinetic experiments, which suggested that H(2)S inhibition of As(III) oxidation is uncompetitive in nature. In summary, the studies reported herein illustrate that H(2)S is a potent inhibitor of As(III) oxidation and will influence the niche opportunities and population distribution of As(III) chemolithotrophs.

Use of {sup 74}As-Tagged Sodium Arsenite in a Study of Effects of a Herbicide on Pond Ecology

Energy Technology Data Exchange (ETDEWEB)

Ball, R. C. [Michigan State University, East Lansing, MI (United States); Hooper, F. H. [Michigan Department of Conservation, Ann Arbor, MI (United States)

1966-05-15

Over-abundance of higher aquatic vegetation is one of the most serious problems in inland lakes of the United States. Sodium arsenite is extensively used in these areas to control or destroy aquatic vegetation, but little is known of its pathways in the aquatic system or its effects on the biota of the system. Sodium arsenite tagged with {sup 74}As was added to a series of aquaria and its uptake, movement within the ecosystem, and effect upon the metabolism of the system studied. A duplicate experiment was run in a. 1/3 acre pond (0.14 hectare) in which plants were treated at the levels(8 ppm) usually employed in commercial treatment. The sodium arsenite was taken up actively by the plants immediately and recycled to the water and soil by decay and sedimentation of the plants within 5 d. The herbicide and tracer were taken up very actively by filamentous algae (Spirogyra) and the activity disappeared within 8 h and the algae died within a day following. Chara which is generally considered not to take up the herbicide was very radioactive but showed no signs of deterioration or change in growth pattern or rate. The tagged material persisted in the water for the duration of the study in amounts of nearly one half of the applied amounts. Certain of the invertebrates (microcrustacea) are very sensitive to low levels of sodium arsenite, while others show large concentrations and appear to be unaffected by the herbicide. The arsenite moved into the soil and reached a depth of 3 in. in the undisturbed bottom deposits in a 60-d period. The general effect on the community metabolism of the pond as shown by the diurnal oxygen curve indicates a drastic response to the herbicide and, raises serious questions as to the advisability of use of this herbicide in fish-producing ponds due to its effect upon the several trophic levels in the food web of fish. (author)

Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

Czech Academy of Sciences Publication Activity Database

Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.

2014-01-01

Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

Science.gov (United States)

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

Czech Academy of Sciences Publication Activity Database

Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.

2004-01-01

Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

Science.gov (United States)

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

A study on the coprecipitation of arsenite and arsenate into calcite coupled with the determination of oxidation states of arsenic both in calcite and water

International Nuclear Information System (INIS)

Yokoyama, Yuka; Takahashi, Yoshio; Mitsunobu, Satoshi; Tanaka, Kazuya; Itai, Takaaki

2009-01-01

It was found that the amount of arsenite incorporated into calcite is much less than that of arsenate. The result suggests that the sequestration of arsenic by coprecipitation with calcite cannot be an important chemical process under reducing conditions such as in groundwater where arsenite is the dominant arsenic species. (author)

Regulation of apoptosis in human melanoma and neuroblastoma cells by statins, sodium arsenite and TRAIL: a role of combined treatment versus monotherapy

Science.gov (United States)

Ivanov, Vladimir N.; Hei, Tom K.

2015-01-01

Treatment of melanoma cells by sodium arsenite or statins (simvastatin and lovastatin) dramatically modified activities of the main cell signaling pathways resulting in the induction of heme oxygenase-1 (HO-1) and in a downregulation of cyclooxygenase-2 (COX-2) protein levels. Through heme degradation and the production of carbon monoxide and biliverdin, HO-1 plays a protective role in different scenario of oxidative stress followed by mitochondrial apoptosis. Both sodium arsenite and statins could be efficient inducers of apoptosis in some melanoma cell lines, but often exhibited only modest proapoptotic activity in others, due to numerous protective mechanisms. We demonstrated in the present study that treatment by sodium arsenite or statins with an additional inhibition of HO-1 expression (or activation) caused a substantial upregulation of apoptosis in melanoma cells. Sodium arsenite- or statin-induced apoptosis was independent of BRAF status (wild type versus V600E) in melanoma lines. Monotreatment required high doses of statins (20–40 μM) for effective induction of apoptosis. As an alternative approach, pretreatment of melanoma cells with statin at decreased doses (5–20 μM) dramatically enhanced TRAIL-induced apoptosis, due to suppression of the NF-κB and STAT3-transcriptional targets (including COX-2) and downregulation of cFLIP-L (a caspase-8 inhibitor) protein levels. Furthermore, combined treatment with sodium arsenite and TRAIL or simvastatin and TRAIL efficiently induced apoptotic commitment in human neuroblastoma cells. In summary, our findings on enhancing effects of combined treatment of cancer cells using statin and TRAIL provide the rationale for further preclinical evaluation. PMID:21910007

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

Science.gov (United States)

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

Helper T cell subpopulations from women are more susceptible to the toxic effect of sodium arsenite in vitro

International Nuclear Information System (INIS)

Vega, Libia; Montes de Oca, Pavel; Saavedra, Rafael; Ostrosky-Wegman, Patricia

2004-01-01

Arsenic is known to produce inhibition as well as induction of proliferative responses in animal and human cells depending on the doses. Despite the amount of information on the immunotoxic effects of arsenic exposure in different animal models, little is known in humans. Arsenic susceptibility of lymphocyte subpopulations (T helper (Th), CD4+; T cytotoxic (Tc), CD8+) and whether arsenic effects are gender related are still to be determined. This work evaluated the in vitro toxicity of sodium arsenite on human T lymphocyte subpopulations from men and women. Peripheral blood mononuclear cells (PBMC) obtained from healthy young men and women were treated with sodium arsenite (0.01, 0.1, and 1 μM). We assessed cell viability, cell proliferation, and the proportion of Th and Tc cells after 48 or 72 h of arsenic exposure in resting and phytohemagglutinin M (PHA)-activated PBMC. We observed that sodium arsenite at 1 μM was more toxic for Th than for Tc cells in PBMC from women. Besides, T lymphocytes from women were more affected by the cell proliferation inhibition induced by arsenic, suggesting that women could be more susceptible to the toxic and immunotoxic effects caused by arsenic exposure

Synergism between arsenite and proteasome inhibitor MG132 over cell death in myeloid leukaemic cells U937 and the induction of low levels of intracellular superoxide anion

International Nuclear Information System (INIS)

Lombardo, Tomás; Cavaliere, Victoria; Costantino, Susana N.; Kornblihtt, Laura; Alvarez, Elida M.; Blanco, Guillermo A.

2012-01-01

Increased oxygen species production has often been cited as a mechanism determining synergism on cell death and growth inhibition effects of arsenic-combined drugs. However the net effect of drug combination may not be easily anticipated solely from available knowledge of drug-induced death mechanisms. We evaluated the combined effect of sodium arsenite with the proteasome inhibitor MG132, and the anti-leukaemic agent CAPE, on growth-inhibition and cell death effect in acute myeloid leukaemic cells U937 and Burkitt's lymphoma-derived Raji cells, by the Chou–Talalay method. In addition we explored the association of cytotoxic effect of drugs with changes in intracellular superoxide anion (O 2 − ) levels. Our results showed that combined arsenite + MG132 produced low levels of O 2 − at 6 h and 24 h after exposure and were synergic on cell death induction in U937 cells over the whole dose range, although the combination was antagonistic on growth inhibition effect. Exposure to a constant non-cytotoxic dose of 80 μM hydrogen peroxide together with arsenite + MG132 changed synergism on cell death to antagonism at all effect levels while increasing O 2 − levels. Arsenite + hydrogen peroxide also resulted in antagonism with increased O 2 − levels in U937 cells. In Raji cells, arsenite + MG132 also produced low levels of O 2 − at 6 h and 24 h but resulted in antagonism on cell death and growth inhibition. By contrast, the combination arsenite + CAPE showed high levels of O 2 − production at 6 h and 24 h post exposure but resulted in antagonism over cell death and growth inhibition effects in U937 and Raji cells. We conclude that synergism between arsenite and MG132 in U937 cells is negatively associated to O 2 − levels at early time points after exposure. -- Highlights: ► Arsenic combined cytotoxic and anti-proliferative effects by Chou–Talalay method. ► Cytotoxic effect associated with superoxide levels as assessed by flow cytometry. ► Synergism

Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

Directory of Open Access Journals (Sweden)

Alessandro R. Ferrari

2018-01-01

Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

Influence of titanium dioxide nanoparticles on speciation and bioavailability of arsenite

Energy Technology Data Exchange (ETDEWEB)

Sun Hongwen [Key Laboratory of Pollution Processes and Environmental Criteria of Ministry of Education, College of Environmental Science and Engineering, Nankai University, Tianjin 300071 (China)], E-mail: sunhongwen@nankai.edu.cn; Zhang Xuezhi [Key Laboratory of Pollution Processes and Environmental Criteria of Ministry of Education, College of Environmental Science and Engineering, Nankai University, Tianjin 300071 (China); Department of Civil and Environmental Engineering, Arizona State University, Tempe, AZ 85287 (United States); Zhang Zhiyan [Key Laboratory of Pollution Processes and Environmental Criteria of Ministry of Education, College of Environmental Science and Engineering, Nankai University, Tianjin 300071 (China); Chen Yongsheng; Crittenden, John C. [Department of Civil and Environmental Engineering, Arizona State University, Tempe, AZ 85287 (United States)

2009-04-15

In this study, the influence of the co-existence of TiO{sub 2} nanoparticles on the speciation of arsenite [As(III)] was studied by observing its adsorption and valence changing. Moreover, the influence of TiO{sub 2} nanoparticles on the bioavailability of As(III) was examined by bioaccumulation test using carp (Cyprinus carpio). The results showed that TiO{sub 2} nanoparticles have a significant adsorption capacity for As (III). Equilibrium was established within 30 min, with about 30% of the initial As (III) being adsorbed onto TiO{sub 2} nanoparticles. Most of aqueous As (III) was oxidized to As(V) in the presence of TiO{sub 2} nanoparticles under sunlight. The carp accumulated considerably more As in the presence of TiO{sub 2} nanoparticles than in the absence of TiO{sub 2} nanoparticles, and after 25-day exposure, As concentration in carp increased by 44%. Accumulation of As in viscera, gills and muscle of the carp was significantly enhanced by the presence of TiO{sub 2} nanoparticles. - The co-existence of TiO{sub 2} nanoparticles could change the speciation of arsenite by adsorption and photo-oxidation, and enhance its bioaccumulation to carp.

Glucose oxidase variants with improved properities

OpenAIRE

Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje

2014-01-01

Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Science.gov (United States)

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

Effectiveness of Iron Filings in Arsenate and Arsenite Removal from Drinking Water

Directory of Open Access Journals (Sweden)

AliReza Asgari

2009-09-01

Full Text Available Groundwater contamination with arsenic (As has been recognized as a serious problem and there are various reports from different regions, especially from Kurdistan Providence, indicating the presence of As in the from of arsenate and arsenite in water recourses. Removal of these compounds can be accomplished by various methods but they are all expensive. In this study, three concentrations (0.5, 1, and 1 mg/L of iron filings (0.25, 0.5, 1 and 1.5 grams were used as a cheap and available material for adsorption of As and the effects of contact time and pH as well as chloride and sulfate ion concentrations on removal efficiency were determined. Description of adsorption isotherms (Ferundlich and Langmuir was accomplished. Finally, the data obtained were analyzed using the Excel softwere. The results indicate that iron filings show a high capability in adsorbing both arsenate and arsenic compounds from polluted water samples at pH 7 over a short contact time of 30 minutes. In fact, this cheap adsorbent shows good treatment when used at doses as low as 1g/L with no considerable interference by interfering anions (SO42- and Cl-. It appears that the absorbability of both arsenate and arsenite by iron filings can be expressed by Ferundlich isotherm with R2>0.96, whereas arsenate adsorption (with a R2 value of more than 0.96 can be better described by Langmuir isotherm than arsenite (with R2 value of more than 0.91. Results also indicate that the amount of iron added to water is much more than the standard value of 0.3mg/L set for dinking water. Nevertheless, this method has far greater advantages in terms of costs and availability than similar methods. Besides, as removal by this method is efficient without pH modification, iron filing treatment of drinking water may, therefore, be recomnended as a convenient solution to the problem of water resources polluted with As in Iran.

Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase

OpenAIRE

Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata

2017-01-01

Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

Science.gov (United States)

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

Science.gov (United States)

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Norrie disease gene is distinct from the monoamine oxidase genes

OpenAIRE

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

Science.gov (United States)

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Synergism between arsenite and proteasome inhibitor MG132 over cell death in myeloid leukaemic cells U937 and the induction of low levels of intracellular superoxide anion

Energy Technology Data Exchange (ETDEWEB)

Lombardo, Tomás [Laboratorio de Immunotoxicologia (LaITO), IDEHU-CONICET, Hospital de Clínicas, José de San Martín, Universidad de Buenos Aires (UBA), Buenos Aires (Argentina); Cavaliere, Victoria; Costantino, Susana N. [Laboratorio de Inmunología Tumoral (LIT), IDEHU-CONICET, Facultad de Farmacia y Bioquímica, UBA, Buenos Aires (Argentina); Kornblihtt, Laura [Servicio de Hematología, Hospital de Clínicas, José de San Martín (UBA), Buenos Aires (Argentina); Alvarez, Elida M. [Laboratorio de Inmunología Tumoral (LIT), IDEHU-CONICET, Facultad de Farmacia y Bioquímica, UBA, Buenos Aires (Argentina); Blanco, Guillermo A., E-mail: gblanco@ffyb.uba.ar [Laboratorio de Immunotoxicologia (LaITO), IDEHU-CONICET, Hospital de Clínicas, José de San Martín, Universidad de Buenos Aires (UBA), Buenos Aires (Argentina)

2012-02-01

Increased oxygen species production has often been cited as a mechanism determining synergism on cell death and growth inhibition effects of arsenic-combined drugs. However the net effect of drug combination may not be easily anticipated solely from available knowledge of drug-induced death mechanisms. We evaluated the combined effect of sodium arsenite with the proteasome inhibitor MG132, and the anti-leukaemic agent CAPE, on growth-inhibition and cell death effect in acute myeloid leukaemic cells U937 and Burkitt's lymphoma-derived Raji cells, by the Chou–Talalay method. In addition we explored the association of cytotoxic effect of drugs with changes in intracellular superoxide anion (O{sub 2}{sup −}) levels. Our results showed that combined arsenite + MG132 produced low levels of O{sub 2}{sup −} at 6 h and 24 h after exposure and were synergic on cell death induction in U937 cells over the whole dose range, although the combination was antagonistic on growth inhibition effect. Exposure to a constant non-cytotoxic dose of 80 μM hydrogen peroxide together with arsenite + MG132 changed synergism on cell death to antagonism at all effect levels while increasing O{sub 2}{sup −} levels. Arsenite + hydrogen peroxide also resulted in antagonism with increased O{sub 2}{sup −} levels in U937 cells. In Raji cells, arsenite + MG132 also produced low levels of O{sub 2}{sup −} at 6 h and 24 h but resulted in antagonism on cell death and growth inhibition. By contrast, the combination arsenite + CAPE showed high levels of O{sub 2}{sup −} production at 6 h and 24 h post exposure but resulted in antagonism over cell death and growth inhibition effects in U937 and Raji cells. We conclude that synergism between arsenite and MG132 in U937 cells is negatively associated to O{sub 2}{sup −} levels at early time points after exposure. -- Highlights: ► Arsenic combined cytotoxic and anti-proliferative effects by Chou–Talalay method. ► Cytotoxic effect

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

Science.gov (United States)

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

Directory of Open Access Journals (Sweden)

Verónica Loera-Castañeda

2014-01-01

Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Science.gov (United States)

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

Science.gov (United States)

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

Science.gov (United States)

Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

2002-11-01

In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

A broad distribution of the alternative oxidase in microsporidian parasites.

Directory of Open Access Journals (Sweden)

Bryony A P Williams

2010-02-01

Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Science.gov (United States)

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia.

Science.gov (United States)

Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain

2009-08-01

The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

Science.gov (United States)

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

Science.gov (United States)

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

Science.gov (United States)

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

Science.gov (United States)

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

[The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

Science.gov (United States)

Stasia, Marie-José

2007-05-01

Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

Norrie disease gene is distinct from the monoamine oxidase genes.

Science.gov (United States)

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Oxidase-based biocatalytic processes

DEFF Research Database (Denmark)

Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

Directory of Open Access Journals (Sweden)

Suriana

2012-08-01

Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

Selenite modulates the level of phenolics and nutrient element to alleviate the toxicity of arsenite in rice (Oryza sativa L.).

Science.gov (United States)

Chauhan, Reshu; Awasthi, Surabhi; Tripathi, Preeti; Mishra, Seema; Dwivedi, Sanjay; Niranjan, Abhishek; Mallick, Shekhar; Tripathi, Pratibha; Pande, Veena; Tripathi, Rudra Deo

2017-04-01

Arsenic (As) contamination of paddy rice is a serious threat all over the world particularly in South East Asia. Selenium (Se) plays important role in protection of plants against various abiotic stresses including heavy metals. Moreover, arsenite (AsIII) and selenite (SeIV) can be biologically antagonistic due to similar electronic configuration and sharing the common transporter for their uptake in plant. In the present study, the response of oxidative stress, phenolic compounds and nutrient elements was analyzed to investigate Se mediated As tolerance in rice seedlings during AsIII and SeIV exposure in hydroponics. Selenite (25µM) significantly decreased As accumulation in plant than As (25µM) alone treated plants. Level of oxidative stress related parameters viz., reactive oxygen species (ROS), lipid peroxidation, electrical conductivity, nitric oxide and pro-oxidant enzyme (NADPH oxidase), were in the order of As>As+Se>control>Se. Selenium ameliorated As phytotoxicity by increased level of phenolic compounds particularly gallic acid, protocatechuic acid, ferulic acid and rutin and thiol metabolism related enzymes viz., serine acetyl transferase (SAT) and cysteine synthase (CS). Selenium supplementation enhanced the uptake of nutrient elements viz., Fe, Mn, Co, Cu, Zn, Mo, and improved plant growth. The results concluded that Se addition in As contaminated environment might be an important strategy to reduce As uptake and associated phytotoxicity in rice plant by modulation of phenolic compounds and increased uptake of nutrient elements. Copyright © 2016 Elsevier Inc. All rights reserved.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Directory of Open Access Journals (Sweden)

Hoi-Sen Yong

Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

Science.gov (United States)

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.

Science.gov (United States)

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

Directory of Open Access Journals (Sweden)

Laura A Nucci

Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

International Nuclear Information System (INIS)

Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan

2017-01-01

Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

Arsenite and its metabolites, MMAIII and DMAIII, modify CYP3A4, PXR and RXR alpha expression in the small intestine of CYP3A4 transgenic mice

International Nuclear Information System (INIS)

Medina-Diaz, I.M.; Estrada-Muniz, E.; Reyes-Hernandez, O.D.; Ramirez, P.; Vega, L.; Elizondo, G.

2009-01-01

Arsenic is an environmental pollutant that has been associated with an increased risk for the development of cancer and several other diseases through alterations of cellular homeostasis and hepatic function. Cytochrome P450 (P450) modification may be one of the factors contributing to these disorders. Several reports have established that exposure to arsenite modifies P450 expression by decreasing or increasing mRNA and protein levels. Cytochrome P450 3A4 (CYP3A4), the predominant P450 expressed in the human liver and intestines, which is regulated mainly by the Pregnane X Receptor-Retinoid X Receptor alpha (PXR-RXR alpha) heterodimer, contributes to the metabolism of approximately half the drugs in clinical use today. The present study investigates the effect of sodium arsenite and its metabolites monomethylarsonous acid (MMA III ) and dimethylarsinous acid (DMA III ) on CYP3A4, PXR, and RXR alpha expression in the small intestine of CYP3A4 transgenic mice. Sodium arsenite treatment increases mRNA, protein and CYP3A4 activity in a dose-dependent manner. However, the increase in protein expression was not as marked as compared to the increase in mRNA levels. Arsenite treatment induces the accumulation of Ub-protein conjugates, indicating that the activation of this mechanism may explain the differences observed between the mRNA and protein expression of CYP3A4 induction. Treatment with 0.05 mg/kg of DMA III induces CYP3A4 in a similar way, while treatment with 0.05 mg/kg of MMA III increases mostly mRNA, and to a lesser degree, CYP3A4 activity. Sodium arsenite and both its metabolites increase PXR mRNA, while only DMA III induces RXR alpha expression. Overall, these results suggest that sodium arsenite and its metabolites induce CYP3A4 expression by increasing PXR expression in the small intestine of CYP3A4 transgenic mice.

Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger.

Science.gov (United States)

Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro

2012-03-01

The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Arsenate and Arsenite Sorption on Magnetite: Relations to Groundwater Arsenic Treatment Using Zerovalent Iron and Natural Attenuation

Science.gov (United States)

Magnetite (Fe3O4) is a zerovalent iron corrosion product; it is also formed in natural soil and sediment. Sorption of arsenate (As(V)) and arsenite (As(III)) on magnetite is an important process of arsenic removal from groundwater using zerovalent iron-based permeable reactive ba...

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

Science.gov (United States)

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

Science.gov (United States)

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

Science.gov (United States)

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Exploring flavin-containing carbohydrate oxidases

NARCIS (Netherlands)

Ferrari, Alessandro Renato

2017-01-01

Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

International Nuclear Information System (INIS)

Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

2008-01-01

Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

Science.gov (United States)

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

Science.gov (United States)

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

Identification of arsenic resistant endophytic bacteria from Pteris vittata roots and characterization for arsenic remediation application.

Science.gov (United States)

Tiwari, Sarita; Sarangi, Bijaya Ketan; Thul, Sanjog T

2016-09-15

Mitigation of arsenic (As) pollution is a topical environmental issue of high R&D priority. The present investigation was carried out to isolate As resistant endophytes from the roots of Indian ecotype Pteris vittata and characterize their As transformation and tolerance ability, plant growth promoting characteristics and their role to facilitate As uptake by the plant. A total of 8 root endophytes were isolated from plants grown in As amended soil (25 mg As kg(-1)). These isolates were studied for minimum inhibitory concentration (MIC), arsenite As(III) - arsenate As(V) transformation ability, plant growth promoting (PGP) characteristics through siderophore, indole acetic acid (IAA) production, phosphatase, ACC deaminase activity, and presence of arsenite oxidase (aox) and arsenite transporter (arsB) genes. On the basis of 16S rDNA sequence analysis, these isolates belong to Proteobacteria, Firmicutes and Bacteroidetes families under the genera Bacillus, Enterobacter, Stenotrophomonas and Rhizobium. All isolates were found As tolerant, of which one isolates showed highest tolerance up to 1000 mg L(-1) concentration in SLP medium. Five isolates were IAA positive with highest IAA production up to 60 mg/L and two isolates exhibited siderophore activity. Phosphatase activity was shown by only one isolate while ACC deaminase activity was absent in all the isolates. The As transformation study by silver nitrate test showed that only two strains had dual characteristics of As(III) oxidation and As (V) reduction, four strains exhibited either of the characteristics while other two didn't confirmed any of the two characteristics. Presence of aox gene was detected in two strains and arsB gene in six isolates. The strain with highest As tolerance also showed highest IAA production and occurrence of arsB gene. Present investigation may open up further scope of utilizing these endophytes for up gradation of phytoextraction process. Copyright © 2016 Elsevier Ltd. All

The inhibition of tissue respiration and alcoholic fermentation at different catabolic levels by ethyl carbamate (urethan) and arsenite

NARCIS (Netherlands)

Florijn, E.; Gruber, M.; Leijnse, B.; Huisman, T.H.J.

1950-01-01

1. A hypothesis is given concerning the action of urethan and arsenite on malignant growth. Two assumptionsares made:- (a) the enzyme system responsible for energy production in malignant tumours is working at maximal rate, contrary to the corresponding enzyme system in normal tissues. (b) a

Role of pH in oxidase variability of Aeromonas hydrophila.

OpenAIRE

Hunt, L K; Overman, T L; Otero, R B

1981-01-01

Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

NARCIS (Netherlands)

Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.

2002-01-01

Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

Biotransformation of As (III to As (V and their stabilization in soil with Bacillus sp. XS2 isolated from gold mine tailing of Xinjiang, China

Directory of Open Access Journals (Sweden)

Santosh Kumar Karn

2016-09-01

Full Text Available Xinjiang province is one of the most polluted region in China, this region affected by multi-metal problem, especially arsenic (As affect very badly. Two major forms of As present in the environment As (III and As (V as compared to As (V, As (III is much more toxic. Our aim is to remediate As (III contaminated soil by using As (III resistant microbe, having the high transforming ability for As (III to As (V. An As (III oxidizing bacterium Bacillus sp. XS2, isolated and selected from gold mine tailing which have shown high resistance up to 6400 mg L−1 and efficiently transformed up to 4000 mg L−1 in sucrose low phosphate medium (SLP, higher than any of the previous reported Bacillus sp.. In soil, we found that XS2 successfully transformed up to 81% of soluble exchangeable fraction within 10 d in contaminated soil (with 500 mg kg−1, which makes it potential microbe for the removal of contaminated site with arsenic in the environment. Further XS2 was characterized for their molecular basis of resistance and we establish that XS2 having arsenic oxidase enzyme activity which is accountable for the detoxification of arsenic at high concentration and provide resistance to the bacterium. Gene encoding arsenic oxidase (aioA-gene was also amplified from this bacterium using polymerase chain reaction (PCR with degenerate primer. The aioA-gene is specific for the arsenite-oxidizing bacteria. The deduced amino acid sequence had shown 42% similarity with pseudomonas sp. arsenic oxidase. Further, the strain was characterized by 16s rRNA gene sequence analysis and shown maximum similarity with Bacillus sp.

Oxidation and detoxification of trivalent arsenic species

International Nuclear Information System (INIS)

Aposhian, H. Vasken; Zakharyan, Robert A.; Avram, Mihaela D.; Kopplin, Michael J.; Wollenberg, Michael L.

2003-01-01

Arsenic compounds with a +3 oxidation state are more toxic than analogous compounds with a +5 oxidation state, for example, arsenite versus arsenate, monomethylarsonous acid (MMA III ) versus monomethylarsonic acid (MMA V ), and dimethylarsinous acid (DMA III ) versus dimethylarsinic acid (DMA V ). It is no longer believed that the methylation of arsenite is the beginning of a methylation-mediated detoxication pathway. The oxidation of these +3 compounds to their less toxic +5 analogs by hydrogen peroxide needs investigation and consideration as a potential mechanism for detoxification. Xanthine oxidase uses oxygen to oxidize hypoxanthine to xanthine to uric acid. Hydrogen peroxide and reactive oxygen are also products. The oxidation of +3 arsenicals by the hydrogen peroxide produced in the xanthine oxidase reaction was blocked by catalase or allopurinol but not by scavengers of the hydroxy radical, e.g., mannitol or potassium iodide. Melatonin, the singlet oxygen radical scavenger, did not inhibit the oxidation. The production of H 2 O 2 by xanthine oxidase may be an important route for decreasing the toxicity of trivalent arsenic species by oxidizing them to their less toxic pentavalent analogs. In addition, there are many other reactions that produce hydrogen peroxide in the cell. Although chemists have used hydrogen peroxide for the oxidation of arsenite to arsenate to purify water, we are not aware of any published account of its potential importance in the detoxification of trivalent arsenicals in biological systems. At present, this oxidation of the +3 oxidation state arsenicals is based on evidence from in vitro experiments. In vivo experiments are needed to substantiate the role and importance of H 2 O 2 in arsenic detoxication in mammals

Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

Directory of Open Access Journals (Sweden)

Sluse F.E.

1998-01-01

Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

Directory of Open Access Journals (Sweden)

Veerachat Muangsombut

2017-08-01

Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

Science.gov (United States)

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Arsenite induces apoptosis in human mesenchymal stem cells by altering Bcl-2 family proteins and by activating intrinsic pathway

International Nuclear Information System (INIS)

Yadav, Santosh; Shi Yongli; Wang Feng; Wang He

2010-01-01

Purpose: Environmental exposure to arsenic is an important public health issue. The effects of arsenic on different tissues and organs have been intensively studied. However, the effects of arsenic on bone marrow mesenchymal stem cells (MSCs) have not been reported. This study is designed to investigate the cell death process caused by arsenite and its related underlying mechanisms on MSCs. The rationale is that absorbed arsenic in the blood circulation can reach to the bone marrow and may affect the cell survival of MSCs. Methods: MSCs of passage 1 were purchased from Tulane University, grown till 70% confluency level and plated according to the experimental requirements followed by treatment with arsenite at various concentrations and time points. Arsenite (iAs III ) induced cytotoxic effects were confirmed by cell viability and cell cycle analysis. For the presence of canonic apoptosis markers; DNA damage, exposure of intramembrane phosphotidylserine, protein and m-RNA expression levels were analyzed. Results: iAs III induced growth inhibition, G2-M arrest and apoptotic cell death in MSCs, the apoptosis induced by iAs III in the cultured MSCs was, via altering Bcl-2 family proteins and by involving intrinsic pathway. Conclusion: iAs III can induce apoptosis in bone marrow-derived MSCs via Bcl-2 family proteins, regulating intrinsic apoptotic pathway. Due to the multipotency of MSC, acting as progenitor cells for a variety of connective tissues including bone, adipose, cartilage and muscle, these effects of arsenic may be important in assessing the health risk of the arsenic compounds and understanding the mechanisms of arsenic-induced harmful effects.

Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

Directory of Open Access Journals (Sweden)

Makkonen J.

2015-01-01

Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

Energy Technology Data Exchange (ETDEWEB)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

Characterization of arsenic resistant bacteria from arsenic rich groundwater of West Bengal, India.

Science.gov (United States)

Sarkar, Angana; Kazy, Sufia K; Sar, Pinaki

2013-03-01

Sixty-four arsenic (As) resistant bacteria isolated from an arsenic rich groundwater sample of West Bengal were characterized to investigate their potential role in subsurface arsenic mobilization. Among the isolated strains predominance of genera Agrobacterium/Rhizobium, Ochrobactrum and Achromobacter which could grow chemolitrophically and utilize arsenic as electron donor were detected. Higher tolerance to As(3+) [maximum tolerable concentration (MTC): ≥10 mM], As(5+) (MTC: ≥100 mM) and other heavy metals like Cu(2+), Cr(2+), Ni(2+) etc. (MTC: ≥10 mM), presence of arsenate reductase and siderophore was frequently observed among the isolates. Ability to produce arsenite oxidase and phosphatase enzyme was detected in 50 and 34 % of the isolates, respectively. Although no direct correlation among taxonomic identity of bacterial strains and their metabolic abilities as mentioned above was apparent, several isolates affiliated to genera Ochrobactrum, Achromobacter and unclassified Rhizobiaceae members were found to be highly resistant to As(3+) and As(5+) and positive for all the test properties. Arsenate reductase activity was found to be conferred by arsC gene, which in many strains was coupled with arsenite efflux gene arsB as well. Phylogenetic incongruence between the 16S rRNA and ars genes lineages indicated possible incidence of horizontal gene transfer for ars genes. Based on the results we propose that under the prevailing low nutrient condition inhabitant bacteria capable of using inorganic electron donors play a synergistic role wherein siderophores and phosphatase activities facilitate the release of sediment bound As(5+), which is subsequently reduced by arsenate reductase resulting into the mobilization of As(3+) in groundwater.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

Science.gov (United States)

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Science.gov (United States)

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

Energy Technology Data Exchange (ETDEWEB)

Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))

1989-09-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

International Nuclear Information System (INIS)

Johnson, J.L.; Rajagopalan, K.V.; London, R.E.

1989-01-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

Science.gov (United States)

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Metagenomic analysis revealed highly diverse microbial arsenic metabolism genes in paddy soils with low-arsenic contents

International Nuclear Information System (INIS)

Xiao, Ke-Qing; Li, Li-Guan; Ma, Li-Ping; Zhang, Si-Yu; Bao, Peng; Zhang, Tong; Zhu, Yong-Guan

2016-01-01

Microbe-mediated arsenic (As) metabolism plays a critical role in global As cycle, and As metabolism involves different types of genes encoding proteins facilitating its biotransformation and transportation processes. Here, we used metagenomic analysis based on high-throughput sequencing and constructed As metabolism protein databases to analyze As metabolism genes in five paddy soils with low-As contents. The results showed that highly diverse As metabolism genes were present in these paddy soils, with varied abundances and distribution for different types and subtypes of these genes. Arsenate reduction genes (ars) dominated in all soil samples, and significant correlation existed between the abundance of arr (arsenate respiration), aio (arsenite oxidation), and arsM (arsenite methylation) genes, indicating the co-existence and close-relation of different As resistance systems of microbes in wetland environments similar to these paddy soils after long-term evolution. Among all soil parameters, pH was an important factor controlling the distribution of As metabolism gene in five paddy soils (p = 0.018). To the best of our knowledge, this is the first study using high-throughput sequencing and metagenomics approach in characterizing As metabolism genes in the five paddy soil, showing their great potential in As biotransformation, and therefore in mitigating arsenic risk to humans. - Highlights: • Use metagenomics to analyze As metabolism genes in paddy soils with low-As content. • These genes were ubiquitous, abundant, and associated with diverse microbes. • pH as an important factor controlling their distribution in paddy soil. • Imply combinational effect of evolution and selection on As metabolism genes. - Metagenomics was used to analyze As metabolism genes in paddy soils with low-As contents. These genes were ubiquitous, abundant, and associated with diverse microbes.

IMBALANCE OF DNA METHYLATION, BOTH HYPERMETHYLATION AND HYPOMETHYLATION, OCCUR AFTER EXPOSURE OF HUMAN CELLS TO NANOMOLAR CONCENTRATIONS OF ARSENITE IN CULTURE.

Science.gov (United States)

Imbalance of DNA methylation, BOTH hypermethylation and hypomethylation, occur after exposure of human cells to nanomolar concentrations of arsenite in culture.We and others have hypothesized that a mechanism of arsenic carcinogenesis could involve alteration of DNA methy...

Polyphenol Oxidase Enzyme and Inactivation Methods

Directory of Open Access Journals (Sweden)

Leman Yılmaz

2018-03-01

Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

Science.gov (United States)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Human hnRNP Q re-localizes to cytoplasmic granules upon PMA, thapsigargin, arsenite and heat-shock treatments

International Nuclear Information System (INIS)

Quaresma, Alexandre J.C.; Bressan, G.C.; Gava, L.M.; Lanza, D.C.F.; Ramos, C.H.I; Kobarg, Joerg

2009-01-01

Eukaryotic gene expression is regulated on different levels ranging from pre-mRNA processing to translation. One of the most characterized families of RNA-binding proteins is the group of hnRNPs: heterogenous nuclear ribonucleoproteins. Members of this protein family play important roles in gene expression control and mRNAs metabolism. In the cytoplasm, several hnRNPs proteins are involved in RNA-related processes and they can be frequently found in two specialized structures, known as GW-bodies (GWbs), previously known as processing bodies: PBs, and stress granules, which may be formed in response to specific stimuli. GWbs have been early reported to be involved in the mRNA decay process, acting as a site of mRNA degradation. In a similar way, stress granules (SGs) have been described as cytoplasmic aggregates, which contain accumulated mRNAs in cells under stress conditions and present reduced or inhibited translation. Here, we characterized the hnRNP Q localization after different stress conditions. hnRNP Q is a predominantly nuclear protein that exhibits a modular organization and several RNA-related functions. Our data suggest that the nuclear localization of hnRNP Q might be modified after different treatments, such as: PMA, thapsigargin, arsenite and heat shock. Under different stress conditions, hnRNP Q can fully co-localize with the endoplasmatic reticulum specific chaperone, BiP. However, under stress, this protein only co-localizes partially with the proteins: GW182 - GWbs marker protein and TIA-1 stress granule component

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

Science.gov (United States)

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.

Science.gov (United States)

Maldonado-Mendoza, Ignacio E; Harrison, Maria J

Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

Science.gov (United States)

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

Science.gov (United States)

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

Science.gov (United States)

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Long Term Performance of an Arsenite-Oxidizing-Chlorate-Reducing Microbial Consortium in an Upflow Anaerobic Sludge Bed (UASB) Bioreactor

Science.gov (United States)

Sun, Wenjie; Sierra-Alvarez, Reyes; Field, Jim A.

2011-01-01

A chlorate (ClO3−) reducing microbial consortium oxidized arsenite (As(III)) to arsenate (As(V)) in an upflow anaerobic sludge-bed bioreactor over 550 d operation. As(III) was converted with high conversion efficiencies (>98%) at volumetric loadings ranging from 0.45 to 1.92 mmol As/(Lreactor d). The oxidation of As(III) was linked to the complete reduction of ClO3− to Cl− and H2O, as demonstrated by a molar ratio of approximately 3.0 mol As(III) oxidized per mole of Cl− formed and by the greatly lowered ClO3−-reducing capacity without As(III) feeding. An autotrophic enrichment culture was established from the bioreactor biofilm. A 16S rRNA gene clone library indicated that the culture was dominated by Dechloromonas, and Stenotrophomonas as well as genera within the family Comamonadaceae. The results indicate that the oxidation of As(III) to less mobile As(V) utilizing ClO3− as a terminal electron acceptor provides a sustainable bioremediation strategy for arsenic contamination in anaerobic environments. PMID:21333531

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

Science.gov (United States)

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

DEFF Research Database (Denmark)

Andreou, Dimitrios; Saetre, Peter; Werge, Thomas

2012-01-01

The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

Xenophilus arseniciresistens sp. nov., an arsenite-resistant bacterium isolated from soil.

Science.gov (United States)

Li, Qin-Fen; Sun, Li-Na; Kwon, Soon-Wo; Chen, Qing; He, Jian; Li, Shun-Peng; Zhang, Jun

2014-06-01

A Gram-reaction-negative, aerobic, motile, rod-shaped, arsenite [As(III)]-resistant bacterium, designated strain YW8(T), was isolated from agricultural soil. 16S rRNA gene sequence analysis showed over 97% sequence similarity to strains of the environmental species Xenophilus azovorans, Xenophilus aerolatus, Simplicispira metamorpha, Variovorax soli, and Xylophilus ampelinus. However, the phylogenetic tree indicated that strain YW8(T) formed a separate clade from Xenophilus azovorans. DNA-DNA hybridization experiments showed that the DNA-DNA relatedness values between strain YW8(T) and its closest phylogenetic neighbours were below 24.2-35.5%, which clearly separated the strain from these closely related species. The major cellular fatty acids of strain YW8(T) were C(16 : 0), C(17 : 0) cyclo, C(18 : 1)ω7c, and summed feature 3(C(16 : 1)ω6c and/or C(16 : 1)ω7c). The genomic DNA G+C content was 69.3 mol%, and the major respiratory quinone was ubiquinone-8. The predominant polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, three unknown phospholipids, an unknown polar lipid and phosphatidylserine. The major polyamines were 2-hydroxyputrescine and putrescine. On the basis of morphological, physiological and biochemical characteristics, phylogenetic position, DNA-DNA hybridization and chemotaxonomic data, strain YW8(T) is considered to represent a novel species of the genus Xenophilus, for which the name Xenophilus arseniciresistens sp. nov. is proposed; the type strain is YW8(T) ( = CCTCC AB2012103(T) = KACC 16853(T)). © 2014 IUMS.

Confirmation of a blocked amino terminus of sulfhydryl oxidase

International Nuclear Information System (INIS)

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.

1990-01-01

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

Directory of Open Access Journals (Sweden)

Marić Slađana

2005-01-01

Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

Immobilization of oxidases and their analytical applications

International Nuclear Information System (INIS)

Yasinzai, M.

2007-01-01

Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

NADPH Oxidases: Progress and Opportunities

OpenAIRE

San Martin, Alejandra; Griendling, Kathy K.

2014-01-01

From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

Possible mechanisms for arsenic-induced proliferative diseases

Energy Technology Data Exchange (ETDEWEB)

Wetterhahn, K.E.; Dudek, E.J.; Shumilla, J.A. [Dartmouth College and Medical School, Hanover, NH (United States)] [and others

1996-12-31

Possible mechanisms for cardiovascular diseases and cancers which have been observed on chronic exposure to arsenic have been investigated. We tested the hypothesis that nonlethal levels of arsenic are mitogenic, cause oxidative stress, increase nuclear translocation of trans-acting factors, and increase expression of genes involved in proliferation. Cultured porcine vascular (from aorta) endothelial cells were used as a model cell system to study the effects of arsenic on the target cells for cardiovascular diseases. Treatment of postconfluent cell cultures with nonovertly toxic concentrations of arsenite increased DNA synthesis, similar to the mitogenic response observed with hydrogen peroxide. Within 1 hour of adding noncytotoxic concentrations of arsenite, cellular levels of oxidants increased relative to control levels, indicating that arsenite promotes cellular oxidations. Arsenite treatment increased nuclear translocation of NF-{kappa}B, an oxidative stress-responsive transcription factor, in a manner similar to that observed with hydrogen peroxide. Pretreatment of intact cells with the antioxidants N-acetylcysteine and dimethylfumarate prevented the arsenite-induced increases in cellular oxidant formation and NF-KB translocation. Arsenite had little or no effect on binding of NF-KB to its DNA recognition sequence in vitro, indicating that it is unlikely that arsenite directly affects NF-KB. The steady-state mRNA levels of intracellular adhesion molecule and urokinase-like plasminogen activator, genes associated with the active endothelial phenotype in arteriosclerosis and cancer metastasis, were increased by nontoxic concentrations of arsenite. These data suggest that arsenite promotes proliferative diseases like heart disease and cancer by activating oxidant-sensitive endothelial cell signaling and gene expression. It is possible that antioxidant therapy would be useful in preventing arsenic-induced cardiovascular disease and cancer.

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

Science.gov (United States)

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

Science.gov (United States)

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

Directory of Open Access Journals (Sweden)

Barbaro Michela

2013-01-01

Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

Science.gov (United States)

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

Simulation of the effects of phosphate on adsorption of arsenite and arsenate on ferrihydrite matrix using a geochemical equilibrium model

International Nuclear Information System (INIS)

Kassenga, G.R.

2005-01-01

Arsenic is of environmental concern because of its toxicity to plants, animals, and human beings. Iron oxides, including the poorly crystalline (amorphous) iron oxides, e.g., ferrihydrite, have a strong affinity for both arsenite and arsenate (the most toxic species of arsenic). In view of this, adsorption on ferrihydrite matrix is the main process of immobilization of arsenic in groundwater. The presence of phosphate in groundwater may however limit adsorption of arsenic on iron oxides due to competition for adsorption sites, resulting in higher aqueous concentrations in some environments. This paper analyses the effects of phosphate on aqueous concentration of arsenic at different pH using a geochemical equilibrium simulation model. It specifically focuses on arsenite and arsenate, the most toxic forms of arsenic. A general description of the occurrence of arsenic in the environment, its toxicity, and health hazards is first given. The paper discusses sources and geochemical processes that control arsenic mobility in aquifers. Adsorption and desorption reactions of arsenic on ferrihydrite and the factors that affect them are described. Modeling of adsorption/desorption processes is then discussed. Finally, the effects of phosphate on adsorption and desorption processes of arsenic on ferrihydrite as a function of pH are analyzed using PHREEQC Version 2, a computer program for simulating chemical reactions and transport processes in natural and polluted water. The model is applied in a case study formulated on the basis of a realistic hydrogeochemical setting to demonstrate how the use of arsenical pesticides and phosphate fertilizers may pose potential public health problems in areas where groundwater is used for domestic purposes. The modeling results have shown that aqueous concentration of arsenic increases with increasing phosphate-phosphorus concentration for pH values less than 10 assuming that ferrihydrite concentration and other hydrogeochemical conditions

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

Science.gov (United States)

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

Modulation of NADPH oxidase activity by known uraemic retention solutes

DEFF Research Database (Denmark)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera

2014-01-01

chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...

Gravity Responsive NADH Oxidase of the Plasma Membrane

Science.gov (United States)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

Science.gov (United States)

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect

Directory of Open Access Journals (Sweden)

Nikola Kovářová

2016-06-01

Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

International Nuclear Information System (INIS)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F.

2009-01-01

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

Science.gov (United States)

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Arsenite activates NFκB through induction of C-reactive protein

International Nuclear Information System (INIS)

Druwe, Ingrid L.; Sollome, James J.; Sanchez-Soria, Pablo; Hardwick, Rhiannon N.; Camenisch, Todd D.; Vaillancourt, Richard R.

2012-01-01

C-reactive protein (CRP) is an acute phase protein in humans. Elevated levels of CRP are produced in response to inflammatory cytokines and are associated with atherosclerosis, hypertension, cardiovascular disease and insulin resistance. Exposure to inorganic arsenic, a common environmental toxicant, also produces cardiovascular disorders, namely atherosclerosis and is associated with insulin-resistance. Inorganic arsenic has been shown to contribute to cardiac toxicities through production of reactive oxygen species (ROS) that result in the activation of NFκB. In this study we show that exposure of the hepatic cell line, HepG2, to environmentally relevant levels of arsenite (0.13 to 2 μM) results in elevated CRP expression and secretion. ROS analysis of the samples showed that a minimal amount of ROS are produced by HepG2 cells in response to these concentrations of arsenic. In addition, treatment of FvB mice with 100 ppb sodium arsenite in the drinking water for 6 months starting at weaning age resulted in dramatically higher levels of CRP in both the liver and inner medullary region of the kidney. Further, mouse Inner Medullary Collecting Duct cells (mIMCD-4), a mouse kidney cell line, were stimulated with 10 ng/ml CRP which resulted in activation of NFκB. Pretreatment with 10 nM Y27632, a known Rho-kinase inhibitor, prior to CRP exposure attenuated NFκB activation. These data suggest that arsenic causes the expression and secretion of CRP and that CRP activates NFκB through activation of the Rho-kinase pathway, thereby providing a novel pathway by which arsenic can contribute to metabolic syndrome and cardiovascular disease. -- Highlights: ► Exposure to arsenic can induce the expression and secretion of CRP. ► Mice treated with NaAsO 2 showed higher levels of CRP in both the liver and kidney. ► mIMCD-3 were stimulated with CRP which resulted in activation of NFκB. ► CRP activates NFκB through activation of the Rho-kinase pathway. ► Data provide

Arsenite activates NFκB through induction of C-reactive protein

Energy Technology Data Exchange (ETDEWEB)

Druwe, Ingrid L.; Sollome, James J.; Sanchez-Soria, Pablo; Hardwick, Rhiannon N.; Camenisch, Todd D.; Vaillancourt, Richard R., E-mail: vaillancourt@pharmacy.arizona.edu

2012-06-15

C-reactive protein (CRP) is an acute phase protein in humans. Elevated levels of CRP are produced in response to inflammatory cytokines and are associated with atherosclerosis, hypertension, cardiovascular disease and insulin resistance. Exposure to inorganic arsenic, a common environmental toxicant, also produces cardiovascular disorders, namely atherosclerosis and is associated with insulin-resistance. Inorganic arsenic has been shown to contribute to cardiac toxicities through production of reactive oxygen species (ROS) that result in the activation of NFκB. In this study we show that exposure of the hepatic cell line, HepG2, to environmentally relevant levels of arsenite (0.13 to 2 μM) results in elevated CRP expression and secretion. ROS analysis of the samples showed that a minimal amount of ROS are produced by HepG2 cells in response to these concentrations of arsenic. In addition, treatment of FvB mice with 100 ppb sodium arsenite in the drinking water for 6 months starting at weaning age resulted in dramatically higher levels of CRP in both the liver and inner medullary region of the kidney. Further, mouse Inner Medullary Collecting Duct cells (mIMCD-4), a mouse kidney cell line, were stimulated with 10 ng/ml CRP which resulted in activation of NFκB. Pretreatment with 10 nM Y27632, a known Rho-kinase inhibitor, prior to CRP exposure attenuated NFκB activation. These data suggest that arsenic causes the expression and secretion of CRP and that CRP activates NFκB through activation of the Rho-kinase pathway, thereby providing a novel pathway by which arsenic can contribute to metabolic syndrome and cardiovascular disease. -- Highlights: ► Exposure to arsenic can induce the expression and secretion of CRP. ► Mice treated with NaAsO{sub 2} showed higher levels of CRP in both the liver and kidney. ► mIMCD-3 were stimulated with CRP which resulted in activation of NFκB. ► CRP activates NFκB through activation of the Rho-kinase pathway. ► Data

Mechanisms of interaction between arsenian pyrite and aqueous arsenite under anoxic and oxic conditions

Science.gov (United States)

Qiu, Guohong; Gao, Tianyu; Hong, Jun; Luo, Yao; Liu, Lihu; Tan, Wenfeng; Liu, Fan

2018-05-01

Pyrite affects the conversion and migration processes of arsenic in soils and waters. Adsorption and redox reactions of arsenite (As(III)) occur on the surface of pyrite, and the interaction processes are influenced by the arsenic incorporated into pyrite. This work examined the effects of arsenic content, pH and oxygen on the interaction between arsenian pyrite and aqueous As(III) and investigated the underlying mechanisms. The results indicated that arsenic incorporation led to a high content of Fe(III) in pyrite, and that As(III) was mainly adsorbed on pyrite surface and part of As(III) was oxidized to As(V) by the newly formed intermediates including hydroxyl radicals and hydrogen peroxide. The oxidation rate increased with increasing arsenic content in the pyrite and the presence of air (oxygen), and first decreased and then increased with increasing pH from 3.0 to 11.0. Hydroxyl radicals and hydrogen peroxide significantly contributed to the oxidation of pyrite and aqueous As(III) in acidic and alkaline solutions, respectively. Although pyrite oxidation increased with increasing arsenic content as indicated by the elevated concentrations of elemental S and SO42-, the percentage of released arsenic in total arsenic of the arsenian pyrite decreased due to the adsorption of arsenic on the surface of newly formed ferric (hydr)oxides, especially the ferric arsenate precipitate formed in high pH solutions. The present study enables a better understanding of the important interaction process of dissolved arsenite and natural pyrites in the study of groundwater contamination, arsenic migration/sequestration, and acid mine drainage formation.

Calcium transport in vesicles energized by cytochrome oxidase

Energy Technology Data Exchange (ETDEWEB)

Rosier, Randy N. [Univ. of Rochester, NY (United States)

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K⁺ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K⁺ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.

Advantages of low pH and limited oxygenation in arsenite removal from water by zero-valent iron.

Science.gov (United States)

Klas, Sivan; Kirk, Donald W

2013-05-15

The removal of toxic arsenic species from contaminated waters by zero-valent iron (ZVI) has drawn considerable attention in recent years. In this approach, arsenic ions are mainly removed by adsorption to the iron corrosion products. Reduction to zero-valent arsenic on the ZVI surface is possible in the absence of competing oxidants and can reduce arsenic mobility and sludge formation. However, associated removal rates are relatively low. In the current study, simultaneous high reduction and removal rates of arsenite (H3AsO3), the more toxic and mobile environmentally occurring arsenic species, was demonstrated by reacting it with ZVI under limited aeration and relatively low pH. 90% of the removed arsenic was attached to the ZVI particles and 60% of which was in the elemental state. Under the same non-acidic conditions, only 40-60% of the removed arsenic was attached to the ZVI with no change in arsenic oxidation state. Under anaerobic conditions, reduction occurred but total arsenic removal rate was significantly lower and ZVI demand was higher. The effective arsenite removal under acidic oxygen-limited conditions was explained by formation of Fe(II)-solid intermediate on the ZVI surface that provided high surface area and reducing power. Copyright © 2013 Elsevier B.V. All rights reserved.

Key role of alternative oxidase in lovastatin solid-state fermentation.

Science.gov (United States)

Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

2017-10-01

Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

H2O2 and NADPH oxidases involve in regulation of 2-(2-phenylethyl)chromones accumulation during salt stress in Aquilaria sinensis calli.

Science.gov (United States)

Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei

2018-04-01

2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.

Modulation of NADPH oxidase activity by known uraemic retention solutes.

Science.gov (United States)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim

2014-08-01

Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

Effects of exogenous glutathione on arsenic burden and NO metabolism in brain of mice exposed to arsenite through drinking water.

Science.gov (United States)

Wang, Yan; Zhao, Fenghong; Jin, Yaping; Zhong, Yuan; Yu, Xiaoyun; Li, Gexin; Lv, Xiuqiang; Sun, Guifan

2011-03-01

Chronic exposure to inorganic arsenic (iAs) is associated with neurotoxicity. Studies to date have disclosed that methylation of ingested iAs is the main metabolic pathway, and it is a process relying on reduced glutathione (GSH). The aim of this study was to explore the effects of exogenous GSH on arsenic burden and metabolism of nitric oxide (NO) in the brain of mice exposed to arsenite via drinking water. Mice were exposed to sodium arsenite through drinking water contaminated with 50 mg/L arsenic for 4 weeks and treated intraperitoneally with saline solution, 200 mg/kg body weight (b.w), 400 mg/kg b.w, or 800 mg/kg b.w GSH, respectively, at the 4th week. Levels of iAs, monomethylarsenic acid, and dimethylarsenic acid (DMAs) in the liver, blood, and brain were determined by method of hydride generation coupled with atomic absorption spectrophotometry. Activities of nitric oxide synthase (NOS) and contents of NO in the brain were determined by colorimetric method. Compared with mice exposed to arsenite alone, administration of GSH increased dose-dependently the primary and secondary methylation ratio in the liver, which caused the decrease in percent iAs and increase in percent DMAs in the liver, as a consequence, resulted in significant decrease in iAs levels in the blood and total arsenic levels in both blood and brain. NOS activities and NO levels in the brain of mice in iAs group were significantly lower than those in control; however, administration of GSH could increase significantly activities of NOS and contents of NO. Findings from this study suggested that exogenous GSH could promote both primary and secondary arsenic methylation capacity in the liver, which might facilitate excretion of arsenicals, and consequently reduce arsenic burden in both blood and brain and furthermore ameliorate the effects of arsenicals on NO metabolism in the brain.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

Science.gov (United States)

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

Science.gov (United States)

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Lysyl oxidase in colorectal cancer

DEFF Research Database (Denmark)

Cox, Thomas R; Erler, Janine T

2013-01-01

Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

Science.gov (United States)

El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

2012-01-01

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

Science.gov (United States)

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

Science.gov (United States)

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

Directory of Open Access Journals (Sweden)

Tao Zhan

Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

Directory of Open Access Journals (Sweden)

Saied Reza Naddaf

2012-12-01

Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

Production of rabbit antibodies against purified Glucose oxidase

Directory of Open Access Journals (Sweden)

Muhammad Anjum Zia

2012-02-01

Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

Czech Academy of Sciences Publication Activity Database

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra

2013-01-01

Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

Folate deficiency enhances arsenic effects on expression of genes involved in epidermal differentiation in transgenic K6/ODC mouse skin

International Nuclear Information System (INIS)

Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.

2007-01-01

Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis

Chemoenzymatic combination of glucose oxidase with titanium silicalite -1

DEFF Research Database (Denmark)

Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.

2010-01-01

Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....

Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions

Directory of Open Access Journals (Sweden)

Sandip A. Ghuge

2015-07-01

Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

Science.gov (United States)

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

Science.gov (United States)

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

[Sequencing of mitochondrial DNA cytochrome oxidase subunit I gene in sarcosaphagous flies from 14 provinces in China].

Science.gov (United States)

Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong

2010-08-01

To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and

Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

Science.gov (United States)

Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

2013-02-01

Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

user

2011-01-31

Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.

Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

Science.gov (United States)

Gudkova, O O; Latyshko, N V; Shandrenko, S G

2016-01-01

In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

Directory of Open Access Journals (Sweden)

Patti Hayes

2015-09-01

Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.

2004-01-01

The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol

Comparative investigations of sodium arsenite, arsenic trioxide and cadmium sulphate in combination with gamma-radiation on apoptosis, micronuclei induction and DNA damage in a human lymphoblastoid cell line

International Nuclear Information System (INIS)

Hornhardt, Sabine; Gomolka, Maria; Walsh, Linda; Jung, Thomas

2006-01-01

In the field of radiation protection the combined exposure to radiation and other toxic agents is recognised as an important research area. To elucidate the basic mechanisms of simultaneous exposure, the interaction of the carcinogens and environmental toxicants cadmium and two arsenic compounds, arsenite and arsenic trioxide, in combination with gamma-radiation in human lymphoblastoid cells (TK6) were investigated. Gamma-radiation induced significant genotoxic effects such as micronuclei formation, DNA damage and apoptosis, whereas arsenic and cadmium had no significant effect on these indicators of cellular damage at non-toxic concentrations. However, in combination with gamma-radiation arsenic trioxide induced a more than additive apoptotic rate compared to the sum of the single effects. Here, the level of apoptotic cells was increased, in a dose-dependent way, up to two-fold compared to the irradiated control cells. Arsenite did not induce a significant additive effect at any of the concentrations or radiation doses tested. On the other hand, arsenic trioxide was less effective than arsenite in the induction of DNA protein cross-links. These data indicate that the two arsenic compounds interact through different pathways in the cell. Cadmium sulphate, like arsenite, had no significant effect on apoptosis in combination with gamma-radiation at low concentrations and, at high concentrations, even reduced the radiation-induced apoptosis. An additive effect on micronuclei induction was observed with 1 μM cadmium sulphate with an increase of up to 80% compared to the irradiated control cells. Toxic concentrations of cadmium and arsenic trioxide seemed to reduce micronuclei induction. The results presented here indicate that relatively low concentrations of arsenic and cadmium, close to those occurring in nature, may interfere with radiation effects. Differences in action of the two arsenic compounds were identified

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

Science.gov (United States)

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-03-17

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

Science.gov (United States)

Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

2017-06-05

Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

International Nuclear Information System (INIS)

Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette

2010-01-01

Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.

Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

Directory of Open Access Journals (Sweden)

Man K. Xu

2017-10-01

Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

Science.gov (United States)

Löw, Hans; Crane, Frederick L; Morré, D James

2012-11-01

The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

Science.gov (United States)

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

Monoamine Oxidase Inhibitors (MAOIs)

Science.gov (United States)

... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

Science.gov (United States)

Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

2016-12-01

Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

Science.gov (United States)

Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

2003-12-01

Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

Science.gov (United States)

Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

2013-07-01

Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

Optimization of glucose oxidase production by Aspergillus niger

African Journals Online (AJOL)

user

2011-02-28

Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase

NARCIS (Netherlands)

Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.

2015-01-01

Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which

Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

Science.gov (United States)

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

2013-11-01

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

Science.gov (United States)

Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

2015-03-28

Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

Probing cytokinin homeostasis in Arabidopsis thaliana by constitutively overexpressing two forms of the maize cytokinin oxidase/dehydrogenase 1 gene

Czech Academy of Sciences Publication Activity Database

Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.

2006-01-01

Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006

Serum diamine oxidase activity in patients with histamine intolerance.

Science.gov (United States)

Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E

2016-03-01

Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.

Identification and characterization of an antennae-specific aldehyde oxidase from the navel orangeworm.

Directory of Open Access Journals (Sweden)

Young-Moo Choo

Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.

Structure and activity of Aspergillus nidulans copper amine oxidase

DEFF Research Database (Denmark)

McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A

2011-01-01

Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

OpenAIRE

Legge, M; Duff, G B

1981-01-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...

Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity

International Nuclear Information System (INIS)

Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.

2004-01-01

Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational

Oxidases as Breast Cancer Oncogens

National Research Council Canada - National Science Library

Yeldandi, Anjana

2000-01-01

...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

Science.gov (United States)

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

Science.gov (United States)

Legge, M; Duff, G B

1981-02-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

Microbial arsenic metabolism: New twists on an old poison

Science.gov (United States)

Stolz, J.F.; Basu, P.; Oremland, R.S.

2010-01-01

Phylogenetically diverse microorganisms metabolize arsenic despite its toxicity and are part of its robust iogeochemical cycle. Respiratory arsenate reductase is a reversible enzyme, functioning in some microbes as an arsenate reductase but in others as an arsenite oxidase. As(III) can serve as an electron donor for anoxygenic photolithoautotrophy and chemolithoautotrophy. Organoarsenicals, such as the feed additive roxarsone, can be used as a source of energy, releasing inorganic arsenic.

Kaempferol modulates pro-inflammatory NF-κB activation by suppressing advanced glycation endproducts-induced NADPH oxidase

Science.gov (United States)

Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal

2010-01-01

Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987

Abiotic and biotic factors responsible for antimonite oxidation in Agrobacterium tumefaciens GW4

Science.gov (United States)

Li, Jingxin; Yang, Birong; Shi, Manman; Yuan, Kai; Guo, Wei; Wang, Qian; Wang, Gejiao

2017-03-01

Antimonite [Sb(III)]-oxidizing bacteria can transform the toxic Sb(III) into the less toxic antimonate [Sb(V)]. Recently, the cytoplasmic Sb(III)-oxidase AnoA and the periplasmic arsenite [As(III)] oxidase AioAB were shown to responsible for bacterial Sb(III) oxidation, however, disruption of each gene only partially decreased Sb(III) oxidation efficiency. This study showed that in Agrobacterium tumefaciens GW4, Sb(III) induced cellular H2O2 content and H2O2 degradation gene katA. Gene knock-out/complementation of katA, anoA, aioA and anoA/aioA and Sb(III) oxidation and growth experiments showed that katA, anoA and aioA were essential for Sb(III) oxidation and resistance and katA was also essential for H2O2 resistance. Furthermore, linear correlations were observed between cellular H2O2 and Sb(V) content in vivo and chemical H2O2 and Sb(V) content in vitro (R2 = 0.93 and 0.94, respectively). These results indicate that besides the biotic factors, the cellular H2O2 induced by Sb(III) also catalyzes bacterial Sb(III) oxidation as an abiotic oxidant. The data reveal a novel mechanism that bacterial Sb(III) oxidation is associated with abiotic (cellular H2O2) and biotic (AnoA and AioAB) factors and Sb(III) oxidation process consumes cellular H2O2 which contributes to microbial detoxification of both Sb(III) and cellular H2O2.

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

Science.gov (United States)

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

Ameliorative Effects of Acacia Honey against Sodium Arsenite-Induced Oxidative Stress in Some Viscera of Male Wistar Albino Rats

OpenAIRE

Muhammad Aliyu; Sani Ibrahim; Hajiya M. Inuwa; Abdullahi B. Sallau; Olagunju Abbas; Idowu A. Aimola; Nathan Habila; Ndidi S. Uche

2013-01-01

Cancer is a leading cause of death worldwide and its development is frequently associated with oxidative stress-induced by carcinogens such as arsenicals. Most foods are basically health-promoting or disease-preventing and a typical example of such type is honey. This study was undertaken to investigate the ameliorative effects of Acacia honey on sodium arsenite-induced oxidative stress in the heart, lung and kidney tissues of male Wistar rats. Male Wistar albino rats divided into four groups...

Pyridox(am)ine-5-Phosphate Oxidase Deficiency Treatable Cause of Neonatal Epileptic Encephalopathy With Burst Suppression: Case Report and Review of the Literature.

Science.gov (United States)

Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet

2015-08-01

Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.

Chronic low-level arsenite exposure through drinking water increases blood pressure and promotes concentric left ventricular hypertrophy in female mice.

Science.gov (United States)

Sanchez-Soria, Pablo; Broka, Derrick; Monks, Sarah L; Camenisch, Todd D

2012-04-01

Cardiovascular disease is the leading cause of death in the United States and worldwide. High incidence of cardiovascular diseases has been linked to populations with elevated arsenic content in their drinking water. Although this correlation has been established in many epidemiological studies, a lack of experimental models to study mechanisms of arsenic-related cardiovascular pathogenesis has limited our understanding of how arsenic exposure predisposes for development of hypertension and increased cardiovascular mortality. Our studies show that mice chronically exposed to drinking water containing 100 parts per billion (ppb) sodium arsenite for 22 weeks show an increase in both systolic and diastolic blood pressure. Echocardiographic analyses as well as histological assessment show concentric left ventricular hypertrophy, a primary cardiac manifestation of chronic hypertension. Live imaging by echocardiography shows a 43% increase in left ventricular mass in arsenic-treated animals. Relative wall thickness (RWT) was calculated showing that all the arsenic-exposed animals show an RWT greater than 0.45, indicating concentric hypertrophy. Importantly, left ventricular hypertrophy, although often associated with chronic hypertension, is an independent risk factor for cardiovascular-related mortalities. These results suggest that chronic low-level arsenite exposure promotes the development of hypertension and the comorbidity of concentric hypertrophy.

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...

Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

Institute of Scientific and Technical Information of China (English)

Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou

2006-01-01

BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

Catalytic aspects of a copper(II) complex: biological oxidase to ...

Indian Academy of Sciences (India)

BISWAJIT CHOWDHURY

2017-10-03

Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.

Platelet monoamine oxidase: specific activity and turnover number in headache

International Nuclear Information System (INIS)

Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.

1982-01-01

Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)

The Arabidopsis aldehyde oxidase 3 (AA03) gene product catalyzes the final step in abscisic acid biosynthesis in leaves

NARCIS (Netherlands)

Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.

2000-01-01

Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde

Increase in activity, glycosylation and expression of cytokinin oxidase/dehydrogenase during the senescence of barley leaf segments in the dark

Czech Academy of Sciences Publication Activity Database

Conrad, K.; Motyka, Václav; Schlüter, T.

2007-01-01

Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007

Immobilization of xanthine oxidase on a polyaniline silicone support.

Science.gov (United States)

Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

1996-03-01

A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

COMPARATIVE TISSUE DISTRIBUTION AND URINARY EXCRETION OF INORGANIC ARSENIC (IAS) AND ITS METHYLATED METABOLITES IN MICE FOLLOWING ORAL ADMINISTRATION OF ARSENATE (ASV) AND ARSENITE (ASIII)

Science.gov (United States)

COMPARATIVE TISSUE DISTRIBUTION AND URINARY EXCRETION OF INORGANIC ARSENIC (iAs) AND ITS METHYLATED METABOLITES IN MICE FOLLOWING ORAL ADMINISTRATION OF ARSENATE (AsV) AND ARSENITE (AsIII). E M Kenyon, L M Del Razo and M F Hughes. U.S. EPA, ORD, NHEERL, ETD, PKB, RTP, NC, USA; ...

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

Science.gov (United States)

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Xanthine oxidase in human skeletal muscle following eccentric exercise

DEFF Research Database (Denmark)

Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.

1997-01-01

the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...

Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-11-02

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-01-01

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

NARCIS (Netherlands)

Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.

2012-01-01

BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The

Arsenic Transformation in Swine Wastewater with Low-Arsenic Content during Anaerobic Digestion

Directory of Open Access Journals (Sweden)

Weiwei Zhai

2017-10-01

Full Text Available In this study, the raw wastewater (RW, and effluents from the acidogenic phase (AP and methanogenic phase (MP in a swine wastewater treatment plant were collected to investigate the occurrence and transformation of arsenic (As, as well as the abundance of As metabolism genes during the anaerobic digestion (AD process. The results showed that total concentrations of As generally decreased by 33–71% after AD. Further analysis showed that the As species of the dissolved fractions were present mainly as dimethylarsinic acid (DMA, with arsenite (As(III and arsenate (As(V as the minor species. Moreover, real-time PCR (qPCR results showed that As metabolism genes (arsC, arsenate reduction gene; aioA, arsenite oxidation gene and arsM, arsenite methylation gene were highly abundant, with arsM being predominant among the metabolism genes. This study provides reliable evidence on As biotransformation in swine wastewater treatment process, suggesting that AD could be a valuable treatment to mitigate the risk of As in wastewater.

Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

Directory of Open Access Journals (Sweden)

Xiaohui eLi

2015-06-01

Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger

NARCIS (Netherlands)

Veenhuis, Marten; Dijken, Johannes Pieter van

1980-01-01

The subcellular localization of glucose oxidase (E.C. 1.1.3.4) in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both

Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

Directory of Open Access Journals (Sweden)

G.H.M. eSagor

2016-02-01

Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A2

International Nuclear Information System (INIS)

Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.

1986-01-01

Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

Science.gov (United States)

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

Science.gov (United States)

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Directory of Open Access Journals (Sweden)

Koji Sode

2012-11-01

Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Isolation of a candidate gene for Norrie disease by positional cloning

NARCIS (Netherlands)

Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.

1992-01-01

The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the

Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase.

Science.gov (United States)

Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao

2018-01-01

This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.

Production of rabbit antibodies against purified Glucose oxidase

OpenAIRE

Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur

2012-01-01

Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...

The use of galactose oxidase in lipid labeling

International Nuclear Information System (INIS)

Radin, N.S.; Evangelatos, G.P.

1981-01-01

Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate

Investigation of sodium arsenite, thioacetamide, and diethanolamine in the alkaline comet assay: Part of the JaCVAM comet validation exercise.

Science.gov (United States)

Beevers, Carol; Henderson, Debbie; Lillford, Lucinda

2015-07-01

As part of the Japanese Center for the Validation of Alternative Methods (JaCVAM)-initiative international validation study of the in vivo rat alkaline comet assay (comet assay), we examined sodium arsenite, thioacetamide, and diethanolamine. Using the JaCVAM approved study protocol version 14.2, each chemical was tested in male rats up to maximum tolerated dose levels and DNA damage in the liver and stomach was assessed approximately 3h after the final administration by gavage. Histopathology assessments of liver and stomach sections from the same animals were also examined for evidence of cytotoxicity or necrosis. No evidence of DNA damage was observed in the stomach of animals treated with sodium arsenite at 7.5, 15, or 30 mg/kg/day. However, equivocal findings were found in the liver, where increases in DNA migration were observed in two independent experiments, but not in all treated animals and not at the same dose levels. Thioacetamide caused an increase in DNA migration in the stomach of rats treated at 19, 38, and 75 mg/kg/day, but not in the liver, despite evidence of marked hepatotoxicity following histopathology assessments. No evidence of DNA damage was observed in the stomach or liver of animals treated with diethanolamine at 175, 350, or 700 mg/kg/day. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

Science.gov (United States)

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

Science.gov (United States)

Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

2018-01-01

Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

Science.gov (United States)

Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

2006-06-01

The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase

Directory of Open Access Journals (Sweden)

Simon Burgener

2017-12-01

Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.

The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.

Science.gov (United States)

Elmer, Lawrence W; Bertoni, John M

2008-11-01

The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.

Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.

Science.gov (United States)

Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A

2001-07-01

Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).

Role of glutathione in tolerance to arsenite in Salvinia molesta, an aquatic fern

Directory of Open Access Journals (Sweden)

Adinan Alves da Silva

2017-09-01

Full Text Available ABSTRACT In many plant species, tolerance to toxic metals is highly dependent on glutathione, an essential metabolite for cellular detoxification. We evaluated the responses of glutathione metabolism to arsenite (AsIII in Salvinia molesta, an aquatic fern that has unexplored phytoremediation potential. Plants were exposed to different AsIII concentrations in nutrient solution for 24 h. AsIII caused cell membrane damage to submerged leaves, indicating oxidative stress. There was an increase in the glutathione content and ϒ-glutamylcysteine synthetase enzyme activity in the submerged and floating leaves. The glutathione peroxidase and glutathione sulfotransferase enzymes also showed increased activity in both plant parts, whereas glutathione reductase only showed increased activity in the submerged leaves. These findings suggest an important role for glutathione in the protection of S. molesta against the toxic effects of AsIII, with more effective tolerance responses in the floating leaves.

Lysyl oxidase in cancer research

DEFF Research Database (Denmark)

Perryman, Lara; Erler, Janine Terra

2014-01-01

Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...

Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase.

Science.gov (United States)

White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H

2009-04-01

The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.

Contribution of the NADH-oxidase (Nox) to the aerobic life of Lactobacillus sanfranciscensis DSM20451T.

Science.gov (United States)

Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F

2011-02-01

Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.

Mural granulosa cell gene expression associated with oocyte developmental competence

Directory of Open Access Journals (Sweden)

Jiang Jin-Yi

2010-03-01

Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

The role of brassinosteroids in the regulation of the plasma membrane H+-ATPase and NADPH oxidase under cadmium stress.

Science.gov (United States)

Jakubowska, Dagmara; Janicka, Małgorzata

2017-11-01

The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC 3.6.3.14) and NADPH oxidase (EC 1.6.3.1). Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.

Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity

Energy Technology Data Exchange (ETDEWEB)

Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)

2014-05-15

Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.

A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency.

Science.gov (United States)

Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia

2008-02-01

We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.

Genomic responses to arsenic in the cyanobacterium Synechocystis sp. PCC 6803.

Directory of Open Access Journals (Sweden)

Ana María Sánchez-Riego

Full Text Available Arsenic is a ubiquitous contaminant and a toxic metalloid which presents two main redox states in nature: arsenite [As(III] and arsenate [As(V]. Arsenic resistance in Synechocystis sp. strain PCC 6803 is mediated by the arsBHC operon and two additional arsenate reductases encoded by the arsI1 and arsI2 genes. Here we describe the genome-wide responses to the presence of arsenate and arsenite in wild type and mutants in the arsenic resistance system. Both forms of arsenic produced similar responses in the wild type strain, including induction of several stress related genes and repression of energy generation processes. These responses were transient in the wild type strain but maintained in time in an arsB mutant strain, which lacks the arsenite transporter. In contrast, the responses observed in a strain lacking all arsenate reductases were somewhat different and included lower induction of genes involved in metal homeostasis and Fe-S cluster biogenesis, suggesting that these two processes are targeted by arsenite in the wild type strain. Finally, analysis of the arsR mutant strain revealed that ArsR seems to only control 5 genes in the genome. Furthermore, the arsR mutant strain exhibited hypersentivity to nickel, copper and cadmium and this phenotype was suppressed by mutation in arsB but not in arsC gene suggesting that overexpression of arsB is detrimental in the presence of these metals in the media.

The contribution of microbial mats to the arsenic geochemistry of an ancient gold mine

International Nuclear Information System (INIS)

Drewniak, Lukasz; Maryan, Natalia; Lewandowski, Wiktor; Kaczanowski, Szymon; Sklodowska, Aleksandra

2012-01-01

The ancient Zloty Stok (SW Poland) gold mine is such an environment, where different microbial communities, able to utilize inorganic arsenic species As(III) and As(V), are found. The purpose of the present study was to (i) estimate prokaryotic diversity in the microbial mats in bottom sediments of this gold mine, (ii) identify microorganisms that can metabolize arsenic, and (iii) estimate their potential role in the arsenic geochemistry of the mine and in the environment. The oxidation/reduction experiments showed that the microbial mat community may significantly contribute to arsenic contamination in groundwater. The presence of both arsenite oxidizing and dissimilatory arsenate reducing bacteria in the mat was confirmed by the detection of arsenite oxidase and dissimilatory arsenate reductase genes, respectively. This work also demonstrated that microorganisms utilizing other compounds that naturally co-occur with arsenic are present within the microbial mat community and may contribute to the arsenic geochemistry in the environment. - Highlights: ► The microbial mats from this ancient gold mine are highly diverse community. ► As(III) oxidizing and As(V) reducing bacteria are present in the mats. ► As redox transformations are linked to the metabolism of microbial mats bacteria. ► Microbial mats play a crucial role in the As biogeochemical cycle within the mine. - The microbial mats from this ancient gold mine can mediate oxidation/reduction reaction of arsenic and in this way may significantly contribute to arsenic contamination in groundwater.

[Experimental rationale for the parameters of a rapid method for oxidase activity determination].

Science.gov (United States)

Butorina, N N

2010-01-01

Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase.

Science.gov (United States)

Lehninger, A L; Reynafarje, B; Costa, L

1985-01-01

The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.

Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis

Directory of Open Access Journals (Sweden)

Richard Dela Cruz

2016-06-01

Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.

Vanillyl-alcohol oxidase, a tasteful biocatalyst

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.

2001-01-01

The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl

Tocopherol and selenite modulate the transplacental effects induced by sodium arsenite in hamsters.

Science.gov (United States)

Sampayo-Reyes, Adriana; Taméz-Guerra, Reyes S; Bermúdez de León, Mario; Vargas-Villarreal, Javier; Lozano-Garza, Héctor Gerardo; Rodríguez-Padilla, Cristina; Cortés, Constanza; Marcos, Ricard; Hernández, Alba

2017-12-01

Human studies suggest that in utero exposure to arsenic results in adverse pregnancy outcomes. The use of dietary supplements, such as sodium selenite (SS) or α-tocopherol succinate (α-TOS), is a reasonable approach to ameliorate such health effects. Sodium arsenite at 100ppm was administered via drinking water to female hamsters from gestational days 1 or 8 to the time of delivery. Viable fetuses, fetal resorptions and non-viable fetuses were recorded during and after pregnancy and total arsenic and its metabolites were characterized in pregnant animals, placentas and fetuses. Arsenic was found to accumulate in the placenta and fetus, increasing fetal mortality, non-viable fetuses and resorptions. Co-administration of SS and α-TOS significantly reduced the observed teratogenic effects. SS influenced arsenic biotransformation by reducing the MMA/InAs index and increasing the DMA/MMA, whereas α-TOS more likely exerts its protective effect through its potent antioxidant activity. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines

Directory of Open Access Journals (Sweden)

Diallo Amadou

2008-08-01

Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells

Directory of Open Access Journals (Sweden)

Peiying Yu

2014-01-01

Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.

Cytochemical localization of catalase and several hydrogen peroxide-producing oxidases in the nucleoids and matrix of rat liver peroxisomes

NARCIS (Netherlands)

Veenhuis, M.; Wendelaar Bonga, S.E.

1979-01-01

The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based

Lysyl Oxidase and the Tumor Microenvironment

Directory of Open Access Journals (Sweden)

Tong-Hong Wang

2016-12-01

Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.

Overexpression of a water-forming NADH oxidase improves the metabolism and stress tolerance of Saccharmyces cerevisiae in aerobic fermenation

Directory of Open Access Journals (Sweden)

Xinchi Shi

2016-09-01

Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved

Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

Science.gov (United States)

Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

1997-03-25

1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

SORPTION OF ARSENATE AND ARSENITE ON RUO2 X H2O: ANALYSIS OF SORBED PHASE OXIDATION STATE BY XANES IN ADVANCED PHOTON SOURCE ACTIVITY REPORT 2002

Science.gov (United States)

The sorption reactions of arsenate (As(V)) and arsenite (As(III)) on RuO2 x H2O were examined by X-ray Absorption Near Edge Spectroscopy (XANES) to elucidate the solid state speciation of sorbed As. At all pH values studied (pH 4-8), RuO2 x H

Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask

OpenAIRE

Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ

2012-01-01

The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...

A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

Science.gov (United States)

Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

2007-04-01

Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

Science.gov (United States)

Vlahos, Ross; Selemidis, Stavros

2014-12-01

Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties

NARCIS (Netherlands)

Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk

2011-01-01

Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two

Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass)

OpenAIRE

Jonathan M. LaMantia; Ambika Chandra; David R. Huff

2018-01-01

Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...

Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

Science.gov (United States)

Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

2015-01-01

Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

Science.gov (United States)

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

Science.gov (United States)

Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats

Directory of Open Access Journals (Sweden)

José Luis Miguel-Carrasco

2012-01-01

Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.

Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.

Science.gov (United States)

Brattsten, L B; Wilkinson, C F; Eisner, T

1977-06-17

The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.

Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging.

Science.gov (United States)

Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R

2014-11-24

Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

A positive feedback-based gene circuit to increase the production of a membrane protein

Directory of Open Access Journals (Sweden)

Gennis Robert B

2010-05-01

Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.

Evaluation of the Expression of Amine Oxidase Proteins in Breast Cancer

Directory of Open Access Journals (Sweden)

Woo Young Sun

2017-12-01

Full Text Available We aimed to evaluate the expression of amine oxidase proteins in breast cancer and their clinical implications. We performed immunohistochemical staining of amine oxidase proteins (LOX, lysyl oxidase, AOC3, amine oxidase, MAOA, monoamine oxidase A, MAOB, monoamine oxidase B. Based on their hormone receptors, such as estrogen receptor (ER and progesterone receptor (PR, human epidermal growth factor receptor 2 (HER-2, and Ki-67 immunohistochemical staining, breast cancer was divided into four molecular subtypes: luminal A, luminal B, HER-2 type, and triple-negative breast cancer (TNBC. Luminal A was observed in 380 cases (49.4%, luminal B in 224 (29.1%, HER-2 type in 68 (8.8%, and TNBC in 98 (12.7%. Stromal AOC3, MAO-A, and MAO-B expression varied according to molecular subtypes. Stromal AOC3 expression was high in luminal B and HER-2 type and MAO-A expression was high in luminal A and luminal B (p < 0.001. MAO-B expression was higher in TNBC than in other subtypes (p = 0.020. LOX positivity was associated with high histological grade (p < 0.001 and high Ki-67 labeling index (LI (p = 0.009, and stromal AOC3 positivity was associated with high histological grade (p = 0.001, high Ki-67 LI (p < 0.001, and HER-2 positivity (p = 0.002. MAO-A positivity was related to low histological grade (p < 0.001, ER positivity, PR positivity (p < 0.001, and low Ki-67 LI (p < 0.001. In univariate analysis, MAO-A positivity was related to short disease-free survival in HER-2 type (p = 0.013, AOC3 negativity was related to short disease-free survival and overall survival in ER-positive breast cancer, PR-positive breast cancer, HER-2-negative breast cancer, and lymph node metastasis. In conclusion, the expression of amine oxidase proteins varies depending on the molecular subtype of breast cancer. Stromal AOC3 expression was high in luminal B and HER-2 type, and MAO-A expression was high in luminal A and luminal B.

Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

Science.gov (United States)

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

2013-01-01

A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

Science.gov (United States)

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

2013-01-01

A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.

Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.

Science.gov (United States)

Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L

2012-08-01

Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (Ppenis. Apocynin treatment of sickle mice reversed (P0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.

Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

DEFF Research Database (Denmark)

Brøndsted, Lone; Atlung, Tove

1996-01-01

The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

Monoamine oxidase and agitation in psychiatric patients.

Science.gov (United States)

Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

2016-08-01

Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.

Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

International Nuclear Information System (INIS)

Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W.

2007-01-01

High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an α-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10 4 U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions

Characterization of ent-kaurene synthase and kaurene oxidase involved in gibberellin biosynthesis from Scoparia dulcis.

Science.gov (United States)

Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum

2018-03-01

Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.

Multi-Copper Oxidases and Human Iron Metabolism

Science.gov (United States)

Vashchenko, Ganna; MacGillivray, Ross T. A.

2013-01-01

Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

Cataplexy and monoamine oxidase deficiency in Norrie disease.

Science.gov (United States)

Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W

1996-05-01

Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy.

Engineering glucose oxidase to minimize the influence of oxygen on sensor response

International Nuclear Information System (INIS)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2014-01-01

Glucose oxidase (GOx) is an important industrial enzyme and is recognized as the gold standard for monitoring blood glucose. However, due to its inherent oxidase property, the presence of oxygen affects electrochemical measurements of venous blood glucose employing artificial electron mediators. We therefore attempted to engineer Penicillium amagasakiense-derived GOx into a dehydrogenase by focusing on the amino acid residues predicted to interact with oxygen. Our rational amino acid substitution approach resulted in the construction of the Ser114Ala/Phe355Leu mutant, which has an 11-fold decrease in oxidase activity and 2.8-fold increase in dehydrogenase activity compared with wild-type GOx. As a result, the dehydrogenase/oxidase activity ratio of the engineered enzyme was 32-fold greater than that of the wild-type enzyme. The enzyme sensor constructed with Ser114Ala/Phe355Leu was considerably less affected by oxygen than the wild-type GOx-based sensor at lower glucose concentrations

Radio-isotopic determination of platelet monoamine oxidase and regulation of its activity by an indigenous drug

International Nuclear Information System (INIS)

Dubey, G.P.; Srivastava, V.K.; Agrawal, A.; Udupa, K.N.

1988-01-01

Platelet monoamine oxidase is a mitochondrial enzyme taking part in the deamination reaction of total catecholamine. Recent studies of monoamine oxidase inhibitors have gained its importance in the control of variety of psychosomatic disorders like mental depression, arterial hypertension and anxiety neurosis. 30 apparently normal individuals and 42 diagnosed cases of essential hypertension were selected for the present study. The platelet monoamine oxidase activity was measured by using 14 C-tryptamine bisuccinate. Comparatively low activity of platelet monoamine oxidase was noticed in hypertension cases than in the normal. After oral administration of an indigenous drug 'Geriforte' for three months, a significant rise in platelet monoamine oxidase activity was noticed in hypertension cases. It can be concluded that this indigenous formulation has the capacity to regulate the monoamine oxidase activity, as such, it may provide an alternative remedy in the management of psychosomatic disorders. (author). 11 refs

Development of a hybrid paclitaxel-loaded arsenite nanoparticle (HPAN) delivery system for synergistic combined therapy of paclitaxel-resistant cancer

Energy Technology Data Exchange (ETDEWEB)

Chen, Fei-yan; Zhang, Yu [Nanchang University, College of Chemistry (China); Chen, Xiang-yu [Xiangya No.2 Hospital of Central South University, Department of Radiology (China); Li, Jia-qian; Xiao, Xiao-ping; Yu, Lu-lu; Tang, Qun, E-mail: tangqun@ncu.edu.cn [Nanchang University, Institute for Advanced Study (China)

2017-04-15

Multidrug resistance (MDR) is a major reason for failure of chemotherapy in a variety of human tumors. For instance, paclitaxel (PTX) has been widely used as a first-line anticancer drug, but resistance to PTX is becoming increasingly serious. Herein, we propose a strategy of combined therapy to overcome MDR of PTX by introducing a hybrid paclitaxel-loaded gadolinium arsenite nanoparticle (HPAN), where PTX was conjugated with rod-shaped gadolinium arsenite (GdAsO{sub x}) nanoparticle (NP). Triggered by endogenous inorganic phosphate (Pi), the hybrid nanoparticles readily collapse, thereby releasing PTX and arsenic trioxide (ATO). An MTT assay indicated IC50 values for HPAN one order of magnitude lower than for a simple equivalent mixture of PTX and ATO against PTX-resistant human colon cancer cells (HCT 166), indicating remarkable synergistic effect. Species type-dependent cellular uptake, induced apoptosis, and cell cycle modulation were also evaluated. Cellular uptake tests indicate that the HPAN presents higher PTX intracellular loading for the PTX-resistant cells and longer intracellular retention time, displaying resistance to drug efflux from the cancer cell than pristine PTX or the equivalent mixture of PTX and ATO. Cell cycle and apoptosis tests consistently proved that addition of HPAN resulted in higher G2/M and apoptosis in PTX-resistant cells. In vivo anticancer experiments evidenced that HPAN had better therapeutic effect on the resistant tumor in the murine xenograft model than pristine PTX or a mixture of PTX and ATO. Our results suggest that HPAN might enhance the therapeutic index and overcome PTX resistance and also demonstrate that the combined therapy is not only related to the species of combined agents but also their physiochemical states.

The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

Science.gov (United States)

Wongnate, Thanyaporn; Chaiyen, Pimchai

2013-07-01

Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

Direct comparison of gluco-oligosaccharide oxidase variants and glucose oxidase: substrate range and H2O2 stability.

Science.gov (United States)

Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R

2016-11-21

Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.

Size-selective QD@MOF core-shell nanocomposites for the highly sensitive monitoring of oxidase activities.

Science.gov (United States)

Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan

2017-01-15

In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.

The antioxidant properties, cytotoxicity and monoamine oxidase ...

African Journals Online (AJOL)

ajl yemi

2011-11-28

Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.

Single-cell analysis by ICP-MS/MS as a fast tool for cellular bioavailability studies of arsenite.

Science.gov (United States)

Meyer, S; López-Serrano, A; Mitze, H; Jakubowski, N; Schwerdtle, T

2018-01-24

Single-cell inductively coupled plasma mass spectrometry (SC-ICP-MS) has become a powerful and fast tool to evaluate the elemental composition at a single-cell level. In this study, the cellular bioavailability of arsenite (incubation of 25 and 50 μM for 0-48 h) has been successfully assessed by SC-ICP-MS/MS for the first time directly after re-suspending the cells in water. This procedure avoids the normally arising cell membrane permeabilization caused by cell fixation methods (e.g. methanol fixation). The reliability and feasibility of this SC-ICP-MS/MS approach with a limit of detection of 0.35 fg per cell was validated by conventional bulk ICP-MS/MS analysis after cell digestion and parallel measurement of sulfur and phosphorus.

Investigation of antihemolytic, xanthine oxidase inhibition ...

African Journals Online (AJOL)

Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...

Biphenyl Modulates the Expression and Function of Respiratory Oxidases in the Polychlorinated-Biphenyls Degrader Pseudomonas pseudoalcaligenes KF707

Directory of Open Access Journals (Sweden)

Federica Sandri

2017-06-01

Full Text Available Pseudomonas pseudoalcaligenes KF707 is a soil bacterium which is known for its capacity to aerobically degrade harmful organic compounds such as polychlorinated biphenyls (PCBs using biphenyl as co-metabolite. Here we provide the first genetic and functional analysis of the KF707 respiratory terminal oxidases in cells grown with two different carbon sources: glucose and biphenyl. We identified five terminal oxidases in KF707: two c(caa3 type oxidases (Caa3 and Ccaa3, two cbb3 type oxidases (Cbb31 and Cbb32, and one bd type cyanide-insensitive quinol oxidase (CIO. While the activity and expression of both Cbb31 and Cbb32 oxidases was prevalent in glucose grown cells as compared to the other oxidases, the activity and expression of the Caa3 oxidase increased considerably only when biphenyl was used as carbon source in contrast to the Cbb32 oxidase which was repressed. Further, the respiratory activity and expression of CIO was up-regulated in a Cbb31 deletion strain as compared to W.T. whereas the CIO up-regulation was not present in Cbb32 and C(caa3 deletion mutants. These results, together, reveal that both function and expression of cbb3 and caa3 type oxidases in KF707 are modulated by biphenyl which is the co-metabolite needed for the activation of the PCBs-degradation pathway.

Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.

Science.gov (United States)

Thrower, J S; Blalock, R; Klinman, J P

2001-08-14

1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

Science.gov (United States)

Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

Intracellular lysyl oxidase: Effect of a specific inhibitor on nuclear mass in proliferating cells

Energy Technology Data Exchange (ETDEWEB)

Saad, Fawzy A. [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Torres, Marie [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Wang, Hao [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Graham, Lila, E-mail: lilagraham@cs.com [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States)

2010-06-11

LOX, the principal enzyme involved in crosslinking of collagen, was the first of several lysyl oxidase isotypes to be characterized. Its active form was believed to be exclusively extracellular. Active LOX was later reported to be present in cell nuclei; its function there is unknown. LOX expression opposes the effect of mutationally activated Ras, which is present in about 30% of human cancers. The mechanism of LOX in countering the action of Ras is also unknown. In the present work, assessment of nuclear protein for possible effects of lysyl oxidase activity led to the discovery that proliferating cells dramatically increase their nuclear protein content when exposed to BAPN ({beta}-aminopropionitrile), a highly specific lysyl oxidase inhibitor that reportedly blocks LOX inhibition of Ras-induced oocyte maturation. In three cell types (PC12 cells, A7r5 smooth muscle cells, and NIH 3T3 fibroblasts), BAPN caused a 1.8-, 1.7-, and 2.1-fold increase in total nuclear protein per cell, respectively, affecting all major components in both nuclear matrix and chromatin fractions. Since nuclear size is correlated with proliferative status, enzyme activity restricting nuclear growth may be involved in the lysyl oxidase tumor suppressive effect. Evidence is also presented for the presence of apparent lysyl oxidase isotype(s) containing a highly conserved LOX active site sequence in the nuclei of PC12 cells, which do not manufacture extracellular lysyl oxidase substrates. Results reported here support the hypothesis that nuclear lysyl oxidase regulates nuclear growth, and thereby modulates cell proliferation.

Exposures to arsenite and methylarsonite produce insulin resistance and impair insulin-dependent glycogen metabolism in hepatocytes.

Science.gov (United States)

Zhang, Chongben; Fennel, Emily M J; Douillet, Christelle; Stýblo, Miroslav

2017-12-01

Environmental exposure to inorganic arsenic (iAs) has been shown to disturb glucose homeostasis, leading to diabetes. Previous laboratory studies have suggested several mechanisms that may underlie the diabetogenic effects of iAs exposure, including (i) inhibition of insulin signaling (leading to insulin resistance) in glucose metabolizing peripheral tissues, (ii) inhibition of insulin secretion by pancreatic β cells, and (iii) dysregulation of the methylation or expression of genes involved in maintenance of glucose or insulin metabolism and function. Published studies have also shown that acute or chronic iAs exposures may result in depletion of hepatic glycogen stores. However, effects of iAs on pathways and mechanisms that regulate glycogen metabolism in the liver have never been studied. The present study examined glycogen metabolism in primary murine hepatocytes exposed in vitro to arsenite (iAs 3+ ) or its methylated metabolite, methylarsonite (MAs 3+ ). The results show that 4-h exposures to iAs 3+ and MAs 3+ at concentrations as low as 0.5 and 0.2 µM, respectively, decreased glycogen content in insulin-stimulated hepatocytes by inhibiting insulin-dependent activation of glycogen synthase (GS) and by inducing activity of glycogen phosphorylase (GP). Further investigation revealed that both iAs 3+ and MAs 3+ inhibit insulin-dependent phosphorylation of protein kinase B/Akt, one of the mechanisms involved in the regulation of GS and GP by insulin. Thus, inhibition of insulin signaling (i.e., insulin resistance) is likely responsible for the dysregulation of glycogen metabolism in hepatocytes exposed to iAs 3+ and MAs 3+ . This study provides novel information about the mechanisms by which iAs exposure impairs glucose homeostasis, pointing to hepatic metabolism of glycogen as one of the targets.

Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

NARCIS (Netherlands)

Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.

2004-01-01

We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42

Increased xanthine oxidase during labour--implications for oxidative stress.

Science.gov (United States)

Many, A; Roberts, J M

1997-11-01

Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.

Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum.

Science.gov (United States)

Gabler, M; Fischer, L

1999-08-01

The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).

Mediation of glycosylated and partially-deglycosylated glucose oxidase of Aspergillus niger by a ferrocene-derivatised detergent.

Science.gov (United States)

Fraser, D M; Zakeeruddin, S M; Grätzel, M

1992-01-30

A ferrocene-derivatised detergent, (11-ferrocenylundecyl) trimethylammonium bromide (FTMAB), when oxidised to the corresponding ferricinium ion, was found by electrochemical studies to be an effective electron acceptor for reduced glucose oxidase of Aspergillus niger (EC 1.13.4) and thus acts as a electron-transfer mediator between glucose oxidase and a working electrode held at a potential sufficiently positive to reoxidise reduced FTMAB. An increase in mediating activity was produced when FTMAB was present in concentrations above its critical micelle concentration. An 'enzyme electrode' was formed by adsorption of glucose oxidase and FTMAB surfactant on a graphite rod. The electrode functioned as an amperometric biosensor for glucose in phosphate-buffered saline solution. A mixed micelle of glucose oxidase and FTMAB, probably adsorbed on the electrode surface, appears to be advantageous for the amperometric determination of glucose. Additionally, glucose oxidase was treated with alpha-mannosidase. When this partially-deglycosylated glucose oxidase was incorporated in an enzyme electrode, a 100-fold increase in the second-order rate constant (k) for electron transfer between the enzyme and FTMAB was observed, together with increased current densities, with respect to the equivalent values for FTMAB and commercial glucose oxidase. The use of deglycosylated enzymes in biosensors is suggested.

Studies on the relationship between cyanide-resistant respi-ration and expression of alternative oxidase in mung bean using antibodies prepared by synthetic polypeptide

Institute of Scientific and Technical Information of China (English)

LI; Chijun; (

2001-01-01

［1］Liang, Z., Liang, H. G., The respiratory metabolism of plants, in Plant Physiology and Molecular Biology (eds. Yu, S. W., Tang, Z. C.) (in Chinese), 2nd ed., Beijing: Science Press, 1998, 344-365.［2］Lü, C. S., Liang, H. G., Induced respiration in melon fruits, Scientia Sinica, 1963, 12(4): 616.［3］Liang, H. G., Lü, C. S., A comparative study of CN-resistant respiration in different cultures of tobacco callus, Plant Physiol., 1984, 75: 876.［4］Elthon, T. E., McIntosh, L., Identification of the alternative terminal oxidase of higher plant mitochondria, Proc. Natl. Acad. Sci. USA, 1987, 84: 8399.［5］Elthon, T. E., Nickels, R. L., McIntosh, L., Monoclonal antibodies to the alternative oxidase of higher plant mitochondria, Plant Physiol., 1989, 89: 1311.［6］Liang, W. S., Liang, H. G., Progress of the alternative oxidase, Chinese Bulletin of Botany (in Chinese), 1997, 14(2): 9.［7］Liang, W. S., Liang, H. G., Induction of alternative oxidase expression by endogenous ethylene in aging potato slices, Acta Phytophysiol. Sin. (in Chinese), 1999, 25(2): 205.［8］He, J. X., Wei, Z. Q., Liang, H. G., Effects of water stress on development, and operation and gene expression of cyanide-resistant respiratory pathway in wheat, Science in China, Ser. C, 1999, 42(3): 300.［9］McIntosh, L., Molecular biology of the alternative oxidase, Plant Physiol., 1994, 105: 781.［10］ Wang, J., Zhang, L. X., Liu, Z. L. et al., A possible calcium binding site in D1 protein: A fluorescence and FTIR study of the interaction between lanthanides and a synthetic peptide, Photosynthesis Research, 1995, 44: 297.［11］ Li, X. P., Du, L. F., Liang, H. G. et al., Preparation and identification of antidodecapeptide of polypeptide D1 or photosys-tem II reaction center, Prog. Biochem. Biophys. (in Chinese), 1997, 24(3): 283.［12］ Wen, J. Q., Liang, H. G., Studies on energy status and mitochondria respiration during growth and senescence of mung bean cotyledons, Physiol

Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen

DEFF Research Database (Denmark)

Farver, O; Wherland, S; Pecht, I

1994-01-01

Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...

Characterization of three multicopper oxidases in the filamentous fungus Podospora anserina: A new role of an ABR1-like protein in fungal development?

Science.gov (United States)

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence

2018-07-01

The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

Energy Technology Data Exchange (ETDEWEB)

Ruvolo, M.; Disotell, T.R.; Allard, M.W. (Harvard Univ., Cambridge, MA (United States)); Brown, W.M. (Univ. of Michigan, Ann Arbor (United States)); Honeycutt, R.L. (Texas A and M Univ., College Station (United States))

1991-02-15

Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

International Nuclear Information System (INIS)

Ruvolo, M.; Disotell, T.R.; Allard, M.W.; Brown, W.M.; Honeycutt, R.L.

1991-01-01

Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time

Antioxidant supplementation upregulates calbindin expression in cerebellar Purkinje cells of rat pups subjected to post natal exposure to sodium arsenite.

Science.gov (United States)

Dhar, Pushpa; Kaushal, Parul; Kumar, Pavan

2018-07-01

Optimal cytoplasmic calcium (Ca 2+ ) levels have been associated with adequate cell functioning and neuronal survival. Altered intracellular Ca 2+ levels following impaired Ca 2+ homeostasis could induce neuronal degeneration or even cell death. There are reports of arsenite induced oxidative stress and the associated disturbances in intracellular calcium homeostasis. The present study focused on determining the strategies that would modulate tissue redox status and calcium binding protein (CaBP) (Calbindin D28k-CB) expression affected adversely by sodium arsenite (NaAsO 2 ) exposure (postnatal) of rat pups. NaAsO 2 alone or along with antioxidants (AOXs) (alpha lipoic acid or curcumin) was administered by intraperitoneal (i.p.) route from postnatal day (PND) 1-21 (covering rapid brain growth period - RBGP) to experimental groups and animals receiving sterile water by the same route served as the controls. At the end of the experimental period, the animals were subjected to euthanasia and the cerebellar tissue obtained therefrom was processed for immunohistochemical localization and western blot analysis of CB protein. CB was diffusely expressed in cell body as well as dendritic processes of Purkinje cells (PCs) along the PC Layer (PCL) in all cerebellar folia of the control and the experimental animals. The multilayered pattern of CB +ve cells along with their downregulated expression and low packing density was significantly evident in the arsenic (iAs) alone exposed group as against the controls and AOX supplemented groups. The observations are suggestive of AOX induced restoration of CaBP expression in rat cerebellum following early postnatal exposure to NaAsO 2 . Copyright © 2018 Elsevier B.V. All rights reserved.

Rational redesign of glucose oxidase for improved catalytic function and stability.

Directory of Open Access Journals (Sweden)

J Todd Holland

Full Text Available Glucose oxidase (GOx is an enzymatic workhorse used in the food and wine industries to combat microbial contamination, to produce wines with lowered alcohol content, as the recognition element in amperometric glucose sensors, and as an anodic catalyst in biofuel cells. It is naturally produced by several species of fungi, and genetic variants are known to differ considerably in both stability and activity. Two of the more widely studied glucose oxidases come from the species Aspergillus niger (A. niger and Penicillium amagasakiense (P. amag., which have both had their respective genes isolated and sequenced. GOx from A. niger is known to be more stable than GOx from P. amag., while GOx from P. amag. has a six-fold superior substrate affinity (K(M and nearly four-fold greater catalytic rate (k(cat. Here we sought to combine genetic elements from these two varieties to produce an enzyme displaying both superior catalytic capacity and stability. A comparison of the genes from the two organisms revealed 17 residues that differ between their active sites and cofactor binding regions. Fifteen of these residues in a parental A. niger GOx were altered to either mirror the corresponding residues in P. amag. GOx, or mutated into all possible amino acids via saturation mutagenesis. Ultimately, four mutants were identified with significantly improved catalytic activity. A single point mutation from threonine to serine at amino acid 132 (mutant T132S, numbering includes leader peptide led to a three-fold improvement in k(cat at the expense of a 3% loss of substrate affinity (increase in apparent K(M for glucose resulting in a specify constant (k(cat/K(M of 23.8 (mM(-1 · s(-1 compared to 8.39 for the parental (A. niger GOx and 170 for the P. amag. GOx. Three other mutant enzymes were also identified that had improvements in overall catalysis: V42Y, and the double mutants T132S/T56V and T132S/V42Y, with specificity constants of 31.5, 32.2, and 31.8 mM(-1 · s

Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase

Directory of Open Access Journals (Sweden)

Fengyu Su

2017-06-01

Full Text Available A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systematically investigated. The selective detection of glucose among other monosaccharides, such as fructose, mannose and galactose indicated that the sensing film has excellent selectivity. The prepared sensor was successfully applied for glucose sample detection of glucose concentration in artificial tears. Keywords: Glucose sensor, Glucose oxidase, Fluorescence, Oxygen film, Diabetes

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

Directory of Open Access Journals (Sweden)

Tamayo-Ramos Juan Antonio

2012-12-01

Full Text Available Abstract Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA and 2,2-azino-di(3-ethylbenzthiazoline sulfonic acid (ABTS, and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.

Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose

International Nuclear Information System (INIS)

Xia, Xiaodong; Long, Yunfei; Wang, Jianxiu

2013-01-01

Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ em max = 650 nm, λ ex max = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O 2 to produce H 2 O 2 , which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10 −6 –140 × 10 −6 M and a detection limit of 0.7 × 10 −6 M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells

Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

Energy Technology Data Exchange (ETDEWEB)

Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China); Wei, Ling [Beijing Center for Physical & Chemical Analysis, Beijing 100089 (China); Liu, Yutong [School of Life Science, Beijing Normal University, Beijing 100875 (China); Liao, Jieying [Department of Translational Medicine, Xiamen Institute of Rare Earth Materials, Chinese Academy of Sciences, Xiamen 361024 (China); Gao, Hui-Ming [Model Animal Research Center of Nanjing University, Nanjing 211800 (China); Zhou, Hui, E-mail: hardhui@gmail.com [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China)

2017-05-01

Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to

Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

International Nuclear Information System (INIS)

Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin; Wei, Ling; Liu, Yutong; Liao, Jieying; Gao, Hui-Ming; Zhou, Hui

2017-01-01

Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm 2 induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm 2 ) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91 phox , p47 phox and p40 phox ); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47 phox and p67 phox translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to oxidative damage to DA neurons. Our

Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi

Science.gov (United States)

Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig