WorldWideScience

Sample records for archaeal rna pseudouridine

  1. Formation of the conserved pseudouridine at position 55 in archaeal tRNA.

    Science.gov (United States)

    Roovers, Martine; Hale, Caryn; Tricot, Catherine; Terns, Michael P; Terns, Rebecca M; Grosjean, Henri; Droogmans, Louis

    2006-01-01

    Pseudouridine (Psi) located at position 55 in tRNA is a nearly universally conserved RNA modification found in all three domains of life. This modification is catalyzed by TruB in bacteria and by Pus4 in eukaryotes, but so far the Psi55 synthase has not been identified in archaea. In this work, we report the ability of two distinct pseudouridine synthases from the hyperthermophilic archaeon Pyrococcus furiosus to specifically modify U55 in tRNA in vitro. These enzymes are (pfu)Cbf5, a protein known to play a role in RNA-guided modification of rRNA, and (pfu)PsuX, a previously uncharacterized enzyme that is not a member of the TruB/Pus4/Cbf5 family of pseudouridine synthases. (pfu)PsuX is hereafter renamed (pfu)Pus10. Both enzymes specifically modify tRNA U55 in vitro but exhibit differences in substrate recognition. In addition, we find that in a heterologous in vivo system, (pfu)Pus10 efficiently complements an Escherichia coli strain deficient in the bacterial Psi55 synthase TruB. These results indicate that it is probable that (pfu)Cbf5 or (pfu)Pus10 (or both) is responsible for the introduction of pseudouridine at U55 in tRNAs in archaea. While we cannot unequivocally assign the function from our results, both possibilities represent unexpected functions of these proteins as discussed herein.

  2. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  3. Transfer RNA pseudouridine synthases in Saccharomyces cerevisiae.

    Science.gov (United States)

    Samuelsson, T; Olsson, M

    1990-05-25

    A transfer RNA lacking modified nucleosides was produced by transcription in vitro of a cloned gene that encodes a Saccharomyces cerevisiae glycine tRNA. At least three different uridines (in nucleotide positions 13, 32, and 55) of this transcript tRNA are modified to pseudouridine by an extract of S. cerevisiae. Variants of the RNA substrate were also constructed that each had only one of these sites, thus allowing specific monitoring of pseudouridylation at different nucleotide positions. Using such RNAs to assay pseudouridine synthesis, enzymes producing this nucleoside were purified from an extract of S. cerevisiae. The activities corresponding to positions 13, 32, and 55 in the tRNA substrate could all be separated chromatographically, indicating that there is a separate enzyme for each of these sites. The enzyme specific for position 55 (denoted pseudouridine synthase 55) was purified approximately 4000-fold using a combination of DEAE-Sepharose, heparin-Sepharose, and hydroxylapatite.

  4. THUMP--a predicted RNA-binding domain shared by 4-thiouridine, pseudouridine synthases and RNA methylases.

    Science.gov (United States)

    Aravind, L; Koonin, E V

    2001-04-01

    Sequence profile searches were used to identify an ancient domain in ThiI-like thiouridine synthases, conserved RNA methylases, archaeal pseudouridine synthases and several uncharacterized proteins. We predict that this domain is an RNA-binding domain that adopts an alpha/beta fold similar to that found in the C-terminal domain of translation initiation factor 3 and ribosomal protein S8.

  5. Structure of a functional ribonucleoprotein pseudouridine synthase bound to a substrate RNA

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Bo; Zhou, Jing; Kahen, Elliot; Terns, Rebecca M.; Terns, Michael P.; Li, Hong; (Inst. Mol. BioScience); (FSU); (Georgia)

    2009-09-29

    Box H/ACA small nucleolar and Cajal body ribonucleoprotein particles comprise the most complex pseudouridine synthases and are essential for ribosome and spliceosome maturation. The multistep and multicomponent-mediated enzyme mechanism remains only partially understood. Here we report a crystal structure at 2.35 {angstrom} of a substrate-bound functional archaeal enzyme containing three of the four proteins, Cbf5, Nop10 and L7Ae, and a box H/ACA RNA that reveals detailed information about the protein-only active site. The substrate RNA, containing 5-fluorouridine at the modification position, is fully docked and catalytically rearranged by the enzyme in a manner similar to that seen in two stand-alone pseudouridine synthases. Structural analysis provides a mechanism for plasticity in the diversity of guide RNA sequences used and identifies a substrate-anchoring loop of Cbf5 that also interacts with Gar1 in unliganded structures. Activity analyses of mutated proteins and RNAs support the structural findings and further suggest a role of the Cbf5 loop in regulation of enzyme activity.

  6. Structure of a functional ribonucleoprotein pseudouridine synthase bound to a substrate RNA.

    Science.gov (United States)

    Liang, Bo; Zhou, Jing; Kahen, Elliot; Terns, Rebecca M; Terns, Michael P; Li, Hong

    2009-07-01

    Box H/ACA small nucleolar and Cajal body ribonucleoprotein particles comprise the most complex pseudouridine synthases and are essential for ribosome and spliceosome maturation. The multistep and multicomponent-mediated enzyme mechanism remains only partially understood. Here we report a crystal structure at 2.35 A of a substrate-bound functional archaeal enzyme containing three of the four proteins, Cbf5, Nop10 and L7Ae, and a box H/ACA RNA that reveals detailed information about the protein-only active site. The substrate RNA, containing 5-fluorouridine at the modification position, is fully docked and catalytically rearranged by the enzyme in a manner similar to that seen in two stand-alone pseudouridine synthases. Structural analysis provides a mechanism for plasticity in the diversity of guide RNA sequences used and identifies a substrate-anchoring loop of Cbf5 that also interacts with Gar1 in unliganded structures. Activity analyses of mutated proteins and RNAs support the structural findings and further suggest a role of the Cbf5 loop in regulation of enzyme activity.

  7. Not all pseudouridine synthases are potently inhibited by RNA containing 5-fluorouridine.

    Science.gov (United States)

    Spedaliere, Christopher J; Mueller, Eugene G

    2004-02-01

    RNA containing 5-fluorouridine has been assumed to inhibit strongly or irreversibly the pseudouridine synthases that act on the RNA. RNA transcripts containing 5-fluorouridine in place of uridine have, therefore, been added to reconstituted systems in order to investigate the importance of particular pseudouridine residues in a given RNA by inactivating the pseudouridine synthase responsible for their generation. In sharp contradiction to the assumption of universal inhibition of pseudouridine synthases by RNA containing 5-fluorouridine, the Escherichia coli pseudouridine synthase TruB, which has physiologically critical eukaryotic homologs, is not inhibited by such RNA. Instead, the RNA containing 5-fluorouridine was handled as a substrate by TruB. The E. coli pseudouridine synthase RluA, on the other hand, forms a covalent complex and is inhibited stoichiometrically by RNA containing 5-fluorouridine. We offer a hypothesis for this disparate behavior and urge caution in interpreting results from reconstitution experiments in which RNA containing 5-fluorouridine is assumed to inhibit a pseudouridine synthase, as normal function may result from a failure to inactivate the targeted enzyme rather than from the absence of nonessential pseudouridine residues.

  8. Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells.

    Science.gov (United States)

    Carlile, Thomas M; Rojas-Duran, Maria F; Zinshteyn, Boris; Shin, Hakyung; Bartoli, Kristen M; Gilbert, Wendy V

    2014-11-01

    Post-transcriptional modification of RNA nucleosides occurs in all living organisms. Pseudouridine, the most abundant modified nucleoside in non-coding RNAs, enhances the function of transfer RNA and ribosomal RNA by stabilizing the RNA structure. Messenger RNAs were not known to contain pseudouridine, but artificial pseudouridylation dramatically affects mRNA function--it changes the genetic code by facilitating non-canonical base pairing in the ribosome decoding centre. However, without evidence of naturally occurring mRNA pseudouridylation, its physiological relevance was unclear. Here we present a comprehensive analysis of pseudouridylation in Saccharomyces cerevisiae and human RNAs using Pseudo-seq, a genome-wide, single-nucleotide-resolution method for pseudouridine identification. Pseudo-seq accurately identifies known modification sites as well as many novel sites in non-coding RNAs, and reveals hundreds of pseudouridylated sites in mRNAs. Genetic analysis allowed us to assign most of the new modification sites to one of seven conserved pseudouridine synthases, Pus1-4, 6, 7 and 9. Notably, the majority of pseudouridines in mRNA are regulated in response to environmental signals, such as nutrient deprivation in yeast and serum starvation in human cells. These results suggest a mechanism for the rapid and regulated rewiring of the genetic code through inducible mRNA modifications. Our findings reveal unanticipated roles for pseudouridylation and provide a resource for identifying the targets of pseudouridine synthases implicated in human disease.

  9. Conformational change of pseudouridine 55 synthase upon its association with RNA substrate.

    Science.gov (United States)

    Phannachet, Kulwadee; Huang, Raven H

    2004-01-01

    Pseudouridine 55 synthase (Psi55S) catalyzes isomerization of uridine (U) to pseudouridine (Psi) at position 55 in transfer RNA. The crystal structures of Thermotoga maritima Psi55S, and its complex with RNA, have been determined at 2.9 and 3.0 A resolutions, respectively. Structural comparisons with other families of pseudouridine synthases (PsiS) indicate that Psi55S may acquire its ability to recognize a stem-loop RNA substrate by two insertions of polypeptides into the PsiS core. The structure of apo-Psi55S reveals that these two insertions interact with each other. However, association with RNA substrate induces substantial conformational change in one of the insertions, resulting in disruption of interaction between insertions and association of both insertions with the RNA substrate. Specific interactions between two insertions, as well as between the insertions and the RNA substrate, account for the molecular basis of the conformational change.

  10. Interactions of transfer RNA pseudouridine synthases with RNAs substituted with fluorouracil.

    Science.gov (United States)

    Samuelsson, T

    1991-11-25

    We have previously purified and characterized two different S. cerevisiae enzymes that produce pseudouridine specifically in nucleotide positions 13 and 55, respectively, in their tRNA substrates. The interactions of these enzymes with fluorinated tRNAs have now been studied. Such RNAs were produced by in vitro transcription using as templates synthetic genes that encode variants of a yeast glycine tRNA. RNAs substituted with fluorouracil were found to markedly inhibit pseudouridine synthase activity and the inhibitory effect of a tRNA was to a large extent dependent on the presence of fluorouracil in the nucleotide position where normally pseudouridylation occurs. Pseudouridine synthases were shown to form highly stable, non-covalent complexes with fluorinated tRNAs and we demonstrate that this interaction may be used to further characterize and purify these enzymes. The use of 5-fluorouracil as a cancer therapeutic agent is discussed in relation to our results.

  11. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  12. X-ray structure of tRNA pseudouridine synthase TruD reveals an inserted domain with a novel fold.

    Science.gov (United States)

    Ericsson, Ulrika B; Nordlund, Pär; Hallberg, B Martin

    2004-05-01

    Pseudouridine synthases catalyse the isomerisation of uridine to pseudouridine in structural RNA. The pseudouridine synthase TruD, that modifies U13 in tRNA, belongs to a recently identified and large family of pseudouridine synthases present in all kingdoms of life. We report here the crystal structure of Escherichia coli TruD at 2.0 A resolution. The structure reveals an overall V-shaped molecule with an RNA-binding cleft formed between two domains: a catalytic domain and an insertion domain. The catalytic domain has a fold similar to that of the catalytic domains of previously characterised pseudouridine synthases, whereas the insertion domain displays a novel fold.

  13. Modification of human U4 RNA requires U6 RNA and multiple pseudouridine synthases.

    Science.gov (United States)

    Zerby, D B; Patton, J R

    1997-12-01

    Small nuclear RNAs (snRNA), cofactors in the splicing of pre-mRNA, are highly modified. In this report the modification of human U4 RNA was studied using cell extracts and in vitro synthesized, and therefore unmodified, U4 RNA. The formation of pseudouridine (Psi) at positions 4, 72 and 79 in U4 RNA was dependent on an RNA-containing cofactor, since the activities in the extracts were micrococcal nuclease (MN) sensitive. Extracts were fractionated on glycerol gradients and there was a broad peak of reconstitution activity centered at 14 S. Reconstitution was not due to additional enzymatic activity, since the peak fraction was MN sensitive. Oligodeoxynucleotide-mediated RNase H digestion of U6 RNA in the extracts inhibited formation of Psi in U4 RNA. From glycerol gradient analysis we determined that exogenously added U4 RNA that is associated with U6 RNA (sedimentation velocity 16 S) was significantly higher in Psi content than U4 RNA not associated with U6 RNA (8 S). Competitive inhibitors of Psi synthases, 5-fluorouridine-containing (5-FU) wild-type and mutant U4 RNAs, were used to investigate formation of Psi in U4 RNA. Deletions and point mutations in these 5-FU-containing U4 RNAs affected their ability to inhibit Psi synthase in vitro. With the aid of these potent inhibitors it was determined that at least two separate activities modify the uridines at these positions.

  14. 16S ribosomal RNA pseudouridine synthase RsuA of Escherichia coli: deletion, mutation of the conserved Asp102 residue, and sequence comparison among all other pseudouridine synthases.

    Science.gov (United States)

    Conrad, J; Niu, L; Rudd, K; Lane, B G; Ofengand, J

    1999-06-01

    The gene for RsuA, the pseudouridine synthase that converts U516 to pseudouridine in 16S ribosomal RNA of Escherichia coli, has been deleted in strains MG1655 and BL21/DE3. Deletion of this gene resulted in the specific loss of pseudouridine516 in both cell lines, and replacement of the gene in trans on a plasmid restored the pseudouridine. Therefore, rsuA is the only gene in E. coli with the ability to produce a protein capable of forming pseudouridine516. There was no effect on the growth rate of rsuA- MG1655 either in rich or minimal medium at either 24, 37, or 42 degrees C. Plasmid rescue of the BL21/DE3 rsuA- strain using pET15b containing an rsuA gene with aspartate102 replaced by asparagine or threonine demonstrated that neither mutant was active in vivo. This result supports a role for this aspartate, located in a unique GRLD sequence in this gene, at the catalytic center of the synthase. Induction of wild-type and the two mutant synthases in strain BL21/DE3 from genes in pET15b yielded a strong overexpression of all three proteins in approximately equal amounts showing that the mutations did not affect production of the protein in vivo and thus that the lack of activity was not due to a failure to produce a gene product. Aspartate102 is found in a conserved motif present in many pseudouridine synthases. The conservation and distribution of this motif in nature was assessed.

  15. tRNA binding, positioning, and modification by the pseudouridine synthase Pus10.

    Science.gov (United States)

    Kamalampeta, Rajashekhar; Keffer-Wilkes, Laura C; Kothe, Ute

    2013-10-23

    Pus10 is the most recently identified pseudouridine synthase found in archaea and higher eukaryotes. It modifies uridine 55 in the TΨC arm of tRNAs. Here, we report the first quantitative biochemical analysis of tRNA binding and pseudouridine formation by Pyrococcus furiosus Pus10. The affinity of Pus10 for both substrate and product tRNA is high (Kd of 30nM), and product formation occurs with a Km of 400nM and a kcat of 0.9s(-1). Site-directed mutagenesis was used to demonstrate that the thumb loop in the catalytic domain is important for efficient catalysis; we propose that the thumb loop positions the tRNA within the active site. Furthermore, a new catalytic arginine residue was identified (arginine 208), which is likely responsible for triggering flipping of the target uridine into the active site of Pus10. Lastly, our data support the proposal that the THUMP-containing domain, found in the N-terminus of Pus10, contributes to binding of tRNA. Together, our findings are consistent with the hypothesis that tRNA binding by Pus10 occurs through an induced-fit mechanism, which is a prerequisite for efficient pseudouridine formation. PMID:23743107

  16. Expression, purification, crystallization and preliminary diffraction studies of the tRNA pseudouridine synthase TruD from Escherichia coli.

    Science.gov (United States)

    Ericsson, Ulrika B; Andersson, Martin E; Engvall, Benita; Nordlund, Pär; Hallberg, B Martin

    2004-04-01

    Pseudouridine, the 5-ribosyl isomer of uridine, is the most common modification of structural RNA. The recently identified pseudouridine synthase TruD belongs to a widespread class of pseudouridine synthases without significant sequence homology to previously known families. TruD from Escherichia coli was overexpressed, purified and crystallized. The crystals diffract to a minimum Bragg spacing of 2.4 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.4, b = 108.6, c = 111.7 A.

  17. Pseudouridine synthases.

    Science.gov (United States)

    Hamma, Tomoko; Ferré-D'Amaré, Adrian R

    2006-11-01

    Pseudouridine synthases are the enzymes responsible for the most abundant posttranscriptional modification of cellular RNAs. These enzymes catalyze the site-specific isomerization of uridine residues that are already part of an RNA chain, and appear to employ both sequence and structural information to achieve site specificity. Crystallographic analyses have demonstrated that all pseudouridine synthases share a common core fold and active site structure and that this core is modified by peripheral domains, accessory proteins, and guide RNAs to give rise to remarkable substrate versatility.

  18. Pseudo-Seq: Genome-Wide Detection of Pseudouridine Modifications in RNA.

    Science.gov (United States)

    Carlile, Thomas M; Rojas-Duran, Maria F; Gilbert, Wendy V

    2015-01-01

    RNA molecules contain a variety of chemically diverse, posttranscriptionally modified bases. The most abundant modified base found in cellular RNAs, pseudouridine (Ψ), has recently been mapped to hundreds of sites in mRNAs, many of which are dynamically regulated. Though the pseudouridine landscape has been determined in only a few cell types and growth conditions, the enzymes responsible for mRNA pseudouridylation are universally conserved, suggesting many novel pseudouridylated sites remain to be discovered. Here, we present Pseudo-seq, a technique that allows the identification of sites of pseudouridylation genome-wide with single-nucleotide resolution. In this chapter, we provide a detailed description of Pseudo-seq. We include protocols for RNA isolation from Saccharomyces cerevisiae, Pseudo-seq library preparation, and data analysis, including descriptions of processing and mapping of sequencing reads, computational identification of sites of pseudouridylation, and assignment of sites to specific pseudouridine synthases. The approach presented here is readily adaptable to any cell or tissue type from which high-quality mRNA can be isolated. Identification of novel pseudouridylation sites is an important first step in elucidating the regulation and functions of these modifications.

  19. The crystal structure of E. coli rRNA pseudouridine synthase RluE.

    Science.gov (United States)

    Pan, Hu; Ho, Joseph D; Stroud, Robert M; Finer-Moore, Janet

    2007-04-13

    Pseudouridine synthase RluE modifies U2457 in a stem of 23 S RNA in Escherichia coli. This modification is located in the peptidyl transferase center of the ribosome. We determined the crystal structures of the C-terminal, catalytic domain of E. coli RluE at 1.2 A resolution and of full-length RluE at 1.6 A resolution. The crystals of the full-length enzyme contain two molecules in the asymmetric unit and in both molecules the N-terminal domain is disordered. The protein has an active site cleft, conserved in all other pseudouridine synthases, that contains invariant Asp and Tyr residues implicated in catalysis. An electropositive surface patch that covers the active site cleft is just wide enough to accommodate an RNA stem. The RNA substrate stem can be docked to this surface such that the catalytic Asp is adjacent to the target base, and a conserved Arg is positioned to help flip the target base out of the stem into the enzyme active site. A flexible RluE specific loop lies close to the conserved region of the stem in the model, and may contribute to substrate specificity. The stem alone is not a good RluE substrate, suggesting RluE makes additional interactions with other regions in the ribosome.

  20. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    Science.gov (United States)

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  1. Comparative study of two box H/ACA ribonucleoprotein pseudouridine-synthases: relation between conformational dynamics of the guide RNA, enzyme assembly and activity.

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Fourmann

    Full Text Available Multiple RNA-guided pseudouridine synthases, H/ACA ribonucleoprotein particles (RNPs which contain a guide RNA and four proteins, catalyze site-specific post-transcriptional isomerization of uridines into pseudouridines in substrate RNAs. In archaeal particles, the guide small RNA (sRNA is anchored by the pseudouridine synthase aCBF5 and the ribosomal protein L7Ae. Protein aNOP10 interacts with both aCBF5 and L7Ae. The fourth protein, aGAR1, interacts with aCBF5 and enhances catalytic efficiency. Here, we compared the features of two H/ACA sRNAs, Pab21 and Pab91, from Pyrococcus abyssi. We found that aCBF5 binds much more weakly to Pab91 than to Pab21. Surprisingly, the Pab91 sRNP exhibits a higher catalytic efficiency than the Pab21 sRNP. We thus investigated the molecular basis of the differential efficiencies observed for the assembly and catalytic activity of the two enzymes. For this, we compared profiles of the extent of lead-induced cleavages in these sRNAs during a stepwise reconstitution of the sRNPs, and analyzed the impact of the absence of the aNOP10-L7Ae interaction. Such probing experiments indicated that the sRNAs undergo a series of conformational changes upon RNP assembly. These changes were also evaluated directly by circular dichroism (CD spectroscopy, a tool highly adapted to analyzing RNA conformational dynamics. In addition, our results reveal that the conformation of helix P1 formed at the base of the H/ACA sRNAs is optimized in Pab21 for efficient aCBF5 binding and RNP assembly. Moreover, P1 swapping improved the assembly of the Pab91 sRNP. Nonetheless, efficient aCBF5 binding probably also relies on the pseudouridylation pocket which is not optimized for high activity in the case of Pab21.

  2. Comparative study of two box H/ACA ribonucleoprotein pseudouridine-synthases: relation between conformational dynamics of the guide RNA, enzyme assembly and activity.

    Science.gov (United States)

    Fourmann, Jean-Baptiste; Tillault, Anne-Sophie; Blaud, Magali; Leclerc, Fabrice; Branlant, Christiane; Charpentier, Bruno

    2013-01-01

    Multiple RNA-guided pseudouridine synthases, H/ACA ribonucleoprotein particles (RNPs) which contain a guide RNA and four proteins, catalyze site-specific post-transcriptional isomerization of uridines into pseudouridines in substrate RNAs. In archaeal particles, the guide small RNA (sRNA) is anchored by the pseudouridine synthase aCBF5 and the ribosomal protein L7Ae. Protein aNOP10 interacts with both aCBF5 and L7Ae. The fourth protein, aGAR1, interacts with aCBF5 and enhances catalytic efficiency. Here, we compared the features of two H/ACA sRNAs, Pab21 and Pab91, from Pyrococcus abyssi. We found that aCBF5 binds much more weakly to Pab91 than to Pab21. Surprisingly, the Pab91 sRNP exhibits a higher catalytic efficiency than the Pab21 sRNP. We thus investigated the molecular basis of the differential efficiencies observed for the assembly and catalytic activity of the two enzymes. For this, we compared profiles of the extent of lead-induced cleavages in these sRNAs during a stepwise reconstitution of the sRNPs, and analyzed the impact of the absence of the aNOP10-L7Ae interaction. Such probing experiments indicated that the sRNAs undergo a series of conformational changes upon RNP assembly. These changes were also evaluated directly by circular dichroism (CD) spectroscopy, a tool highly adapted to analyzing RNA conformational dynamics. In addition, our results reveal that the conformation of helix P1 formed at the base of the H/ACA sRNAs is optimized in Pab21 for efficient aCBF5 binding and RNP assembly. Moreover, P1 swapping improved the assembly of the Pab91 sRNP. Nonetheless, efficient aCBF5 binding probably also relies on the pseudouridylation pocket which is not optimized for high activity in the case of Pab21.

  3. Identification of two Escherichia coli pseudouridine synthases that show multisite specificity for 23S RNA.

    Science.gov (United States)

    Huang, L; Ku, J; Pookanjanatavip, M; Gu, X; Wang, D; Greene, P J; Santi, D V

    1998-11-10

    Several putative Escherichia coli pseudouridine (Psi) synthases have been identified by iterative searching of genomic databases for ORFs homologous to known Psi synthases [Gustafsson et al. (1996) Nucleic Acids Res. 24, 3756-3762]. Of these, yceC and yfiI were proposed to encode Psi synthases which modify 23S rRNA. In the present work, yceC and yfiI were cloned and overexpressed in E. coli, and the encoded enzymes, YceC and YfiI, were purified to homogeneity. Both proteins converted Urd residues of rRNA to Psi, thus confirming their identities as Psi synthases. However, in in vitro experiments both enzymes extensively modified Urd residues of both 23S rRNA and 16S rRNA. Gene-disruption of yceCresulted in the absence of Psi modification at positions U955, 2504, and 2580 of 23S RNA, thus identifying these sites as in vivo targets for YceC. Likewise, yfiI disruption resulted in the absence of Psi modification at positions U1911, 1917, and possibly 1915 of 23S RNA. Disruption of yceC did not affect the growth under the conditions tested, whereas yfiI-disrupted cells showed a dramatic decrease in growth rate. Since YceC and YfiI hypermodify RNA in vitro, factors in addition to ribonucleotide sequence must contribute to the in vivo specificity of these enzymes.

  4. Caenorhabditis elegans pseudouridine synthase 1 activity in vivo: tRNA is a substrate, but not U2 small nuclear RNA.

    Science.gov (United States)

    Patton, Jeffrey R; Padgett, Richard W

    2003-06-01

    The formation of pseudouridine (Psi) from uridine is post-transcriptional and catalysed by pseudouridine synthases, several of which have been characterized from eukaryotes. Pseudouridine synthase 1 (Pus1p) has been well characterized from yeast and mice. In yeast, Pus1p has been shown to have dual substrate specificity, modifying uridines in tRNAs and at position 44 in U2 small nuclear RNA (U2 snRNA). In order to study the in vivo activity of a metazoan Pus1p, a knockout of the gene coding for the homologue of Pus1p in Caenorhabditis elegans was obtained. The deletion encompasses the first two putative exons and includes the essential aspartate that is required for activity in truA pseudouridine synthases. The locations of most modified nucleotides on small RNAs in C. elegans are not known, and the positions of Psi were determined on four tRNAs and U2 snRNA. The uridine at position 27 of tRNA(Val) (AAC), a putative Pus1p-modification site, was converted into Psi in the wild-type worms, but the tRNA(Val) (AAC) from mutant worms lacked the modification. Psi formation at positions 13, 32, 38 and 39, all of which should be modified by other pseudouridine synthases, was not affected by the loss of Pus1p. The absence of Pus1p in C. elegans had no effect on the modification of U2 snRNA in vivo, even though worm U2 snRNA has a Psi at position 45 (the equivalent of yeast U2 snRNA position 44) and at four other positions. This result was unexpected, given the known dual specificity of yeast Pus1p.

  5. Crystal structure of the catalytic domain of RluD, the only rRNA pseudouridine synthase required for normal growth of Escherichia coli.

    Science.gov (United States)

    Del Campo, Mark; Ofengand, James; Malhotra, Arun

    2004-02-01

    Escherichia coli pseudouridine synthase RluD makes pseudouridines 1911, 1915, and 1917 in the loop of helix 69 in 23S RNA. These are the most highly conserved ribosomal pseudouridines known. Of 11 pseudouridine synthases in E. coli, only cells lacking RluD have severe growth defects and abnormal ribosomes. We have determined the 2.0 A structure of the catalytic domain of RluD (residues 77-326), the first structure of an RluA family member. The catalytic domain folds into a mainly antiparallel beta-sheet flanked by several loops and helices. A positively charged cleft that presumably binds RNA leads to the conserved Asp 139. The RluD N-terminal S4 domain, connected by a flexible linker, is disordered in our structure. RluD is very similar in both catalytic domain structure and active site arrangement to the pseudouridine synthases RsuA, TruB, and TruA. We identify five sequence motifs, two of which are novel, in the RluA, RsuA, TruB, and TruA families, uniting them as one superfamily. These results strongly suggest that four of the five families of pseudouridine synthases arose by divergent evolution. The RluD structure also provides insight into its multisite specificity.

  6. Ribonucleoproteins in Archaeal Pre-rRNA Processing and Modification

    Directory of Open Access Journals (Sweden)

    W. S. Vincent Yip

    2013-01-01

    Full Text Available Given that ribosomes are one of the most important cellular macromolecular machines, it is not surprising that there is intensive research in ribosome biogenesis. Ribosome biogenesis is a complex process. The maturation of ribosomal RNAs (rRNAs requires not only the precise cleaving and folding of the pre-rRNA but also extensive nucleotide modifications. At the heart of the processing and modifications of pre-rRNAs in Archaea and Eukarya are ribonucleoprotein (RNP machines. They are called small RNPs (sRNPs, in Archaea, and small nucleolar RNPs (snoRNPs, in Eukarya. Studies on ribosome biogenesis originally focused on eukaryotic systems. However, recent studies on archaeal sRNPs have provided important insights into the functions of these RNPs. This paper will introduce archaeal rRNA gene organization and pre-rRNA processing, with a particular focus on the discovery of the archaeal sRNP components, their functions in nucleotide modification, and their structures.

  7. Attempted prebiotic synthesis of pseudouridine

    Science.gov (United States)

    Dworkin, J. P.; Miller, S. L. (Principal Investigator)

    1997-01-01

    Pseudouridine is a modified base found in all tRNA and rRNA. Hence, it is reasonable to think that pseudouridine was important in the early evolution, if not the origin, of life. Since uracil reacts rapidly with formaldehyde and other aldehydes at the C-5 position, it is plausible that pseudouridine could be synthesized in a similar way by the reaction of the C-5 of uracil with the C-1 of ribose. The determining factor is whether the ribose could react with the uracil faster than ribose decomposes. However, both rates are determined by the amount of free aldehyde in the ribose. Various plausible prebiotic reactions were investigated and none showed pseudouridine above the detection limit (prebiotic conditions. Unless efficient non-biological catalysts for any of these reactions exist, pseudouridine would not have been synthesized to any significant extent without the use of biologically produced enzymes.

  8. Steroid receptor RNA activator (SRA modification by the human pseudouridine synthase 1 (hPus1p: RNA binding, activity, and atomic model.

    Directory of Open Access Journals (Sweden)

    Tiphaine Huet

    Full Text Available The most abundant of the modified nucleosides, and once considered as the "fifth" nucleotide in RNA, is pseudouridine, which results from the action of pseudouridine synthases. Recently, the mammalian pseudouridine synthase 1 (hPus1p has been reported to modulate class I and class II nuclear receptor responses through its ability to modify the Steroid receptor RNA Activator (SRA. These findings highlight a new level of regulation in nuclear receptor (NR-mediated transcriptional responses. We have characterised the RNA association and activity of the human Pus1p enzyme with its unusual SRA substrate. We validate that the minimal RNA fragment within SRA, named H7, is necessary for both the association and modification by hPus1p. Furthermore, we have determined the crystal structure of the catalytic domain of hPus1p at 2.0 Å resolution, alone and in a complex with several molecules present during crystallisation. This model shows an extended C-terminal helix specifically found in the eukaryotic protein, which may prevent the enzyme from forming a homodimer, both in the crystal lattice and in solution. Our biochemical and structural data help to understand the hPus1p active site architecture, and detail its particular requirements with regard to one of its nuclear substrates, the non-coding RNA SRA.

  9. Steroid receptor RNA activator (SRA) modification by the human pseudouridine synthase 1 (hPus1p): RNA binding, activity, and atomic model.

    Science.gov (United States)

    Huet, Tiphaine; Miannay, François-Alexandre; Patton, Jeffrey R; Thore, Stéphane

    2014-01-01

    The most abundant of the modified nucleosides, and once considered as the "fifth" nucleotide in RNA, is pseudouridine, which results from the action of pseudouridine synthases. Recently, the mammalian pseudouridine synthase 1 (hPus1p) has been reported to modulate class I and class II nuclear receptor responses through its ability to modify the Steroid receptor RNA Activator (SRA). These findings highlight a new level of regulation in nuclear receptor (NR)-mediated transcriptional responses. We have characterised the RNA association and activity of the human Pus1p enzyme with its unusual SRA substrate. We validate that the minimal RNA fragment within SRA, named H7, is necessary for both the association and modification by hPus1p. Furthermore, we have determined the crystal structure of the catalytic domain of hPus1p at 2.0 Å resolution, alone and in a complex with several molecules present during crystallisation. This model shows an extended C-terminal helix specifically found in the eukaryotic protein, which may prevent the enzyme from forming a homodimer, both in the crystal lattice and in solution. Our biochemical and structural data help to understand the hPus1p active site architecture, and detail its particular requirements with regard to one of its nuclear substrates, the non-coding RNA SRA.

  10. A previously unidentified activity of yeast and mouse RNA:pseudouridine synthases 1 (Pus1p) on tRNAs.

    Science.gov (United States)

    Behm-Ansmant, Isabelle; Massenet, Séverine; Immel, Françoise; Patton, Jeffrey R; Motorin, Yuri; Branlant, Christiane

    2006-08-01

    Mouse pseudouridine synthase 1 (mPus1p) was the first vertebrate RNA:pseudouridine synthase that was cloned and characterized biochemically. The mPus1p was previously found to catalyze Psi formation at positions 27, 28, 34, and 36 in in vitro produced yeast and human tRNAs. On the other hand, the homologous Saccharomyces cerevisiae scPus1p protein was shown to modify seven uridine residues in tRNAs (26, 27, 28, 34, 36, 65, and 67) and U44 in U2 snRNA. In this work, we expressed mPus1p in yeast cells lacking scPus1p and studied modification of U2 snRNA and several yeast tRNAs. Our data showed that, in these in vivo conditions, the mouse enzyme efficiently modifies yeast U2 snRNA at position 44 and tRNAs at positions 27, 28, 34, and 36. However, a tRNA:Psi26-synthase activity of mPus1p was not observed. Furthermore, we found that both scPus1p and mPus1p, in vivo and in vitro, have a previously unidentified activity at position 1 in cytoplasmic tRNAArg(ACG). This modification can take place in mature tRNA, as well as in pre-tRNAs with 5' and/or 3' extensions. Thus, we identified the protein carrying one of the last missing yeast tRNA:Psi synthase activities. In addition, our results reveal an additional activity of mPus1p at position 30 in tRNA that scPus1p does not possess.

  11. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA.

    Science.gov (United States)

    Sunita, S; Zhenxing, H; Swaathi, J; Cygler, Miroslaw; Matte, Allan; Sivaraman, J

    2006-06-16

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine (Psi) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E.coli RluF at 2.6A resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of Psi-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  12. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Sunita,S.; Zhenxing, H.; Swaathi, J.; Cygler, M.; Matte, A.; Sivaraman, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. The structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.

  13. Transfection of pseudouridine-modified mRNA encoding CPD-photolyase leads to repair of DNA damage in human keratinocytes: a new approach with future therapeutic potential

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; Rózsa, Dávid; Nagy, Georgina; Juhász, Attila; Juhász, István; van der Horst, Gijsbertus; Horkay, Irén; Remenyik, Éva; Karikó, Katalin; Emri, Gabriella

    2013-01-01

    UVB irradiation induces harmful photochemical reactions, including formation of cyclobutane pyrimidine dimers (CPDs) in DNA. Accumulation of unrepaired CPD lesions causes inflammation, premature ageing and skin cancer. Photolyases are DNA repair enzymes that can rapidly restore DNA integrity in a light-dependent process called photoreactivation, but these enzymes are absent in humans. Here, we present a novel mRNA-based gene therapy method that directs synthesis of a marsupial, Potorous tridactylus, CPD-photolyase in cultured human keratinocytes. Pseudouridine was incorporated during in vitro transcription to make the mRNA non-immunogenic and highly translatable. Keratinocytes transfected with lipofectamine-complexed mRNA expressed photolyase in the nuclei for at least 2 days. Exposing photolyase mRNA-transfected cells to UVB irradiation resulted in significantly less CPD in those cells that were also treated with photoreactivating light, which is required for photolyase activity. The functional photolyase also diminished other UVB-mediated effects, including induction of IL-6 and inhibition of cell proliferation. These results demonstrate that pseudouridine-containing photolyase mRNA is a powerful tool to repair UVB-induced DNA lesions. The pseudouridine-modified mRNA approach has a strong potential to discern cellular effects of CPD in UV-related cell biological studies. The mRNA-based transient expression of proteins offers a number of opportunities for future application in medicine. PMID:24211294

  14. RNA-Based Assessment of Diversity and Composition of Active Archaeal Communities in the German Bight

    Directory of Open Access Journals (Sweden)

    Bernd Wemheuer

    2012-01-01

    Full Text Available Archaea play an important role in various biogeochemical cycles. They are known extremophiles inhabiting environments such as thermal springs or hydrothermal vents. Recent studies have revealed a significant abundance of Archaea in moderate environments, for example, temperate sea water. Nevertheless, the composition and ecosystem function of these marine archaeal communities is largely unknown. To assess diversity and composition of active archaeal communities in the German Bight, seven marine water samples were taken and studied by RNA-based analysis of ribosomal 16S rRNA. For this purpose, total RNA was extracted from the samples and converted to cDNA. Archaeal community structures were investigated by pyrosequencing-based analysis of 16S rRNA amplicons generated from cDNA. To our knowledge, this is the first study combining next-generation sequencing and metatranscriptomics to study archaeal communities in marine habitats. The pyrosequencing-derived dataset comprised 62,045 archaeal 16S rRNA sequences. We identified Halobacteria as the predominant archaeal group across all samples with increased abundance in algal blooms. Thermoplasmatales (Euryarchaeota and the Marine Group I (Thaumarchaeota were identified in minor abundances. It is indicated that archaeal community patterns were influenced by environmental conditions.

  15. Analyses of in vivo interactions between transcription factors and the archaeal RNA polymerase.

    Science.gov (United States)

    Walker, Julie E; Santangelo, Thomas J

    2015-09-15

    Transcription factors regulate the activities of RNA polymerase (RNAP) at each stage of the transcription cycle. Many basal transcription factors with common ancestry are employed in eukaryotic and archaeal systems that directly bind to RNAP and influence intramolecular movements of RNAP and modulate DNA or RNA interactions. We describe and employ a flexible methodology to directly probe and quantify the binding of transcription factors to RNAP in vivo. We demonstrate that binding of the conserved and essential archaeal transcription factor TFE to the archaeal RNAP is directed, in part, by interactions with the RpoE subunit of RNAP. As the surfaces involved are conserved in many eukaryotic and archaeal systems, the identified TFE-RNAP interactions are likely conserved in archaeal-eukaryal systems and represent an important point of contact that can influence the efficiency of transcription initiation.

  16. Crystal structure of pseudouridine synthase RluA: indirect sequence readout through protein-induced RNA structure.

    Science.gov (United States)

    Hoang, Charmaine; Chen, Junjun; Vizthum, Caroline A; Kandel, Jason M; Hamilton, Christopher S; Mueller, Eugene G; Ferré-D'Amaré, Adrian R

    2006-11-17

    RluA is a dual-specificity enzyme responsible for pseudouridylating 23S rRNA and several tRNAs. The 2.05 A resolution structure of RluA bound to a substrate RNA comprising the anticodon stem loop of tRNA(Phe) reveals that enzyme binding induces a dramatic reorganization of the RNA. Instead of adopting its canonical U turn conformation, the anticodon loop folds into a new structure with a reverse-Hoogsteen base pair and three flipped-out nucleotides. Sequence conservation, the cocrystal structure, and the results of structure-guided mutagenesis suggest that RluA recognizes its substrates indirectly by probing RNA loops for their ability to adopt the reorganized fold. The planar, cationic side chain of an arginine intercalates between the reverse-Hoogsteen base pair and the bottom pair of the anticodon stem, flipping the nucleotide to be modified into the active site of RluA. Sequence and structural comparisons suggest that pseudouridine synthases of the RluA, RsuA, and TruA families employ an equivalent arginine for base flipping.

  17. Identification and site of action of the remaining four putative pseudouridine synthases in Escherichia coli.

    Science.gov (United States)

    Del Campo, M; Kaya, Y; Ofengand, J

    2001-11-01

    There are 10 known putative pseudouridine synthase genes in Escherichia coli. The products of six have been previously assigned, one to formation of the single pseudouridine in 16S RNA, three to the formation of seven pseudouridines in 23S RNA, and three to the formation of three pseudouridines in tRNA (one synthase makes pseudouridine in 23S RNA and tRNA). Here we show that the remaining four putative synthase genes make bona fide pseudouridine synthases and identify which pseudouridines they make. RluB (formerly YciL) and RluE (formerly YmfC) make pseudouridine2605 and pseudouridine2457, respectively, in 23S RNA. RluF (formerly YjbC) makes the newly discovered pseudouridine2604 in 23S RNA, and TruC (formerly YqcB) makes pseudouridine65 in tRNA(Ile1) and tRNA(Asp). Deletion of each of these synthase genes individually had no effect on exponential growth in rich media at 25 degrees C, 37 degrees C, or 42 degrees C. A strain lacking RluB and RluF also showed no growth defect under these conditions. Mutation of a conserved aspartate in a common sequence motif, previously shown to be essential for the other six E. coli pseudouridine synthases and several yeast pseudouridine synthases, also caused a loss of in vivo activity in all four of the synthases studied in this work.

  18. Attempted prebiotic synthesis of pseudouridine

    Science.gov (United States)

    Dworkin, J. P.; Miller, S. L. (Principal Investigator)

    1997-01-01

    Pseudouridine is a modified base found in all tRNA and rRNA. Hence, it is reasonable to think that pseudouridine was important in the early evolution, if not the origin, of life. Since uracil reacts rapidly with formaldehyde and other aldehydes at the C-5 position, it is plausible that pseudouridine could be synthesized in a similar way by the reaction of the C-5 of uracil with the C-1 of ribose. The determining factor is whether the ribose could react with the uracil faster than ribose decomposes. However, both rates are determined by the amount of free aldehyde in the ribose. Various plausible prebiotic reactions were investigated and none showed pseudouridine above the detection limit (products could be observed. Thus the rate of addition of ribose to uracil is much slower than the decomposition of ribose under any reasonable prebiotic conditions. Unless efficient non-biological catalysts for any of these reactions exist, pseudouridine would not have been synthesized to any significant extent without the use of biologically produced enzymes.

  19. Functional and structural impact of target uridine substitutions on the H/ACA ribonucleoprotein particle pseudouridine synthase.

    Science.gov (United States)

    Zhou, Jing; Liang, Bo; Li, Hong

    2010-07-27

    Box H/ACA ribonucleoprotein protein particles catalyze the majority of pseudouridylation in functional RNA. Different from stand alone pseudouridine synthases, the RNP pseudouridine synthase comprises multiple protein subunits and an RNA subunit. Previous studies showed that each subunit, regardless its location, is sensitive to the step of subunit placement at the catalytic center and potentially to the reaction status of the substrate. Here we describe the impact of chemical substitutions of target uridine on enzyme activity and structure. We found that 3-methyluridine in place of uridine inhibited its isomerization while 2'-deoxyuridine or 4-thiouridine did not. Significantly, crystal structures of an archaeal box H/ACA RNP bound with the nonreactive and the two postreactive substrate analogues showed only subtle structural changes throughout the assembly except for a conserved tyrosine and a substrate anchoring loop of Cbf5. Our results suggest a potential role of these elements and the subunit that contacts them in substrate binding and product release.

  20. An archaeal tRNA-synthetase complex that enhances aminoacylation under extreme conditions

    DEFF Research Database (Denmark)

    Godinic-Mikulcic, Vlatka; Jaric, Jelena; Hausmann, Corinne D;

    2011-01-01

    Aminoacyl-tRNA synthetases (aaRSs) play an integral role in protein synthesis, functioning to attach the correct amino acid with its cognate tRNA molecule. AaRSs are known to associate into higher-order multi-aminoacyl-tRNA synthetase complexes (MSC) involved in archaeal and eukaryotic translation...... the catalytic efficiency of serine attachment to tRNA, but had no effect on the activity of MtArgRS. Further, the most pronounced improvements in the aminoacylation activity of MtSerRS induced by MtArgRS were observed under conditions of elevated temperature and osmolarity. These data indicate that......, although the precise biological role remains largely unknown. To gain further insights into archaeal MSCs, possible protein-protein interactions with the atypical Methanothermobacter thermautotrophicus seryl-tRNA synthetase (MtSerRS) were investigated. Yeast two-hybrid analysis revealed arginyl-tRNA...

  1. An investigation into eukaryotic pseudouridine synthases.

    Science.gov (United States)

    King, Ross D; Lu, Chuan

    2014-08-01

    A common post-transcriptional modification of RNA is the conversion of uridine to its isomer pseudouridine. We investigated the biological significance of eukaryotic pseudouridine synthases using the yeast Saccharomyces cerevisiae. We conducted a comprehensive statistical analysis on growth data from automated perturbation (gene deletion) experiments, and used bi-logistic curve analysis to characterise the yeast phenotypes. The deletant strains displayed different alteration in growth properties, including in some cases enhanced growth and/or biphasic growth curves not seen in wild-type strains under matched conditions. These results demonstrate that disrupting pseudouridine synthases can have a significant qualitative effect on growth. We further investigated the significance of post-transcriptional pseudouridine modification through investigation of the scientific literature. We found that (1) In Toxoplasma gondii, a pseudouridine synthase gene is critical in cellular differentiation between the two asexual forms: Tachyzoites and bradyzoites; (2) Mutation of pseudouridine synthase genes has also been implicated in human diseases (mitochondrial myopathy and sideroblastic anemia (MLASA); dyskeratosis congenita). Taken together, these results are consistent with pseudouridine synthases having a Gene Ontology function of "biological regulation".

  2. The mechanism of pseudouridine synthases from a covalent complex with RNA, and alternate specificity for U2605 versus U2604 between close homologs.

    Science.gov (United States)

    Czudnochowski, Nadine; Ashley, Gary W; Santi, Daniel V; Alian, Akram; Finer-Moore, Janet; Stroud, Robert M

    2014-02-01

    RluB catalyses the modification of U2605 to pseudouridine (Ψ) in a stem-loop at the peptidyl transferase center of Escherichia coli 23S rRNA. The homolog RluF is specific to the adjacent nucleotide in the stem, U2604. The 1.3 Å resolution crystal structure of the complex between the catalytic domain of RluB and the isolated substrate stem-loop, in which the target uridine is substituted by 5-fluorouridine (5-FU), reveals a covalent bond between the isomerized target base and tyrosine 140. The structure is compared with the catalytic domain alone determined at 2.5 Å resolution. The RluB-bound stem-loop has essentially the same secondary structure as in the ribosome, with a bulge at A2602, but with 5-FU2605 flipped into the active site. We showed earlier that RluF induced a frame-shift of the RNA, moving A2602 into the stem and translating its target, U2604, into the active site. A hydrogen-bonding network stabilizes the bulge in the RluB-RNA but is not conserved in RluF and so RluF cannot stabilize the bulge. On the basis of the covalent bond between enzyme and isomerized 5-FU we propose a Michael addition mechanism for pseudouridine formation that is consistent with all experimental data.

  3. Critical aspartic acid residues in pseudouridine synthases.

    Science.gov (United States)

    Ramamurthy, V; Swann, S L; Paulson, J L; Spedaliere, C J; Mueller, E G

    1999-08-01

    The pseudouridine synthases catalyze the isomerization of uridine to pseudouridine at particular positions in certain RNA molecules. Genomic data base searches and sequence alignments using the first four identified pseudouridine synthases led Koonin (Koonin, E. V. (1996) Nucleic Acids Res. 24, 2411-2415) and, independently, Santi and co-workers (Gustafsson, C., Reid, R., Greene, P. J., and Santi, D. V. (1996) Nucleic Acids Res. 24, 3756-3762) to group this class of enzyme into four families, which display no statistically significant global sequence similarity to each other. Upon further scrutiny (Huang, H. L., Pookanjanatavip, M., Gu, X. G., and Santi, D. V. (1998) Biochemistry 37, 344-351), the Santi group discovered that a single aspartic acid residue is the only amino acid present in all of the aligned sequences; they then demonstrated that this aspartic acid residue is catalytically essential in one pseudouridine synthase. To test the functional significance of the sequence alignments in light of the global dissimilarity between the pseudouridine synthase families, we changed the aspartic acid residue in representatives of two additional families to both alanine and cysteine: the mutant enzymes are catalytically inactive but retain the ability to bind tRNA substrate. We have also verified that the mutant enzymes do not release uracil from the substrate at a rate significant relative to turnover by the wild-type pseudouridine synthases. Our results clearly show that the aligned aspartic acid residue is critical for the catalytic activity of pseudouridine synthases from two additional families of these enzymes, supporting the predictive power of the sequence alignments and suggesting that the sequence motif containing the aligned aspartic acid residue might be a prerequisite for pseudouridine synthase function.

  4. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    OpenAIRE

    Hongming WANG; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated read...

  5. Pseudouridines in spliceosomal snRNAs

    Institute of Scientific and Technical Information of China (English)

    Andrew T. Yu; Junhui Ge; Yi-Tao Yu

    2011-01-01

    Spliceosomal RNAs are a family of small nuclear RNAs (snRNAs) that are essential for pre-mRNA splicing.All vertebrate spliceosomal snRNAs are extensively pseudouridylated after transcription.Pseudouridines in spliceosomal snRNAs are generally clustered in regions that are functionally important during splicing.Many of these modified nucleotides are conserved across species lines.Recent studies have demonstrated that spliceosomal snRNA pseudouridylation is catalyzed by two different mechanisms:an RNA-dependent mechanism and an RNA-independent mechanism.The functions of the pseudouridines in spliceosomal snRNAs (U2 snRNA in particular) have also been extensively studied.Experimental data indicate that virtually all pseudouridines in U2 snRNA are functionally important.Besides the currently known pseudouridines (constitutive modifications),recent work has also indicated that pseudouridylation can be induced at novel positions under stress conditions,thus strongly suggesting that pseudouridylation is also a regulatory modification.

  6. Crystal structure of the S. solfataricus archaeal exosome reveals conformational flexibility in the RNA-binding ring.

    Directory of Open Access Journals (Sweden)

    Changrui Lu

    Full Text Available BACKGROUND: The exosome complex is an essential RNA 3'-end processing and degradation machinery. In archaeal organisms, the exosome consists of a catalytic ring and an RNA-binding ring, both of which were previously reported to assume three-fold symmetry. METHODOLOGY/PRINCIPAL FINDINGS: Here we report an asymmetric 2.9 A Sulfolobus solfataricus archaeal exosome structure in which the three-fold symmetry is broken due to combined rigid body and thermal motions mainly within the RNA-binding ring. Since increased conformational flexibility was also observed in the RNA-binding ring of the related bacterial PNPase, we speculate that this may reflect an evolutionarily conserved mechanism to accommodate diverse RNA substrates for degradation. CONCLUSION/SIGNIFICANCE: This study clearly shows the dynamic structures within the RNA-binding domains, which provides additional insights on mechanism of asymmetric RNA binding and processing.

  7. Linking pseudouridine synthases to growth, development and cell competition.

    Science.gov (United States)

    Tortoriello, Giuseppe; de Celis, José F; Furia, Maria

    2010-08-01

    Eukaryotic pseudouridine synthases direct RNA pseudouridylation and bind H/ACA small nucleolar RNA (snoRNAs), which, in turn, may act as precursors of microRNA-like molecules. In humans, loss of pseudouridine synthase activity causes dyskeratosis congenita (DC), a complex systemic disorder characterized by cancer susceptibility, failures in ribosome biogenesis and telomere stability, and defects in stem cell formation. Considering the significant interest in deciphering the various molecular consequences of pseudouridine synthase failure, we performed a loss of function analysis of minifly (mfl), the pseudouridine synthase gene of Drosophila, in the wing disc, an advantageous model system for studies of cell growth and differentiation. In this organ, depletion of the mfl-encoded pseudouridine synthase causes a severe reduction in size by decreasing both the number and the size of wing cells. Reduction of cell number was mainly attributable to cell death rather than reduced proliferation, establishing that apoptosis plays a key role in the development of the loss of function mutant phenotype. Depletion of Mfl also causes a proliferative disadvantage in mosaic tissues that leads to the elimination of mutant cells by cell competition. Intriguingly, mfl silencing also triggered unexpected effects on wing patterning and cell differentiation, including deviations from normal lineage boundaries, mingling of cells of different compartments, and defects in the formation of the wing margin that closely mimic the phenotype of reduced Notch activity. These results suggest that a component of the pseudouridine synthase loss of function phenotype is caused by defects in Notch signalling.

  8. Crystal structure of TruD, a novel pseudouridine synthase with a new protein fold.

    Science.gov (United States)

    Kaya, Yusuf; Del Campo, Mark; Ofengand, James; Malhotra, Arun

    2004-04-30

    TruD, a recently discovered novel pseudouridine synthase in Escherichia coli, is responsible for modifying uridine13 in tRNA(Glu) to pseudouridine. It has little sequence homology with the other 10 pseudouridine synthases in E. coli which themselves have been grouped into four related protein families. Crystal structure determination of TruD revealed a two domain structure consisting of a catalytic domain that differs in sequence but is structurally very similar to the catalytic domain of other pseudouridine synthases and a second large domain (149 amino acids, 43% of total) with a novel alpha/beta fold that up to now has not been found in any other protein.

  9. Transcriptome-wide mapping of pseudouridines: pseudouridine synthases modify specific mRNAs in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Alexander F Lovejoy

    Full Text Available We developed a novel technique, called pseudouridine site identification sequencing (PSI-seq, for the transcriptome-wide mapping of pseudouridylation sites with single-base resolution from cellular RNAs based on the induced termination of reverse transcription specifically at pseudouridines following CMCT treatment. PSI-seq analysis of RNA samples from S. cerevisiae correctly detected all of the 43 known pseudouridines in yeast 18S and 25S ribosomal RNA with high specificity. Moreover, application of PSI-seq to the yeast transcriptome revealed the presence of site-specific pseudouridylation within dozens of mRNAs, including RPL11a, TEF1, and other genes implicated in translation. To identify the mechanisms responsible for mRNA pseudouridylation, we genetically deleted candidate pseudouridine synthase (Pus enzymes and reconstituted their activities in vitro. These experiments demonstrated that the Pus1 enzyme was necessary and sufficient for pseudouridylation of RPL11a mRNA, whereas Pus4 modified TEF1 mRNA, and Pus6 pseudouridylated KAR2 mRNA. Finally, we determined that modification of RPL11a at Ψ -68 was observed in RNA from the related yeast S. mikitae, and Ψ -239 in TEF1 mRNA was maintained in S. mikitae as well as S. pombe, indicating that these pseudouridylations are ancient, evolutionarily conserved RNA modifications. This work establishes that site-specific pseudouridylation of eukaryotic mRNAs is a genetically programmed RNA modification that naturally occurs in multiple yeast transcripts via distinct mechanisms, suggesting that mRNA pseudouridylation may provide an important novel regulatory function. The approach and strategies that we report here should be generally applicable to the discovery of pseudouridylation, or other RNA modifications, in diverse biological contexts.

  10. Transcriptome-wide mapping of pseudouridines: pseudouridine synthases modify specific mRNAs in S. cerevisiae.

    Science.gov (United States)

    Lovejoy, Alexander F; Riordan, Daniel P; Brown, Patrick O

    2014-01-01

    We developed a novel technique, called pseudouridine site identification sequencing (PSI-seq), for the transcriptome-wide mapping of pseudouridylation sites with single-base resolution from cellular RNAs based on the induced termination of reverse transcription specifically at pseudouridines following CMCT treatment. PSI-seq analysis of RNA samples from S. cerevisiae correctly detected all of the 43 known pseudouridines in yeast 18S and 25S ribosomal RNA with high specificity. Moreover, application of PSI-seq to the yeast transcriptome revealed the presence of site-specific pseudouridylation within dozens of mRNAs, including RPL11a, TEF1, and other genes implicated in translation. To identify the mechanisms responsible for mRNA pseudouridylation, we genetically deleted candidate pseudouridine synthase (Pus) enzymes and reconstituted their activities in vitro. These experiments demonstrated that the Pus1 enzyme was necessary and sufficient for pseudouridylation of RPL11a mRNA, whereas Pus4 modified TEF1 mRNA, and Pus6 pseudouridylated KAR2 mRNA. Finally, we determined that modification of RPL11a at Ψ -68 was observed in RNA from the related yeast S. mikitae, and Ψ -239 in TEF1 mRNA was maintained in S. mikitae as well as S. pombe, indicating that these pseudouridylations are ancient, evolutionarily conserved RNA modifications. This work establishes that site-specific pseudouridylation of eukaryotic mRNAs is a genetically programmed RNA modification that naturally occurs in multiple yeast transcripts via distinct mechanisms, suggesting that mRNA pseudouridylation may provide an important novel regulatory function. The approach and strategies that we report here should be generally applicable to the discovery of pseudouridylation, or other RNA modifications, in diverse biological contexts.

  11. Role of cysteine residues in pseudouridine synthases of different families.

    Science.gov (United States)

    Ramamurthy, V; Swann, S L; Spedaliere, C J; Mueller, E G

    1999-10-01

    The pseudouridine synthases catalyze the isomerization of uridine to pseudouridine in RNA molecules. An attractive mechanism was proposed based on that of thymidylate synthase, in which the thiol(ate) group of a cysteine side chain serves as the nucleophile in a Michael addition to C6 of the isomerized uridine. Such a role for cysteine in the pseudouridine synthase TruA (also named Psi synthase I) has been discredited by site-directed mutagenesis, but sequence alignments have led to the conclusion that there are four distinct "families" of pseudouridine synthases that share no statistically significant global sequence similarity. It was, therefore, necessary to probe the role of cysteine residues in pseudouridine synthases of the families that do not include TruA. We examined the enzymes RluA and TruB, which are members of different families than TruA and each other. Substitution of cysteine for amino acids with nonnucleophilic side chains did not significantly alter the catalytic activity of either pseudouridine synthase. We conclude, therefore, that neither TruB nor RluA require thiol(ate) groups to effect catalysis, excluding their participation in a Michael addition to C6 of uridine, although not eliminating that mechanism (with an alternate nucleophile) from future consideration.

  12. The pseudouridine synthases: revisiting a mechanism that seemed settled.

    Science.gov (United States)

    Spedaliere, Christopher J; Ginter, Joy M; Johnston, Murray V; Mueller, Eugene G

    2004-10-13

    RNA containing 5-fluorouridine, [f 5U]RNA, has been used as a mechanistic probe for the pseudouridine synthases, which convert uridine in RNA to its C-glycoside isomer, pseudouridine. Hydrated products of f 5U were attributed to ester hydrolysis of a covalent complex between an essential aspartic acid residue and f 5U, and the results were construed as strong support for a mechanism involving Michael addition by the aspartic acid residue. Labeling studies with [18O]water are now reported that rule out such ester hydrolysis in one pseudouridine synthase, TruB. The aspartic acid residue does not become labeled, and the hydroxyl group in the hydrated product of f 5U derives directly from solvent. The hydrated product, therefore, cannot be construed to support Michael addition during the conversion of uridine to pseudouridine, but the results do not rule out such a mechanism. A hypothesis is offered for the seemingly disparate behavior of different pseudouridine synthases toward [f 5U]RNA.

  13. Novel predicted RNA-binding domains associated with the translation machinery.

    Science.gov (United States)

    Aravind, L; Koonin, E V

    1999-03-01

    Two previously undetected domains were identified in a variety of RNA-binding proteins, particularly RNA-modifying enzymes, using methods for sequence profile analysis. A small domain consisting of 60-65 amino acid residues was detected in the ribosomal protein S4, two families of pseudouridine synthases, a novel family of predicted RNA methylases, a yeast protein containing a pseudouridine synthetase and a deaminase domain, bacterial tyrosyl-tRNA synthetases, and a number of uncharacterized, small proteins that may be involved in translation regulation. Another novel domain, designated PUA domain, after PseudoUridine synthase and Archaeosine transglycosylase, was detected in archaeal and eukaryotic pseudouridine synthases, archaeal archaeosine synthases, a family of predicted ATPases that may be involved in RNA modification, a family of predicted archaeal and bacterial rRNA methylases. Additionally, the PUA domain was detected in a family of eukaryotic proteins that also contain a domain homologous to the translation initiation factor eIF1/SUI1; these proteins may comprise a novel type of translation factors. Unexpectedly, the PUA domain was detected also in bacterial and yeast glutamate kinases; this is compatible with the demonstrated role of these enzymes in the regulation of the expression of other genes. We propose that the S4 domain and the PUA domain bind RNA molecules with complex folded structures, adding to the growing collection of nucleic acid-binding domains associated with DNA and RNA modification enzymes. The evolution of the translation machinery components containing the S4, PUA, and SUI1 domains must have included several events of lateral gene transfer and gene loss as well as lineage-specific domain fusions.

  14. Functional and Structural Impact of Target Uridine Substitutions on the H/ACA Ribonucleoprotein Particle Pseudouridine Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jing; Liang, Bo; Li, Hong (FSU)

    2010-09-17

    Box H/ACA ribonucleoprotein protein particles catalyze the majority of pseudouridylation in functional RNA. Different from stand alone pseudouridine synthases, the RNP pseudouridine synthase comprises multiple protein subunits and an RNA subunit. Previous studies showed that each subunit, regardless its location, is sensitive to the step of subunit placement at the catalytic center and potentially to the reaction status of the substrate. Here we describe the impact of chemical substitutions of target uridine on enzyme activity and structure. We found that 3-methyluridine in place of uridine inhibited its isomerization while 2{prime}-deoxyuridine or 4-thiouridine did not. Significantly, crystal structures of an archaeal box H/ACA RNP bound with the nonreactive and the two postreactive substrate analogues showed only subtle structural changes throughout the assembly except for a conserved tyrosine and a substrate anchoring loop of Cbf5. Our results suggest a potential role of these elements and the subunit that contacts them in substrate binding and product release.

  15. Complete architecture of the archaeal RNA polymerase open complex from single-molecule FRET and NPS

    Science.gov (United States)

    Nagy, Julia; Grohmann, Dina; Cheung, Alan C. M.; Schulz, Sarah; Smollett, Katherine; Werner, Finn; Michaelis, Jens

    2015-01-01

    The molecular architecture of RNAP II-like transcription initiation complexes remains opaque due to its conformational flexibility and size. Here we report the three-dimensional architecture of the complete open complex (OC) composed of the promoter DNA, TATA box-binding protein (TBP), transcription factor B (TFB), transcription factor E (TFE) and the 12-subunit RNA polymerase (RNAP) from Methanocaldococcus jannaschii. By combining single-molecule Förster resonance energy transfer and the Bayesian parameter estimation-based Nano-Positioning System analysis, we model the entire archaeal OC, which elucidates the path of the non-template DNA (ntDNA) strand and interaction sites of the transcription factors with the RNAP. Compared with models of the eukaryotic OC, the TATA DNA region with TBP and TFB is positioned closer to the surface of the RNAP, likely providing the mechanism by which DNA melting can occur in a minimal factor configuration, without the dedicated translocase/helicase encoding factor TFIIH.

  16. Pseudouridines and pseudouridine synthases of the ribosome.

    Science.gov (United States)

    Ofengand, J; Malhotra, A; Remme, J; Gutgsell, N S; Del Campo, M; Jean-Charles, S; Peil, L; Kaya, Y

    2001-01-01

    psi are ubiquitous in ribosomal RNA. Eubacteria, Archaea, and eukaryotes all contain psi, although their number varies widely, with eukaryotes having the most. The small ribosomal subunit can apparently do without psi in some organisms, even though others have as many as 40 or more. Large subunits appear to need at least one psi but can have up to 50-60. psi is made by a set of site-specific enzymes in eubacteria, and in eukaryotes by a single enzyme complexed with auxiliary proteins and specificity-conferring guide RNAs. The mechanism is not known in Archaea, but based on an analysis of the kinds of psi synthases found in sequenced archaeal genomes, it is likely to involve use of guide RNAs. All psi synthases can be classified into one of four related groups, virtually all of which have a conserved aspartate residue in a conserved sequence motif. The aspartate is essential for psi formation in all twelve synthases examined so far. When the need for psi in E. coli was examined, the only synthase whose absence caused a major decrease in growth rate under normal conditions was RluD, the synthase that makes psi 1911, psi 1915, and psi 1917 in the helix 69 end-loop. This growth defect was the result of a major failure in assembly of the large ribosomal subunit. The defect could be prevented by supplying the rluD structural gene in trans, and also by providing a point mutant gene that made a synthase unable to make psi. Therefore, the RluD synthase protein appears to be directly involved in 50S subunit assembly, possibly as an RNA chaperone, and this activity is independent of its ability to form psi. This result is not without precedent. Depletion of PET56, a 2'-O-methyltransferase specific for G2251 (E. coli numbering) in yeast mitochondria virtually blocks 50S subunit assembly and mitochondrial function (Sirum-Connolly et al. 1995), but the methylation activity of the enzyme is not required (T. Mason, pers. comm.). The absence of FtsJ, a heat shock protein that makes

  17. Crystal structure of the RluD pseudouridine synthase catalytic module, an enzyme that modifies 23S rRNA and is essential for normal cell growth of Escherichia coli.

    Science.gov (United States)

    Sivaraman, J; Iannuzzi, Pietro; Cygler, Miroslaw; Matte, Allan

    2004-01-01

    Pseudouridine (5-beta-D-ribofuranosyluracil, Psi) is the most commonly found modified base in RNA. Conversion of uridine to Psi is performed enzymatically in both prokaryotes and eukaryotes by pseudouridine synthases (EC 4.2.1.70). The Escherichia coli Psi-synthase RluD modifies uridine to Psi at positions 1911, 1915 and 1917 within 23S rRNA. RluD also possesses a second function related to proper assembly of the 50S ribosomal subunit that is independent of Psi-synthesis. Here, we report the crystal structure of the catalytic module of RluD (residues 68-326; DeltaRluD) refined at 1.8A to a final R-factor of 21.8% (R(free)=24.3%). DeltaRluD is a monomeric enzyme having an overall mixed alpha/beta fold. The DeltaRluD molecule consists of two subdomains, a catalytic subdomain and C-terminal subdomain with the RNA-binding cleft formed by loops extending from the catalytic sub-domain. The catalytic sub-domain of DeltaRluD has a similar fold as in TruA, TruB and RsuA, with the location of the RNA-binding cleft, active-site and conserved, catalytic Asp residue superposing in all four structures. Superposition of the crystal structure of TruB bound to a T-stem loop with RluD reveals that similar RNA-protein interactions for the flipped-out uridine base would exist in both structures, implying that base-flipping is necessary for catalysis. This observation also implies that the specificity determinants for site-specific RNA-binding and recognition likely reside in parts of RluD beyond the active site.

  18. The Pseudouridine Synthases Proceed through a Glycal Intermediate.

    Science.gov (United States)

    Veerareddygari, Govardhan Reddy; Singh, Sanjay K; Mueller, Eugene G

    2016-06-29

    The pseudouridine synthases isomerize (U) in RNA to pseudouridine (Ψ), and the mechanism that they follow has long been a question of interest. The recent elucidation of a product of the mechanistic probe 5-fluorouridine that had been epimerized to the arabino isomer suggested that the Ψ synthases might operate through a glycal intermediate formed by deprotonation of C2'. When that position in substrate U is deuterated, a primary kinetic isotope effect is observed, which indisputably indicates that the proposed deprotonation occurs during the isomerization of U to Ψ and establishes the mechanism followed by the Ψ synthases.

  19. Pseudouridine-deficient transfer RNAs from Escherichia coli B and their use as substrates for pseudouridine synthetase.

    Science.gov (United States)

    Kwong, L K; Moore, V G; Kaiser, I I

    1977-09-25

    Transfer RNAs isolated from Escherichia coli B grown in the presence of 2-thiouracil are deficient in pseudouridine. Much of this deficiency is from the T psi C region, which has only about 50% of its normal pseudouridine content. The other modified nucleoside from this region, ribothymidine, is reduced by only about 10%. Studies showed that 2-thiouracil is incoproated into the RNA of E. coli during growth in the presence of the analog. This incorporation appears to result from the replacement of uracil, occur in a random manner, and involve all RNA species. The extent of incorporation varies from 1 to 3 mol %, depending upon the preparation and RNA species examined. Electrophoresis on polyacrylamide gels and chromatography on Sephadex G-75 and reverse phase (Systen 5) columns of normal and 2-thiouracil-containing tRNAs revealed no profile differences. No accumulation of any precursor tRNA in the thiopyrimidine-treated cells is found. A partial recovery of the pseudouridine content of 2-thiouracil-containing tRNAs can be achieved in vivo by removal of the 2-thiouracil from the culture media. These transfer RNAs have also been used as substrates to study the properties of a partially purified preparation of pseudouridine synthetase II invitro and should be useful as substrates in the further purification of this enzyme. PMID:330528

  20. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea

    Science.gov (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.

    2014-12-01

    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  1. Formation of a stalled early intermediate of pseudouridine synthesis monitored by real-time FRET.

    Science.gov (United States)

    Hengesbach, Martin; Voigts-Hoffmann, Felix; Hofmann, Benjamin; Helm, Mark

    2010-03-01

    Pseudouridine is the most abundant of more than 100 chemically distinct natural ribonucleotide modifications. Its synthesis consists of an isomerization reaction of a uridine residue in the RNA chain and is catalyzed by pseudouridine synthases. The unusual reaction mechanism has become the object of renewed research effort, frequently involving replacement of the substrate uridines with 5-fluorouracil (f(5)U). f(5)U is known to be a potent inhibitor of pseudouridine synthase activity, but the effect varies among the target pseudouridine synthases. Derivatives of f(5)U have previously been detected, which are thought to be either hydrolysis products of covalent enzyme-RNA adducts, or isomerization intermediates. Here we describe the interaction of pseudouridine synthase 1 (Pus1p) with f(5)U-containing tRNA. The interaction described is specific to Pus1p and position 27 in the tRNA anticodon stem, but the enzyme neither forms a covalent adduct nor stalls at a previously identified reaction intermediate of f(5)U. The f(5)U27 residue, as analyzed by a DNAzyme-based assay using TLC and mass spectrometry, displayed physicochemical properties unaltered by the reversible interaction with Pus1p. Thus, Pus1p binds an f(5)U-containing substrate, but, in contrast to other pseudouridine synthases, leaves the chemical structure of f(5)U unchanged. The specific, but nonproductive, interaction demonstrated here thus constitutes an intermediate of Pus turnover, stalled by the presence of f(5)U in an early state of catalysis. Observation of the interaction of Pus1p with fluorescence-labeled tRNA by a real-time readout of fluorescence anisotropy and FRET revealed significant structural distortion of f(5)U-tRNA structure in the stalled intermediate state of pseudouridine catalysis.

  2. A cell-free yellow lupin extract containing activities of pseudouridine 35 and 55 synthases.

    Science.gov (United States)

    Pieńkowska, J; Wrzesiński, J; Szweykowska-Kulińska, Z

    1998-01-01

    Plant cytoplasmic tyrosine tRNA was pseudouridylated at three different positions: 35, 39 and 55. These pseudouridines were introduced by three different enzymes--pseudouridine synthases. Variants of the Arabidopsis thaliana pre-tRNA(Tyr) were constructed that allow to monitor specifically pseudouridylation at different nucleotide positions. Using such RNAs to assay pseudouridine synthesis we have prepared an extract from Lupinus luteus cv. Ventus seeds containing activities of at least psi35 and psi55 synthases. This is the first report describing the preparation of the lupin seed extract that specifically modifies plant pre-tRNA(Tyr) transcribed by T7 RNA polymerase. U35 is converted to psi35 only in an intron-dependent manner, while pseudouridylation of U55 is insensitive to the presence or absence of an intron.

  3. Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity

    OpenAIRE

    Charpentier, Emmanuelle; Richter, Hagen; van der Oost, John; White, Malcolm F

    2015-01-01

    CRISPR-Cas is an RNA-mediated adaptive immune system that defends bacteria and archaea against mobile genetic elements. Short mature CRISPR RNAs (crRNAs) are key elements in the interference step of the immune pathway. A CRISPR array composed of a series of repeats interspaced by spacer sequences acquired from invading mobile genomes is transcribed as a precursor crRNA (pre-crRNA) molecule. This pre-crRNA undergoes one or two maturation steps to generate the mature crRNAs that guide CRISPR-as...

  4. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  5. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    Science.gov (United States)

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)].

  6. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  7. Transcriptome-wide mapping of 5-methylcytidine RNA modifications in bacteria, archaea, and yeast reveals m5C within archaeal mRNAs.

    Directory of Open Access Journals (Sweden)

    Sarit Edelheit

    2013-06-01

    Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.

  8. Functional interaction of yeast and human TATA-binding proteins with an archaeal RNA polymerase and promoter.

    OpenAIRE

    Wettach, J; Gohl, H P; Tschochner, H; Thomm, M

    1995-01-01

    TATA boxes are common structural features of eucaryal class II and archaeal promoters. In addition, a gene encoding a polypeptide with sequence similarity to eucaryal TATA-binding protein (TBP) has recently been detected in Archaea, but its relationship to the archaeal transcription factors A (aTFA) and B (aTFB) was unclear. Here, we demonstrate that yeast and human TBP can substitute for aTFB in a Methanococcus-derived archaeal cell-free transcription system. Template-commitment studies show...

  9. Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity

    NARCIS (Netherlands)

    Charpentier, Emmanuelle; Richter, Hagen; Oost, van der John; White, Malcolm F.

    2015-01-01

    CRISPR-Cas is an RNA-mediated adaptive immune system that defends bacteria and archaea against mobile genetic elements. Short mature CRISPR RNAs (crRNAs) are key elements in the interference step of the immune pathway. A CRISPR array composed of a series of repeats interspaced by spacer sequences

  10. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    Science.gov (United States)

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  11. An archaeal CRISPR type III-B system exhibiting distinctive RNA targeting features and mediating dual RNA and DNA interference

    DEFF Research Database (Denmark)

    Peng, Wenfang; Feng, Mingxia; Feng, Xu;

    2015-01-01

    CRISPR-Cas systems provide a small RNA-based mechanism to defend against invasive genetic elements in archaea and bacteria. To investigate the in vivo mechanism of RNA interference by two type III-B systems (Cmr-α and Cmr-β) in Sulfolobus islandicus, a genetic assay was developed using plasmids...... carrying an artificial mini-CRISPR (AC) locus with a single spacer. After pAC plasmids were introduced into different strains, Northern analyses confirmed that mature crRNAs were produced from the plasmid-borne CRISPR loci, which then guided gene silencing to target gene expression. Spacer mutagenesis....... islandicus Cmr-α mediated transcription-dependent DNA interference, the Cmr-α constitutes the first CRISPR system exhibiting dual targeting of RNA and DNA....

  12. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    Directory of Open Access Journals (Sweden)

    Jin-Kyung Hong

    Full Text Available Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7% belonged to the MG-I and SCG, which together contained most (93.9% of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and 95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and ecological niche of Thaumarchaeota.

  13. Pre-steady-state kinetic analysis of the three Escherichia coli pseudouridine synthases TruB, TruA, and RluA reveals uniformly slow catalysis.

    Science.gov (United States)

    Wright, Jaden R; Keffer-Wilkes, Laura C; Dobing, Selina R; Kothe, Ute

    2011-12-01

    Pseudouridine synthases catalyze formation of the most abundant modification of functional RNAs by site-specifically isomerizing uridines to pseudouridines. While the structure and substrate specificity of these enzymes have been studied in detail, the kinetic and the catalytic mechanism of pseudouridine synthases remain unknown. Here, the first pre-steady-state kinetic analysis of three Escherichia coli pseudouridine synthases is presented. A novel stopped-flow absorbance assay revealed that substrate tRNA binding by TruB takes place in two steps with an overall rate of 6 sec(-1). In order to observe catalysis of pseudouridine formation directly, the traditional tritium release assay was adapted for the quench-flow technique, allowing, for the first time, observation of a single round of pseudouridine formation. Thereby, the single-round rate constant of pseudouridylation (k(Ψ)) by TruB was determined to be 0.5 sec(-1). This rate constant is similar to the k(cat) obtained under multiple-turnover conditions in steady-state experiments, indicating that catalysis is the rate-limiting step for TruB. In order to investigate if pseudouridine synthases are characterized by slow catalysis in general, the rapid kinetic quench-flow analysis was also performed with two other E. coli enzymes, RluA and TruA, which displayed rate constants of pseudouridine formation of 0.7 and 0.35 sec(-1), respectively. Hence, uniformly slow catalysis might be a general feature of pseudouridine synthases that share a conserved catalytic domain and supposedly use the same catalytic mechanism.

  14. The handling of the mechanistic probe 5-fluorouridine by the pseudouridine synthase TruA and its consistency with the handling of the same probe by the pseudouridine synthases TruB and RluA.

    Science.gov (United States)

    McDonald, Marguerite K; Miracco, Edward J; Chen, Junjun; Xie, Yizhou; Mueller, Eugene G

    2011-01-25

    RNA containing 5-fluorouridine (F(5)U) had previously been used to examine the mechanism of the pseudouridine synthase TruA, formerly known as pseudouridine synthase I [Gu et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96, 14270-14275]. From that work, it was reasonably concluded that the pseudouridine synthases proceed via a mechanism involving a Michael addition by an active site aspartic acid residue to the pyrimidine ring of uridine or F(5)U. Those conclusions rested on the assumption that the hydrate of F(5)U was obtained after digestion of the product RNA and that hydration resulted from hydrolysis of the ester intermediate between the aspartic acid residue and F(5)U. As reported here, (18)O labeling definitively demonstrates that ester hydrolysis does not give rise to the observed hydrated product and that digestion generates not the expected mononucleoside product but rather a dinucleotide between a hydrated isomer of F(5)U and the following nucleoside in RNA. The discovery that digestion products are dinucleotides accounts for the previously puzzling differences in the isolated products obtained following the action of the pseudouridine synthases TruB and RluA on F(5)U in RNA.

  15. Pyrosequencing of mcrA and archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen communities in anaerobic digesters.

    Science.gov (United States)

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng; Lee, Patrick K H

    2015-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield.

  16. An arginine-aspartate network in the active site of bacterial TruB is critical for catalyzing pseudouridine formation.

    Science.gov (United States)

    Friedt, Jenna; Leavens, Fern M V; Mercier, Evan; Wieden, Hans-Joachim; Kothe, Ute

    2014-04-01

    Pseudouridine synthases introduce the most common RNA modification and likely use the same catalytic mechanism. Besides a catalytic aspartate residue, the contributions of other residues for catalysis of pseudouridine formation are poorly understood. Here, we have tested the role of a conserved basic residue in the active site for catalysis using the bacterial pseudouridine synthase TruB targeting U55 in tRNAs. Substitution of arginine 181 with lysine results in a 2500-fold reduction of TruB's catalytic rate without affecting tRNA binding. Furthermore, we analyzed the function of a second-shell aspartate residue (D90) that is conserved in all TruB enzymes and interacts with C56 of tRNA. Site-directed mutagenesis, biochemical and kinetic studies reveal that this residue is not critical for substrate binding but influences catalysis significantly as replacement of D90 with glutamate or asparagine reduces the catalytic rate 30- and 50-fold, respectively. In agreement with molecular dynamics simulations of TruB wild type and TruB D90N, we propose an electrostatic network composed of the catalytic aspartate (D48), R181 and D90 that is important for catalysis by fine-tuning the D48-R181 interaction. Conserved, negatively charged residues similar to D90 are found in a number of pseudouridine synthases, suggesting that this might be a general mechanism.

  17. Crystallization and preliminary X-ray diffraction analysis of an archaeal tRNA-modification enzyme, TiaS, complexed with tRNAIle2 and ATP

    International Nuclear Information System (INIS)

    A. fulgidus TiaS was cocrystallized with tRNAIle2 and ATP and X-ray diffraction data were collected to 2.9 Å resolution using a synchrotron-radiation source. The cytidine at the first anticodon position of archaeal tRNAIle2, which decodes the isoleucine AUA codon, is modified to 2-agmatinylcytidine (agm2C) to guarantee the fidelity of protein biosynthesis. This post-transcriptional modification is catalyzed by tRNAIle-agm2C synthetase (TiaS) using ATP and agmatine as substrates. Archaeoglobus fulgidus TiaS was overexpressed in Escherichia coli cells and purified. tRNAIle2 was prepared by in vitro transcription with T7 RNA polymerase. TiaS was cocrystallized with both tRNAIle2 and ATP by the vapour-diffusion method. The crystals of the TiaS–tRNAIle2–ATP complex diffracted to 2.9 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the primitive hexagonal space group P3221, with unit-cell parameters a = b = 131.1, c = 86.6 Å. The asymmetric unit is expected to contain one TiaS–tRNAIle2–ATP complex, with a Matthews coefficient of 2.8 Å3 Da−1 and a solvent content of 61%

  18. The UCSC Archaeal Genome Browser: 2012 update.

    Science.gov (United States)

    Chan, Patricia P; Holmes, Andrew D; Smith, Andrew M; Tran, Danny; Lowe, Todd M

    2012-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of the vertebrate UCSC Genome Browser, but also integrates archaeal and bacterial-specific tracks with a few graphic display enhancements. The browser currently contains 115 archaeal genomes, plus 31 genomes of viruses known to infect archaea. Some of the recently developed or enhanced tracks visualize data from published high-throughput RNA-sequencing studies, the NCBI Conserved Domain Database, sequences from pre-genome sequencing studies, predicted gene boundaries from three different protein gene prediction algorithms, tRNAscan-SE gene predictions with RNA secondary structures and CRISPR locus predictions. We have also developed a companion resource, the Archaeal COG Browser, to provide better search and display of arCOG gene function classifications, including their phylogenetic distribution among available archaeal genomes.

  19. Crystal structures of the catalytic domains of pseudouridine synthases RluC and RluD from Escherichia coli.

    Science.gov (United States)

    Mizutani, Kenji; Machida, Yoshitaka; Unzai, Satoru; Park, Sam-Yong; Tame, Jeremy R H

    2004-04-20

    The most frequent modification of RNA, the conversion of uridine bases to pseudouridines, is found in all living organisms and often in highly conserved locations in ribosomal and transfer RNA. RluC and RluD are homologous enzymes which each convert three specific uridine bases in Escherichia coli ribosomal 23S RNA to pseudouridine: bases 955, 2504, and 2580 in the case of RluC and 1911, 1915, and 1917 in the case of RluD. Both have an N-terminal S4 RNA binding domain. While the loss of RluC has little phenotypic effect, loss of RluD results in a much reduced growth rate. We have determined the crystal structures of the catalytic domain of RluC, and full-length RluD. The S4 domain of RluD appears to be highly flexible or unfolded and is completely invisible in the electron density map. Despite the conserved topology shared by the two proteins, the surface shape and charge distribution are very different. The models suggest significant differences in substrate binding by different pseudouridine synthases.

  20. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali;

    2015-01-01

    viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered...

  1. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    DEFF Research Database (Denmark)

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U...

  2. Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA.

    Science.gov (United States)

    Schwartz, Schraga; Bernstein, Douglas A; Mumbach, Maxwell R; Jovanovic, Marko; Herbst, Rebecca H; León-Ricardo, Brian X; Engreitz, Jesse M; Guttman, Mitchell; Satija, Rahul; Lander, Eric S; Fink, Gerald; Regev, Aviv

    2014-09-25

    Pseudouridine is the most abundant RNA modification, yet except for a few well-studied cases, little is known about the modified positions and their function(s). Here, we develop Ψ-seq for transcriptome-wide quantitative mapping of pseudouridine. We validate Ψ-seq with spike-ins and de novo identification of previously reported positions and discover hundreds of unique sites in human and yeast mRNAs and snoRNAs. Perturbing pseudouridine synthases (PUS) uncovers which pseudouridine synthase modifies each site and their target sequence features. mRNA pseudouridinylation depends on both site-specific and snoRNA-guided pseudouridine synthases. Upon heat shock in yeast, Pus7p-mediated pseudouridylation is induced at >200 sites, and PUS7 deletion decreases the levels of otherwise pseudouridylated mRNA, suggesting a role in enhancing transcript stability. rRNA pseudouridine stoichiometries are conserved but reduced in cells from dyskeratosis congenita patients, where the PUS DKC1 is mutated. Our work identifies an enhanced, transcriptome-wide scope for pseudouridine and methods to dissect its underlying mechanisms and function.

  3. Box C/D RNA guides for the ribose methylation of archaeal tRNAs. The tRNATrp intron guides the formation of two ribose-methylated nucleosides in the mature tRNATrp

    Science.gov (United States)

    d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Gaspin, Christine; Bachellerie, Jean-Pierre

    2001-01-01

    Following a search of the Pyrococcus genomes for homologs of eukaryotic methylation guide small nucleolar RNAs, we have experimentally identified in Pyrococcus abyssi four novel box C/D small RNAs predicted to direct 2′-O-ribose methylations onto the first position of the anticodon in tRNALeu(CAA), tRNALeu(UAA), elongator tRNAMet and tRNATrp, respectively. Remarkably, one of them corresponds to the intron of its presumptive target, pre-tRNATrp. This intron is predicted to direct in cis two distinct ribose methylations within the unspliced tRNA precursor, not only onto the first position of the anticodon in the 5′ exon but also onto position 39 (universal tRNA numbering) in the 3′ exon. The two intramolecular RNA duplexes expected to direct methylation, which both span an exon–intron junction in pre-tRNATrp, are phylogenetically conserved in euryarchaeotes. We have experimentally confirmed the predicted guide function of the box C/D intron in halophile Haloferax volcanii by mutagenesis analysis, using an in vitro splicing/RNA modification assay in which the two cognate ribose methylations of pre-tRNATrp are faithfully reproduced. Euryarchaeal pre-tRNATrp should provide a unique system to further investigate the molecular mechanisms of RNA-guided ribose methylation and gain new insights into the origin and evolution of the complex family of archaeal and eukaryotic box C/D small RNAs. PMID:11713301

  4. Archaeal DNA replication.

    Science.gov (United States)

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  5. Dissecting the roles of a strictly conserved tyrosine in substrate recognition and catalysis by pseudouridine 55 synthase.

    Science.gov (United States)

    Phannachet, Kulwadee; Elias, Youssef; Huang, Raven H

    2005-11-29

    Sequence alignment of the TruA, TruB, RsuA, and RluA families of pseudouridine synthases (PsiS) identifies a strictly conserved aspartic acid, which has been shown to be the critical nucleophile for the PsiS-catalyzed formation of pseudouridine (Psi). However, superposition of the representative structures from these four families of enzymes identifies two additional amino acids, a lysine or an arginine (K/R) and a tyrosine (Y), from a K/RxY motif that are structurally conserved in the active site. We have created a series of Thermotoga maritima and Escherichia coli pseudouridine 55 synthase (Psi55S) mutants in which the conserved Y is mutated to other amino acids. A new crystal structure of the T. maritima Psi55S Y67F mutant in complex with a 5FU-RNA at 2.4 A resolution revealed formation of 5-fluoro-6-hydroxypseudouridine (5FhPsi), the same product previously seen in wild-type Psi55S-5FU-RNA complex structures. HPLC analysis confirmed efficient formation of 5FhPsi by both Psi55S Y67F and Y67L mutants but to a much lesser extent by the Y67A mutant when 5FU-RNA substrate was used. However, both HPLC analysis and a tritium release assay indicated that these mutants had no detectable enzymatic activity when the natural RNA substrate was used. The combined structural and mutational studies lead us to propose that the side chain of the conserved tyrosine in these four families of PsiS plays a dual role within the active site, maintaining the structural integrity of the active site through its hydrophobic phenyl ring and acting as a general base through its OH group for the proton abstraction required in the last step of PsiS-catalyzed formation of Psi.

  6. A factor related to pseudouridine synthases is required for chloroplast group II intron trans-splicing in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Perron, K; Goldschmidt-Clermont, M; Rochaix, J D

    1999-11-15

    In Chlamydomonas reinhardtii, the psaA mRNA is assembled by a process involving two steps of trans-splicing that remove two group II introns and give rise to the mature mRNA. The products of at least 14 nuclear genes and one chloroplast gene (tscA) are necessary for this process. We have cloned Maa2, one of the nuclear genes involved in trans-splicing of the second intron. Maa2 encodes a protein with similarity to conserved domains of pseudouridine synthases, but mutagenesis of putative catalytic residues showed that this activity may not be required for trans-splicing of psaA RNA. Although it is not clear whether the pseudouridine synthase activity has been maintained in Maa2, it is possible that this enzyme was recruited during evolution as an RNA chaperone for folding or stabilizing the psaA intron. The Maa2 protein appears to be associated through ionic interactions with a low density membrane system in the chloroplast that also contains RNA-binding proteins involved in translation.

  7. Pseudouridine synthases: four families of enzymes containing a putative uridine-binding motif also conserved in dUTPases and dCTP deaminases.

    Science.gov (United States)

    Koonin, E V

    1996-06-15

    Using a combination of several methods for protein sequence comparison and motif analysis, it is shown that the four recently described pseudouridine syntheses with different specificities belong to four distinct families. Three of these families share two conserved motifs that are likely to be directly involved in catalysis. One of these motifs is detected also in two other families of enzymes that specifically bind uridine, namely deoxycitidine triphosphate deaminases and deoxyuridine triphosphatases. It is proposed that this motif is an essential part of the uridine-binding site. Two of the pseudouridine syntheses, one of which modifies the anticodon arm of tRNAs and the other is predicted to modify a portion of the large ribosomal subunit RNA belonging to the peptidyltransferase center, are encoded in all extensively sequenced genomes, including the 'minimal' genome of Mycoplasma genitalium. These particular RNA modifications and the respective enzymes are likely to be essential for the functioning of any cell.

  8. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides.

    Science.gov (United States)

    Hudson, Graham A; Bloomingdale, Richard J; Znosko, Brent M

    2013-11-01

    Pseudouridine (Ψ) is the most common noncanonical nucleotide present in naturally occurring RNA and serves a variety of roles in the cell, typically appearing where structural stability is crucial to function. Ψ residues are isomerized from native uridine residues by a class of highly conserved enzymes known as pseudouridine synthases. In order to quantify the thermodynamic impact of pseudouridylation on U-A base pairs, 24 oligoribonucleotides, 16 internal and eight terminal Ψ-A oligoribonucleotides, were thermodynamically characterized via optical melting experiments. The thermodynamic parameters derived from two-state fits were used to generate linearly independent parameters for use in secondary structure prediction algorithms using the nearest-neighbor model. On average, internally pseudouridylated duplexes were 1.7 kcal/mol more stable than their U-A counterparts, and terminally pseudouridylated duplexes were 1.0 kcal/mol more stable than their U-A equivalents. Due to the fact that Ψ-A pairs maintain the same Watson-Crick hydrogen bonding capabilities as the parent U-A pair in A-form RNA, the difference in stability due to pseudouridylation was attributed to two possible sources: the novel hydrogen bonding capabilities of the newly relocated imino group as well as the novel stacking interactions afforded by the electronic configuration of the Ψ residue. The newly derived nearest-neighbor parameters for Ψ-A base pairs may be used in conjunction with other nearest-neighbor parameters for accurately predicting the most likely secondary structure of A-form RNA containing Ψ-A base pairs.

  9. Environmental shaping of sponge associated archaeal communities.

    Directory of Open Access Journals (Sweden)

    Aline S Turque

    Full Text Available BACKGROUND: Archaea are ubiquitous symbionts of marine sponges but their ecological roles and the influence of environmental factors on these associations are still poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We compared the diversity and composition of archaea associated with seawater and with the sponges Hymeniacidon heliophila, Paraleucilla magna and Petromica citrina in two distinct environments: Guanabara Bay, a highly impacted estuary in Rio de Janeiro, Brazil, and the nearby Cagarras Archipelago. For this we used metagenomic analyses of 16S rRNA and ammonia monooxygenase (amoA gene libraries. Hymeniacidon heliophila was more abundant inside the bay, while P. magna was more abundant outside and P. citrina was only recorded at the Cagarras Archipelago. Principal Component Analysis plots (PCA generated using pairwise unweighted UniFrac distances showed that the archaeal community structure of inner bay seawater and sponges was different from that of coastal Cagarras Archipelago. Rarefaction analyses showed that inner bay archaeaoplankton were more diverse than those from the Cagarras Archipelago. Only members of Crenarchaeota were found in sponge libraries, while in seawater both Crenarchaeota and Euryarchaeota were observed. Although most amoA archaeal genes detected in this study seem to be novel, some clones were affiliated to known ammonia oxidizers such as Nitrosopumilus maritimus and Cenarchaeum symbiosum. CONCLUSION/SIGNIFICANCE: The composition and diversity of archaeal communities associated with pollution-tolerant sponge species can change in a range of few kilometers, probably influenced by eutrophication. The presence of archaeal amoA genes in Porifera suggests that Archaea are involved in the nitrogen cycle within the sponge holobiont, possibly increasing its resistance to anthropogenic impacts. The higher diversity of Crenarchaeota in the polluted area suggests that some marine sponges are able to change the composition

  10. RNA-modifying enzymes.

    Science.gov (United States)

    Ferré-D'Amaré, Adrian R

    2003-02-01

    A bewildering number of post-transcriptional modifications are introduced into cellular RNAs by enzymes that are often conserved among archaea, bacteria and eukaryotes. The modifications range from those with well-understood functions, such as tRNA aminoacylation, to widespread but more mysterious ones, such as pseudouridylation. Recent structure determinations have included two types of RNA nucleobase modifying enzyme: pseudouridine synthases and tRNA guanine transglycosylases.

  11. Cloning and characterization of Arabidopsis thaliana AtNAP57--a homologue of yeast pseudouridine synthase Cbf5p.

    Science.gov (United States)

    Maceluch, J; Kmieciak, M; Szweykowska-Kulińska, Z; Jarmołowski, A

    2001-01-01

    Rat Nap57 and its yeast homologue Cbf5p are pseudouridine synthases involved in rRNA biogenesis, localized in the nucleolus. These proteins, together with H/ACA class of snoRNAs compose snoRNP particles, in which snoRNA guides the synthase to direct site-specific pseudouridylation of rRNA. In this paper we present an Arabidopsis thaliana protein that is highly homologous to Cbf5p (72% identity and 85% homology) and NAP57 (67% identity and 81% homology). Moreover, the plant protein has conserved structural motifs that are characteristic features of pseudouridine synthases of the TruB class. We have named the cloned and characterized protein AtNAP57 (Arabidopsis thaliana homologue of NAP57). AtNAP57 is a 565 amino-acid protein and its calculated molecular mass is 63 kDa. The protein is encoded by a single copy gene located on chromosome 3 of the A. thaliana genome. Interestingly, the AtNAP57 gene does not contain any introns. Mutations in the human DKC1 gene encoding dyskerin (human homologue of yeast Cbf5p and rat NAP57) cause dyskeratosis congenita a rare inherited bone marrow failure syndrome characterized by abnormal skin pigmentation, nail dystrophy and mucosal leukoplakia.

  12. The archaeal TFIIE homologue facilitates transcription initiation by enhancing TATA-box recognition

    NARCIS (Netherlands)

    Bell, S.D.; Brinkman, A.B.; Oost, van der J.; Jackson, S.P.

    2001-01-01

    Transcription from many archaeal promoters can be reconstituted in vitro using recombinant TATA-box binding protein (TBP) and transcription factor B (TFB)—homologues of eukaryal TBP and TFIIB—together with purified RNA polymerase (RNAP). However, all archaeal genomes sequenced to date reveal the pre

  13. Transcription by Methanothermobacter thermautotrophicus RNA Polymerase In Vitro Releases Archaeal Transcription Factor B but Not TATA-Box Binding Protein from the Template DNA

    OpenAIRE

    Xie, Yunwei; Reeve, John N.

    2004-01-01

    Transcription initiation in Archaea requires the assembly of a preinitiation complex containing the TATA- box binding protein (TBP), transcription factor B (TFB), and RNA polymerase (RNAP). The results reported establish the fate of Methanothermobacter thermautotrophicus TBP and TFB following transcription initiation by M. thermautotrophicus RNAP in vitro. TFB is released after initiation, during extension of the transcript from 4 to 24 nucleotides, but TBP remains bound to the template DNA. ...

  14. Archaeal CRISPR-based immune systems

    DEFF Research Database (Denmark)

    Garrett, Roger A; Vestergaard, Gisle Alberg; Shah, Shiraz Ali

    2011-01-01

    CRISPR (clustered regularly interspaced short palindromic repeats)-based immune systems are essentially modular with three primary functions: the excision and integration of new spacers, the processing of CRISPR transcripts to yield mature CRISPR RNAs (crRNAs), and the targeting and cleavage...... of foreign nucleic acid. The primary target appears to be the DNA of foreign genetic elements, but the CRISPR/Cmr system that is widespread amongst archaea also specifically targets and cleaves RNA in vitro. The archaeal CRISPR systems tend to be both diverse and complex. Here we examine evidence...... of CRISPR loci and the evidence for intergenomic exchange of CRISPR systems....

  15. Transcriptome-wide mapping reveals widespread dynamic regulated pseudouridylation of ncRNA and mRNA

    Science.gov (United States)

    Schwartz, Schraga; Bernstein, Douglas A.; Mumbach, Maxwell R.; Jovanovic, Marko; Herbst, Rebecca H.; León-Ricardo, Brian X.; Engreitz, Jesse M.; Guttman, Mitchell; Satija, Rahul; Lander, Eric S.; Fink, Gerald; Regev, Aviv

    2014-01-01

    SUMMARY Pseudouridine is the most abundant RNA modification, yet except for a few well-studied cases, little is known about the modified positions and their function(s). Here, we develop Ψ-seq for transcriptome-wide quantitative mapping of pseudouridine. We validate Ψ-seq with spike-ins and de novo identification of previously reported positions and discover hundreds of novel sites in human and yeast mRNAs and snoRNAs. Perturbing pseudouridine synthases (PUSs) uncovers which PUSs modify each site and their target sequence features. mRNA pseudouridinylation depends on both site-specific and snoRNA-guided PUSs. Upon heat shock in yeast, Pus7-mediated pseudouridylation is induced at >200 sites and Pus7 deletion decreases the levels of otherwise pseudouridylated mRNA, suggesting a role in enhancing transcript stability. rRNA pseudouridine stoichiometries are conserved, but reduced in cells from dyskeratosis congenita patients, where the PUS DKC1 is mutated. Our work identifies an enhanced, transcritome-wide scope for pseudouridine, and methods to dissect its underlying mechanisms and function. PMID:25219674

  16. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony

    2015-01-01

    Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2 with an environm......Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2...... in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...

  17. Response of Archaeal Communities in Beach Sediments to Spilled Oil and Bioremediation

    OpenAIRE

    Röling, Wilfred F. M.; Couto de Brito, Ivana R.; Swannell, Richard P. J.; Head, Ian M.

    2004-01-01

    While the contribution of Bacteria to bioremediation of oil-contaminated shorelines is well established, the response of Archaea to spilled oil and bioremediation treatments is unknown. The relationship between archaeal community structure and oil spill bioremediation was examined in laboratory microcosms and in a bioremediation field trial. 16S rRNA gene-based PCR and denaturing gradient gel analysis revealed that the archaeal community in oil-free laboratory microcosms was stable for 26 day...

  18. Shaping the Archaeal Cell Envelope

    NARCIS (Netherlands)

    Ellen, Albert F.; Zolghadr, Behnam; Driessen, Arnold M. J.; Albers, Sonja-Verena

    2010-01-01

    Although archaea have a similar cellular organization as other prokaryotes, the lipid composition of their membranes and their cell surface is unique. Here we discuss recent developments in our understanding of the archaeal protein secretion mechanisms, the assembly of macromolecular cell surface st

  19. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.

    2013-01-01

      The work presented in this thesis provides novel insights in several aspects of the molecular biology of archaea, bacteria and their viruses. Three fundamentally different groups of viruses are associated with the three domains of life. Archaeal viruses are characterized by a particularly

  20. Phylogenetic Diversity of Archaea and the Archaeal Ammonia Monooxygenase Gene in Uranium Mining-Impacted Locations in Bulgaria

    Directory of Open Access Journals (Sweden)

    Galina Radeva

    2014-01-01

    Full Text Available Uranium mining and milling activities adversely affect the microbial populations of impacted sites. The negative effects of uranium on soil bacteria and fungi are well studied, but little is known about the effects of radionuclides and heavy metals on archaea. The composition and diversity of archaeal communities inhabiting the waste pile of the Sliven uranium mine and the soil of the Buhovo uranium mine were investigated using 16S rRNA gene retrieval. A total of 355 archaeal clones were selected, and their 16S rDNA inserts were analysed by restriction fragment length polymorphism (RFLP discriminating 14 different RFLP types. All evaluated archaeal 16S rRNA gene sequences belong to the 1.1b/Nitrososphaera cluster of Crenarchaeota. The composition of the archaeal community is distinct for each site of interest and dependent on environmental characteristics, including pollution levels. Since the members of 1.1b/Nitrososphaera cluster have been implicated in the nitrogen cycle, the archaeal communities from these sites were probed for the presence of the ammonia monooxygenase gene (amoA. Our data indicate that amoA gene sequences are distributed in a similar manner as in Crenarchaeota, suggesting that archaeal nitrification processes in uranium mining-impacted locations are under the control of the same key factors controlling archaeal diversity.

  1. Identification of archaeal proteins that affect the exosome function in vitro

    Directory of Open Access Journals (Sweden)

    Palhano Fernando L

    2010-05-01

    Full Text Available Abstract Background The archaeal exosome is formed by a hexameric RNase PH ring and three RNA binding subunits and has been shown to bind and degrade RNA in vitro. Despite extensive studies on the eukaryotic exosome and on the proteins interacting with this complex, little information is yet available on the identification and function of archaeal exosome regulatory factors. Results Here, we show that the proteins PaSBDS and PaNip7, which bind preferentially to poly-A and AU-rich RNAs, respectively, affect the Pyrococcus abyssi exosome activity in vitro. PaSBDS inhibits slightly degradation of a poly-rA substrate, while PaNip7 strongly inhibits the degradation of poly-A and poly-AU by the exosome. The exosome inhibition by PaNip7 appears to depend at least partially on its interaction with RNA, since mutants of PaNip7 that no longer bind RNA, inhibit the exosome less strongly. We also show that FITC-labeled PaNip7 associates with the exosome in the absence of substrate RNA. Conclusions Given the high structural homology between the archaeal and eukaryotic proteins, the effect of archaeal Nip7 and SBDS on the exosome provides a model for an evolutionarily conserved exosome control mechanism.

  2. Deletion of the RluD pseudouridine synthase promotes SsrA peptide tagging of ribosomal protein S7.

    Science.gov (United States)

    Schaub, Ryan E; Hayes, Christopher S

    2011-01-01

    RluD catalyses formation of three pseudouridine residues within helix 69 of the 50S ribosome subunit. Helix 69 makes important contacts with the decoding centre on the 30S subunit and deletion of rluD was recently shown to interfere with translation termination in Escherichia coli. Here, we show that deletion of rluD increases tmRNA activity on ribosomes undergoing release factor 2 (RF2)-mediated termination at UGA stop codons. Strikingly, tmRNA-mediated SsrA peptide tagging of two proteins, ribosomal protein S7 and LacI, was dramatically increased in ΔrluD cells. S7 tagging was due to a unique C-terminal peptide extension found in E. coli K-12 strains. Introduction of the rpsG gene (encoding S7) from an E. coli B strain abrogated S7 tagging in the ΔrluD background, and partially complemented the mutant's slow-growth phenotype. Additionally, exchange of the K-12 prfB gene (encoding RF2) with the B strain allele greatly reduced tagging in ΔrluD cells. In contrast to E. coli K-12 cells, deletion of rluD in an E. coli B strain resulted in no growth phenotype. These findings indicate that the originally observed rluD phenotypes result from synthetic interactions with rpsG and prfB alleles found within E. coli K-12 strains.

  3. Metagenomic evaluation of bacterial and archaeal diversity in the geothermal hot springs of manikaran, India.

    Science.gov (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Green, Stefan J; Joshi, Amit; Chauhan, Ashvini

    2015-02-19

    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat.

  4. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    Directory of Open Access Journals (Sweden)

    Sonu Bhatia

    2015-09-01

    Full Text Available The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  5. 利用小亚基核糖体RNA技术分析温室黄瓜近根土壤古菌和真菌多样性%Diversity analysis of archaeal and fungal communities in adjacent cucumber root soil samples in greenhouse by small-subunit rRNA gene cloning

    Institute of Scientific and Technical Information of China (English)

    赵志祥; 芦晓飞; 陈国华; 茆振川; 杨宇红; 刘二明; 谢丙炎

    2011-01-01

    土壤古菌和真菌在温室生态系统是仅次于细菌的微生物,具有类似于细菌的重要生态功能.通过构建古菌16S rRNA和真菌18S rRNA基因克隆文库,分析温室黄瓜近根土壤古菌和真菌群落结构组成,为开发利用温室这一特殊的生态环境中丰富的微生物资源以及理解微生物与植物间的互作提供参考依据.采用研磨-冻融-溶菌酶-蛋白酶K-SDS热处理以及CTAB处理等理化方法,提取和纯化微生物总DNA,构建古菌16S rRNA和真菌18S rRNA基因克隆文库.利用DOTUR软件将古菌和真菌序列按照相似性97%的标准分成若干个可操作分类单元(OTUs).土壤古菌克隆文库主要包括泉古菌门和未分类的古菌两大类,并有少部分广域古菌类群,所有泉古菌均属于热变形菌纲,共45个OTUs;真菌克隆文库包括真菌门的大多数亚门真菌,共24个OTUs,未发现担子菌亚门真菌.古菌多样性比较丰富,且发现少量的广域古菌(甲烷菌),这一情况可能与温室长期高温高湿,高有机质含量,土壤处于缺氧环境有关;土壤真菌的优势种群为子囊菌,占到土壤真菌的80%以上,这可能与绝大多数植物真菌性病害属于土传病害,通过菌丝体、菌核或子囊壳在土壤病残体中越冬有一定的关系.%Soil archaea and fungi play important roles in the greenhouse soil ecosystem. To develop and apply rich microbial resources in greenhouse ecological environment, and to understand the interaction between microbes and plants, we constructed archaeal 16S rRNA and fungai 18S rRNA gene libraries to analyze the compositions of archaeal and fungal communityies. Total greenhouse soil DNA was directly extracted and purified by skiving-thawing-lysozyme-proteinase K-SDS hot treatment and treatment of cetyltriethylammnonium bromide (CTAB). After PCR amplification, retrieving, ligating, transforming, screening of white clones, archaeal 16S rRNA and fungai 18S rRNA gene libraries were

  6. Archaeal Enzymes and Applications in Industrial Biocatalysts.

    Science.gov (United States)

    Littlechild, Jennifer A

    2015-01-01

    Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in "extreme" conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  7. Archaeal Enzymes and Applications in Industrial Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jennifer A. Littlechild

    2015-01-01

    Full Text Available Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in “extreme” conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  8. The UCSC Archaeal Genome Browser: 2012 update

    OpenAIRE

    Chan, Patricia P.; Holmes, Andrew D.; Smith, Andrew M.; Tran, Danny; Lowe, Todd M.

    2011-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of ...

  9. Unexpected linear ion trap collision-induced dissociation and Fourier transform ion cyclotron resonance infrared multi-photon dissociation fragmentation of a hydrated C-glycoside of 5-fluorouridine formed by the action of the pseudouridine synthases RluA and TruB.

    Science.gov (United States)

    Miracco, Edward J; Bogdanov, Bogdan; Mueller, Eugene G

    2011-09-30

    As part of the investigation of the pseudouridine synthases, 5-fluorouridine in RNA was employed as a mechanistic probe. The hydrated, rearranged product of 5-fluorouridine was isolated as part of a dinucleotide and found to undergo unusual fragmentation during mass spectrometry, with the facile loss of HNCO from the product pyrimidine ring favored over phosphodiester bond rupture. Although the loss of HNCO from uridine and pseudouridine is well established, the pericyclic process leading to their fragmentation cannot operate with the saturated pyrimidine ring in the product of 5-fluorouridine. Based on the MS(n) results and calculations reported here, a new mechanism relying on the peculiar disposition of the functional groups of the product pyrimidine ring is proposed to account for the unusually facile fragmentation.

  10. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards* #

    OpenAIRE

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-01-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profili...

  11. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea

    OpenAIRE

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Pierre E Galand; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-01-01

    International audience To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacte...

  12. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  13. pH dominates variation in tropical soil archaeal diversity and community structure.

    Science.gov (United States)

    Tripathi, Binu M; Kim, Mincheol; Lai-Hoe, Ang; Shukor, Nor A A; Rahim, Raha A; Go, Rusea; Adams, Jonathan M

    2013-11-01

    Little is known of the factors influencing soil archaeal community diversity and composition in the tropics. We sampled soils across a range of forest and nonforest environments in the equatorial tropics of Malaysia, covering a wide range of pH values. DNA was PCR-amplified for the V1-V3 region of the 16S rRNA gene, and 454-pyrosequenced. Soil pH was the best predictor of diversity and community composition of Archaea, being a stronger predictor than land use. Archaeal OTU richness was highest in the most acidic soils. Overall archaeal abundance in tropical soils (determined by qPCR) also decreased at higher pH. This contrasts with the opposite trend previously found in temperate soils. Thaumarcheota group 1.1b was more abundant in alkaline soils, whereas group 1.1c was only detected in acidic soils. These results parallel those found in previous studies in cooler climates, emphasizing niche conservatism among broad archaeal groups. Among the most abundant operational taxonomic units (OTUs), there was clear evidence of niche partitioning by pH. No individual OTU occurred across the entire range of pH values. Overall, the results of this study show that pH plays a major role in structuring tropical soil archaeal communities.

  14. Composition of bacterial and archaeal communities during landfill refuse decomposition processes.

    Science.gov (United States)

    Song, Liyan; Wang, Yangqing; Zhao, Heping; Long, David T

    2015-12-01

    Little is known about the archaeal and the bacterial diversities in a landfill during different phases of decomposition. In this study, the archaeal and the bacterial diversities of Laogang landfill (Shanghai, China) at two different decomposition phases (i.e., initial methanogenic phase (IMP) and stable methanogenic phase (SMP)), were culture-independently examined using PCR-based 454 pyrosequencing. A total of 47,753 sequences of 16S rRNA genes were retrieved from 69,954 reads and analyzed to evaluate the diversities of the archaeal and bacterial communities. The most predominant types of archaea were hydrogenotrophic Methanomicrobiales, and of bacteria were Proteobacteria, Firmicutes, and Bacteroidetes. As might be expected, their abundances varied at decomposition phases. Archaea Methanomicrobiales accounts for 97.6% of total archaeal population abundance in IMP and about 57.6% in SMP. The abundance of archaeal genus Halobacteriale was 0.1% in IMP and was 20.3% in the SMP. The abundance of Firmicutes was 21.3% in IMP and was 4.3% in SMP. The abundance of Bacteroidetes represented 11.5% of total bacterial in IMP and was dominant (49.4%) in SMP. Both the IMP and SMP had unique cellulolytic bacteria compositions. IMP consisted of members of Bacillus, Fibrobacter, and Eubacterium, while SMP harbored groups of Microbacterium. Both phases had Clostridium with different abundance, 4-5 folds higher in SMP.

  15. Characterization of Olkiluoto bacterial and archaeal communities by 454 pyrosequencing

    Energy Technology Data Exchange (ETDEWEB)

    Bomberg, M.; Nyyssoenen, M.; Itaevaara, M. [VTT Technical Research Centre of Finland, Espoo (Finland)

    2012-06-15

    Recent advancement in sequencing technologies, 'Next Generation Sequencing', such as FLX 454 pyrosequencing has made it possible to obtain large amounts of sequence data where previously only few sequences could be obtained. This technique is especially useful for the study of community composition of uncultured microbial populations in environmental samples. In this project, the FLX 454 pyrosequencing technique was used to obtain up to 20 000 16S rRNA sequences or 10 000 mRNA sequences from each sample for identification of the microbial species composition as well as for comparison of the microbial communities between different samples. This project focused on the characterization of active microbial communities in the groundwater at the final disposal site of high radioactive wastes in Olkiluoto by FLX 454 pyrosequencing of the bacterial and archaeal ribosomal RNA as well as of the mRNA transcripts of the dsrB gene and mcrA gene of sulphate reducing bacteria and methanogenic archaea, respectively. Specific emphasis was put on studying the relationship of active and latent sulphate reducers and methanogens by qPCR due to their important roles in deep geobiochemical processes connected to copper corrosion. Seven packered boreholes were sampled anaerobically in Olkiluoto during 2009-2010. Groundwater was pumped from specific depths and the microbial cells werecollected by filtration on a membrane. Active microbial communities were studied based on RNA extracted from the membranes and translated to copy DNA, followed by sequencing by 454 Tag pyrosequencing. A total of 27 different bacterial and 17 archaeal taxonomic groups were detected.

  16. Enzymatic characterization and mutational studies of TruD--the fifth family of pseudouridine synthases.

    Science.gov (United States)

    Chan, Chio Mui; Huang, Raven H

    2009-09-01

    Pseudouridine (Psi) is formed through isomerization of uridine (U) catalyzed by a class of enzymes called pseudouridine synthases (PsiS). TruD is the fifth family of PsiS. Studies of the first four families (TruA, TruB, RsuA, and RluA) of PsiS reveal a conserved Asp and Tyr are critical for catalysis. However, in TruD family, the tyrosine is not conserved. In this study, we measured the enzymatic parameters for TruD in Escherichia coli, and carried out enzymatic assays for a series of single, double, and triple TruD mutants. Our studies indicate that a Glu, strictly conserved in only TruD family is likely to be the general base in TruD. We also proposed a possible distinct mechanism of TruD-catalyzed Psi formation compared to the first four families.

  17. Direct Modulation of RNA Polymerase Core Functions by Basal Transcription Factors

    OpenAIRE

    Werner, Finn; Weinzierl, Robert O. J.

    2005-01-01

    Archaeal RNA polymerases (RNAPs) are recruited to promoters through the joint action of three basal transcription factors: TATA-binding protein, TFB (archaeal homolog of TFIIB), and TFE (archaeal homolog of TFIIE). Our results demonstrate several new insights into the mechanisms of TFB and TFE during the transcription cycle. (i) The N-terminal Zn ribbon of TFB displays a surprising degree of redundancy for the recruitment of RNAP during transcription initiation in the archaeal system. (ii) Th...

  18. Protein Adaptations in Archaeal Extremophiles

    Directory of Open Access Journals (Sweden)

    Christopher J. Reed

    2013-01-01

    Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

  19. Functional importance of motif I of pseudouridine synthases: mutagenesis of aligned lysine and proline residues.

    Science.gov (United States)

    Spedaliere, C J; Hamilton, C S; Mueller, E G

    2000-08-01

    On the basis of sequence alignments, the pseudouridine synthases were grouped into four families that share no statistically significant global sequence similarity, though some common sequence motifs were discovered [Koonin, E. V. (1996) Nucleic Acids. Res. 24, 2411-2415; Gustafsson, C., Reid, R., Greene, P. J., and Santi, D. V. (1996) Nucleic Acids Res. 24, 3756-3762]. We have investigated the functional significance of these alignments by substituting the nearly invariant lysine and proline residues in Motif I of RluA and TruB, pseudouridine synthases belonging to different families. Contrary to our expectations, the altered enzymes display only very mild kinetic impairment. Substitution of the aligned lysine and proline residues does, however, reduce structural stability, consistent with a temperature sensitive phenotype that results from substitution of the cognate proline residue in Cbf5p, a yeast homologue of TruB [Zerbarjadian, Y., King, T., Fournier, M. J., Clarke, L., and Carbon, J. (1999) Mol. Cell. Biol. 19, 7461-7472]. Together, our data support a functional role for Motif I, as predicted by sequence alignments, though the effect of substituting the highly conserved residues was milder than we anticipated. By extrapolation, our findings also support the assignment of pseudouridine synthase function to certain physiologically important eukaryotic proteins that contain Motif I, including the human protein dyskerin, alteration of which leads to the disease dyskeratosis congenita.

  20. Methanopyrus kandleri: an archaeal methanogen unrelated to all other known methanogens

    Science.gov (United States)

    Burggraf, S.; Stetter, K. O.; Rouviere, P.; Woese, C. R.

    1991-01-01

    Analysis of its 16S rRNA sequence shows that the newly discovered hyperthermophilic methanogen, Methanopryus kandleri, is phylogenetically unrelated to any other known methanogen. The organism represents a separate lineage originating near the root of the archaeal tree. Although the 16S rRNA sequence of Mp. kandleri resembles euryarchaeal 16S rRNAs more than it does crenarchaeal, it shows more crenarchaeal signature features than any known euryarchaeal rRNA. Attempts to place it in relation to the root of the archaeal tree show that the Mp. kandleri lineage likely arises from the euryarchaeal branch of the tree. While the existence of so deeply branching a methanogenic lineage brings into question the thesis that methanogenesis evolved from an earlier metabolism similar to that seen in Thermococcus, it at the same time reinforces the notion that the aboriginal [correction of aborginal] archaeon was a thermophile.

  1. Bacterial and Archaeal Diversity From the Eastern Lau Spreading Center

    Science.gov (United States)

    Reysenbach, A.; Banta, A.; Kelly, S.; Kirshstein, J.; Voytek, M.

    2005-12-01

    Due to the diversity of venting styles, geological settings and variations in fluid geochemistry, the Valu Fa Ridge and Eastern Lau Spreading Center (ELSC) provide a unique opportunity to explore the effects geological and geochemical variables on patterns of microbial phylogenetic and metabolic diversity. High temperature sulfides, diffuse flow fluids and microbial mats were collected from six active vent fields on the Valu Fa Ridge and Eastern Lau Spreading Center during the R/V Melville cruise TUIM05MV. All samples were subsampled for molecular and microbial culturing purposes. The archaeal and bacterial 16S rRNA genes were amplified by PCR from a selection of samples. Additionally, the presence of Aquificales and an unidentified lineage, the DHVE archaeal group, was explored using PCR primers specific for these groups. A selection of DNAs were also screened for functional genes that are diagnostic for certain pathways, viz, aclB (reductive TCA cycle), mcrA (methanogenesis), nirS and nirK (nitrite reduction), amoA (ammonia oxidation). Culturing of thermophiles, both acidophiles and neutrophiles, was initiated. Over 20 hydrogen oxidizing (hydrogen and oxygen) or nitrate reducing (hydrogen and nitrate) chemolithoautotrophs were isolated as colonies and grow at 70 degrees C. All are related to Persephonella hydrogenophila, with the exception of 2 cultures that perhaps represent new species of Hydrogenivirga and Aquifex. Preliminary analysis of patterns of Aquificales diversity using both culturing and molecular approaches suggest that the distributions of this group alone are very different from that observed at other hydrothermal sites such as along the East Pacific Rise or Central Indian Ridge. As yet, the most commonly isolated Aquificales, P. marina, has not been detected in enrichment cultures from ELSC, and the diversity of Aquificales-related sequences is much greater than detected from sites along the EPR. It is therefore also likely, that patterns of

  2. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    Directory of Open Access Journals (Sweden)

    Thiago Rodrigues

    2014-01-01

    Full Text Available The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked differences between the archaeal communities found in the two seasons. I.1a and I.1c Thaumarchaeota were found in greater numbers in the transition period, while MCG Archaea was dominant on the dry season. Methanogens were only found in the dry season. Analysis of 16S rRNA sequences revealed lower diversity on the transition period. We detected archaeal amoA sequences in both seasons, but there were more OTUs during the dry season. These sequences were within the same cluster as Nitrosotalea devanaterra’s amoA gene. The principal coordinate analysis (PCoA test revealed significant differences between samples from different seasons. These results provide information on archaeal diversity in freshwater lake sediments of the Cerrado and indicates that rain is likely a factor that impacts these communities.

  3. Archaeal Nitrification in Hot Springs

    Science.gov (United States)

    Richter, A.; Daims, H.; Reigstad, L.; Wanek, W.; Wagner, M.; Schleper, C.

    2006-12-01

    Biological nitrification, i.e. the aerobic conversion of ammonia to nitrate via nitrite, is a major component of the global nitrogen cycle. Until recently, it was thought that the ability to aerobically oxidize ammonia was confined to bacteria of the phylum Proteobacteria. However, it has recently been shown that Archaea of the phylum Crenarchaeota are also capable of ammonia oxidation. As many Crenarchaeota are thermophilic or hyperthermophilic, and at least some of them are capable of ammonia oxidation we speculated on the existence of (hyper)thermophilic ammonia-oxidizing archaea (AOA). Using PCR primers specifically targeting the archaeal ammonia monooxygenase (amoA) gene, we were indeed able to confirm the presence of such organisms in several hot springs in Reykjadalur, Iceland. These hot springs exhibited temperatures well above 80 °C and pH values ranging from 2.0 to 4.5. To proof that nitrification actually took place under these extreme conditions, we measured gross nitrification rates by the isotope pool dilution method; we added 15N-labelled nitrate to the mud and followed the dilution of the label by nitrate production from ammonium either in situ (incubation in the hot spring) or under controlled conditions in the laboratory (at 80 °C). The nitrification rates in the hot springs ranged from 0.79 to 2.22 mg nitrate-N per L of mud and day. Controls, in which microorganisms were killed before the incubations, demonstrated that the nitrification was of biological origin. Addition of ammonium increased the gross nitrification rate approximately 3-fold, indicating that the nitrification was ammonium limited under the conditions used. Collectively, our study provides evidence that (1) AOA are present in hot springs and (2) that they are actively nitrifying. These findings have major implications for our understanding of nitrogen cycling of hot environments.

  4. Differences in the Composition of Archaeal Communities in Sediments from Contrasting Zones of Lake Taihu

    Science.gov (United States)

    Fan, Xianfang; Xing, Peng

    2016-01-01

    In shallow lakes, different primary producers might impact the physiochemical characteristics of the sediment and the associated microbial communities. Until now, little was known about the features of sediment Archaea and their variation across different primary producer-dominated ecosystems. Lake Taihu provides a suitable study area with cyanobacteria- and macrophyte-dominated zones co-occurring in one ecosystem. The composition of the sediment archaeal community was assessed using 16S rRNA gene amplicon sequencing technology, based on which the potential variation with respect to the physiochemical characteristics of the sediment was analyzed. Euryarchaeota (30.19% of total archaeal sequences) and Bathyarchaeota (28.00%) were the two most abundant phyla, followed by Crenarchaeota (11.37%), Aigarchaeota (10.24%) and Thaumarchaeota (5.98%). The differences found in the composition of the archaeal communities between the two zones was significant (p = 0.005). Sediment from macrophyte-dominated zones had high TOC and TN content and an abundance of archaeal lineages potentially involved in the degradation of complex organic compounds, such as the order Thermoplasmatales. In the area dominated by Cyanobacteria, archaeal lineages related to sulfur metabolism, for example, Sulfolobales and Desulfurococcales, were significantly enriched. Among Bathyarchaeota, subgroups MCG-6 and MCG-15 were significantly accumulated in the sediment of areas dominated by macrophytes whereas MCG-4 was consistently dominant in both type of sediments. The present study contributes to the knowledge of sediment archaeal communities with different primary producers and their possible biogeochemical functions in sediment habitats. PMID:27708641

  5. Archaeal Abundance across a pH Gradient in an Arable Soil and Its Relationship to Bacterial and Fungal Growth Rates

    OpenAIRE

    Bengtson, Per; Sterngren, Anna E.; Rousk, Johannes

    2012-01-01

    Soil pH is one of the most influential factors for the composition of bacterial and fungal communities, but the influence of soil pH on the distribution and composition of soil archaeal communities has yet to be systematically addressed. The primary aim of this study was to determine how total archaeal abundance (quantitative PCR [qPCR]-based estimates of 16S rRNA gene copy numbers) is related to soil pH across a pH gradient (pH 4.0 to 8.3). Secondarily, we wanted to assess how archaeal abund...

  6. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    OpenAIRE

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  7. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    International Nuclear Information System (INIS)

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  8. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    ; attachment, alignment, and fusion. Upon infection, the intracellular replication cycle lasts 8 h at which point the virus particles are released as spindle-shaped tailless particles. Chapter II builds on the replication and purification methods in Chapter I to study the interaction between the two...... nanoplatforms than mammalian viruses because they cannot proliferate in humans and hence are less likely to trigger adverse effects. Another group of viruses that fits this criterion is archaeal viruses yet their potential remains untapped. As a group, archaeal viruses offer distinct advantages such as unique...

  9. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards.

    Science.gov (United States)

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-11-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle.

  10. Planktonic Euryarchaeota are a significant source of archaeal tetraether lipids in the ocean

    Science.gov (United States)

    Lincoln, Sara A.; Wai, Brenner; Eppley, John M.; Church, Matthew J.; Summons, Roger E.; DeLong, Edward F.

    2014-01-01

    Archaea are ubiquitous in marine plankton, and fossil forms of archaeal tetraether membrane lipids in sedimentary rocks document their participation in marine biogeochemical cycles for >100 million years. Ribosomal RNA surveys have identified four major clades of planktonic archaea but, to date, tetraether lipids have been characterized in only one, the Marine Group I Thaumarchaeota. The membrane lipid composition of the other planktonic archaeal groups—all uncultured Euryarchaeota—is currently unknown. Using integrated nucleic acid and lipid analyses, we found that Marine Group II Euryarchaeota (MG-II) contributed significantly to the tetraether lipid pool in the North Pacific Subtropical Gyre at shallow to intermediate depths. Our data strongly suggested that MG-II also synthesize crenarchaeol, a tetraether lipid previously considered to be a unique biomarker for Thaumarchaeota. Metagenomic datasets spanning 5 y indicated that depth stratification of planktonic archaeal groups was a stable feature in the North Pacific Subtropical Gyre. The consistent prevalence of MG-II at depths where the bulk of exported organic matter originates, together with their ubiquitous distribution over diverse oceanic provinces, suggests that this clade is a significant source of tetraether lipids to marine sediments. Our results are relevant to archaeal lipid biomarker applications in the modern oceans and the interpretation of these compounds in the geologic record. PMID:24946804

  11. Archaeal and bacterial diversity in hot springs on the Tibetan Plateau, China.

    Science.gov (United States)

    Huang, Qiuyuan; Dong, Christina Z; Dong, Raymond M; Jiang, Hongchen; Wang, Shang; Wang, Genhou; Fang, Bin; Ding, Xiaoxue; Niu, Lu; Li, Xin; Zhang, Chuanlun; Dong, Hailiang

    2011-09-01

    The diversity of archaea and bacteria was investigated in ten hot springs (elevation >4600 m above sea level) in Central and Central-Eastern Tibet using 16S rRNA gene phylogenetic analysis. The temperature and pH of these hot springs were 26-81°C and close to neutral, respectively. A total of 959 (415 and 544 for bacteria and archaea, respectively) clone sequences were obtained. Phylogenetic analysis showed that bacteria were more diverse than archaea and that these clone sequences were classified into 82 bacterial and 41 archaeal operational taxonomic units (OTUs), respectively. The retrieved bacterial clones were mainly affiliated with four known groups (i.e., Firmicutes, Proteobacteria, Cyanobacteria, Chloroflexi), which were similar to those in other neutral-pH hot springs at low elevations. In contrast, most of the archaeal clones from the Tibetan hot springs were affiliated with Thaumarchaeota, a newly proposed archaeal phylum. The dominance of Thaumarchaeota in the archaeal community of the Tibetan hot springs appears to be unique, although the exact reasons are not yet known. Statistical analysis showed that diversity indices of both archaea and bacteria were not statistically correlated with temperature, which is consistent with previous studies.

  12. Events during Initiation of Archaeal Transcription: Open Complex Formation and DNA-Protein Interactions

    OpenAIRE

    Hausner, Winfried; Thomm, Michael

    2001-01-01

    Transcription in Archaea is initiated by association of a TATA box binding protein (TBP) with a TATA box. This interaction is stabilized by the binding of the transcription factor IIB (TFIIB) orthologue TFB. We show here that the RNA polymerase of the archaeon Methanococcus, in contrast to polymerase II, does not require hydrolysis of the β-γ bond of ATP for initiation of transcription and open complex formation on linearized DNA. Permanganate probing revealed that the archaeal open complex s...

  13. The σ enigma: Bacterial σ factors, archaeal TFB and eukaryotic TFIIB are homologs

    OpenAIRE

    Burton, Samuel P; Burton, Zachary F.

    2014-01-01

    Structural comparisons of initiating RNA polymerase complexes and structure-based amino acid sequence alignments of general transcription initiation factors (eukaryotic TFIIB, archaeal TFB and bacterial σ factors) show that these proteins are homologs. TFIIB and TFB each have two-five-helix cyclin-like repeats (CLRs) that include a C-terminal helix-turn-helix (HTH) motif (CLR/HTH domains). Four homologous HTH motifs are present in bacterial σ factors that are relics of CLR/HTH domains. Sequen...

  14. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea.

    Science.gov (United States)

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Galand, Pierre E; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-08-01

    To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacterial amoA transcripts. Our results showed a succession of different nitrifiers from river to sea with bacterial amoA transcripts dominating in the freshwater station while archaeal transcripts were predominant in the marine station. The 16S rRNA sequence analysis revealed that Thaumarchaeota marine group I (MGI) were the most abundant overall but other archaeal groups like Methanosaeta were also potentially active in winter (December-March) and Euryarchaeota marine group II (MGII) were dominant in seawater in summer (April-August). Each station also contained different Thaumarchaeota MGI phylogenetic clusters, and the clusters' microdiversity was associated to specific environmental conditions suggesting the presence of ecotypes adapted to distinct ecological niches. The amoA and ureC transcript dynamics further indicated that some of the Thaumarchaeota MGI subclusters were involved in ammonia oxidation through the hydrolysis of urea. Our findings show that ammonia-oxidizing Archaea and Bacteria were adapted to contrasted conditions and that the Thaumarchaeota MGI diversity probably corresponds to distinct metabolisms or life strategies. PMID:25851445

  15. Transcriptome-wide dynamics of RNA pseudouridylation.

    Science.gov (United States)

    Karijolich, John; Yi, Chengqi; Yu, Yi-Tao

    2015-10-01

    Pseudouridylation is the most abundant internal post-transcriptional modification of stable RNAs, with fundamental roles in the biogenesis and function of spliceosomal small nuclear RNAs (snRNAs) and ribosomal RNAs (rRNAs). Recently, the first transcriptome-wide maps of RNA pseudouridylation were published, greatly expanding the catalogue of known pseudouridylated RNAs. These data have further implicated RNA pseudouridylation in the cellular stress response and, moreover, have established that mRNAs are also targets of pseudouridine synthases, potentially representing a novel mechanism for expanding the complexity of the cellular proteome.

  16. Stratified active archaeal communities in the sediments of Jiulong River Estuary, China

    Directory of Open Access Journals (Sweden)

    Qianqian eLi

    2012-08-01

    Full Text Available Here the composition of total and active archaeal communities in a sediment core of Jiulong River estuary at Fujian Province, Southern China was reported. Profiles of CH4 and SO42- concentrations from the sediment core indicated the existence of a sulfate-methane transition zone (SMTZ in which sulfate reduction-coupled anaerobic oxidation of methane occurs. Accordingly, three sediment layers (16-18.5 cm, 71-73.5 cm, 161-163.5 cm from the 1.2 m sediment core were sectioned and named top, middle and bottom, respectively. Total DNA and RNA of each layer were extracted and used for clone libraries and sequence analysis of 16S rRNA genes, the reverse transcription (RT-PCR products of 16S rRNA and methyl CoM reductase alpha subunit (mcrA genes. Phylogenetic analysis indicated that archaeal communities of the three layers were dominated by the Miscellaneous Crenarchaeotal Group (MCG whose ecological functions were still unknown. The MCG could be further divided into seven subgroups, named MCG-A, B, C, D, E, F and G. MCG-A and MCG-G were the most active groups in the estuarine sediments. Known anaerobic methanotrophic archaea (ANMEs were only found as minor components in these estuarine archaeal communities. This study, together with the studies of deep subsurface sediments, would be a very good start point to target and compare the specific active archaeal groups and their roles in the dark, deep subsurface sediment environments.

  17. Structure of the rare archaeal biosphere and seasonal dynamics of active ecotypes in surface coastal waters.

    Science.gov (United States)

    Hugoni, Mylène; Taib, Najwa; Debroas, Didier; Domaizon, Isabelle; Jouan Dufournel, Isabelle; Bronner, Gisèle; Salter, Ian; Agogué, Hélène; Mary, Isabelle; Galand, Pierre E

    2013-04-01

    Marine Archaea are important players among microbial plankton and significantly contribute to biogeochemical cycles, but details regarding their community structure and long-term seasonal activity and dynamics remain largely unexplored. In this study, we monitored the interannual archaeal community composition of abundant and rare biospheres in northwestern Mediterranean Sea surface waters by pyrosequencing 16S rDNA and rRNA. A detailed analysis of the rare biosphere structure showed that the rare archaeal community was composed of three distinct fractions. One contained the rare Archaea that became abundant at different times within the same ecosystem; these cells were typically not dormant, and we hypothesize that they represent a local seed bank that is specific and essential for ecosystem functioning through cycling seasonal environmental conditions. The second fraction contained cells that were uncommon in public databases and not active, consisting of aliens to the studied ecosystem and representing a nonlocal seed bank of potential colonizers. The third fraction contained Archaea that were always rare but actively growing; their affiliation and seasonal dynamics were similar to the abundant microbes and could not be considered a seed bank. We also showed that the major archaeal groups, Thaumarchaeota marine group I and Euryarchaeota group II.B in winter and Euryarchaeota group II.A in summer, contained different ecotypes with varying activities. Our findings suggest that archaeal diversity could be associated with distinct metabolisms or life strategies, and that the rare archaeal biosphere is composed of a complex assortment of organisms with distinct histories that affect their potential for growth.

  18. Detection and analysis of elusive members of a novel and diverse archaeal community within a thermal spring streamer consortium.

    Science.gov (United States)

    Colman, Daniel R; Thomas, Raquela; Maas, Kendra R; Takacs-Vesbach, Cristina D

    2015-03-01

    Recent metagenomic analyses of Yellowstone National Park (YNP) thermal spring communities suggested the presence of minor archaeal populations that simultaneous PCR-based assays using traditional 'universal' 16S rRNA gene primers failed to detect. Here we use metagenomics to identify PCR primers effective at detecting elusive members of the Archaea, assess their efficacy, and describe the diverse and novel archaeal community from a circum-neutral thermal spring from the Bechler region of YNP. We determined that a less commonly used PCR primer, Arch349F, captured more diversity in this spring than the widely used A21F primer. A search of the PCR primers against the RDP 16S rRNA gene database indicated that Arch349F also captured the largest percentage of Archaea, including 41 % more than A21F. Pyrosequencing using the Arch349F primer recovered all of the phylotypes present in the clone-based portion of the study and the metagenome of this spring in addition to several other populations of Archaea, some of which are phylogenetically novel. In contrast to the lack of amplification with traditional 16S rRNA gene primers, our comprehensive analyses suggested a diverse archaeal community in the Bechler spring, with implications for recently discovered groups such as the Geoarchaeota and other undescribed archaeal groups.

  19. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  20. Spatiotemporal dynamics of bacterial and archaeal communities in household biogas digesters from tropical and subtropical regions of Yunnan Province, China.

    Science.gov (United States)

    Tian, Guangliang; Li, Qiumin; Dong, Minghua; Wu, Yan; Yang, Bin; Zhang, Lijuan; Li, Yingjuan; Yin, Fang; Zhao, Xingling; Wang, Yongxia; Xiao, Wei; Cui, Xiaolong; Zhang, Wudi

    2016-06-01

    A combination of 16S rRNA gene PCR-based techniques and the determination of abiotic factors were used to study community composition, richness, and evenness and the correlation between biotic and abiotic factors in 19 household biogas digesters in tropical and subtropical regions of Yunnan Province, China. The results revealed that both bacterial and archaeal community composition differed between regions and archaeal community composition was more affected by season than bacterial; regardless of sampling location, the dominant bacterial phyla included Chloroflexi, Bacteroidetes, Firmicutes, and Proteobacteria, and the most dominant archaeal phylum was Euryarchaeota; in digesters from both regions, Chloroflexi as the first or second most dominant bacteria accounted for 21.50-26.10 % of bacterial library sequences, and the phylum Crenarchaeota as the second most dominant archaea accounted for 17.65-19.77 % of archaeal library sequences; the species Methanosaeta concilii as the most dominant archaeal species accounted for 67.80-72.80 % of the sequences. This study found that most of the abundant microbial communities in 19 biogas digesters are similar, and this result will provide enlightenment for finding the universal nature in rural biogas digesters at tropical and subtropical regions in China. PMID:26916266

  1. Bacterial and archaeal communities in the deep-sea sediments of inactive hydrothermal vents in the Southwest India Ridge.

    Science.gov (United States)

    Zhang, Likui; Kang, Manyu; Xu, Jiajun; Xu, Jian; Shuai, Yinjie; Zhou, Xiaojian; Yang, Zhihui; Ma, Kesen

    2016-01-01

    Active deep-sea hydrothermal vents harbor abundant thermophilic and hyperthermophilic microorganisms. However, microbial communities in inactive hydrothermal vents have not been well documented. Here, we investigated bacterial and archaeal communities in the two deep-sea sediments (named as TVG4 and TVG11) collected from inactive hydrothermal vents in the Southwest India Ridge using the high-throughput sequencing technology of Illumina MiSeq2500 platform. Based on the V4 region of 16S rRNA gene, sequence analysis showed that bacterial communities in the two samples were dominated by Proteobacteria, followed by Bacteroidetes, Actinobacteria and Firmicutes. Furthermore, archaeal communities in the two samples were dominated by Thaumarchaeota and Euryarchaeota. Comparative analysis showed that (i) TVG4 displayed the higher bacterial richness and lower archaeal richness than TVG11; (ii) the two samples had more divergence in archaeal communities than bacterial communities. Bacteria and archaea that are potentially associated with nitrogen, sulfur metal and methane cycling were detected in the two samples. Overall, we first provided a comparative picture of bacterial and archaeal communities and revealed their potentially ecological roles in the deep-sea environments of inactive hydrothermal vents in the Southwest Indian Ridge, augmenting microbial communities in inactive hydrothermal vents.

  2. Bacterial and archaeal communities in the deep-sea sediments of inactive hydrothermal vents in the Southwest India Ridge

    Science.gov (United States)

    Zhang, Likui; Kang, Manyu; Xu, Jiajun; Xu, Jian; Shuai, Yinjie; Zhou, Xiaojian; Yang, Zhihui; Ma, Kesen

    2016-05-01

    Active deep-sea hydrothermal vents harbor abundant thermophilic and hyperthermophilic microorganisms. However, microbial communities in inactive hydrothermal vents have not been well documented. Here, we investigated bacterial and archaeal communities in the two deep-sea sediments (named as TVG4 and TVG11) collected from inactive hydrothermal vents in the Southwest India Ridge using the high-throughput sequencing technology of Illumina MiSeq2500 platform. Based on the V4 region of 16S rRNA gene, sequence analysis showed that bacterial communities in the two samples were dominated by Proteobacteria, followed by Bacteroidetes, Actinobacteria and Firmicutes. Furthermore, archaeal communities in the two samples were dominated by Thaumarchaeota and Euryarchaeota. Comparative analysis showed that (i) TVG4 displayed the higher bacterial richness and lower archaeal richness than TVG11; (ii) the two samples had more divergence in archaeal communities than bacterial communities. Bacteria and archaea that are potentially associated with nitrogen, sulfur metal and methane cycling were detected in the two samples. Overall, we first provided a comparative picture of bacterial and archaeal communities and revealed their potentially ecological roles in the deep-sea environments of inactive hydrothermal vents in the Southwest Indian Ridge, augmenting microbial communities in inactive hydrothermal vents.

  3. Denaturing gradient gel electrophoresis and barcoded pyrosequencing reveal unprecedented archaeal diversity in mangrove sediment and rhizosphere samples.

    Science.gov (United States)

    Pires, Ana C C; Cleary, Daniel F R; Almeida, Adelaide; Cunha, Angela; Dealtry, Simone; Mendonça-Hagler, Leda C S; Smalla, Kornelia; Gomes, Newton C M

    2012-08-01

    Mangroves are complex ecosystems that regulate nutrient and sediment fluxes to the open sea. The importance of bacteria and fungi in regulating nutrient cycles has led to an interest in their diversity and composition in mangroves. However, very few studies have assessed Archaea in mangroves, and virtually nothing is known about whether mangrove rhizospheres affect archaeal diversity and composition. Here, we studied the diversity and composition of Archaea in mangrove bulk sediment and the rhizospheres of two mangrove trees, Rhizophora mangle and Laguncularia racemosa, using denaturing gradient gel electrophoresis (DGGE) and pyrosequencing of archaeal 16S rRNA genes with a nested-amplification approach. DGGE profiles revealed significant structural differences between bulk sediment and rhizosphere samples, suggesting that roots of both mangrove species influence the sediment archaeal community. Nearly all of the detected sequences obtained with pyrosequencing were identified as Archaea, but most were unclassified at the level of phylum or below. Archaeal richness was, furthermore, the highest in the L. racemosa rhizosphere, intermediate in bulk sediment, and the lowest in the R. mangle rhizosphere. This study shows that rhizosphere microhabitats of R. mangle and L. racemosa, common plants in subtropical mangroves located in Rio de Janeiro, Brazil, hosted distinct archaeal assemblages. PMID:22660713

  4. Bacterial/archaeal/organellar polyadenylation.

    Science.gov (United States)

    Mohanty, Bijoy K; Kushner, Sidney R

    2011-01-01

    Although the first poly(A) polymerase (PAP) was discovered in Escherichia coli in 1962, the study of polyadenylation in bacteria was largely ignored for the next 30 years. However, with the identification of the structural gene for E. coli PAP I in 1992, it became possible to analyze polyadenylation using both biochemical and genetic approaches. Subsequently, it has been shown that polyadenylation plays a multifunctional role in prokaryotic RNA metabolism. Although the bulk of our current understanding of prokaryotic polyadenylation comes from studies on E. coli, recent limited experiments with Cyanobacteria, organelles, and Archaea have widened our view on the diversity, complexity, and universality of the polyadenylation process. For example, the identification of polynucleotide phosphorylase (PNPase), a reversible phosphorolytic enzyme that is highly conserved in bacteria, as an additional PAP in E. coli caught everyone by surprise. In fact, PNPase has now been shown to be the source of post-transcriptional RNA modifications in a wide range of cells of prokaryotic origin including those that lack a eubacterial PAP homolog. Accordingly, the past few years have witnessed increased interest in the mechanism and role of post-transcriptional modifications in all species of prokaryotic origin. However, the fact that many of the poly(A) tails are very short and unstable as well as the presence of polynucleotide tails has posed significant technical challenges to the scientific community trying to unravel the mystery of polyadenylation in prokaryotes. This review discusses the current state of knowledge regarding polyadenylation and its functions in bacteria, organelles, and Archaea.

  5. Niche specialization of terrestrial archaeal ammonia oxidizers

    OpenAIRE

    Gubry-Rangin, Cécile; Hai, Brigitte; Quince, Christopher; Engel, Marion; Thomson, Bruce C.; James, Phillip; Schloter, Michael; Robert I. Griffiths; Prosser, James I.; Nicol, Graeme W.

    2011-01-01

    Soil pH is a major determinant of microbial ecosystem processes and potentially a major driver of evolution, adaptation, and diversity of ammonia oxidizers, which control soil nitrification. Archaea are major components of soil microbial communities and contribute significantly to ammonia oxidation in some soils. To determine whether pH drives evolutionary adaptation and community structure of soil archaeal ammonia oxidizers, sequences of amoA, a key functional gene of ammonia oxidation, were...

  6. Changes in archaeal abundance and community structure along a salinity gradient in the lower Pearl River and its estuary

    Science.gov (United States)

    Zhang, C.; Wang, J.; Xie, W.; Wang, P.; Wei, Y.; Chen, S.; Zhou, X.

    2013-12-01

    Archaea occur in a wide range of habitats and across broad environmental gradients. At the global scale, salinity is known to be a major driving force for archaeal species diversity. The goal of this study was to examine changes in abundance and diversity of archaeal community DNA and membrane lipids in the water column along a salinity gradient in the lower Pearl River and estuary in the context of water/gas chemistry (pH, nitrate/nitrite, ammonia, methane, carbon dioxide). The pH increased and nitrate/nitrite and ammonia decreased from the lower Pearl River to the estuary. Methane and carbon dioxide fluxes were high in the lower Pearl River and decreased sharply in the estuary and toward the open ocean. The archaeal lipid profile exhibited abrupt changes from dominance of GDGT-0 (a glycerol diakly glycerol tetraether with zero cyclopentyl ring, which is commonly present in methanogens) to dominance of crenarchaeol (a specific biomarker for Thaumarchaeota) with increasing salinity from zero in the lower Pearl River to >0.5% in the estuary. Quantification of the 16S rRNA gene abundance using qPCR revealed a switch from bacteria-dominance to archaea-dominance and the ratio of archaeal nirK/bacterial-amoA genes had a peak value in the estuary, suggesting enhanced activity of ammonia oxidation by archaea. Pyrosequencing of archaeal 16S rRNA, amoA and nirK genes exhibited systematic variation defined by habitat types. Our current studies employ rate measurements of carbon fixation, ammonia oxidation, and nitrate reduction using isotope labeling approaches, which will allow us to link changes in archaeal community structure and ecological function.

  7. Insight into the mechanisms and functions of spliceosomal snRNA pseudouridylation

    Institute of Scientific and Technical Information of China (English)

    Hironori; Adachi; Yi-Tao; Yu

    2014-01-01

    Pseudouridines(Ψs) are the most abundant and highly conserved modified nucleotides found in various stable RNAs of all organisms. Most Ψs are clustered in regions that are functionally important for pre-m RNA splicing. Ψ has an extra hydrogen bond donor that endows RNA molecules with distinct properties that contribute significantly to RNA-mediated cellular processes. Experimental data indicate that spliceosomal sn RNA pseudouridylation can be catalyzed by both RNA-dependent and RNA-independent mechanisms. Recent work has also demonstrated that pseudouridylation can be induced at novel positions under stress conditions, suggesting a regulatory role for Ψ.

  8. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  9. Geochemical Approach to Archaeal Ecology: δ13C of GDGTs

    Science.gov (United States)

    Lichtin, S.; Warren, C.; Pearson, A.; Pagani, M.

    2015-12-01

    Over the last decade and a half, glycerol dialkyl glycerol tetraethers (GDGTs) have increasingly been used to reconstruct environmental temperatures; proxies like TEX86 that correlate the relative abundance of these archaeal cell membrane lipids to sea surface temperature are omnipresent in paleoclimatology literature. While it has become common to make claims about past temperatures using GDGTs, our present understanding of the organisms that synthesize the compounds is still quite limited. The generally accepted theory states that microorganisms like the Thaumarchaeota modify the structure of membrane lipids to increase intermolecular interactions, strengthening the membrane at higher temperatures. Yet to date, culture experiments have been largely restricted to a single species, Nitrosopumilus maritimes, and recent studies on oceanic archaeal rRNA have revealed that these biomarkers are produced in diverse, heterogeneous, and site-specific communities. This brings up questions as to whether different subclasses of GDGTs, and all subsequent proxies, represent adaptation within a single organismal group or a shift in community composition. To investigate whether GDGTs with different chain structures, from the simple isoprenoidal GDGT-0 to Crenarchaeol with its many cyclopentane groups, are sourced from archaea with similar or disparate metabolic pathways—and if that information is inherited in GDGTs trapped in marine sediments—this study examines the stable carbon isotope values (δ13C) of GDGTs extracted from the uppermost meters of sediment in the Orca Basin, Gulf of Mexico, using spooling-wire microcombustion isotope-ratio mass spectrometer (SWiM-IRMS), tackling a fundamental assumption of the TEX86 proxy that influences the way we perceive the veracity of existing temperature records.

  10. Archaeal community structures in the solfataric acidic hot springs with different temperatures and elemental compositions.

    Science.gov (United States)

    Satoh, Tomoko; Watanabe, Keiko; Yamamoto, Hideo; Yamamoto, Shuichi; Kurosawa, Norio

    2013-01-01

    Archaeal 16S rRNA gene compositions and environmental factors of four distinct solfataric acidic hot springs in Kirishima, Japan were compared. The four ponds were selected by differences of temperature and total dissolved elemental concentration as follows: (1) Pond-A: 93°C and 1679 mg L(-1), (2) Pond-B: 66°C and 2248 mg L(-1), (3) Pond-C: 88°C and 198 mg L(-1), and (4) Pond-D: 67°C and 340 mg L(-1). In total, 431 clones of 16S rRNA gene were classified into 26 phylotypes. In Pond-B, the archaeal diversity was the highest among the four, and the members of the order Sulfolobales were dominant. The Pond-D also showed relatively high diversity, and the most frequent group was uncultured thermoacidic spring clone group. In contrast to Pond-B and Pond-D, much less diverse archaeal clones were detected in Pond-A and Pond-C showing higher temperatures. However, dominant groups in these ponds were also different from each other. The members of the order Sulfolobales shared 89% of total clones in Pond-A, and the uncultured crenarchaeal groups shared 99% of total Pond-C clones. Therefore, species compositions and biodiversity were clearly different among the ponds showing different temperatures and dissolved elemental concentrations.

  11. TBP Domain Symmetry in Basal and Activated Archaeal Transcription

    OpenAIRE

    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter

    2008-01-01

    The TATA-box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in th...

  12. Nitrification of archaeal ammonia oxidizers in a high- temperature hot spring

    Science.gov (United States)

    Chen, Shun; Peng, Xiaotong; Xu, Hengchao; Ta, Kaiwen

    2016-04-01

    The oxidation of ammonia by microbes has been shown to occur in diverse natural environments. However, the link of in situ nitrification activity to taxonomic identities of ammonia oxidizers in high-temperature environments remains poorly understood. Here, we studied in situ ammonia oxidation rates and the diversity of ammonia-oxidizing Archaea (AOA) in surface and bottom sediments at 77 °C in the Gongxiaoshe hot spring, Tengchong, Yunnan, China. The in situ ammonia oxidation rates measured by the 15N-NO3- pool dilution technique in the surface and bottom sediments were 4.80 and 5.30 nmol N g-1 h-1, respectively. Real-time quantitative polymerase chain reaction (qPCR) indicated that the archaeal 16S rRNA genes and amoA genes were present in the range of 0.128 to 1.96 × 108 and 2.75 to 9.80 × 105 gene copies g-1 sediment, respectively, while bacterial amoA was not detected. Phylogenetic analysis of 16S rRNA genes showed high sequence similarity to thermophilic Candidatus Nitrosocaldus yellowstonii, which represented the most abundant operational taxonomic units (OTU) in both surface and bottom sediments. The archaeal predominance was further supported by fluorescence in situ hybridization (FISH) visualization. The cell-specific rate of ammonia oxidation was estimated to range from 0.410 to 0.790 fmol N archaeal cell-1 h-1, higher than those in the two US Great Basin hot springs. These results suggest the importance of archaeal rather than bacterial ammonia oxidation in driving the nitrogen cycle in terrestrial geothermal environments.

  13. Seasonal dynamics of bacterial and archaeal methanogenic communities in flooded rice fields and effect of drainage

    Directory of Open Access Journals (Sweden)

    Björn eBreidenbach

    2015-01-01

    Full Text Available We studied the resident (16S rDNA and the active (16S rRNA members of soil archaeal and bacterial communities during rice plant development by sampling three growth stages (vegetative, reproductive and maturity under field conditions. Additionally, the microbial community was investigated in two non-flooded fields (unplanted, cultivated with upland maize in order to monitor the reaction of the microbial communities to non-flooded, dry conditions. The abundance of Bacteria and Archaea was monitored by quantitative PCR showing an increase in 16S rDNA during reproductive stage and stable 16S rRNA copies throughout the growth season. Community profiling by T-RFLP indicated a relatively stable composition during rice plant growth whereas pyrosequencing revealed minor changes in relative abundance of a few bacterial groups. Comparison of the two non-flooded fields with flooded rice fields showed that the community composition of the Bacteria was slightly different, while that of the Archaea was almost the same. Only the relative abundance of Methanosarcinaceae and Soil Crenarchaeotic Group increased in non-flooded versus flooded soil. The abundance of bacterial and archaeal 16S rDNA copies was highest in flooded rice fields, followed by non-flooded maize and unplanted fields. However, the abundance of ribosomal RNA (active microbes was similar indicating maintenance of a high level of ribosomal RNA under the non-flooded conditions, which were unfavorable for anaerobic bacteria and methanogenic archaea. This maintenance possibly serves as preparedness for activity when conditions improve. In summary, the analyses showed that the bacterial and archaeal communities inhabiting Philippine rice field soil were relatively stable over the season but reacted upon change in field management.

  14. Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun

    2013-04-01

    Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs.

  15. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm.

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  16. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied. PMID:27006640

  17. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Directory of Open Access Journals (Sweden)

    Daiva Domenech Tupinambá

    2016-01-01

    Full Text Available This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7% were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area. More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  18. Bacterial and archaeal phylogenetic diversity associated with swine sludge from an anaerobic treatment lagoon.

    Science.gov (United States)

    Cardinali-Rezende, Juliana; Pereira, Zelina L; Sanz, José L; Chartone-Souza, Edmar; Nascimento, Andréa M A

    2012-11-01

    Over the last decades, the demand for pork products has increased significantly, along with concern about suitable waste management. Anaerobic-lagoon fermentation for swine-sludge stabilization is a good strategy, although little is known about the microbial communities in the lagoons. Here, we employed a cloning- and sequencing-based analysis of the 16S rRNA gene to characterize and quantify the prokaryotic community composition in a swine-waste-sludge anaerobic lagoon (SAL). DNA sequence analysis revealed that the SAL library harbored 15 bacterial phyla: Bacteroidetes, Cloroflexi, Proteobacteria, Firmicutes, Deinococcus-Thermus, Synergystetes, Gemmatimonadetes, Chlorobi, Fibrobacteres, Verrucomicrobia and candidates division OP5, OP8, WWE1, KSB1, WS6. The SAL library was generally dominated by carbohydrate-oxidizing bacteria. The archaeal sequences were related to the Crenarchaeota and Euryarchaeota phyla. Crenarchaeota predominated in the library, demonstrating that it is not restricted to high-temperature environments, being also responsible for ammonium oxidation in the anaerobic lagoon. Euryarchaeota sequences were associated with the hydrogenotrophic methanogens (Methanomicrobiales and Methanobacteriales). Quantitative PCR analysis revealed that the number of bacterial cells was at least three orders of magnitude higher than the number of archaeal cells in the SAL. The identified prokaryotic diversity was ecologically significant, particularly the archaeal community of hydrogenotrophic methanogens, which was responsible for methane production in the anaerobic lagoon. This study provided insight into the archaeal involvement in the overall oxidation of organic matter and the production of methane. Therefore, the treatment of swine waste in the sludge anaerobic lagoon could represent a potential inoculum for the start-up of municipal solid-waste digesters. PMID:22828793

  19. Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

    Science.gov (United States)

    Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

    1991-01-01

    A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

  20. Effect of Tree Species and Mycorrhizal Colonization on the Archaeal Population of Boreal Forest Rhizospheres▿

    OpenAIRE

    Bomberg, Malin; Timonen, Sari

    2008-01-01

    Group 1.1c Crenarchaeota are the predominating archaeal group in acidic boreal forest soils. In this study, we show that the detection frequency of 1.1c crenarchaeotal 16S rRNA genes in the rhizospheres of the boreal forest trees increased following colonization by the ectomycorrhizal fungus Paxillus involutus. This effect was very clear in the fine roots of Pinus sylvestris, Picea abies, and Betula pendula, the most common forest trees in Finland. The nonmycorrhizal fine roots had a clearly ...

  1. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    OpenAIRE

    Thiago Rodrigues; Elisa Catão; Mercedes M. C. Bustamante; Quirino, Betania F.; Kruger, Ricardo H; Kyaw, Cynthia M

    2014-01-01

    The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked ...

  2. Spatial isolation and environmental factors drive distinct bacterial and archaeal communities in different types of petroleum reservoirs in China

    Science.gov (United States)

    Gao, Peike; Tian, Huimei; Wang, Yansen; Li, Yanshu; Li, Yan; Xie, Jinxia; Zeng, Bing; Zhou, Jiefang; Li, Guoqiang; Ma, Ting

    2016-02-01

    To investigate the spatial distribution of microbial communities and their drivers in petroleum reservoir environments, we performed pyrosequencing of microbial partial 16S rRNA, derived from 20 geographically separated water-flooding reservoirs, and two reservoirs that had not been flooded, in China. The results indicated that distinct underground microbial communities inhabited the different reservoirs. Compared with the bacteria, archaeal alpha-diversity was not strongly correlated with the environmental variables. The variation of the bacterial and archaeal community compositions was affected synthetically, by the mining patterns, spatial isolation, reservoir temperature, salinity and pH of the formation brine. The environmental factors explained 64.22% and 78.26% of the total variance for the bacterial and archaeal communities, respectively. Despite the diverse community compositions, shared populations (48 bacterial and 18 archaeal genera) were found and were dominant in most of the oilfields. Potential indigenous microorganisms, including Carboxydibrachium, Thermosinus, and Neptunomonas, were only detected in a reservoir that had not been flooded with water. This study indicates that: 1) the environmental variation drives distinct microbial communities in different reservoirs; 2) compared with the archaea, the bacterial communities were highly heterogeneous within and among the reservoirs; and 3) despite the community variation, some microorganisms are dominant in multiple petroleum reservoirs.

  3. Seasonal Changes of Freshwater Ammonia-Oxidizing Archaeal Assemblages and Nitrogen Species in Oligotrophic Alpine Lakes▿ †

    OpenAIRE

    Auguet, Jean-Christophe; Nomokonova, Natalya; Camarero, Lluis; Casamayor, Emilio O.

    2011-01-01

    The annual changes in the composition and abundance of ammonia-oxidizing archaea (AOA) were analyzed monthly in surface waters of three high mountain lakes within the Limnological Observatory of the Pyrenees (LOOP; northeast Spain) using both 16S rRNA and functional (ammonia monooxygenase gene, amoA) gene sequencing as well as quantitative PCR amplification. The set of biological data was related to changes in nitrogen species and to other relevant environmental variables. The whole archaeal ...

  4. Quantitative and phylogenetic study of the Deep Sea Archaeal Group in sediments of the arctic mid-ocean spreading ridge

    Directory of Open Access Journals (Sweden)

    Steffen Leth eJørgensen

    2013-10-01

    Full Text Available In marine sediments archaea often constitute a considerable part of the microbial community, of which the Deep Sea Archaeal Group (DSAG is one of the most predominant. Despite their high abundance no members from this archaeal group have so far been characterized and thus their metabolism is unknown. Here we show that the relative abundance of DSAG marker genes can be correlated with geochemical parameters, allowing prediction of both the potential electron donors and acceptors of these organisms. We estimated the abundance of 16S rRNA genes from Archaea, Bacteria and DSAG in 52 sediment horizons from two cores collected at the slow-spreading Arctic Mid-Ocean Ridge, using qPCR. The results indicate that members of the DSAG make up the entire archaeal population in certain horizons and constitute up to ~ 50% of the total microbial community. The quantitative data were correlated to 30 different geophysical and geochemical parameters obtained from the same sediment horizons. We observed a significant correlation between the relative abundance of DSAG 16S rRNA genes and the content of organic carbon (p < 0.0001. Further, significant co-variation with iron oxide, and dissolved iron and manganese (all p < 0.0000, indicated a direct or indirect link to iron and manganese cycling. Neither of these parameters correlated with the relative abundance of archaeal or bacterial 16S rRNA genes, nor did any other major electron donor or acceptor measured. Phylogenetic analysis of DSAG 16S rRNA gene sequences reveals three monophyletic lineages with no apparent habitat-specific distribution. In this study we support the hypothesis that members of the DSAG are tightly linked to the content of organic carbon and directly or indirectly involved in the cycling of iron and/or manganese compounds. Further, we provide a molecular tool to assess their abundance in environmental samples and enrichment cultures.

  5. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

    Science.gov (United States)

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

  6. Reconstitution of RNA exosomes from human and Saccharomyces cerevisiae: Cloning, expression, purification, and activity assays

    OpenAIRE

    Greimann, Jaclyn C.; Lima, Christopher D.

    2008-01-01

    Eukaryotic RNA exosomes participate in 3′-5′ processing and degradation of RNA in the nucleus and cytoplasm. RNA exosomes are multi-subunit complexes composed of at least nine distinct proteins which form the exosome core. While the eukaryotic exosome core shares structural and sequence similarity to phosphorolytic archaeal exosomes and bacterial PNPase, the eukaryotic exosome core has diverged from its archaeal and bacterial cousins and appears devoid of phosphorolytic activity. In yeast, th...

  7. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Directory of Open Access Journals (Sweden)

    Pedro R Frade

    Full Text Available Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%. About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater, host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity.

  8. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Science.gov (United States)

    Frade, Pedro R; Roll, Katharina; Bergauer, Kristin; Herndl, Gerhard J

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP) and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis) over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs) characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%). About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively) were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA) showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater), host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity. PMID:26788724

  9. A Method for Identification of Selenoprotein Genes in Archaeal Genomes

    Institute of Scientific and Technical Information of China (English)

    Mingfeng Li; Yanzhao Huang; Yi Xiao

    2009-01-01

    The genetic codon UGA has a dual function: serving as a terminator and encoding selenocysteine. However, most popular gene annotation programs only take it as a stop signal, resulting in misannotation or completely missing selenoprotein genes. We developed a computational method named Asec-Prediction that is specific for the prediction of archaeal selenoprotein genes. To evaluate its effectiveness, we first applied it to 14 archaeal genomes with previously known selenoprotein genes, and Asec-Prediction identified all reported selenoprotein genes without redundant results. When we applied it to 12 archaeal genomes that had not been researched for selenoprotein genes, Asec-Prediction detected a novel selenoprotein gene in Methanosarcina acetivorans. Further evidence was also collected to support that the predicted gene should be a real selenoprotein gene. The result shows that Asec-Prediction is effective for the prediction of archaeal selenoprotein genes.

  10. Similarities and Contrasts in the Archaeal Community of Two Japanese Mountains: Mt. Norikura Compared to Mt. Fuji.

    Science.gov (United States)

    Singh, Dharmesh; Takahashi, Koichi; Park, Jungok; Adams, Jonathan M

    2016-02-01

    The community ecology, abundance, and diversity patterns of soil archaea are poorly understood-despite the fact that they are a major branch of life that is ubiquitous and important in nitrogen cycling in terrestrial ecosystems. We set out to investigate the elevational patterns of archaeal ecology, and how these compare with other groups of organisms. Many studies of different groups of organisms (plants, birds, etc.) have shown a series of distinct communities with elevation, and often a diversity maximum in mid-elevations. We investigated the soil archaeal communities on Mt. Norikura, Japan, using 454 pyrosequencing of the 16S ribosomal RNA (rRNA) gene. There was a strong mid-elevation maximum in diversity, and a mid-elevation maximum in abundance of soil archaea 16S rRNA and amoA genes. These diversity and abundance maximums could not be correlated with any identifiable soil parameter, nor plant diversity. Discrete, predictable communities of archaea occurred at each elevational level, also not explicable in terms of pH or major nutrients. When we compared the archaeal community and diversity patterns with those found in an earlier study of Mt Fuji, both mountains showed mid-elevation maximums in diversity and abundance of archaea, possibly a result of some common environmental factor such as soil disturbance frequency. However, they showed distinct sets of archaeal communities at similar elevational sampling points. Presumably, the difference reflects their distinct geology (Norikura being andesitic, while Fuji is basaltic) and the resulting combinations of soil chemistry and environmental conditions, although no explanatory variable was found. Clearly, many soil archaea have strongly defined niches and will only occur in a narrow subset of the range of possible climate and soil conditions. The findings of a mid-elevation diversity maximum on Norikura provides a further instance of how widespread this unexplained pattern is in nature, in a wide variety of

  11. Structure and Cell Biology of Archaeal Virus STIV

    OpenAIRE

    Fu, Chi-yu; Johnson, John E.

    2012-01-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interaction...

  12. Archaeal community in a human-disturbed watershed in southeast China: diversity, distribution, and responses to environmental changes.

    Science.gov (United States)

    Hu, Anyi; Wang, Hongjie; Li, Jiangwei; Liu, Jing; Chen, Nengwang; Yu, Chang-Ping

    2016-05-01

    The response of freshwater bacterial community to anthropogenic disturbance has been well documented, yet the studies of freshwater archaeal community are rare, especially in lotic environments. Here, we investigated planktonic and benthic archaeal communities in a human-perturbed watershed (Jiulong River Watershed, JRW) of southeast China by using Illumina 16S ribosomal RNA gene amplicon sequencing. The results of taxonomic assignments indicated that SAGMGC-1, Methanobacteriaceae, Methanospirillaceae, and Methanoregulaceae were the four most abundant families in surface waters, accounting for 12.65, 23.21, 18.58 and 10.97 % of planktonic communities, whereas Nitrososphaeraceae and Miscellaneous Crenarchaeotic Group occupied more than 49 % of benthic communities. The compositions of archaeal communities and populations in waters and sediments were significantly different from each other. Remarkably, the detection frequencies of families Methanobacteriaceae and Methanospirillaceae, and genera Methanobrevibacter and Methanosphaera in planktonic communities correlated strongly with bacterial fecal indicator, suggesting some parts of methanogenic Archaea may come from fecal contamination. Because soluble reactive phosphorus (SRP) and the ratio of dissolved inorganic nitrogen to SRP instead of nitrogen nutrients showed significant correlation with several planktonic Nitrosopumilus- and Nitrosotalea-like OTUs, Thaumarchaeota may play an unexplored role in biogeochemical cycling of river phosphorus. Multivariate statistical analyses revealed that the variation of α-diversity of planktonic archaeal community was best explained by water temperature, whereas nutrient concentrations and stoichiometry were the significant drivers of β-diversity of planktonic and benthic communities. Taken together, these results demonstrate that the structure of archaeal communities in the JRW is sensitive to anthropogenic disturbances caused by riparian human activities. PMID:26810199

  13. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes...

  14. Co-expression and co-purification of archaeal and eukaryal box C/D RNPs.

    Directory of Open Access Journals (Sweden)

    Yu Peng

    Full Text Available Box C/D ribonucleoprotein particles (RNPs are 2'-O-methylation enzymes required for maturation of ribosomal and small nuclear RNA. Previous biochemical and structural studies of the box C/D RNPs were limited by the unavailability of purified intact RNPs. We developed a bacterial co-expression strategy based on the combined use of a multi-gene expression system and a tRNA-scaffold construct that allowed the expression and purification of homogeneous archaeal and human box C/D RNPs. While the co-expressed and co-purified archaeal box C/D RNP was found to be fully active in a 2'-O-methylation assay, the intact human U14 box C/D RNP showed no detectable catalytic activity, consistent with the earlier findings that assembly of eukaryotic box C/D RNPs is nonspontaneous and requires additional protein factors. Our systems provide a means for further biochemical and structural characterization of box C/D RNPs and their assembly factors.

  15. Ecological structuring of bacterial and archaeal taxa in surface ocean waters.

    Science.gov (United States)

    Yilmaz, Pelin; Iversen, Morten H; Hankeln, Wolfgang; Kottmann, Renzo; Quast, Christian; Glöckner, Frank O

    2012-08-01

    The Global Ocean Sampling (GOS) expedition is currently the largest and geographically most comprehensive metagenomic dataset, including samples from the Atlantic, Pacific, and Indian Oceans. This study makes use of the wide range of environmental conditions and habitats encompassed within the GOS sites in order to investigate the ecological structuring of bacterial and archaeal taxon ranks. Community structures based on taxonomically classified 16S ribosomal RNA (rRNA) gene fragments at phylum, class, order, family, and genus rank levels were examined using multivariate statistical analysis, and the results were inspected in the context of oceanographic environmental variables and structured habitat classifications. At all taxon rank levels, community structures of neritic, oceanic, estuarine biomes, as well as other exotic biomes (salt marsh, lake, mangrove), were readily distinguishable from each other. A strong structuring of the communities with chlorophyll a concentration and a weaker yet significant structuring with temperature and salinity were observed. Furthermore, there were significant correlations between community structures and habitat classification. These results were used for further investigation of one-to-one relationships between taxa and environment and provided indications for ecological preferences shaped by primary production for both cultured and uncultured bacterial and archaeal clades. PMID:22416918

  16. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  17. Archaeal diversity and abundance within different layers of summer sea-ice and seawater from Prydz Bay, Antarctica

    Institute of Scientific and Technical Information of China (English)

    MA Jifei; DU Zongjun; LUO Wei; YU Yong; ZENG Yixin; CHEN Bo; LI Huirong

    2014-01-01

    Fluorescence in-situ hybridization (FISH) and 16S rRNA gene clone library analyses were used to determine the abundance and diversity of archaea in Prydz Bay, Antarctica. Correlation analysis was also performed to assess links between physicochemical parameters and archaeal abundance and diversity within the sea-ice. Samples of sea-ice and seawater were collected during the 26th Chinese National Antarctic Research Expedition. The results of FISH showed that archaea were relatively abundant within the top layer of the sea-ice, and correlation analysis suggested that the concentration of 4NH+ might be one of the main factors underlying this distribution pattern. However, using 16S rRNA gene libraries, archaea were not detected in the top and middle layers of the sea-ice. All archaeal clones obtained from the bottom layer of the sea-ice were grouped into the Marine Group I Crenarchaeota while the archaeal clones from seawater were assigned to Marine Group I Crenarchaeota, Marine Group II Euryarchaeota, and Marine Group III Euryarchaeota. Overall, the ifndings of this study showed that the diversity of archaea in the sea-ice in Prydz Bay was low.

  18. [Effects of long-term fertilization on bacterial and archaeal diversity and community structure within subtropical red paddy soils].

    Science.gov (United States)

    Yuan, Hong-zhao; Wu, Hao; Ge, Ti-da; Li, Ke-lin; Wu, Jin-shui; Wang, Jiu-rong

    2015-06-01

    Paddy soils not only function as an important sink for "missing carbon" but also play an important role in the production of greenhouse gases such as N2O and CH4. Dynamic changes in greenhouse gases in the atmosphere are closely related to microbially mediated carbon and nitrogen transformation processes occurring in soil. Using soil samples collected from a long-term fertilization experimental site in Taojiang County, subtropical China (established in 1986), we determined the effects of long-term (>25 years) non-fertilization (CK), chemical fertilization (NPK), and NPK combined with rice straw residues (NPKS) on soil bacterial and archaeal community structures. The 16S rRNA genotypes from the three differently treated soils were divided into 9 bacterial phylotypes, mainly including Proteobacteria, Acidobacteria, Chloroflexi, and archaea of Crenarchaeota and Euryarchaeota. The relative abundance of Proteobacteria, Acidobacteria and Crenarchaeota increased in the soils under NPK and NPKS treatments, with the increase being greater in the latter treatment. LUBSHUFF statistical analyses also demonstrated that there was significant difference among the microbial community compositions in CK-, NPK- and NPKS-treated soils. The abundance of bacterial and archaeal 16S rRNA genes ranged from 0.58 x 10(10) to 1.06 x 10(10) copies · g(-1) dry soil and from 1.16 x 10(6) to 1.72 x 10(6) copies · g(-1) dry soil, respectively. Application of fertilizers increased the bacterial and archaeal abundance and diversity in the treated soils, with NPKS > NPK. Long-term chemical and organic applications significantly affected the abundance, diversity and composition of bacterial and archaeal communities in paddy ecosystems. PMID:26572036

  19. Bacterial and Archaeal Diversity in the Gastrointestinal Tract of the North American Beaver (Castor canadensis)

    Science.gov (United States)

    Gruninger, Robert J.; McAllister, Tim A.; Forster, Robert J.

    2016-01-01

    The North American Beaver (Castor canadensis) is the second largest living rodent and an iconic symbol of Canada. The beaver is a semi-aquatic browser whose diet consists of lignocellulose from a variety of plants. The beaver is a hindgut fermenter and has an enlarged ceacum that houses a complex microbiome. There have been few studies examining the microbial diversity in gastrointestinal tract of hindgut fermenting herbivores. To examine the bacterial and archaeal communities inhabiting the gastrointestinal tract of the beaver, the microbiome of the ceacum and feaces was examined using culture-independent methods. DNA from the microbial community of the ceacum and feaces of 4 adult beavers was extracted, and the16S rRNA gene was sequenced using either bacterial or archaeal specific primers. A total of 1447 and 1435 unique bacterial OTUs were sequenced from the ceacum and feaces, respectively. On average, the majority of OTUs within the ceacum were classified as Bacteroidetes (49.2%) and Firmicutes (47.6%). The feaces was also dominated by OTUs from Bacteroidetes (36.8%) and Firmicutes (58.9%). The composition of bacterial community was not significantly different among animals. The composition of the ceacal and feacal microbiome differed, but this difference is due to changes in the abundance of closely related OTUs, not because of major differences in the taxonomic composition of the communities. Within these communities, known degraders of lignocellulose were identified. In contrast, to the bacterial microbiome, the archaeal community was dominated by a single species of methanogen, Methanosphaera stadtmanae. The data presented here provide the first insight into the microbial community within the hindgut of the beaver. PMID:27227334

  20. Plant genotype-specific archaeal and bacterial endophytes but similar Bacillus antagonists colonize Mediterranean olive trees

    Directory of Open Access Journals (Sweden)

    Henry eMueller

    2015-03-01

    Full Text Available Endophytes have an intimate and often symbiotic interaction with their hosts. Less is known about the composition and function of endophytes in trees. In order to evaluate our hypothesis that plant genotype and origin have a strong impact on both, endophytes of leaves from 10 Olea europaea L. cultivars from the Mediterranean basin growing at a single agricultural site in Spain and from nine wild olive trees located in natural habitats in Greece, Cyprus and on Madeira Island were studied. The composition of the bacterial endophytic communities as revealed by 16S rRNA gene amplicon sequencing and the subsequent PCoA analysis showed a strong correlation to the plant genotypes. The bacterial distribution patterns were congruent with the plant origins in Eastern and Western areas of the Mediterranean basin. Subsequently, the endophytic microbiome of wild olives was shown to be closely related to those of cultivated olives of the corresponding geographic origins. The olive leaf endosphere harbored mostly Proteobacteria, followed by Firmicutes, Actinobacteria and Bacteroidetes. The detection of a high portion of archaeal taxa belonging to the phyla Thaumarchaeota, Crenarchaeota and Euryarchaeota in the amplicon libraries was an unexpected discovery, which was confirmed by quantitative real-time PCR revealing an archaeal portion of up to 35.8%. Although the function of these Archaea for their host plant remains speculative, this finding suggests a significant relevance of archaeal endophytes for plant-microbe interactions. In addition, the antagonistic potential of culturable endophytes was determined; all isolates with antagonistic activity against the olive-pathogenic fungus Verticillium dahliae Kleb. belong to Bacillus amyloliquefaciens. In contrast to the specific global structural diversity, BOX-fingerprints of the antagonistic Bacillus isolates were highly similar and independent of the olive genotype from which they were isolated.

  1. Land-use systems affect Archaeal community structure and functional diversity in western Amazon soils

    Directory of Open Access Journals (Sweden)

    Acácio Aparecido Navarrete

    2011-10-01

    Full Text Available The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure and ammonia-oxidizing Archaea (richness and community composition were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009 from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old, agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA of Archaea (306 sequences, the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366, followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715, crops (H' = 1.4613; D = 0.3309 and secondary forest (H' = 0.8633; D = 0.5405. All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 % previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.

  2. Response of Archaeal and Bacterial Soil Communities to Changes Associated with Outdoor Cattle Overwintering.

    Directory of Open Access Journals (Sweden)

    Alica Chroňáková

    Full Text Available Archaea and bacteria are important drivers for nutrient transformations in soils and catalyse the production and consumption of important greenhouse gases. In this study, we investigate changes in archaeal and bacterial communities of four Czech grassland soils affected by outdoor cattle husbandry. Two show short-term (3 years; STI and long-term impact (17 years; LTI, one is regenerating from cattle impact (REG and a control is unaffected by cattle (CON. Cattle manure (CMN, the source of allochthonous microbes, was collected from the same area. We used pyrosequencing of 16S rRNA genes to assess the composition of archaeal and bacterial communities in each soil type and CMN. Both short- and long- term cattle impact negatively altered archaeal and bacterial diversity, leading to increase of homogenization of microbial communities in overwintering soils over time. Moreover, strong shifts in the prokaryotic communities were observed in response to cattle overwintering, with the greatest impact on archaea. Oligotrophic and acidophilic microorganisms (e.g. Thaumarchaeota, Acidobacteria, and α-Proteobacteria dominated in CON and expressed strong negative response to increased pH, total C and N. Whereas copiotrophic and alkalophilic microbes (e.g. methanogenic Euryarchaeota, Firmicutes, Chloroflexi, Actinobacteria, and Bacteroidetes were common in LTI showing opposite trends. Crenarchaeota were also found in LTI, though their trophic interactions remain cryptic. Firmicutes, Bacteroidetes, Methanobacteriaceae, and Methanomicrobiaceae indicated the introduction and establishment of faecal microbes into the impacted soils, while Chloroflexi and Methanosarcinaceae suggested increased abundance of soil-borne microbes under altered environmental conditions. The observed changes in prokaryotic community composition may have driven corresponding changes in soil functioning.

  3. Methanobacterium thermoautotrophicum RNA Polymerase and Transcription In Vitro

    OpenAIRE

    Darcy, Trevor J.; Hausner, Winfried; Awery, Donald E.; Edwards, Aled M.; Thomm, Michael; Reeve, John N.

    1999-01-01

    RNA polymerase (RNAP) purified from Methanobacterium thermoautotrophicum ΔH has been shown to initiate transcription accurately in vitro from the hmtB archaeal histone promoter with either native or recombinant forms of the M. thermoautotrophicum TATA-binding protein and transcription factor TFB. Efforts to obtain transcription initiation from hydrogen-regulated methane gene promoters were, however, unsuccessful. Two previously unrecognized archaeal RNAP subunits have been identified, and com...

  4. Crystal structure of an archaeal actin homolog.

    Science.gov (United States)

    Roeben, Annette; Kofler, Christine; Nagy, István; Nickell, Stephan; Hartl, F Ulrich; Bracher, Andreas

    2006-04-21

    Prokaryotic homologs of the eukaryotic structural protein actin, such as MreB and ParM, have been implicated in determination of bacterial cell shape, and in the segregation of genomic and plasmid DNA. In contrast to these bacterial actin homologs, little is known about the archaeal counterparts. As a first step, we expressed a predicted actin homolog of the thermophilic archaeon Thermoplasma acidophilum, Ta0583, and determined its crystal structure at 2.1A resolution. Ta0583 is expressed as a soluble protein in T.acidophilum and is an active ATPase at physiological temperature. In vitro, Ta0583 forms sheets with spacings resembling the crystal lattice, indicating an inherent propensity to form filamentous structures. The fold of Ta0583 contains the core structure of actin and clearly belongs to the actin/Hsp70 superfamily of ATPases. Ta0583 is approximately equidistant from actin and MreB on the structural level, and combines features from both eubacterial actin homologs, MreB and ParM. The structure of Ta0583 co-crystallized with ADP indicates that the nucleotide binds at the interface between the subdomains of Ta0583 in a manner similar to that of actin. However, the conformation of the nucleotide observed in complex with Ta0583 clearly differs from that in complex with actin, but closely resembles the conformation of ParM-bound nucleotide. On the basis of sequence and structural homology, we suggest that Ta0583 derives from a ParM-like actin homolog that was once encoded by a plasmid and was transferred into a common ancestor of Thermoplasma and Ferroplasma. Intriguingly, both genera are characterized by the lack of a cell wall, and therefore Ta0583 could have a function in cellular organization.

  5. Environmental and Genetic Influences of Archaeal Lipid Distribution in Natural and Artificial Marine Environments

    Science.gov (United States)

    Warren, C.; Pagani, M.

    2012-12-01

    TEX86 is a proxy of sea surface temperature based on refractory glycerol dibiphytanyl glycerol tetraethers (GDGT) in the cell membranes of low-temperature dwelling (non-hyperthermophilic) Archaea. The degree to which environmental signals other than temperature influence the distribution of GDGT compounds is poorly understood. Few representatives of the Thaumarchaeota — the clade to which the dominant GDGT production has been attributed — have been described or isolated in pure culture, and the role of genetic lineage in the synthesis and distribution of GDGTs is unknown. For this project we collected water, filter and substrate samples from tank systems in non-profit and commercial aquariums around the United States. This analysis compares GDGT core lipids and intact polar lipid distributions with Archaeal genetic sequence data processed using rRNA and 454 Pyrosequencing. Environmental attributes (such as dissolved oxygen concentration, salinity, organic density, etc.) specific to each tank are also compared to lipid analyses and the presence of specific lineages within select tank systems. Our preliminary results demonstrate that archaeal GDGTs are present and abundant within a range of environmental conditions, including artificial saline and brackish waters derived from municipal sources. Comparisons of existing TEX86 calibration values with known temperatures suggest that residuals vary based on non-temperature parameters. Branched compounds are absent in most aquarium systems, but dominate in systems prepared with municipal water.

  6. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    Science.gov (United States)

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  7. Archaeal Populations in Hypersaline Sediments Underlying Orange Microbial Mats in the Napoli Mud Volcano▿†

    Science.gov (United States)

    Lazar, Cassandre Sara; L'Haridon, Stéphane; Pignet, Patricia; Toffin, Laurent

    2011-01-01

    Microbial mats in marine cold seeps are known to be associated with ascending sulfide- and methane-rich fluids. Hence, they could be visible indicators of anaerobic oxidation of methane (AOM) and methane cycling processes in underlying sediments. The Napoli mud volcano is situated in the Olimpi Area that lies on saline deposits; from there, brine fluids migrate upward to the seafloor. Sediments associated with a brine pool and microbial orange mats of the Napoli mud volcano were recovered during the Medeco cruise. Based on analysis of RNA-derived sequences, the “active” archaeal community was composed of many uncultured lineages, such as rice cluster V or marine benthic group D. Function methyl coenzyme M reductase (mcrA) genes were affiliated with the anaerobic methanotrophic Archaea (ANME) of the ANME-1, ANME-2a, and ANME-2c groups, suggesting that AOM occurred in these sediment layers. Enrichment cultures showed the presence of viable marine methylotrophic Methanococcoides in shallow sediment layers. Thus, the archaeal community diversity seems to show that active methane cycling took place in the hypersaline microbial mat-associated sediments of the Napoli mud volcano. PMID:21335391

  8. Phylogeny of bacterial and archaeal genomes using conserved genes: supertrees and supermatrices.

    Directory of Open Access Journals (Sweden)

    Jenna Morgan Lang

    Full Text Available Over 3000 microbial (bacterial and archaeal genomes have been made publically available to date, providing an unprecedented opportunity to examine evolutionary genomic trends and offering valuable reference data for a variety of other studies such as metagenomics. The utility of these genome sequences is greatly enhanced when we have an understanding of how they are phylogenetically related to each other. Therefore, we here describe our efforts to reconstruct the phylogeny of all available bacterial and archaeal genomes. We identified 24, single-copy, ubiquitous genes suitable for this phylogenetic analysis. We used two approaches to combine the data for the 24 genes. First, we concatenated alignments of all genes into a single alignment from which a Maximum Likelihood (ML tree was inferred using RAxML. Second, we used a relatively new approach to combining gene data, Bayesian Concordance Analysis (BCA, as implemented in the BUCKy software, in which the results of 24 single-gene phylogenetic analyses are used to generate a "primary concordance" tree. A comparison of the concatenated ML tree and the primary concordance (BUCKy tree reveals that the two approaches give similar results, relative to a phylogenetic tree inferred from the 16S rRNA gene. After comparing the results and the methods used, we conclude that the current best approach for generating a single phylogenetic tree, suitable for use as a reference phylogeny for comparative analyses, is to perform a maximum likelihood analysis of a concatenated alignment of conserved, single-copy genes.

  9. The TOR signaling pathway regulates starvation-induced pseudouridylation of yeast U2 snRNA.

    Science.gov (United States)

    Wu, Guowei; Radwan, Mohamed K; Xiao, Mu; Adachi, Hironori; Fan, Jason; Yu, Yi-Tao

    2016-08-01

    Pseudouridine (Ψ) has been identified in various types of RNAs, including mRNA, rRNA, tRNA, snRNA, and many other noncoding RNAs. We have previously shown that RNA pseudouridylation, like DNA and protein modifications, can be induced by stress. For instance, growing yeast cells to saturation induces the formation of Ψ93 in U2 snRNA. Here, we further investigate this inducible RNA modification. We show that switching yeast cells from nutrient-rich medium to different nutrient-deprived media (including water) results in the formation of Ψ93 in U2 snRNA. Using gene deletion/conditional depletion as well as rapamycin treatment, we further show that the TOR signaling pathway, which controls cell entry into stationary phase, regulates Ψ93 formation. The RAS/cAMP signaling pathway, which parallels the TOR pathway, plays no role in this inducible modification.

  10. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet

    2006-01-01

    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  11. Familial relationships in hyperthermo- and acidophilic archaeal viruses

    DEFF Research Database (Denmark)

    Happonen, Lotta Johanna; Redder, Peter; Peng, Xu;

    2010-01-01

    Archaea often live in extreme, harsh environments such as acidic hot springs and hypersaline waters. To date, only two icosahedrally symmetric, membrane-containing archaeal viruses, SH1 and Sulfolobus turreted icosahedral virus (STIV), have been described in detail. We report the sequence and three...

  12. The σ enigma: bacterial σ factors, archaeal TFB and eukaryotic TFIIB are homologs.

    Science.gov (United States)

    Burton, Samuel P; Burton, Zachary F

    2014-01-01

    Structural comparisons of initiating RNA polymerase complexes and structure-based amino acid sequence alignments of general transcription initiation factors (eukaryotic TFIIB, archaeal TFB and bacterial σ factors) show that these proteins are homologs. TFIIB and TFB each have two-five-helix cyclin-like repeats (CLRs) that include a C-terminal helix-turn-helix (HTH) motif (CLR/HTH domains). Four homologous HTH motifs are present in bacterial σ factors that are relics of CLR/HTH domains. Sequence similarities clarify models for σ factor and TFB/TFIIB evolution and function and suggest models for promoter evolution. Commitment to alternate modes for transcription initiation appears to be a major driver of the divergence of bacteria and archaea. PMID:25483602

  13. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    OpenAIRE

    Kara Bowen De León; Robin eGerlach; Peyton, Brent M.; Matthew W Fields

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park, Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatur...

  14. Dye label interference with RNA modification reveals 5-fluorouridine as non-covalent inhibitor.

    Science.gov (United States)

    Spenkuch, Felix; Hinze, Gerald; Kellner, Stefanie; Kreutz, Christoph; Micura, Ronald; Basché, Thomas; Helm, Mark

    2014-11-10

    The interest in RNA modification enzymes surges due to their involvement in epigenetic phenomena. Here we present a particularly informative approach to investigate the interaction of dye-labeled RNA with modification enzymes. We investigated pseudouridine (Ψ) synthase TruB interacting with an alleged suicide substrate RNA containing 5-fluorouridine (5FU). A longstanding dogma, stipulating formation of a stable covalent complex was challenged by discrepancies between the time scale of complex formation and enzymatic turnover. Instead of classic mutagenesis, we used differentially positioned fluorescent labels to modulate substrate properties in a range of enzymatic conversion between 6% and 99%. Despite this variegation, formation of SDS-stable complexes occurred instantaneously for all 5FU-substrates. Protein binding was investigated by advanced fluorescence spectroscopy allowing unprecedented simultaneous detection of change in fluorescence lifetime, anisotropy decay, as well as emission and excitation maxima. Determination of Kd values showed that introduction of 5FU into the RNA substrate increased protein affinity by 14× at most. Finally, competition experiments demonstrated reversibility of complex formation for 5FU-RNA. Our results lead us to conclude that the hitherto postulated long-term covalent interaction of TruB with 5FU tRNA is based on the interpretation of artifacts. This is likely true for the entire class of pseudouridine synthases.

  15. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park.

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M; Fields, Matthew W

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  16. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M.; Fields, Matthew W.

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts. PMID:24282404

  17. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Directory of Open Access Journals (Sweden)

    Kara Bowen De León

    2013-11-01

    Full Text Available The Heart Lake Geyser Basin (HLGB is remotely located at the base of Mount Sheridan in southern Yellowstone National Park, Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5 hot springs with varying temperatures (44°C, 63°C, 75°C. The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44°C and 63°C springs and a hyperthermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  18. Influences of plant type on bacterial and archaeal communities in constructed wetland treating polluted river water.

    Science.gov (United States)

    Long, Yan; Yi, Hao; Chen, Sili; Zhang, Zhengke; Cui, Kai; Bing, Yongxin; Zhuo, Qiongfang; Li, Bingxin; Xie, Shuguang; Guo, Qingwei

    2016-10-01

    Both bacteria and archaeal communities can play important roles in biogeochemical processes in constructed wetland (CW) system. However, the influence of plant type on microbial community in surface water CW remains unclear. The present study investigated bacterial and archaeal communities in five surface water CW systems with different plant species. The abundance, richness, and diversity of both bacterial and archaeal communities considerably differed in these five CW systems. Compared with the other three CW systems, the CW systems planted with Vetiveria zizanioides or Juncus effusus L. showed much higher bacterial abundance but lower archaeal abundance. Bacteria outnumbered archaea in each CW system. Moreover, the CW systems planted with V. zizanioides or J. effusus L. had relatively lower archaeal but higher bacterial richness and diversity. In each CW system, bacterial community displayed much higher richness and diversity than archaeal community. In addition, a remarkable difference of both bacterial and archaeal community structures was observed in the five studied CW systems. Proteobacteria was the most abundant bacterial group (accounting for 33-60 %). Thaumarchaeota organisms (57 %) predominated in archaeal communities in CW systems planted with V. zizanioides or J. effusus L., while Woesearchaeota (23 or 24 %) and Euryarchaeota (23 or 15 %) were the major archaeal groups in CW systems planted with Cyperus papyrus or Canna indica L. Archaeal community in CW planted with Typha orientalis Presl was mainly composed of unclassified archaea. Therefore, plant type exerted a considerable influence on microbial community in surface water CW system. PMID:27392623

  19. Glycosidic Bond Conformation Preference Plays a Pivotal Role in Catalysis of RNA Pseudouridylation: A Combined Simulation and Structural Study

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jing; Lv, Chao; Liang, Bo; Chen, Mengen; Yang, Wei; Li, Hong (FSU)

    2010-11-11

    The most abundant chemical modification on RNA is isomerization of uridine (or pseudouridylation) catalyzed by pseudouridine synthases. The catalytic mechanism of this essential process remains largely speculative, partly due to lack of knowledge of the pre-reactive state that is important to the identification of reactive chemical moieties. In the present study, we showed, using orthogonal space random-walk free-energy simulation, that the pre-reactive states of uridine and its reactive derivative 5-fluorouridine, bound to a ribonucleoprotein particle pseudouridine synthase, strongly prefer the syn glycosidic bond conformation, while that of the nonreactive 5-bromouridine-containing substrate is largely populated in the anti conformation state. A high-resolution crystal structure of the 5-bromouridine-containing substrate bound to the ribonucleoprotein particle pseudouridine synthase and enzyme activity assay confirmed the anti nonreactive conformation and provided the molecular basis for its confinement. The observed preference for the syn pre-reactive state by the enzyme-bound uridine may help to distinguish among currently proposed mechanisms.

  20. Glycosidic bond conformation preference plays a pivotal role in catalysis of RNA pseudouridylation: a combined simulation and structural study.

    Science.gov (United States)

    Zhou, Jing; Lv, Chao; Liang, Bo; Chen, Mengen; Yang, Wei; Li, Hong

    2010-09-01

    The most abundant chemical modification on RNA is isomerization of uridine (or pseudouridylation) catalyzed by pseudouridine synthases. The catalytic mechanism of this essential process remains largely speculative, partly due to lack of knowledge of the pre-reactive state that is important to the identification of reactive chemical moieties. In the present study, we showed, using orthogonal space random-walk free-energy simulation, that the pre-reactive states of uridine and its reactive derivative 5-fluorouridine, bound to a ribonucleoprotein particle pseudouridine synthase, strongly prefer the syn glycosidic bond conformation, while that of the nonreactive 5-bromouridine-containing substrate is largely populated in the anti conformation state. A high-resolution crystal structure of the 5-bromouridine-containing substrate bound to the ribonucleoprotein particle pseudouridine synthase and enzyme activity assay confirmed the anti nonreactive conformation and provided the molecular basis for its confinement. The observed preference for the syn pre-reactive state by the enzyme-bound uridine may help to distinguish among currently proposed mechanisms.

  1. Distribution of Archaeal and Bacterial communities in a subtropical reservoir

    Directory of Open Access Journals (Sweden)

    Laís Américo Soares

    2015-12-01

    Full Text Available Abstract Aim: Microbial communities play a central role in environmental process such as organic matter mineralization and the nutrient cycling process in aquatic ecosystems. Despite their ecological importance, variability of the structure of archaeal and bacterial communities in freshwater remains understudied. Methods In the present study we investigated the richness and density of archaea and bacteria in the water column and sediments of the Itupararanga Reservoir. We also evaluated the relationship between the communities and the biotic and abiotic characteristics. Samples were taken at five depths in the water column next to the dam and three depths next to the reservoir entrance. Results PCR-DGGE evaluation of the archaeal and bacterial communities showed that both were present in the water column, even in oxygenated conditions. Conclusions The density of the bacteria (qPCR was greater than that of the archaea, a result of the higher metabolic plasticity of bacteria compared with archaea.

  2. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

    2002-01-01

    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  3. Global analysis of viral infection in an archaeal model system

    Directory of Open Access Journals (Sweden)

    Walid S. Maaty

    2012-12-01

    Full Text Available The origin and evolutionary relationship of viruses is poorly understood. This makes archaeal virus-host of particular interest because the hosts generally root near the base of phylogenetic trees, while some of the viruses have clear structural similarities to those that infect prokaryotic and eukaryotic cells. Despite the advantageous position for use in evolutionary studies, little is known about archaeal viruses or how they interact with their hosts, compared to viruses of bacteria and eukaryotes. In addition, many archaeal viruses have been isolated from extreme environments and present a unique opportunity for elucidating factors that are important for existence at the extremes.. In this article we focus on virus-host interactions using a proteomics approach to study Sulfolobus Turreted Icosahedral Virus (STIV infection of Sulfolobus solfataricus P2. Using cultures grown from the ATCC cell stock, a single cycle of STIV infection was sampled 6 times over a 72 hr period. More than 700 proteins were identified throughout the course of the experiments. Seventy one host proteins were found to change by nearly two-fold (p<0.05 with 40 becoming more abundant and 31 less abundant. The modulated proteins represent 30 different cell pathways and 14 COG groups. 2D gel analysis showed that changes in post translational modifications were a common feature of the affected proteins. The results from these studies showed that the prokaryotic antiviral adaptive immune system CRISPR associated proteins (CAS proteins were regulated in response to the virus infection. It was found that regulated proteins come from mRNAs with a shorter than average half-life. In addition, activity-based protein profiling (ABPP profiling on 2D gels showed caspase, hydrolase and tyrosine phosphatase enzyme activity labeling at the protein isoform level. Together, this data provides a more detailed global view of archaeal cellular responses to viral infection, demonstrates the

  4. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil

    Directory of Open Access Journals (Sweden)

    Yendi E. Navarro-Noya

    2015-01-01

    Full Text Available In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5, indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances clearly clustered the communities by pH.

  5. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil.

    Science.gov (United States)

    Navarro-Noya, Yendi E; Valenzuela-Encinas, César; Sandoval-Yuriar, Alonso; Jiménez-Bueno, Norma G; Marsch, Rodolfo; Dendooven, Luc

    2015-01-01

    In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC) ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5), indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances) clearly clustered the communities by pH.

  6. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest.

    Science.gov (United States)

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2011-03-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees were monitored at bimonthly intervals through 16S rRNA gene-based terminal restriction fragment length polymorphism profiling and quantitative PCR analysis. Effects on nitrifying and denitrifying groups were assessed by measuring the abundances of nirS and nosZ genes as well as bacterial and archaeal amoA genes. Seasonal dynamics displayed by key phylogenetic and nitrogen (N) cycling functional groups were found to be tightly coupled with seasonal alterations in labile C and N pools as well as with variation in soil temperature and soil moisture. In particular, archaea and acidobacteria were highly responsive to soil nutritional and soil climatic changes associated with seasonality, indicating their high metabolic versatility and capability to adapt to environmental changes. For these phyla, significant interrelations with soil chemical and microbial process data were found suggesting their potential, but poorly described contribution to nitrification or denitrification in temperate forest soils. In conclusion, our extensive approach allowed us to get novel insights into effects of seasonality and resource availability on the microbial community, in particular on hitherto poorly studied bacterial phyla and functional groups.

  7. Identification and characterization of SNJ2, the first temperate pleolipovirus integrating into the genome of the SNJ1-lysogenic archaeal strain.

    Science.gov (United States)

    Liu, Ying; Wang, Jiao; Liu, Yang; Wang, Yuchen; Zhang, Ziqian; Oksanen, Hanna M; Bamford, Dennis H; Chen, Xiangdong

    2015-12-01

    Proviral regions have been identified in the genomes of many haloarchaea, but only a few archaeal halophilic temperate viruses have been studied. Here, we report a new virus, SNJ2, originating from archaeal strain Natrinema sp. J7-1. We demonstrate that this temperate virus coexists with SNJ1 virus and is dependent on SNJ1 for efficient production. Here, we show that SNJ1 is an icosahedral membrane-containing virus, whereas SNJ2 is a pleomorphic one. Instead of producing progeny virions and forming plaques, SNJ2 integrates into the host tRNA(Met) gene. The virion contains a discontinuous, circular, double-stranded DNA genome of 16 992 bp, in which both nicks and single-stranded regions are present preceded by a 'GCCCA' motif. Among 25 putative SNJ2 open reading frames (ORFs), five of them form a cluster of conserved ORFs homologous to archaeal pleolipoviruses isolated from hypersaline environments. Two structural protein encoding genes in the conserved cluster were verified in SNJ2. Furthermore, SNJ2-like proviruses containing the conserved gene cluster were identified in the chromosomes of archaea belonging to 10 different genera. Comparison of SNJ2 and these proviruses suggests that they employ a similar integration strategy into a tRNA gene. PMID:26331239

  8. The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability.

    Science.gov (United States)

    Copela, Laura A; Chakshusmathi, Ghadiyaram; Sherrer, R Lynn; Wolin, Sandra L

    2006-04-01

    Although the La protein stabilizes nascent pre-tRNAs from nucleases, influences the pathway of pre-tRNA maturation, and assists correct folding of certain pre-tRNAs, it is dispensable for growth in both budding and fission yeast. Here we show that the Saccharomyces cerevisiae La shares functional redundancy with both tRNA modification enzymes and other proteins that contact tRNAs during their biogenesis. La is important for growth in the presence of mutations in either the arginyl tRNA synthetase or the tRNA modification enzyme Trm1p. In addition, two pseudouridine synthases, PUS3 and PUS4, are important for growth in strains carrying a mutation in tRNA(Arg)(CCG) and are essential when La is deleted in these strains. Depletion of Pus3p results in accumulation of the aminoacylated mutant tRNA(Arg)(CCG) in nuclei, while depletion of Pus4p results in decreased stability of the mutant tRNA. Interestingly, the degradation of mutant unstable forms of tRNA(Arg)(CCG) does not require the Trf4p poly(A) polymerase, suggesting that yeast cells possess multiple pathways for tRNA decay. These data demonstrate that La functions redundantly with both tRNA modifications and proteins that associate with tRNAs to achieve tRNA structural stability and efficient biogenesis.

  9. Distribution and Diversity of Archaeal Ammonia Monooxygenase Genes Associated with Corals▿ †

    OpenAIRE

    Beman, J. Michael; Roberts, Kathryn J.; Wegley, Linda; Rohwer, Forest; Francis, Christopher A.

    2007-01-01

    Corals are known to harbor diverse microbial communities of Bacteria and Archaea, yet the ecological role of these microorganisms remains largely unknown. Here we report putative ammonia monooxygenase subunit A (amoA) genes of archaeal origin associated with corals. Multiple DNA samples drawn from nine coral species and four different reef locations were PCR screened for archaeal and bacterial amoA genes, and archaeal amoA gene sequences were obtained from five different species of coral coll...

  10. Substrate tRNA Recognition Mechanism of a Multisite-specific tRNA Methyltransferase, Aquifex aeolicus Trm1, Based on the X-ray Crystal Structure*

    OpenAIRE

    Awai, Takako; Ochi, Anna; Ihsanawati,; Sengoku, Toru; Hirata, Akira; Bessho, Yoshitaka; Yokoyama, Shigeyuki; Hori, Hiroyuki

    2011-01-01

    Archaeal and eukaryotic tRNA (N2,N2-guanine)-dimethyltransferase (Trm1) produces N2,N2-dimethylguanine at position 26 in tRNA. In contrast, Trm1 from Aquifex aeolicus, a hyper-thermophilic eubacterium, modifies G27 as well as G26. Here, a gel mobility shift assay revealed that the T-arm in tRNA is the binding site of A. aeolicus Trm1. To address the multisite specificity, we performed an x-ray crystal structure study. The overall structure of A. aeolicus Trm1 is similar to that of archaeal Tr...

  11. Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

    Science.gov (United States)

    Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

    2016-09-01

    Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing. PMID:27338271

  12. Archaeal enrichment in the hypoxic zone in the northern Gulf of Mexico.

    Science.gov (United States)

    Gillies, Lauren E; Thrash, J Cameron; deRada, Sergio; Rabalais, Nancy N; Mason, Olivia U

    2015-10-01

    Areas of low oxygen have spread exponentially over the past 40 years, and are cited as a key stressor on coastal ecosystems. The world's second largest coastal hypoxic (≤ 2 mg of O2 l(-1)) zone occurs annually in the northern Gulf of Mexico. The net effect of hypoxia is the diversion of energy flow away from higher trophic levels to microorganisms. This energy shunt is consequential to the overall productivity of hypoxic water masses and the ecosystem as a whole. In this study, water column samples were collected at 39 sites in the nGOM, 21 of which were hypoxic. Analysis of the microbial community along a hypoxic to oxic dissolved oxygen gradient revealed that the relative abundance (iTag) of Thaumarchaeota species 16S rRNA genes (> 40% of the microbial community in some hypoxic samples), the absolute abundance (quantitative polymerase chain reaction; qPCR) of Thaumarchaeota 16S rRNA genes and archaeal ammonia-monooxygenase gene copy number (qPCR) were significantly higher in hypoxic samples. Spatial interpolation of the microbial and chemical data revealed a continuous, shelfwide band of low dissolved oxygen waters that were dominated by Thaumarchaeota (and Euryarchaeota), amoA genes and high concentrations of phosphate in the nGOM, thus implicating physicochemical forcing on microbial abundance. PMID:25818237

  13. Archaeal and anaerobic methane oxidizer communities in the Sonora Margin cold seeps, Guaymas Basin (Gulf of California).

    Science.gov (United States)

    Vigneron, Adrien; Cruaud, Perrine; Pignet, Patricia; Caprais, Jean-Claude; Cambon-Bonavita, Marie-Anne; Godfroy, Anne; Toffin, Laurent

    2013-08-01

    Cold seeps, located along the Sonora Margin transform fault in the Guaymas Basin, were extensively explored during the 'BIG' cruise in June 2010. They present a seafloor mosaic pattern consisting of different faunal assemblages and microbial mats. To investigate this mostly unknown cold and hydrocarbon-rich environment, geochemical and microbiological surveys of the sediments underlying two microbial mats and a surrounding macrofaunal habitat were analyzed in detail. The geochemical measurements suggest biogenic methane production and local advective sulfate-rich fluxes in the sediments. The distributions of archaeal communities, particularly those involved in the methane cycle, were investigated at different depths (surface to 18 cm below the sea floor (cmbsf)) using complementary molecular approaches, such as Automated method of Ribosomal Intergenic Spacer Analysis (ARISA), 16S rRNA libraries, fluorescence in situ hybridization and quantitative polymerase chain reaction with new specific primer sets targeting methanogenic and anaerobic methanotrophic lineages. Molecular results indicate that metabolically active archaeal communities were dominated by known clades of anaerobic methane oxidizers (archaeal anaerobic methanotroph (ANME)-1, -2 and -3), including a novel 'ANME-2c Sonora' lineage. ANME-2c were found to be dominant, metabolically active and physically associated with syntrophic Bacteria in sulfate-rich shallow sediment layers. In contrast, ANME-1 were more prevalent in the deepest sediment samples and presented a versatile behavior in terms of syntrophic association, depending on the sulfate concentration. ANME-3 were concentrated in small aggregates without bacterial partners in a restricted sediment horizon below the first centimetres. These niche specificities and syntrophic behaviors, depending on biological surface assemblages and environmental availability of electron donors, acceptors and carbon substrates, suggest that ANME could support

  14. Controls on bacterial and archaeal community structure and greenhouse gas production in natural, mined, and restored Canadian peatlands

    Directory of Open Access Journals (Sweden)

    Nathan eBasiliko

    2013-07-01

    Full Text Available Northern peatlands are important global C reservoirs, largely because of their slow rates of microbial C mineralization. Particularly in sites that are heavily influenced by anthropogenic disturbances, there is scant information about microbial ecology and whether or not microbial community structure influences greenhouse gas production. This work characterized communities of bacteria and archaea using terminal restriction fragment length polymorphism and sequence analysis of 16S rRNA and functional genes across eight natural, mined, or restored peatlands in two locations in eastern Canada. Correlations were explored among chemical properties of peat, bacterial and archaeal community structure, and carbon dioxide and methane production rates under oxic and anoxic conditions. Bacteria and archaea similar to those found in other peat soil environments were detected. In contrast to other reports, methanogen diversity was low in our study, with only 2 groups of known or suspected methanogens. Although mining and restoration affected substrate availability and microbial activity, these land-uses did not consistently affect bacterial or archaeal community composition. In fact, larger differences were observed between the two locations and between oxic and anoxic peat samples than between mined and restored sites, with anoxic samples characterized by less detectable bacterial diversity and stronger dominance by members of the phylum Acidobacteria. There were also no apparent strong linkages between prokaryote community structure and methane or carbon dioxide production, suggesting that different organisms exhibit functional redundancy and/or that the same taxa function at very different rates when exposed to different peat substrates. In contrast to other earlier work focusing on fungal communities across similar mined and restored peatlands, bacterial and archaeal communities appeared to be more resistant or resilient to peat substrate changes brought

  15. Expanding networks of RNA virus evolution

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2012-06-01

    Full Text Available Abstract In a recent BMC Evolutionary Biology article, Huiquan Liu and colleagues report two new genomes of double-stranded RNA (dsRNA viruses from fungi and use these as a springboard to perform an extensive phylogenomic analysis of dsRNA viruses. The results support the old scenario of polyphyletic origin of dsRNA viruses from different groups of positive-strand RNA viruses and additionally reveal extensive horizontal gene transfer between diverse viruses consistent with the network-like rather than tree-like mode of viral evolution. Together with the unexpected discoveries of the first putative archaeal RNA virus and a RNA-DNA virus hybrid, this work shows that RNA viral genomics has major surprises to deliver. See research article: http://www.biomedcentral.com/1471-2148/12/91

  16. Electroporation of archaeal lipid membranes using MD simulations.

    Science.gov (United States)

    Polak, Andraž; Tarek, Mounir; Tomšič, Matija; Valant, Janez; Ulrih, Nataša Poklar; Jamnik, Andrej; Kramar, Peter; Miklavčič, Damijan

    2014-12-01

    Molecular dynamics (MD) simulations were used to investigate the electroporation of archaeal lipid bilayers when subjected to high transmembrane voltages induced by a charge imbalance, mimicking therefore millisecond electric pulse experiments. The structural characteristics of the bilayer, a 9:91 mol% 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-myo-inositol (AI) and 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-1'(2'-O-α-D-glucosyl)-myo-inositol (AGI) were compared to small angle X-ray scattering data. A rather good agreement of the electron density profiles at temperatures of 298 and 343 K was found assessing therefore the validity of the protocols and force fields used in simulations. Compared to dipalmitoyl-phosphatidylcholine (DPPC), the electroporation threshold for the bilayer was found to increase from ~2 V to 4.3 V at 323 K, and to 5.2 V at 298 K. Comparing the electroporation thresholds of the archaeal lipids to those of simple diphytanoyl-phosphatidylcholine (DPhPC) bilayers (2.5 V at 323 K) allowed one to trace back the stability of the membranes to the structure of their lipid head groups. Addition of DPPC in amounts of 50 mol% to the archaeal lipid bilayers decreases their stability and lowers the electroporation thresholds to 3.8 V and 4.1 V at respectively 323 and 298 K. The present study therefore shows how membrane compositions can be selected to cover a wide range of responses to electric stimuli. This provides new routes for the design of liposomes that can be efficiently used as drug delivery carriers, as the selection of their composition allows one to tune in their electroporation threshold for subsequent release of their load.

  17. Factors affecting Archaeal Lipid Compositions of the Sulfolobus Species

    Science.gov (United States)

    He, L.; Han, J.; Wei, Y.; Lin, L.; Wei, Y.; Zhang, C.

    2010-12-01

    Temperature is the best known variable affecting the distribution of the archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) in marine and freshwater systems. Other variables such as pH, ionic strength, or bicarbonate concentration may also affect archaeal GDGTs in terrestrial systems. Studies of pure cultures can help us pinpoint the specific effects these variables may have on archaeal lipid distribution in natural environments. In this study, three Sulfolobus species (HG4, HB5-2, HB9-6) isolated from Tengchong hot springs (pH 2-3, temperature 73-90°C) in China were used to investigate the effects of temperature, pH, substrate, and type of strain on the composition of GDGTs. Results showed that increase in temperature had negative effects on the relative contents of GDGT-0 (no cyclopentyl rings), GDGT-1 (one cyclopentyl ring), GDGT-2 and GDGT-3 but positive effects on GDGT-4, GDGT-4', GDGT-5 and GDGT-5'. Increase in pH, on the other hand, had negative effects on GDGT-0, GDGT-1, GDGT-4', GDGT-5 and GDGT-5', and positive effects on GDGT-3 and GDGT-4. GDGT-2 remained relatively constant with changing pH. When the HG4 was grown on different substrates, GDGT-5 was five time more abundant in sucrose-grown cultures than in yeast extract- or sulfur- grown cultures, suggesting that carbohydrates may stimulate the production of GDGT-5. For all three species, the ring index (average number of rings) of GDGTs correlated positively with incubation temperature. In HG4, ring index was much lower at optimal pH (3.5) than at other pH values. Ring index of HB5-2 or HB9-6 is higher than that of HG4, suggesting that speciation may affect the degree of cyclization of GDGT of the Sulfolobus. These results indicate that individual archaeal lipids respond differently to changes in environmental variables, which may be also species specific.

  18. Modelling the evolution of the archaeal tryptophan synthase

    Directory of Open Access Journals (Sweden)

    Merkl Rainer

    2007-04-01

    Full Text Available Abstract Background Microorganisms and plants are able to produce tryptophan. Enzymes catalysing the last seven steps of tryptophan biosynthesis are encoded in the canonical trp operon. Among the trp genes are most frequently trpA and trpB, which code for the alpha and beta subunit of tryptophan synthase. In several prokaryotic genomes, two variants of trpB (named trpB1 or trpB2 occur in different combinations. The evolutionary history of these trpB genes is under debate. Results In order to study the evolution of trp genes, completely sequenced archaeal and bacterial genomes containing trpB were analysed. Phylogenetic trees indicated that TrpB sequences constitute four distinct groups; their composition is in agreement with the location of respective genes. The first group consisted exclusively of trpB1 genes most of which belonged to trp operons. Groups two to four contained trpB2 genes. The largest group (trpB2_o contained trpB2 genes all located outside of operons. Most of these genes originated from species possessing an operon-based trpB1 in addition. Groups three and four pertain to trpB2 genes of those genomes containing exclusively one or two trpB2 genes, but no trpB1. One group (trpB2_i consisted of trpB2 genes located inside, the other (trpB2_a of trpB2 genes located outside the trp operon. TrpA and TrpB form a heterodimer and cooperate biochemically. In order to characterise trpB variants and stages of TrpA/TrpB cooperation in silico, several approaches were combined. Phylogenetic trees were constructed for all trp genes; their structure was assessed via bootstrapping. Alternative models of trpB evolution were evaluated with parsimony arguments. The four groups of trpB variants were correlated with archaeal speciation. Several stages of TrpA/TrpB cooperation were identified and trpB variants were characterised. Most plausibly, trpB2 represents the predecessor of the modern trpB gene, and trpB1 evolved in an ancestral bacterium

  19. Community Composition and Abundance of Bacterial, Archaeal and Nitrifying Populations in Savanna Soils on Contrasting Bedrock Material in Kruger National Park, South Africa

    Science.gov (United States)

    Rughöft, Saskia; Herrmann, Martina; Lazar, Cassandre S.; Cesarz, Simone; Levick, Shaun R.; Trumbore, Susan E.; Küsel, Kirsten

    2016-01-01

    Savannas cover at least 13% of the global terrestrial surface and are often nutrient limited, especially by nitrogen. To gain a better understanding of their microbial diversity and the microbial nitrogen cycling in savanna soils, soil samples were collected along a granitic and a basaltic catena in Kruger National Park (South Africa) to characterize their bacterial and archaeal composition and the genetic potential for nitrification. Although the basaltic soils were on average 5 times more nutrient rich than the granitic soils, all investigated savanna soil samples showed typically low nutrient availabilities, i.e., up to 38 times lower soil N or C contents than temperate grasslands. Illumina MiSeq amplicon sequencing revealed a unique soil bacterial community dominated by Actinobacteria (20–66%), Chloroflexi (9–29%), and Firmicutes (7–42%) and an increase in the relative abundance of Actinobacteria with increasing soil nutrient content. The archaeal community reached up to 14% of the total soil microbial community and was dominated by the thaumarchaeal Soil Crenarchaeotic Group (43–99.8%), with a high fraction of sequences related to the ammonia-oxidizing genus Nitrosopshaera sp. Quantitative PCR targeting amoA genes encoding the alpha subunit of ammonia monooxygenase also revealed a high genetic potential for ammonia oxidation dominated by archaea (~5 × 107 archaeal amoA gene copies g−1 soil vs. mostly < 7 × 104 bacterial amoA gene copies g−1 soil). Abundances of archaeal 16S rRNA and amoA genes were positively correlated with soil nitrate, N and C contents. Nitrospira sp. was detected as the most abundant group of nitrite oxidizing bacteria. The specific geochemical conditions and particle transport dynamics at the granitic catena were found to affect soil microbial communities through clay and nutrient relocation along the hill slope, causing a shift to different, less diverse bacterial and archaeal communities at the footslope. Overall, our

  20. CRISPRTarget: bioinformatic prediction and analysis of crRNA targets

    NARCIS (Netherlands)

    Biswas, A.; Gagnon, J.N.; Brouns, S.J.J.; Fineran, P.C.; Brown, C.M.

    2013-01-01

    The bacterial and archaeal CRISPR/Cas adaptive immune system targets specific protospacer nucleotide sequences in invading organisms. This requires base pairing between processed CRISPR RNA and the target protospacer. For type I and II CRISPR/Cas systems, protospacer adjacent motifs (PAM) are essent

  1. Energy for two: New archaeal lineages and the origin of mitochondria.

    Science.gov (United States)

    Martin, William F; Neukirchen, Sinje; Zimorski, Verena; Gould, Sven B; Sousa, Filipa L

    2016-09-01

    Metagenomics bears upon all aspects of microbiology, including our understanding of mitochondrial and eukaryote origin. Recently, ribosomal protein phylogenies show the eukaryote host lineage - the archaeal lineage that acquired the mitochondrion - to branch within the archaea. Metagenomic studies are now uncovering new archaeal lineages that branch more closely to the host than any cultivated archaea do. But how do they grow? Carbon and energy metabolism as pieced together from metagenome assemblies of these new archaeal lineages, such as the Deep Sea Archaeal Group (including Lokiarchaeota) and Bathyarchaeota, do not match the physiology of any cultivated microbes. Understanding how these new lineages live in their environment is important, and might hold clues about how mitochondria arose and how the eukaryotic lineage got started. Here we look at these exciting new metagenomic studies, what they say about archaeal physiology in modern environments, how they impact views on host-mitochondrion physiological interactions at eukaryote origin. PMID:27339178

  2. The roles of the essential Asp-48 and highly conserved His-43 elucidated by the pH dependence of the pseudouridine synthase TruB.

    Science.gov (United States)

    Hamilton, Christopher S; Spedaliere, Christopher J; Ginter, Joy M; Johnston, Murray V; Mueller, Eugene G

    2005-01-01

    All known pseudouridine synthases have a conserved aspartic acid residue that is essential for catalysis, Asp-48 in Escherichia coli TruB. To probe the role of this residue, inactive D48C TruB was oxidized to generate the sulfinic acid cognate of aspartic acid. The oxidation restored significant but reduced catalytic activity, consistent with the proposed roles of Asp-48 as a nucleophile and general base. The family of pseudouridine synthases including TruB also has a nearly invariant histidine residue, His-43 in the E. coli enzyme. To examine the role of this conserved residue, site-directed mutagenesis was used to generate H43Q, H43N, H43A, H43G, and H43F TruB. Except for phenylalanine, the substitutions seriously impaired the enzyme, but all of the altered TruB retained significant activity. To examine the roles of Asp-48 and His-43 more fully, the pH dependences of wild-type, oxidized D48C, and H43A TruB were determined. The wild-type enzyme displays a typical bell-shaped profile. With oxidized D48C TruB, logk(cat) varies linearly with pH, suggesting the participation of specific rather than general base catalysis. Substitution of His-43 perturbs the pH profile, but it remains bell-shaped. The ascending limb of the pH profile is assigned to Asp-48, and the descending limb is tentatively ascribed to an active site tyrosine residue, the bound substrate uridine, or the bound product pseudouridine.

  3. Methanobacterium Dominates Biocathodic Archaeal Communities in Methanogenic Microbial Electrolysis Cells

    KAUST Repository

    Siegert, Michael

    2015-07-06

    © 2015 American Chemical Society. Methane is the primary end product from cathodic current in microbial electrolysis cells (MECs) in the absence of methanogenic inhibitors, but little is known about the archaeal communities that develop in these systems. MECs containing cathodes made from different materials (carbon brushes, or plain graphite blocks or blocks coated with carbon black and platinum, stainless steel, nickel, ferrihydrite, magnetite, iron sulfide, or molybdenum disulfide) were inoculated with anaerobic digester sludge and acclimated at a set potential of -600 mV (versus a standard hydrogen electrode). The archaeal communities on all cathodes, except those coated with platinum, were predominated by Methanobacterium (median 97% of archaea). Cathodes with platinum contained mainly archaea most similar to Methanobrevibacter. Neither of these methanogens were abundant (<0.1% of archaea) in the inoculum, and therefore their high abundance on the cathode resulted from selective enrichment. In contrast, bacterial communities on the cathode were more diverse, containing primarily δ-Proteobacteria (41% of bacteria). The lack of a consistent bacterial genus on the cathodes indicated that there was no similarly selective enrichment of bacteria on the cathode. These results suggest that the genus Methanobacterium was primarily responsible for methane production in MECs when cathodes lack efficient catalysts for hydrogen gas evolution. (Figure Presented).

  4. Structure and cell biology of archaeal virus STIV.

    Science.gov (United States)

    Fu, Chi-yu; Johnson, Johnson E

    2012-04-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interactions. Reliable laboratory conditions to propagate STIV and available genetic tools allowed structural characterization of the virus and viral components that lead to the proposal of common capsid ancestry with PRD1 (bacteriophage), Adenovirus (eukaryotic virus) and PBCV (chlorellavirus). Microarray and proteomics approaches systematically analyzed viral replication and the corresponding host responses. Cellular cryo-electron tomography and thin-section EM studies uncovered the assembly and maturation pathway of STIV and revealed dramatic cellular ultra-structure changes upon infection. The viral-induced pyramid-like protrusions on cell surfaces represent a novel viral release mechanism and previously uncharacterized functions in viral replication. PMID:22482708

  5. Rapid fold and structure determination of the archaeal translation elongation factor 1β from Methanobacterium thermoautotrophicum

    International Nuclear Information System (INIS)

    The tertiary fold of the elongation factor, aEF-1β, from Methanobacterium thermoautotrophicum was determined in a high-throughput fashion using a minimal set of NMR experiments. NMR secondary structure prediction, deuterium exchange experiments and the analysis of chemical shift perturbations were combined to identify the protein fold as an alpha-beta sandwich typical of many RNA binding proteins including EF-G. Following resolution of the tertiary fold, a high resolution structure of aEF-1β was determined using heteronuclear and homonuclear NMR experiments and a semi-automated NOESY assignment strategy. Analysis of the aEF-1β structure revealed close similarity to its human analogue, eEF-1β. In agreement with studies on EF-Ts and human EF-1β, a functional mechanism for nucleotide exchange is proposed wherein Phe46 on an exposed loop acts as a lever to eject GDP from the associated elongation factor G-protein, aEF-1α. aEF-1β was also found to bind calcium in the groove between helix α2 and strand β4. This novel feature was not observed previously and may serve a structural function related to protein stability or may play a functional role in archaeal protein translation

  6. Magnetic Au Nanoparticles on Archaeal S-Layer Ghosts as Templates

    Directory of Open Access Journals (Sweden)

    Sonja Selenska-Pobell

    2011-10-01

    Full Text Available Cell‐ghosts representing empty cells of the archaeon Sulfolobus acidocaldarius, consisting only of their highly ordered and unusually stable outermost proteinaceous surface layer (S‐layer, were used as templates for Au nanoparticles fabrication. The properties of these archaeal Au nanoparticles differ significantly from those produced earlier by us onto bacterial S‐layer sheets. The archaeal Au nanoparticles, with a size of about 2.5 nm, consist exclusively of metallic Au(0, while those produced on the bacterial S‐layer had a size of about 4 nm and represented a mixture of Au(0 and Au(III in the ratio of 40 to 60 %. The most impressive feature of the archaeal Au nanoparticles is that they are strongly paramagnetic, in contrast to the bacterial ones and also to bulk gold. SQUID magnetometry and XMCD measurements demonstrated that the archaeal Au nanoparticles possess a rather large magnetic moment of about 0.1 µB/atom. HR‐ TEM‐EDX analysis revealed that the archaeal Au nanoparticles are linked to the sulfur atoms of the thiol groups of the amino acid cysteine, characteristic only for archaeal S‐layers. This is the first study demonstrating the formation of such unusually strong magnetic Au nanoparticles on a non‐modified archaeal S‐layer.

  7. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  8. Archaeal promoter architecture and mechanism of gene activation.

    Science.gov (United States)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  9. Useful scars: Physics of the capsids of archaeal viruses

    Science.gov (United States)

    Perotti, L. E.; Dharmavaram, S.; Klug, W. S.; Marian, J.; Rudnick, J.; Bruinsma, R. F.

    2016-07-01

    We propose a physical model for the capsids of tailed archaeal viruses as viscoelastic membranes under tension. The fluidity is generated by thermal motion of scarlike structures that are an intrinsic feature of the ground state of large particle arrays covering surfaces with nonzero Gauss curvature. The tension is generated by a combination of the osmotic pressure of the enclosed genome and an extension force generated by filamentous structure formation that drives the formation of the tails. In continuum theory, the capsid has the shape of a surface of constant mean curvature: an unduloid. Particle arrays covering unduloids are shown to exhibit pronounced subdiffusive and diffusive single-particle transport at temperatures that are well below the melting temperature of defect-free particle arrays on a surface with zero Gauss curvature.

  10. Structural and Functional Characterization of an Archaeal Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated Complex for Antiviral Defense (CASCADE)

    DEFF Research Database (Denmark)

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K;

    2011-01-01

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA....... The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5......a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2...

  11. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE).

    Science.gov (United States)

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K; Graham, Shirley; Liu, Huanting; Naismith, James H; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J; White, Malcolm F; Lawrence, C Martin

    2011-06-17

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea.

  12. Changes in northern Gulf of Mexico sediment bacterial and archaeal communities exposed to hypoxia

    Science.gov (United States)

    Biogeochemical changes in marine sediments during coastal water hypoxia are well described, but less is known about underlying changes in microbial communities. Bacterial and archaeal communities in Louisiana continental shelf (LCS) hypoxic zone sediments were characterized by py...

  13. The essence of being extremophilic : the role of the unique archaeal membrane lipids

    NARCIS (Netherlands)

    Vossenberg, Jack L.C.M. van de; Driessen, Arnold J.M.; Konings, Wil N.

    1998-01-01

    In extreme environments, mainly Archaea are encountered. The archaeal cytoplasmic membrane contains unique ether lipids that cannot easily be degraded, are temperature- and mechanically resistant, and highly salt tolerant. Moreover, thermophilic and extreme acidophilic Archaea possess membrane-spann

  14. Quantification of bacterial and archaeal symbionts in high and low microbial abundance sponges using real-time PCR

    KAUST Repository

    Bayer, Kristina

    2014-07-09

    In spite of considerable insights into the microbial diversity of marine sponges, quantitative information on microbial abundances and community composition remains scarce. Here, we established qPCR assays for the specific quantification of four bacterial phyla of representative sponge symbionts as well as the kingdoms Eubacteria and Archaea. We could show that the 16S rRNA gene numbers of Archaea, Chloroflexi, and the candidate phylum Poribacteria were 4-6 orders of magnitude higher in high microbial abundance (HMA) than in low microbial abundance (LMA) sponges and that actinobacterial 16S rRNA gene numbers were 1-2 orders higher in HMA over LMA sponges, while those for Cyanobacteria were stable between HMA and LMA sponges. Fluorescence in situ hybridization of Aplysina aerophoba tissue sections confirmed the numerical dominance of Chloroflexi, which was followed by Poribacteria. Archaeal and actinobacterial cells were detected in much lower numbers. By use of fluorescence-activated cell sorting as a primer- and probe-independent approach, the dominance of Chloroflexi, Proteobacteria, and Poribacteria in A. aerophoba was confirmed. Our study provides new quantitative insights into the microbiology of sponges and contributes to a better understanding of the HMA/LMA dichotomy. The authors quantified sponge symbionts in eight sponge species from three different locations by real time PCR targetting 16S rRNA genes. Additionally, FISH was performed and diversity and abundance of singularized microbial symbionts from Aplysina aerophoba was determined for a comprehensive quantification work. © 2014 Federation of European Microbiological Societies.

  15. Accurate placement of substrate RNA by Gar1 in H/ACA RNA-guided pseudouridylation.

    Science.gov (United States)

    Wang, Peng; Yang, Lijiang; Gao, Yi Qin; Zhao, Xin Sheng

    2015-09-01

    H/ACA RNA-guided ribonucleoprotein particle (RNP), the most complicated RNA pseudouridylase so far known, uses H/ACA guide RNA for substrate capture and four proteins (Cbf5, Nop10, L7Ae and Gar1) for pseudouridylation. Although it was shown that Gar1 not only facilitates the product release, but also enhances the catalytic activity, the chemical role that Gar1 plays in this complicated machinery is largely unknown. Kinetics measurement on Pyrococcus furiosus RNPs at different temperatures making use of fluorescence anisotropy showed that Gar1 reduces the catalytic barrier through affecting the activation entropy instead of enthalpy. Site-directed mutagenesis combined with molecular dynamics simulations demonstrated that V149 in the thumb loop of Cbf5 is critical in placing the target uridine to the right position toward catalytic D85 of Cbf5. The enzyme elegantly aligns the position of uridine in the catalytic site with the help of Gar1. In addition, conversion of uridine to pseudouridine results in a rigid syn configuration of the target nucleotide in the active site and causes Gar1 to pull out the thumb. Both factors guarantee the efficient release of the product. PMID:26206671

  16. Soil bacterial and archaeal communities of the Stringer Creek Watershed in relation to soil moisture, chemistry, and gas fluxes

    Science.gov (United States)

    Jones, R. T.; Du, Z.; Riveros-Iregui, D.; Dore, J. E.; Emanuel, R. E.; McGlynn, B. L.; McDermott, T.; Li, X.

    2013-12-01

    The Stringer Creek watershed within the Tenderfoot Creek Experimental Forest (Montana) is a highly instrumented watershed with long-term hydrologic and gas flux measurements, and is an ideal study system to incorporate microbiological characterizations into landscape scale hydrological and biogeochemical studies. As a first attempt to determine how hydrological processes, soil chemistry, and gas fluxes are correlated with bacterial and archaeal lineages in soil, we collected soil samples across the watershed (July 9 - 11, 2012) and used barcoded high-throughput DNA sequencing to characterize the bacterial and archaeal communities. Soils were collected adjacent to gas well sites at 5 cm, 20 cm, and 50 cm depths, corresponding to the depths of the wells. Gas measurements included CO2, CH4, O2, and N2O; soil measurements included water content, % carbon, and % nitrogen. We analyzed 775,000 16S rRNA gene sequences from 28 soil samples. Relative abundances of certain microbial lineages or groups (e.g. methanotrophs, methanogens, Acidobacteria, Bacteroidetes, Firmicutes, Proteobacteria, etc.) varied significantly with CO2, CH4, and O2 concentrations. Furthermore, beta-diversity analyses showed that microbial community composition was significantly governed by water content, % nitrogen, and % carbon; community composition also significantly varied with CO2, CH4, and O2 concentrations. Together, our results suggest that soil environmental factors such as water content, % carbon, and % nitrogen affect microbial community composition, and that microbial community composition correlates with CO2, O2, and CH4 concentrations. Future work will focus on characterizing microbial communities across the entire summer season as soil conditions drastically change from fully saturated to very dry.

  17. Specific bacterial, archaeal, and eukaryotic communities in tidal-flat sediments along a vertical profile of several meters.

    Science.gov (United States)

    Wilms, Reinhard; Sass, Henrik; Köpke, Beate; Köster, Jürgen; Cypionka, Heribert; Engelen, Bert

    2006-04-01

    The subsurface of a tidal-flat sediment was analyzed down to 360 cm in depth by molecular and geochemical methods. A community structure analysis of all three domains of life was performed using domain-specific PCR followed by denaturing gradient gel electrophoresis analysis and sequencing of characteristic bands. The sediment column comprised horizons easily distinguishable by lithology that were deposited in intertidal and salt marsh environments. The pore water profile was characterized by a subsurface sulfate peak at a depth of about 250 cm. Methane and sulfate profiles were opposed, showing increased methane concentrations in the sulfate-free layers. The availability of organic carbon appeared to have the most pronounced effect on the bacterial community composition in deeper sediment layers. In general, the bacterial community was dominated by fermenters and syntrophic bacteria. The depth distribution of methanogenic archaea correlated with the sulfate profile and could be explained by electron donor competition with sulfate-reducing bacteria. Sequences affiliated with the typically hydrogenotrophic Methanomicrobiales were present in sulfate-free layers. Archaea belonging to the Methanosarcinales that utilize noncompetitive substrates were found along the entire anoxic-sediment column. Primers targeting the eukaryotic 18S rRNA gene revealed the presence of a subset of archaeal sequences in the deeper part of the sediment cores. The phylogenetic distance to other archaeal sequences indicates that these organisms represent a new phylogenetic group, proposed as "tidal-flat cluster 1." Eukarya were still detectable at 360 cm, even though their diversity decreased with depth. Most of the eukaryotic sequences were distantly related to those of grazers and deposit feeders.

  18. Analysis of Bacterial and Archaeal Communities along a High-Molecular-Weight Polyacrylamide Transportation Pipeline System in an Oil Field

    Directory of Open Access Journals (Sweden)

    Cai-Yun Li

    2015-04-01

    Full Text Available Viscosity loss of high-molecular-weight partially hydrolyzed polyacrylamide (HPAM solution was observed in a water injection pipeline before being injected into subterranean oil wells. In order to investigate the possible involvement of microorganisms in HPAM viscosity loss, both bacterial and archaeal community compositions of four samples collected from different points of the transportation pipeline were analyzed using PCR-amplification of the 16S rRNA gene and clone library construction method together with the analysis of physicochemical properties of HPAM solution and environmental factors. Further, the relationship between environmental factors and HPAM properties with microorganisms were delineated by canonical correspondence analysis (CCA. Diverse bacterial and archaeal groups were detected in the four samples. The microbial community of initial solution S1 gathered from the make-up tank is similar to solution S2 gathered from the first filter, and that of solution S3 obtained between the first and the second filter is similar to that of solution S4 obtained between the second filter and the injection well. Members of the genus Acinetobacter sp. were detected with high abundance in S3 and S4 in which HPAM viscosity was considerably reduced, suggesting that they likely played a considerable role in HPAM viscosity loss. This study presents information on microbial community diversity in the HPAM transportation pipeline and the possible involvement of microorganisms in HPAM viscosity loss and biodegradation. The results will help to understand the microbial community contribution made to viscosity change and are beneficial for providing information for microbial control in oil fields.

  19. Archaeal diversity and the extent of iron and manganese pyritization in sediments from a tropical mangrove creek (Cardoso Island, Brazil)

    Science.gov (United States)

    Otero, X. L.; Lucheta, A. R.; Ferreira, T. O.; Huerta-Díaz, M. A.; Lambais, M. R.

    2014-06-01

    Even though several studies on the geochemical processes occurring in mangrove soils and sediments have been performed, information on the diversity of Archaea and their functional roles in these ecosystems, especially in subsurface environments, is scarce. In this study, we have analyzed the depth distribution of Archaea and their possible relationships with the geochemical transformations of Fe and Mn in a sediment core from a tropical mangrove creek, using 16S rRNA gene profiling and sequential extraction of different forms of Fe and Mn. A significant shift in the archaeal community structure was observed in the lower layers (90-100 cm), coinciding with a clear decrease in total organic carbon (TOC) content and an increase in the percentage of sand. The comparison of the archaeal communities showed a dominance of methanogenic Euryarchaeota in the upper layers (0-20 cm), whereas Crenarchaeota was the most abundant taxon in the lower layers. The dominance of methanogenic Euryarchaeota in the upper layer of the sediment suggests the occurrence of methanogenesis in anoxic microenvironments. The concentrations of Fe-oxyhydroxides in the profile were very low, and showed positive correlation with the concentrations of pyrite and degrees of Fe and Mn pyritization. Additionally, a partial decoupling of pyrite formation from organic matter concentration was observed, suggesting excessive Fe pyritization. This overpyritization of Fe can be explained either by the anoxic oxidation of methane by sulfate and/or by detrital pyrite tidal transportation from the surrounding mangrove soils. The higher pyritization levels observed in deeper layers of the creek sediment were also in agreement with its Pleistocenic origin.

  20. tRNA evolution from the proto-tRNA minihelix world

    Science.gov (United States)

    Root-Bernstein, Robert; Kim, Yunsoo; Sanjay, Adithya; Burton, Zachary F.

    2016-01-01

    ABSTRACT Multiple models have been advanced for the evolution of cloverleaf tRNA. Here, the conserved archaeal tRNA core (75-nt) is posited to have evolved from ligation of three proto-tRNA minihelices (31-nt) and two-symmetrical 9-nt deletions within joined acceptor stems (93 – 18 = 75-nt). The primary evidence for this conclusion is that the 5-nt stem 7-nt anticodon loop and the 5-nt stem 7-nt T loop are structurally homologous and related by coding sequence. We posit that the D loop was generated from a third minihelix (31-nt) in which the stem and loop became rearranged after 9-nt acceptor stem deletions and cloverleaf folding. The most 3´-5-nt segment of the D loop and the 5-nt V loop are apparent remnants of the joined acceptor stems (14 – 9 = 5-nt). Before refolding in the tRNA cloverleaf, we posit that the 3′-5-nt segment of the D loop and the 5-nt V loop were paired, and, in the tRNA cloverleaf, frequent pairing of positions 29 (D loop) and 47 (V loop) remains (numbered on a 75-nt tRNA cloverleaf core). Amazingly, after >3.5 billion years of evolutionary pressure on the tRNA cloverleaf structure, a model can be constructed that convincingly describes the genesis of 75/75-nt conserved archaeal tRNA core positions. Judging from the tRNA structure, cloverleaf tRNA appears to represent at least a second-generation scheme (and possibly a third-generation scheme) that replaced a robust 31-nt minihelix protein-coding system, evidence for which is preserved in the cloverleaf structure. Understanding tRNA evolution provides insights into ribosome and rRNA evolution. PMID:27636862

  1. Identification of an archaeal mercury regulon by chromatin immunoprecipitation.

    Science.gov (United States)

    Rudrappa, Deepak; Yao, Andrew I; White, Derrick; Pavlik, Benjamin J; Singh, Raghuveer; Facciotti, Marc T; Blum, Paul

    2015-12-01

    Mercury is a heavy metal and toxic to all forms of life. Metal exposure can invoke a response to improve survival. In archaea, several components of a mercury response system have been identified, but it is not known whether metal transport is a member of this system. To identify such missing components, a peptide-tagged MerR transcription factor was used to localize enriched chromosome regions by chromosome immunoprecipitation combined with DNA sequence analysis. Such regions could serve as secondary regulatory binding sites to control the expression of additional genes associated with mercury detoxification. Among the 31 highly enriched loci, a subset of five was pursued as potential candidates based on their current annotations. Quantitative reverse transcription-PCR analysis of these regions with and without mercury treatment in WT and mutant strains lacking merR indicated significant regulatory responses under these conditions. Of these, a Family 5 extracellular solute-binding protein and the MarR transcription factor shown previously to control responses to oxidation were most strongly affected. Inactivation of the solute-binding protein by gene disruption increased the resistance of mutant cells to mercury challenge. Inductively coupled plasma-MS analysis of the mutant cell line following metal challenge indicated there was less intracellular mercury compared with the isogenic WT strain. Together, these regulated genes comprise new members of the archaeal MerR regulon and reveal a cascade of transcriptional control not previously demonstrated in this model organism.

  2. Protein phosphorylation and its role in archaeal signal transduction.

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C; Albers, Sonja-Verena; Siebers, Bettina

    2016-09-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies.

  3. Protein phosphorylation and its role in archaeal signal transduction

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C.; Albers, Sonja-Verena; Siebers, Bettina

    2016-01-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies. PMID:27476079

  4. tRNA binding properties of eukaryotic translation initiation factor 2 from Encephalitozoon cuniculi.

    Science.gov (United States)

    Naveau, Marie; Lazennec-Schurdevin, Christine; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2010-10-12

    A critical consequence of the initiation of translation is the setting of the reading frame for mRNA decoding. In eukaryotic and archaeal cells, heterotrimeric initiation factor e/aIF2, in its GTP form, specifically binds Met-tRNA(i)(Met) throughout the translation initiation process. After start codon recognition, the factor, in its GDP-bound form, loses affinity for Met-tRNA(i)(Met) and eventually dissociates from the initiation complex. The role of each aIF2 subunit in tRNA binding has been extensively studied in archaeal systems. The isolated archaeal γ subunit is able to bind tRNA, but the α subunit is required for strong binding. Until now, difficulties during purification have hampered the study of the role of each of the three subunits of eukaryotic eIF2 in specific binding of the initiator tRNA. Here, we have produced the three subunits of eIF2 from Encephalitozoon cuniculi, isolated or assembled into heterodimers or into the full heterotrimer. Using assays following protection of Met-tRNA(i)(Met) against deacylation, we show that the eukaryotic γ subunit is able to bind by itself the initiator tRNA. However, the two peripheral α and β subunits are required for strong binding and contribute equally to tRNA binding affinity. The core domains of α and β probably act indirectly by stabilizing the tRNA binding site on the γ subunit. These results, together with those previously obtained with archaeal aIF2 and yeast eIF2, show species-specific distributions of the roles of the peripheral subunits of e/aIF2 in tRNA binding. PMID:20822097

  5. Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands.

    Science.gov (United States)

    Hartmann, Martin; Lee, Sangwon; Hallam, Steven J; Mohn, William W

    2009-12-01

    Disturbances caused by timber harvesting have critical long-term effects on the forest soil microbiota and alter fundamental ecosystem services provided by these communities. This study assessed the effects of organic matter removal and soil compaction on microbial community structures in different soil horizons 13 years after timber harvesting at the long-term soil productivity site at Skulow Lake, British Columbia. A harvested stand was compared with an unmanaged forest stand. Ribosomal intergenic spacer profiles of bacteria, archaea and eukarya indicated significantly different community structures in the upper three soil horizons of the two stands, with differences decreasing with depth. Large-scale sequencing of the ribosomal intergenic spacers coupled to small-subunit ribosomal RNA genes allowed taxonomic identification of major microbial phylotypes affected by harvesting or varying among soil horizons. Actinobacteria and Gemmatimonadetes were the predominant phylotypes in the bacterial profiles, with the relative abundance of these groups highest in the unmanaged stand, particularly in the deeper soil horizons. Predominant eukaryal phylotypes were mainly assigned to known mycorrhizal and saprotrophic species of Basidiomycetes and Ascomycetes. Harvesting affected Basidiomycetes to a minor degree but had stronger effects on some Ascomycetes. Archaeal profiles had low diversity with only a few predominant crenarchaeal phylotypes whose abundance appeared to increase with depth. Detection of these effects 13 years after harvesting may indicate a long-term change in processes mediated by the microbial community with important consequences for forest productivity. These effects warrant more comprehensive investigation of the effects of harvesting on the structure of forest soil microbial communities and the functional consequences. PMID:19659501

  6. Pyrosequencing-derived bacterial, archaeal, and fungal diversity of spacecraft hardware destined for Mars.

    Science.gov (United States)

    La Duc, Myron T; Vaishampayan, Parag; Nilsson, Henrik R; Torok, Tamas; Venkateswaran, Kasthuri

    2012-08-01

    Spacecraft hardware and assembly cleanroom surfaces (233 m(2) in total) were sampled, total genomic DNA was extracted, hypervariable regions of the 16S rRNA gene (bacteria and archaea) and ribosomal internal transcribed spacer (ITS) region (fungi) were subjected to 454 tag-encoded pyrosequencing PCR amplification, and 203,852 resulting high-quality sequences were analyzed. Bioinformatic analyses revealed correlations between operational taxonomic unit (OTU) abundance and certain sample characteristics, such as source (cleanroom floor, ground support equipment [GSE], or spacecraft hardware), cleaning regimen applied, and location about the facility or spacecraft. National Aeronautics and Space Administration (NASA) cleanroom floor and GSE surfaces gave rise to a larger number of diverse bacterial communities (619 OTU; 20 m(2)) than colocated spacecraft hardware (187 OTU; 162 m(2)). In contrast to the results of bacterial pyrosequencing, where at least some sequences were generated from each of the 31 sample sets examined, only 13 and 18 of these sample sets gave rise to archaeal and fungal sequences, respectively. As was the case for bacteria, the abundance of fungal OTU in the GSE surface samples dramatically diminished (9× less) once cleaning protocols had been applied. The presence of OTU representative of actinobacteria, deinococci, acidobacteria, firmicutes, and proteobacteria on spacecraft surfaces suggests that certain bacterial lineages persist even following rigorous quality control and cleaning practices. The majority of bacterial OTU observed as being recurrent belonged to actinobacteria and alphaproteobacteria, supporting the hypothesis that the measures of cleanliness exerted in spacecraft assembly cleanrooms (SAC) inadvertently select for the organisms which are the most fit to survive long journeys in space.

  7. Human settlement as driver of bacterial, but not of archaeal, ammonia oxidizers abundance and community structure in tropical stream sediments

    Directory of Open Access Journals (Sweden)

    Mariana De Paula Reis

    2015-08-01

    Full Text Available Ammonia-oxidizing archaea (AOA and bacteria (AOB are a diverse and functionally important group in the nitrogen cycle. Nevertheless, AOA and AOB communities driving this process remain uncharacterized in tropical freshwater sediment. Here, the effect of human settlement on the AOA and AOB diversity and abundance have been assessed by phylogenetic and quantitative PCR analyses, using archaeal and bacterial amoA and 16S rRNA genes. Overall, each environment contained specific clades of amoA and 16S rRNA genes sequences, suggesting that selective pressures lead to AOA and AOB inhabiting distinct ecological niches. Human settlement activities, as derived from increased metal and mineral nitrogen contents, appear to cause a response among the AOB community, with Nitrosomonas taking advantage over Nitrosospira in impacted environments. We also observed a dominance of AOB over AOA in mining-impacted sediments, suggesting that AOB might be the primary drivers of ammonia oxidation in these sediments. In addition, ammonia concentrations demonstrated to be the driver for the abundance of AOA, with an inversely proportional correlation between them. Our findings also revealed the presence of novel ecotypes of Thaumarchaeota, such as those related to the obligate acidophilic Nitrosotalea devanaterra at ammonia-rich places of circumneutral pH. These data add significant new information regarding AOA and AOB from tropical freshwater sediments, albeit future studies would be required to provide additional insights into the niche differentiation among these microorganisms.

  8. Effects of Diets Supplemented with Ensiled Mulberry Leaves and Sun-Dried Mulberry Fruit Pomace on the Ruminal Bacterial and Archaeal Community Composition of Finishing Steers.

    Science.gov (United States)

    Niu, Yuhong; Meng, Qingxiang; Li, Shengli; Ren, Liping; Zhou, Bo; Schonewille, Thomas; Zhou, Zhenming

    2016-01-01

    This study investigated the effects of ensiled mulberry leaves (EML) and sun-dried mulberry fruit pomace (SMFP) on the ruminal bacterial and archaeal community composition of finishing steers. Corn grain- and cotton meal-based concentrate was partially replaced with EML or SMFP. The diets had similar crude protein (CP), neutral detergent fiber (NDF), and metabolizable energy. Following the feeding trial, the steers were slaughtered and ruminal liquid samples were collected to study the ruminal microbiome. Extraction of DNA, amplification of the V4 region of the 16S rRNA gene, and Illumina MiSeq pyrosequencing were performed for each sample. Following sequence de-noising, chimera checking, and quality trimming, an average of 209,610 sequences were generated per sample. Quantitative real-time PCR was performed to examine the selected bacterial species in the rumen. Our results showed that the predominant phyla were Bacteroidetes (43.90%), Firmicutes (39.06%), Proteobacteria (4.31%), and Tenericutes (2.04%), and the predominant genera included Prevotella (13.82%), Ruminococcus (2.51%), Butyrivibrio (2.38%), and Succiniclasticum (2.26%). Compared to the control group, EML and SMFP groups had a higher abundance of total bacteria (p composition was similar among the three groups. At the phylum level, there were no significant differences in Firmicutes (p = 0.7932), Bacteroidetes (p = 0.2330), Tenericutes (p = 0.2811), or Proteobacteria (p = 0.0680) levels among the three groups; however, Fibrobacteres decreased in EML (p = 0.0431). At the genus level, there were no differences in Prevotella (p = 0.4280), Ruminococcus (p = 0.2639), Butyrivibrio (p = 0.4433), or Succiniclasticum (p = 0.0431) levels among the groups. Additionally, the dietary treatments had no significant effects on the archaeal community composition in the rumen. Therefore, EML and SMFP supplementation had no significant effects on the ruminal bacterial or archaeal community composition of finishing steers.

  9. Temperature increases from 55 to 75 C in a two-phase biogas reactor result in fundamental alterations within the bacterial and archaeal community structure

    Energy Technology Data Exchange (ETDEWEB)

    Rademacher, Antje [Leibniz-Institut fuer Agrartechnik Potsdam-Bornim e.V. (ATB), Potsdam (Germany). Abt. Bioverfahrenstechnik; Technische Univ. Berlin (Germany). Inst. fuer Technischen Umweltschutz; Nolte, Christine; Schoenberg, Mandy; Klocke, Michael [Leibniz-Institut fuer Agrartechnik Potsdam-Bornim e.V. (ATB), Potsdam (Germany). Abt. Bioverfahrenstechnik

    2012-10-15

    Agricultural biogas plants were operated in most cases below their optimal performance. An increase in the fermentation temperature and a spatial separation of hydrolysis/acetogenesis and methanogenesis are known strategies in improving and stabilizing biogas production. In this study, the dynamic variability of the bacterial and archaeal community was monitored within a two-phase leach bed biogas reactor supplied with rye silage and straw during a stepwise temperature increase from 55 to 75 C within the leach bed reactor (LBR), using TRFLP analyses. To identify the terminal restriction fragments that were obtained, bacterial and archaeal 16S rRNA gene libraries were constructed. Above 65 C, the bacterial community structure changed from being Clostridiales-dominated toward being dominated by members of the Bacteroidales, Clostridiales, and Thermotogales orders. Simultaneously, several changes occurred, including a decrease in the total cell count, degradation rate, and biogas yield along with alterations in the intermediate production. A bioaugmentation with compost at 70 C led to slight improvements in the reactor performance; these did not persist at 75 C. However, the archaeal community within the downstream anaerobic filter reactor (AF), operated constantly at 55 C, altered by the temperature increase in the LBR. At an LBR temperature of 55 C, members of the Methanobacteriales order were prevalent in the AF, whereas at higher LBR temperatures Methanosarcinales prevailed. Altogether, the best performance of this two-phase reactor was achieved at an LBR temperature of below 65 C, which indicates that this temperature range has a favorable effect on the microbial community responsible for the production of biogas. (orig.)

  10. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-06-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  11. Virus-mediated archaeal hecatomb in the deep seafloor

    Science.gov (United States)

    Danovaro, Roberto; Dell’Anno, Antonio; Corinaldesi, Cinzia; Rastelli, Eugenio; Cavicchioli, Ricardo; Krupovic, Mart; Noble, Rachel T.; Nunoura, Takuro; Prangishvili, David

    2016-01-01

    Viruses are the most abundant biological entities in the world’s oceans, and they play a crucial role in global biogeochemical cycles. In deep-sea ecosystems, archaea and bacteria drive major nutrient cycles, and viruses are largely responsible for their mortality, thereby exerting important controls on microbial dynamics. However, the relative impact of viruses on archaea compared to bacteria is unknown, limiting our understanding of the factors controlling the functioning of marine systems at a global scale. We evaluate the selectivity of viral infections by using several independent approaches, including an innovative molecular method based on the quantification of archaeal versus bacterial genes released by viral lysis. We provide evidence that, in all oceanic surface sediments (from 1000- to 10,000-m water depth), the impact of viral infection is higher on archaea than on bacteria. We also found that, within deep-sea benthic archaea, the impact of viruses was mainly directed at members of specific clades of Marine Group I Thaumarchaeota. Although archaea represent, on average, ~12% of the total cell abundance in the top 50 cm of sediment, virus-induced lysis of archaea accounts for up to one-third of the total microbial biomass killed, resulting in the release of ~0.3 to 0.5 gigatons of carbon per year globally. Our results indicate that viral infection represents a key mechanism controlling the turnover of archaea in surface deep-sea sediments. We conclude that interactions between archaea and their viruses might play a profound, previously underestimated role in the functioning of deep-sea ecosystems and in global biogeochemical cycles. PMID:27757416

  12. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs

    NARCIS (Netherlands)

    Frade, P.R.; Roll, K.; Bergauer, K.; Herndl, G.

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associatedwith the surface mucus layer of corals have rarely taken place. It has thereforeremained enigmatic whether mucus-associated archaeal and bacterial communities exhibita similar specificity towards coral hosts a

  13. Liquid but Durable: Molecular Dynamics Simulations Explain the Unique Properties of Archaeal-Like Membranes

    Science.gov (United States)

    Chugunov, Anton O.; Volynsky, Pavel E.; Krylov, Nikolay A.; Boldyrev, Ivan A.; Efremov, Roman G.

    2014-12-01

    Archaeal plasma membranes appear to be extremely durable and almost impermeable to water and ions, in contrast to the membranes of Bacteria and Eucaryota. Additionally, they remain liquid within a temperature range of 0-100°C. These are the properties that have most likely determined the evolutionary fate of Archaea, and it may be possible for bionanotechnology to adopt these from nature. In this work, we use molecular dynamics simulations to assess at the atomistic level the structure and dynamics of a series of model archaeal membranes with lipids that have tetraether chemical nature and ``branched'' hydrophobic tails. We conclude that the branched structure defines dense packing and low water permeability of archaeal-like membranes, while at the same time ensuring a liquid-crystalline state, which is vital for living cells. This makes tetraether lipid systems promising in bionanotechnology and material science, namely for design of new and unique membrane nanosystems.

  14. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea.

    Science.gov (United States)

    Lee, Zarraz May-Ping; Bussema, Carl; Schmidt, Thomas M

    2009-01-01

    A dramatic exception to the general pattern of single-copy genes in bacterial and archaeal genomes is the presence of 1-15 copies of each ribosomal RNA encoding gene. The original version of the Ribosomal RNA Database (rrnDB) cataloged estimates of the number of 16S rRNA-encoding genes; the database now includes the number of genes encoding each of the rRNAs (5S, 16S and 23S), an internally transcribed spacer region, and the number of tRNA genes. The rrnDB has been used largely by microbiologists to predict the relative rate at which microbial populations respond to favorable growth conditions, and to interpret 16S rRNA-based surveys of microbial communities. To expand the functionality of the rrnDB (http://ribosome.mmg.msu.edu/rrndb/index.php), the search engine has been redesigned to allow database searches based on 16S rRNA gene copy number, specific organisms or taxonomic subsets of organisms. The revamped database also computes average gene copy numbers for any collection of entries selected. Curation tools now permit rapid updates, resulting in an expansion of the database to include data for 785 bacterial and 69 archaeal strains. The rrnDB continues to serve as the authoritative, curated source that documents the phylogenetic distribution of rRNA and tRNA genes in microbial genomes.

  15. Turnover of microbial lipids in the deep biosphere and growth of benthic archaeal populations.

    Science.gov (United States)

    Xie, Sitan; Lipp, Julius S; Wegener, Gunter; Ferdelman, Timothy G; Hinrichs, Kai-Uwe

    2013-04-01

    Deep subseafloor sediments host a microbial biosphere with unknown impact on global biogeochemical cycles. This study tests previous evidence based on microbial intact polar lipids (IPLs) as proxies of live biomass, suggesting that Archaea dominate the marine sedimentary biosphere. We devised a sensitive radiotracer assay to measure the decay rate of ([(14)C]glucosyl)-diphytanylglyceroldiether (GlcDGD) as an analog of archaeal IPLs in continental margin sediments. The degradation kinetics were incorporated in model simulations that constrained the fossil fraction of subseafloor IPLs and rates of archaeal turnover. Simulating the top 1 km in a generic continental margin sediment column, we estimated degradation rate constants of GlcDGD being one to two orders of magnitude lower than those of bacterial IPLs, with half-lives of GlcDGD increasing with depth to 310 ky. Given estimated microbial community turnover times of 1.6-73 ky in sediments deeper than 1 m, 50-96% of archaeal IPLs represent fossil signals. Consequently, previous lipid-based estimates of global subseafloor biomass probably are too high, and the widely observed dominance of archaeal IPLs does not rule out a deep biosphere dominated by Bacteria. Reverse modeling of existing concentration profiles suggest that archaeal IPL synthesis rates decline from around 1,000 pg⋅mL(-1) sediment⋅y(-1) at the surface to 0.2 pg⋅mL(-1)⋅y(-1) at 1 km depth, equivalent to production of 7 × 10(5) to 140 archaeal cells⋅mL(-1) sediment⋅y(-1), respectively. These constraints on microbial growth are an important step toward understanding the relationship between the deep biosphere and the carbon cycle.

  16. Comparison of Fecal Methanogenic Archaeal Community Between Erhualian and Landrace Pigs Using Denaturing Gradient Gel Electrophoresis and Real-Time PCR Analysis

    Institute of Scientific and Technical Information of China (English)

    SU Yong; Hauke Smidt; ZHU Wei-Yun

    2014-01-01

    Erhualian and Landrace breeds are typical genetically obese and lean pigs, respectively. To compare the fecal methanogenic Archaeal community between these two pig breeds, fecal samples from different growth phase pigs were collected and used for PCR-denaturing gradient gel electrophoresis (DGGE) with two primer pairs (344fGC/519r and 519f/915rGC) and real-time PCR analysis. Results showed that a better separation and higher quality of bands pattern were obtained in DGGE proifles using primers 344fGC/519r as compared with primers 519f/915rGC. Sequencing of DGGE bands showed that the predominant methanogens in the feces of Erhualian and Landrace pigs belonged to Methanobrevibacter spp. and Methanosphaera spp. Real-time PCR analysis revealed that there was no signiifcant difference in the numbers of fecal total methanogens between Erhualian and Landrace pigs;however, pig growth phase affected the numbers of 16S rRNA genes of total methanogens and Methanobrevibacter smithii. Dissociation curves of methyl coenzyme-M reductase subunit A (mcrA) gene fragments ampliifed with real-time PCR showed all samples possessed a single peak at 82°C, which might be associated with M. smithii. Samples from the same growth phase of each breed showed good replicative dissociation curves. The results suggest that the growth phase (including diet factor) other than genotype of pig may affect the fecal methanogenic Archaeal community of pigs.

  17. The Human SepSecS-tRNA[superscript Sec] Complex Reveals the Mechanism of Selenocysteine Formation

    Energy Technology Data Exchange (ETDEWEB)

    Palioura, Sotiria; Sherrer, R. Lynn; Steitz, Thomas A.; Söll, Dieter; Simonovic, Miljan; (Yale); (UIC)

    2009-08-13

    Selenocysteine is the only genetically encoded amino acid in humans whose biosynthesis occurs on its cognate transfer RNA (tRNA). O-Phosphoseryl-tRNA:selenocysteinyl-tRNA synthase (SepSecS) catalyzes the final step of selenocysteine formation by a poorly understood tRNA-dependent mechanism. The crystal structure of human tRNA{sup Sec} in complex with SepSecS, phosphoserine, and thiophosphate, together with in vivo and in vitro enzyme assays, supports a pyridoxal phosphate-dependent mechanism of Sec-tRNA{sup Sec} formation. Two tRNA{sup Sec} molecules, with a fold distinct from other canonical tRNAs, bind to each SepSecS tetramer through their 13-base pair acceptor-T{Upsilon}C arm (where {Upsilon} indicates pseudouridine). The tRNA binding is likely to induce a conformational change in the enzyme's active site that allows a phosphoserine covalently attached to tRNA{sup Sec}, but not free phosphoserine, to be oriented properly for the reaction to occur.

  18. Phylogenetic analysis of bacterial and archaeal arsC gene sequences suggests an ancient, common origin for arsenate reductase

    Directory of Open Access Journals (Sweden)

    Dugas Sandra L

    2003-07-01

    Full Text Available Abstract Background The ars gene system provides arsenic resistance for a variety of microorganisms and can be chromosomal or plasmid-borne. The arsC gene, which codes for an arsenate reductase is essential for arsenate resistance and transforms arsenate into arsenite, which is extruded from the cell. A survey of GenBank shows that arsC appears to be phylogenetically widespread both in organisms with known arsenic resistance and those organisms that have been sequenced as part of whole genome projects. Results Phylogenetic analysis of aligned arsC sequences shows broad similarities to the established 16S rRNA phylogeny, with separation of bacterial, archaeal, and subsequently eukaryotic arsC genes. However, inconsistencies between arsC and 16S rRNA are apparent for some taxa. Cyanobacteria and some of the γ-Proteobacteria appear to possess arsC genes that are similar to those of Low GC Gram-positive Bacteria, and other isolated taxa possess arsC genes that would not be expected based on known evolutionary relationships. There is no clear separation of plasmid-borne and chromosomal arsC genes, although a number of the Enterobacteriales (γ-Proteobacteria possess similar plasmid-encoded arsC sequences. Conclusion The overall phylogeny of the arsenate reductases suggests a single, early origin of the arsC gene and subsequent sequence divergence to give the distinct arsC classes that exist today. Discrepancies between 16S rRNA and arsC phylogenies support the role of horizontal gene transfer (HGT in the evolution of arsenate reductases, with a number of instances of HGT early in bacterial arsC evolution. Plasmid-borne arsC genes are not monophyletic suggesting multiple cases of chromosomal-plasmid exchange and subsequent HGT. Overall, arsC phylogeny is complex and is likely the result of a number of evolutionary mechanisms.

  19. Archaeal and bacterial diversity in an arsenic-rich shallow-sea hydrothermal system undergoing phase separation

    Directory of Open Access Journals (Sweden)

    Roy Edward Price

    2013-07-01

    Full Text Available Phase separation is a ubiquitous process in seafloor hydrothermal vents, creating a large range of salinities. Toxic elements (e.g., arsenic partition into the vapor phase, and thus can be enriched in both high and low salinity fluids. However, investigations of microbial diversity at sites associated with phase separation are rare. We evaluated prokaryotic diversity in arsenic-rich shallow-sea vents off Milos Island (Greece by comparative analysis of 16S rRNA clone sequences from two vent sites with similar pH and temperature but marked differences in salinity. Clone sequences were also obtained for aioA-like functional genes (AFGs. Bacteria in the surface sediments (0 to 1.5 cm at the high salinity site consisted of mainly Epsilonproteobacteria (Arcobacter sp., which transitioned to almost exclusively Firmicutes (Bacillus sp. at ~10 cm depth. However, the low salinity site consisted of Bacteroidetes (Flavobacteria in the surface and Epsilonproteobacteria (Arcobacter sp. at ~10 cm depth. Archaea in the high salinity surface sediments were dominated by the orders Archaeoglobales and Thermococcales, transitioning to Thermoproteales and Desulfurococcales (Staphylothermus sp. in the deeper sediments. In contrast, the low salinity site was dominated by Thermoplasmatales in the surface and Thermoproteales at depth. Similarities in gas and redox chemistry suggest that salinity and/or arsenic concentrations may select for microbial communities that can tolerate these parameters. Many of the archaeal 16S rRNA sequences contained inserts, possibly introns, including members of the Euryarchaeota. Clones containing AFGs affiliated with either Alpha- or Betaproteobacteria, although most were only distantly related to published representatives. Most clones (89% originated from the deeper layer of the low salinity, highest arsenic site. This is the only sample with overlap in 16S rRNA data, suggesting arsenotrophy as an important metabolism in similar

  20. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  1. The X-ray Crystal Structure of RNA Polymerase from Archaea

    Energy Technology Data Exchange (ETDEWEB)

    Hirata,A.; Klein, B.; Murakami, K.

    2008-01-01

    The transcription apparatus in Archaea can be described as a simplified version of its eukaryotic RNA polymerase (RNAP) II counterpart, comprising an RNAPII-like enzyme as well as two general transcription factors, the TATA-binding protein (TBP) and the eukaryotic TFIIB orthologue TFB. It has been widely understood that precise comparisons of cellular RNAP crystal structures could reveal structural elements common to all enzymes and that these insights would be useful in analysing components of each enzyme that enable it to perform domain-specific gene expression. However, the structure of archaeal RNAP has been limited to individual subunits3, 4. Here we report the first crystal structure of the archaeal RNAP from Sulfolobus solfataricus at 3.4 Angstroms resolution, completing the suite of multi-subunit RNAP structures from all three domains of life. We also report the high-resolution (at 1.76 Angstroms ) crystal structure of the D/L subcomplex of archaeal RNAP and provide the first experimental evidence of any RNAP possessing an iron-sulphur (Fe-S) cluster, which may play a structural role in a key subunit of RNAP assembly. The striking structural similarity between archaeal RNAP and eukaryotic RNAPII highlights the simpler archaeal RNAP as an ideal model system for dissecting the molecular basis of eukaryotic transcription.

  2. The effect of maturity and depositional redox conditions on archaeal tetraether lipid palaeothermometry

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Schouten, S.; Hopmans, E.C.

    2004-01-01

    Recently we proposed a new organic sea surface temperature proxy, TEX86, based on the distribution of archaeal tetraether lipids. Here, we have examined the effect of oxic degradation and maturity on this new temperature proxy. Our results show that oxic degradation does not appear to affect the TEX

  3. Effect of soil properties and hydrology on Archaeal community composition in three temperate grasslands on peat

    DEFF Research Database (Denmark)

    Görres, Carolyn-Monika; Conrad, Ralf; Petersen, Søren O

    2013-01-01

    Grasslands established on drained peat soils are regarded as negligible methane (CH4) sources; however, they can still exhibit considerable soil CH4 dynamics. We investigated archaeal community composition in two different fen peat soils and one bog peat soil under permanent grassland in Denmark...

  4. CrAgDb--a database of annotated chaperone repertoire in archaeal genomes.

    Science.gov (United States)

    Rani, Shikha; Srivastava, Abhishikha; Kumar, Manish; Goel, Manisha

    2016-03-01

    Chaperones are a diverse class of ubiquitous proteins that assist other cellular proteins in folding correctly and maintaining their native structure. Many different chaperones cooperate to constitute the 'proteostasis' machinery in the cells. It has been proposed earlier that archaeal organisms could be ideal model systems for deciphering the basic functioning of the 'protein folding machinery' in higher eukaryotes. Several chaperone families have been characterized in archaea over the years but mostly one protein at a time, making it difficult to decipher the composition and mechanistics of the protein folding system as a whole. In order to deal with these lacunae, we have developed a database of all archaeal chaperone proteins, CrAgDb (Chaperone repertoire in Archaeal genomes). The data have been presented in a systematic way with intuitive browse and search facilities for easy retrieval of information. Access to these curated datasets should expedite large-scale analysis of archaeal chaperone networks and significantly advance our understanding of operation and regulation of the protein folding machinery in archaea. Researchers could then translate this knowledge to comprehend the more complex protein folding pathways in eukaryotic systems. The database is freely available at http://14.139.227.92/mkumar/cragdb/. PMID:26862144

  5. Archaeal communities associated with roots of the common reed (Phragmites australis) in Beijing Cuihu Wetland.

    Science.gov (United States)

    Liu, Yin; Li, Hong; Liu, Qun Fang; Li, Yan Hong

    2015-05-01

    The richness, phylogeny and composition of archaeal community associated with the roots of common reed (Phragmites australis) growing in the Beijing Cuihu Wetland, China was investigated using a 16S rDNA library. In total, 235 individual sequences were collected, and a phylogenetic analysis revealed that 69.4 and 11.5 % of clones were affiliated with the Euryarchaeota and the Crenarchaeota, respectively. In Euryarchaeota, the archaeal community was dominated by species in following genera: Methanobacterium in the order Methanobacteriales (60.7 %); Methanoregula and Methanospirillum in the order Methanomicrobiales (20.2 %), and Methanomethylovorans, Methanosarcina and Methanosaeta in the order Methanosarcinales (17.2 %). Of 27 sequences assigned to uncultured Crenarchaeota, 22 were grouped into Group 1.3, and five grouped into Group 1.1b. Hence, the archaeal communities associated with reed roots are largely involved in methane production, and, to a lesser extent, in ammonia oxidization. Quantification of the archaeal amoA gene indicated that ammonia oxidizing archaea were more numerous in the rhizosphere soil than in the root tissue or surrounding water. A total of 19.1 % of the sequences were unclassified, suggesting that many unidentified archaea are probably involved in the reed wetland ecosystem. PMID:25739566

  6. ENERGY-TRANSDUCING PROPERTIES OF PRIMARY PROTON PUMPS RECONSTITUTED INTO ARCHAEAL BIPOLAR LIPID VESICLES

    NARCIS (Netherlands)

    ELFERINK, MGL; DEWIT, JG; DRIESSEN, AJM; KONINGS, WN; Elferink, Marieke G.L.

    1993-01-01

    Archaeal lipids differ considerably from eubacterial and eukaryotic lipids in their structure and physical properties. From the membranes of the extreme thermophilic archaea Sulfolobus acidocaldarius a tetraether lipid fraction was isolated, which can form closed and stable monolayer liposomes in aq

  7. High Oxygen Concentration Increases the Abundance and Activity of Bacterial Rather than Archaeal Nitrifiers in Rice Field Soil.

    Science.gov (United States)

    Ke, Xiubin; Lu, Wei; Conrad, Ralf

    2015-11-01

    Oxygen is considered as a limiting factor for nitrification in rice paddy soil. However, little is known about how the nitrifying microbial community responds to different oxygen concentrations at community and transcript level. In this study, soil and roots were harvested from 50-day-old rice microcosms and were incubated for up to 45 days under two oxygen concentrations: 2 % O(2) and 20 % O(2) (ambient air). Nitrification rates were measured from the accumulation of nitrite plus nitrate. The population dynamics of bacterial (AOB) and archaeal (AOA) ammonia oxidizers was determined from the abundance (using quantitative PCR (qPCR)) and composition (using terminal restriction fragment length polymorphism and cloning/sequencing) of their amoA genes, that of nitrite oxidizers (NOB) by quantifying the nxrA gene of Nitrobacter spp. and the 16S rRNA gene of Nitrospira spp. The activity of the nitrifiers was determined by quantifying the copy numbers of amoA and nxrA transcripts (using RT-qPCR). Different oxygen concentrations did not affect the community compositions of AOB, AOA, and NOB, which however were different between surface soil, bottom soil, and rice roots. However, nitrification rates were higher under ambient air than 2 % O(2), and abundance and transcript activities of AOB, but not of AOA, were also higher. Abundance and transcript copy numbers of Nitrobacter were also higher at ambient air. These results indicate that AOB and NOB, but not AOA, were sensitive to oxygen availability. PMID:26054702

  8. A comparison of rpoB and 16S rRNA as markers in pyrosequencing studies of bacterial diversity

    NARCIS (Netherlands)

    Vos, M.; Quince, C.; Pijl, A.S.; De Hollander, M.; Kowalchuk, G.A.

    2012-01-01

    Background The 16S rRNA gene is the gold standard in molecular surveys of bacterial and archaeal diversity, but it has the disadvantages that it is often multiple-copy, has little resolution below the species level and cannot be readily interpreted in an evolutionary framework. We compared the 16S r

  9. RNA-Based Investigation of Ammonia-Oxidizing Archaea in Hot Springs of Yunnan Province, China ▿ †

    OpenAIRE

    Jiang, Hongchen; Huang, Qiuyuan; DONG, HAILIANG; WANG, Peng; Wang, Fengping; Li, Wenjun; Zhang, Chuanlun

    2010-01-01

    Using RNA-based techniques and hot spring samples collected from Yunnan Province, China, we show that the amoA gene of aerobic ammonia-oxidizing archaea can be transcribed at temperatures higher than 74°C and up to 94°C, suggesting that archaeal nitrification can potentially occur at near boiling temperatures.

  10. Diversity and Habitat Niche Modeling of Candidate Archaeal Phylum Aigarchaeota

    Science.gov (United States)

    Alba, T. W.; Goertz, G.; Williams, A. J.; Cole, J. K.; Murugapiran, S. K.; Dodsworth, J. A.; Hedlund, B. P.

    2013-12-01

    ';Aigarchaeota' (formerly known as pSL4 and Hot Water Crenarchaeotic Group I (HWCGI)) is a candidate phylum of Archaea known only by 16S rRNA gene fragments from cultivation-independent microbial surveys and a single composite genome from Candidatus ';Caldiarchaeum subterraneum', an inhabitant of a subterranean gold mine in Japan. Sequences reported in various publications are found exclusively in geothermal settings, but a comprehensive assessment has not yet been performed. We mined public databases for 16S rRNA gene sequences related to known ';Aigarchaeota' and used a combination of approaches to rigorously define the phylogenetic boundaries of the phylum. The analyses supported the proposed relationship between ';Aigarchaeota', Thaumarchaeota, Crenarchaeota, and Korarchaeota in the so-called 'TACK superphylum' and identified ~200 16S rRNA genes and gene fragments belonging to ';Aigarchaeota', including those recovered from terrestrial geothermal systems on several continents (North America, Asia, Africa, Europe, and Oceania) and marine geothermal and subsurface samples in both the Atlantic and Pacific. ';Aigarchaeota' belonged to at least three family- to order-level groups and at least seven genus-level groups. All genus-level groups were recovered from geographically distant locations, suggesting a global distribution within amenable habitats. ';Aigarchaeota'-specific primers for the polymerase chain reaction (PCR) amplification of 16S rRNA genes were designed using SP-Designer and reviewed using the Ribosomal Database Project Probe Match tool. The primers will be used to determine the presence and abundance of ';Aigarchaeota' in a wide variety of samples from terrestrial geothermal systems in the western U.S. and Asia. These phylogenetic data, along with a large geochemical database, will be analyzed using multivariate statistics to develop biogeographic and habitat niche models for ';Aigarchaeota'. This study offers the first coherent view of the

  11. The Vertical Distribution of Sediment Archaeal Community in the “Black Bloom” Disturbing Zhushan Bay of Lake Taihu

    Science.gov (United States)

    Fan, Xianfang; Xing, Peng

    2016-01-01

    Using the Illumina sequencing technology, we investigated the vertical distribution of archaeal community in the sediment of Zhushan Bay of Lake Taihu, where the black bloom frequently occurred in summer. Overall, the Miscellaneous Crenarchaeotal Group (MCG), Deep Sea Hydrothermal Vent Group 6 (DHVEG-6), and Methanobacterium dominated the archaeal community. However, we observed significant difference in composition of archaeal community among different depths of the sediment. DHVEG-6 dominated in the surface layer (0–3 cm) sediment. Methanobacterium was the dominating archaeal taxa in the L2 (3–6 cm) and L3 (6–10) sediment. MCG was most abundant in the L4 (10–15 cm) and L5 (15–20 cm) sediment. Besides, DHVEG-6 was significantly affected by the concentration of total phosphorus (TP). And loss on ignition (LOI) was an important environmental factor for Methanobacterium. As the typical archaeal taxa in the surface layer sediment, DHVEG-6 and Methanobacterium might be more adapted to abundant substrate supply from cyanobacterial blooms and take active part in the biomass transformation. We propose that DHVEG-6 and Methanobacterium could be the key archaeal taxa correlated with the “black bloom” formation in Zhushan Bay. PMID:26884723

  12. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota. PMID:26494757

  13. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota.

  14. A human CCT5 gene mutation causing distal neuropathy impairs hexadecamer assembly in an archaeal model.

    Science.gov (United States)

    Min, Wonki; Angileri, Francesca; Luo, Haibin; Lauria, Antonino; Shanmugasundaram, Maruda; Almerico, Anna Maria; Cappello, Francesco; de Macario, Everly Conway; Lednev, Igor K; Macario, Alberto J L; Robb, Frank T

    2014-10-27

    Chaperonins mediate protein folding in a cavity formed by multisubunit rings. The human CCT has eight non-identical subunits and the His147Arg mutation in one subunit, CCT5, causes neuropathy. Knowledge is scarce on the impact of this and other mutations upon the chaperone's structure and functions. To make progress, experimental models must be developed. We used an archaeal mutant homolog and demonstrated that the His147Arg mutant has impaired oligomeric assembly, ATPase activity, and defective protein homeostasis functions. These results establish for the first time that a human chaperonin gene defect can be reproduced and studied at the molecular level with an archaeal homolog. The major advantage of the system, consisting of rings with eight identical subunits, is that it amplifies the effects of a mutation as compared with the human counterpart, in which just one subunit per ring is defective. Therefore, the slight deficit of a non-lethal mutation can be detected and characterized.

  15. Expression, purification and crystallization of an archaeal-type phosphoenolpyruvate carboxylase

    International Nuclear Information System (INIS)

    The expression, purification, crystallization and preliminary diffraction analysis of an archaeal-type phosphoenolpyruvate carboxylase are described. Complete highly redundant X-ray data have been measured from a crystal diffracting to 3.13 Å resolution. An archaeal-type phosphoenolpyruvate carboxylase (PepcA) from Clostridium perfringens has been expressed in Escherichia coli in a soluble form with an amino-terminal His tag. The recombinant protein is enzymatically active and two crystal forms have been obtained. Complete diffraction data extending to 3.13 Å resolution have been measured from a crystal soaked in KAu(CN)2, using radiation at a wavelength just above the Au LIII edge. The asymmetric unit contains two tetramers of PepcA

  16. The Korarchaeota: Archaeal orphans representing an ancestral lineage of life

    Energy Technology Data Exchange (ETDEWEB)

    Elkins, James G.; Kunin, Victor; Anderson, Iain; Barry, Kerrie; Goltsman, Eugene; Lapidus, Alla; Hedlund, Brian; Hugenholtz, Phil; Kyrpides, Nikos; Graham, David; Keller, Martin; Wanner, Gerhard; Richardson, Paul; Stetter, Karl O.

    2007-05-01

    Based on conserved cellular properties, all life on Earth can be grouped into different phyla which belong to the primary domains Bacteria, Archaea, and Eukarya. However, tracing back their evolutionary relationships has been impeded by horizontal gene transfer and gene loss. Within the Archaea, the kingdoms Crenarchaeota and Euryarchaeota exhibit a profound divergence. In order to elucidate the evolution of these two major kingdoms, representatives of more deeply diverged lineages would be required. Based on their environmental small subunit ribosomal (ss RNA) sequences, the Korarchaeota had been originally suggested to have an ancestral relationship to all known Archaea although this assessment has been refuted. Here we describe the cultivation and initial characterization of the first member of the Korarchaeota, highly unusual, ultrathin filamentous cells about 0.16 {micro}m in diameter. A complete genome sequence obtained from enrichment cultures revealed an unprecedented combination of signature genes which were thought to be characteristic of either the Crenarchaeota, Euryarchaeota, or Eukarya. Cell division appears to be mediated through a FtsZ-dependent mechanism which is highly conserved throughout the Bacteria and Euryarchaeota. An rpb8 subunit of the DNA-dependent RNA polymerase was identified which is absent from other Archaea and has been described as a eukaryotic signature gene. In addition, the representative organism possesses a ribosome structure typical for members of the Crenarchaeota. Based on its gene complement, this lineage likely diverged near the separation of the two major kingdoms of Archaea. Further investigations of these unique organisms may shed additional light onto the evolution of extant life.

  17. Fossilization and degradation of archaeal intact polar tetraether lipids in deeply buried marine sediments (Peru Margin)

    OpenAIRE

    Lengger, S. K.; Hopmans, E.C.; Sinninghe Damsté, J.S.; Schouten, S.

    2014-01-01

    Glycerol dibiphytanyl glycerol tetraether (GDGT) lipids are part of the cellular membranes of Thaumarchaeota, an archaeal phylum composed of aerobic ammonia oxidizers, and are used in the paleotemperature proxy TEX86. GDGTs in live cells possess polar head groups and are called intact polar lipids (IPL-GDGTs). Their transformation to core lipids (CL) by cleavage of the head group was assumed to proceed rapidly after cell death, but it has been suggested that some of these IPL-GDGTs can, just ...

  18. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    OpenAIRE

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-01-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly differen...

  19. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    Science.gov (United States)

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  20. Archaeal Transcription: Function of an Alternative Transcription Factor B from Pyrococcus furiosus▿

    OpenAIRE

    Micorescu, Michael; Grünberg, Sebastian; Franke, Andreas; Cramer, Patrick; Thomm, Michael; Bartlett, Michael

    2007-01-01

    The genome of the hyperthermophile archaeon Pyrococcus furiosus encodes two transcription factor B (TFB) paralogs, one of which (TFB1) was previously characterized in transcription initiation. The second TFB (TFB2) is unusual in that it lacks recognizable homology to the archaeal TFB/eukaryotic TFIIB B-finger motif. TFB2 functions poorly in promoter-dependent transcription initiation, but photochemical cross-linking experiments indicated that the orientation and occupancy of transcription com...

  1. Factors Controlling the Distribution of Archaeal Tetraethers in Terrestrial Hot Springs▿

    OpenAIRE

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, Wenjun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L.

    2008-01-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, i...

  2. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest

    OpenAIRE

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2010-01-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees wer...

  3. Significance of archaeal nitrification in hypoxic waters of the Baltic Sea

    OpenAIRE

    Berg, Carlo; Vandieken, Verona; Thamdrup, Bo; Jürgens, Klaus

    2014-01-01

    Ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota are widespread, and their abundance in many terrestrial and aquatic ecosystems suggests a prominent role in nitrification. AOA also occur in high numbers in oxygen-deficient marine environments, such as the pelagic redox gradients of the central Baltic Sea; however, data on archaeal nitrification rates are scarce and little is known about the factors, for example sulfide, that regulate nitrification in this system. In the present wo...

  4. Abundance and Composition of Epiphytic Bacterial and Archaeal Ammonia Oxidizers of Marine Red and Brown Macroalgae

    OpenAIRE

    Trias, R. (Rosalía); García-Lledó A. (Arantzazu); Sánchez, N.; López-Jurado, J. L.; Hallin, S. (Sara); Bañeras, Ll. (Lluís)

    2012-01-01

    Ammonia-oxidizing bacteria (AOB) and archaea (AOA) are important for nitrogen cycling in marine ecosystems. Little is known about the diversity and abundance of these organisms on the surface of marine macroalgae, despite the algae’s potential importance to create surfaces and local oxygen-rich environments supporting ammonia oxidation at depths with low dissolved oxygen levels. We determined the abundance and composition of the epiphytic bacterial and archaeal ammonia-oxidizing communities o...

  5. Global Occurrence of Archaeal amoA Genes in Terrestrial Hot Springs▿

    OpenAIRE

    Zhang, Chuanlun L.; Ye, Qi; Huang, Zhiyong; Li, Wenjun; Chen, Jinquan; Song, Zhaoqi; Zhao, Weidong; Bagwell, Christopher; Inskeep, William P.; Ross, Christian; Gao, Lei; Wiegel, Juergen; Romanek, Christopher S.; Shock, Everett L.; Hedlund, Brian P.

    2008-01-01

    Despite the ubiquity of ammonium in geothermal environments and the thermodynamic favorability of aerobic ammonia oxidation, thermophilic ammonia-oxidizing microorganisms belonging to the crenarchaeota kingdom have only recently been described. In this study, we analyzed microbial mats and surface sediments from 21 hot spring samples (pH 3.4 to 9.0; temperature, 41 to 86°C) from the United States, China, and Russia and obtained 846 putative archaeal ammonia monooxygenase large-subunit (amoA) ...

  6. Biogas production and methanogenic archaeal community in mesophilic and thermophilic anaerobic co-digestion processes.

    Science.gov (United States)

    Yu, D; Kurola, J M; Lähde, K; Kymäläinen, M; Sinkkonen, A; Romantschuk, M

    2014-10-01

    Over 258 Mt of solid waste are generated annually in Europe, a large fraction of which is biowaste. Sewage sludge is another major waste fraction. In this study, biowaste and sewage sludge were co-digested in an anaerobic digestion reactor (30% and 70% of total wet weight, respectively). The purpose was to investigate the biogas production and methanogenic archaeal community composition in the anaerobic digestion reactor under meso- (35-37 °C) and thermophilic (55-57 °C) processes and an increasing organic loading rate (OLR, 1-10 kg VS m(-3) d(-1)), and also to find a feasible compromise between waste treatment capacity and biogas production without causing process instability. In summary, more biogas was produced with all OLRs by the thermophilic process. Both processes showed a limited diversity of the methanogenic archaeal community which was dominated by Methanobacteriales and Methanosarcinales (e.g. Methanosarcina) in both meso- and thermophilic processes. Methanothermobacter was detected as an additional dominant genus in the thermophilic process. In addition to operating temperatures, the OLRs, the acetate concentration, and the presence of key substrates like propionate also affected the methanogenic archaeal community composition. A bacterial cell count 6.25 times higher than archaeal cell count was observed throughout the thermophilic process, while the cell count ratio varied between 0.2 and 8.5 in the mesophilic process. This suggests that the thermophilic process is more stable, but also that the relative abundance between bacteria and archaea can vary without seriously affecting biogas production.

  7. Exploring microbial dark matter to resolve the deep archaeal ancestry of eukaryotes.

    Science.gov (United States)

    Saw, Jimmy H; Spang, Anja; Zaremba-Niedzwiedzka, Katarzyna; Juzokaite, Lina; Dodsworth, Jeremy A; Murugapiran, Senthil K; Colman, Dan R; Takacs-Vesbach, Cristina; Hedlund, Brian P; Guy, Lionel; Ettema, Thijs J G

    2015-09-26

    The origin of eukaryotes represents an enigmatic puzzle, which is still lacking a number of essential pieces. Whereas it is currently accepted that the process of eukaryogenesis involved an interplay between a host cell and an alphaproteobacterial endosymbiont, we currently lack detailed information regarding the identity and nature of these players. A number of studies have provided increasing support for the emergence of the eukaryotic host cell from within the archaeal domain of life, displaying a specific affiliation with the archaeal TACK superphylum. Recent studies have shown that genomic exploration of yet-uncultivated archaea, the so-called archaeal 'dark matter', is able to provide unprecedented insights into the process of eukaryogenesis. Here, we provide an overview of state-of-the-art cultivation-independent approaches, and demonstrate how these methods were used to obtain draft genome sequences of several novel members of the TACK superphylum, including Lokiarchaeum, two representatives of the Miscellaneous Crenarchaeotal Group (Bathyarchaeota), and a Korarchaeum-related lineage. The maturation of cultivation-independent genomics approaches, as well as future developments in next-generation sequencing technologies, will revolutionize our current view of microbial evolution and diversity, and provide profound new insights into the early evolution of life, including the enigmatic origin of the eukaryotic cell. PMID:26323759

  8. Assessment of bacterial and archaeal community structure in Swine wastewater treatment processes.

    Science.gov (United States)

    Da Silva, Marcio Luis Busi; Cantão, Mauricio Egídio; Mezzari, Melissa Paola; Ma, Jie; Nossa, Carlos Wolfgang

    2015-07-01

    Microbial communities from two field-scale swine wastewater treatment plants (WWTPs) were assessed by pyrosequencing analyses of bacterial and archaeal 16S ribosomal DNA (rDNA) fragments. Effluent samples from secondary (anaerobic covered lagoons and upflow anaerobic sludge blanket [UASB]) and tertiary treatment systems (open-pond natural attenuation lagoon and air-sparged nitrification-denitrification tank followed by alkaline phosphorus precipitation process) were analyzed. A total of 56,807 and 48,859 high-quality reads were obtained from bacterial and archaeal libraries, respectively. Dominant bacterial communities were associated with the phylum Firmicutes, Bacteroidetes, Proteobacteria, or Actinobacteria. Bacteria and archaea diversity were highest in UASB effluent sample. Escherichia, Lactobacillus, Bacteroides, and/or Prevotella were used as indicators of putative pathogen reduction throughout the WWTPs. Satisfactory pathogen reduction was observed after the open-pond natural attenuation lagoon but not after the air-sparged nitrification/denitrification followed by alkaline phosphorus precipitation treatment processes. Among the archaeal communities, 80% of the reads was related to hydrogeno-trophic methanogens Methanospirillum. Enrichment of hydrogenotrophic methanogens detected in effluent samples from the anaerobic covered lagoons and UASB suggested that CO2 reduction with H2 was the dominant methanogenic pathway in these systems. Overall, the results served to improve our current understanding of major microbial communities' changes downgradient from the pen and throughout swine WWTP as a result of different treatment processes. PMID:25432577

  9. The Primary Results of Analyses on The Archaeal and Bacterial Diversity of Active Cave Environments Settled in Limestones at Southern Turkey

    Science.gov (United States)

    Tok, Ezgi; Kurt, Halil; Tunga Akarsubasi, A.

    2016-04-01

    The microbial diversity of cave sediments which are obtained from three different caves named Insuyu, Balatini and Altınbeşik located at Southern Turkey has been investigated using molecular methods for biomineralization . The total number of 22 samples were taken in duplicates from the critical zones of the caves at where the water activity is observed all year round. Microbial communities were monitored by 16S rRNA gene based PCR-DGGE (Polymerase Chain Reaction - Denaturating Gradient Gel Electrophoresis) methodology. DNA were extracted from the samples by The PowerSoil® DNA Isolation Kit (MO BIO Laboratories inc., CA) with the modifications on the producer's protocol. The synthetic DNA molecule poly-dIdC was used to increase the yield of PCR amplification via blocking the reaction between CaCO3 and DNA molecules. Thereafter samples were amplified by using both Archaeal and Bacterial universal primers (ref). Subsequently, archaeal and bacterial diversities in cave sediments, were investigated to be able to compare with respect to their similarities by using DGGE. DGGE patterns were analysed with BioNumerics software 5.1. Similarity matrix and dendograms of the DGGE profiles were generated based on the Dice correlation coefficient (band-based) and unweighted pair-group method with arithmetic mean (UPGMA). The structural diversity of the microbial community was examined by the Shannon index of general diversity (H). Similtaneously, geochemical analyses of the sediment samples were performed within the scope of this study. Total organic carbon (TOC), x-ray diffraction spectroscopy (XRD) and x-ray fluorescence spectroscopy (XRF) analysis of sediments were also implemented. The extensive results will be obtained at the next stages of the study currently carried on.

  10. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  11. Characterization of an archaeal two-component system that regulates methanogenesis in Methanosaeta harundinacea.

    Directory of Open Access Journals (Sweden)

    Jie Li

    Full Text Available Two-component signal transduction systems (TCSs are a major mechanism used by bacteria in response to environmental changes. Although many sequenced archaeal genomes encode TCSs, they remain poorly understood. Previously, we reported that a methanogenic archaeon, Methanosaeta harundinacea, encodes FilI, which synthesizes carboxyl-acyl homoserine lactones, to regulate transitions of cellular morphology and carbon metabolic fluxes. Here, we report that filI, the cotranscribed filR2, and the adjacent filR1 constitute an archaeal TCS. FilI possesses a cytoplasmic kinase domain (histidine kinase A and histidine kinase-like ATPase and its cognate response regulator. FilR1 carries a receiver (REC domain coupled with an ArsR-related domain with potential DNA-binding ability, while FilR2 carries only a REC domain. In a phosphorelay assay, FilI was autophosphorylated and specifically transferred the phosphoryl group to FilR1 and FilR2, confirming that the three formed a cognate TCS. Through chromatin immunoprecipitation-quantitative polymerase chain reaction (ChIP-qPCR using an anti-FilR1 antibody, FilR1 was shown to form in vivo associations with its own promoter and the promoter of the filI-filR2 operon, demonstrating a regulatory pattern common among TCSs. ChIP-qPCR also detected FilR1 associations with key genes involved in acetoclastic methanogenesis, acs4 and acs1. Electrophoretic mobility shift assays confirmed the in vitro tight binding of FilR1 to its own promoter and those of filI-filR2, acs4, and mtrABC. This also proves the DNA-binding ability of the ArsR-related domain, which is found primarily in Archaea. The archaeal promoters of acs4, filI, acs1, and mtrABC also initiated FilR1-modulated expression in an Escherichia coli lux reporter system, suggesting that FilR1 can up-regulate both archaeal and bacterial transcription. In conclusion, this work identifies an archaeal FilI/FilRs TCS that regulates the methanogenesis of M. harundinacea.

  12. Functional analysis of archaeal MBF1 by complementation studies in yeast

    Directory of Open Access Journals (Sweden)

    Siebers Bettina

    2011-03-01

    Full Text Available Abstract Background Multiprotein-bridging factor 1 (MBF1 is a transcriptional co-activator that bridges a sequence-specific activator (basic-leucine zipper (bZIP like proteins (e.g. Gcn4 in yeast or steroid/nuclear-hormone receptor family (e.g. FTZ-F1 in insect and the TATA-box binding protein (TBP in Eukaryotes. MBF1 is absent in Bacteria, but is well- conserved in Eukaryotes and Archaea and harbors a C-terminal Cro-like Helix Turn Helix (HTH domain, which is the only highly conserved, classical HTH domain that is vertically inherited in all Eukaryotes and Archaea. The main structural difference between archaeal MBF1 (aMBF1 and eukaryotic MBF1 is the presence of a Zn ribbon motif in aMBF1. In addition MBF1 interacting activators are absent in the archaeal domain. To study the function and therefore the evolutionary conservation of MBF1 and its single domains complementation studies in yeast (mbf1Δ as well as domain swap experiments between aMBF1 and yMbf1 were performed. Results In contrast to previous reports for eukaryotic MBF1 (i.e. Arabidopsis thaliana, insect and human the two archaeal MBF1 orthologs, TMBF1 from the hyperthermophile Thermoproteus tenax and MMBF1 from the mesophile Methanosarcina mazei were not functional for complementation of an Saccharomyces cerevisiae mutant lacking Mbf1 (mbf1Δ. Of twelve chimeric proteins representing different combinations of the N-terminal, core domain, and the C-terminal extension from yeast and aMBF1, only the chimeric MBF1 comprising the yeast N-terminal and core domain fused to the archaeal C-terminal part was able to restore full wild-type activity of MBF1. However, as reported previously for Bombyx mori, the C-terminal part of yeast Mbf1 was shown to be not essential for function. In addition phylogenetic analyses revealed a common distribution of MBF1 in all Archaea with available genome sequence, except of two of the three Thaumarchaeota; Cenarchaeum symbiosum A and Nitrosopumilus maritimus

  13. The structure of the RNA m5C methyltransferase YebU from Escherichia coli reveals a C-terminal RNA-recruiting PUA domain.

    Science.gov (United States)

    Hallberg, B Martin; Ericsson, Ulrika B; Johnson, Kenneth A; Andersen, Niels Møller; Douthwaite, Stephen; Nordlund, Pär; Beuscher, Albert E; Erlandsen, Heidi

    2006-07-21

    Nucleotide methylations are the most common type of rRNA modification in bacteria, and are introduced post-transcriptionally by a wide variety of site-specific enzymes. Three 5-methylcytidine (m(5)C) bases are found in the rRNAs of Escherichia coli and one of these, at nucleotide 1407 in 16 S rRNA, is the modification product of the methyltransferase (MTase) YebU (also called RsmF). YebU requires S-adenosyl-l-methionine (SAM) and methylates C1407 within assembled 30 S subunits, but not in naked 16 S rRNA or within tight-couple 70 S ribosomes. Here, we describe the three-dimensional structure of YebU determined by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including RsmB and PH1374. The C-terminal one-third of YebU contains a domain similar to that in pseudouridine synthases and archaeosine-specific transglycosylases (PUA-domain), which was not predicted by sequence alignments. Furthermore, YebU is predicted to contain extended regions of positive electrostatic potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU.

  14. Detection of RNA nucleoside modifications with the uridine-specific ribonuclease MC1 from Momordica charantia.

    Science.gov (United States)

    Addepalli, Balasubrahmanym; Lesner, Nicholas P; Limbach, Patrick A

    2015-10-01

    A codon-optimized recombinant ribonuclease, MC1 is characterized for its uridine-specific cleavage ability to map nucleoside modifications in RNA. The published MC1 amino acid sequence, as noted in a previous study, was used as a template to construct a synthetic gene with a natural codon bias favoring expression in Escherichia coli. Following optimization of various expression conditions, the active recombinant ribonuclease was successfully purified as a C-terminal His-tag fusion protein from E. coli [Rosetta 2(DE3)] cells. The isolated protein was tested for its ribonuclease activity against oligoribonucleotides and commercially available E. coli tRNA(Tyr I). Analysis of MC1 digestion products by ion-pairing reverse phase liquid-chromatography coupled with mass spectrometry (IP-RP-LC-MS) revealed enzymatic cleavage of RNA at the 5'-termini of uridine and pseudouridine, but cleavage was absent if the uridine was chemically modified or preceded by a nucleoside with a bulky modification. Furthermore, the utility of this enzyme to generate complementary digestion products to other common endonucleases, such as RNase T1, which enables the unambiguous mapping of modified residues in RNA is demonstrated. PMID:26221047

  15. Crystallization and preliminary X-ray crystallographic analysis of bacterial tRNA(Sec) in complex with seryl-tRNA synthetase.

    Science.gov (United States)

    Itoh, Yuzuru; Sekine, Shun Ichi; Yokoyama, Shigeyuki

    2012-06-01

    Selenocysteine (Sec) is translationally incorporated into proteins in response to the UGA codon. The tRNA specific to Sec (tRNA(Sec)) is first ligated with serine by seryl-tRNA synthetase (SerRS). To elucidate the tertiary structure of bacterial tRNA(Sec) and its specific interaction with SerRS, the bacterial tRNA(Sec) from Aquifex aeolicus was crystallized as the heterologous complex with the archaeal SerRS from Methanopyrus kandleri. Although X-ray diffraction by crystals of tRNA(Sec) in complex with wild-type SerRS was rather poor (to 5.7 Å resolution), the resolution was improved by introducing point mutations targeting the crystal-packing interface. Heavy-atom labelling also contributed to resolution improvement. A 3.2 Å resolution diffraction data set for phase determination was obtained from a K(2)Pt(CN)(4)-soaked crystal. PMID:22684069

  16. Factors Controlling the Distribution of Archaeal Tetraethers in Terrestrial Hot Springs▿

    Science.gov (United States)

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, WenJun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L.

    2008-01-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, including Yellowstone National Park (United States), the Great Basin of Nevada and California (United States), Kamchatka (Russia), Tengchong thermal field (China), and Thailand. These samples had temperatures of 36.5 to 87°C and pH values of 3.0 to 9.2. GDGT abundances also were determined for three soil samples adjacent to some of the hot springs. Principal component analysis identified four factors that accounted for most of the variance among nine individual GDGTs, temperature, and pH. Significant correlations were observed between pH and the GDGTs crenarchaeol and GDGT-4 (four cyclopentane rings, m/z 1,294); pH correlated positively with crenarchaeol and inversely with GDGT-4. Weaker correlations were observed between temperature and the four factors. Three of the four GDGTs used in the marine TEX86 paleotemperature index (GDGT-1 to -3, but not crenarchaeol isomer) were associated with a single factor. No correlation was observed for GDGT-0 (acyclic caldarchaeol): it is effectively its own variable. The biosynthetic mechanisms and exact archaeal community structures leading to these relationships remain unknown. However, the data in general show promise for the continued development of GDGT lipid-based physiochemical proxies for archaeal evolution and for paleo-ecology or paleoclimate studies. PMID:18390673

  17. Factors controlling the distribution of archaeal tetraethers in terrestrial hot springs.

    Science.gov (United States)

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, WenJun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L

    2008-06-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, including Yellowstone National Park (United States), the Great Basin of Nevada and California (United States), Kamchatka (Russia), Tengchong thermal field (China), and Thailand. These samples had temperatures of 36.5 to 87 degrees C and pH values of 3.0 to 9.2. GDGT abundances also were determined for three soil samples adjacent to some of the hot springs. Principal component analysis identified four factors that accounted for most of the variance among nine individual GDGTs, temperature, and pH. Significant correlations were observed between pH and the GDGTs crenarchaeol and GDGT-4 (four cyclopentane rings, m/z 1,294); pH correlated positively with crenarchaeol and inversely with GDGT-4. Weaker correlations were observed between temperature and the four factors. Three of the four GDGTs used in the marine TEX(86) paleotemperature index (GDGT-1 to -3, but not crenarchaeol isomer) were associated with a single factor. No correlation was observed for GDGT-0 (acyclic caldarchaeol): it is effectively its own variable. The biosynthetic mechanisms and exact archaeal community structures leading to these relationships remain unknown. However, the data in general show promise for the continued development of GDGT lipid-based physiochemical proxies for archaeal evolution and for paleo-ecology or paleoclimate studies. PMID:18390673

  18. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Science.gov (United States)

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  19. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Science.gov (United States)

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts.

  20. Identification of novel positive-strand RNA viruses by metagenomic analysis of archaea-dominated Yellowstone hot springs.

    Science.gov (United States)

    Bolduc, Benjamin; Shaughnessy, Daniel P; Wolf, Yuri I; Koonin, Eugene V; Roberto, Francisco F; Young, Mark

    2012-05-01

    There are no known RNA viruses that infect Archaea. Filling this gap in our knowledge of viruses will enhance our understanding of the relationships between RNA viruses from the three domains of cellular life and, in particular, could shed light on the origin of the enormous diversity of RNA viruses infecting eukaryotes. We describe here the identification of novel RNA viral genome segments from high-temperature acidic hot springs in Yellowstone National Park in the United States. These hot springs harbor low-complexity cellular communities dominated by several species of hyperthermophilic Archaea. A viral metagenomics approach was taken to assemble segments of these RNA virus genomes from viral populations isolated directly from hot spring samples. Analysis of these RNA metagenomes demonstrated unique gene content that is not generally related to known RNA viruses of Bacteria and Eukarya. However, genes for RNA-dependent RNA polymerase (RdRp), a hallmark of positive-strand RNA viruses, were identified in two contigs. One of these contigs is approximately 5,600 nucleotides in length and encodes a polyprotein that also contains a region homologous to the capsid protein of nodaviruses, tetraviruses, and birnaviruses. Phylogenetic analyses of the RdRps encoded in these contigs indicate that the putative archaeal viruses form a unique group that is distinct from the RdRps of RNA viruses of Eukarya and Bacteria. Collectively, our findings suggest the existence of novel positive-strand RNA viruses that probably replicate in hyperthermophilic archaeal hosts and are highly divergent from RNA viruses that infect eukaryotes and even more distant from known bacterial RNA viruses. These positive-strand RNA viruses might be direct ancestors of RNA viruses of eukaryotes.

  1. Bacterial and archaeal community structures in the Arctic deep-sea sediment

    Institute of Scientific and Technical Information of China (English)

    LI Yan; LIU Qun; LI Chaolun; DONG Yi; ZHANG Wenyan; ZHANG Wuchang; XIAO Tian

    2015-01-01

    Microbial community structures in the Arctic deep-sea sedimentary ecosystem are determined by organic matter input, energy availability, and other environmental factors. However, global warming and earlier ice-cover melting are affecting the microbial diversity. To characterize the Arctic deep-sea sediment microbial diversity and its rela-tionship with environmental factors, we applied Roche 454 sequencing of 16S rDNA amplicons from Arctic deep-sea sediment sample. Both bacterial and archaeal communities’ richness, compositions and structures as well as tax-onomic and phylogenetic affiliations of identified clades were characterized. Phylotypes relating to sulfur reduction and chemoorganotrophic lifestyle are major groups in the bacterial groups;while the archaeal community is domi-nated by phylotypes most closely related to the ammonia-oxidizing Thaumarchaeota (96.66%) and methanogenic Euryarchaeota (3.21%). This study describes the microbial diversity in the Arctic deep marine sediment (>3 500 m) near the North Pole and would lay foundation for future functional analysis on microbial metabolic processes and pathways predictions in similar environments.

  2. Archaeal membrane-associated proteases: insights on Haloferax volcanii and other haloarchaea

    Directory of Open Access Journals (Sweden)

    Maria Ines Giménez

    2015-02-01

    Full Text Available The function of membrane proteases range from general house-keeping to regulation of cellular processes. Although the biological role of these enzymes in archaea is poorly understood, some of them are implicated in the biogenesis of the archaeal cell envelope and surface structures. The membrane-bound ATP-dependent Lon protease is essential for cell viability and affects membrane carotenoid content in Haloferax volcanii. At least two different proteases are needed in this archaeon to accomplish the posttranslational modifications of the S-layer glycoprotein. The rhomboid protease RhoII is involved in the N-glycosylation of the S-layer protein with a sulfoquinovose-containing oligosaccharide while archaeosortase ArtA mediates the proteolytic processing coupled-lipid modification of this glycoprotein facilitating its attachment to the archaeal cell surface. Interestingly, two different signal peptidase I homologs exist in H. volcanii, Sec11a and Sec11b, which likely play distinct physiological roles. Type IV prepilin peptidase PibD processes flagellin/pilin precursors, being essential for the biogenesis and function of the archaellum and other cell surface structures in H. volcanii.

  3. Overexpression, purification and crystallization of an archaeal DNA ligase from Pyrococcus furiosus

    International Nuclear Information System (INIS)

    Crystals of the archaeal DNA ligase from Pyrococcus furiosus were obtained using 6.6%(v/v) ethanol as a precipitant and diffracted X-rays to 1.7 Å resolution. DNA ligases seal single-strand breaks in double-stranded DNA and their function is essential to maintain the integrity of the genome during various aspects of DNA metabolism, such as replication, excision repair and recombination. DNA-strand breaks are frequently generated as reaction intermediates in these events and the sealing of these breaks depends solely on the proper function of DNA ligase. Crystals of the archaeal DNA ligase from Pyrococcus furiosus were obtained using 6.6%(v/v) ethanol as a precipitant and diffracted X-rays to 1.7 Å resolution. They belong to the monoclinic space group P21, with unit-cell parameters a = 61.1, b = 88.3, c = 63.4 Å, β = 108.9°. The asymmetric unit contains one ligase molecule

  4. Archaeal Genome Guardians Give Insights into Eukaryotic DNA Replication and Damage Response Proteins

    Directory of Open Access Journals (Sweden)

    David S. Shin

    2014-01-01

    Full Text Available As the third domain of life, archaea, like the eukarya and bacteria, must have robust DNA replication and repair complexes to ensure genome fidelity. Archaea moreover display a breadth of unique habitats and characteristics, and structural biologists increasingly appreciate these features. As archaea include extremophiles that can withstand diverse environmental stresses, they provide fundamental systems for understanding enzymes and pathways critical to genome integrity and stress responses. Such archaeal extremophiles provide critical data on the periodic table for life as well as on the biochemical, geochemical, and physical limitations to adaptive strategies allowing organisms to thrive under environmental stress relevant to determining the boundaries for life as we know it. Specifically, archaeal enzyme structures have informed the architecture and mechanisms of key DNA repair proteins and complexes. With added abilities to temperature-trap flexible complexes and reveal core domains of transient and dynamic complexes, these structures provide insights into mechanisms of maintaining genome integrity despite extreme environmental stress. The DNA damage response protein structures noted in this review therefore inform the basis for genome integrity in the face of environmental stress, with implications for all domains of life as well as for biomanufacturing, astrobiology, and medicine.

  5. Geographic distribution of archaeal ammonia oxidizing ecotypes in the Atlantic Ocean

    Directory of Open Access Journals (Sweden)

    Eva eSintes

    2016-02-01

    Full Text Available In marine ecosystems, Thaumarchaeota are most likely the major ammonia oxidizers. While ammonia concentrations vary by about two orders of magnitude in the oceanic water column, archaeal ammonia oxidizers (AOA vary by only one order of magnitude from surface to bathypelagic waters. Thus, the question arises whether the key enzyme responsible for ammonia oxidation, ammonia monooxygenase (amo, exhibits different affinities to ammonia along the oceanic water column and consequently, whether there are different ecotypes of AOA present in the oceanic water column. We determined the abundance and phylogeny of archaeal ammonia oxidizers (AOA based on their amoA gene. Two ecotypes of AOA exhibited a distribution pattern reflecting the reported availability of ammonia and the physico-chemical conditions throughout the Atlantic, and from epi- to bathypelagic waters. The distinction between these two ecotypes was not only detectable at the nucleotide level. Consistent changes were also detected at the amino acid level. These changes include substitutions of polar to hydrophobic amino acid, and glycine substitutions that could have an effect on the configuration of the amo protein and thus, on its activity. Although we cannot identify the specific effect, the ratio of non-synonymous to synonymous substitutions (dN/dS between the two ecotypes indicates a strong positive selection between them. Consequently, our results point to a certain degree of environmental selection on these two ecotypes that have led to their niche specialization.

  6. Bacterial and archaeal dynamics in phylogeny and function in the North Atlantic deep waters

    Science.gov (United States)

    Herndl, G. J.; Brink, M.; Agogue, H.

    2009-04-01

    The diversity and specific functional aspects linked to the N cycle of the bacterio- and archaeoplankton were investigated in the major deep water masses of the North Atlantic following the main driver of the thermohaline circulation, the North Atlantic Deep Water, from 65°N to 5°S. The phylogenetic composition of Bacteria and Archaea is not only depth-dependent but, specific water masses harbor specific prokaryotic communities. The specific composition of these communities in a particular water mass is maintained even over large distances. The distribution of archaeal and bacterial amoA genes were also determined. Archaeal amoA copy numbers decreased drastically with depth especially in the eastern subtropical Atlantic. This coincides with the lower nutrient concentration of the deep waters in the southern parts of the North Atlantic and the older age of the deep-water masses there. These data demonstrate that the diversity and potential nitrification activity are closely linked to the hydrology and chemical characteristics of the major water masses in the North Atlantic.

  7. Archaeal Life on Tangkuban Perahu- Sampling and Culture Growth in Indonesian Laboratories

    Directory of Open Access Journals (Sweden)

    SRI HANDAYANI

    2012-09-01

    Full Text Available The aim of the expedition to Tangkuban Perahu, West Java was to obtain archaeal samples from the solfatara fields located in Domas crater. This was one of the places, where scientists from the University of Regensburg Germany had formerly isolated Indonesian archaea, especially Thermoplasma and Sulfolobus species but not fully characterized. We collected five samples from mud holes with temperatures from 57 to 88 oC and pH of 1.5-2. A portion of each sample was grown at the University of Regensburg in modified Allen’s medium at 80 oC. From four out of five samples enrichment cultures were obtained, autotrophically on elemental sulphur and heterotrophically on sulfur and yeast extract; electron micrographs are presented. In the laboratories of Universitas Indonesia the isolates were cultured at 55-60 oC in order to grow tetraetherlipid synthesizing archaea, both Thermoplasmatales and Sulfolobales. Here, we succeeded to culture the same type of archaeal cells, which had been cultured in Regensburg, probably a Sulfolobus species and in Freundt’s medium, Thermoplasma species. The harvested cells are documented by phase contrast microscope equipped with a digital camera. Our next steps will be to further characterize genetically the cultured cells from Tangkuban Perahu isolates.

  8. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    Science.gov (United States)

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane.

  9. TAF1B is a TFIIB-like component of the basal transcription machinery for RNA polymerase I.

    Science.gov (United States)

    Naidu, Srivatsava; Friedrich, J Karsten; Russell, Jackie; Zomerdijk, Joost C B M

    2011-09-16

    Transcription by eukaryotic RNA polymerases (Pols) II and III and archaeal Pol requires structurally related general transcription factors TFIIB, Brf1, and TFB, respectively, which are essential for polymerase recruitment and initiation events. A TFIIB-like protein was not evident in the Pol I basal transcription machinery. We report that TAF1B, a subunit of human Pol I basal transcription factor SL1, is structurally related to TFIIB/TFIIB-like proteins, through predicted amino-terminal zinc ribbon and cyclin-like fold domains. SL1, essential for Pol I recruitment to the ribosomal RNA gene promoter, also has an essential postpolymerase recruitment role, operating through TAF1B. Therefore, a TFIIB-related protein is implicated in preinitiation complex assembly and postpolymerase recruitment events in Pol I transcription, underscoring the parallels between eukaryotic Pol I, II, and III and archaeal transcription machineries. PMID:21921199

  10. Archaeal tetraether membrane lipid fluxes in the northeastern Pacific and the Arabian Sea: implications for TEX86 paleothermometry

    NARCIS (Netherlands)

    Wuchter, C.; Schouten, S.; Wakeham, S.G.; Sinninghe Damsté, J.S.

    2006-01-01

    The newly introduced temperature proxy, the tetraether index of archaeal lipids with 86 carbon atoms (TEX86), is based on the number of cyclopentane moieties in the glycerol dialkyl glycerol tetraether (GDGT) lipids of marine Crenarchaeota. The composition of sedimentary GDGTs used for TEX86 paleoth

  11. Structure and genome organization of AFV2, a novel archaeal lipothrixvirus with unusual terminal and core structures

    DEFF Research Database (Denmark)

    Häring, Monika; Vestergaard, Gisle Alberg; Brügger, Kim;

    2005-01-01

    A novel filamentous virus, AFV2, from the hyperthermophilic archaeal genus Acidianus shows structural similarity to lipothrixviruses but differs from them in its unusual terminal and core structures. The double-stranded DNA genome contains 31,787 bp and carries eight open reading frames homologous...

  12. Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle

    DEFF Research Database (Denmark)

    Prangishvili, David; Vestergaard, Gisle Alberg; Häring, Monika;

    2006-01-01

    A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long...

  13. Archaeal ammonia oxidation in volcanic grassland soils of Iceland. Effects of elevated temperature and N availability on processes and organisms

    NARCIS (Netherlands)

    Daebeler, A.

    2014-01-01

    Thaumarchaea are recognized today as the most abundant and ubiquitously dis­tributed archaeal organisms, especially in the oceans and soil. Their phylogenetic placement as a phylum, the capability of all cultivated Thaumarchaea to oxidize ammonia for energy conservation as well as many further aspec

  14. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    NARCIS (Netherlands)

    Sintes, Eva; Bergauer, Kristin; De Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotype

  15. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.;

    2015-01-01

    RNA modification has attracted increasing interest as it is realized that epitranscriptomics is important in disease development. In type 2 diabetes we have suggested that high urinary excretion of 8-oxo-2'-Guanosine (8oxoGuo), as a measure of global RNA oxidation, is associated with poor survival.......9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...... diabetes. In agreement with our previous finding, DNA oxidation did not show any prognostic value. RNA oxidation represents oxidative stress intracellularly, presumably predominantly in the cytosol. The mechanism of RNA oxidation is not clear, but hypothesized to result from mitochondrial dysfunction...

  16. Forest strata drive spatial structure of bacterial and archaeal communities and microbial methane cycling in neotropical bromeliad wetlands

    Science.gov (United States)

    Martinson, Guntars; Brandt, Franziska; Conrad, Ralf

    2016-04-01

    Several thousands of tank bromeliads per hectare of neotropical forest create a unique wetland ecosystem that harbors diverse communities of archaea and bacteria and emit substantial amounts of methane. We studied spatial distribution of archaeal and bacterial communities, microbial methane cycling and their environmental drivers in tank bromeliad wetlands. We selected tank bromeliads of different species and functional types (terrestrial and canopy bromeliads) in a neotropical montane forest of Southern Ecuador and sampled the organic tank slurry. Archaeal and bacterial communities were characterized using terminal-restriction fragment length polymorphism (T-RFLP) and Illumina MiSeq sequencing, respectively, and linked with physico-chemical tank-slurry properties. Additionally, we performed tank-slurry incubations to measure methane production potential, stable carbon isotope fractionation and pathway of methane formation. Archaeal and bacterial community composition in bromeliad wetlands was dominated by methanogens and by Alphaproteobacteria, respectively, and did not differ between species but between functional types. Hydrogenotrophic Methanomicrobiales were the dominant methanogens among all bromeliads but the relative abundance of aceticlastic Methanosaetaceae increased in terrestrial bromeliads. Complementary, hydrogenotrophic methanogenesis was the dominant pathway of methane formation but the relative contribution of aceticlastic methanogenesis increased in terrestrial bromeliads and led to a concomitant increase in total methane production. Rhodospirillales were characteristic for canopy bromeliads, Planctomycetales and Actinomycetalis for terrestrial bromeliads. While nitrogen concentration and pH explained 32% of the archaeal community variability, 29% of the bacterial community variability was explained by nitrogen, acetate and propionate concentrations. Our study demonstrates that bromeliad functional types, associated with different forest strata

  17. A study of archaeal enzymes involved in polar lipid synthesis linking amino acid sequence information, genomic contexts and lipid composition

    Directory of Open Access Journals (Sweden)

    Hiromi Daiyasu

    2005-01-01

    Full Text Available Cellular membrane lipids, of which phospholipids are the major constituents, form one of the characteristic features that distinguish Archaea from other organisms. In this study, we focused on the steps in archaeal phospholipid synthetic pathways that generate polar lipids such as archaetidylserine, archaetidylglycerol, and archaetidylinositol. Only archaetidylserine synthase (ASS, from Methanothermobacter thermautotrophicus, has been experimentally identified. Other enzymes have not been fully examined. Through database searching, we detected many archaeal hypothetical proteins that show sequence similarity to members of the CDP alcohol phosphatidyltransferase family, such as phosphatidylserine synthase (PSS, phosphatidylglycerol synthase (PGS and phosphatidylinositol synthase (PIS derived from Bacteria and Eukarya. The archaeal hypothetical proteins were classified into two groups, based on the sequence similarity. Members of the first group, including ASS from M. thermautotrophicus, were closely related to PSS. The rough agreement between PSS homologue distribution within Archaea and the experimentally identified distribution of archaetidylserine suggested that the hypothetical proteins are ASSs. We found that an open reading frame (ORF tends to be adjacent to that of ASS in the genome, and that the order of the two ORFs is conserved. The sequence similarity of phosphatidylserine decarboxylase to the product of the ORF next to the ASS gene, together with the genomic context conservation, suggests that the ORF encodes archaetidylserine decarboxylase, which may transform archaetidylserine to archaetidylethanolamine. The second group of archaeal hypothetical proteins was related to PGS and PIS. The members of this group were subjected to molecular phylogenetic analysis, together with PGSs and PISs and it was found that they formed two distinct clusters in the molecular phylogenetic tree. The distribution of members of each cluster within Archaea

  18. Archaeal diversity in deep-sea hydrothermal sediments from the East Pacific Rise%东太平洋海隆深海热液区沉积物古菌多样性分析

    Institute of Scientific and Technical Information of China (English)

    刘青; 谢运标; 陈逍遥; 周梅先

    2014-01-01

    Archaeal diversity of deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise was investiga-ted and analyzed with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).Phyloge-netic analyses revealed that a total of 296 random 16S rRNA gene clones were assigned to Thaumarchaeota (47.64%),Euryarchaeota (44.93%),Crenarchaeota (6.77%)and unclassified Archaea (0.68%).Among them,the genus Nitrosopumilus belonging to the phylum Thaumarchaeota and the class Thermoplasmata belonging to the phylum Euryarchaeota were the dominant groups,representing 35.47% and 27.03% of archaeal clones,re-spectively.In addition,some archaeal 16S rRNA gene sequences were affiliated with deep-sea hydrothermal vent Euryarchaeota 3,5 and 6 (DHVE3,DHVE5 and DHVE6),and Marine Benthic Group B and G (MBGB and MB-GE ).Archaeal communities in sediments from 3 sites on East Pacific Rise were clearly distinct from each other.97 archaeal clones from S5-TVG1 site were divided to Thaumarchaeota (49.48%),Euryarchaeota (49.48%)and Crenarchaeota (1.03%).103 archaeal clones from S14-TVG10 site belonged to Thaumarchaeota(84.47%)and Euryarchaeota (15.53%).96 archaeal clones from S16-TVG12 site were assigned to Euryarchaeota(71.88%), Crenarchaeota (19.79%),Thaumarchaeota (6.25%)and unclassified Archaea (2.08%).Our results indicate that Archaea is abundant and there are a lot of novel archaeal groups in deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise,and the distinct community structure and diversity of Archaea in deep-sea hydrother-mal sediments suggested that the sampling area was influenced by hydrothermalism.%采用PCR-RFLP方法对东太平洋海隆深海热液区3个站位沉积物中的古菌多样性进行了初步研究.结果显示,从古菌16S rRNA基因文库中随机挑取的296个阳性克隆分属奇古菌门(Thaumar-chaeota,47.64%)、广古菌门(Euryarchaeota,44.93%)、泉古菌门(Crenarchaeota,6.77

  19. Biological Membranes in Extreme Conditions: Simulations of Anionic Archaeal Tetraether Lipid Membranes.

    Directory of Open Access Journals (Sweden)

    Luis Felipe Pineda De Castro

    Full Text Available In contrast to the majority of organisms that have cells bound by di-ester phospholipids, archaeal membranes consist of di- and tetraether phospholipids. Originating from organisms that withstand harsh conditions (e.g., low pH and a wide range of temperatures such membranes have physical properties that make them attractive materials for biological research and biotechnological applications. We developed force-field parameters based on the widely used Generalized Amber Force Field (GAFF to enable the study of anionic tetraether membranes of the model archaean Sulfolobus acidocaldarius by computer simulations. The simulations reveal that the physical properties of these unique membranes depend on the number of cyclopentane rings included in each lipid unit, and on the size of cations that are used to ensure charge neutrality. This suggests that the biophysical properties of Sulfolobus acidocaldarius cells depend not only on the compositions of their membranes but also on the media in which they grow.

  20. Tertiary structure of bacterial selenocysteine tRNA.

    Science.gov (United States)

    Itoh, Yuzuru; Sekine, Shun-ichi; Suetsugu, Shiro; Yokoyama, Shigeyuki

    2013-07-01

    Selenocysteine (Sec) is translationally incorporated into proteins in response to the UGA codon. The tRNA specific to Sec (tRNA(Sec)) is first ligated with serine by seryl-tRNA synthetase (SerRS). In the present study, we determined the 3.1 Å crystal structure of the tRNA(Sec) from the bacterium Aquifex aeolicus, in complex with the heterologous SerRS from the archaeon Methanopyrus kandleri. The bacterial tRNA(Sec) assumes the L-shaped structure, from which the long extra arm protrudes. Although the D-arm conformation and the extra-arm orientation are similar to those of eukaryal/archaeal tRNA(Sec)s, A. aeolicus tRNA(Sec) has unique base triples, G14:C21:U8 and C15:G20a:G48, which occupy the positions corresponding to the U8:A14 and R15:Y48 tertiary base pairs of canonical tRNAs. Methanopyrus kandleri SerRS exhibited serine ligation activity toward A. aeolicus tRNA(Sec) in vitro. The SerRS N-terminal domain interacts with the extra-arm stem and the outer corner of tRNA(Sec). Similar interactions exist in the reported tRNA(Ser) and SerRS complex structure from the bacterium Thermus thermophilus. Although the catalytic C-terminal domain of M. kandleri SerRS lacks interactions with A. aeolicus tRNA(Sec) in the present complex structure, the conformational flexibility of SerRS is likely to allow the CCA terminal region of tRNA(Sec) to enter the SerRS catalytic site. PMID:23649835

  1. MED: a new non-supervised gene prediction algorithm for bacterial and archaeal genomes

    Directory of Open Access Journals (Sweden)

    Yang Yi-Fan

    2007-03-01

    Full Text Available Abstract Background Despite a remarkable success in the computational prediction of genes in Bacteria and Archaea, a lack of comprehensive understanding of prokaryotic gene structures prevents from further elucidation of differences among genomes. It continues to be interesting to develop new ab initio algorithms which not only accurately predict genes, but also facilitate comparative studies of prokaryotic genomes. Results This paper describes a new prokaryotic genefinding algorithm based on a comprehensive statistical model of protein coding Open Reading Frames (ORFs and Translation Initiation Sites (TISs. The former is based on a linguistic "Entropy Density Profile" (EDP model of coding DNA sequence and the latter comprises several relevant features related to the translation initiation. They are combined to form a so-called Multivariate Entropy Distance (MED algorithm, MED 2.0, that incorporates several strategies in the iterative program. The iterations enable us to develop a non-supervised learning process and to obtain a set of genome-specific parameters for the gene structure, before making the prediction of genes. Conclusion Results of extensive tests show that MED 2.0 achieves a competitive high performance in the gene prediction for both 5' and 3' end matches, compared to the current best prokaryotic gene finders. The advantage of the MED 2.0 is particularly evident for GC-rich genomes and archaeal genomes. Furthermore, the genome-specific parameters given by MED 2.0 match with the current understanding of prokaryotic genomes and may serve as tools for comparative genomic studies. In particular, MED 2.0 is shown to reveal divergent translation initiation mechanisms in archaeal genomes while making a more accurate prediction of TISs compared to the existing gene finders and the current GenBank annotation.

  2. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; van der Horst, Gijsbertus T. J.; Szegedi, Andrea; Horkay, Irén; Emri, Gabriella; Karikó, Katalin; Remenyik, Éva

    2015-01-01

    Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs), the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA) encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK) blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases. PMID:26121660

  3. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA.

    Directory of Open Access Journals (Sweden)

    Gábor Boros

    Full Text Available Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs, the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases.

  4. Phylogenetic Diversity and Spatial Distribution of the Microbial Community Associated with the Caribbean Deep-water Sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA Gene Analysis

    OpenAIRE

    Meyer, Birte; Kuever, Jan

    2008-01-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species...

  5. Predicting RNA-RNA Interactions Using RNAstructure.

    Science.gov (United States)

    DiChiacchio, Laura; Mathews, David H

    2016-01-01

    RNA-RNA binding is a required step for many regulatory and catalytic processes in the cell. Identifying RNA-RNA hybridization sites is challenging because of the competition between intramolecular and intermolecular structure formation. A complete picture of RNA-RNA binding includes an understanding of single-stranded folding and binding site accessibility, and is strongly concentration-dependent. This chapter provides guidance for using RNAstructure to predict RNA-RNA binding sites and RNA-RNA structures, utilizing free energy minimization and partition function calculations. RNAstructure is freely available at http://rna.urmc.rochester.edu/RNAstructure.html . PMID:27665592

  6. Archaeal and bacterial tetraether lipids in tropical ponds with contrasted salinity (Guadeloupe, French West Indies): Implications for tetraether-based environmental proxies

    OpenAIRE

    Huguet, Arnaud; Grossi, Vincent; Belmahdi, Imène; Fosse, Céline; Derenne, Sylvie

    2015-01-01

    International audience The occurrence and distribution of archaeal and bacterial glycerol dialkyl glycerol tetraether lipids (GDGTs) in continental saline environments have been rarely investigated. Here, the abundance and distribution of archaeal isoprenoid GDGTs (iGDGTs) and archaeol, and of bacterial branched GDGTs (brGDGTs) in four tropical water ponds of contrasting salinity in two islands from the French Western Indies, Grande-Terre and La Désirade, have been determined. The sediment...

  7. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs

    OpenAIRE

    Frade, Pedro R.; Katharina Roll; Kristin Bergauer; Herndl, Gerhard J.

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP) and ...

  8. The Cm56 tRNA modification in archaea is catalyzed either by a specific 2′-O-methylase, or a C/D sRNP

    Science.gov (United States)

    RENALIER, MARIE-HÉLÈNE; JOSEPH, NICOLE; GASPIN, CHRISTINE; THEBAULT, PATRICIA; MOUGIN, ANNIE

    2005-01-01

    We identified the first archaeal tRNA ribose 2′-O-methylase, aTrm56, belonging to the Cluster of Orthologous Groups (COG) 1303 that contains archaeal genes only. The corresponding protein exhibits a SPOUT S-adenosylmethionine (AdoMet)-dependent methyltransferase domain found in bacterial and yeast G18 tRNA 2′-O-methylases (SpoU, Trm3). We cloned the Pyrococcus abyssi PAB1040 gene belonging to this COG, expressed and purified the corresponding protein, and showed that in vitro, it specifically catalyzes the AdoMet-dependent 2′-O-ribose methylation of C at position 56 in tRNA transcripts. This tRNA methylation is present only in archaea, and the gene for this enzyme is present in all the archaeal genomes sequenced up to now, except in the crenarchaeon Pyrobaculum aerophilum. In this archaea, the C56 2′-O-methylation is provided by a C/D sRNP. Our work is the first demonstration that, within the same kingdom, two different mechanisms are used to modify the same nucleoside in tRNAs. PMID:15987815

  9. Responses of bacterial and archaeal communities to nitrate stimulation after oil pollution in mangrove sediment revealed by Illumina sequencing.

    Science.gov (United States)

    Wang, Lei; Huang, Xu; Zheng, Tian-Ling

    2016-08-15

    This study aimed to investigate microbial responses to nitrate stimulation in oiled mangrove mesocosm. Both supplementary oil and nitrate changed the water and sediment chemical properties contributing to the shift of microbial communities. Denitrifying genes nirS and nirK were increased several times by the interaction of oil spiking and nitrate addition. Bacterial chao1 was reduced by oil spiking and further by nitrate stimulation, whereas archaeal chao1 was only inhibited by oil pollution on early time. Sampling depth explained most of variation and significantly impacted bacterial and archaeal communities, while oil pollution only significantly impacted bacterial communities (pexplaining less variation, nitrate addition coupled with oil spiking enhanced the growth of hydrocarbon degraders in mangrove. The findings demonstrate the impacts of environmental factors and their interactions in shaping microbial communities during nitrate stimulation. Our study suggests introducing genera Desulfotignum and Marinobacter into oiled mangrove for bioaugmentation. PMID:27262497

  10. Responses of bacterial and archaeal communities to nitrate stimulation after oil pollution in mangrove sediment revealed by Illumina sequencing.

    Science.gov (United States)

    Wang, Lei; Huang, Xu; Zheng, Tian-Ling

    2016-08-15

    This study aimed to investigate microbial responses to nitrate stimulation in oiled mangrove mesocosm. Both supplementary oil and nitrate changed the water and sediment chemical properties contributing to the shift of microbial communities. Denitrifying genes nirS and nirK were increased several times by the interaction of oil spiking and nitrate addition. Bacterial chao1 was reduced by oil spiking and further by nitrate stimulation, whereas archaeal chao1 was only inhibited by oil pollution on early time. Sampling depth explained most of variation and significantly impacted bacterial and archaeal communities, while oil pollution only significantly impacted bacterial communities (poil spiking enhanced the growth of hydrocarbon degraders in mangrove. The findings demonstrate the impacts of environmental factors and their interactions in shaping microbial communities during nitrate stimulation. Our study suggests introducing genera Desulfotignum and Marinobacter into oiled mangrove for bioaugmentation.

  11. Non-extremophilic 'extremophiles' - Archaeal dominance in the subsurface and their implication for life

    Science.gov (United States)

    Reitschuler, Christoph; Lins, Philipp; Illmer, Paul

    2014-05-01

    Archaea - besides bacteria and eukaryota constituting the third big domain of life - were so far regarded as typical inhabitants of extreme environments, as indicated by the name (Archaeon, Greek: 'original', 'primal'). Previous research and cultivation successes were basically carried out in habitats characterized by extreme temperature, pH and salinity regimes. Such extreme conditions, as expected at the beginning of the Earth's evolution, are occasionally also prevalent on extraterrestrial planets and moons and make the Archaeal domain a key group to be studied concerning life's evolution and the most likely pioneer organisms to colonize environments that are regarded as hostile. However, in recent years it became obvious that Archaea, in particular non-extremophilic species, can be found almost ubiquitously in marine, freshwater, terrestrial and also subsurface habitats and occasionally outnumber other microbial domains and hold key positions in globally relevant energy and nutrient cycles. Besides extreme environments - the big question remains how to define a parameter as extreme - subsurface and cave environments present a window to the past, where adaptions to early life's conditions can be studied and how microbiomes may be structured in a habitat that represents a refugium on extraterrestrial celestial bodies, were surface conditions might be at first sight too extreme for life. The lower part of the alpine Hundsalm cave in Tyrol (Austria) offered a unique opportunity to study an almost pristine cave habitat, which is separated from the touristic part of the ice cave. The main focus of our research was laid on the microbial communities that were supposed to be in connection with secondary carbonate precipitations ('moonmilk'). For the ascertainment of these so far poorly evaluated structures a multiple approach assessment was chosen to generate a virtually complete picture of these subsurface microbiomes. Thereby, a combination of different cultivation

  12. tRNAfeature: An algorithm for tRNA features to identify tRNA genes in DNA sequences.

    Science.gov (United States)

    Yang, Cheng-Hong; Lin, Yu-Da; Chuang, Li-Yeh

    2016-09-01

    The identification of transfer RNAs (tRNAs) is critical for a detailed understanding of the evolution of biological organisms and viruses. However, some tRNAs are difficult to recognize due to their unusual sub-structures and may result in the detection of the wrong anticodon. Therefore, the detection of unusual sub-structures of tRNA genes remains an important challenge. In this study, we propose a method to identify tRNA genes based on tRNA features. tRNAfeature attempts to refold the sequence with single-stranded regions longer than those found in the canonical and conventional structural models for tRNA. We predicted a set of 53926 archaeal, eubacterial and eukaryotic tRNA genes annotated in tRNADB-CE and scanned the tRNA genes in whole genome sequencing. The results indicate that tRNAfeature is more powerful than other existing methods for identifying tRNAs. PMID:27291467

  13. Archaeal tetraether membrane lipid fluxes in the northeastern Pacific and the Arabian Sea: implications for TEX86 paleothermometry

    OpenAIRE

    Wuchter, C.; Schouten, S.; Wakeham, S.G.; Sinninghe Damsté, J.S.

    2006-01-01

    The newly introduced temperature proxy, the tetraether index of archaeal lipids with 86 carbon atoms (TEX86), is based on the number of cyclopentane moieties in the glycerol dialkyl glycerol tetraether (GDGT) lipids of marine Crenarchaeota. The composition of sedimentary GDGTs used for TEX86 paleothermometry is thought to reflect sea surface temperature (SST). However, marine Crenarchaeota occur ubiquitously in the world oceans over the entire depth range and not just in surface waters. We an...

  14. Archaeal and bacterial community dynamics and bioprocess performance of a bench-scale two-stage anaerobic digester.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Garcia-Ruiz, Maria Jesus; Rodriguez-Sanchez, Alejandro; Osorio, Francisco; Gonzalez-Lopez, Jesus

    2016-07-01

    Two-stage technologies have been developed for anaerobic digestion of waste-activated sludge. In this study, the archaeal and bacterial community structure dynamics and bioprocess performance of a bench-scale two-stage anaerobic digester treating urban sewage sludge have been studied by the means of high-throughput sequencing techniques and physicochemical parameters such as pH, dried sludge, volatile dried sludge, acid concentration, alkalinity, and biogas generation. The coupled analyses of archaeal and bacterial communities and physicochemical parameters showed a direct relationship between archaeal and bacterial populations and bioprocess performance during start-up and working operation of a two-stage anaerobic digester. Moreover, results demonstrated that archaeal and bacterial community structure was affected by changes in the acid/alkalinity ratio in the bioprocess. Thus, a predominance of the acetoclastic methanogen Methanosaeta was observed in the methanogenic bioreactor at high-value acid/alkaline ratio, while a predominance of Methanomassilicoccaeceae archaea and Methanoculleus genus was observed in the methanogenic bioreactor at low-value acid/alkaline ratio. Biodiversity tag-iTag sequencing studies showed that methanogenic archaea can be also detected in the acidogenic bioreactor, although its biological activity was decreased after 4 months of operation as supported by physicochemical analyses. Also, studies of the VFA producers and VFA consumers microbial populations showed as these microbiota were directly affected by the physicochemical parameters generated in the bioreactors. We suggest that the results obtained in our study could be useful for future implementations of two-stage anaerobic digestion processes at both bench- and full-scale. PMID:26940050

  15. Identification and genomic analysis of transcription factors in archaeal genomes exemplifies their functional architecture and evolutionary origin.

    Science.gov (United States)

    Pérez-Rueda, Ernesto; Janga, Sarath Chandra

    2010-06-01

    Archaea, which represent a large fraction of the phylogenetic diversity of organisms, are prokaryotes with eukaryote-like basal transcriptional machinery. This organization makes the study of their DNA-binding transcription factors (TFs) and their transcriptional regulatory networks particularly interesting. In addition, there are limited experimental data regarding their TFs. In this work, 3,918 TFs were identified and exhaustively analyzed in 52 archaeal genomes. TFs represented less than 5% of the gene products in all the studied species comparable with the number of TFs identified in parasites or intracellular pathogenic bacteria, suggesting a deficit in this class of proteins. A total of 75 families were identified, of which HTH_3, AsnC, TrmB, and ArsR families were universally and abundantly identified in all the archaeal genomes. We found that archaeal TFs are significantly small compared with other protein-coding genes in archaea as well as bacterial TFs, suggesting that a large fraction of these small-sized TFs could supply the probable deficit of TFs in archaea, by possibly forming different combinations of monomers similar to that observed in eukaryotic transcriptional machinery. Our results show that although the DNA-binding domains of archaeal TFs are similar to bacteria, there is an underrepresentation of ligand-binding domains in smaller TFs, which suggests that protein-protein interactions may act as mediators of regulatory feedback, indicating a chimera of bacterial and eukaryotic TFs' functionality. The analysis presented here contributes to the understanding of the details of transcriptional apparatus in archaea and provides a framework for the analysis of regulatory networks in these organisms.

  16. Insights into archaeal evolution and symbiosis from the genomes of a Nanoarchaeon and its crenarchaeal host from Yellowstone National Park

    Energy Technology Data Exchange (ETDEWEB)

    Podar, Mircea [ORNL; Graham, David E [ORNL; Reysenbach, Anna-Louise [Portland State University; Koonin, Eugene [National Center for Biotechnology Information; Wolf, Yuri [National Center for Biotechnology Information; Makarova, Kira S. [National Center for Biotechnology Information

    2013-01-01

    A hyperthemophilic member of the Nanoarchaeota from Obsidian Pool, a thermal feature in Yellowstone National Park was characterized using single cell isolation and sequencing, together with its putative host, a Sulfolobales archaeon. This first representative of a non-marine Nanoarchaeota (Nst1) resembles Nanoarchaeum equitans by lacking most biosynthetic capabilities, the two forming a deep-branching archaeal lineage. However, the Nst1 genome is over 20% larger, encodes a complete gluconeogenesis pathway and a full complement of archaeal flagellum proteins. Comparison of the two genomes suggests that the marine and terrestrial Nanoarchaeota lineages share a common ancestor that was already a symbiont of another archaeon. With a larger genome, a smaller repertoire of split protein encoding genes and no split non-contiguous tRNAs, Nst1 appears to have experienced less severe genome reduction than N. equitans. The inferred host of Nst1 is potentially autotrophic, with a streamlined genome and simplified central and energetic metabolism as compared to other Sulfolobales. The two distinct Nanoarchaeota-host genomic data sets offer insights into the evolution of archaeal symbiosis and parasitism and will further enable studies of the cellular and molecular mechanisms of these relationships.

  17. Phylogenetic analysis of the archaeal community in an alkaline-saline soil of the former lake Texcoco (Mexico).

    Science.gov (United States)

    Valenzuela-Encinas, César; Neria-González, Isabel; Alcántara-Hernández, Rocio J; Enríquez-Aragón, J Arturo; Estrada-Alvarado, Isabel; Hernández-Rodríguez, César; Dendooven, Luc; Marsch, Rodolfo

    2008-03-01

    The soil of the former lake Texcoco is an extreme environment localized in the valley of Mexico City, Mexico. It is highly saline and alkaline, where Na+, Cl(-), HCO3(-) and CO3(2-) are the predominant ions, with a pH ranging from 9.8 to 11.7 and electrolytic conductivities in saturation extracts from 22 to 150 dS m(-1). Metagenomic DNA from the archaeal community was extracted directly from soil and used as template to amplify 16S ribosomal gene by PCR. PCR products were used to construct gene libraries. The ribosomal library showed that the archaeal diversity included Natronococcus sp., Natronolimnobius sp., Natronobacterium sp., Natrinema sp., Natronomonas sp., Halovivax sp., "Halalkalicoccus jeotgali" and novel clades within the family of Halobacteriaceae. Four clones could not be classified. It was found that the archaeal diversity in an alkaline-saline soil of the former lake Texcoco, Mexico, was low, but showed yet uncharacterized and unclassified species.

  18. Phylogenetic and functional analysis of metagenome sequence from high-temperature archaeal habitats demonstrate linkages between metabolic potential and geochemistry

    Directory of Open Access Journals (Sweden)

    William P. Inskeep

    2013-05-01

    Full Text Available Geothermal habitats in Yellowstone National Park (YNP provide an unparalled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (~40-45 Mbase Sanger sequencing per site was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G+C content and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH. These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high temperature systems of YNP.

  19. Biosynthesis of ribose-5-phosphate and erythrose-4-phosphate in archaea: a phylogenetic analysis of archaeal genomes

    Directory of Open Access Journals (Sweden)

    Tim Soderberg

    2005-01-01

    Full Text Available A phylogenetic analysis of the genes encoding enzymes in the pentose phosphate pathway (PPP, the ribulose monophosphate (RuMP pathway, and the chorismate pathway of aromatic amino acid biosynthesis, employing data from 13 complete archaeal genomes, provides a potential explanation for the enigmatic phylogenetic patterns of the PPP genes in archaea. Genomic and biochemical evidence suggests that three archaeal species (Methanocaldococcus jannaschii, Thermoplasma acidophilum and Thermoplasma volcanium produce ribose-5-phosphate via the nonoxidative PPP (NOPPP, whereas nine species apparently lack an NOPPP but may employ a reverse RuMP pathway for pentose synthesis. One species (Halobacterium sp. NRC-1 lacks both the NOPPP and the RuMP pathway but may possess a modified oxidative PPP (OPPP, the details of which are not yet known. The presence of transketolase in several archaeal species that are missing the other two NOPPP genes can be explained by the existence of differing requirements for erythrose-4-phosphate (E4P among archaea: six species use transketolase to make E4P as a precursor to aromatic amino acids, six species apparently have an alternate biosynthetic pathway and may not require the ability to make E4P, and one species (Pyrococcus horikoshii probably does not synthesize aromatic amino acids at all.

  20. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry.

    Science.gov (United States)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus J; Kozubal, Mark A; Rusch, Douglas B; Tringe, Susannah G; Macur, Richard E; Jennings, Ryan deM; Boyd, Eric S; Spear, John R; Roberto, Francisco F

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G + C content) and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport, and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH). These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high-temperature systems of YNP.

  1. Divergent responses of methanogenic archaeal communities in two rice cultivars to elevated ground-level O3.

    Science.gov (United States)

    Zhang, Jianwei; Tang, Haoye; Zhu, Jianguo; Lin, Xiangui; Feng, Youzhi

    2016-06-01

    Inhibitive effect of elevated ground-level ozone (O3) on paddy methane (CH4) emission varies with rice cultivars. However, little information is available on its microbial mechanism. For this purpose, the responses of methane-metabolizing microorganisms, methanogenic archaea and methanotrophic bacteria to O3 pollution were investigated in the O3-tolerant (YD6) and the O3-sensitive (IIY084) cultivars at two rice growth stages in Free Air Concentration Elevation of O3 (O3-FACE) system of China. It was found that O3 pollution didn't change the abundances of Type I and Type II methanotrophic bacteria at two rice stages. For methanogenic archaea, their abundances in both cultivars were decreased by O3 pollution at the tillering stage. Furthermore, a greater negative influence on methanogenic archaeal community was observed on IIY084 than on YD6: at tillering stage, the alpha diversity indices of methanogenic archaeal community in IIY084 was decreased to a greater extent than in YD6; IIY084 shifted methanogenic archaeal community composition and decreased the abundances and the diversities of Methanosarcinaceae and Methanosaetaceae as well as the abundance of Methanomicrobiales, while the diversity of Methanocellaceae were increased in YD6. These findings indicate that the variations in the responses of paddy CH4 emission to O3 pollution between cultivars could result from the divergent responses of their methanogenic archaea. PMID:26895536

  2. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  3. Phylogeny and Taxonomy of Archaea: A Comparison of the Whole-Genome-Based CVTree Approach with 16S rRNA Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Guanghong Zuo

    2015-03-01

    Full Text Available A tripartite comparison of Archaea phylogeny and taxonomy at and above the rank order is reported: (1 the whole-genome-based and alignment-free CVTree using 179 genomes; (2 the 16S rRNA analysis exemplified by the All-Species Living Tree with 366 archaeal sequences; and (3 the Second Edition of Bergey’s Manual of Systematic Bacteriology complemented by some current literature. A high degree of agreement is reached at these ranks. From the newly proposed archaeal phyla, Korarchaeota, Thaumarchaeota, Nanoarchaeota and Aigarchaeota, to the recent suggestion to divide the class Halobacteria into three orders, all gain substantial support from CVTree. In addition, the CVTree helped to determine the taxonomic position of some newly sequenced genomes without proper lineage information. A few discrepancies between the CVTree and the 16S rRNA approaches call for further investigation.

  4. Plant nitrogen-use strategy as a driver of rhizosphere archaeal and bacterial ammonia oxidiser abundance.

    Science.gov (United States)

    Thion, Cécile E; Poirel, Jessica D; Cornulier, Thomas; De Vries, Franciska T; Bardgett, Richard D; Prosser, James I

    2016-07-01

    The influence of plants on archaeal (AOA) and bacterial (AOB) ammonia oxidisers (AO) is poorly understood. Higher microbial activity in the rhizosphere, including organic nitrogen (N) mineralisation, may stimulate both groups, while ammonia uptake by plants may favour AOA, considered to prefer lower ammonia concentration. We therefore hypothesised (i) higher AOA and AOB abundances in the rhizosphere than bulk soil and (ii) that AOA are favoured over AOB in the rhizosphere of plants with an exploitative strategy and high N demand, especially (iii) during early growth, when plant N uptake is higher. These hypotheses were tested by growing 20 grassland plants, covering a spectrum of resource-use strategies, and determining AOA and AOB amoA gene abundances, rhizosphere and bulk soil characteristics and plant functional traits. Joint Bayesian mixed models indicated no increase in AO in the rhizosphere, but revealed that AOA were more abundant in the rhizosphere of exploitative plants, mostly grasses, and less abundant under conservative plants. In contrast, AOB abundance in the rhizosphere and bulk soil depended on pH, rather than plant traits. These findings provide a mechanistic basis for plant-ammonia oxidiser interactions and for links between plant functional traits and ammonia oxidiser ecology.

  5. Cooperative adsorption of critical metal ions using archaeal poly-γ-glutamate.

    Science.gov (United States)

    Hakumai, Yuichi; Oike, Shota; Shibata, Yuka; Ashiuchi, Makoto

    2016-06-01

    Antimony, beryllium, chromium, cobalt (Co), gallium (Ga), germanium, indium (In), lithium, niobium, tantalum, the platinoids, the rare-earth elements (including dysprosium, Dy), and tungsten are generally regarded to be critical (rare) metals, and the ions of some of these metals are stabilized in acidic solutions. We examined the adsorption capacities of three water-soluble functional polymers, namely archaeal poly-γ-glutamate (L-PGA), polyacrylate (PAC), and polyvinyl alcohol (PVA), for six valuable metal ions (Co(2+), Ni(2+), Mn(2+), Ga(3+), In(3+), and Dy(3+)). All three polymers showed apparently little or no capacity for divalent cations, whereas L-PGA and PAC showed the potential to adsorb trivalent cations, implying the beneficial valence-dependent selectivity of anionic polyelectrolytes with multiple carboxylates for metal ions. PVA did not adsorb metal ions, indicating that the crucial role played by carboxyl groups in the adsorption of crucial metal ions cannot be replaced by hydroxyl groups under the conditions. In addition, equilibrium studies using the non-ideal competitive adsorption model indicated that the potential for L-PGA to be used for the removal (or collection) of water-soluble critical metal ions (e.g., Ga(3+), In(3+), and Dy(3+)) was far superior to that of any other industrially-versatile PAC materials. PMID:27013333

  6. Plant nitrogen-use strategy as a driver of rhizosphere archaeal and bacterial ammonia oxidiser abundance.

    Science.gov (United States)

    Thion, Cécile E; Poirel, Jessica D; Cornulier, Thomas; De Vries, Franciska T; Bardgett, Richard D; Prosser, James I

    2016-07-01

    The influence of plants on archaeal (AOA) and bacterial (AOB) ammonia oxidisers (AO) is poorly understood. Higher microbial activity in the rhizosphere, including organic nitrogen (N) mineralisation, may stimulate both groups, while ammonia uptake by plants may favour AOA, considered to prefer lower ammonia concentration. We therefore hypothesised (i) higher AOA and AOB abundances in the rhizosphere than bulk soil and (ii) that AOA are favoured over AOB in the rhizosphere of plants with an exploitative strategy and high N demand, especially (iii) during early growth, when plant N uptake is higher. These hypotheses were tested by growing 20 grassland plants, covering a spectrum of resource-use strategies, and determining AOA and AOB amoA gene abundances, rhizosphere and bulk soil characteristics and plant functional traits. Joint Bayesian mixed models indicated no increase in AO in the rhizosphere, but revealed that AOA were more abundant in the rhizosphere of exploitative plants, mostly grasses, and less abundant under conservative plants. In contrast, AOB abundance in the rhizosphere and bulk soil depended on pH, rather than plant traits. These findings provide a mechanistic basis for plant-ammonia oxidiser interactions and for links between plant functional traits and ammonia oxidiser ecology. PMID:27130939

  7. Geographic Distribution of Archaeal Ammonia Oxidizing Ecotypes in the Atlantic Ocean.

    Science.gov (United States)

    Sintes, Eva; De Corte, Daniele; Haberleitner, Elisabeth; Herndl, Gerhard J

    2016-01-01

    In marine ecosystems, Thaumarchaeota are most likely the major ammonia oxidizers. While ammonia concentrations vary by about two orders of magnitude in the oceanic water column, archaeal ammonia oxidizers (AOA) vary by only one order of magnitude from surface to bathypelagic waters. Thus, the question arises whether the key enzyme responsible for ammonia oxidation, ammonia monooxygenase (amo), exhibits different affinities to ammonia along the oceanic water column and consequently, whether there are different ecotypes of AOA present in the oceanic water column. We determined the abundance and phylogeny of AOA based on their amoA gene. Two ecotypes of AOA exhibited a distribution pattern reflecting the reported availability of ammonia and the physico-chemical conditions throughout the Atlantic, and from epi- to bathypelagic waters. The distinction between these two ecotypes was not only detectable at the nucleotide level. Consistent changes were also detected at the amino acid level. These changes include substitutions of polar to hydrophobic amino acid, and glycine substitutions that could have an effect on the configuration of the amo protein and thus, on its activity. Although we cannot identify the specific effect, the ratio of non-synonymous to synonymous substitutions (dN/dS) between the two ecotypes indicates a strong positive selection between them. Consequently, our results point to a certain degree of environmental selection on these two ecotypes that have led to their niche specialization. PMID:26903961

  8. Potential radiocarbon chronology tool using archaeal tetraether lipids for the western Arctic Ocean sediment

    Science.gov (United States)

    Uchida, M.; Kondo, M.; Utsumi, M.; Shibata, Y.

    2011-12-01

    The Arctic Ocean plays a major role in global climate changes by changing global energy balance through ice-albedo feedback and by affecting the oceanic thermohaline circulation through the water exchange with the Atlantic and Pacific Ocean. For future prediction of those changes in Arctic Ocean it is necessary to reconstruct details of past climate history with accurate age model. However, it is not easy to make age model of sediment cores covering late Pleistocene-Holocene transition including global abrupt climate change because preservation of carbonate fossil such as planktonic foraminifera is very limited. In the glacial time, foraminifera is almost barren. Thus, so far climate history in the Arctic Ocean environment is poorly understood. For these reasons, we are looking for alternative chronological target instead of foraminifera. In this study, radiocarbon contents of archaeal glycerol dibiphytanyl glycerol tetraether lipids (GDGTs) from Arctic surface sediments, which is also used for paleothermometry, were measured and compared with those of dissolved inorganic carbon (DIC) of sea water, planktonic and benthic foraminifera, shell, and bulk organic matter in the same horizons. We will discuss potential as chronology using the GDGTs and carbon sources of these compounds.

  9. Crystal structure of the flagellar accessory protein FlaH of Methanocaldococcus jannaschii suggests a regulatory role in archaeal flagellum assembly.

    Science.gov (United States)

    Meshcheryakov, Vladimir A; Wolf, Matthias

    2016-06-01

    Archaeal flagella are unique structures that share functional similarity with bacterial flagella, but are structurally related to bacterial type IV pili. The flagellar accessory protein FlaH is one of the conserved components of the archaeal motility system. However, its function is not clearly understood. Here, we present the 2.2 Å resolution crystal structure of FlaH from the hyperthermophilic archaeon, Methanocaldococcus jannaschii. The protein has a characteristic RecA-like fold, which has been found previously both in archaea and bacteria. We show that FlaH binds to immobilized ATP-however, it lacks ATPase activity. Surface plasmon resonance analysis demonstrates that ATP affects the interaction between FlaH and the archaeal motor protein FlaI. In the presence of ATP, the FlaH-FlaI interaction becomes significantly weaker. A database search revealed similarity between FlaH and several DNA-binding proteins of the RecA superfamily. The closest structural homologs of FlaH are KaiC-like proteins, which are archaeal homologs of the circadian clock protein KaiC from cyanobacteria. We propose that one of the functions of FlaH may be the regulation of archaeal motor complex assembly. PMID:27060465

  10. CoBaltDB: Complete bacterial and archaeal orfeomes subcellular localization database and associated resources

    Directory of Open Access Journals (Sweden)

    Lucchetti-Miganeh Céline

    2010-03-01

    Full Text Available Abstract Background The functions of proteins are strongly related to their localization in cell compartments (for example the cytoplasm or membranes but the experimental determination of the sub-cellular localization of proteomes is laborious and expensive. A fast and low-cost alternative approach is in silico prediction, based on features of the protein primary sequences. However, biologists are confronted with a very large number of computational tools that use different methods that address various localization features with diverse specificities and sensitivities. As a result, exploiting these computer resources to predict protein localization accurately involves querying all tools and comparing every prediction output; this is a painstaking task. Therefore, we developed a comprehensive database, called CoBaltDB, that gathers all prediction outputs concerning complete prokaryotic proteomes. Description The current version of CoBaltDB integrates the results of 43 localization predictors for 784 complete bacterial and archaeal proteomes (2.548.292 proteins in total. CoBaltDB supplies a simple user-friendly interface for retrieving and exploring relevant information about predicted features (such as signal peptide cleavage sites and transmembrane segments. Data are organized into three work-sets ("specialized tools", "meta-tools" and "additional tools". The database can be queried using the organism name, a locus tag or a list of locus tags and may be browsed using numerous graphical and text displays. Conclusions With its new functionalities, CoBaltDB is a novel powerful platform that provides easy access to the results of multiple localization tools and support for predicting prokaryotic protein localizations with higher confidence than previously possible. CoBaltDB is available at http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software/cobalten.

  11. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    OpenAIRE

    Sintes, Eva; Bergauer, Kristin; de Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotypes of marine Crenarchaeota Group I (MCGI) were detected in the waters of the tropical Atlantic and the coastal Arctic. The HAC-AOA ecotype (high ammonia concentration AOA) was ≍ 8000 times and 15 ti...

  12. Dark matter in archaeal genomes: a rich source of novel mobile elements, defense systems and secretory complexes.

    Science.gov (United States)

    Makarova, Kira S; Wolf, Yuri I; Forterre, Patrick; Prangishvili, David; Krupovic, Mart; Koonin, Eugene V

    2014-09-01

    Microbial genomes encompass a sizable fraction of poorly characterized, narrowly spread fast-evolving genes. Using sensitive methods for sequences comparison and protein structure prediction, we performed a detailed comparative analysis of clusters of such genes, which we denote "dark matter islands", in archaeal genomes. The dark matter islands comprise up to 20% of archaeal genomes and show remarkable heterogeneity and diversity. Nevertheless, three classes of entities are common in these genomic loci: (a) integrated viral genomes and other mobile elements; (b) defense systems, and (c) secretory and other membrane-associated systems. The dark matter islands in the genome of thermophiles and mesophiles show similar general trends of gene content, but thermophiles are substantially enriched in predicted membrane proteins whereas mesophiles have a greater proportion of recognizable mobile elements. Based on this analysis, we predict the existence of several novel groups of viruses and mobile elements, previously unnoticed variants of CRISPR-Cas immune systems, and new secretory systems that might be involved in stress response, intermicrobial conflicts and biogenesis of novel, uncharacterized membrane structures.

  13. Temperature and pH dependence of DNA ejection from archaeal lemon-shaped virus His1.

    Science.gov (United States)

    Hanhijärvi, K J; Ziedaite, G; Hæggström, E; Bamford, D H

    2016-07-01

    The archaeal virus His1 isolated from a hypersaline environment infects an extremely halophilic archaeon Haloarcula hispanica. His1 features a lemon-shaped capsid, which is so far found only in archaeal viruses. This unique capsid can withstand high salt concentrations, and can transform into a helical tube, which in turn is resistant to extremely harsh conditions. Hypersaline environments exhibit a wide range of temperatures and pH conditions, which present an extra challenge to their inhabitants. We investigated the influence of pH and temperature on DNA ejection from His1 virus using single-molecule fluorescence experiments. The observed number of ejecting viruses is constant in pH 5 to 9, while the ejection process is suppressed at pH below 5. Similarly, the number of ejections within 15-42 °C shows only a minor increase around 25-37 °C. The maximum velocity of single ejected DNA increases with temperature, in qualitative agreement with the continuum model of dsDNA ejection. PMID:26820561

  14. Comparative Analysis of 16S rRNA and amoA Genes from Archaea Selected with Organic and Inorganic Amendments in Enrichment Culture

    OpenAIRE

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Holly M Simon

    2012-01-01

    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the “root” clade, we detected no corresponding amoA gene. The amoA-contai...

  15. Defining Optimized Properties of Modified mRNA to Enhance Virus- and DNA- Independent Protein Expression in Adult Stem Cells and Fibroblasts

    Directory of Open Access Journals (Sweden)

    Frauke Hausburg

    2015-02-01

    Full Text Available Background: By far, most strategies for cell reprogramming and gene therapy are based on the introduction of DNA after viral delivery. To avoid the high risks accompanying these goals, non-viral and DNA-free delivery methods for various cell types are required. Methods: Relying on an initially established PCR-based protocol for convenient template DNA production, we synthesized five differently modified EGFP mRNA (mmRNA species, incorporating various degrees of 5-methylcytidine-5'-triphosphate (5mC and pseudouridine-5'-triphosphate (Ψ. We then investigated their effect on i protein expression efficiencies and ii cell viability for human mesenchymal stem cells (hMSCs and fibroblasts from different origins. Results: Our protocol allows highly efficient mmRNA production in vitro, enabling rapid and stable protein expression after cell transfection. However, our results also demonstrate that the terminally optimal modification needs to be defined in pilot experiments for each particular cell type. Transferring our approach to the conversion of fibroblasts into skeletal myoblasts using mmRNA encoding MyoD, we confirm the huge potential of mmRNA based protein expression for virus- and DNA-free reprogramming strategies. Conclusion: The achieved high protein expression levels combined with good cell viability not only in fibroblasts but also in hMSCs provides a promising option for mmRNA based modification of various cell types including slowly proliferating adult stem cells. Therefore, we are confident that our findings will substantially contribute to the improvement of efficient cell reprogramming and gene therapy approaches.

  16. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    OpenAIRE

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restrict...

  17. Characterization of the archaeal ribonuclease P proteins from Pyrococcus horikoshii OT3.

    Science.gov (United States)

    Terada, Atsushi; Honda, Takashi; Fukuhara, Hideo; Hada, Kazumasa; Kimura, Makoto

    2006-08-01

    Ribonuclease P (RNase P) is a ribonucleoprotein complex involved in the processing of the 5'-leader sequence of precursor tRNA (pre-tRNA). Our earlier study revealed that RNase P RNA (pRNA) and five proteins (PhoPop5, PhoRpp38, PhoRpp21, PhoRpp29, and PhoRpp30) in the hyperthermophilic archaeon Pyrococcus horikoshii OT3 reconstituted RNase P activity that exhibits enzymatic properties like those of the authentic enzyme. In present study, we investigated involvement of the individual proteins in RNase P activity. Two particles (R-3Ps), in which pRNA was mixed with three proteins, PhoPop5, PhoRpp30, and PhoRpp38 or PhoPop5, PhoRpp30, and PhoRpp21 showed a detectable RNase P activity, and five reconstituted particles (R-4Ps) composed of pRNA and four proteins exhibited RNase P activity, albeit at reduced level compared to that of the reconstituted particle (R-5P) composed of pRNA and five proteins. Time-course analysis of the RNase P activities of R-4Ps indicated that the R-4Ps lacking PhoPop5, PhoRpp21, or PhoRpp30 had virtually reduced activity, while omission of PhoRpp29 or PhoRpp38 had a slight effect on the activity. The results indicate that the proteins contribute to RNase P activity in order of PhoPop5 > PhoRpp30 > PhoRpp21 > PhoRpp29 > PhoRpp38. It was further found that R-4Ps showed a characteristic Mg2+ ion dependency approximately identical to that of R-5P. However, R-4Ps had optimum temperature of around at 55 degrees C which is lower than 70 degrees C for R-5P. Together, it is suggested that the P. horikoshii RNase P proteins are predominantly involved in optimization of the pRNA conformation, though they are individually dispensable for RNase P activity in vitro.

  18. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards%不同肥料处理下茶园土壤细菌和古菌群落的时间变化研究

    Institute of Scientific and Technical Information of China (English)

    Hua WANG; Shao-hui YANG; Jing-ping YANG; Ya-min LV; Xing ZHAO; Ji-liang PANG

    2014-01-01

    研究目的:研究化学肥料和有机肥处理条件下,茶园酸性土壤细菌和古菌群落结构,以及氮素转化相关功能酶基因丰度的时间变化规律。  创新要点:研究肥料、土壤温度及土壤含水量对茶园酸性土壤细菌和古菌群落结构,以及氮素转化相关功能酶基因丰度的影响。  研究方法:应用末端限制性片段长度多态性(T-RFLP)技术分析茶园酸性土壤中细菌和古菌群落结构随时间的变化规律,应用荧光定量聚合酶链式反应(PCR)技术,研究茶园酸性土壤细菌、古菌、硝化作用功能酶基因(细菌和古菌amoA基因)和细菌反硝化作用功能酶基因(narG、nirK、nirS和nosZ基因)丰度的时间变化规律。  重要结论:茶园土壤细菌和古菌群落结构受到肥料的影响,并随着取样时间有显著的变化。细菌、古菌和古菌的amoA基因的丰度在7月份最小,而细菌的amoA基因和反硝化作用功能酶基因(除nirK基因)的丰度在9月份最小。有机肥处理增加了细菌、古菌和氮素转化相关功能酶基因的丰度,但化学肥料的施用对菌群及功能酶基因丰度的影响较小。土壤温度显著影响了土壤细菌和古菌的群落结构。土壤含水量与细菌反硝化作用功能酶基因有显著的相关性。土壤有机碳含量与细菌、古菌及功能酶基因丰度之间有显著的相关性。%It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total

  19. Extracellular RNA Communication (ExRNA)

    Data.gov (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  20. Pseudouridylation of helix 69 of 23S rRNA is necessary for an effective translation termination

    DEFF Research Database (Denmark)

    Ejby, Morten; Sørensen, Michael A; Pedersen, Steen

    2007-01-01

    Escherichia coli strains with inactivated rluD genes were previously found to lack the conserved pseudouridines in helix 69 of 23S ribosomal RNA and to grow slowly. A suppressor mutant was isolated with a near normal growth rate that had changed the conserved Glu-172 codon to a Lys codon in prf......B, encoding translation termination factor RF2. When nonsense suppression in strains with all combinations of prfB(+)/prfB(E172K) and rluD(+)/rluD::cat was analyzed, misreading of all three stop codons as sense codons was found to be increased by rluD inactivation: Nonsense suppression was increased 2-fold...... at UAG codons, 9-fold at UAA, and 14-fold at UGA. The increased read-through at UGA corresponds to reading UGA as a sense codon in 30% of the cases. In contrast, the accuracy of reading sense codons appeared unaffected by loss of rluD. When the inactivated rluD gene was combined with the altered prf...

  1. Distribution of bacterial and archaeal ether lipids in soils and surface sediments of Tibetan lakes: Implications for GDGT-based proxies in saline high mountain lakes

    NARCIS (Netherlands)

    Günther, F.; Thiele, A.; Gleixner, G.; Xu, B.Q.; Yao, T.; Schouten, S.

    2014-01-01

    Bacterial and archaeal lipids, such as glycerol dialkyl glycerol tetraethers (GDGTs) and dialkyl glycerol diethers, are increasingly used as proxies for specific environmental parameters, such as air temperature and soil pH in lacustrine environments. Little is known, however, about the distribution

  2. Effect of supplementing coconut or krabok oil, rich in medium-chain fatty acids on ruminal fermentation, protozoa and archaeal population of bulls

    NARCIS (Netherlands)

    Panyakaew, P.; Boon, N.; Goel, G.; Yuangklang, C.; Schonewille, J.T.; Hendriks, W.H.; Fievez, V.

    2013-01-01

    Medium-chain fatty acids (MCFA), for example, capric acid (C10:0), myristic (C14:0) and lauric (C12:0) acid, have been suggested to decrease rumen archaeal abundance and protozoal numbers. This study aimed to compare the effect of MCFA, either supplied through krabok (KO) or coconut (CO) oil, on rum

  3. Combinatorics of RNA-RNA interaction

    DEFF Research Database (Denmark)

    Li, Thomas J X; Reidys, Christian

    2012-01-01

    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure...

  4. Functional implication of archaeal homologues of human RNase P protein pair Pop5 and Rpp30.

    Science.gov (United States)

    Hamasaki, Masato; Hazeyama, Kohsuke; Iwasaki, Fumihiko; Ueda, Toshifumi; Nakashima, Takashi; Kakuta, Yoshimitsu; Kimura, Makoto

    2016-01-01

    PhoPop5 and PhoRpp30 in the hyperthermophilic archaeon Pyrococcus horikoshii, homologues of human ribonuclease P (RNase P) proteins hPop5 and Rpp30, respectively, fold into a heterotetramer [PhoRpp30-(PhoPop5)2-PhoRpp30], which plays a crucial role in the activation of RNase P RNA (PhopRNA). Here, we examined the functional implication of PhoPop5 and PhoRpp30 in the tetramer. Surface plasmon resonance (SPR) analysis revealed that the tetramer strongly interacts with an oligonucleotide including the nucleotide sequence of a stem-loop SL3 in PhopRNA. In contrast, PhoPop5 had markedly reduced affinity to SL3, whereas PhoRpp30 had little affinity to SL3. SPR studies of PhoPop5 mutants further revealed that the C-terminal helix (α4) in PhoPop5 functions as a molecular recognition element for SL3. Moreover, gel filtration indicated that PhoRpp30 exists as a monomer, whereas PhoPop5 is an oligomer in solution, suggesting that PhoRpp30 assists PhoPop5 in attaining a functionally active conformation by shielding hydrophobic surfaces of PhoPop5. These results, together with available data, allow us to generate a structural and mechanistic model for the PhopRNA activation by PhoPop5 and PhoRpp30, in which the two C-terminal helices (α4) of PhoPop5 in the tetramer whose formation is assisted by PhoRpp30 act as binding elements and bridge SL3 and SL16 in PhopRNA. PMID:26152732

  5. Diversity of Archaea in Icelandic hot springs based on 16S rRNA and chaperonin genes.

    Science.gov (United States)

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2011-07-01

    The diversity of archaeal communities growing in four hot springs (65-90 °C, pH 6.5) was assessed with 16S rRNA gene primers specific for the domain Archaea. Overall, mainly uncultured members of the Desulfurococcales, the Thermoproteales and the Korarchaeota, were identified. Based on this diversity, a set of chaperonin heat-shock protein (Hsp60) gene sequences from different archaeal species were aligned to design two degenerate primer sets for the amplification of the chaperonin gene: Ths and Kor (which can also detect the korarchaeotal chaperonin gene from one of the samples). A phylogenetic tree was constructed using the chaperonin sequences retrieved and other sequences from cultured representatives. The Alpha and Beta paralogs of the chaperonin gene were observed within the main clades and orthologs among them. Cultivated representatives from these clades were assigned to either paralog in the chaperonin tree. Uncultured representatives observed in the 16S rRNA gene analysis were found to be related to the Desulfurococcales. The topologies of the 16S rRNA gene and chaperonin phylogenetic trees were compared, and similar phylogenetic relationships were observed. Our results suggest that the chaperonin Hsp60 gene may be used as a phylogenetic marker for the clades found in this extreme environment.

  6. Plasmodium Apicoplast Gln-tRNA Gln Biosynthesis Utilizes a Unique GatAB Amidotransferase Essential for Erythrocytic Stage Parasites

    KAUST Repository

    Mailu, Boniface M.

    2015-08-28

    © 2015 by The American Society for Biochemistry and Molecular Biology, Inc. The malaria parasite Plasmodium falciparum apicoplast indirect aminoacylation pathway utilizes a non-discriminating glutamyl-tRNA synthetase to synthesize Glu-tRNAGln and a glutaminyl-tRNA amidotransferase to convert Glu-tRNAGln to Gln-tRNAGln. Here, we show that Plasmodium falciparum and other apicomplexans possess a unique heterodimeric glutamyltRNA amidotransferase consisting of GatA and GatB subunits (GatAB). We localized the P. falciparum GatA and GatB subunits to the apicoplast in blood stage parasites and demonstrated that recombinant GatAB converts Glu-tRNAGln to Gln-tRNAGln in vitro. We demonstrate that the apicoplast GatAB-catalyzed reaction is essential to the parasite blood stages because we could not delete the Plasmodium berghei gene encoding GatA in blood stage parasites in vivo. A phylogenetic analysis placed the split between Plasmodium GatB, archaeal GatE, and bacterial GatB prior to the phylogenetic divide between bacteria and archaea. Moreover, Plasmodium GatA also appears to have emerged prior to the bacterial-archaeal phylogenetic divide. Thus, although GatAB is found in Plasmodium, it emerged prior to the phylogenetic separation of archaea and bacteria.

  7. CRISPRstrand: predicting repeat orientations to determine the crRNA-encoding strand at CRISPR loci

    DEFF Research Database (Denmark)

    Alkhnbashi, Omer S.; Costa, Fabrizio; Shah, Shiraz Ali;

    2014-01-01

    Motivation: The discovery of CRISPR-Cas systems almost 20 years ago rapidly changed our perception of the bacterial and archaeal immune systems. CRISPR loci consist of several repetitive DNA sequences called repeats, inter-spaced by stretches of variable length sequences called spacers. This CRISPR...... array is transcribed and processed into multiple mature RNA species (crRNAs). A single crRNA is integrated into an interference complex, together with CRISPR-associated (Cas) proteins, to bind and degrade invading nucleic acids. Although existing bioinformatics tools can recognize CRISPR loci...... by their characteristic repeat-spacer architecture, they generally output CRISPR arrays of ambiguous orientation and thus do not determine the strand from which crRNAs are processed. Knowledge of the correct orientation is crucial for many tasks, including the classification of CRISPR conservation, the detection...

  8. Multiple archaeal groups mediate methane oxidation in anoxic cold seep sediments

    OpenAIRE

    Victoria J Orphan; House, Christopher H.; Hinrichs, Kai-Uwe; McKeegan, Kevin D.; DeLong, Edward F.

    2002-01-01

    No microorganism capable of anaerobic growth on methane as the sole carbon source has yet been cultivated. Consequently, information about these microbes has been inferred from geochemical and microbiological observations of field samples. Stable isotope analysis of lipid biomarkers and rRNA gene surveys have implicated specific microbes in the anaerobic oxidation of methane (AOM). Here we use combined fluorescent in situ hybridization and secondary ion mass spectrometry analyses, to identify...

  9. Preliminary crystallography confirms that the archaeal DNA-binding and tryptophan-sensing regulator TrpY is a dimer.

    Science.gov (United States)

    Cafasso, Jacquelyn; Manjasetty, Babu A; Karr, Elizabeth A; Sandman, Kathleen; Chance, Mark R; Reeve, John N

    2010-11-01

    TrpY regulates the transcription of the metabolically expensive tryptophan-biosynthetic operon in the thermophilic archaeon Methanothermobacter thermautotrophicus. TrpY was crystallized using the hanging-drop method with ammonium sulfate as the precipitant. The crystals belonged to the tetragonal space group P4(3)2(1)2 or P4(1)2(1)2, with unit-cell parameters a = b = 87, c = 147 Å, and diffracted to 2.9 Å resolution. The possible packing of molecules within the cell based on the values of the Matthews coefficient (V(M)) and analysis of the self-rotation function are consistent with the asymmetric unit being a dimer. Determining the structure of TrpY in detail will provide insight into the mechanisms of DNA binding, tryptophan sensing and transcription regulation at high temperature by this novel archaeal protein. PMID:21045304

  10. Preliminary Crystallography Confirms that the Archaeal DNA-binding and Tryptophan-sensing Regulator TrpY is a Dimer

    Energy Technology Data Exchange (ETDEWEB)

    J Cafasso; B Manjasetty; E Karr; K Sandman; M Chance; J Reeve

    2011-12-31

    TrpY regulates the transcription of the metabolically expensive tryptophan-biosynthetic operon in the thermophilic archaeon Methanothermobacter thermautotrophicus. TrpY was crystallized using the hanging-drop method with ammonium sulfate as the precipitant. The crystals belonged to the tetragonal space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 87, c = 147 {angstrom}, and diffracted to 2.9 {angstrom} resolution. The possible packing of molecules within the cell based on the values of the Matthews coefficient (V{sub M}) and analysis of the self-rotation function are consistent with the asymmetric unit being a dimer. Determining the structure of TrpY in detail will provide insight into the mechanisms of DNA binding, tryptophan sensing and transcription regulation at high temperature by this novel archaeal protein.

  11. A dimeric Rep protein initiates replication of a linear archaeal virus genome: implications for the Rep mechanism and viral replication

    DEFF Research Database (Denmark)

    Oke, Muse; Kerou, Melina; Liu, Huanting;

    2011-01-01

    The Rudiviridae are a family of rod-shaped archaeal viruses with covalently closed, linear double-stranded DNA (dsDNA) genomes. Their replication mechanisms remain obscure, although parallels have been drawn to the Poxviridae and other large cytoplasmic eukaryotic viruses. Here we report that a...... active-site tyrosine and the 5' end of the DNA, releasing a 3' DNA end as a primer for DNA synthesis. The enzyme can also catalyze the joining reaction that is necessary to reseal the DNA hairpin and terminate replication. The dimeric structure points to a simple mechanism through which two closely...... positioned active sites, each with a single tyrosine residue, work in tandem to catalyze DNA nicking and joining. We propose a novel mechanism for rudivirus DNA replication, incorporating the first known example of a Rep protein that is not linked to RCR. The implications for Rep protein function and viral...

  12. A shift in the archaeal nitrifier community in response to natural and anthropogenic disturbances in the northern Gulf of Mexico.

    Science.gov (United States)

    Newell, Silvia E; Eveillard, Damien; McCarthy, Mark J; Gardner, Wayne S; Liu, Zhanfei; Ward, Bess B

    2014-02-01

    The Gulf of Mexico is affected by hurricanes and suffers seasonal hypoxia. The Deepwater Horizon oil spill impacted every trophic level in the coastal region. Despite their importance in bioremediation and biogeochemical cycles, it is difficult to predict the responses of microbial communities to physical and anthropogenic disturbances. Here, we quantify sediment ammonia-oxidizing archaeal (AOA) community diversity, resistance and resilience, and important geochemical factors after major hurricanes and the oil spill. Dominant AOA archetypes correlated with different geochemical factors, suggesting that different AOA are constrained by distinct parameters. Diversity was lowest after the hurricanes, showing weak resistance to physical disturbances. However, diversity was highest during the oil spill and coincided with a community shift, suggesting a new alternative stable state sustained for at least 1 year. The new AOA community was not significantly different from that at the spill site 1 year after the spill. This sustained shift in nitrifier community structure may be a result of oil exposure. PMID:24596268

  13. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry

    DEFF Research Database (Denmark)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus;

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high......-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.......4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and...

  14. Spatial distribution of archaeal and bacterial ammonia oxidizers in the littoral buffer zone of a nitrogen-rich lake

    Institute of Scientific and Technical Information of China (English)

    Yu Wang; Guibing Zhu; Lei Ye; Xiaojuan Feng; Huub J. M. Op den Camp; Chengqing Yin

    2012-01-01

    The spatial distribution and diversity of archaeal and bacterial ammonia oxidizers (AOA and AOB) were evaluated targeting amoA genes in the gradient of a littoral buffer zone which has been identified as a hot spot for N cycling.Here we found high spatial heterogeneity in the nitrification rate and abundance of ammonia oxidizers in the five sampling sites.The bacterial amoA gene was numerically dominant in most of the surface soil but decreased dramatically in deep layers.Higher nitrification potentials were detected in two sites near the land/water interface at 4.4-6.1 μg NO2--N/(g dry weight soil.hr),while only 1.0-1.7 μg NO2- -N/(gdry weight soil·hr) was measured at other sites.The potential nitrification rates were proportional to the amoA gene abundance for AOB,hut with no significant correlation with AOA.The NH4+ concentration was the most determinative parameter for the abundance of AOB and potential nitrification rates in this study.Higher richness in the surface layer was found in the analysis of biodiversity.Phylogenetic analysis revealed that most of the bacterial amoA sequences in surface soil were affiliated with the genus of Nitrosopira while the archaeal sequences were almost equally affiliated with Candidatus ‘Nitrososphaera gargensis' and Candidatus ‘Nitrosoealdus yellowstonii'.The spatial distribution of AOA and AOB indicated that bacteria may play a more important role in nitrification in the littoral buffer zone of a N-rich lake.

  15. Crystallization and preliminary X-ray crystallographic analysis of bacterial tRNASec in complex with seryl-tRNA synthetase

    International Nuclear Information System (INIS)

    Bacterial selenocysteine tRNA was crystallized as the heterologous complex with archaeal seryl-tRNA synthetase. X-ray diffraction was improved by introducing point mutations and heavy-atom labeling, and a 3.2 Å diffraction data set for phase determination was obtained from a platinum-labeled crystal. Selenocysteine (Sec) is translationally incorporated into proteins in response to the UGA codon. The tRNA specific to Sec (tRNASec) is first ligated with serine by seryl-tRNA synthetase (SerRS). To elucidate the tertiary structure of bacterial tRNASec and its specific interaction with SerRS, the bacterial tRNASec from Aquifex aeolicus was crystallized as the heterologous complex with the archaeal SerRS from Methanopyrus kandleri. Although X-ray diffraction by crystals of tRNASec in complex with wild-type SerRS was rather poor (to 5.7 Å resolution), the resolution was improved by introducing point mutations targeting the crystal-packing interface. Heavy-atom labelling also contributed to resolution improvement. A 3.2 Å resolution diffraction data set for phase determination was obtained from a K2Pt(CN)4-soaked crystal

  16. Insights into the catalytic mechanism of 16S rRNA methyltransferase RsmE (m³U1498) from crystal and solution structures.

    Science.gov (United States)

    Zhang, Heng; Wan, Hua; Gao, Zeng-Qiang; Wei, Yong; Wang, Wen-Jia; Liu, Guang-Feng; Shtykova, Eleonora V; Xu, Jian-Hua; Dong, Yu-Hui

    2012-11-01

    RsmE is the founding member of a new RNA methyltransferase (MTase) family responsible for methylation of U1498 in 16S ribosomal RNA in Escherichia coli. It is well conserved across bacteria and plants and may play an important role in ribosomal intersubunit communication. The crystal structure in monomer showed that it consists of two distinct but structurally related domains: the PUA (pseudouridine synthases and archaeosine-specific transglycosylases)-like RNA recognition and binding domain and the conserved MTase domain with a deep trefoil knot. Analysis of small-angle X-ray scattering data revealed that RsmE forms a flexible dimeric conformation that may be essential for substrate binding. The S-adenosyl-l-methionine (AdoMet)-binding characteristic determined by isothermal titration calorimetry suggested that there is only one AdoMet molecule bound in the subunit of the homodimer. In vitro methylation assay of the mutants based on the RsmE-AdoMet-uridylic acid complex model showed key residues involved in substrate binding and catalysis. Comprehensive comparisons of RsmE with closely related MTases, combined with the biochemical experiments, indicated that the MTase domain of one subunit in dimeric RsmE is responsible for binding of one AdoMet molecule and catalytic process while the PUA-like domain in the other subunit is mainly responsible for recognition of one substrate molecule (the ribosomal RNA fragment and ribosomal protein complex). The methylation process is required by collaboration of both subunits, and dimerization is functionally critical for catalysis. In general, our study provides new information on the structure-function relationship of RsmE and thereby suggests a novel catalytic mechanism.

  17. RNA structures regulating nidovirus RNA synthesis

    NARCIS (Netherlands)

    Born, Erwin van den

    2006-01-01

    Viruses depend on their host cell for the production of their progeny. The genetic information that is required to regulate this process is contained in the viral genome. In the case of plus-stranded RNA viruses, like nidoviruses, the RNA genome is directly involved in translation (resulting in the

  18. RNA modifications by oxidation

    DEFF Research Database (Denmark)

    Poulsen, Henrik E; Specht, Elisabeth; Broedbaek, Kasper;

    2012-01-01

    other RNA molecules show virtually no oxidation. The iron-storage disease hemochromatosis exhibits the most prominent general increase in RNA oxidation ever observed. Oxidation of RNA primarily leads to strand breaks and to oxidative base modifications. Oxidized mRNA is recognized by the ribosomes...... type 2 diabetics; this demonstrates the clinical relevance of RNA oxidation. Taken collectively the available data suggest that RNA oxidation is a contributing factor in several diseases such as diabetes, hemochromatosis, heart failure, and ß-cell destruction. The mechanism involves free iron...

  19. Evolutionary genomics of archaeal viruses: unique viral genomes in the third domain of life

    DEFF Research Database (Denmark)

    Prangishvili, D.; Garrett, R. A.; Koonin, E.

    2006-01-01

    . In accord with this distinction, the sequenced genomes of euryarchaeal viruses encode many proteins homologous to bacteriophage capsid proteins. In contrast, initial analysis of the crenarchaeal viral genomes revealed no relationships with bacteriophages and, generally, very few proteins with detectable......In terms of virion morphology, the known viruses of archaea fall into two distinct classes: viruses of mesophilic and moderately thermophilic Eueryarchaeota closely resemble head-and-tail bacteriophages whereas viruses of hyperthermophilic Crenarchaeota show a variety of unique morphotypes...... of bacteriophages. The proteins encoded by the genes belonging to this pool include predicted transcription regulators, ATPases implicated in viral DNA replication and packaging, enzymes of DNA precursor metabolism, RNA modification enzymes, and glycosylases. In addition, each of the crenarchaeal viruses encodes...

  20. Bacterial and archaeal diversity in an iron-rich coastal hydrothermal field in Yamagawa, Kagoshima, Japan

    DEFF Research Database (Denmark)

    Kawaichi, Satoshi; Ito, Norihiro; Yoshida, Takashi;

    2013-01-01

    . The environmental settings of the coastal hydrothermal field were similar in some degree to those of deep-sea hydrothermal environments because of its emission of H2, CO2, and sulfide from the bottom of the hot spot. The results of clone analyses based on the 16S rRNA gene led us to speculate the presence...... of a chemo-synthetic microbial ecosystem, where chemolithoautotrophic thermophiles, primarily the bacterial order Aquificales, function as primary producers using H2 or sulfur compounds as their energy source and CO2 as their carbon source, and the organic compounds synthesized by them support the growth...... of chemoheterotrophic thermophiles, such as members of the order Thermales and the family Desulfurococcaceae. In addition, the dominance of members of the bacterial genus Herbaspirillum in the high temperature bottom layer led us to speculate the temporal formation of mesophilic zones where they can also function...

  1. Spatial Variations in Archaeal Lipids of Surface Water and Core-Top Sediments in the South China Sea and Their Implications for Paleoclimate Studies▿†

    OpenAIRE

    Wei, Yuli; Wang, Jinxiang; Liu, Jie; Dong, Liang; Li, Li; Wang, Hui; Wang, Peng; Zhao, Meixun; Zhang, Chuanlun L.

    2011-01-01

    The South China Sea (SCS) is the largest marginal sea of the western Pacific Ocean, yet little is known about archaeal distributions and TEX86-based temperatures in this unique oceanic setting. Here we report findings of abundances in both core lipids (CL) and intact polar lipids (IPL) of Archaea from surface water (CL only) and core-top sediments from different regions of the SCS. TEX86-derived temperatures were also calculated for these samples. The surface water had extremely low abundance...

  2. Promoter recognition in archaea is mediated by transcription factors: identification of transcription factor aTFB from Methanococcus thermolithotrophicus as archaeal TATA-binding protein.

    OpenAIRE

    Gohl, H P; Gröndahl, B; Thomm, M

    1995-01-01

    At least two transcription factors, aTFB and aTFA, are required for accurate and faithful in vitro transcription of homologous templates in cell-free extracts from the methanogenic Archaeon Methanococcus thermolithotrophicus. We have recently shown that the function of aTFB can be replaced by eucaryal TATA-binding proteins. Here we demonstrate using template commitment experiments that promoter recognition in an Archaeon is mediated by transcription factors. The archaeal TATA box was identifi...

  3. Diversity and Abundance of Ammonia-Oxidizing Archaeal Nitrite Reductase (nirK) Genes in Estuarine Sediments of San Francisco Bay

    Science.gov (United States)

    Reji, L.; Lee, J. A.; Damashek, J.; Francis, C. A.

    2013-12-01

    Nitrification, the microbially-mediated aerobic oxidation of ammonia to nitrate via nitrite, is an integral component of the global biogeochemical nitrogen cycle. The first and rate-limiting step of nitrification, ammonia oxidation, is carried out by two distinct microbial groups: ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). Molecular ecological studies targeting the amoA gene have revealed the abundance and ubiquity of AOA in terrestrial as well as aquatic environments. In addition to the ammonia oxidation machinery that includes the amoA gene, AOA also encode a gene for copper-containing nitrite reductase (nirK). The distribution patterns and functional role of nirK in AOA remain mostly unknown; proposed functions include the indirect involvement in ammonia oxidation through the production of nitric oxide during nitrite reduction, and (2) nitrite detoxification. In the present study, the diversity and abundance of archaeal nirK genes in estuarine sediments were investigated using quantitative polymerase chain reaction, cloning and sequencing approaches. In sediment samples collected from the San Francisco Bay estuary, two archaeal nirK variants (AnirKa and AnirKb) were amplified using specific primer sets. Overall, AnirKa was observed to be significantly more abundant than AnirKb in the sediment samples, with variation in relative abundance spanning two to three orders of magnitude between sampling sites. Phylogenetic analysis revealed a number of unique archaeal nirK sequence types, as well as many that clustered with sequences from previous estuarine studies and cultured AOA isolates, such as Nitrosopumilus maritimus. This study yielded new insights into the diversity and abundance of archaeal nirK genes in estuarine sediments, and highlights the importance of further investigating the physiological role of this gene in AOA, as well as its suitability as a marker gene for studying AOA in the environment.

  4. 古菌细胞膜脂在古菌群落组成及其对环境响应研究中的应用%Applications of archaeal membrane lipids in investigating archaeal community composition and its responses to environmental factors

    Institute of Scientific and Technical Information of China (English)

    曹鹏; 沈菊培; 贺纪正

    2012-01-01

    Archaea, as the third life form distinct from bacteria and eukaryota, widely distribute in various kinds of habitats, and play important roles in the biogeochemical cycles of carbon and nitrogen and in ecosystem functioning. As the biomarker of archaea, archaeal membrane lipids can be used to investigate the archaeal community composition and its responses to the environment. This paper introduced the structural characteristics of archaeal membrane lipids and the differences in the membrane lipids composition among different archaeal communities, and discussed the feasibility of using archeal membrane lipids in depicting archaeal community composition. The abundance of archaeal membrane lipids in the environment could be used to characterize the biomass of archaea, and the related results could complement and ascertain each other with the DNA-based bio-molecular approaches on the accuracy, analysis efficiency, and cost. Based on the description of the difficulties and importance of using archaeal membrane lipids to analyze the composition and abundance of archaeal communities, and by linking to the environmental factors such as temperature and pH that affected the archaeal community composition, the relationships between archaea and their habitats were further expatiated, and the evolution process of archaeal communities and its application prospects in the studies of geochemistry and geological events were analyzed.%古菌作为区别于细菌和真核生物的第3种生命形式广泛分布于各种生境,与碳、氮等元素的生物地球化学循环密切相关,在整个生态系统中具有重要作用.古菌细胞膜脂作为古菌重要的生物标志物,在其群落组成和对环境变化响应的研究中具有重要指示作用.本文介绍了古菌细胞膜脂的结构特征及不同古菌类群间细胞膜脂结构差异,用以表征古菌群落的组成特征.环境中细胞膜脂丰度可反映古菌生物量,并可与基于DNA的分子生物学

  5. Robust identification of noncoding RNA from transcriptomes requires phylogenetically-informed sampling.

    Directory of Open Access Journals (Sweden)

    Stinus Lindgreen

    2014-10-01

    Full Text Available Noncoding RNAs are integral to a wide range of biological processes, including translation, gene regulation, host-pathogen interactions and environmental sensing. While genomics is now a mature field, our capacity to identify noncoding RNA elements in bacterial and archaeal genomes is hampered by the difficulty of de novo identification. The emergence of new technologies for characterizing transcriptome outputs, notably RNA-seq, are improving noncoding RNA identification and expression quantification. However, a major challenge is to robustly distinguish functional outputs from transcriptional noise. To establish whether annotation of existing transcriptome data has effectively captured all functional outputs, we analysed over 400 publicly available RNA-seq datasets spanning 37 different Archaea and Bacteria. Using comparative tools, we identify close to a thousand highly-expressed candidate noncoding RNAs. However, our analyses reveal that capacity to identify noncoding RNA outputs is strongly dependent on phylogenetic sampling. Surprisingly, and in stark contrast to protein-coding genes, the phylogenetic window for effective use of comparative methods is perversely narrow: aggregating public datasets only produced one phylogenetic cluster where these tools could be used to robustly separate unannotated noncoding RNAs from a null hypothesis of transcriptional noise. Our results show that for the full potential of transcriptomics data to be realized, a change in experimental design is paramount: effective transcriptomics requires phylogeny-aware sampling.

  6. Structure of the prolyl-tRNA synthetase from the eukaryotic pathogen Giardia lamblia

    Energy Technology Data Exchange (ETDEWEB)

    Larson, Eric T.; Kim, Jessica E.; Napuli, Alberto J.; Verlinde, Christophe L. M. J.; Fan, Erkang; Zucker, Frank H.; Van Voorhis, Wesley C.; Buckner, Frederick S.; Hol, Wim G. J.; Merritt, Ethan A., E-mail: merritt@u.washington.edu [Medical Structural Genomics of Pathogenic Protozoa, (United States); University of Washington, Seattle, WA 98195 (United States)

    2012-09-01

    The structure of Giardia prolyl-tRNA synthetase cocrystallized with proline and ATP shows evidence for half-of-the-sites activity, leading to a corresponding mixture of reaction substrates and product (prolyl-AMP) in the two active sites of the dimer. The genome of the human intestinal parasite Giardia lamblia contains only a single aminoacyl-tRNA synthetase gene for each amino acid. The Giardia prolyl-tRNA synthetase gene product was originally misidentified as a dual-specificity Pro/Cys enzyme, in part owing to its unexpectedly high off-target activation of cysteine, but is now believed to be a normal representative of the class of archaeal/eukaryotic prolyl-tRNA synthetases. The 2.2 Å resolution crystal structure of the G. lamblia enzyme presented here is thus the first structure determination of a prolyl-tRNA synthetase from a eukaryote. The relative occupancies of substrate (proline) and product (prolyl-AMP) in the active site are consistent with half-of-the-sites reactivity, as is the observed biphasic thermal denaturation curve for the protein in the presence of proline and MgATP. However, no corresponding induced asymmetry is evident in the structure of the protein. No thermal stabilization is observed in the presence of cysteine and ATP. The implied low affinity for the off-target activation product cysteinyl-AMP suggests that translational fidelity in Giardia is aided by the rapid release of misactivated cysteine.

  7. Ancient origin of the divergent forms of leucyl-tRNA synthetases in the Halobacteriales

    Directory of Open Access Journals (Sweden)

    Andam Cheryl P

    2012-06-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT has greatly impacted the genealogical history of many lineages, particularly for prokaryotes, with genes frequently moving in and out of a line of descent. Many genes that were acquired by a lineage in the past likely originated from ancestral relatives that have since gone extinct. During the course of evolution, HGT has played an essential role in the origin and dissemination of genetic and metabolic novelty. Results Three divergent forms of leucyl-tRNA synthetase (LeuRS exist in the archaeal order Halobacteriales, commonly known as haloarchaea. Few haloarchaeal genomes have the typical archaeal form of this enzyme and phylogenetic analysis indicates it clusters within the Euryarchaeota as expected. The majority of sequenced halobacterial genomes possess a bacterial form of LeuRS. Phylogenetic reconstruction puts this larger group of haloarchaea at the base of the bacterial domain. The most parsimonious explanation is that an ancient transfer of LeuRS took place from an organism related to the ancestor of the bacterial domain to the haloarchaea. The bacterial form of LeuRS further underwent gene duplications and/or gene transfers within the haloarchaea, with some genomes possessing two distinct types of bacterial LeuRS. The cognate tRNALeu also reveals two distinct clusters for the haloarchaea; however, these tRNALeu clusters do not coincide with the groupings found in the LeuRS tree, revealing that LeuRS evolved independently of its cognate tRNA. Conclusions The study of leucyl-tRNA synthetase in haloarchaea illustrates the importance of gene transfer originating in lineages that went extinct since the transfer occurred. The haloarchaeal LeuRS and tRNALeu did not co-evolve.

  8. A Gateway platform for functional genomics in Haloferax volcanii: deletion of three tRNA modification genes

    Directory of Open Access Journals (Sweden)

    Basma El Yacoubi

    2009-01-01

    Full Text Available In part due to the existence of simple methods for its cultivation and genetic manipulation, Haloferax volcanii is a major archaeal model organism. It is the only archaeon for which the whole set of post-transcriptionally modified tRNAs has been sequenced, allowing for an in silico prediction of all RNA modification genes present in the organism. One approach to check these predictions experimentally is via the construction of targeted gene deletion mutants. Toward this goal, an integrative “Gateway vector” that allows gene deletion in H. volcanii uracil auxotrophs was constructed. The vector was used to delete three predicted tRNA modification genes: HVO_2001 (encoding an archaeal transglycosyl tranferase or arcTGT, which is involved in archeosine biosynthesis; HVO_2348 (encoding a newly discovered GTP cyclohydrolase I, which catalyzes the first step common to archaeosine and folate biosynthesis; and HVO_2736 (encoding a member of the COG1444 family, which is involved in N4-acetylcytidine (ac4C formation. Preliminary phenotypic analysis of the deletion mutants was conducted, and confirmed all three predictions.

  9. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    extraction Two replicates of ~0.5 to 1 g sub-samples of all six samples were subjected to DNA extraction. The MOBIO soil DNA extraction kit (MO BIO, USA) was used for extraction as per the protocol provided by the manufacturer. DNA extracts from each sub... manufacturer’s instructions. PCR primers Arch-amoAF: 5’-STAATGGTCTGGCTTAGACG and Arch-amoAR: 5’- GCGGCCATCCATCTGTATGT were used for amplifying AamoA-gene fragments following Francis et al. (2005). The PCR products were pooled and purified as done for 16S r...

  10. Novel archaeal macrocyclic diether core membrane lipids in a methane-derived carbonate crust from a mud volcano in the Sorokin Trough, NE Black Sea

    Directory of Open Access Journals (Sweden)

    Alina Stadnitskaia

    2003-01-01

    Full Text Available A methane-derived carbonate crust was collected from the recently discovered NIOZ mud volcano in the Sorokin Trough, NE Black Sea during the 11th Training-through-Research cruise of the R/V Professor Logachev. Among several specific bacterial and archaeal membrane lipids present in this crust, two novel macrocyclic diphytanyl glycerol diethers, containing one or two cyclopentane rings, were detected. Their structures were tentatively identified based on the interpretation of mass spectra, comparison with previously reported mass spectral data, and a hydrogenation experiment. This macrocyclic type of archaeal core membrane diether lipid has so far been identified only in the deep-sea hydrothermal vent methanogen Methanococcus jannaschii. Here, we provide the first evidence that these macrocyclic diethers can also contain internal cyclopentane rings. The molecular structure of the novel diethers resembles that of dibiphytanyl tetraethers in which biphytane chains, containing one and two pentacyclic rings, also occur. Such tetraethers were abundant in the crust. Compound-specific isotope measurements revealed δ13C values of –104 to –111‰ for these new archaeal lipids, indicating that they are derived from methanotrophic archaea acting within anaerobic methane-oxidizing consortia, which subsequently induce authigenic carbonate formation.

  11. Irreducibility in RNA structures

    OpenAIRE

    Jin, Emma Y.; Reidys, Christian M.

    2009-01-01

    In this paper we study irreducibility in RNA structures. By RNA structure we mean RNA secondary as well as RNA pseudoknot structures. In our analysis we shall contrast random and minimum free energy (mfe) configurations. We compute various distributions: of the numbers of irreducible substructures, their locations and sizes, parameterized in terms of the maximal number of mutually crossing arcs, $k-1$, and the minimal size of stacks $\\sigma$. In particular, we analyze the size of the largest ...

  12. RNA Localization in Astrocytes

    DEFF Research Database (Denmark)

    Thomsen, Rune

    2012-01-01

    of 18S ribosomal RNA and the Rab13, Pkp4, Ankrd25, and Inpp1 mRNAs in astrocyte protrusions. The Boyden chamber isolated RNA from both primary astrocytes and C8S cells was analyzed by next generation sequencing (NGS), which revealed that >250 polyadenylated (polyA) RNA species accumulated in the cell...

  13. Working with RNA

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    Working with RNA is not a special discipline in molecular biology. However, RNA is chemically and structurally different from DNA and a few simple work rules have to be implemented to maintain the integrity of the RNA. Alkaline pH, high temperatures, and heavy metal ions should be avoided when po...

  14. RNA self-assembly and RNA nanotechnology.

    Science.gov (United States)

    Grabow, Wade W; Jaeger, Luc

    2014-06-17

    CONSPECTUS: Nanotechnology's central goal involves the direct control of matter at the molecular nanometer scale to build nanofactories, nanomachines, and other devices for potential applications including electronics, alternative fuels, and medicine. In this regard, the nascent use of nucleic acids as a material to coordinate the precise arrangements of specific molecules marked an important milestone in the relatively recent history of nanotechnology. While DNA served as the pioneer building material in nucleic acid nanotechnology, RNA continues to emerge as viable alternative material with its own distinct advantages for nanoconstruction. Several complementary assembly strategies have been used to build a diverse set of RNA nanostructures having unique structural attributes and the ability to self-assemble in a highly programmable and controlled manner. Of the different strategies, the architectonics approach uniquely endeavors to understand integrated structural RNA architectures through the arrangement of their characteristic structural building blocks. Viewed through this lens, it becomes apparent that nature routinely uses thermodynamically stable, recurrent modular motifs from natural RNA molecules to generate unique and more complex programmable structures. With the design principles found in natural structures, a number of synthetic RNAs have been constructed. The synthetic nanostructures constructed to date have provided, in addition to affording essential insights into RNA design, important platforms to characterize and validate the structural self-folding and assembly properties of RNA modules or building blocks. Furthermore, RNA nanoparticles have shown great promise for applications in nanomedicine and RNA-based therapeutics. Nevertheless, the synthetic RNA architectures achieved thus far consist largely of static, rigid particles that are still far from matching the structural and functional complexity of natural responsive structural elements such

  15. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase – engineering a thermostable ATP independent enzyme

    Directory of Open Access Journals (Sweden)

    Zhelkovsky Alexander M

    2012-07-01

    Full Text Available Abstract Background RNA ligases are essential reagents for many methods in molecular biology including NextGen RNA sequencing. To prevent ligation of RNA to itself, ATP independent mutant ligases, defective in self-adenylation, are often used in combination with activated pre-adenylated linkers. It is important that these ligases not have de-adenylation activity, which can result in activation of RNA and formation of background ligation products. An additional useful feature is for the ligase to be active at elevated temperatures. This has the advantage or reducing preferences caused by structures of single-stranded substrates and linkers. Results To create an RNA ligase with these desirable properties we performed mutational analysis of the archaeal thermophilic RNA ligase from Methanobacterium thermoautotrophicum. We identified amino acids essential for ATP binding and reactivity but dispensable for phosphodiester bond formation with 5’ pre-adenylated donor substrate. The motif V lysine mutant (K246A showed reduced activity in the first two steps of ligation reaction. The mutant has full ligation activity with pre-adenylated substrates but retained the undesirable activity of deadenylation, which is the reverse of step 2 adenylation. A second mutant, an alanine substitution for the catalytic lysine in motif I (K97A abolished activity in the first two steps of the ligation reaction, but preserved wild type ligation activity in step 3. The activity of the K97A mutant is similar with either pre-adenylated RNA or single-stranded DNA (ssDNA as donor substrates but we observed two-fold preference for RNA as an acceptor substrate compared to ssDNA with an identical sequence. In contrast, truncated T4 RNA ligase 2, the commercial enzyme used in these applications, is significantly more active using pre-adenylated RNA as a donor compared to pre-adenylated ssDNA. However, the T4 RNA ligases are ineffective in ligating ssDNA acceptors. Conclusions

  16. Archaeal abundance in post-mortem ruminal digesta may help predict methane emissions from beef cattle

    Science.gov (United States)

    Wallace, R. John; Rooke, John A.; Duthie, Carol-Anne; Hyslop, Jimmy J.; Ross, David W.; McKain, Nest; de Souza, Shirley Motta; Snelling, Timothy J.; Waterhouse, Anthony; Roehe, Rainer

    2014-07-01

    Methane produced from 35 Aberdeen-Angus and 33 Limousin cross steers was measured in respiration chambers. Each group was split to receive either a medium- or high-concentrate diet. Ruminal digesta samples were subsequently removed to investigate correlations between methane emissions and the rumen microbial community, as measured by qPCR of 16S or 18S rRNA genes. Diet had the greatest influence on methane emissions. The high-concentrate diet resulted in lower methane emissions (P < 0.001) than the medium-concentrate diet. Methane was correlated, irrespective of breed, with the abundance of archaea (R = 0.39), bacteria (-0.47), protozoa (0.45), Bacteroidetes (-0.37) and Clostridium Cluster XIVa (-0.35). The archaea:bacteria ratio provided a stronger correlation (0.49). A similar correlation was found with digesta samples taken 2-3 weeks later at slaughter. This finding could help enable greenhouse gas emissions of large animal cohorts to be predicted from samples taken conveniently in the abattoir.

  17. Metabolic traits of an uncultured archaeal lineage -MSBL1- from brine pools of the Red Sea

    KAUST Repository

    Mwirichia, Romano

    2016-01-13

    The candidate Division MSBL1 (Mediterranean Sea Brine Lakes 1) comprises a monophyletic group of uncultured archaea found in different hypersaline environments. Previous studies propose methanogenesis as the main metabolism. Here, we describe a metabolic reconstruction of MSBL1 based on 32 single-cell amplified genomes from Brine Pools of the Red Sea (Atlantis II, Discovery, Nereus, Erba and Kebrit). Phylogeny based on rRNA genes as well as conserved single copy genes delineates the group as a putative novel lineage of archaea. Our analysis shows that MSBL1 may ferment glucose via the Embden–Meyerhof–Parnas pathway. However, in the absence of organic carbon, carbon dioxide may be fixed via the ribulose bisphosphate carboxylase, Wood-Ljungdahl pathway or reductive TCA cycle. Therefore, based on the occurrence of genes for glycolysis, absence of the core genes found in genomes of all sequenced methanogens and the phylogenetic position, we hypothesize that the MSBL1 are not methanogens, but probably sugar-fermenting organisms capable of autotrophic growth. Such a mixotrophic lifestyle would confer survival advantage (or possibly provide a unique narrow niche) when glucose and other fermentable sugars are not available.

  18. Metabolic traits of an uncultured archaeal lineage -MSBL1- from brine pools of the Red Sea

    Science.gov (United States)

    Mwirichia, Romano; Alam, Intikhab; Rashid, Mamoon; Vinu, Manikandan; Ba-Alawi, Wail; Anthony Kamau, Allan; Kamanda Ngugi, David; Göker, Markus; Klenk, Hans-Peter; Bajic, Vladimir; Stingl, Ulrich

    2016-01-01

    The candidate Division MSBL1 (Mediterranean Sea Brine Lakes 1) comprises a monophyletic group of uncultured archaea found in different hypersaline environments. Previous studies propose methanogenesis as the main metabolism. Here, we describe a metabolic reconstruction of MSBL1 based on 32 single-cell amplified genomes from Brine Pools of the Red Sea (Atlantis II, Discovery, Nereus, Erba and Kebrit). Phylogeny based on rRNA genes as well as conserved single copy genes delineates the group as a putative novel lineage of archaea. Our analysis shows that MSBL1 may ferment glucose via the Embden-Meyerhof-Parnas pathway. However, in the absence of organic carbon, carbon dioxide may be fixed via the ribulose bisphosphate carboxylase, Wood-Ljungdahl pathway or reductive TCA cycle. Therefore, based on the occurrence of genes for glycolysis, absence of the core genes found in genomes of all sequenced methanogens and the phylogenetic position, we hypothesize that the MSBL1 are not methanogens, but probably sugar-fermenting organisms capable of autotrophic growth. Such a mixotrophic lifestyle would confer survival advantage (or possibly provide a unique narrow niche) when glucose and other fermentable sugars are not available.

  19. Combinatorics of RNA-RNA interaction

    CERN Document Server

    Li, Thomas J X

    2010-01-01

    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure means that in a diagram representation the intramolecular bonds of each partner are pseudoknot-free, that the intermolecular binding pairs are noncrossing, and that there is no so-called ``zig-zag'' configuration. This paper presents the combinatorics of RNA interaction structures including their generating function, singularity analysis as well as explicit recurrence relations. In particular, our results imply simple asymptotic formulas for the number of joint structures.

  20. Combinatorics of RNA-RNA interaction.

    Science.gov (United States)

    Li, Thomas J X; Reidys, Christian M

    2012-02-01

    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure means that in a diagram representation the intramolecular bonds of each partner are pseudoknot-free, that the intermolecular binding pairs are noncrossing, and that there is no so-called "zigzag" configuration. This paper presents the combinatorics of RNA interaction structures including their generating function, singularity analysis as well as explicit recurrence relations. In particular, our results imply simple asymptotic formulas for the number of joint structures.

  1. Pyrosequencing reveals the influence of elevated atmospheric CO2 on the composition of archaeal communities in the rhizosphere of C3 and C4 crops

    Science.gov (United States)

    Nelson, D. M.; Cann, I. K.; Mackie, R. I.

    2008-12-01

    The projected increase in atmospheric CO2 concentrations throughout the 21st century is likely to increase aboveground and belowground plant productivity and cause changes in the quantity and quality of plant root exudates, although plants using C4 photosynthesis are likely to be only affected during times of drought (Leakey et al., 2006, Plant Physiology, 140, 779). Evidence is emerging from molecular tools that these changes may influence the abundance and composition of soil microbial communities that regulate key soil processes, such as nitrogen cycling (Lesaulnier et al., 2008, Environmental Microbiology, 10, 926). However, most molecular tools are not well-suited for comparing multiple samples at great sequencing depth, which is critical when considering soil microbial communities of high diversity. To overcome these limitations we used pyrosequencing and quantitative PCR (qPCR) of two genes (the V3 region of 16S rDNA and the amoA gene) to examine intra- and inter-treatment variability in the abundance and composition of microbial communities in the rhizosphere of soybean (C3) and maize (C4) grown in field conditions under ambient (~380 ppm) and elevated (~550 ppm) CO2 using FACE (free-air concentration enrichment) technology during the 2006 growing season in central Illinois. We specifically focused on archaeal communities because of their key role in nitrification (Leininger et al., 2006, Nature, 442, 806). The majority (>97%) of recovered sequences were from members of the phylum Crenarchaeota. Principle component analysis of sequence results from the V3 and amoA genes indicated significant (p<0.05) differences in the composition of rhizosphere archaeal communities between ambient and elevated CO2 beneath soybean, but not maize. qPCR suggested no significant difference in the abundance of archaea between treatments for soybean and maize. The lack of response of archaeal community composition beneath maize to elevated CO2 is consistent with relatively high

  2. Effect of supplementing coconut or krabok oil, rich in medium-chain fatty acids on ruminal fermentation, protozoa and archaeal population of bulls.

    Science.gov (United States)

    Panyakaew, P; Boon, N; Goel, G; Yuangklang, C; Schonewille, J Th; Hendriks, W H; Fievez, V

    2013-12-01

    Medium-chain fatty acids (MCFA), for example, capric acid (C10:0), myristic (C14:0) and lauric (C12:0) acid, have been suggested to decrease rumen archaeal abundance and protozoal numbers. This study aimed to compare the effect of MCFA, either supplied through krabok (KO) or coconut (CO) oil, on rumen fermentation, protozoal counts and archaeal abundance, as well as their diversity and functional organization. KO contains similar amounts of C12:0 as CO (420 and 458 g/kg FA, respectively), but has a higher proportion of C14:0 (464 v. 205 g/kg FA, respectively). Treatments contained 35 g supplemental fat per kg DM: a control diet with tallow (T); a diet with supplemental CO; and a diet with supplemental KO. A 4th treatment consisted of a diet with similar amounts of MCFA (i.e. C10:0+C12:0+C14:0) from CO and KO. To ensure isolipidic diets, extra tallow was supplied in the latter treatment (KO+T). Eight fistulated bulls (two bulls per treatment), fed a total mixed ration predominantly based on cassava chips, rice straw, tomato pomace, rice bran and soybean meal (1.5% of BW), were used. Both KO and CO increased the rumen volatile fatty acids, in particular propionate and decreased acetate proportions. Protozoal numbers were reduced through the supplementation of an MCFA source (CO, KO and KO+T), with the strongest reduction by KO. Quantitative real-time polymerase chain reaction assays based on archaeal primers showed a decrease in abundance of Archaea when supplementing with KO and KO+T compared with T and CO. The denaturing gradient gel electrophoresis profiles of the rumen archaeal population did not result in a grouping of treatments. Richness indices were calculated from the number of DGGE bands, whereas community organization was assessed from the Pareto-Lorenz evenness curves on the basis of DGGE band intensities. KO supplementation (KO and KO+T treatments) increased richness and evenness within the archaeal community. Further research including methane

  3. Impacts of temperature and pH on the distribution of archaeal lipids in Yunnan hot springs, China.

    Science.gov (United States)

    Wu, Weiyan; Zhang, Chuanlun L; Wang, Huanye; He, Liu; Li, Wenjun; Dong, Hailiang

    2013-01-01

    In culture experiments and many low temperature environments, the distribution of isoprenoid glycerol dialkyl glycerol tetraethers (GDGTs) commonly shows a strong correlation with temperature; however, this is often not the case in hot springs. We studied 26 hot springs in Yunnan, China, in order to determine whether temperature or other factors control the distribution of GDGTs in these environments. The hot springs ranged in temperature from 39.0 to 94.0°C, and in pH from 2.35 to 9.11. Water chemistry including nitrogen-, sulfur-, and iron species was also determined. Lipids from the samples were analyzed using liquid chromatography-mass spectrometry (LC-MS). Distributions of GDGTs in these hot springs were examined using cluster analysis, which resulted in two major groups. Group 1 was characterized by the lack of dominance of any individual GDGTs, while Group 2 was defined by the dominance of GDGT-0 or thaumarchaeol. Temperature was the main control on GDGT distribution in Group 1, whereas pH played an important role in the distribution of GDGTs in Group 2. However, no correlations were found between the distribution of GDGTs and any of the nitrogen-, sulfur-, or iron species. Results of this study indicate the dominance of temperature or pH control on archaeal lipid distribution, which can be better evaluated in the context of lipid classification.

  4. Impacts of temperature and pH on the distribution of archaeal lipids in Yunnan hot springs, China

    Directory of Open Access Journals (Sweden)

    Weiyan eWu

    2013-10-01

    Full Text Available In culture experiments and many low temperature environments, the distribution of isoprenoid glycerol dialkyl glycerol tetraethers (GDGTs commonly shows a strong correlation with temperature; however, this is often not the case in hot springs. We studied 26 hot springs in Yunnan, China, in order to determine whether temperature or other factors control the distribution of GDGTs in these environments. The hot springs ranged in temperature from 39°C to 94°C, and in pH from 2.35 to 9.11. Water chemistry including nitrogen-, sulfur- and iron species was also determined. Lipids from the samples were analyzed using LC-MS (liquid chromatography-mass spectrometry. Distributions of GDGTs in these hot springs were examined using cluster analysis, which resulted in two major groups. Group 1 was characterized by the lack of dominance of any individual GDGTs, while Group 2 was defined by the dominance of GDGT-0 or thaumarchaeol. Temperature was the main control on GDGT distribution in Group 1, whereas pH played an important role in the distribution of GDGTs in Group 2. However, no correlations were found between the distribution of GDGTs and any of the nitrogen-, sulfur- or iron species. Results of this study indicate the predominance of temperature or pH control on archaeal lipid distribution, which can be better evaluated in the context of lipid classification.

  5. S-layers at second glance? Altiarchaeal grappling hooks (hami resemble archaeal S-layer proteins in structure and sequence

    Directory of Open Access Journals (Sweden)

    Alexandra Kristin Perras

    2015-06-01

    Full Text Available The uncultivated Ca. Altiarchaeum hamiconexum (formerly known as SM1 Euryarchaeon carries highly specialized nano-grappling hooks (hami on its cell surface. Until now little is known about the major protein forming these structured fibrous cell surface appendages, the genes involved or membrane anchoring of these filaments. These aspects were analyzed in depth in this study using environmental transcriptomics combined with imaging methods. Since a laboratory culture of this archaeon is not yet available, natural biofilm samples with high Ca. A. hamiconexum abundance were used for the entire analyses. The filamentous surface appendages spanned both membranes of the cell, which are composed of glycosyl-archaeol. The hami consisted of multiple copies of the same protein, the corresponding gene of which was identified via metagenome-mapped transcriptome analysis. The hamus subunit proteins, which are likely to self-assemble due to their predicted beta sheet topology, revealed no similiarity to known microbial flagella-, archaella-, fimbriae- or pili-proteins, but a high similarity to known S-layer proteins of the archaeal phylum at their N-terminal region (47-44% identity. Our results provide new insights into the structure of the unique hami and their major protein and indicate their divergent evolution with S-layer proteins.

  6. Archaeal Diversity in Biofilm Technologies Applied to Treat Urban and Industrial Wastewater: Recent Advances and Future Prospects

    Directory of Open Access Journals (Sweden)

    Jesús González-López

    2013-09-01

    Full Text Available Biological wastewater treatment (WWT frequently relies on biofilms for the removal of anthropogenic contaminants. The use of inert carrier materials to support biofilm development is often required, although under certain operating conditions microorganisms yield structures called granules, dense aggregates of self-immobilized cells with the characteristics of biofilms maintained in suspension. Molecular techniques have been successfully applied in recent years to identify the prokaryotic communities inhabiting biofilms in WWT plants. Although methanogenic Archaea are widely acknowledged as key players for the degradation of organic matter in anaerobic bioreactors, other biotechnological functions fulfilled by Archaea are less explored, and research on their significance and potential for WWT is largely needed. In addition, the occurrence of biofilms in WWT plants can sometimes be a source of operational problems. This is the case for membrane bioreactors (MBR, an advanced technology that combines conventional biological treatment with membrane filtration, which is strongly limited by biofouling, defined as the undesirable accumulation of microbial biofilms and other materials on membrane surfaces. The prevalence and spatial distribution of archaeal communities in biofilm-based WWT as well as their role in biofouling are reviewed here, in order to illustrate the significance of this prokaryotic cellular lineage in engineered environments devoted to WWT.

  7. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    Directory of Open Access Journals (Sweden)

    Elisabeth W. Vissers

    2013-01-01

    Full Text Available Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO. This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA and bacteria (AOB over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton.

  8. Raman crystallography of RNA.

    Science.gov (United States)

    Gong, Bo; Chen, Jui-Hui; Yajima, Rieko; Chen, Yuanyuan; Chase, Elaine; Chadalavada, Durga M; Golden, Barbara L; Carey, Paul R; Bevilacqua, Philip C

    2009-10-01

    Raman crystallography is the application of Raman spectroscopy to single crystals. This technique has been applied to a variety of protein molecules where it has provided unique information about biopolymer folding, substrate binding, and catalysis. Here, we describe the application of Raman crystallography to functional RNA molecules. RNA represents unique opportunities and challenges for Raman crystallography. One issue that confounds studies of RNA is its tendency to adopt multiple non-functional folds. Raman crystallography has the advantage that it isolates a single state of the RNA within the crystal and can evaluate its fold, metal ion binding properties (ligand identity, stoichiometry, and affinity), proton binding properties (identity, stoichiometry, and affinity), and catalytic potential. In particular, base-specific stretches can be identified and then associated with the binding of metal ions and protons. Because measurements are carried out in the hanging drop at ambient, rather than cryo, conditions and because RNA crystals tend to be approximately 70% solvent, RNA dynamics and conformational changes become experimentally accessible. This review focuses on experimental setup and procedures, acquisition and interpretation of Raman data, and determination of physicochemical properties of the RNA. Raman crystallographic and solution biochemical experiments on the HDV RNA enzyme are summarized and found to be in excellent agreement. Remarkably, characterization of the crystalline state has proven to help rather than hinder functional characterization of functional RNA, most likely because the tendency of RNA to fold heterogeneously is limited in a crystalline environment. Future applications of Raman crystallography to RNA are briefly discussed.

  9. Cytoplasmic Z-RNA

    Energy Technology Data Exchange (ETDEWEB)

    Zarling, D.A.; Calhoun, C.J.; Hardin, C.C.; Zarling, A.H.

    1987-09-01

    Specific immunochemical probes for Z-RNA were generated and characterized to search for possible Z-RNA-like double helices in cells. Z-RNA was detected in the cytoplasm of fixed protozoan cells by immunofluorescence microscopy using these anti-Z-RNA IgCs. In contrast, autoimmune or experimentally elicited anti-DNA antibodies, specifically reactive with B-DNA or Z-DNA, stained the nuclei. Pre-or nonimmune IgGs did not bind to the cells. RNase A or T1 digestion eliminated anti-Z-RNA IgG binding to cytoplasmic determinants; however, DNase I or mung bean nuclease had no effect. Doxorubicin and ethidium bromide prevented anti-Z-RNA antibody binding; however, actinomycin D, which does not bind double-stranded RNA, did not. Anti-Z-RNA immunofluorescence was specifically blocked in competition assays by synthetic Z-RNA but not Z-DNA, A-RNA, or single-stranded RNAs. Thus, some cytoplasmic sequences in fixed cells exist in the left-handed Z-RNA conformation.

  10. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    While increasing evidence appoints diverse types of RNA as key players in the regulatory networks underlying cellular differentiation and metabolism, the potential functions of thousands of conserved RNA structures encoded in mammalian genomes remain to be determined. Since the functions of most...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA......-protein pulldown combined with mass spectrometry analysis is applied for in vivo as well as in vitro identification of RNA-binding proteins, the latter succeeding in verifying known RNA-protein interactions. Secondly, acknowledging the significance of flexible promoter usage for the diversification...

  11. Semiautomated improvement of RNA alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth; Lind-Thomsen, Allan; Knudsen, Bjarne;

    2007-01-01

    : the mir-399 RNA, vertebrate telomase RNA (vert-TR), bacterial transfer-messenger RNA (tmRNA), and the signal recognition particle (SRP) RNA. The general use of the method is illustrated by the ability to accommodate pseudoknots and handle even large and divergent RNA families. The open architecture...

  12. iRNA-seq

    DEFF Research Database (Denmark)

    Madsen, Jesper Grud Skat; Schmidt, Søren Fisker; Larsen, Bjørk Ditlev;

    2015-01-01

    RNA-seq is a sensitive and accurate technique to compare steady-state levels of RNA between different cellular states. However, as it does not provide an account of transcriptional activity per se, other technologies are needed to more precisely determine acute transcriptional responses. Here, we...... have developed an easy, sensitive and accurate novel computational method, IRNA-SEQ: , for genome-wide assessment of transcriptional activity based on analysis of intron coverage from total RNA-seq data. Comparison of the results derived from iRNA-seq analyses with parallel results derived using...... current methods for genome-wide determination of transcriptional activity, i.e. global run-on (GRO)-seq and RNA polymerase II (RNAPII) ChIP-seq, demonstrate that iRNA-seq provides similar results in terms of number of regulated genes and their fold change. However, unlike the current methods that are all...

  13. Archaeal Viruses Contribute to the Novel Viral Assemblage Inhabiting Oceanic, Basalt-Hosted Deep Subsurface Crustal Fluids

    Science.gov (United States)

    Nigro, O. D.; Rappe, M. S.; Jungbluth, S.; Lin, H. T.; Steward, G.

    2015-12-01

    Fluids contained in the basalt-hosted deep subsurface of the world's oceans represent one of the most inaccessible and understudied biospheres on earth. Recent improvements in sampling infrastructure have allowed us to collect large volumes of crustal fluids (~104 L) from Circulation Obviation Retrofit Kits (CORKs) placed in boreholes located on the eastern flank of the Juan de Fuca Ridge (JdFR). We detected viruses within these fluids by TEM and epifluorescence microscopy in samples collected from 2010 to 2014. Viral abundance, determined by epifluorescence counts, indicated that concentrations of viruses in subsurface basement fluids (~105 ml-1) are lower than the overlying seawater, but are higher in abundance than microbial cells in the same samples. Analysis of TEM images revealed distinct viral morphologies (rod and spindle-shaped) that resemble the morphologies of viral families infecting archaea. There are very few, if any, direct observations of these viral morphologies in marine samples, although they have been observed in enrichment cultures and their signature genes detected in metagenomic studies from hydrothermal vents and marine sediments. Analysis of metagenomes from the JdFR crustal fluids revealed sequences with homology to archaeal viruses from the rudiviridae, bicaudaviridae and fuselloviridae. Prokaryotic communities in fluids percolating through the basaltic basement rock of the JdFR flank are distinct from those inhabiting the overlying sediments and seawater. Similarly, our data support the idea that the viral assemblage in these fluids is distinct from viral assemblages in other marine and terrestrial aquatic environments. Our data also suggest that viruses contribute to the mortality of deep subsurface prokaryotes through cell lysis, and viruses may alter the genetic potential of their hosts through the processes of lysogenic conversion and horizontal gene transfer.

  14. Bacterial CS2 hydrolases from Acidithiobacillus thiooxidans strains are homologous to the archaeal catenane CS2 hydrolase.

    Science.gov (United States)

    Smeulders, Marjan J; Pol, Arjan; Venselaar, Hanka; Barends, Thomas R M; Hermans, John; Jetten, Mike S M; Op den Camp, Huub J M

    2013-09-01

    Carbon disulfide (CS(2)) and carbonyl sulfide (COS) are important in the global sulfur cycle, and CS(2) is used as a solvent in the viscose industry. These compounds can be converted by sulfur-oxidizing bacteria, such as Acidithiobacillus thiooxidans species, to carbon dioxide (CO(2)) and hydrogen sulfide (H2S), a property used in industrial biofiltration of CS(2)-polluted airstreams. We report on the mechanism of bacterial CS(2) conversion in the extremely acidophilic A. thiooxidans strains S1p and G8. The bacterial CS(2) hydrolases were highly abundant. They were purified and found to be homologous to the only other described (archaeal) CS(2) hydrolase from Acidianus strain A1-3, which forms a catenane of two interlocked rings. The enzymes cluster in a group of β-carbonic anhydrase (β-CA) homologues that may comprise a subclass of CS(2) hydrolases within the β-CA family. Unlike CAs, the CS(2) hydrolases did not hydrate CO(2) but converted CS(2) and COS with H(2)O to H(2)S and CO(2). The CS(2) hydrolases of A. thiooxidans strains G8, 2Bp, Sts 4-3, and BBW1, like the CS(2) hydrolase of Acidianus strain A1-3, exist as both octamers and hexadecamers in solution. The CS(2) hydrolase of A. thiooxidans strain S1p forms only octamers. Structure models of the A. thiooxidans CS(2) hydrolases based on the structure of Acidianus strain A1-3 CS(2) hydrolase suggest that the A. thiooxidans strain G8 CS(2) hydrolase may also form a catenane. In the A. thiooxidans strain S1p enzyme, two insertions (positions 26 and 27 [PD] and positions 56 to 61 [TPAGGG]) and a nine-amino-acid-longer C-terminal tail may prevent catenane formation.

  15. Archaeal Ammonia Oxidizers and Total Production of N2O and CH4 in Arctic Polar Desert Soils

    Science.gov (United States)

    Brummell, Martin; Robert, Stan; Bodrossy, Levente; Abell, Guy; Siciliano, Steven

    2014-05-01

    Ammonia-oxidizing Archaea are abundant in Arctic desert soils and appear to be responsible for the majority of ammonia oxidation activity in these cold and dry ecosystems. We used DNA microarrays to characterize the microbial community consisting of ammonia-oxidizing Archaea and methane-oxidizing Bacteria in three polar deserts from Ellesmere Island, Canada. Patterns of net greenhouse gas production, including production and consumption of CO2, CH4, and N2O were compared with community relative richness and abundance in a structural equation model that tested causal hypotheses relating edaphic factors to the biological community and net gas production. We extracted and amplified DNA sequences from soils collected at three polar deserts on Ellesmere Island in the Canadian high Arctic, and characterized the community structure using DNA microarrays. The functional genes Archaeal AmoA and pMMO were used to compare patterns of biological community structure to the observed patterns of net greenhouse gas production from those soils, as measured in situ. Edaphic factors including water content, bulk density, pH, and nutrient levels such as nitrate, ammonia, and extractable organic carbon were also measured for each soil sample, resulting in a highly multivariate dataset. Both concentration and net production of the three greenhouse gases were correlated, suggesting underlying causal factors. Edaphic factors such as soil moisture and pH had important, direct effects on the community composition of both functional groups of microorganisms, and pH further had a direct effect on N2O production. The structural relationship between the examined microbial communities and net production of both N2O and CH4 was strong and consistent between varying model structures and matrices, providing high confidence that this model relationship accurately reflects processes occurring in Arctic desert soils.

  16. Spatial Variations in Archaeal Lipids of Surface Water and Core-Top Sediments in the South China Sea and Their Implications for Paleoclimate Studies▿†

    Science.gov (United States)

    Wei, Yuli; Wang, Jinxiang; Liu, Jie; Dong, Liang; Li, Li; Wang, Hui; Wang, Peng; Zhao, Meixun; Zhang, Chuanlun L.

    2011-01-01

    The South China Sea (SCS) is the largest marginal sea of the western Pacific Ocean, yet little is known about archaeal distributions and TEX86-based temperatures in this unique oceanic setting. Here we report findings of abundances in both core lipids (CL) and intact polar lipids (IPL) of Archaea from surface water (CL only) and core-top sediments from different regions of the SCS. TEX86-derived temperatures were also calculated for these samples. The surface water had extremely low abundances of CL (average of 0.05 ± 0.13 ng/liter; n = 75), with higher values present in regions where upwelling is known to occur. The core-top sediments had CL values of 0.1 to 0.9 μg/g, which are on the low end of CL concentrations reported for other marine sediments and may reflect the oligotrophic nature of the open SCS. The IPL of Archaea accounted for 6 to 36.4% of total lipids (CL plus IPL), indicating that the majority of archaeal lipids in core-top sediments were derived from nonliving cells. The TEX86-based temperatures of surface water were overall lower than satellite-based sea surface temperatures or CTD-measured in situ temperatures. The core-top sediment samples, however, had TEX86 temperatures very close to the mean annual sea surface temperatures, except for samples with water depths of less than 100 m. Our results demonstrated low and heterogeneous distributions of archaeal lipids in surface water and core-top sediments of the SCS, which may reflect local or regional differences in productivity of Archaea. While TEX86-based temperatures for core-top marine sediments at deep water depths (>100 m) generally reflected mean annual sea surface temperatures, TEX86 temperatures in surface water varied basin wide and underestimated sea surface temperatures in most locations for the season when surface water samples were collected. PMID:21890672

  17. Archaeal and Bacterial Diversity and Enzymatic Activities Associated With Particulate Matter in the Laptev Sea, a River-Impacted Arctic Shelf Environment

    Science.gov (United States)

    Evans, C. T.; Deming, J. W.

    2006-12-01

    Arctic Ocean shelves are influenced by riverine input of terrestrial, relatively refractory particulate organic matter (POM) as well as fresh material from marine phytoplankton blooms. The fate of organic particles and aggregates depends in large part on their associated microbes and the effectiveness of hydrolytic enzymes. The Laptev Sea provides an ideal setting to test for connections between Archaeal and Bacterial communities, the quality of the POM they colonize, and the activities of extracellular enzymes. Aboard the Russian icebreaker Kapitan Dranitsyn during the NABOS 2005 cruise to the Laptev Sea, we sampled various size fractions of particulate matter, from 0.2 to 70 μm. Patterns of Archaeal and Bacterial diversity were analyzed using terminal restriction fragment length polymorphism (T-RFLP). Extracellular enzymatic activities were evaluated using fluorescent substrate analogs. Thus far, we have observed a statistically significant difference between particle-associated and free-living Bacteria, many of which appear (by clone library) to be gamma-proteobacteria or CFB. Bacterial community richness associated with the largest particle fractions, where protease and glucosidase activities were the highest, was best explained by indicators of primary productivity (chlorophyll a and phaeopigments), while richness associated with smaller size fractions was best explained by general particle indicators (and depth and salinity). In contrast, particle-associated Archaea were not significantly different from their free-living counterparts. Archaeal clone library results indicate a predominance of Marine Group 1 Crenarchaea, the group containing a recently isolated nitrifying Archaeon. Given all these results, we hypothesize that in the Laptev Sea cold-active Bacteria are the primary agents in the enzymatic degradation of POM, whether terrestrial or marine, while Archaea play other roles in the elemental cycles of Arctic waters, perhaps especially in the nitrogen

  18. RNA decay by messenger RNA interferases

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo;

    2008-01-01

    Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...

  19. Topology of RNA-RNA interaction structures

    DEFF Research Database (Denmark)

    Andersen, Jørgen Ellegaard; Huang, Fenix Wenda; Penner, Robert;

    2012-01-01

    Abstract The topological filtration of interacting RNA complexes is studied, and the role is analyzed of certain diagrams called irreducible shadows, which form suitable building blocks for more general structures. We prove that, for two interacting RNAs, called interaction structures, there exist...

  20. 印度尼西亚Padang Cermin热泉古菌多样性分析%Phylogenetic Diversity of Archaeal Community in the Hot Spring in Padang Cermin, Sumatra, Indonesia

    Institute of Scientific and Technical Information of China (English)

    沈继红; 宋维志; 林学政; 王帅; Dewi Seswita Zilda

    2012-01-01

    通过印度尼西亚苏门答腊岛Padang Cermin热泉环境基因组DNA构建古菌16S rRNA基因文库,并利用PCR-RFLP技术对其古菌多样性和系统发育分析进行了研究.根据限制性内切酶AluⅠ和MspⅠ的特征性酶切图谱,将62个阳性克隆归类为14个分类操作单位(operational taxonomic unit,OTU),文库的覆盖度达90.32%.克隆文库的优势类群为OTU2和OTU1,分别占克隆文库的27.42%和20.96%.从每个OUT中选取一个代表性克隆进行16S rRNA基因的序列测定与系统发育分析,结果表明,测定的Padang Cermin热泉中的古菌均属于泉古菌门,包括热变形菌目(Thermoproteales)、硫还原球菌目(Desulfurococcales)、杂色泉古菌(miscellaneous crenarchaeotic group,MCG)和未培养泉古菌(uncultured Crenarchaeota,UC),该热泉代表性克隆与GenBank数据库已有16S rRNA序列的相似性为91.9%~97.8%,而且与其相似性最高的序列均来自未培养的古菌克隆,由结果可见,Padang Cermin热泉古菌群落与已报道的其他热泉古菌群落的相似性较低,表明该热泉可能具有某些独特的特征,存在着特殊的古菌生态类群.%Diversity and phylogenetic analysis of archaea in the hot spring in Padang Cermin, Sumatra, Indonesia are investigated by constructing the 16S rRNA gene library of metagenomic DNA and using PCR-RFLP technique. Total 62 positive clones are classified into 14 operational taxonomic units (OTUs) according to their distinct restriction patterns of two kinds of restriction enzymes Alu Ⅰ and MspⅠ . A representative clone from each OTU is sequenced. The phylogenetic analysis shows that all archaea in the hot spring in Padang Cermin belong to Crenarchaeota, including Thermoproteales, Desulfurococcales, miscellaneous crenarchaeotic group (MCG) and some unidentified families. The similarities between the representative clone sequences from the hot spring in Padang Cermin and their closest sequences deposited in Gen

  1. Pyrosequencing reveals the influence of elevated atmospheric CO2 on the composition of archaeal communities in the rhizosphere of C3 and C4 crops

    Science.gov (United States)

    Nelson, D. M.; Cann, I. K.; Mackie, R. I.

    2008-12-01

    The projected increase in atmospheric CO2 concentrations throughout the 21st century is likely to increase aboveground and belowground plant productivity and cause changes in the quantity and quality of plant root exudates, although plants using C4 photosynthesis are likely to be only affected during times of drought (Leakey et al., 2006, Plant Physiology, 140, 779). Evidence is emerging from molecular tools that these changes may influence the abundance and composition of soil microbial communities that regulate key soil processes, such as nitrogen cycling (Lesaulnier et al., 2008, Environmental Microbiology, 10, 926). However, most molecular tools are not well-suited for comparing multiple samples at great sequencing depth, which is critical when considering soil microbial communities of high diversity. To overcome these limitations we used pyrosequencing and quantitative PCR (qPCR) of two genes (the V3 region of 16S rDNA and the amoA gene) to examine intra- and inter-treatment variability in the abundance and composition of microbial communities in the rhizosphere of soybean (C3) and maize (C4) grown in field conditions under ambient (~380 ppm) and elevated (~550 ppm) CO2 using FACE (free-air concentration enrichment) technology during the 2006 growing season in central Illinois. We specifically focused on archaeal communities because of their key role in nitrification (Leininger et al., 2006, Nature, 442, 806). The majority (>97%) of recovered sequences were from members of the phylum Crenarchaeota. Principle component analysis of sequence results from the V3 and amoA genes indicated significant (psoybean, but not maize. qPCR suggested no significant difference in the abundance of archaea between treatments for soybean and maize. The lack of response of archaeal community composition beneath maize to elevated CO2 is consistent with relatively high soil moisture availability throughout the summer of 2006, whereas the significant influence of elevated CO2 on

  2. Algal and archaeal polyisoprenoids in a recent marine sediment: Molecular isotopic evidence for anaerobic oxidation of methane RID C-7675-2009

    DEFF Research Database (Denmark)

    Bian, LQ; Hinrichs, KU; Xie, TM;

    2001-01-01

    Analyses of C-13 contents of individual organic molecules in a marine sediment show that crocetane, 2,6,11,15-tetramethylhexadecane, an isomer of phytane, is produced by microorganisms that use methane as their main source of carbon. The sediments lie at a water depth of 68 m in the Kattegat......-consuming member of the microbial consortium responsible for the anaerobic oxidation of methane [Hoehler et al., 1994], in which, as first demonstrated quantitatively in these sediments [Iversen and Jørgensen, 1985], electrons are transferred from methane to sulfate. The presence of archaeal biomass throughout...

  3. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency.

    Science.gov (United States)

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-05-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2'-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2'-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA fromPyrococcus furiosus We find that the methylation efficacy at sites D and D' differ substantially, with substrate D' turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D' is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D' sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5'-end of the product.

  4. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Directory of Open Access Journals (Sweden)

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  5. Ab initio RNA folding

    International Nuclear Information System (INIS)

    RNA molecules are essential cellular machines performing a wide variety of functions for which a specific three-dimensional structure is required. Over the last several years, the experimental determination of RNA structures through x-ray crystallography and NMR seems to have reached a plateau in the number of structures resolved each year, but as more and more RNA sequences are being discovered, the need for structure prediction tools to complement experimental data is strong. Theoretical approaches to RNA folding have been developed since the late nineties, when the first algorithms for secondary structure prediction appeared. Over the last 10 years a number of prediction methods for 3D structures have been developed, first based on bioinformatics and data-mining, and more recently based on a coarse-grained physical representation of the systems. In this review we are going to present the challenges of RNA structure prediction and the main ideas behind bioinformatic approaches and physics-based approaches. We will focus on the description of the more recent physics-based phenomenological models and on how they are built to include the specificity of the interactions of RNA bases, whose role is critical in folding. Through examples from different models, we will point out the strengths of physics-based approaches, which are able not only to predict equilibrium structures, but also to investigate dynamical and thermodynamical behavior, and the open challenges to include more key interactions ruling RNA folding. (topical review)

  6. Psiscan: a computational approach to identify H/ACA-like and AGA-like non-coding RNA in trypanosomatid genomes

    Directory of Open Access Journals (Sweden)

    Ziporen Yaara

    2008-11-01

    Full Text Available Abstract Background Detection of non coding RNA (ncRNA molecules is a major bioinformatics challenge. This challenge is particularly difficult when attempting to detect H/ACA molecules which are involved in converting uridine to pseudouridine on rRNA in trypanosomes, because these organisms have unique H/ACA molecules (termed H/ACA-like that lack several of the features that characterize H/ACA molecules in most other organisms. Results We present here a computational tool called Psiscan, which was designed to detect H/ACA-like molecules in trypanosomes. We started by analyzing known H/ACA-like molecules and characterized their crucial elements both computationally and experimentally. Next, we set up constraints based on this analysis and additional phylogenic and functional data to rapidly scan three trypanosome genomes (T. brucei, T. cruzi and L. major for sequences that observe these constraints and are conserved among the species. In the next step, we used minimal energy calculation to select the molecules that are predicted to fold into a lowest energy structure that is consistent with the constraints. In the final computational step, we used a Support Vector Machine that was trained on known H/ACA-like molecules as positive examples and on negative examples of molecules that were identified by the computational analyses but were shown experimentally not to be H/ACA-like molecules. The leading candidate molecules predicted by the SVM model were then subjected to experimental validation. Conclusion The experimental validation showed 11 molecules to be expressed (4 out of 25 in the intermediate stage and 7 out of 19 in the final validation after the machine learning stage. Five of these 11 molecules were further shown to be bona fide H/ACA-like molecules. As snoRNA in trypanosomes are organized in clusters, the new H/ACA-like molecules could be used as starting points to manually search for additional molecules in their neighbourhood. All

  7. Conversion of upland to paddy field specifically alters the community structure of archaeal ammonia oxidizers in an acid soil

    Directory of Open Access Journals (Sweden)

    M. S. Alam

    2013-08-01

    Full Text Available The function of ammonia-oxidizing archaea (AOA and bacteria (AOB depends on the major energy-generating compounds (i.e., ammonia and oxygen. The diversification of AOA and AOB communities along ecological gradients of substrate availability in a complex environment have been much debated but rarely tested. In this study, two ecosystems of maize and rice crops under different fertilization regimes were selected to investigate the community diversification of soil AOA and AOB upon conversion of an upland field to a paddy field and long-term field fertilization in an acid soil. Real-time quantitative polymerase chain reaction of ammonia monooxygenase (amoA genes demonstrated that the abundance of AOA was significantly stimulated after conversion of upland to paddy soils for more than 100 yr, whereas a slight decline in AOB numbers was observed. Denaturing gradient gel electrophoresis fingerprints of amoA genes further revealed remarkable changes in the community compositions of AOA after conversion of aerobic upland to flooded paddy field. Sequencing analysis revealed that upland soil was dominated by AOA within the soil group 1.1b lineage, whereas the marine group 1.1a-associated lineage predominated in AOA communities in paddy soils. Irrespective of whether the soil was upland or paddy soil, long-term field fertilization led to increased abundance of amoA genes in AOA and AOB compared with control treatments (no fertilization, whereas archaeal amoA gene abundances outnumbered their bacterial counterparts in all samples. Phylogenetic analyses of amoA genes showed that Nitrosospira cluster-3-like AOB dominated bacterial ammonia oxidizers in both paddy and upland soils, regardless of fertilization treatment. The results of this study suggest that the marine group 1.1a-associated AOA will be better adapted to the flooded paddy field than AOA ecotypes of the soil group 1.1b lineage, and indicate that long-term flooding is the dominant selective force

  8. Conversion of upland to paddy field specifically alters the community structure of archaeal ammonia oxidizers in an acid soil

    Science.gov (United States)

    Alam, M. S.; Ren, G. D.; Lu, L.; Zheng, Y.; Peng, X. H.; Jia, Z. J.

    2013-08-01

    The function of ammonia-oxidizing archaea (AOA) and bacteria (AOB) depends on the major energy-generating compounds (i.e., ammonia and oxygen). The diversification of AOA and AOB communities along ecological gradients of substrate availability in a complex environment have been much debated but rarely tested. In this study, two ecosystems of maize and rice crops under different fertilization regimes were selected to investigate the community diversification of soil AOA and AOB upon conversion of an upland field to a paddy field and long-term field fertilization in an acid soil. Real-time quantitative polymerase chain reaction of ammonia monooxygenase (amoA) genes demonstrated that the abundance of AOA was significantly stimulated after conversion of upland to paddy soils for more than 100 yr, whereas a slight decline in AOB numbers was observed. Denaturing gradient gel electrophoresis fingerprints of amoA genes further revealed remarkable changes in the community compositions of AOA after conversion of aerobic upland to flooded paddy field. Sequencing analysis revealed that upland soil was dominated by AOA within the soil group 1.1b lineage, whereas the marine group 1.1a-associated lineage predominated in AOA communities in paddy soils. Irrespective of whether the soil was upland or paddy soil, long-term field fertilization led to increased abundance of amoA genes in AOA and AOB compared with control treatments (no fertilization), whereas archaeal amoA gene abundances outnumbered their bacterial counterparts in all samples. Phylogenetic analyses of amoA genes showed that Nitrosospira cluster-3-like AOB dominated bacterial ammonia oxidizers in both paddy and upland soils, regardless of fertilization treatment. The results of this study suggest that the marine group 1.1a-associated AOA will be better adapted to the flooded paddy field than AOA ecotypes of the soil group 1.1b lineage, and indicate that long-term flooding is the dominant selective force driving the

  9. Acidianus Tailed Spindle Virus: a New Archaeal Large Tailed Spindle Virus Discovered by Culture-Independent Methods

    Science.gov (United States)

    Hochstein, Rebecca A.; Amenabar, Maximiliano J.; Munson-McGee, Jacob H.; Boyd, Eric S.

    2016-01-01

    this research, we report a virus-centered approach to virus discovery and characterization, linking viral metagenomic sequences to a virus particle, its sequenced genome, and its host directly in environmental samples, without using culture-dependent methods. This approach provides a pathway for the discovery, isolation, and characterization of new viruses. While this study used an acidic hot spring environment to characterize a new archaeal virus, Acidianus tailed spindle virus (ATSV), the approach can be generally applied to any environment to expand knowledge of virus diversity in all three domains of life. PMID:26763997

  10. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

    International Nuclear Information System (INIS)

    A hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from S. solfataricus P1 has been crystallized as a recombinant protein with a vector-derived long N-terminal extension region. The P43212 crystals of recombinant ARF diffracted to 1.85 Å resolution using synchrotron radiation. The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule

  11. Abundance and Diversity of Bacterial, Archaeal, and Fungal Communities Along an Altitudinal Gradient in Alpine Forest Soils: What Are the Driving Factors?

    Science.gov (United States)

    Siles, José A; Margesin, Rosa

    2016-07-01

    Shifts in soil microbial communities over altitudinal gradients and the driving factors are poorly studied. Their elucidation is indispensable to gain a comprehensive understanding of the response of ecosystems to global climate change. Here, we investigated soil archaeal, bacterial, and fungal communities at four Alpine forest sites representing a climosequence, over an altitudinal gradient from 545 to 2000 m above sea level (asl), regarding abundance and diversity by using qPCR and Illumina sequencing, respectively. Archaeal community was dominated by Thaumarchaeota, and no significant shifts were detected in abundance or community composition with altitude. The relative bacterial abundance increased at higher altitudes, which was related to increasing levels of soil organic matter and nutrients with altitude. Shifts in bacterial richness and diversity as well as community structure (comprised basically of Proteobacteria, Acidobacteria, Actinobacteria, and Bacteroidetes) significantly correlated with several environmental and soil chemical factors, especially soil pH. The site at the lowest altitude harbored the highest bacterial richness and diversity, although richness/diversity community properties did not show a monotonic decrease along the gradient. The relative size of fungal community also increased with altitude and its composition comprised Ascomycota, Basidiomycota, and Zygomycota. Changes in fungal richness/diversity and community structure were mainly governed by pH and C/N, respectively. The variation of the predominant bacterial and fungal classes over the altitudinal gradient was the result of the environmental and soil chemical factors prevailing at each site. PMID:26961712

  12. Generation of siRNA Nanosheets for Efficient RNA Interference

    Science.gov (United States)

    Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

    2016-04-01

    After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

  13. Shapes of interacting RNA complexes

    DEFF Research Database (Denmark)

    Fu, Benjamin Mingming; Reidys, Christian

    2014-01-01

    Shapes of interacting RNA complexes are studied using a filtration via their topological genus. A shape of an RNA complex is obtained by (iteratively) collapsing stacks and eliminating hairpin loops.This shape-projection preserves the topological core of the RNA complex and for fixed topological ...... sampling algorithm for shapes of RNA complexes of fixed topological genus.......Shapes of interacting RNA complexes are studied using a filtration via their topological genus. A shape of an RNA complex is obtained by (iteratively) collapsing stacks and eliminating hairpin loops.This shape-projection preserves the topological core of the RNA complex and for fixed topological...... genus there are only finitely many such shapes. Our main result is a new bijection that relates the shapes of RNA complexes with shapes of RNA structures. This allows to compute the shape polynomial of RNA complexes via the shape polynomial of RNA structures. We furthermore present a linear time uniform...

  14. Studying RNA-protein interactions in vivo by RNA immunoprecipitation

    DEFF Research Database (Denmark)

    Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q

    2011-01-01

    The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases an...

  15. mRNA turnover rate limits siRNA and microRNA efficacy

    OpenAIRE

    Larsson, Erik; Sander, Chris; Marks, Debora

    2010-01-01

    What determines how strongly an mRNA responds to a microRNA or an siRNA? We know that properties of the sequence match between the small RNA and the mRNA are crucial. However, large-scale validations of siRNA efficacies have shown that certain transcripts remain recalcitrant to perturbation even after repeated redesign of the siRNA (Krueger et al, 2007). Weak response to RNAi may thus be an inherent property of the mRNA, but the underlying factors have proven difficult to uncover. siRNAs indu...

  16. Affinity of ribosomal protein S8 from mesophilic and (hyper)thermophilic archaea and bacteria for 16S rRNA correlates with the growth temperatures of the organisms.

    Science.gov (United States)

    Gruber, Thomas; Köhrer, Caroline; Lung, Birgit; Shcherbakov, Dmitri; Piendl, Wolfgang

    2003-08-14

    The ribosomal protein S8 plays a pivotal role in the assembly of the 30S ribosomal subunit. Using filter binding assays, S8 proteins from mesophilic, and (hyper)thermophilic species of the archaeal genus Methanococcus and from the bacteria Escherichia coli and Thermus thermophilus were tested for their affinity to their specific 16S rRNA target site. S8 proteins from hyperthermophiles exhibit a 100-fold and S8 from thermophiles exhibit a 10-fold higher affinity than their mesophilic counterparts. Thus, there is a striking correlation of affinity of S8 proteins for their specific RNA binding site and the optimal growth temperatures of the respective organisms. The stability of individual rRNA-protein complexes might modulate the stability of the ribosome, providing a maximum of thermostability and flexibility at the growth temperature of the organism.

  17. Simultaneous RNA-DNA FISH.

    Science.gov (United States)

    Lai, Lan-Tian; Meng, Zhenyu; Shao, Fangwei; Zhang, Li-Feng

    2016-01-01

    A highly useful tool for studying lncRNAs is simultaneous RNA-DNA FISH, which reveals the localization and quantitative information of RNA and DNA in cellular contexts. However, a simple combination of RNA FISH and DNA FISH often generates disappointing results because the fragile RNA signals are often damaged by the harsh conditions used in DNA FISH for denaturing the DNA. Here, we describe a robust and simple RNA-DNA FISH protocol, in which amino-labeled nucleic acid probes are used for RNA FISH. The method is suitable to detect single-RNA molecules simultaneously with DNA.

  18. The Bridge Helix of RNA Polymerase Acts as a Central Nanomechanical Switchboard for Coordinating Catalysis and Substrate Movement

    Directory of Open Access Journals (Sweden)

    Robert O. J. Weinzierl

    2011-01-01

    Full Text Available The availability of in vitro assembly systems to produce recombinant archaeal RNA polymerases (RNAPs offers one of the most powerful experimental tools for investigating the still relatively poorly understood molecular mechanisms underlying RNAP function. Over the last few years, we pioneered new robot-based high-throughput mutagenesis approaches to study structure/function relationships within various domains surrounding the catalytic center. The Bridge Helix domain, which appears in numerous X-ray structures as a 35-amino-acid-long alpha helix, coordinates the concerted movement of several other domains during catalysis through kinking of two discrete molecular hinges. Mutations affecting these kinking mechanisms have a direct effect on the specific catalytic activity of RNAP and can in some instances more than double it. Molecular dynamics simulations have established themselves as exceptionally useful for providing additional insights and detailed models to explain the underlying structural motions.

  19. Yeast nuclear RNA processing

    Institute of Scientific and Technical Information of China (English)

    Jade; Bernstein; Eric; A; Toth

    2012-01-01

    Nuclear RNA processing requires dynamic and intricately regulated machinery composed of multiple enzymes and their cofactors.In this review,we summarize recent experiments using Saccharomyces cerevisiae as a model system that have yielded important insights regarding the conversion of pre-RNAs to functional RNAs,and the elimination of aberrant RNAs and unneeded intermediates from the nuclear RNA pool.Much progress has been made recently in describing the 3D structure of many elements of the nuclear degradation machinery and its cofactors.Similarly,the regulatory mechanisms that govern RNA processing are gradually coming into focus.Such advances invariably generate many new questions,which we highlight in this review.

  20. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup

    2012-01-01

    Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...... pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways....

  1. Co-occurrence patterns for abundant marine archaeal and bacterial lineages in the deep chlorophyll maximum of coastal California

    OpenAIRE

    Beman, J. Michael; Steele, Joshua A; Fuhrman, Jed A.

    2011-01-01

    Microorganisms remineralize and respire half of marine primary production, yet the niches occupied by specific microbial groups, and how these different groups may interact, are poorly understood. In this study, we identify co-occurrence patterns for marine Archaea and specific bacterial groups in the chlorophyll maximum of the Southern California Bight. Quantitative PCR time series of marine group 1 (MG1) Crenarchaeota 16S rRNA genes varied substantially over time but were well-correlated (r...

  2. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  3. Mechanisms for the export of archaeal lipids down the water column in the upwelling area off Cape Blanc, North-West Africa

    Science.gov (United States)

    Ebersbach, Friederike; Goldenstein, Nadine; Iversen, Morten; Mollenhauer, Gesine; Hinrichs, Kai-Uwe

    2016-04-01

    Transport mechanisms of microbial membrane lipids from surface waters to the seafloor are poorly understood. In particular, pelagic archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) from planktonic archaea are frequently used for reconstruction of ancient sea surface temperatures (Schouten et al. 2013). Because planktonic archaea are too small and neutrally buoyant to sink independently, transport vehicles for efficient export of fossil archaeal biomarkers to the sediment are required. The surface ocean is coupled with the deep ocean through biogenic sinking particles, a process known as the biological pump (Volk and Hoffert 1985). Two different pathways for particle formation, mainly taking place in the mesopelagic zone, are distinguished: Direct aggregation of phytoplankton blooms or grazing, resulting in phyto-detrital aggregates or reprocessed faecal material, respectively. Grazing and packaging into sinking particles is a possible export mechanism for GDGTs (Huguet et al. 2006). Moreover, it is assumed that phyto-detrital aggregates also play an important role in transporting GDGTs to the deep (Mollenhauer et al. 2015), but processes behind this pathway remain unclear. However, there are only few studies that link GDGT signals in sinking particles to the composition of the exported particulate matter (e.g. Yamamoto et al., 2012; Mollenhauer et al. 2015). Here we investigate sinking particles and suspended particulate matter (SPM) from spring blooms in 2012 and 2013 in the upwelling region in the Atlantic Ocean off Cape Blanc, Mauritania. We compare for the first time material from free-floating sediment traps (100, 200 and 400 m; purely sinking particles) with sinking particles and SPM from size fractionated in-situ pump (ISP) filters (several depths between 40 and 2350 m). This setup allows to relate the signal from archaeal lipids to (i) the flux of particulate organic carbon and the particle assemblages as revealed by the characterisation of

  4. The oxidative pentose phosphate pathway in the haloarchaeon Haloferax volcanii involves a novel type of glucose-6-phosphate dehydrogenase--The archaeal Zwischenferment.

    Science.gov (United States)

    Pickl, Andreas; Schönheit, Peter

    2015-04-28

    The oxidative pentose phosphate pathway (OPPP), catalyzing the oxidation of glucose-6-phosphate to ribulose-5-phosphate is ubiquitous in eukarya and bacteria but has not yet been reported in archaea. In haloarchaea a putative 6-phosphogluconate dehydrogenase (6PGDH) is annotated, whereas a gene coding for glucose-6-phosphate dehydrogenase (Glc6PDH) could not be identified. Here we report the purification and characterization of a novel type of Glc6PDH in Haloferax volcanii that is not related to bacterial and eukaryal Glc6PDHs and the encoding gene is designated as azf (archaeal zwischenferment). Further, recombinant H. volcanii 6PGDH was characterized. Deletion mutant analyses indicate that both, Glc6PDH and 6PGDH, are functionally involved in pentose phosphate formation in vivo. This is the first report on the operation of the OPPP in the domain of archaea.

  5. Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains.

    Science.gov (United States)

    Whitman, William B; Woyke, Tanja; Klenk, Hans-Peter; Zhou, Yuguang; Lilburn, Timothy G; Beck, Brian J; De Vos, Paul; Vandamme, Peter; Eisen, Jonathan A; Garrity, George; Hugenholtz, Philip; Kyrpides, Nikos C

    2015-01-01

    The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity.

  6. Exploring the biotechnologial applications in the archaeal domain Explorando as aplicações biotecnológicas do domínio archaea

    Directory of Open Access Journals (Sweden)

    S.M.C. Alquéres

    2007-09-01

    Full Text Available Archaea represent a considerable fraction of the prokaryotic world in marine and terrestrial ecosystems, indicating that organisms from this domain might have a large impact on global energy cycles. The extremophilic nature of many archaea has stimulated intense efforts to understand the physiological adaptations for living in extreme environments. Their unusual properties make them a potentially valuable resource in the development of novel biotechnological processes and industrial applications as new pharmaceuticals, cosmetics, nutritional supplements, molecular probes, enzymes, and fine chemicals. In the present mini-review, we show and discuss some exclusive characteristics of Archaea domain and the current knowledge about the biotechnological uses of the archaeal enzymes. The topics are: archaeal characteristics, phylogenetic division, biotechnological applications, isolation and cultivation of new microbes, achievements in genomics, and metagenomic.As arqueas representam uma considerável fração dos procariotos nos ecossistemas marinhos e terrestes, indicando que estes organismos devem possuir um grande impacto nos ciclos energéticos. A natureza extremofílica de muitas arqueas tem estimulado intensos esforços para compreender sua adaptação fisiológica a ambientes extremos. Suas propriedades incomus as tornam uma fonte valiosa no desenvolvimento de novos processos biotecnológicos e aplicações industriais como novos fármacos, cosméticos, suplementos nutricionais, sondas moleculares, enzimas e reagentes. Na presente mini-revisão, mostramos e discutimos algumas de suas características exclusivas correlacionando-as com seu potencial biotecnológico e aplicação industrial. Os tópicos são: características das arqueas, divisão filogenética, aplicações biotecnológicas, isolamento e cultivo de novos microrganismos, genoma e metagenoma.

  7. Shaping tRNA

    Science.gov (United States)

    Priano, Christine

    2013-01-01

    This model-building activity provides a quick, visual, hands-on tool that allows students to examine more carefully the cloverleaf structure of a typical tRNA molecule. When used as a supplement to lessons that involve gene expression, this exercise reinforces several concepts in molecular genetics, including nucleotide base-pairing rules, the…

  8. The RNA interference revolution

    Directory of Open Access Journals (Sweden)

    G. Lenz

    2005-12-01

    Full Text Available The discovery of double-stranded RNA-mediated gene silencing has rapidly led to its use as a method of choice for blocking a gene, and has turned it into one of the most discussed topics in cell biology. Although still in its infancy, the field of RNA interference has already produced a vast array of results, mainly in Caenorhabditis elegans, but recently also in mammalian systems. Micro-RNAs are short hairpins of RNA capable of blocking translation, which are transcribed from genomic DNA and are implicated in several aspects from development to cell signaling. The present review discusses the main methods used for gene silencing in cell culture and animal models, including the selection of target sequences, delivery methods and strategies for a successful silencing. Expected developments are briefly discussed, ranging from reverse genetics to therapeutics. Thus, the development of the new paradigm of RNA-mediated gene silencing has produced two important advances: knowledge of a basic cellular mechanism present in the majority of eukaryotic cells and access to a potent and specific new method for gene silencing.

  9. 海南东寨港红树林不同植被土壤微生物群落结构比较%Comparison of bacterial and archaeal community of mangrove soil under different vegetation in Dongzhaigang,Hainan Island

    Institute of Scientific and Technical Information of China (English)

    任健; 阎冰; 洪葵

    2012-01-01

    [Objective] We compared bacterial and archaeal diversity and community structure of mangrove soil under different vegetation, and to reveal better understanding of microbial resources. [Methods] Bacterial and arehaeal 16S rRNA gene libraries were constructed and analyzed for soils under Kandelia candel trees. Sonneratia apetala trees, and naked tideland, in Dongzhaigang Mangrove National Nature Reserve of Hainan Island. Template DNA was directly extracted from soil samples. PCR were amplified using primers 27F/1492R (bacterial) and Arch21F/Arch958R (archaeal). [ Results ] A total of 16 phyla dominated by Proteobacteria and Chloroflexi were detected in bacterial libraries, and 6 groups of Crenarchaeota and 7 groups of Euryarchaeota, predominated by Marine Benthic Group C and Marine Benthic Group D, respectively were found in archaeal libraries. 5hannon-Wiener index (H') and Srhaul estimator indicated that soil microbial diversity under the introduced species Sonneratia apetala was much lower than indigenous species Kandelia candel, even lower than naked tidal flat sediment near mangrove. Distinct differences in microbial community structure under different vegetation were observed. Soil microbial community structure under Kandelia candel was much similar with that of naked tideland. [ Conclusion ] Mangrove soil contained rich population of bacteria and archaea; there existed distinct differences in mangrove soil microbial community structure and diversity among different vegetation.%[目的]比较不同植被下红树林土壤细菌和古菌的多样性及群落结构,认识红树林土壤微生物资源多样性.[方法]直接提取红树林土壤总DNA,采用细菌通用引物27F/1492R和古菌通用引物Arch21 F/Arch958R进行PCR扩增,构建细菌和古菌16S rRNA基因文库,对海南东寨港自然保护区秋茄林、无瓣海桑林和无红树林裸滩土壤的细菌和古菌多样性和群落结构进行分析和比较.[结果]3种土壤样品的细菌类

  10. Messenger RNA (mRNA) nanoparticle tumour vaccination

    Science.gov (United States)

    Phua, Kyle K. L.; Nair, Smita K.; Leong, Kam W.

    2014-06-01

    Use of mRNA-based vaccines for tumour immunotherapy has gained increasing attention in recent years. A growing number of studies applying nanomedicine concepts to mRNA tumour vaccination show that the mRNA delivered in nanoparticle format can generate a more robust immune response. Advances in the past decade have deepened our understanding of gene delivery barriers, mRNA's biological stability and immunological properties, and support the notion for engineering innovations tailored towards a more efficient mRNA nanoparticle vaccine delivery system. In this review we will first examine the suitability of mRNA for engineering manipulations, followed by discussion of a model framework that highlights the barriers to a robust anti-tumour immunity mediated by mRNA encapsulated in nanoparticles. Finally, by consolidating existing literature on mRNA nanoparticle tumour vaccination within the context of this framework, we aim to identify bottlenecks that can be addressed by future nanoengineering research.

  11. A Grammatical Approach to RNA-RNA Interaction Prediction

    Science.gov (United States)

    Kato, Yuki; Akutsu, Tatsuya; Seki, Hiroyuki

    2007-11-01

    Much attention has been paid to two interacting RNA molecules involved in post-transcriptional control of gene expression. Although there have been a few studies on RNA-RNA interaction prediction based on dynamic programming algorithm, no grammar-based approach has been proposed. The purpose of this paper is to provide a new modeling for RNA-RNA interaction based on multiple context-free grammar (MCFG). We present a polynomial time parsing algorithm for finding the most likely derivation tree for the stochastic version of MCFG, which is applicable to RNA joint secondary structure prediction including kissing hairpin loops. Also, elementary tests on RNA-RNA interaction prediction have shown that the proposed method is comparable to Alkan et al.'s method.

  12. Evolutionary patterns in the sequence and structure of transfer RNA: early origins of archaea and viruses.

    Directory of Open Access Journals (Sweden)

    Feng-Jie Sun

    2008-03-01

    Full Text Available Transfer RNAs (tRNAs are ancient molecules that are central to translation. Since they probably carry evolutionary signatures that were left behind when the living world diversified, we reconstructed phylogenies directly from the sequence and structure of tRNA using well-established phylogenetic methods. The trees placed tRNAs with long variable arms charging Sec, Tyr, Ser, and Leu consistently at the base of the rooted phylogenies, but failed to reveal groupings that would indicate clear evolutionary links to organismal origin or molecular functions. In order to uncover evolutionary patterns in the trees, we forced tRNAs into monophyletic groups using constraint analyses to generate timelines of organismal diversification and test competing evolutionary hypotheses. Remarkably, organismal timelines showed Archaea was the most ancestral superkingdom, followed by viruses, then superkingdoms Eukarya and Bacteria, in that order, supporting conclusions from recent phylogenomic studies of protein architecture. Strikingly, constraint analyses showed that the origin of viruses was not only ancient, but was linked to Archaea. Our findings have important implications. They support the notion that the archaeal lineage was very ancient, resulted in the first organismal divide, and predated diversification of tRNA function and specificity. Results are also consistent with the concept that viruses contributed to the development of the DNA replication machinery during the early diversification of the living world.

  13. Analysis of dsDNA and RNA viromes in methanogenic digesters reveals novel viral genetic diversity.

    Science.gov (United States)

    Calusinska, Magdalena; Marynowska, Martyna; Goux, Xavier; Lentzen, Esther; Delfosse, Philippe

    2016-04-01

    Although viruses are not the key players of the anaerobic digestion process, they may affect the dynamics of bacterial and archaeal populations involved in biogas production. Until now viruses have received very little attention in this specific habitat; therefore, as a first step towards their characterization, we optimized a virus filtration protocol from anaerobic sludge. Afterwards, to assess dsDNA and RNA viral diversity in sludge samples from nine different reactors fed either with waste water, agricultural residues or solid municipal waste plus agro-food residues, we performed metagenomic analyses. As a result we showed that, while the dsDNA viromes (21 assigned families in total) were dominated by dsDNA phages of the order Caudovirales, RNA viruses (14 assigned families in total) were less diverse and were for the main part plant-infecting viruses. Interestingly, less than 2% of annotated contigs were assigned as putative human and animal pathogens. Our study greatly extends the existing view of viral genetic diversity in methanogenic reactors and shows that these viral assemblages are distinct not only among the reactor types but also from nearly 30 other environments already studied, including the human gut, fermented food, deep sea sediments and other aquatic habitats. PMID:26568175

  14. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double strand

  15. Natural RNA circles function as efficient microRNA sponges

    DEFF Research Database (Denmark)

    Hansen, Thomas Birkballe; Jensen, Trine I; Clausen, Bettina Hjelm;

    2013-01-01

    MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so-called comp......MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so......-called competing endogenous RNA in humans and target mimicry in plants. We previously identified a highly expressed circular RNA (circRNA) in human and mouse brain. Here we show that this circRNA acts as a miR-7 sponge; we term this circular transcript ciRS-7 (circular RNA sponge for miR-7). ciRS-7 contains more...... sponge, suggesting that miRNA sponge effects achieved by circRNA formation are a general phenomenon. This study serves as the first, to our knowledge, functional analysis of a naturally expressed circRNA....

  16. Transcriptomics in the tropics: Total RNA-based profiling of Costa Rican bromeliad-associated communities

    Directory of Open Access Journals (Sweden)

    Shana K. Goffredi

    2015-01-01

    Full Text Available RNA-Seq was used to examine the microbial, eukaryotic, and viral communities in water catchments (‘tanks’ formed by tropical bromeliads from Costa Rica. In total, transcripts with taxonomic affiliation to a wide array of bacteria, archaea, and eukaryotes, were observed, as well as RNA-viruses that appeared related to the specific presence of eukaryotes. Bacteria from 25 phyla appeared to comprise the majority of transcripts in one tank (Wg24, compared to only 14 phyla in the other (Wg25. Conversely, eukaryotes from only 16 classes comprised the majority of transcripts in Wg24, compared to 24 classes in the Wg25, revealing a greater eukaryote diversity in the latter. Given that these bromeliads had tanks of similar size (i.e. vertical oxygen gradient, and were neighboring with presumed similar light regime and acquisition of leaf litter through-fall, it is possible that pH was the factor governing these differences in bacterial and eukaryotic communities (Wg24 had a tank pH of 3.6 and Wg25 had a tank pH of 6.2. Archaeal diversity was similar in both tanks, represented by 7 orders, with the exception of Methanocellales transcripts uniquely recovered from Wg25. Based on measures of FPKG (fragments mapped per kilobase of gene length, genes involved in methanogenesis, in addition to a spirochaete flagellin gene, were among those most highly expressed in Wg25. Conversely, aldehyde dehydrogenase and monosaccharide-binding protein were among genes most highly expressed in Wg24. The ability to observe specific presence of insect, plant, and fungi-associated RNA-viruses was unexpected. As with other techniques, there are inherent biases in the use of RNA-Seq, however, these data suggest the possibility of understanding the entire community, including ecological interactions, via simultaneous analysis of microbial, eukaryotic, and viral transcripts.

  17. Transcriptomics in the tropics: Total RNA-based profiling of Costa Rican bromeliad-associated communities.

    Science.gov (United States)

    Goffredi, Shana K; Jang, Gene E; Haroon, Mohamed F

    2015-01-01

    RNA-Seq was used to examine the microbial, eukaryotic, and viral communities in water catchments ('tanks') formed by tropical bromeliads from Costa Rica. In total, transcripts with taxonomic affiliation to a wide array of bacteria, archaea, and eukaryotes, were observed, as well as RNA-viruses that appeared related to the specific presence of eukaryotes. Bacteria from 25 phyla appeared to comprise the majority of transcripts in one tank (Wg24), compared to only 14 phyla in the other (Wg25). Conversely, eukaryotes from only 16 classes comprised the majority of transcripts in Wg24, compared to 24 classes in the Wg25, revealing a greater eukaryote diversity in the latter. Given that these bromeliads had tanks of similar size (i.e. vertical oxygen gradient), and were neighboring with presumed similar light regime and acquisition of leaf litter through-fall, it is possible that pH was the factor governing these differences in bacterial and eukaryotic communities (Wg24 had a tank pH of 3.6 and Wg25 had a tank pH of 6.2). Archaeal diversity was similar in both tanks, represented by 7 orders, with the exception of Methanocellales transcripts uniquely recovered from Wg25. Based on measures of FPKG (fragments mapped per kilobase of gene length), genes involved in methanogenesis, in addition to a spirochaete flagellin gene, were among those most highly expressed in Wg25. Conversely, aldehyde dehydrogenase and monosaccharide-binding protein were among genes most highly expressed in Wg24. The ability to observe specific presence of insect, plant, and fungi-associated RNA-viruses was unexpected. As with other techniques, there are inherent biases in the use of RNA-Seq, however, these data suggest the possibility of understanding the entire community, including ecological interactions, via simultaneous analysis of microbial, eukaryotic, and viral transcripts. PMID:25755850

  18. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.;

    2011-01-01

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive...... public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. 2010 Elsevier Ltd. All rights reserved....

  19. RNA Interference in livestock

    OpenAIRE

    Merkl, Claudia

    2010-01-01

    RNA Interference (RNAi) allows experimental reduction of gene expression, providing a tool for the investigation of gene function, disease therapy and the generation of animal models for human diseases. RNAi offers an opportunity to carry out precise genetic manipulations in a wide variety of species. This thesis describes the use of RNAi to downregulate two porcine genes, the whey protein Beta-Lactoglobulin (BLG) and the tumor suppressor protein p53. BLG is a major component in porcine and r...

  20. A miRNA-tRNA mix-up: tRNA origin of proposed miRNA.

    Science.gov (United States)

    Schopman, Nick C T; Heynen, Stephan; Haasnoot, Joost; Berkhout, Ben

    2010-01-01

    The rapid release of new data from DNA genome sequencing projects has led to a variety of misannotations in public databases. Our results suggest that next generation sequencing approaches are particularly prone to such misannotations. Two related miRNA candidates did recently enter the miRBase database, miR-1274b and miR-1274a, but they share identical 18-nucleotide stretches with tRNA (Lys3) and tRNA (Lys5) , respectively. The possibility that the small RNA fragments that led to the description of these two miRNAs originated from the two tRNAs was examined. The ratio of the miR-1274b:miR-1274a fragments does closely resemble the known tRNA lys3:lys5 ratio in the cell. Furthermore, the proposed miRNA hairpins have a very low prediction score and the proposed miRNA genes are in fact endogenous retroviral elements. We searched for other miRNA-mimics in the human genome and found more examples of tRNA-miRNA mimicry. We propose that the corresponding miRNAs should be validated in more detail, as the small RNA fragments that led to their description are likely derived from tRNA processing. PMID:20818168

  1. RNA-SSPT: RNA Secondary Structure Prediction Tools.

    Science.gov (United States)

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes. PMID:24250115

  2. Current preclinical small interfering RNA (siRNA)-based conjugate systems for RNA therapeutics.

    Science.gov (United States)

    Lee, Soo Hyeon; Kang, Yoon Young; Jang, Hyo-Eun; Mok, Hyejung

    2016-09-01

    Recent promising clinical results of RNA therapeutics have drawn big attention of academia and industries to RNA therapeutics and their carrier systems. To improve their feasibility in clinics, systemic evaluations of currently available carrier systems under clinical trials and preclinical studies are needed. In this review, we focus on recent noticeable preclinical studies and clinical results regarding siRNA-based conjugates for clinical translations. Advantages and drawbacks of siRNA-based conjugates are discussed, compared to particle-based delivery systems. Then, representative siRNA-based conjugates with aptamers, peptides, carbohydrates, lipids, polymers, and nanostructured materials are introduced. To improve feasibility of siRNA conjugates in preclinical studies, several considerations for the rational design of siRNA conjugates in terms of cleavability, immune responses, multivalent conjugations, and mechanism of action are also presented. Lastly, we discuss lessons from previous preclinical and clinical studies related to siRNA conjugates and perspectives of their clinical applications. PMID:26514375

  3. Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.

    Science.gov (United States)

    Kojima, Kenji K; Jurka, Jerzy

    2015-01-01

    Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480

  4. A comparison of rpoB and 16S rRNA as markers in pyrosequencing studies of bacterial diversity.

    Directory of Open Access Journals (Sweden)

    Michiel Vos

    Full Text Available BACKGROUND: The 16S rRNA gene is the gold standard in molecular surveys of bacterial and archaeal diversity, but it has the disadvantages that it is often multiple-copy, has little resolution below the species level and cannot be readily interpreted in an evolutionary framework. We compared the 16S rRNA marker with the single-copy, protein-coding rpoB marker by amplifying and sequencing both from a single soil sample. Because the higher genetic resolution of the rpoB gene prohibits its use as a universal marker, we employed consensus-degenerate primers targeting the Proteobacteria. METHODOLOGY/PRINCIPAL FINDINGS: Pyrosequencing can be problematic because of the poor resolution of homopolymer runs. As these erroneous runs disrupt the reading frame of protein-coding sequences, removal of sequences containing nonsense mutations was found to be a valuable filter in addition to flowgram-based denoising. Although both markers gave similar estimates of total diversity, the rpoB marker revealed more species, requiring an order of magnitude fewer reads to obtain 90% of the true diversity. The application of population genetic methods was demonstrated on a particularly abundant sequence cluster. CONCLUSIONS/SIGNIFICANCE: The rpoB marker can be a complement to the 16S rRNA marker for high throughput microbial diversity studies focusing on specific taxonomic groups. Additional error filtering is possible and tests for recombination or selection can be employed.

  5. An integrated study reveals diverse methanogens, Thaumarchaeota, and yet-uncultivated archaeal lineages in Armenian hot springs.

    Science.gov (United States)

    Hedlund, Brian P; Dodsworth, Jeremy A; Cole, Jessica K; Panosyan, Hovik H

    2013-07-01

    Culture-independent and enrichment techniques, with an emphasis on members of the Archaea, were used to determine the composition and structure of microbial communities inhabiting microbial mats in the source pools of two geothermal springs near the towns of Arzakan and Jermuk in Armenia. Amplification of small-subunit rRNA genes using "universal" primers followed by pyrosequencing (pyrotags) revealed highly diverse microbial communities in both springs, with >99 % of pyrosequences corresponding to members of the domain Bacteria. The spring in Arzakan was colonized by a photosynthetic mat dominated by Cyanobacteria, in addition to Proteobacteria, Bacteroidetes, Chloroflexi, Spirochaeta and a diversity of other Bacteria. The spring in Jermuk was colonized by phylotypes related to sulfur, iron, and hydrogen chemolithotrophs in the Betaproteobacteria and Epsilonproteobacteria, along with a diversity of other Bacteria. Analysis of near full-length small subunit rRNA genes amplified using Archaea-specific primers showed that both springs are inhabited by a diversity of methanogens, including Methanomicrobiales and Methanosarcinales and relatives of Methanomassiliicoccus luminyensis, close relatives of the ammonia-oxidizing archaeon (AOA) "Candidatus Nitrososphaera gargensis", and the yet-uncultivated Miscellaneous Crenarchaeotal Group and Deep Hydrothermal Vent Crenarchaeota group 1. Methanogenic enrichments confirmed the predicted physiological diversity, revealing methylotrophic, acetoclastic, and hydrogenotrophic methanogenesis at 45 and 55 °C, but not 65 °C. This is one of only a few studies combining cultivation-independent and -dependent approaches to study archaea in moderate-temperature (37-73 °C) terrestrial geothermal environments and suggests important roles for methanogenic archaea and AOA in the carbon and nitrogen biogeochemical cycles in these environments. PMID:23632917

  6. An integrated study reveals diverse methanogens, Thaumarchaeota, and yet-uncultivated archaeal lineages in Armenian hot springs.

    Science.gov (United States)

    Hedlund, Brian P; Dodsworth, Jeremy A; Cole, Jessica K; Panosyan, Hovik H

    2013-07-01

    Culture-independent and enrichment techniques, with an emphasis on members of the Archaea, were used to determine the composition and structure of microbial communities inhabiting microbial mats in the source pools of two geothermal springs near the towns of Arzakan and Jermuk in Armenia. Amplification of small-subunit rRNA genes using "universal" primers followed by pyrosequencing (pyrotags) revealed highly diverse microbial communities in both springs, with >99 % of pyrosequences corresponding to members of the domain Bacteria. The spring in Arzakan was colonized by a photosynthetic mat dominated by Cyanobacteria, in addition to Proteobacteria, Bacteroidetes, Chloroflexi, Spirochaeta and a diversity of other Bacteria. The spring in Jermuk was colonized by phylotypes related to sulfur, iron, and hydrogen chemolithotrophs in the Betaproteobacteria and Epsilonproteobacteria, along with a diversity of other Bacteria. Analysis of near full-length small subunit rRNA genes amplified using Archaea-specific primers showed that both springs are inhabited by a diversity of methanogens, including Methanomicrobiales and Methanosarcinales and relatives of Methanomassiliicoccus luminyensis, close relatives of the ammonia-oxidizing archaeon (AOA) "Candidatus Nitrososphaera gargensis", and the yet-uncultivated Miscellaneous Crenarchaeotal Group and Deep Hydrothermal Vent Crenarchaeota group 1. Methanogenic enrichments confirmed the predicted physiological diversity, revealing methylotrophic, acetoclastic, and hydrogenotrophic methanogenesis at 45 and 55 °C, but not 65 °C. This is one of only a few studies combining cultivation-independent and -dependent approaches to study archaea in moderate-temperature (37-73 °C) terrestrial geothermal environments and suggests important roles for methanogenic archaea and AOA in the carbon and nitrogen biogeochemical cycles in these environments.

  7. Transfer RNA and human disease

    Directory of Open Access Journals (Sweden)

    Jamie A Abbott

    2014-06-01

    Full Text Available Pathological mutations in tRNA genes and tRNA processing enzymes are numerous and result in very complicated clinical phenotypes. Mitochondrial tRNA (mt-tRNA genes are hotspots for pathological mutations and over 200 mt-tRNA mutations have been linked to various disease states. Often these mutations prevent tRNA aminoacylation. Disrupting this primary function affects protein synthesis and the expression, folding, and function of oxidative phosphorylation enzymes. Mitochondrial tRNA mutations manifest in a wide panoply of diseases related to cellular energetics, including COX deficiency (cytochrome C oxidase, mitochondrial myopathy, MERRF (Myoclonic Epilepsy with Ragged Red Fibers, and MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes. Diseases caused by mt-tRNA mutations can also affect very specific tissue types, as in the case of neurosensory non-syndromic hearing loss and pigmentary retinopathy, diabetes mellitus, and hypertrophic cardiomyopathy. Importantly, mitochondrial heteroplasmy plays a role in disease severity and age of onset as well. Not surprisingly, mutations in enzymes that modify cytoplasmic and mitochondrial tRNAs are also linked to a diverse range of clinical phenotypes. In addition to compromised aminoacylation of the tRNAs, mutated modifying enzymes can also impact tRNA expression and abundance, tRNA modifications, tRNA folding, and even tRNA maturation (e.g., splicing. Some of these pathological mutations in tRNAs and processing enzymes are likely to affect non-canonical tRNA functions, and contribute to the diseases without significantly impacting on translation. This chapter will review recent literature on the relation of mitochondrial and cytoplasmic tRNA, and enzymes that process tRNAs, to human disease. We explore the mechanisms involved in the clinical presentation of these various diseases with an emphasis on neurological disease.

  8. RNA Thermodynamic Structural Entropy.

    Directory of Open Access Journals (Sweden)

    Juan Antonio Garcia-Martin

    Full Text Available Conformational entropy for atomic-level, three dimensional biomolecules is known experimentally to play an important role in protein-ligand discrimination, yet reliable computation of entropy remains a difficult problem. Here we describe the first two accurate and efficient algorithms to compute the conformational entropy for RNA secondary structures, with respect to the Turner energy model, where free energy parameters are determined from UV absorption experiments. An algorithm to compute the derivational entropy for RNA secondary structures had previously been introduced, using stochastic context free grammars (SCFGs. However, the numerical value of derivational entropy depends heavily on the chosen context free grammar and on the training set used to estimate rule probabilities. Using data from the Rfam database, we determine that both of our thermodynamic methods, which agree in numerical value, are substantially faster than the SCFG method. Thermodynamic structural entropy is much smaller than derivational entropy, and the correlation between length-normalized thermodynamic entropy and derivational entropy is moderately weak to poor. In applications, we plot the structural entropy as a function of temperature for known thermoswitches, such as the repression of heat shock gene expression (ROSE element, we determine that the correlation between hammerhead ribozyme cleavage activity and total free energy is improved by including an additional free energy term arising from conformational entropy, and we plot the structural entropy of windows of the HIV-1 genome. Our software RNAentropy can compute structural entropy for any user-specified temperature, and supports both the Turner'99 and Turner'04 energy parameters. It follows that RNAentropy is state-of-the-art software to compute RNA secondary structure conformational entropy. Source code is available at https://github.com/clotelab/RNAentropy/; a full web server is available at http

  9. Identifying microRNA/mRNA dysregulations in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Miles Gregory D

    2012-03-01

    Full Text Available Abstract Background MicroRNAs are a class of noncoding RNA molecules that co-regulate the expression of multiple genes via mRNA transcript degradation or translation inhibition. Since they often target entire pathways, they may be better drug targets than genes or proteins. MicroRNAs are known to be dysregulated in many tumours and associated with aggressive or poor prognosis phenotypes. Since they regulate mRNA in a tissue specific manner, their functional mRNA targets are poorly understood. In previous work, we developed a method to identify direct mRNA targets of microRNA using patient matched microRNA/mRNA expression data using an anti-correlation signature. This method, applied to clear cell Renal Cell Carcinoma (ccRCC, revealed many new regulatory pathways compromised in ccRCC. In the present paper, we apply this method to identify dysregulated microRNA/mRNA mechanisms in ovarian cancer using data from The Cancer Genome Atlas (TCGA. Methods TCGA Microarray data was normalized and samples whose class labels (tumour or normal were ambiguous with respect to consensus ensemble K-Means clustering were removed. Significantly anti-correlated and correlated genes/microRNA differentially expressed between tumour and normal samples were identified. TargetScan was used to identify gene targets of microRNA. Results We identified novel microRNA/mRNA mechanisms in ovarian cancer. For example, the expression level of RAD51AP1 was found to be strongly anti-correlated with the expression of hsa-miR-140-3p, which was significantly down-regulated in the tumour samples. The anti-correlation signature was present separately in the tumour and normal samples, suggesting a direct causal dysregulation of RAD51AP1 by hsa-miR-140-3p in the ovary. Other pairs of potentially biological relevance include: hsa-miR-145/E2F3, hsa-miR-139-5p/TOP2A, and hsa-miR-133a/GCLC. We also identified sets of positively correlated microRNA/mRNA pairs that are most likely result from

  10. RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

    2012-04-15

    The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

  11. Alfalfa mosaic virus coat protein bridges RNA and RNA-dependent RNA polymerase in vitro.

    Science.gov (United States)

    Reichert, Vienna L; Choi, Mehee; Petrillo, Jessica E; Gehrke, Lee

    2007-07-20

    Alfalfa mosaic virus (AMV) RNA replication requires the viral coat protein (CP). AMV CP is an integral component of the viral replicase; moreover, it binds to the viral RNA 3'-termini and induces the formation of multiple new base pairs that organize the RNA conformation. The results described here suggest that AMV coat protein binding defines template selection by organizing the 3'-terminal RNA conformation and by positioning the RNA-dependent RNA polymerase (RdRp) at the initiation site for minus strand synthesis. RNA-protein interactions were analyzed by using a modified Northwestern blotting protocol that included both viral coat protein and labeled RNA in the probe solution ("far-Northwestern blotting"). We observed that labeled RNA alone bound the replicase proteins poorly; however, complex formation was enhanced significantly in the presence of AMV CP. The RNA-replicase bridging function of the AMV CP may represent a mechanism for accurate de novo initiation in the absence of canonical 3' transfer RNA signals. PMID:17400272

  12. ALFALFA MOSAIC VIRUS COAT PROTEIN BRIDGES RNA AND RNA-DEPENDENT RNA POLYMERASE IN VITRO

    Science.gov (United States)

    Reichert, Vienna L.; Choi, Mehee; Petrillo, Jessica E.; Gehrke, Lee

    2007-01-01

    Alfalfa mosaic virus (AMV) RNA replication requires the viral coat protein (CP). AMV CP is an integral component of the viral replicase; moreover, it binds to the viral RNA 3' termini and induces the formation of multiple new base pairs that organize the RNA conformation. The results described here suggest that AMV coat protein binding defines template selection by organizing the 3'-terminal RNA conformation and by positioning the RNA-dependent RNA polymerase (RdRp) at the initiation site for minus strand synthesis. RNA-protein interactions were analyzed by using a modified northwestern blotting protocol that included both viral coat protein and labeled RNA in the probe solution (“far-northwestern blotting”). We observed that labeled RNA alone bound the replicase proteins poorly; however, complex formation was enhanced significantly in the presence of AMV CP. The RNA-replicase bridging function of the AMV CP may represent a mechanism for accurate de novo initiation in the absence of canonical 3' transfer RNA signals. PMID:17400272

  13. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob;

    2009-01-01

    Small non-coding regulatory RNAs in bacteria have been shown predominantly to be tightly regulated at the level of transcription initiation, and sRNAs that function by an antisense mechanism on trans-encoded target mRNAs have been shown or predicted to act stoichiometrically. Here we show that Mic......M, which silences the expression of an outer membrane protein, YbfM under most growth conditions, does not become destabilized by target mRNA overexpression, indicating that the small RNA regulator acts catalytically. Furthermore, our regulatory studies suggested that control of micM expression is unlikely...... to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of its...

  14. Aminoacyl-tRNA Synthetases in the Bacterial World.

    Science.gov (United States)

    Giegé, Richard; Springer, Mathias

    2016-05-01

    Aminoacyl-tRNA synthetases (aaRSs) are modular enzymes globally conserved in the three kingdoms of life. All catalyze the same two-step reaction, i.e., the attachment of a proteinogenic amino acid on their cognate tRNAs, thereby mediating the correct expression of the genetic code. In addition, some aaRSs acquired other functions beyond this key role in translation. Genomics and X-ray crystallography have revealed great structural diversity in aaRSs (e.g., in oligomery and modularity, in ranking into two distinct groups each subdivided in 3 subgroups, by additional domains appended on the catalytic modules). AaRSs show huge structural plasticity related to function and limited idiosyncrasies that are kingdom or even species specific (e.g., the presence in many Bacteria of non discriminating aaRSs compensating for the absence of one or two specific aaRSs, notably AsnRS and/or GlnRS). Diversity, as well, occurs in the mechanisms of aaRS gene regulation that are not conserved in evolution, notably between distant groups such as Gram-positive and Gram-negative Bacteria. The review focuses on bacterial aaRSs (and their paralogs) and covers their structure, function, regulation, and evolution. Structure/function relationships are emphasized, notably the enzymology of tRNA aminoacylation and the editing mechanisms for correction of activation and charging errors. The huge amount of genomic and structural data that accumulated in last two decades is reviewed, showing how the field moved from essentially reductionist biology towards more global and integrated approaches. Likewise, the alternative functions of aaRSs and those of aaRS paralogs (e.g., during cell wall biogenesis and other metabolic processes in or outside protein synthesis) are reviewed. Since aaRS phylogenies present promiscuous bacterial, archaeal, and eukaryal features, similarities and differences in the properties of aaRSs from the three kingdoms of life are pinpointed throughout the review and

  15. Quantification of miRNA-mRNA interactions.

    Science.gov (United States)

    Muniategui, Ander; Nogales-Cadenas, Rubén; Vázquez, Miguél; Aranguren, Xabier L; Agirre, Xabier; Luttun, Aernout; Prosper, Felipe; Pascual-Montano, Alberto; Rubio, Angel

    2012-01-01

    miRNAs are small RNA molecules (' 22nt) that interact with their corresponding target mRNAs inhibiting the translation of the mRNA into proteins and cleaving the target mRNA. This second effect diminishes the overall expression of the target mRNA. Several miRNA-mRNA relationship databases have been deployed, most of them based on sequence complementarities. However, the number of false positives in these databases is large and they do not overlap completely. Recently, it has been proposed to combine expression measurement from both miRNA and mRNA and sequence based predictions to achieve more accurate relationships. In our work, we use LASSO regression with non-positive constraints to integrate both sources of information. LASSO enforces the sparseness of the solution and the non-positive constraints restrict the search of miRNA targets to those with down-regulation effects on the mRNA expression. We named this method TaLasso (miRNA-Target LASSO).We used TaLasso on two public datasets that have paired expression levels of human miRNAs and mRNAs. The top ranked interactions recovered by TaLasso are especially enriched (more than using any other algorithm) in experimentally validated targets. The functions of the genes with mRNA transcripts in the top-ranked interactions are meaningful. This is not the case using other algorithms.TaLasso is available as Matlab or R code. There is also a web-based tool for human miRNAs at http://talasso.cnb.csic.es/.

  16. Relating the Diversity, Abundance, and Activity of Ammonia-Oxidizing Archaeal Communities to Nitrification Rates in the Coastal Ocean

    Science.gov (United States)

    Tolar, B. B.; Smith, J. M.; Chavez, F.; Francis, C.

    2015-12-01

    Ammonia oxidation, the rate-limiting first step of nitrification, is an important link between reduced (ammonia) and oxidized (nitrate) nitrogen, and controls the relative distribution of these forms of inorganic nitrogen. This process is catalyzed via the ammonia monooxygenase enzyme of both ammonia-oxidizing Bacteria (AOB) and Archaea (AOA); the α subunit of this enzyme is encoded by the amoA gene and has been used as the molecular marker to detect this process. In the ocean, AOA are typically 10-1000 times more and are likely more active than AOB, and thus are key players in the marine nitrogen cycle. Monterey Bay is a dynamic site to study nitrification, as seasonal upwelling brings deep water and nutrients into surface waters, which can promote phytoplankton blooms and impact biogeochemical processes such as the nitrogen cycle. We have sampled two sites within Monterey Bay bimonthly for two years as part of the ongoing Monterey Bay Time Series (MBTS) to quantify AOA genes, transcripts, and nitrification rates. Two ecotypes of AOA are routinely found in Monterey Bay - the 'shallow' water column A (WCA) and 'deep' water column B (WCB) clades, which are thought to have distinct physiological properties and can be distinguished based on the amoA gene sequence. Previous work has shown a strong relationship between nitrification rates in Monterey Bay with the abundance of WCA amoA genes and transcripts. Additionally, we found a correlation between the relative abundance of Marine Group I (MGI) Thaumarchaeota 16S rRNA reads (as % of total) and the absolute abundance of AOA amoA genes (determined via qPCR) in Monterey Bay and the California Current System. AOA 16S rRNA gene abundances in turn correlated significantly with changes in nitrification rate with depth, while the relative abundance of genes and transcripts binned to a single AOA (Nitrosopumilus maritimus) was not significantly correlated to nitrification rate. Further analysis of the sequenced AOA

  17. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analyses of threonyl-tRNA synthetase editing domain from Aeropyrum pernix

    International Nuclear Information System (INIS)

    The editing domain of threonyl-tRNA synthetase from the archaeon Aeropyrum pernix has been overexpressed, purified and crystallized. The crystal diffracted to a resolution of 1.66 Å. The proofreading function of aminoacyl-tRNA synthetases is crucial in maintaining the fidelity of protein synthesis. Most archaeal threonyl-tRNA synthetases (ThrRSs) possess a unique proofreading domain unrelated to their eukaryotic/bacterial counterpart. The crystal structure of this domain from the archaeon Pyrococcus abysii in complex with its cognate and noncognate substrate analogues had given insights into its catalytic and discriminatory mechanisms. To probe further into the mechanistic and evolutionary aspects of this domain, work has been extended to another archaeon Aeropyrum pernix. The organism possesses two proteins corresponding to threonyl-tRNA synthetase, i.e. ThrRS1 and ThrRS2, encoded by two different genes, thrS1 and thrS2, respectively. ThrRS1 is responsible for aminoacylation and ThrRS2 for proofreading activity. Here the purification, crystallization and preliminary X-ray crystallographic investigation of the N-terminal proofreading domain of ThrRS2 from A. pernix is reported. The crystals belong to either the P41212 or P43212 space group and consist of one monomer per asymmetric unit

  18. RNA interference and antiviral therapy

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    RNA interference (RNAi) is an evolutionally conserved gene silencing mechanism present in a variety of eukaryotic species. RNAi uses short double-stranded RNA (dsRNA) to trigger degradation or translation repression of homologous RNA targets in a sequence-specific manner. This system can be induced effectively in vitro and in vivo by direct application of small interfering RNAs (siRNAs), or by expression of short hairpin RNA (shRNA) with non-viral and viral vectors. To date, RNAi has been extensively used as a novel and effective tool for functional genomic studies, and has displayed great potential in treating human diseases, including human genetic and acquired disorders such as cancer and viral infections. In the present review, we focus on the recent development in the use of RNAi in the prevention and treatment of viral infections. The mechanisms,strategies, hurdles and prospects of employing RNAi in the pharmaceutical industry are also discussed.

  19. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

    Science.gov (United States)

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie

    2014-04-01

    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

  20. Isolation of ‘Candidatus Nitrosocosmicus franklandus’, a novel ureolytic soil archaeal ammonia oxidiser with tolerance to high ammonia concentration

    Science.gov (United States)

    Lehtovirta-Morley, Laura E.; Ross, Jenna; Hink, Linda; Weber, Eva B.; Gubry-Rangin, Cécile; Thion, Cécile; Prosser, James I.; Nicol, Graeme W.

    2016-01-01

    Studies of the distribution of ammonia oxidising archaea (AOA) and bacteria (AOB) suggest distinct ecological niches characterised by ammonia concentration and pH, arising through differences in substrate affinity and ammonia tolerance. AOA form five distinct phylogenetic clades, one of which, the ‘Nitrososphaera sister cluster’, has no cultivated isolate. A representative of this cluster, named ‘Candidatus Nitrosocosmicus franklandus’, was isolated from a pH 7.5 arable soil and we propose a new cluster name: ‘Nitrosocosmicus’. While phylogenetic analysis of amoA genes indicates its association with the Nitrososphaera sister cluster, analysis of 16S rRNA genes provided no support for a relative branching that is consistent with a ‘sister cluster’, indicating placement within a lineage of the order Nitrososphaerales. ‘Ca. N. franklandus’ is capable of ureolytic growth and its tolerances to nitrite and ammonia are higher than in other AOA and similar to those of typical soil AOB. Similarity of other growth characteristics of ‘Ca. N. franklandus’ with those of typical soil AOB isolates reduces support for niche differentiation between soil AOA and AOB and suggests that AOA have a wider physiological diversity than previously suspected. In particular, the high ammonia tolerance of ‘Ca. N. franklandus’ suggests potential contributions to nitrification in fertilised soils. PMID:26976843

  1. Isolation of 'Candidatus Nitrosocosmicus franklandus', a novel ureolytic soil archaeal ammonia oxidiser with tolerance to high ammonia concentration.

    Science.gov (United States)

    Lehtovirta-Morley, Laura E; Ross, Jenna; Hink, Linda; Weber, Eva B; Gubry-Rangin, Cécile; Thion, Cécile; Prosser, James I; Nicol, Graeme W

    2016-05-01

    Studies of the distribution of ammonia oxidising archaea (AOA) and bacteria (AOB) suggest distinct ecological niches characterised by ammonia concentration and pH, arising through differences in substrate affinity and ammonia tolerance. AOA form five distinct phylogenetic clades, one of which, the 'Nitrososphaera sister cluster', has no cultivated isolate. A representative of this cluster, named 'Candidatus Nitrosocosmicus franklandus', was isolated from a pH 7.5 arable soil and we propose a new cluster name:'Nitrosocosmicus' While phylogenetic analysis of amoA genes indicates its association with the Nitrososphaera sister cluster, analysis of 16S rRNA genes provided no support for a relative branching that is consistent with a 'sister cluster', indicating placement within a lineage of the order Nitrososphaerales 'Ca.N. franklandus' is capable of ureolytic growth and its tolerances to nitrite and ammonia are higher than in other AOA and similar to those of typical soil AOB. Similarity of other growth characteristics of 'Ca.N. franklandus' with those of typical soil AOB isolates reduces support for niche differentiation between soil AOA and AOB and suggests that AOA have a wider physiological diversity than previously suspected. In particular, the high ammonia tolerance of 'Ca.N. franklandus' suggests potential contributions to nitrification in fertilised soils. PMID:26976843

  2. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants

    Science.gov (United States)

    Holman, Devin B.; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W.

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers’ grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills. PMID:27300323

  3. Novel viral genomes identified from six metagenomes reveal wide distribution of archaeal viruses and high viral diversity in terrestrial hot springs.

    Science.gov (United States)

    Gudbergsdóttir, Sóley Ruth; Menzel, Peter; Krogh, Anders; Young, Mark; Peng, Xu

    2016-03-01

    Limited by culture-dependent methods the number of viruses identified from thermophilic Archaea and Bacteria is still very small. In this study we retrieved viral sequences from six hot spring metagenomes isolated worldwide, revealing a wide distribution of four archaeal viral families, Ampullaviridae, Bicaudaviridae, Lipothrixviridae and Rudiviridae. Importantly, we identified 10 complete or near complete viral genomes allowing, for the first time, an assessment of genome conservation and evolution of the Ampullaviridae family as well as Sulfolobus Monocaudavirus 1 (SMV1)-related viruses. Among the novel genomes, one belongs to a putative thermophilic virus infecting the bacterium Hydrogenobaculum, for which no virus has been reported in the literature. Moreover, a high viral diversity was observed in the metagenomes, especially among the Lipothrixviridae, as indicated by the large number of unique contigs and the lack of a completely assembled genome for this family. This is further supported by the large number of novel genes in the complete and partial genomes showing no sequence similarities to public databases. CRISPR analysis revealed hundreds of novel CRISPR loci and thousands of novel CRISPR spacers from each metagenome, reinforcing the notion of high viral diversity in the thermal environment.

  4. Characterization of Bacterial, Archaeal and Eukaryote Symbionts from Antarctic Sponges Reveals a High Diversity at a Three-Domain Level and a Particular Signature for This Ecosystem

    Science.gov (United States)

    Rodríguez-Marconi, Susana; De la Iglesia, Rodrigo; Díez, Beatriz; Fonseca, Cássio A.; Hajdu, Eduardo; Trefault, Nicole

    2015-01-01

    Sponge-associated microbial communities include members from the three domains of life. In the case of bacteria, they are diverse, host specific and different from the surrounding seawater. However, little is known about the diversity and specificity of Eukarya and Archaea living in association with marine sponges. This knowledge gap is even greater regarding sponges from regions other than temperate and tropical environments. In Antarctica, marine sponges are abundant and important members of the benthos, structuring the Antarctic marine ecosystem. In this study, we used high throughput ribosomal gene sequencing to investigate the three-domain diversity and community composition from eight different Antarctic sponges. Taxonomic identification reveals that they belong to families Acarnidae, Chalinidae, Hymedesmiidae, Hymeniacidonidae, Leucettidae, Microcionidae, and Myxillidae. Our study indicates that there are different diversity and similarity patterns between bacterial/archaeal and eukaryote microbial symbionts from these Antarctic marine sponges, indicating inherent differences in how organisms from different domains establish symbiotic relationships. In general, when considering diversity indices and number of phyla detected, sponge-associated communities are more diverse than the planktonic communities. We conclude that three-domain microbial communities from Antarctic sponges are different from surrounding planktonic communities, expanding previous observations for Bacteria and including the Antarctic environment. Furthermore, we reveal differences in the composition of the sponge associated bacterial assemblages between Antarctic and tropical-temperate environments and the presence of a highly complex microbial eukaryote community, suggesting a particular signature for Antarctic sponges, different to that reported from other ecosystems. PMID:26421612

  5. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Science.gov (United States)

    Holman, Devin B; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills. PMID:27300323

  6. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Science.gov (United States)

    Holman, Devin B; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills.

  7. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Directory of Open Access Journals (Sweden)

    Devin B Holman

    Full Text Available Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills.

  8. Exploring Archaeal Communities And Genomes Across Five Deep-Sea Brine Lakes Of The Red Sea With A Focus On Methanogens

    KAUST Repository

    Guan, Yue

    2015-12-15

    The deep-sea hypersaline lakes in the Red Sea are among the most challenging, extreme, and unusual environments on the planet Earth. Despite their harshness to life, they are inhabited by diverse and novel members of prokaryotes. Methanogenesis was proposed as one of the main metabolic pathways that drive microbial colonization in similar habitats. However, not much is known about the identities of the methane-producing microbes in the Red Sea, let alone the way in which they could adapt to such poly extreme environments. Combining a range of microbial community assessment, cultivation and omics (genomics, transcriptomics, and single amplified genomics) approaches, this dissertation seeks to fill these gaps in our knowledge by studying archaeal composition, particularly methanogens, their genomic capacities and transcriptomic characteristics in order to elucidate their diversity, function, and adaptation to the deep-sea brines of the Red Sea. Although typical methanogens are not abundant in the samples collected from brine pool habitats of the Red Sea, the pilot cultivation experiment has revealed novel halophilic methanogenic species of the domain Archaea. Their physiological traits as well as their genomic and transcriptomic features unveil an interesting genetic and functional adaptive capacity that allows them to thrive in the unique deep-sea hypersaline environments in the Red Sea.

  9. Bacterial and Archaeal Communities Variability Associated with Upwelling and Anthropogenic Pressures in the Protection Area of Arraial do Cabo (Cabo Frio region - RJ).

    Science.gov (United States)

    Coelho-Souza, Sergio A; Araújo, Fábio V; Cury, Juliano C; Jesus, Hugo E; Pereira, Gilberto C; Guimarães, Jean R D; Peixoto, Raquel S; Dávila, Alberto M R; Rosado, Alexandre S

    2015-09-01

    Upwelling systems contain a high diversity of pelagic microorganisms and their composition and activity are defined by factors like temperature and nutrient concentration. Denaturing gradient gel electrophoresis (DGGE) technique was used to verify the spatial and temporal genetic variability of Bacteria and Archaea in two stations of the Arraial do Cabo coastal region, one under upwelling pressure and another under anthropogenic pressure. In addition, biotic and abiotic variables were measured in surface and deep waters from three other stations between these stations. Six samplings were done during a year and adequately represented the degrees of upwelling and anthropogenic pressures to the system. Principal Component Analysis (PCA) showed negative correlations between the concentrations of ammonia and phosphorous with prokaryotic secondary production and the total heterotrophic bacteria. PCA also showed negative correlation between temperature and the abundance of prokaryotic cells. Bacterial and archaeal compositions were changeable as were the oceanographic conditions, and upwelling had a regional pressure while anthropogenic pressure was punctual. We suggest that the measurement of prokaryotic secondary production was associated with both Bacteria and Archaea activities, and that substrate availability and temperature determine nutrients cycling. PMID:26375020

  10. Temperate membrane-containing halophilic archaeal virus SNJ1 has a circular dsDNA genome identical to that of plasmid pHH205.

    Science.gov (United States)

    Zhang, Ziqian; Liu, Ying; Wang, Shuai; Yang, Di; Cheng, Yichen; Hu, Jiani; Chen, Jin; Mei, Yunjun; Shen, Ping; Bamford, Dennis H; Chen, Xiangdong

    2012-12-20

    A temperate haloarchaeal virus, SNJ1, was induced from the lysogenic host, Natrinema sp. J7-1, with mitomycin C, and the virus produced plaques on lawns of Natrinema sp. J7-2. Optimization of the induction conditions allowed us to increase the titer from ~10(4) PFU/ml to ~10(11) PFU/ml. Single-step growth curves exhibited a burst size of ~100 PFU/cell. The genome of SNJ1 was observed to be a circular, double-stranded DNA (dsDNA) molecule (16,341 bp). Surprisingly, the sequence of SNJ1 was identical to that of a previously described plasmid, pHH205, indicating that this plasmid is the provirus of SNJ1. Several structural protein-encoding genes were identified in the viral genome. In addition, the comparison of putative packaging ATPase sequences from bacterial, archaeal and eukaryotic viruses, as well as the presence of lipid constituents from the host phospholipid pool, strongly suggest that SNJ1 belongs to the PRD1-type lineage of dsDNA viruses, which have an internal membrane. PMID:22784791

  11. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  12. Investigation of Archaeal and Bacterial community structure of five different small drinking water networks with special regard to the nitrifying microorganisms.

    Science.gov (United States)

    Nagymáté, Zsuzsanna; Homonnay, Zalán G; Márialigeti, Károly

    2016-01-01

    Total microbial community structure, and particularly nitrifying communities inhabiting five different small drinking water networks characterized with different water physical and chemical parameters was investigated, using cultivation-based methods and sequence aided Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis. Ammonium ion, originated from well water, was only partially oxidized via nitrite to nitrate in the drinking water distribution systems. Nitrification occurred at low ammonium ion concentration (27-46μM), relatively high pH (7.6-8.2) and over a wide range of dissolved oxygen concentrations (0.4-9.0mgL(-1)). The nitrifying communities of the distribution systems were characterized by variable most probable numbers (2×10(2)-7.1×10(4) MPN L(-1)) and probably originated from the non-treated well water. The sequence aided T-RFLP method revealed that ammonia-oxidizing microorganisms and nitrite-oxidizing Bacteria (Nitrosomonas oligotropha, Nitrosopumilus maritimus, and Nitrospira moscoviensis, 'Candidatus Nitrospira defluvii') were present in different ratios in the total microbial communities of the distinct parts of the water network systems. The nitrate generated by nitrification was partly utilized by nitrate-reducing (and denitrifying) Bacteria, present in low MPN and characterized by sequence aided T-RFLP as Comamonas sp. and Pseudomonas spp. Different environmental factors, like pH, chemical oxygen demand, calculated total inorganic nitrogen content (moreover nitrite and nitrate concentration), temperature had important effect on the total bacterial and archaeal community distribution. PMID:27296965

  13. RNA nanoparticles come of age

    Institute of Scientific and Technical Information of China (English)

    John J.Rossi

    2011-01-01

    @@ RNA has multiple functions in nature, including informa- tional transfer (mRNA) Ill, adaptor function (tRNAs) [2], guide functions (snRNAs, snoRNAs) [3,4]catalytic func- tion (ribozymes and the large ribosomal RNA) [5-7], and environmental sensing (riboswitehes) [8].In contrast, DNA only serves as an information storage molecule, and proteins serve as structural and enzymatic molecules.

  14. Hyperexpansion of RNA Bacteriophage Diversity

    Science.gov (United States)

    Krishnamurthy, Siddharth R.; Janowski, Andrew B.; Zhao, Guoyan; Barouch, Dan; Wang, David

    2016-01-01

    Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages) in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR)-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent. PMID:27010970

  15. Hyperexpansion of RNA Bacteriophage Diversity.

    Directory of Open Access Journals (Sweden)

    Siddharth R Krishnamurthy

    2016-03-01

    Full Text Available Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent.

  16. Hyperexpansion of RNA Bacteriophage Diversity.

    Science.gov (United States)

    Krishnamurthy, Siddharth R; Janowski, Andrew B; Zhao, Guoyan; Barouch, Dan; Wang, David

    2016-03-01

    Bacteriophage modulation of microbial populations impacts critical processes in ocean, soil, and animal ecosystems. However, the role of bacteriophages with RNA genomes (RNA bacteriophages) in these processes is poorly understood, in part because of the limited number of known RNA bacteriophage species. Here, we identify partial genome sequences of 122 RNA bacteriophage phylotypes that are highly divergent from each other and from previously described RNA bacteriophages. These novel RNA bacteriophage sequences were present in samples collected from a range of ecological niches worldwide, including invertebrates and extreme microbial sediment, demonstrating that they are more widely distributed than previously recognized. Genomic analyses of these novel bacteriophages yielded multiple novel genome organizations. Furthermore, one RNA bacteriophage was detected in the transcriptome of a pure culture of Streptomyces avermitilis, suggesting for the first time that the known tropism of RNA bacteriophages may include gram-positive bacteria. Finally, reverse transcription PCR (RT-PCR)-based screening for two specific RNA bacteriophages in stool samples from a longitudinal cohort of macaques suggested that they are generally acutely present rather than persistent.

  17. Seasonal changes in bacterial and archaeal gene expression patterns across salinity gradients in the Columbia River coastal margin.

    Directory of Open Access Journals (Sweden)

    Maria W Smith

    Full Text Available Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM. A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April and late summer (August. Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition

  18. Spatial Interaction of Archaeal Ammonia-Oxidizers and Nitrite-Oxidizing Bacteria in an Unfertilized Grassland Soil

    Science.gov (United States)

    Stempfhuber, Barbara; Richter-Heitmann, Tim; Regan, Kathleen M.; Kölbl, Angelika; Wüst, Pia K.; Marhan, Sven; Sikorski, Johannes; Overmann, Jörg; Friedrich, Michael W.; Kandeler, Ellen; Schloter, Michael

    2016-01-01

    Interrelated successive transformation steps of nitrification are performed by distinct microbial groups – the ammonia-oxidizers, comprising ammonia-oxidizing archaea (AOA) and bacteria (AOB), and nitrite-oxidizers such as Nitrobacter and Nitrospira, which are the dominant genera in the investigated soils. Hence, not only their presence and activity in the investigated habitat is required for nitrification, but also their temporal and spatial interactions. To demonstrate the interdependence of both groups and to address factors promoting putative niche differentiation within each group, temporal and spatial changes in nitrifying organisms were monitored in an unfertilized grassland site over an entire vegetation period at the plot scale of 10 m2. Nitrifying organisms were assessed by measuring the abundance of marker genes (amoA for AOA and AOB, nxrA for Nitrobacter, 16S rRNA gene for Nitrospira) selected for the respective sub-processes. A positive correlation between numerically dominant AOA and Nitrospira, and their co-occurrence at the same spatial scale in August and October, suggests that the nitrification process is predominantly performed by these groups and is restricted to a limited timeframe. Amongst nitrite-oxidizers, niche differentiation was evident in observed seasonally varying patterns of co-occurrence and spatial separation. While their distributions were most likely driven by substrate concentrations, oxygen availability may also have played a role under substrate-limited conditions. Phylogenetic analysis revealed temporal shifts in Nitrospira community composition with an increasing relative abundance of OTU03 assigned to sublineage V from August onward, indicating its important role in nitrite oxidation. PMID:26834718

  19. Spatial Interaction of Archaeal Ammonia-Oxidizers and Nitrite-Oxidizing Bacteria in an Unfertilized Grassland Soil.

    Science.gov (United States)

    Stempfhuber, Barbara; Richter-Heitmann, Tim; Regan, Kathleen M; Kölbl, Angelika; Wüst, Pia K; Marhan, Sven; Sikorski, Johannes; Overmann, Jörg; Friedrich, Michael W; Kandeler, Ellen; Schloter, Michael

    2015-01-01

    Interrelated successive transformation steps of nitrification are performed by distinct microbial groups - the ammonia-oxidizers, comprising ammonia-oxidizing archaea (AOA) and bacteria (AOB), and nitrite-oxidizers such as Nitrobacter and Nitrospira, which are the dominant genera in the investigated soils. Hence, not only their presence and activity in the investigated habitat is required for nitrification, but also their temporal and spatial interactions. To demonstrate the interdependence of both groups and to address factors promoting putative niche differentiation within each group, temporal and spatial changes in nitrifying organisms were monitored in an unfertilized grassland site over an entire vegetation period at the plot scale of 10 m(2). Nitrifying organisms were assessed by measuring the abundance of marker genes (amoA for AOA and AOB, nxrA for Nitrobacter, 16S rRNA gene for Nitrospira) selected for the respective sub-processes. A positive correlation between numerically dominant AOA and Nitrospira, and their co-occurrence at the same spatial scale in August and October, suggests that the nitrification process is predominantly performed by these groups and is restricted to a limited timeframe. Amongst nitrite-oxidizers, niche differentiation was evident in observed seasonally varying patterns of co-occurrence and spatial separation. While their distributions were most likely driven by substrate concentrations, oxygen availability may also have played a role under substrate-limited conditions. Phylogenetic analysis revealed temporal shifts in Nitrospira community composition with an increasing relative abundance of OTU03 assigned to sublineage V from August onward, indicating its important role in nitrite oxidation. PMID:26834718

  20. Spatial interaction of archaeal ammonia-oxidizers and nitrite-oxidizing bacteria in an unfertilized grassland soil

    Directory of Open Access Journals (Sweden)

    Barbara eStempfhuber

    2016-01-01

    Full Text Available Interrelated successive transformation steps of nitrification are performed by distinct microbial groups – the ammonia-oxidizers, comprising ammonia-oxidizing archaea (AOA and bacteria (AOB, and nitrite-oxidizers such as Nitrobacter and Nitrospira, which are the dominant genera in the investigated soils. Hence, not only their presence and activity in the investigated habitat is required for nitrification, but also their temporal and spatial interactions. To demonstrate the interdependence of both groups and to address factors promoting putative niche differentiation within each group, temporal and spatial changes in nitrifying organisms were monitored in an unfertilized grassland site over an entire vegetation period at the plot scale of 10 m². Nitrifying organisms were assessed by measuring the abundance of marker genes (amoA for AOA and AOB, nxrA for Nitrobacter, 16S rRNA gene for Nitrospira selected for the respective sub-processes. A positive correlation between numerically dominant AOA and Nitrospira, and their co-occurrence at the same spatial scale in August and October, suggests that the nitrification process is predominantly performed by these groups and is restricted to a limited timeframe. Amongst nitrite-oxidizers, niche differentiation was evident in observed seasonally varying patterns of co-occurrence and spatial separation. While their distributions were most likely driven by substrate concentrations, oxygen availability may also have played a role under substrate-limited conditions. Phylogenetic analysis revealed temporal shifts in Nitrospira community composition with an increasing relative abundance of OTU03 assigned to sublineage V from August onwards, indicating its important role in nitrite oxidation.