WorldWideScience

Sample records for archaeal family-b dna

  1. Archaeal DNA replication.

    Science.gov (United States)

    Kelman, Lori M; Kelman, Zvi

    2014-01-01

    DNA replication is essential for all life forms. Although the process is fundamentally conserved in the three domains of life, bioinformatic, biochemical, structural, and genetic studies have demonstrated that the process and the proteins involved in archaeal DNA replication are more similar to those in eukaryal DNA replication than in bacterial DNA replication, but have some archaeal-specific features. The archaeal replication system, however, is not monolithic, and there are some differences in the replication process between different species. In this review, the current knowledge of the mechanisms governing DNA replication in Archaea is summarized. The general features of the replication process as well as some of the differences are discussed. PMID:25421597

  2. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-06-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  3. Characterization of a family B DNA polymerase from Thermococcus barophilus Ch5 and its application for long and accurate PCR.

    Science.gov (United States)

    Kwon, Kyung-Min; Kang, Sung Gyun; Sokolova, Tatyana G; Cho, Sung Suk; Kim, Yun Jae; Kim, Cheorl-Ho; Kwon, Suk-Tae

    2016-05-01

    The family B DNA polymerase gene from the euryarchaeon Thermococcus barophilus Ch5 (Tba5) contains an open reading frame of 6198 base pairs that encodes 2065 amino acid residues. The gene is split by three inteins that must be spliced out to form the mature DNA polymerase. A Tba5 DNA polymerase gene without inteins (genetically intein-spliced) was expressed under the control of the pET-28b(+)T7lac promoter in E. coli Rosetta 2(DE3)pLysS cells. The molecular mass of the purified Tba5 DNA polymerase was about 90kDa consistent with the 90,470Da molecular mass calculated based on the 776 amino acid sequence. The optimal pH for Tba5 DNA polymerase activity was 7.5 and the optimal temperature was 70-75°C. The enzyme possessed 3'→5' exonuclease activity and was activated by magnesium ions. PCR amplification using Tba5 DNA polymerase enables high-yield for 1- to 6-kb target DNA products, while 8- to 10-kb target DNA products were amplified at low or inefficient levels. To simultaneously improve product yield and amplification fidelity, Tba5 plus DNA polymerase mixtures were constituted with various amounts of Tba5 DNA polymerase mixed with Taq DNA polymerase. The Tba5 plus DNA polymerase mixtures robustly amplified up to 25-kb λ DNA fragments. In addition, the PCR error rate of Tba5 plus3 and Tba5 plus4 mixtures were much lower than those of wild-type Tba5 DNA polymerase, Pfu DNA polymerase, Taq DNA polymerase, and Pfu plus DNA polymerase. PMID:26992800

  4. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    OpenAIRE

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-01-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly differen...

  5. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    OpenAIRE

    Tom eKillelea; Celine eRalec; Audrey eBosse; Ghislaine eHenneke

    2014-01-01

    International audience DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased perfor...

  6. Events during Initiation of Archaeal Transcription: Open Complex Formation and DNA-Protein Interactions

    OpenAIRE

    Hausner, Winfried; Thomm, Michael

    2001-01-01

    Transcription in Archaea is initiated by association of a TATA box binding protein (TBP) with a TATA box. This interaction is stabilized by the binding of the transcription factor IIB (TFIIB) orthologue TFB. We show here that the RNA polymerase of the archaeon Methanococcus, in contrast to polymerase II, does not require hydrolysis of the β-γ bond of ATP for initiation of transcription and open complex formation on linearized DNA. Permanganate probing revealed that the archaeal open complex s...

  7. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  8. Overexpression, purification and crystallization of an archaeal DNA ligase from Pyrococcus furiosus

    International Nuclear Information System (INIS)

    Crystals of the archaeal DNA ligase from Pyrococcus furiosus were obtained using 6.6%(v/v) ethanol as a precipitant and diffracted X-rays to 1.7 Å resolution. DNA ligases seal single-strand breaks in double-stranded DNA and their function is essential to maintain the integrity of the genome during various aspects of DNA metabolism, such as replication, excision repair and recombination. DNA-strand breaks are frequently generated as reaction intermediates in these events and the sealing of these breaks depends solely on the proper function of DNA ligase. Crystals of the archaeal DNA ligase from Pyrococcus furiosus were obtained using 6.6%(v/v) ethanol as a precipitant and diffracted X-rays to 1.7 Å resolution. They belong to the monoclinic space group P21, with unit-cell parameters a = 61.1, b = 88.3, c = 63.4 Å, β = 108.9°. The asymmetric unit contains one ligase molecule

  9. Specificity and function of Archaeal DNA replication initiator proteins

    DEFF Research Database (Denmark)

    Samson, Rachel Y.; Xu, Yanqun; Gadelha, Catarina;

    2013-01-01

    Chromosomes with multiple DNA replication origins are a hallmark of Eukaryotes and some Archaea. All eukaryal nuclear replication origins are defined by the origin recognition complex (ORC) that recruits the replicative helicase MCM(2-7) via Cdc6 and Cdt1. We find that the three origins in the...... investigate the role of ATP binding and hydrolysis in initiator function in vivo and in vitro. We find that the ATP-bound form of Orc1-1 is proficient for replication and implicates hydrolysis of ATP in downregulation of origin activity. Finally, we reveal that ATP and DNA binding by Orc1-1 remodels the...... protein's structure rather than that of the DNA template....

  10. Archaeal Genome Guardians Give Insights into Eukaryotic DNA Replication and Damage Response Proteins

    Directory of Open Access Journals (Sweden)

    David S. Shin

    2014-01-01

    Full Text Available As the third domain of life, archaea, like the eukarya and bacteria, must have robust DNA replication and repair complexes to ensure genome fidelity. Archaea moreover display a breadth of unique habitats and characteristics, and structural biologists increasingly appreciate these features. As archaea include extremophiles that can withstand diverse environmental stresses, they provide fundamental systems for understanding enzymes and pathways critical to genome integrity and stress responses. Such archaeal extremophiles provide critical data on the periodic table for life as well as on the biochemical, geochemical, and physical limitations to adaptive strategies allowing organisms to thrive under environmental stress relevant to determining the boundaries for life as we know it. Specifically, archaeal enzyme structures have informed the architecture and mechanisms of key DNA repair proteins and complexes. With added abilities to temperature-trap flexible complexes and reveal core domains of transient and dynamic complexes, these structures provide insights into mechanisms of maintaining genome integrity despite extreme environmental stress. The DNA damage response protein structures noted in this review therefore inform the basis for genome integrity in the face of environmental stress, with implications for all domains of life as well as for biomanufacturing, astrobiology, and medicine.

  11. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Directory of Open Access Journals (Sweden)

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  12. Temperature and pH dependence of DNA ejection from archaeal lemon-shaped virus His1.

    Science.gov (United States)

    Hanhijärvi, K J; Ziedaite, G; Hæggström, E; Bamford, D H

    2016-07-01

    The archaeal virus His1 isolated from a hypersaline environment infects an extremely halophilic archaeon Haloarcula hispanica. His1 features a lemon-shaped capsid, which is so far found only in archaeal viruses. This unique capsid can withstand high salt concentrations, and can transform into a helical tube, which in turn is resistant to extremely harsh conditions. Hypersaline environments exhibit a wide range of temperatures and pH conditions, which present an extra challenge to their inhabitants. We investigated the influence of pH and temperature on DNA ejection from His1 virus using single-molecule fluorescence experiments. The observed number of ejecting viruses is constant in pH 5 to 9, while the ejection process is suppressed at pH below 5. Similarly, the number of ejections within 15-42 °C shows only a minor increase around 25-37 °C. The maximum velocity of single ejected DNA increases with temperature, in qualitative agreement with the continuum model of dsDNA ejection. PMID:26820561

  13. Preliminary crystallography confirms that the archaeal DNA-binding and tryptophan-sensing regulator TrpY is a dimer.

    Science.gov (United States)

    Cafasso, Jacquelyn; Manjasetty, Babu A; Karr, Elizabeth A; Sandman, Kathleen; Chance, Mark R; Reeve, John N

    2010-11-01

    TrpY regulates the transcription of the metabolically expensive tryptophan-biosynthetic operon in the thermophilic archaeon Methanothermobacter thermautotrophicus. TrpY was crystallized using the hanging-drop method with ammonium sulfate as the precipitant. The crystals belonged to the tetragonal space group P4(3)2(1)2 or P4(1)2(1)2, with unit-cell parameters a = b = 87, c = 147 Å, and diffracted to 2.9 Å resolution. The possible packing of molecules within the cell based on the values of the Matthews coefficient (V(M)) and analysis of the self-rotation function are consistent with the asymmetric unit being a dimer. Determining the structure of TrpY in detail will provide insight into the mechanisms of DNA binding, tryptophan sensing and transcription regulation at high temperature by this novel archaeal protein. PMID:21045304

  14. Preliminary Crystallography Confirms that the Archaeal DNA-binding and Tryptophan-sensing Regulator TrpY is a Dimer

    Energy Technology Data Exchange (ETDEWEB)

    J Cafasso; B Manjasetty; E Karr; K Sandman; M Chance; J Reeve

    2011-12-31

    TrpY regulates the transcription of the metabolically expensive tryptophan-biosynthetic operon in the thermophilic archaeon Methanothermobacter thermautotrophicus. TrpY was crystallized using the hanging-drop method with ammonium sulfate as the precipitant. The crystals belonged to the tetragonal space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 87, c = 147 {angstrom}, and diffracted to 2.9 {angstrom} resolution. The possible packing of molecules within the cell based on the values of the Matthews coefficient (V{sub M}) and analysis of the self-rotation function are consistent with the asymmetric unit being a dimer. Determining the structure of TrpY in detail will provide insight into the mechanisms of DNA binding, tryptophan sensing and transcription regulation at high temperature by this novel archaeal protein.

  15. Influence of DNA isolation method on the investigation of archaeal diversity and abundance in biogas plants.

    Science.gov (United States)

    Theiss, Juliane; Rother, Michael; Röske, Kerstin

    2016-09-01

    Various methods are available for DNA isolation from environmental samples. Because the chemical and biological composition of samples such as soil, sludge, or plant material is different, the effectiveness of DNA isolation can vary depending on the method applied and thus, have a substantial effect on the results of downstream analysis of the microbial community. Although the process of biogas formation is being intensely investigated, a systematic evaluation of kits for DNA isolation from material of biogas plants is still lacking. Since no DNA isolation kit specifically tailored for DNA isolation from sludge of biogas plants is available, this study compares five commercially available kits regarding their influence on downstream analyses such denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR). The results show that not all kits are equally suited for the DNA isolation from samples of different biogas plants, but highly reproducible DGGE fingerprints as well as qPCR results across the tested samples from biogas reactors using different substrate compositions could be produced using selected kits. PMID:27089887

  16. Solution properties of the archaeal CRISPR DNA repeat-binding homeodomain protein Cbp2

    DEFF Research Database (Denmark)

    Kenchappa, Chandra; Heiðarsson, Pétur Orri; Kragelund, Birthe;

    2013-01-01

    in facilitating high affinity DNA binding of Cbp2 by tethering the two domains. Structural studies on mutant proteins provide support for Cys(7) and Cys(28) enhancing high thermal stability of Cbp2(Hb) through disulphide bridge formation. Consistent with their proposed CRISPR transcriptional regulatory role, Cbp2......Clustered regularly interspaced short palindromic repeats (CRISPR) form the basis of diverse adaptive immune systems directed primarily against invading genetic elements of archaea and bacteria. Cbp1 of the crenarchaeal thermoacidophilic order Sulfolobales, carrying three imperfect repeats, binds...... specifically to CRISPR DNA repeats and has been implicated in facilitating production of long transcripts from CRISPR loci. Here, a second related class of CRISPR DNA repeat-binding protein, denoted Cbp2, is characterized that contains two imperfect repeats and is found amongst members of the crenarchaeal...

  17. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Directory of Open Access Journals (Sweden)

    Javier Abellón-Ruiz

    2016-01-01

    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  18. Temperate membrane-containing halophilic archaeal virus SNJ1 has a circular dsDNA genome identical to that of plasmid pHH205.

    Science.gov (United States)

    Zhang, Ziqian; Liu, Ying; Wang, Shuai; Yang, Di; Cheng, Yichen; Hu, Jiani; Chen, Jin; Mei, Yunjun; Shen, Ping; Bamford, Dennis H; Chen, Xiangdong

    2012-12-20

    A temperate haloarchaeal virus, SNJ1, was induced from the lysogenic host, Natrinema sp. J7-1, with mitomycin C, and the virus produced plaques on lawns of Natrinema sp. J7-2. Optimization of the induction conditions allowed us to increase the titer from ~10(4) PFU/ml to ~10(11) PFU/ml. Single-step growth curves exhibited a burst size of ~100 PFU/cell. The genome of SNJ1 was observed to be a circular, double-stranded DNA (dsDNA) molecule (16,341 bp). Surprisingly, the sequence of SNJ1 was identical to that of a previously described plasmid, pHH205, indicating that this plasmid is the provirus of SNJ1. Several structural protein-encoding genes were identified in the viral genome. In addition, the comparison of putative packaging ATPase sequences from bacterial, archaeal and eukaryotic viruses, as well as the presence of lipid constituents from the host phospholipid pool, strongly suggest that SNJ1 belongs to the PRD1-type lineage of dsDNA viruses, which have an internal membrane. PMID:22784791

  19. Archaeal Enzymes and Applications in Industrial Biocatalysts.

    Science.gov (United States)

    Littlechild, Jennifer A

    2015-01-01

    Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in "extreme" conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  20. Archaeal Enzymes and Applications in Industrial Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jennifer A. Littlechild

    2015-01-01

    Full Text Available Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in “extreme” conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.

  1. Chemical shifts assignments of the archaeal MC1 protein and a strongly bent 15 base pairs DNA duplex in complex.

    Science.gov (United States)

    Loth, Karine; Landon, Céline; Paquet, Françoise

    2015-04-01

    MC1 is the most abundant architectural protein present in Methanosarcina thermophila CHTI55 in laboratory growth conditions and is structurally unrelated to other DNA-binding proteins. MC1 functions are to shape and to protect DNA against thermal denaturation by binding to it. Therefore, MC1 has a strong affinity for any double-stranded DNA. However, it recognizes and preferentially binds to bent DNA, such as four-way junctions and negatively supercoiled DNA minicircles. Combining NMR data, electron microscopy data, biochemistry, molecular modelisation and docking approaches, we proposed recently a new type of DNA/protein complex, in which the monomeric protein MC1 binds on the concave side of a strongly bent 15 base pairs DNA. We present here the NMR chemical shifts assignments of each partner in the complex, (1)H (15)N MC1 protein and (1)H (13)C (15)N bent duplex DNA, as first step towards the first experimental 3D structure of this new type of DNA/protein complex.

  2. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali;

    2015-01-01

    viruses and plasmids. In particular, it has been suggested that ECE-host interactions have shaped the coevolution of ECEs and their archaeal hosts. Furthermore, archaeal hosts have developed defense systems, including the innate restriction-modification (R-M) system and the adaptive CRISPR (clustered...

  3. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  4. An archaeal CRISPR type III-B system exhibiting distinctive RNA targeting features and mediating dual RNA and DNA interference

    DEFF Research Database (Denmark)

    Peng, Wenfang; Feng, Mingxia; Feng, Xu;

    2015-01-01

    CRISPR-Cas systems provide a small RNA-based mechanism to defend against invasive genetic elements in archaea and bacteria. To investigate the in vivo mechanism of RNA interference by two type III-B systems (Cmr-α and Cmr-β) in Sulfolobus islandicus, a genetic assay was developed using plasmids...... carrying an artificial mini-CRISPR (AC) locus with a single spacer. After pAC plasmids were introduced into different strains, Northern analyses confirmed that mature crRNAs were produced from the plasmid-borne CRISPR loci, which then guided gene silencing to target gene expression. Spacer mutagenesis....... islandicus Cmr-α mediated transcription-dependent DNA interference, the Cmr-α constitutes the first CRISPR system exhibiting dual targeting of RNA and DNA....

  5. Elucidating the transcription cycle of the UV-inducible hyperthermophilic archaeal virus SSV1 by DNA microarrays.

    Science.gov (United States)

    Fröls, Sabrina; Gordon, Paul M K; Panlilio, Mayi Arcellana; Schleper, Christa; Sensen, Christoph W

    2007-08-15

    The spindle-shaped Sulfolobus virus SSV1 was the first of a series of unusual and uniquely shaped viruses isolated from hyperthermophilic Archaea. Using whole-genome microarrays we show here that the circular 15.5 kb DNA genome of SSV1 exhibits a chronological regulation of its transcription upon UV irradiation, reminiscent to the life cycles of bacteriophages and eukaryotic viruses. The transcriptional cycle starts with a small UV-specific transcript and continues with early transcripts on both its flanks. The late transcripts appear after the onset of viral replication and are extended to their full lengths towards the end of the approximately 8.5 h cycle. While we detected only small differences in genome-wide analysis of the host Sulfolobus solfataricus comparing infected versus uninfected strains, we found a marked difference with respect to the strength and speed of the general UV response of the host. Models for the regulation of the virus cycle, and putative functions of genes in SSV1 are presented. PMID:17467765

  6. Structure and Cell Biology of Archaeal Virus STIV

    OpenAIRE

    Fu, Chi-yu; Johnson, John E.

    2012-01-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interaction...

  7. Distribution and Diversity of Archaeal Ammonia Monooxygenase Genes Associated with Corals▿ †

    OpenAIRE

    Beman, J. Michael; Roberts, Kathryn J.; Wegley, Linda; Rohwer, Forest; Francis, Christopher A.

    2007-01-01

    Corals are known to harbor diverse microbial communities of Bacteria and Archaea, yet the ecological role of these microorganisms remains largely unknown. Here we report putative ammonia monooxygenase subunit A (amoA) genes of archaeal origin associated with corals. Multiple DNA samples drawn from nine coral species and four different reef locations were PCR screened for archaeal and bacterial amoA genes, and archaeal amoA gene sequences were obtained from five different species of coral coll...

  8. Where does DNA replication start in archaea?

    OpenAIRE

    Vas, Amit; Leatherwood, Janet

    2000-01-01

    Genome-wide measures of DNA strand composition have been used to find archaeal DNA replication origins. Archaea seem to replicate using a single origin (as do eubacteria) even though archaeal replication factors are more like those of eukaryotes.

  9. Structural and functional analyses of five conserved positively charged residues in the L1 and N-terminal DNA binding motifs of archaeal RADA protein.

    Directory of Open Access Journals (Sweden)

    Li-Tzu Chen

    Full Text Available RecA family proteins engage in an ATP-dependent DNA strand exchange reaction that includes a ssDNA nucleoprotein helical filament and a homologous dsDNA sequence. In spite of more than 20 years of efforts, the molecular mechanism of homology pairing and strand exchange is still not fully understood. Here we report a crystal structure of Sulfolobus solfataricus RadA overwound right-handed filament with three monomers per helical pitch. This structure reveals conformational details of the first ssDNA binding disordered loop (denoted L1 motif and the dsDNA binding N-terminal domain (NTD. L1 and NTD together form an outwardly open palm structure on the outer surface of the helical filament. Inside this palm structure, five conserved basic amino acid residues (K27, K60, R117, R223 and R229 surround a 25 A pocket that is wide enough to accommodate anionic ssDNA, dsDNA or both. Biochemical analyses demonstrate that these five positively charged residues are essential for DNA binding and for RadA-catalyzed D-loop formation. We suggest that the overwound right-handed RadA filament represents a functional conformation in the homology search and pairing reaction. A new structural model is proposed for the homologous interactions between a RadA-ssDNA nucleoprotein filament and its dsDNA target.

  10. Archaeal CRISPR-based immune systems

    DEFF Research Database (Denmark)

    Garrett, Roger A; Vestergaard, Gisle Alberg; Shah, Shiraz Ali

    2011-01-01

    CRISPR (clustered regularly interspaced short palindromic repeats)-based immune systems are essentially modular with three primary functions: the excision and integration of new spacers, the processing of CRISPR transcripts to yield mature CRISPR RNAs (crRNAs), and the targeting and cleavage...... of foreign nucleic acid. The primary target appears to be the DNA of foreign genetic elements, but the CRISPR/Cmr system that is widespread amongst archaea also specifically targets and cleaves RNA in vitro. The archaeal CRISPR systems tend to be both diverse and complex. Here we examine evidence...... of CRISPR loci and the evidence for intergenomic exchange of CRISPR systems....

  11. Analyses of in vivo interactions between transcription factors and the archaeal RNA polymerase.

    Science.gov (United States)

    Walker, Julie E; Santangelo, Thomas J

    2015-09-15

    Transcription factors regulate the activities of RNA polymerase (RNAP) at each stage of the transcription cycle. Many basal transcription factors with common ancestry are employed in eukaryotic and archaeal systems that directly bind to RNAP and influence intramolecular movements of RNAP and modulate DNA or RNA interactions. We describe and employ a flexible methodology to directly probe and quantify the binding of transcription factors to RNAP in vivo. We demonstrate that binding of the conserved and essential archaeal transcription factor TFE to the archaeal RNAP is directed, in part, by interactions with the RpoE subunit of RNAP. As the surfaces involved are conserved in many eukaryotic and archaeal systems, the identified TFE-RNAP interactions are likely conserved in archaeal-eukaryal systems and represent an important point of contact that can influence the efficiency of transcription initiation.

  12. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony

    2015-01-01

    Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2 with an environm......Infection of archaea with phylogenetically diverse single viruses, performed in different laboratories, has failed to activate spacer acquisition into host CRISPR loci. The first successful uptake of archaeal de novo spacers was observed on infection of Sulfolobus solfataricus P2...... in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...

  13. Transcription by Methanothermobacter thermautotrophicus RNA Polymerase In Vitro Releases Archaeal Transcription Factor B but Not TATA-Box Binding Protein from the Template DNA

    OpenAIRE

    Xie, Yunwei; Reeve, John N.

    2004-01-01

    Transcription initiation in Archaea requires the assembly of a preinitiation complex containing the TATA- box binding protein (TBP), transcription factor B (TFB), and RNA polymerase (RNAP). The results reported establish the fate of Methanothermobacter thermautotrophicus TBP and TFB following transcription initiation by M. thermautotrophicus RNAP in vitro. TFB is released after initiation, during extension of the transcript from 4 to 24 nucleotides, but TBP remains bound to the template DNA. ...

  14. RNA-Based Assessment of Diversity and Composition of Active Archaeal Communities in the German Bight

    Directory of Open Access Journals (Sweden)

    Bernd Wemheuer

    2012-01-01

    Full Text Available Archaea play an important role in various biogeochemical cycles. They are known extremophiles inhabiting environments such as thermal springs or hydrothermal vents. Recent studies have revealed a significant abundance of Archaea in moderate environments, for example, temperate sea water. Nevertheless, the composition and ecosystem function of these marine archaeal communities is largely unknown. To assess diversity and composition of active archaeal communities in the German Bight, seven marine water samples were taken and studied by RNA-based analysis of ribosomal 16S rRNA. For this purpose, total RNA was extracted from the samples and converted to cDNA. Archaeal community structures were investigated by pyrosequencing-based analysis of 16S rRNA amplicons generated from cDNA. To our knowledge, this is the first study combining next-generation sequencing and metatranscriptomics to study archaeal communities in marine habitats. The pyrosequencing-derived dataset comprised 62,045 archaeal 16S rRNA sequences. We identified Halobacteria as the predominant archaeal group across all samples with increased abundance in algal blooms. Thermoplasmatales (Euryarchaeota and the Marine Group I (Thaumarchaeota were identified in minor abundances. It is indicated that archaeal community patterns were influenced by environmental conditions.

  15. Shaping the Archaeal Cell Envelope

    NARCIS (Netherlands)

    Ellen, Albert F.; Zolghadr, Behnam; Driessen, Arnold M. J.; Albers, Sonja-Verena

    2010-01-01

    Although archaea have a similar cellular organization as other prokaryotes, the lipid composition of their membranes and their cell surface is unique. Here we discuss recent developments in our understanding of the archaeal protein secretion mechanisms, the assembly of macromolecular cell surface st

  16. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.

    2013-01-01

      The work presented in this thesis provides novel insights in several aspects of the molecular biology of archaea, bacteria and their viruses. Three fundamentally different groups of viruses are associated with the three domains of life. Archaeal viruses are characterized by a particularly

  17. Phylogenetic Diversity of Archaea and the Archaeal Ammonia Monooxygenase Gene in Uranium Mining-Impacted Locations in Bulgaria

    Directory of Open Access Journals (Sweden)

    Galina Radeva

    2014-01-01

    Full Text Available Uranium mining and milling activities adversely affect the microbial populations of impacted sites. The negative effects of uranium on soil bacteria and fungi are well studied, but little is known about the effects of radionuclides and heavy metals on archaea. The composition and diversity of archaeal communities inhabiting the waste pile of the Sliven uranium mine and the soil of the Buhovo uranium mine were investigated using 16S rRNA gene retrieval. A total of 355 archaeal clones were selected, and their 16S rDNA inserts were analysed by restriction fragment length polymorphism (RFLP discriminating 14 different RFLP types. All evaluated archaeal 16S rRNA gene sequences belong to the 1.1b/Nitrososphaera cluster of Crenarchaeota. The composition of the archaeal community is distinct for each site of interest and dependent on environmental characteristics, including pollution levels. Since the members of 1.1b/Nitrososphaera cluster have been implicated in the nitrogen cycle, the archaeal communities from these sites were probed for the presence of the ammonia monooxygenase gene (amoA. Our data indicate that amoA gene sequences are distributed in a similar manner as in Crenarchaeota, suggesting that archaeal nitrification processes in uranium mining-impacted locations are under the control of the same key factors controlling archaeal diversity.

  18. The UCSC Archaeal Genome Browser: 2012 update

    OpenAIRE

    Chan, Patricia P.; Holmes, Andrew D.; Smith, Andrew M.; Tran, Danny; Lowe, Todd M.

    2011-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of ...

  19. The UCSC Archaeal Genome Browser: 2012 update.

    Science.gov (United States)

    Chan, Patricia P; Holmes, Andrew D; Smith, Andrew M; Tran, Danny; Lowe, Todd M

    2012-01-01

    The UCSC Archaeal Genome Browser (http://archaea.ucsc.edu) offers a graphical web-based resource for exploration and discovery within archaeal and other selected microbial genomes. By bringing together existing gene annotations, gene expression data, multiple-genome alignments, pre-computed sequence comparisons and other specialized analysis tracks, the genome browser is a powerful aggregator of varied genomic information. The genome browser environment maintains the current look-and-feel of the vertebrate UCSC Genome Browser, but also integrates archaeal and bacterial-specific tracks with a few graphic display enhancements. The browser currently contains 115 archaeal genomes, plus 31 genomes of viruses known to infect archaea. Some of the recently developed or enhanced tracks visualize data from published high-throughput RNA-sequencing studies, the NCBI Conserved Domain Database, sequences from pre-genome sequencing studies, predicted gene boundaries from three different protein gene prediction algorithms, tRNAscan-SE gene predictions with RNA secondary structures and CRISPR locus predictions. We have also developed a companion resource, the Archaeal COG Browser, to provide better search and display of arCOG gene function classifications, including their phylogenetic distribution among available archaeal genomes.

  20. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  1. pH dominates variation in tropical soil archaeal diversity and community structure.

    Science.gov (United States)

    Tripathi, Binu M; Kim, Mincheol; Lai-Hoe, Ang; Shukor, Nor A A; Rahim, Raha A; Go, Rusea; Adams, Jonathan M

    2013-11-01

    Little is known of the factors influencing soil archaeal community diversity and composition in the tropics. We sampled soils across a range of forest and nonforest environments in the equatorial tropics of Malaysia, covering a wide range of pH values. DNA was PCR-amplified for the V1-V3 region of the 16S rRNA gene, and 454-pyrosequenced. Soil pH was the best predictor of diversity and community composition of Archaea, being a stronger predictor than land use. Archaeal OTU richness was highest in the most acidic soils. Overall archaeal abundance in tropical soils (determined by qPCR) also decreased at higher pH. This contrasts with the opposite trend previously found in temperate soils. Thaumarcheota group 1.1b was more abundant in alkaline soils, whereas group 1.1c was only detected in acidic soils. These results parallel those found in previous studies in cooler climates, emphasizing niche conservatism among broad archaeal groups. Among the most abundant operational taxonomic units (OTUs), there was clear evidence of niche partitioning by pH. No individual OTU occurred across the entire range of pH values. Overall, the results of this study show that pH plays a major role in structuring tropical soil archaeal communities.

  2. Protein Adaptations in Archaeal Extremophiles

    Directory of Open Access Journals (Sweden)

    Christopher J. Reed

    2013-01-01

    Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

  3. Crystal structure of an archaeal actin homolog.

    Science.gov (United States)

    Roeben, Annette; Kofler, Christine; Nagy, István; Nickell, Stephan; Hartl, F Ulrich; Bracher, Andreas

    2006-04-21

    Prokaryotic homologs of the eukaryotic structural protein actin, such as MreB and ParM, have been implicated in determination of bacterial cell shape, and in the segregation of genomic and plasmid DNA. In contrast to these bacterial actin homologs, little is known about the archaeal counterparts. As a first step, we expressed a predicted actin homolog of the thermophilic archaeon Thermoplasma acidophilum, Ta0583, and determined its crystal structure at 2.1A resolution. Ta0583 is expressed as a soluble protein in T.acidophilum and is an active ATPase at physiological temperature. In vitro, Ta0583 forms sheets with spacings resembling the crystal lattice, indicating an inherent propensity to form filamentous structures. The fold of Ta0583 contains the core structure of actin and clearly belongs to the actin/Hsp70 superfamily of ATPases. Ta0583 is approximately equidistant from actin and MreB on the structural level, and combines features from both eubacterial actin homologs, MreB and ParM. The structure of Ta0583 co-crystallized with ADP indicates that the nucleotide binds at the interface between the subdomains of Ta0583 in a manner similar to that of actin. However, the conformation of the nucleotide observed in complex with Ta0583 clearly differs from that in complex with actin, but closely resembles the conformation of ParM-bound nucleotide. On the basis of sequence and structural homology, we suggest that Ta0583 derives from a ParM-like actin homolog that was once encoded by a plasmid and was transferred into a common ancestor of Thermoplasma and Ferroplasma. Intriguingly, both genera are characterized by the lack of a cell wall, and therefore Ta0583 could have a function in cellular organization.

  4. Archaeal Nitrification in Hot Springs

    Science.gov (United States)

    Richter, A.; Daims, H.; Reigstad, L.; Wanek, W.; Wagner, M.; Schleper, C.

    2006-12-01

    Biological nitrification, i.e. the aerobic conversion of ammonia to nitrate via nitrite, is a major component of the global nitrogen cycle. Until recently, it was thought that the ability to aerobically oxidize ammonia was confined to bacteria of the phylum Proteobacteria. However, it has recently been shown that Archaea of the phylum Crenarchaeota are also capable of ammonia oxidation. As many Crenarchaeota are thermophilic or hyperthermophilic, and at least some of them are capable of ammonia oxidation we speculated on the existence of (hyper)thermophilic ammonia-oxidizing archaea (AOA). Using PCR primers specifically targeting the archaeal ammonia monooxygenase (amoA) gene, we were indeed able to confirm the presence of such organisms in several hot springs in Reykjadalur, Iceland. These hot springs exhibited temperatures well above 80 °C and pH values ranging from 2.0 to 4.5. To proof that nitrification actually took place under these extreme conditions, we measured gross nitrification rates by the isotope pool dilution method; we added 15N-labelled nitrate to the mud and followed the dilution of the label by nitrate production from ammonium either in situ (incubation in the hot spring) or under controlled conditions in the laboratory (at 80 °C). The nitrification rates in the hot springs ranged from 0.79 to 2.22 mg nitrate-N per L of mud and day. Controls, in which microorganisms were killed before the incubations, demonstrated that the nitrification was of biological origin. Addition of ammonium increased the gross nitrification rate approximately 3-fold, indicating that the nitrification was ammonium limited under the conditions used. Collectively, our study provides evidence that (1) AOA are present in hot springs and (2) that they are actively nitrifying. These findings have major implications for our understanding of nitrogen cycling of hot environments.

  5. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    ; attachment, alignment, and fusion. Upon infection, the intracellular replication cycle lasts 8 h at which point the virus particles are released as spindle-shaped tailless particles. Chapter II builds on the replication and purification methods in Chapter I to study the interaction between the two...... nanoplatforms than mammalian viruses because they cannot proliferate in humans and hence are less likely to trigger adverse effects. Another group of viruses that fits this criterion is archaeal viruses yet their potential remains untapped. As a group, archaeal viruses offer distinct advantages such as unique...

  6. Structure and cell biology of archaeal virus STIV.

    Science.gov (United States)

    Fu, Chi-yu; Johnson, Johnson E

    2012-04-01

    Recent investigations of archaeal viruses have revealed novel features of their structures and life cycles when compared to eukaryotic and bacterial viruses, yet there are structure-based unifying themes suggesting common ancestral relationships among dsDNA viruses in the three kingdoms of life. Sulfolobus solfataricus and the infecting virus Sulfolobus turreted icosahedral virus (STIV) is one of the well-established model systems to study archaeal virus replication and viral-host interactions. Reliable laboratory conditions to propagate STIV and available genetic tools allowed structural characterization of the virus and viral components that lead to the proposal of common capsid ancestry with PRD1 (bacteriophage), Adenovirus (eukaryotic virus) and PBCV (chlorellavirus). Microarray and proteomics approaches systematically analyzed viral replication and the corresponding host responses. Cellular cryo-electron tomography and thin-section EM studies uncovered the assembly and maturation pathway of STIV and revealed dramatic cellular ultra-structure changes upon infection. The viral-induced pyramid-like protrusions on cell surfaces represent a novel viral release mechanism and previously uncharacterized functions in viral replication. PMID:22482708

  7. Environmental shaping of sponge associated archaeal communities.

    Directory of Open Access Journals (Sweden)

    Aline S Turque

    Full Text Available BACKGROUND: Archaea are ubiquitous symbionts of marine sponges but their ecological roles and the influence of environmental factors on these associations are still poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We compared the diversity and composition of archaea associated with seawater and with the sponges Hymeniacidon heliophila, Paraleucilla magna and Petromica citrina in two distinct environments: Guanabara Bay, a highly impacted estuary in Rio de Janeiro, Brazil, and the nearby Cagarras Archipelago. For this we used metagenomic analyses of 16S rRNA and ammonia monooxygenase (amoA gene libraries. Hymeniacidon heliophila was more abundant inside the bay, while P. magna was more abundant outside and P. citrina was only recorded at the Cagarras Archipelago. Principal Component Analysis plots (PCA generated using pairwise unweighted UniFrac distances showed that the archaeal community structure of inner bay seawater and sponges was different from that of coastal Cagarras Archipelago. Rarefaction analyses showed that inner bay archaeaoplankton were more diverse than those from the Cagarras Archipelago. Only members of Crenarchaeota were found in sponge libraries, while in seawater both Crenarchaeota and Euryarchaeota were observed. Although most amoA archaeal genes detected in this study seem to be novel, some clones were affiliated to known ammonia oxidizers such as Nitrosopumilus maritimus and Cenarchaeum symbiosum. CONCLUSION/SIGNIFICANCE: The composition and diversity of archaeal communities associated with pollution-tolerant sponge species can change in a range of few kilometers, probably influenced by eutrophication. The presence of archaeal amoA genes in Porifera suggests that Archaea are involved in the nitrogen cycle within the sponge holobiont, possibly increasing its resistance to anthropogenic impacts. The higher diversity of Crenarchaeota in the polluted area suggests that some marine sponges are able to change the composition

  8. Archaeal communities associated with roots of the common reed (Phragmites australis) in Beijing Cuihu Wetland.

    Science.gov (United States)

    Liu, Yin; Li, Hong; Liu, Qun Fang; Li, Yan Hong

    2015-05-01

    The richness, phylogeny and composition of archaeal community associated with the roots of common reed (Phragmites australis) growing in the Beijing Cuihu Wetland, China was investigated using a 16S rDNA library. In total, 235 individual sequences were collected, and a phylogenetic analysis revealed that 69.4 and 11.5 % of clones were affiliated with the Euryarchaeota and the Crenarchaeota, respectively. In Euryarchaeota, the archaeal community was dominated by species in following genera: Methanobacterium in the order Methanobacteriales (60.7 %); Methanoregula and Methanospirillum in the order Methanomicrobiales (20.2 %), and Methanomethylovorans, Methanosarcina and Methanosaeta in the order Methanosarcinales (17.2 %). Of 27 sequences assigned to uncultured Crenarchaeota, 22 were grouped into Group 1.3, and five grouped into Group 1.1b. Hence, the archaeal communities associated with reed roots are largely involved in methane production, and, to a lesser extent, in ammonia oxidization. Quantification of the archaeal amoA gene indicated that ammonia oxidizing archaea were more numerous in the rhizosphere soil than in the root tissue or surrounding water. A total of 19.1 % of the sequences were unclassified, suggesting that many unidentified archaea are probably involved in the reed wetland ecosystem. PMID:25739566

  9. Structure and genome organization of AFV2, a novel archaeal lipothrixvirus with unusual terminal and core structures

    DEFF Research Database (Denmark)

    Häring, Monika; Vestergaard, Gisle Alberg; Brügger, Kim;

    2005-01-01

    A novel filamentous virus, AFV2, from the hyperthermophilic archaeal genus Acidianus shows structural similarity to lipothrixviruses but differs from them in its unusual terminal and core structures. The double-stranded DNA genome contains 31,787 bp and carries eight open reading frames homologous...

  10. Niche specialization of terrestrial archaeal ammonia oxidizers

    OpenAIRE

    Gubry-Rangin, Cécile; Hai, Brigitte; Quince, Christopher; Engel, Marion; Thomson, Bruce C.; James, Phillip; Schloter, Michael; Robert I. Griffiths; Prosser, James I.; Nicol, Graeme W.

    2011-01-01

    Soil pH is a major determinant of microbial ecosystem processes and potentially a major driver of evolution, adaptation, and diversity of ammonia oxidizers, which control soil nitrification. Archaea are major components of soil microbial communities and contribute significantly to ammonia oxidation in some soils. To determine whether pH drives evolutionary adaptation and community structure of soil archaeal ammonia oxidizers, sequences of amoA, a key functional gene of ammonia oxidation, were...

  11. Structure of the rare archaeal biosphere and seasonal dynamics of active ecotypes in surface coastal waters.

    Science.gov (United States)

    Hugoni, Mylène; Taib, Najwa; Debroas, Didier; Domaizon, Isabelle; Jouan Dufournel, Isabelle; Bronner, Gisèle; Salter, Ian; Agogué, Hélène; Mary, Isabelle; Galand, Pierre E

    2013-04-01

    Marine Archaea are important players among microbial plankton and significantly contribute to biogeochemical cycles, but details regarding their community structure and long-term seasonal activity and dynamics remain largely unexplored. In this study, we monitored the interannual archaeal community composition of abundant and rare biospheres in northwestern Mediterranean Sea surface waters by pyrosequencing 16S rDNA and rRNA. A detailed analysis of the rare biosphere structure showed that the rare archaeal community was composed of three distinct fractions. One contained the rare Archaea that became abundant at different times within the same ecosystem; these cells were typically not dormant, and we hypothesize that they represent a local seed bank that is specific and essential for ecosystem functioning through cycling seasonal environmental conditions. The second fraction contained cells that were uncommon in public databases and not active, consisting of aliens to the studied ecosystem and representing a nonlocal seed bank of potential colonizers. The third fraction contained Archaea that were always rare but actively growing; their affiliation and seasonal dynamics were similar to the abundant microbes and could not be considered a seed bank. We also showed that the major archaeal groups, Thaumarchaeota marine group I and Euryarchaeota group II.B in winter and Euryarchaeota group II.A in summer, contained different ecotypes with varying activities. Our findings suggest that archaeal diversity could be associated with distinct metabolisms or life strategies, and that the rare archaeal biosphere is composed of a complex assortment of organisms with distinct histories that affect their potential for growth.

  12. TBP Domain Symmetry in Basal and Activated Archaeal Transcription

    OpenAIRE

    Ouhammouch, Mohamed; Hausner, Winfried; Geiduschek, E Peter

    2008-01-01

    The TATA-box binding protein (TBP) is the platform for assembly of archaeal and eukaryotic transcription preinitiation complexes. Ancestral gene duplication and fusion events have produced the saddle-shaped TBP molecule, with its two direct-repeat subdomains and pseudo-two-fold symmetry. Collectively, eukaryotic TBPs have diverged from their present-day archaeal counterparts, which remain highly symmetrical. The similarity of the N- and C-halves of archaeal TBPs is especially pronounced in th...

  13. Characterization of Olkiluoto bacterial and archaeal communities by 454 pyrosequencing

    Energy Technology Data Exchange (ETDEWEB)

    Bomberg, M.; Nyyssoenen, M.; Itaevaara, M. [VTT Technical Research Centre of Finland, Espoo (Finland)

    2012-06-15

    Recent advancement in sequencing technologies, 'Next Generation Sequencing', such as FLX 454 pyrosequencing has made it possible to obtain large amounts of sequence data where previously only few sequences could be obtained. This technique is especially useful for the study of community composition of uncultured microbial populations in environmental samples. In this project, the FLX 454 pyrosequencing technique was used to obtain up to 20 000 16S rRNA sequences or 10 000 mRNA sequences from each sample for identification of the microbial species composition as well as for comparison of the microbial communities between different samples. This project focused on the characterization of active microbial communities in the groundwater at the final disposal site of high radioactive wastes in Olkiluoto by FLX 454 pyrosequencing of the bacterial and archaeal ribosomal RNA as well as of the mRNA transcripts of the dsrB gene and mcrA gene of sulphate reducing bacteria and methanogenic archaea, respectively. Specific emphasis was put on studying the relationship of active and latent sulphate reducers and methanogens by qPCR due to their important roles in deep geobiochemical processes connected to copper corrosion. Seven packered boreholes were sampled anaerobically in Olkiluoto during 2009-2010. Groundwater was pumped from specific depths and the microbial cells werecollected by filtration on a membrane. Active microbial communities were studied based on RNA extracted from the membranes and translated to copy DNA, followed by sequencing by 454 Tag pyrosequencing. A total of 27 different bacterial and 17 archaeal taxonomic groups were detected.

  14. Transmembrane signal transduction by peptide hormones via family B G protein-coupled receptors

    Directory of Open Access Journals (Sweden)

    Kelly J Culhane

    2015-11-01

    Full Text Available Although family B G protein-coupled receptors (GPCRs contain only 15 members, they play key roles in transmembrane signal transduction of hormones. Family B GPCRs are drug targets for developing therapeutics for diseases ranging from metabolic to neurological disorders. Despite their importance, the molecular mechanism of activation of family B GPCRs remains largely unexplored due to the challenges in expression and purification of functional receptors to the quantity for biophysical characterization. Currently, there is no crystal structure available of a full-length family B GPCR. However, structures of key domains, including the extracellular ligand binding regions and seven-helical transmembrane regions, have been solved by X-ray crystallography and NMR, providing insights into the mechanisms of ligand recognition and selectivity, and helical arrangements within the cell membrane. Moreover, biophysical and biochemical methods have been used to explore functions, key residues for signaling, and the kinetics and dynamics of signaling processes. This review summarizes the current knowledge of the signal transduction mechanism of family B GPCRs at the molecular level and comments on the challenges and outlook for mechanistic studies of family B GPCRs.

  15. Assessment of bacterial and archaeal community structure in Swine wastewater treatment processes.

    Science.gov (United States)

    Da Silva, Marcio Luis Busi; Cantão, Mauricio Egídio; Mezzari, Melissa Paola; Ma, Jie; Nossa, Carlos Wolfgang

    2015-07-01

    Microbial communities from two field-scale swine wastewater treatment plants (WWTPs) were assessed by pyrosequencing analyses of bacterial and archaeal 16S ribosomal DNA (rDNA) fragments. Effluent samples from secondary (anaerobic covered lagoons and upflow anaerobic sludge blanket [UASB]) and tertiary treatment systems (open-pond natural attenuation lagoon and air-sparged nitrification-denitrification tank followed by alkaline phosphorus precipitation process) were analyzed. A total of 56,807 and 48,859 high-quality reads were obtained from bacterial and archaeal libraries, respectively. Dominant bacterial communities were associated with the phylum Firmicutes, Bacteroidetes, Proteobacteria, or Actinobacteria. Bacteria and archaea diversity were highest in UASB effluent sample. Escherichia, Lactobacillus, Bacteroides, and/or Prevotella were used as indicators of putative pathogen reduction throughout the WWTPs. Satisfactory pathogen reduction was observed after the open-pond natural attenuation lagoon but not after the air-sparged nitrification/denitrification followed by alkaline phosphorus precipitation treatment processes. Among the archaeal communities, 80% of the reads was related to hydrogeno-trophic methanogens Methanospirillum. Enrichment of hydrogenotrophic methanogens detected in effluent samples from the anaerobic covered lagoons and UASB suggested that CO2 reduction with H2 was the dominant methanogenic pathway in these systems. Overall, the results served to improve our current understanding of major microbial communities' changes downgradient from the pen and throughout swine WWTP as a result of different treatment processes. PMID:25432577

  16. Changes in archaeal abundance and community structure along a salinity gradient in the lower Pearl River and its estuary

    Science.gov (United States)

    Zhang, C.; Wang, J.; Xie, W.; Wang, P.; Wei, Y.; Chen, S.; Zhou, X.

    2013-12-01

    Archaea occur in a wide range of habitats and across broad environmental gradients. At the global scale, salinity is known to be a major driving force for archaeal species diversity. The goal of this study was to examine changes in abundance and diversity of archaeal community DNA and membrane lipids in the water column along a salinity gradient in the lower Pearl River and estuary in the context of water/gas chemistry (pH, nitrate/nitrite, ammonia, methane, carbon dioxide). The pH increased and nitrate/nitrite and ammonia decreased from the lower Pearl River to the estuary. Methane and carbon dioxide fluxes were high in the lower Pearl River and decreased sharply in the estuary and toward the open ocean. The archaeal lipid profile exhibited abrupt changes from dominance of GDGT-0 (a glycerol diakly glycerol tetraether with zero cyclopentyl ring, which is commonly present in methanogens) to dominance of crenarchaeol (a specific biomarker for Thaumarchaeota) with increasing salinity from zero in the lower Pearl River to >0.5% in the estuary. Quantification of the 16S rRNA gene abundance using qPCR revealed a switch from bacteria-dominance to archaea-dominance and the ratio of archaeal nirK/bacterial-amoA genes had a peak value in the estuary, suggesting enhanced activity of ammonia oxidation by archaea. Pyrosequencing of archaeal 16S rRNA, amoA and nirK genes exhibited systematic variation defined by habitat types. Our current studies employ rate measurements of carbon fixation, ammonia oxidation, and nitrate reduction using isotope labeling approaches, which will allow us to link changes in archaeal community structure and ecological function.

  17. Stratified active archaeal communities in the sediments of Jiulong River Estuary, China

    Directory of Open Access Journals (Sweden)

    Qianqian eLi

    2012-08-01

    Full Text Available Here the composition of total and active archaeal communities in a sediment core of Jiulong River estuary at Fujian Province, Southern China was reported. Profiles of CH4 and SO42- concentrations from the sediment core indicated the existence of a sulfate-methane transition zone (SMTZ in which sulfate reduction-coupled anaerobic oxidation of methane occurs. Accordingly, three sediment layers (16-18.5 cm, 71-73.5 cm, 161-163.5 cm from the 1.2 m sediment core were sectioned and named top, middle and bottom, respectively. Total DNA and RNA of each layer were extracted and used for clone libraries and sequence analysis of 16S rRNA genes, the reverse transcription (RT-PCR products of 16S rRNA and methyl CoM reductase alpha subunit (mcrA genes. Phylogenetic analysis indicated that archaeal communities of the three layers were dominated by the Miscellaneous Crenarchaeotal Group (MCG whose ecological functions were still unknown. The MCG could be further divided into seven subgroups, named MCG-A, B, C, D, E, F and G. MCG-A and MCG-G were the most active groups in the estuarine sediments. Known anaerobic methanotrophic archaea (ANMEs were only found as minor components in these estuarine archaeal communities. This study, together with the studies of deep subsurface sediments, would be a very good start point to target and compare the specific active archaeal groups and their roles in the dark, deep subsurface sediment environments.

  18. Bacterial and archaeal phylogenetic diversity associated with swine sludge from an anaerobic treatment lagoon.

    Science.gov (United States)

    Cardinali-Rezende, Juliana; Pereira, Zelina L; Sanz, José L; Chartone-Souza, Edmar; Nascimento, Andréa M A

    2012-11-01

    Over the last decades, the demand for pork products has increased significantly, along with concern about suitable waste management. Anaerobic-lagoon fermentation for swine-sludge stabilization is a good strategy, although little is known about the microbial communities in the lagoons. Here, we employed a cloning- and sequencing-based analysis of the 16S rRNA gene to characterize and quantify the prokaryotic community composition in a swine-waste-sludge anaerobic lagoon (SAL). DNA sequence analysis revealed that the SAL library harbored 15 bacterial phyla: Bacteroidetes, Cloroflexi, Proteobacteria, Firmicutes, Deinococcus-Thermus, Synergystetes, Gemmatimonadetes, Chlorobi, Fibrobacteres, Verrucomicrobia and candidates division OP5, OP8, WWE1, KSB1, WS6. The SAL library was generally dominated by carbohydrate-oxidizing bacteria. The archaeal sequences were related to the Crenarchaeota and Euryarchaeota phyla. Crenarchaeota predominated in the library, demonstrating that it is not restricted to high-temperature environments, being also responsible for ammonium oxidation in the anaerobic lagoon. Euryarchaeota sequences were associated with the hydrogenotrophic methanogens (Methanomicrobiales and Methanobacteriales). Quantitative PCR analysis revealed that the number of bacterial cells was at least three orders of magnitude higher than the number of archaeal cells in the SAL. The identified prokaryotic diversity was ecologically significant, particularly the archaeal community of hydrogenotrophic methanogens, which was responsible for methane production in the anaerobic lagoon. This study provided insight into the archaeal involvement in the overall oxidation of organic matter and the production of methane. Therefore, the treatment of swine waste in the sludge anaerobic lagoon could represent a potential inoculum for the start-up of municipal solid-waste digesters. PMID:22828793

  19. Characterization of an archaeal two-component system that regulates methanogenesis in Methanosaeta harundinacea.

    Directory of Open Access Journals (Sweden)

    Jie Li

    Full Text Available Two-component signal transduction systems (TCSs are a major mechanism used by bacteria in response to environmental changes. Although many sequenced archaeal genomes encode TCSs, they remain poorly understood. Previously, we reported that a methanogenic archaeon, Methanosaeta harundinacea, encodes FilI, which synthesizes carboxyl-acyl homoserine lactones, to regulate transitions of cellular morphology and carbon metabolic fluxes. Here, we report that filI, the cotranscribed filR2, and the adjacent filR1 constitute an archaeal TCS. FilI possesses a cytoplasmic kinase domain (histidine kinase A and histidine kinase-like ATPase and its cognate response regulator. FilR1 carries a receiver (REC domain coupled with an ArsR-related domain with potential DNA-binding ability, while FilR2 carries only a REC domain. In a phosphorelay assay, FilI was autophosphorylated and specifically transferred the phosphoryl group to FilR1 and FilR2, confirming that the three formed a cognate TCS. Through chromatin immunoprecipitation-quantitative polymerase chain reaction (ChIP-qPCR using an anti-FilR1 antibody, FilR1 was shown to form in vivo associations with its own promoter and the promoter of the filI-filR2 operon, demonstrating a regulatory pattern common among TCSs. ChIP-qPCR also detected FilR1 associations with key genes involved in acetoclastic methanogenesis, acs4 and acs1. Electrophoretic mobility shift assays confirmed the in vitro tight binding of FilR1 to its own promoter and those of filI-filR2, acs4, and mtrABC. This also proves the DNA-binding ability of the ArsR-related domain, which is found primarily in Archaea. The archaeal promoters of acs4, filI, acs1, and mtrABC also initiated FilR1-modulated expression in an Escherichia coli lux reporter system, suggesting that FilR1 can up-regulate both archaeal and bacterial transcription. In conclusion, this work identifies an archaeal FilI/FilRs TCS that regulates the methanogenesis of M. harundinacea.

  20. A dimeric Rep protein initiates replication of a linear archaeal virus genome: implications for the Rep mechanism and viral replication

    DEFF Research Database (Denmark)

    Oke, Muse; Kerou, Melina; Liu, Huanting;

    2011-01-01

    The Rudiviridae are a family of rod-shaped archaeal viruses with covalently closed, linear double-stranded DNA (dsDNA) genomes. Their replication mechanisms remain obscure, although parallels have been drawn to the Poxviridae and other large cytoplasmic eukaryotic viruses. Here we report that a...... active-site tyrosine and the 5' end of the DNA, releasing a 3' DNA end as a primer for DNA synthesis. The enzyme can also catalyze the joining reaction that is necessary to reseal the DNA hairpin and terminate replication. The dimeric structure points to a simple mechanism through which two closely...... positioned active sites, each with a single tyrosine residue, work in tandem to catalyze DNA nicking and joining. We propose a novel mechanism for rudivirus DNA replication, incorporating the first known example of a Rep protein that is not linked to RCR. The implications for Rep protein function and viral...

  1. Identification of an archaeal mercury regulon by chromatin immunoprecipitation.

    Science.gov (United States)

    Rudrappa, Deepak; Yao, Andrew I; White, Derrick; Pavlik, Benjamin J; Singh, Raghuveer; Facciotti, Marc T; Blum, Paul

    2015-12-01

    Mercury is a heavy metal and toxic to all forms of life. Metal exposure can invoke a response to improve survival. In archaea, several components of a mercury response system have been identified, but it is not known whether metal transport is a member of this system. To identify such missing components, a peptide-tagged MerR transcription factor was used to localize enriched chromosome regions by chromosome immunoprecipitation combined with DNA sequence analysis. Such regions could serve as secondary regulatory binding sites to control the expression of additional genes associated with mercury detoxification. Among the 31 highly enriched loci, a subset of five was pursued as potential candidates based on their current annotations. Quantitative reverse transcription-PCR analysis of these regions with and without mercury treatment in WT and mutant strains lacking merR indicated significant regulatory responses under these conditions. Of these, a Family 5 extracellular solute-binding protein and the MarR transcription factor shown previously to control responses to oxidation were most strongly affected. Inactivation of the solute-binding protein by gene disruption increased the resistance of mutant cells to mercury challenge. Inductively coupled plasma-MS analysis of the mutant cell line following metal challenge indicated there was less intracellular mercury compared with the isogenic WT strain. Together, these regulated genes comprise new members of the archaeal MerR regulon and reveal a cascade of transcriptional control not previously demonstrated in this model organism.

  2. Seasonal dynamics of bacterial and archaeal methanogenic communities in flooded rice fields and effect of drainage

    Directory of Open Access Journals (Sweden)

    Björn eBreidenbach

    2015-01-01

    Full Text Available We studied the resident (16S rDNA and the active (16S rRNA members of soil archaeal and bacterial communities during rice plant development by sampling three growth stages (vegetative, reproductive and maturity under field conditions. Additionally, the microbial community was investigated in two non-flooded fields (unplanted, cultivated with upland maize in order to monitor the reaction of the microbial communities to non-flooded, dry conditions. The abundance of Bacteria and Archaea was monitored by quantitative PCR showing an increase in 16S rDNA during reproductive stage and stable 16S rRNA copies throughout the growth season. Community profiling by T-RFLP indicated a relatively stable composition during rice plant growth whereas pyrosequencing revealed minor changes in relative abundance of a few bacterial groups. Comparison of the two non-flooded fields with flooded rice fields showed that the community composition of the Bacteria was slightly different, while that of the Archaea was almost the same. Only the relative abundance of Methanosarcinaceae and Soil Crenarchaeotic Group increased in non-flooded versus flooded soil. The abundance of bacterial and archaeal 16S rDNA copies was highest in flooded rice fields, followed by non-flooded maize and unplanted fields. However, the abundance of ribosomal RNA (active microbes was similar indicating maintenance of a high level of ribosomal RNA under the non-flooded conditions, which were unfavorable for anaerobic bacteria and methanogenic archaea. This maintenance possibly serves as preparedness for activity when conditions improve. In summary, the analyses showed that the bacterial and archaeal communities inhabiting Philippine rice field soil were relatively stable over the season but reacted upon change in field management.

  3. A Method for Identification of Selenoprotein Genes in Archaeal Genomes

    Institute of Scientific and Technical Information of China (English)

    Mingfeng Li; Yanzhao Huang; Yi Xiao

    2009-01-01

    The genetic codon UGA has a dual function: serving as a terminator and encoding selenocysteine. However, most popular gene annotation programs only take it as a stop signal, resulting in misannotation or completely missing selenoprotein genes. We developed a computational method named Asec-Prediction that is specific for the prediction of archaeal selenoprotein genes. To evaluate its effectiveness, we first applied it to 14 archaeal genomes with previously known selenoprotein genes, and Asec-Prediction identified all reported selenoprotein genes without redundant results. When we applied it to 12 archaeal genomes that had not been researched for selenoprotein genes, Asec-Prediction detected a novel selenoprotein gene in Methanosarcina acetivorans. Further evidence was also collected to support that the predicted gene should be a real selenoprotein gene. The result shows that Asec-Prediction is effective for the prediction of archaeal selenoprotein genes.

  4. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

    Science.gov (United States)

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

  5. Crystal structure of the flagellar accessory protein FlaH of Methanocaldococcus jannaschii suggests a regulatory role in archaeal flagellum assembly.

    Science.gov (United States)

    Meshcheryakov, Vladimir A; Wolf, Matthias

    2016-06-01

    Archaeal flagella are unique structures that share functional similarity with bacterial flagella, but are structurally related to bacterial type IV pili. The flagellar accessory protein FlaH is one of the conserved components of the archaeal motility system. However, its function is not clearly understood. Here, we present the 2.2 Å resolution crystal structure of FlaH from the hyperthermophilic archaeon, Methanocaldococcus jannaschii. The protein has a characteristic RecA-like fold, which has been found previously both in archaea and bacteria. We show that FlaH binds to immobilized ATP-however, it lacks ATPase activity. Surface plasmon resonance analysis demonstrates that ATP affects the interaction between FlaH and the archaeal motor protein FlaI. In the presence of ATP, the FlaH-FlaI interaction becomes significantly weaker. A database search revealed similarity between FlaH and several DNA-binding proteins of the RecA superfamily. The closest structural homologs of FlaH are KaiC-like proteins, which are archaeal homologs of the circadian clock protein KaiC from cyanobacteria. We propose that one of the functions of FlaH may be the regulation of archaeal motor complex assembly. PMID:27060465

  6. Functional analysis of archaeal MBF1 by complementation studies in yeast

    Directory of Open Access Journals (Sweden)

    Siebers Bettina

    2011-03-01

    SCM1. Conclusions The absence of MBF1-interacting activators in the archaeal domain, the presence of a Zn ribbon motif in the divergent N-terminal domain of aMBF1 and the complementation experiments using archaeal- yeast chimeric proteins presented here suggests that archaeal MBF1 is not able to functionally interact with the transcription machinery and/or Gcn4 of S. cerevisiae. Based on modeling and structural prediction it is tempting to speculate that aMBF1 might act as a single regulator or non-essential transcription factor, which directly interacts with DNA via the positive charged linker or the basal transcription machinery via its Zn ribbon motif and the HTH domain. However, also alternative functions in ribosome biosynthesis and/or functionality have been discussed and therefore further experiments are required to unravel the function of MBF1 in Archaea. Reviewers This article was reviewed by William Martin, Patrick Forterre, John van der Oost and Fabian Blombach (nominated by Eugene V Koonin (United States. For the full reviews, please go to the Reviewer's Reports section.

  7. Identification and genomic analysis of transcription factors in archaeal genomes exemplifies their functional architecture and evolutionary origin.

    Science.gov (United States)

    Pérez-Rueda, Ernesto; Janga, Sarath Chandra

    2010-06-01

    Archaea, which represent a large fraction of the phylogenetic diversity of organisms, are prokaryotes with eukaryote-like basal transcriptional machinery. This organization makes the study of their DNA-binding transcription factors (TFs) and their transcriptional regulatory networks particularly interesting. In addition, there are limited experimental data regarding their TFs. In this work, 3,918 TFs were identified and exhaustively analyzed in 52 archaeal genomes. TFs represented less than 5% of the gene products in all the studied species comparable with the number of TFs identified in parasites or intracellular pathogenic bacteria, suggesting a deficit in this class of proteins. A total of 75 families were identified, of which HTH_3, AsnC, TrmB, and ArsR families were universally and abundantly identified in all the archaeal genomes. We found that archaeal TFs are significantly small compared with other protein-coding genes in archaea as well as bacterial TFs, suggesting that a large fraction of these small-sized TFs could supply the probable deficit of TFs in archaea, by possibly forming different combinations of monomers similar to that observed in eukaryotic transcriptional machinery. Our results show that although the DNA-binding domains of archaeal TFs are similar to bacteria, there is an underrepresentation of ligand-binding domains in smaller TFs, which suggests that protein-protein interactions may act as mediators of regulatory feedback, indicating a chimera of bacterial and eukaryotic TFs' functionality. The analysis presented here contributes to the understanding of the details of transcriptional apparatus in archaea and provides a framework for the analysis of regulatory networks in these organisms.

  8. Bacterial and Archaeal Diversity in the Gastrointestinal Tract of the North American Beaver (Castor canadensis)

    Science.gov (United States)

    Gruninger, Robert J.; McAllister, Tim A.; Forster, Robert J.

    2016-01-01

    The North American Beaver (Castor canadensis) is the second largest living rodent and an iconic symbol of Canada. The beaver is a semi-aquatic browser whose diet consists of lignocellulose from a variety of plants. The beaver is a hindgut fermenter and has an enlarged ceacum that houses a complex microbiome. There have been few studies examining the microbial diversity in gastrointestinal tract of hindgut fermenting herbivores. To examine the bacterial and archaeal communities inhabiting the gastrointestinal tract of the beaver, the microbiome of the ceacum and feaces was examined using culture-independent methods. DNA from the microbial community of the ceacum and feaces of 4 adult beavers was extracted, and the16S rRNA gene was sequenced using either bacterial or archaeal specific primers. A total of 1447 and 1435 unique bacterial OTUs were sequenced from the ceacum and feaces, respectively. On average, the majority of OTUs within the ceacum were classified as Bacteroidetes (49.2%) and Firmicutes (47.6%). The feaces was also dominated by OTUs from Bacteroidetes (36.8%) and Firmicutes (58.9%). The composition of bacterial community was not significantly different among animals. The composition of the ceacal and feacal microbiome differed, but this difference is due to changes in the abundance of closely related OTUs, not because of major differences in the taxonomic composition of the communities. Within these communities, known degraders of lignocellulose were identified. In contrast, to the bacterial microbiome, the archaeal community was dominated by a single species of methanogen, Methanosphaera stadtmanae. The data presented here provide the first insight into the microbial community within the hindgut of the beaver. PMID:27227334

  9. Land-use systems affect Archaeal community structure and functional diversity in western Amazon soils

    Directory of Open Access Journals (Sweden)

    Acácio Aparecido Navarrete

    2011-10-01

    Full Text Available The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure and ammonia-oxidizing Archaea (richness and community composition were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009 from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old, agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA of Archaea (306 sequences, the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366, followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715, crops (H' = 1.4613; D = 0.3309 and secondary forest (H' = 0.8633; D = 0.5405. All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 % previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.

  10. Bacterial and archaeal community structures in the Arctic deep-sea sediment

    Institute of Scientific and Technical Information of China (English)

    LI Yan; LIU Qun; LI Chaolun; DONG Yi; ZHANG Wenyan; ZHANG Wuchang; XIAO Tian

    2015-01-01

    Microbial community structures in the Arctic deep-sea sedimentary ecosystem are determined by organic matter input, energy availability, and other environmental factors. However, global warming and earlier ice-cover melting are affecting the microbial diversity. To characterize the Arctic deep-sea sediment microbial diversity and its rela-tionship with environmental factors, we applied Roche 454 sequencing of 16S rDNA amplicons from Arctic deep-sea sediment sample. Both bacterial and archaeal communities’ richness, compositions and structures as well as tax-onomic and phylogenetic affiliations of identified clades were characterized. Phylotypes relating to sulfur reduction and chemoorganotrophic lifestyle are major groups in the bacterial groups;while the archaeal community is domi-nated by phylotypes most closely related to the ammonia-oxidizing Thaumarchaeota (96.66%) and methanogenic Euryarchaeota (3.21%). This study describes the microbial diversity in the Arctic deep marine sediment (>3 500 m) near the North Pole and would lay foundation for future functional analysis on microbial metabolic processes and pathways predictions in similar environments.

  11. Phylogenetic analysis of the archaeal community in an alkaline-saline soil of the former lake Texcoco (Mexico).

    Science.gov (United States)

    Valenzuela-Encinas, César; Neria-González, Isabel; Alcántara-Hernández, Rocio J; Enríquez-Aragón, J Arturo; Estrada-Alvarado, Isabel; Hernández-Rodríguez, César; Dendooven, Luc; Marsch, Rodolfo

    2008-03-01

    The soil of the former lake Texcoco is an extreme environment localized in the valley of Mexico City, Mexico. It is highly saline and alkaline, where Na+, Cl(-), HCO3(-) and CO3(2-) are the predominant ions, with a pH ranging from 9.8 to 11.7 and electrolytic conductivities in saturation extracts from 22 to 150 dS m(-1). Metagenomic DNA from the archaeal community was extracted directly from soil and used as template to amplify 16S ribosomal gene by PCR. PCR products were used to construct gene libraries. The ribosomal library showed that the archaeal diversity included Natronococcus sp., Natronolimnobius sp., Natronobacterium sp., Natrinema sp., Natronomonas sp., Halovivax sp., "Halalkalicoccus jeotgali" and novel clades within the family of Halobacteriaceae. Four clones could not be classified. It was found that the archaeal diversity in an alkaline-saline soil of the former lake Texcoco, Mexico, was low, but showed yet uncharacterized and unclassified species.

  12. Phylogenetic and functional analysis of metagenome sequence from high-temperature archaeal habitats demonstrate linkages between metabolic potential and geochemistry

    Directory of Open Access Journals (Sweden)

    William P. Inskeep

    2013-05-01

    Full Text Available Geothermal habitats in Yellowstone National Park (YNP provide an unparalled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (~40-45 Mbase Sanger sequencing per site was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G+C content and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH. These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high temperature systems of YNP.

  13. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry.

    Science.gov (United States)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus J; Kozubal, Mark A; Rusch, Douglas B; Tringe, Susannah G; Macur, Richard E; Jennings, Ryan deM; Boyd, Eric S; Spear, John R; Roberto, Francisco F

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and/or microbial mats and subjected to numerous phylogenetic and functional analyses. Analysis of individual sequences (e.g., MEGAN and G + C content) and assemblies from each habitat type revealed the presence of dominant archaeal populations in all environments, 10 of whose genomes were largely reconstructed from the sequence data. Analysis of protein family occurrence, particularly of those involved in energy conservation, electron transport, and autotrophic metabolism, revealed significant differences in metabolic strategies across sites consistent with differences in major geochemical attributes (e.g., sulfide, oxygen, pH). These observations provide an ecological basis for understanding the distribution of indigenous archaeal lineages across high-temperature systems of YNP.

  14. Complete architecture of the archaeal RNA polymerase open complex from single-molecule FRET and NPS

    Science.gov (United States)

    Nagy, Julia; Grohmann, Dina; Cheung, Alan C. M.; Schulz, Sarah; Smollett, Katherine; Werner, Finn; Michaelis, Jens

    2015-01-01

    The molecular architecture of RNAP II-like transcription initiation complexes remains opaque due to its conformational flexibility and size. Here we report the three-dimensional architecture of the complete open complex (OC) composed of the promoter DNA, TATA box-binding protein (TBP), transcription factor B (TFB), transcription factor E (TFE) and the 12-subunit RNA polymerase (RNAP) from Methanocaldococcus jannaschii. By combining single-molecule Förster resonance energy transfer and the Bayesian parameter estimation-based Nano-Positioning System analysis, we model the entire archaeal OC, which elucidates the path of the non-template DNA (ntDNA) strand and interaction sites of the transcription factors with the RNAP. Compared with models of the eukaryotic OC, the TATA DNA region with TBP and TFB is positioned closer to the surface of the RNAP, likely providing the mechanism by which DNA melting can occur in a minimal factor configuration, without the dedicated translocase/helicase encoding factor TFIIH.

  15. Familial relationships in hyperthermo- and acidophilic archaeal viruses

    DEFF Research Database (Denmark)

    Happonen, Lotta Johanna; Redder, Peter; Peng, Xu;

    2010-01-01

    Archaea often live in extreme, harsh environments such as acidic hot springs and hypersaline waters. To date, only two icosahedrally symmetric, membrane-containing archaeal viruses, SH1 and Sulfolobus turreted icosahedral virus (STIV), have been described in detail. We report the sequence and three...

  16. Bacterial and archaeal resistance to ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Confalonieri, F; Sommer, S, E-mail: fabrice.confalonieri@u-psud.fr, E-mail: suzanne.sommer@u-psud.fr [University Paris-Sud, CNRS UMR8621, Institut de Genetique et Microbiologie, Batiments 400-409, Universite Paris-Sud, 91405 Orsay (France)

    2011-01-01

    Organisms living in extreme environments must cope with large fluctuations of temperature, high levels of radiation and/or desiccation, conditions that can induce DNA damage ranging from base modifications to DNA double-strand breaks. The bacterium Deinococcus radiodurans is known for its resistance to extremely high doses of ionizing radiation and for its ability to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Recently, extreme ionizing radiation resistance was also generated by directed evolution of an apparently radiation-sensitive bacterial species, Escherichia coli. Radioresistant organisms are not only found among the Eubacteria but also among the Archaea that represent the third kingdom of life. They present a set of particular features that differentiate them from the Eubacteria and eukaryotes. Moreover, Archaea are often isolated from extreme environments where they live under severe conditions of temperature, pressure, pH, salts or toxic compounds that are lethal for the large majority of living organisms. Thus, Archaea offer the opportunity to understand how cells are able to cope with such harsh conditions. Among them, the halophilic archaeon Halobacterium sp and several Pyrococcus or Thermococcus species, such as Thermococcus gammatolerans, were also shown to display high level of radiation resistance. The dispersion, in the phylogenetic tree, of radioresistant prokaryotes suggests that they have independently acquired radioresistance. Different strategies were selected during evolution including several mechanisms of radiation byproduct detoxification and subtle cellular metabolism modifications to help cells recover from radiation-induced injuries, protection of proteins against oxidation, an efficient DNA repair tool box, an original pathway of DNA double-strand break repair, a condensed nucleoid that may prevent the dispersion of the DNA fragments and specific radiation-induced proteins involved in

  17. Influences of plant type on bacterial and archaeal communities in constructed wetland treating polluted river water.

    Science.gov (United States)

    Long, Yan; Yi, Hao; Chen, Sili; Zhang, Zhengke; Cui, Kai; Bing, Yongxin; Zhuo, Qiongfang; Li, Bingxin; Xie, Shuguang; Guo, Qingwei

    2016-10-01

    Both bacteria and archaeal communities can play important roles in biogeochemical processes in constructed wetland (CW) system. However, the influence of plant type on microbial community in surface water CW remains unclear. The present study investigated bacterial and archaeal communities in five surface water CW systems with different plant species. The abundance, richness, and diversity of both bacterial and archaeal communities considerably differed in these five CW systems. Compared with the other three CW systems, the CW systems planted with Vetiveria zizanioides or Juncus effusus L. showed much higher bacterial abundance but lower archaeal abundance. Bacteria outnumbered archaea in each CW system. Moreover, the CW systems planted with V. zizanioides or J. effusus L. had relatively lower archaeal but higher bacterial richness and diversity. In each CW system, bacterial community displayed much higher richness and diversity than archaeal community. In addition, a remarkable difference of both bacterial and archaeal community structures was observed in the five studied CW systems. Proteobacteria was the most abundant bacterial group (accounting for 33-60 %). Thaumarchaeota organisms (57 %) predominated in archaeal communities in CW systems planted with V. zizanioides or J. effusus L., while Woesearchaeota (23 or 24 %) and Euryarchaeota (23 or 15 %) were the major archaeal groups in CW systems planted with Cyperus papyrus or Canna indica L. Archaeal community in CW planted with Typha orientalis Presl was mainly composed of unclassified archaea. Therefore, plant type exerted a considerable influence on microbial community in surface water CW system. PMID:27392623

  18. Distribution of Archaeal and Bacterial communities in a subtropical reservoir

    Directory of Open Access Journals (Sweden)

    Laís Américo Soares

    2015-12-01

    Full Text Available Abstract Aim: Microbial communities play a central role in environmental process such as organic matter mineralization and the nutrient cycling process in aquatic ecosystems. Despite their ecological importance, variability of the structure of archaeal and bacterial communities in freshwater remains understudied. Methods In the present study we investigated the richness and density of archaea and bacteria in the water column and sediments of the Itupararanga Reservoir. We also evaluated the relationship between the communities and the biotic and abiotic characteristics. Samples were taken at five depths in the water column next to the dam and three depths next to the reservoir entrance. Results PCR-DGGE evaluation of the archaeal and bacterial communities showed that both were present in the water column, even in oxygenated conditions. Conclusions The density of the bacteria (qPCR was greater than that of the archaea, a result of the higher metabolic plasticity of bacteria compared with archaea.

  19. Prediction of novel archaeal enzymes from sequence-derived features

    DEFF Research Database (Denmark)

    Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

    2002-01-01

    The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

  20. Global analysis of viral infection in an archaeal model system

    Directory of Open Access Journals (Sweden)

    Walid S. Maaty

    2012-12-01

    Full Text Available The origin and evolutionary relationship of viruses is poorly understood. This makes archaeal virus-host of particular interest because the hosts generally root near the base of phylogenetic trees, while some of the viruses have clear structural similarities to those that infect prokaryotic and eukaryotic cells. Despite the advantageous position for use in evolutionary studies, little is known about archaeal viruses or how they interact with their hosts, compared to viruses of bacteria and eukaryotes. In addition, many archaeal viruses have been isolated from extreme environments and present a unique opportunity for elucidating factors that are important for existence at the extremes.. In this article we focus on virus-host interactions using a proteomics approach to study Sulfolobus Turreted Icosahedral Virus (STIV infection of Sulfolobus solfataricus P2. Using cultures grown from the ATCC cell stock, a single cycle of STIV infection was sampled 6 times over a 72 hr period. More than 700 proteins were identified throughout the course of the experiments. Seventy one host proteins were found to change by nearly two-fold (p<0.05 with 40 becoming more abundant and 31 less abundant. The modulated proteins represent 30 different cell pathways and 14 COG groups. 2D gel analysis showed that changes in post translational modifications were a common feature of the affected proteins. The results from these studies showed that the prokaryotic antiviral adaptive immune system CRISPR associated proteins (CAS proteins were regulated in response to the virus infection. It was found that regulated proteins come from mRNAs with a shorter than average half-life. In addition, activity-based protein profiling (ABPP profiling on 2D gels showed caspase, hydrolase and tyrosine phosphatase enzyme activity labeling at the protein isoform level. Together, this data provides a more detailed global view of archaeal cellular responses to viral infection, demonstrates the

  1. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil

    Directory of Open Access Journals (Sweden)

    Yendi E. Navarro-Noya

    2015-01-01

    Full Text Available In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5, indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances clearly clustered the communities by pH.

  2. Archaeal Communities in a Heterogeneous Hypersaline-Alkaline Soil.

    Science.gov (United States)

    Navarro-Noya, Yendi E; Valenzuela-Encinas, César; Sandoval-Yuriar, Alonso; Jiménez-Bueno, Norma G; Marsch, Rodolfo; Dendooven, Luc

    2015-01-01

    In this study the archaeal communities in extreme saline-alkaline soils of the former lake Texcoco, Mexico, with electrolytic conductivities (EC) ranging from 0.7 to 157.2 dS/m and pH from 8.5 to 10.5 were explored. Archaeal communities in the 0.7 dS/m pH 8.5 soil had the lowest alpha diversity values and were dominated by a limited number of phylotypes belonging to the mesophilic Candidatus Nitrososphaera. Diversity and species richness were higher in the soils with EC between 9.0 and 157.2 dS/m. The majority of OTUs detected in the hypersaline soil were members of the Halobacteriaceae family. Novel phylogenetic branches in the Halobacteriales class were detected in the soil, and more abundantly in soil with the higher pH (10.5), indicating that unknown and uncharacterized Archaea can be found in this soil. Thirteen different genera of the Halobacteriaceae family were identified and were distributed differently between the soils. Halobiforma, Halostagnicola, Haloterrigena, and Natronomonas were found in all soil samples. Methanogenic archaea were found only in soil with pH between 10.0 and 10.3. Retrieved methanogenic archaea belonged to the Methanosarcinales and Methanomicrobiales orders. The comparison of the archaeal community structures considering phylogenetic information (UniFrac distances) clearly clustered the communities by pH.

  3. Ribonucleoproteins in Archaeal Pre-rRNA Processing and Modification

    Directory of Open Access Journals (Sweden)

    W. S. Vincent Yip

    2013-01-01

    Full Text Available Given that ribosomes are one of the most important cellular macromolecular machines, it is not surprising that there is intensive research in ribosome biogenesis. Ribosome biogenesis is a complex process. The maturation of ribosomal RNAs (rRNAs requires not only the precise cleaving and folding of the pre-rRNA but also extensive nucleotide modifications. At the heart of the processing and modifications of pre-rRNAs in Archaea and Eukarya are ribonucleoprotein (RNP machines. They are called small RNPs (sRNPs, in Archaea, and small nucleolar RNPs (snoRNPs, in Eukarya. Studies on ribosome biogenesis originally focused on eukaryotic systems. However, recent studies on archaeal sRNPs have provided important insights into the functions of these RNPs. This paper will introduce archaeal rRNA gene organization and pre-rRNA processing, with a particular focus on the discovery of the archaeal sRNP components, their functions in nucleotide modification, and their structures.

  4. MED: a new non-supervised gene prediction algorithm for bacterial and archaeal genomes

    Directory of Open Access Journals (Sweden)

    Yang Yi-Fan

    2007-03-01

    Full Text Available Abstract Background Despite a remarkable success in the computational prediction of genes in Bacteria and Archaea, a lack of comprehensive understanding of prokaryotic gene structures prevents from further elucidation of differences among genomes. It continues to be interesting to develop new ab initio algorithms which not only accurately predict genes, but also facilitate comparative studies of prokaryotic genomes. Results This paper describes a new prokaryotic genefinding algorithm based on a comprehensive statistical model of protein coding Open Reading Frames (ORFs and Translation Initiation Sites (TISs. The former is based on a linguistic "Entropy Density Profile" (EDP model of coding DNA sequence and the latter comprises several relevant features related to the translation initiation. They are combined to form a so-called Multivariate Entropy Distance (MED algorithm, MED 2.0, that incorporates several strategies in the iterative program. The iterations enable us to develop a non-supervised learning process and to obtain a set of genome-specific parameters for the gene structure, before making the prediction of genes. Conclusion Results of extensive tests show that MED 2.0 achieves a competitive high performance in the gene prediction for both 5' and 3' end matches, compared to the current best prokaryotic gene finders. The advantage of the MED 2.0 is particularly evident for GC-rich genomes and archaeal genomes. Furthermore, the genome-specific parameters given by MED 2.0 match with the current understanding of prokaryotic genomes and may serve as tools for comparative genomic studies. In particular, MED 2.0 is shown to reveal divergent translation initiation mechanisms in archaeal genomes while making a more accurate prediction of TISs compared to the existing gene finders and the current GenBank annotation.

  5. Architecture of the DNA polymerase B-proliferating cell nuclear antigen (PCNA)-DNA ternary complex

    OpenAIRE

    Mayanagi, Kouta; Kiyonari, Shinichi; Nishida, Hirokazu; Saito, Mihoko; Kohda, Daisuke; Ishino, Yoshizumi; Shirai, Tsuyoshi; Morikawa, Kosuke

    2011-01-01

    DNA replication in archaea and eukaryotes is executed by family B DNA polymerases, which exhibit full activity when complexed with the DNA clamp, proliferating cell nuclear antigen (PCNA). This replication enzyme consists of the polymerase and exonuclease moieties responsible for DNA synthesis and editing (proofreading), respectively. Because of the editing activity, this enzyme ensures the high fidelity of DNA replication. However, it remains unclear how the PCNA-complexed enzyme temporally ...

  6. Bacterial and Archaeal Diversity From the Eastern Lau Spreading Center

    Science.gov (United States)

    Reysenbach, A.; Banta, A.; Kelly, S.; Kirshstein, J.; Voytek, M.

    2005-12-01

    Due to the diversity of venting styles, geological settings and variations in fluid geochemistry, the Valu Fa Ridge and Eastern Lau Spreading Center (ELSC) provide a unique opportunity to explore the effects geological and geochemical variables on patterns of microbial phylogenetic and metabolic diversity. High temperature sulfides, diffuse flow fluids and microbial mats were collected from six active vent fields on the Valu Fa Ridge and Eastern Lau Spreading Center during the R/V Melville cruise TUIM05MV. All samples were subsampled for molecular and microbial culturing purposes. The archaeal and bacterial 16S rRNA genes were amplified by PCR from a selection of samples. Additionally, the presence of Aquificales and an unidentified lineage, the DHVE archaeal group, was explored using PCR primers specific for these groups. A selection of DNAs were also screened for functional genes that are diagnostic for certain pathways, viz, aclB (reductive TCA cycle), mcrA (methanogenesis), nirS and nirK (nitrite reduction), amoA (ammonia oxidation). Culturing of thermophiles, both acidophiles and neutrophiles, was initiated. Over 20 hydrogen oxidizing (hydrogen and oxygen) or nitrate reducing (hydrogen and nitrate) chemolithoautotrophs were isolated as colonies and grow at 70 degrees C. All are related to Persephonella hydrogenophila, with the exception of 2 cultures that perhaps represent new species of Hydrogenivirga and Aquifex. Preliminary analysis of patterns of Aquificales diversity using both culturing and molecular approaches suggest that the distributions of this group alone are very different from that observed at other hydrothermal sites such as along the East Pacific Rise or Central Indian Ridge. As yet, the most commonly isolated Aquificales, P. marina, has not been detected in enrichment cultures from ELSC, and the diversity of Aquificales-related sequences is much greater than detected from sites along the EPR. It is therefore also likely, that patterns of

  7. Electroporation of archaeal lipid membranes using MD simulations.

    Science.gov (United States)

    Polak, Andraž; Tarek, Mounir; Tomšič, Matija; Valant, Janez; Ulrih, Nataša Poklar; Jamnik, Andrej; Kramar, Peter; Miklavčič, Damijan

    2014-12-01

    Molecular dynamics (MD) simulations were used to investigate the electroporation of archaeal lipid bilayers when subjected to high transmembrane voltages induced by a charge imbalance, mimicking therefore millisecond electric pulse experiments. The structural characteristics of the bilayer, a 9:91 mol% 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-myo-inositol (AI) and 2,3-di-O-sesterterpanyl-sn-glicerol-1-phospho-1'(2'-O-α-D-glucosyl)-myo-inositol (AGI) were compared to small angle X-ray scattering data. A rather good agreement of the electron density profiles at temperatures of 298 and 343 K was found assessing therefore the validity of the protocols and force fields used in simulations. Compared to dipalmitoyl-phosphatidylcholine (DPPC), the electroporation threshold for the bilayer was found to increase from ~2 V to 4.3 V at 323 K, and to 5.2 V at 298 K. Comparing the electroporation thresholds of the archaeal lipids to those of simple diphytanoyl-phosphatidylcholine (DPhPC) bilayers (2.5 V at 323 K) allowed one to trace back the stability of the membranes to the structure of their lipid head groups. Addition of DPPC in amounts of 50 mol% to the archaeal lipid bilayers decreases their stability and lowers the electroporation thresholds to 3.8 V and 4.1 V at respectively 323 and 298 K. The present study therefore shows how membrane compositions can be selected to cover a wide range of responses to electric stimuli. This provides new routes for the design of liposomes that can be efficiently used as drug delivery carriers, as the selection of their composition allows one to tune in their electroporation threshold for subsequent release of their load.

  8. Factors affecting Archaeal Lipid Compositions of the Sulfolobus Species

    Science.gov (United States)

    He, L.; Han, J.; Wei, Y.; Lin, L.; Wei, Y.; Zhang, C.

    2010-12-01

    Temperature is the best known variable affecting the distribution of the archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) in marine and freshwater systems. Other variables such as pH, ionic strength, or bicarbonate concentration may also affect archaeal GDGTs in terrestrial systems. Studies of pure cultures can help us pinpoint the specific effects these variables may have on archaeal lipid distribution in natural environments. In this study, three Sulfolobus species (HG4, HB5-2, HB9-6) isolated from Tengchong hot springs (pH 2-3, temperature 73-90°C) in China were used to investigate the effects of temperature, pH, substrate, and type of strain on the composition of GDGTs. Results showed that increase in temperature had negative effects on the relative contents of GDGT-0 (no cyclopentyl rings), GDGT-1 (one cyclopentyl ring), GDGT-2 and GDGT-3 but positive effects on GDGT-4, GDGT-4', GDGT-5 and GDGT-5'. Increase in pH, on the other hand, had negative effects on GDGT-0, GDGT-1, GDGT-4', GDGT-5 and GDGT-5', and positive effects on GDGT-3 and GDGT-4. GDGT-2 remained relatively constant with changing pH. When the HG4 was grown on different substrates, GDGT-5 was five time more abundant in sucrose-grown cultures than in yeast extract- or sulfur- grown cultures, suggesting that carbohydrates may stimulate the production of GDGT-5. For all three species, the ring index (average number of rings) of GDGTs correlated positively with incubation temperature. In HG4, ring index was much lower at optimal pH (3.5) than at other pH values. Ring index of HB5-2 or HB9-6 is higher than that of HG4, suggesting that speciation may affect the degree of cyclization of GDGT of the Sulfolobus. These results indicate that individual archaeal lipids respond differently to changes in environmental variables, which may be also species specific.

  9. Modelling the evolution of the archaeal tryptophan synthase

    Directory of Open Access Journals (Sweden)

    Merkl Rainer

    2007-04-01

    Full Text Available Abstract Background Microorganisms and plants are able to produce tryptophan. Enzymes catalysing the last seven steps of tryptophan biosynthesis are encoded in the canonical trp operon. Among the trp genes are most frequently trpA and trpB, which code for the alpha and beta subunit of tryptophan synthase. In several prokaryotic genomes, two variants of trpB (named trpB1 or trpB2 occur in different combinations. The evolutionary history of these trpB genes is under debate. Results In order to study the evolution of trp genes, completely sequenced archaeal and bacterial genomes containing trpB were analysed. Phylogenetic trees indicated that TrpB sequences constitute four distinct groups; their composition is in agreement with the location of respective genes. The first group consisted exclusively of trpB1 genes most of which belonged to trp operons. Groups two to four contained trpB2 genes. The largest group (trpB2_o contained trpB2 genes all located outside of operons. Most of these genes originated from species possessing an operon-based trpB1 in addition. Groups three and four pertain to trpB2 genes of those genomes containing exclusively one or two trpB2 genes, but no trpB1. One group (trpB2_i consisted of trpB2 genes located inside, the other (trpB2_a of trpB2 genes located outside the trp operon. TrpA and TrpB form a heterodimer and cooperate biochemically. In order to characterise trpB variants and stages of TrpA/TrpB cooperation in silico, several approaches were combined. Phylogenetic trees were constructed for all trp genes; their structure was assessed via bootstrapping. Alternative models of trpB evolution were evaluated with parsimony arguments. The four groups of trpB variants were correlated with archaeal speciation. Several stages of TrpA/TrpB cooperation were identified and trpB variants were characterised. Most plausibly, trpB2 represents the predecessor of the modern trpB gene, and trpB1 evolved in an ancestral bacterium

  10. The archaeal TFIIE homologue facilitates transcription initiation by enhancing TATA-box recognition

    NARCIS (Netherlands)

    Bell, S.D.; Brinkman, A.B.; Oost, van der J.; Jackson, S.P.

    2001-01-01

    Transcription from many archaeal promoters can be reconstituted in vitro using recombinant TATA-box binding protein (TBP) and transcription factor B (TFB)—homologues of eukaryal TBP and TFIIB—together with purified RNA polymerase (RNAP). However, all archaeal genomes sequenced to date reveal the pre

  11. Energy for two: New archaeal lineages and the origin of mitochondria.

    Science.gov (United States)

    Martin, William F; Neukirchen, Sinje; Zimorski, Verena; Gould, Sven B; Sousa, Filipa L

    2016-09-01

    Metagenomics bears upon all aspects of microbiology, including our understanding of mitochondrial and eukaryote origin. Recently, ribosomal protein phylogenies show the eukaryote host lineage - the archaeal lineage that acquired the mitochondrion - to branch within the archaea. Metagenomic studies are now uncovering new archaeal lineages that branch more closely to the host than any cultivated archaea do. But how do they grow? Carbon and energy metabolism as pieced together from metagenome assemblies of these new archaeal lineages, such as the Deep Sea Archaeal Group (including Lokiarchaeota) and Bathyarchaeota, do not match the physiology of any cultivated microbes. Understanding how these new lineages live in their environment is important, and might hold clues about how mitochondria arose and how the eukaryotic lineage got started. Here we look at these exciting new metagenomic studies, what they say about archaeal physiology in modern environments, how they impact views on host-mitochondrion physiological interactions at eukaryote origin. PMID:27339178

  12. Methanobacterium Dominates Biocathodic Archaeal Communities in Methanogenic Microbial Electrolysis Cells

    KAUST Repository

    Siegert, Michael

    2015-07-06

    © 2015 American Chemical Society. Methane is the primary end product from cathodic current in microbial electrolysis cells (MECs) in the absence of methanogenic inhibitors, but little is known about the archaeal communities that develop in these systems. MECs containing cathodes made from different materials (carbon brushes, or plain graphite blocks or blocks coated with carbon black and platinum, stainless steel, nickel, ferrihydrite, magnetite, iron sulfide, or molybdenum disulfide) were inoculated with anaerobic digester sludge and acclimated at a set potential of -600 mV (versus a standard hydrogen electrode). The archaeal communities on all cathodes, except those coated with platinum, were predominated by Methanobacterium (median 97% of archaea). Cathodes with platinum contained mainly archaea most similar to Methanobrevibacter. Neither of these methanogens were abundant (<0.1% of archaea) in the inoculum, and therefore their high abundance on the cathode resulted from selective enrichment. In contrast, bacterial communities on the cathode were more diverse, containing primarily δ-Proteobacteria (41% of bacteria). The lack of a consistent bacterial genus on the cathodes indicated that there was no similarly selective enrichment of bacteria on the cathode. These results suggest that the genus Methanobacterium was primarily responsible for methane production in MECs when cathodes lack efficient catalysts for hydrogen gas evolution. (Figure Presented).

  13. 古菌细胞膜脂在古菌群落组成及其对环境响应研究中的应用%Applications of archaeal membrane lipids in investigating archaeal community composition and its responses to environmental factors

    Institute of Scientific and Technical Information of China (English)

    曹鹏; 沈菊培; 贺纪正

    2012-01-01

    Archaea, as the third life form distinct from bacteria and eukaryota, widely distribute in various kinds of habitats, and play important roles in the biogeochemical cycles of carbon and nitrogen and in ecosystem functioning. As the biomarker of archaea, archaeal membrane lipids can be used to investigate the archaeal community composition and its responses to the environment. This paper introduced the structural characteristics of archaeal membrane lipids and the differences in the membrane lipids composition among different archaeal communities, and discussed the feasibility of using archeal membrane lipids in depicting archaeal community composition. The abundance of archaeal membrane lipids in the environment could be used to characterize the biomass of archaea, and the related results could complement and ascertain each other with the DNA-based bio-molecular approaches on the accuracy, analysis efficiency, and cost. Based on the description of the difficulties and importance of using archaeal membrane lipids to analyze the composition and abundance of archaeal communities, and by linking to the environmental factors such as temperature and pH that affected the archaeal community composition, the relationships between archaea and their habitats were further expatiated, and the evolution process of archaeal communities and its application prospects in the studies of geochemistry and geological events were analyzed.%古菌作为区别于细菌和真核生物的第3种生命形式广泛分布于各种生境,与碳、氮等元素的生物地球化学循环密切相关,在整个生态系统中具有重要作用.古菌细胞膜脂作为古菌重要的生物标志物,在其群落组成和对环境变化响应的研究中具有重要指示作用.本文介绍了古菌细胞膜脂的结构特征及不同古菌类群间细胞膜脂结构差异,用以表征古菌群落的组成特征.环境中细胞膜脂丰度可反映古菌生物量,并可与基于DNA的分子生物学

  14. Identification and characterization of SNJ2, the first temperate pleolipovirus integrating into the genome of the SNJ1-lysogenic archaeal strain.

    Science.gov (United States)

    Liu, Ying; Wang, Jiao; Liu, Yang; Wang, Yuchen; Zhang, Ziqian; Oksanen, Hanna M; Bamford, Dennis H; Chen, Xiangdong

    2015-12-01

    Proviral regions have been identified in the genomes of many haloarchaea, but only a few archaeal halophilic temperate viruses have been studied. Here, we report a new virus, SNJ2, originating from archaeal strain Natrinema sp. J7-1. We demonstrate that this temperate virus coexists with SNJ1 virus and is dependent on SNJ1 for efficient production. Here, we show that SNJ1 is an icosahedral membrane-containing virus, whereas SNJ2 is a pleomorphic one. Instead of producing progeny virions and forming plaques, SNJ2 integrates into the host tRNA(Met) gene. The virion contains a discontinuous, circular, double-stranded DNA genome of 16 992 bp, in which both nicks and single-stranded regions are present preceded by a 'GCCCA' motif. Among 25 putative SNJ2 open reading frames (ORFs), five of them form a cluster of conserved ORFs homologous to archaeal pleolipoviruses isolated from hypersaline environments. Two structural protein encoding genes in the conserved cluster were verified in SNJ2. Furthermore, SNJ2-like proviruses containing the conserved gene cluster were identified in the chromosomes of archaea belonging to 10 different genera. Comparison of SNJ2 and these proviruses suggests that they employ a similar integration strategy into a tRNA gene. PMID:26331239

  15. Magnetic Au Nanoparticles on Archaeal S-Layer Ghosts as Templates

    Directory of Open Access Journals (Sweden)

    Sonja Selenska-Pobell

    2011-10-01

    Full Text Available Cell‐ghosts representing empty cells of the archaeon Sulfolobus acidocaldarius, consisting only of their highly ordered and unusually stable outermost proteinaceous surface layer (S‐layer, were used as templates for Au nanoparticles fabrication. The properties of these archaeal Au nanoparticles differ significantly from those produced earlier by us onto bacterial S‐layer sheets. The archaeal Au nanoparticles, with a size of about 2.5 nm, consist exclusively of metallic Au(0, while those produced on the bacterial S‐layer had a size of about 4 nm and represented a mixture of Au(0 and Au(III in the ratio of 40 to 60 %. The most impressive feature of the archaeal Au nanoparticles is that they are strongly paramagnetic, in contrast to the bacterial ones and also to bulk gold. SQUID magnetometry and XMCD measurements demonstrated that the archaeal Au nanoparticles possess a rather large magnetic moment of about 0.1 µB/atom. HR‐ TEM‐EDX analysis revealed that the archaeal Au nanoparticles are linked to the sulfur atoms of the thiol groups of the amino acid cysteine, characteristic only for archaeal S‐layers. This is the first study demonstrating the formation of such unusually strong magnetic Au nanoparticles on a non‐modified archaeal S‐layer.

  16. Archaeal promoter architecture and mechanism of gene activation

    DEFF Research Database (Denmark)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  17. Archaeal promoter architecture and mechanism of gene activation.

    Science.gov (United States)

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  18. Useful scars: Physics of the capsids of archaeal viruses

    Science.gov (United States)

    Perotti, L. E.; Dharmavaram, S.; Klug, W. S.; Marian, J.; Rudnick, J.; Bruinsma, R. F.

    2016-07-01

    We propose a physical model for the capsids of tailed archaeal viruses as viscoelastic membranes under tension. The fluidity is generated by thermal motion of scarlike structures that are an intrinsic feature of the ground state of large particle arrays covering surfaces with nonzero Gauss curvature. The tension is generated by a combination of the osmotic pressure of the enclosed genome and an extension force generated by filamentous structure formation that drives the formation of the tails. In continuum theory, the capsid has the shape of a surface of constant mean curvature: an unduloid. Particle arrays covering unduloids are shown to exhibit pronounced subdiffusive and diffusive single-particle transport at temperatures that are well below the melting temperature of defect-free particle arrays on a surface with zero Gauss curvature.

  19. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  20. Geochemical Approach to Archaeal Ecology: δ13C of GDGTs

    Science.gov (United States)

    Lichtin, S.; Warren, C.; Pearson, A.; Pagani, M.

    2015-12-01

    Over the last decade and a half, glycerol dialkyl glycerol tetraethers (GDGTs) have increasingly been used to reconstruct environmental temperatures; proxies like TEX86 that correlate the relative abundance of these archaeal cell membrane lipids to sea surface temperature are omnipresent in paleoclimatology literature. While it has become common to make claims about past temperatures using GDGTs, our present understanding of the organisms that synthesize the compounds is still quite limited. The generally accepted theory states that microorganisms like the Thaumarchaeota modify the structure of membrane lipids to increase intermolecular interactions, strengthening the membrane at higher temperatures. Yet to date, culture experiments have been largely restricted to a single species, Nitrosopumilus maritimes, and recent studies on oceanic archaeal rRNA have revealed that these biomarkers are produced in diverse, heterogeneous, and site-specific communities. This brings up questions as to whether different subclasses of GDGTs, and all subsequent proxies, represent adaptation within a single organismal group or a shift in community composition. To investigate whether GDGTs with different chain structures, from the simple isoprenoidal GDGT-0 to Crenarchaeol with its many cyclopentane groups, are sourced from archaea with similar or disparate metabolic pathways—and if that information is inherited in GDGTs trapped in marine sediments—this study examines the stable carbon isotope values (δ13C) of GDGTs extracted from the uppermost meters of sediment in the Orca Basin, Gulf of Mexico, using spooling-wire microcombustion isotope-ratio mass spectrometer (SWiM-IRMS), tackling a fundamental assumption of the TEX86 proxy that influences the way we perceive the veracity of existing temperature records.

  1. Phylogenetic and Functional Analysis of Metagenome Sequence from High-Temperature Archaeal Habitats Demonstrate Linkages between Metabolic Potential and Geochemistry

    DEFF Research Database (Denmark)

    Inskeep, William P; Jay, Zackary J; Herrgard, Markus;

    2013-01-01

    Geothermal habitats in Yellowstone National Park (YNP) provide an unparalleled opportunity to understand the environmental factors that control the distribution of archaea in thermal habitats. Here we describe, analyze, and synthesize metagenomic and geochemical data collected from seven high......-temperature sites that contain microbial communities dominated by archaea relative to bacteria. The specific objectives of the study were to use metagenome sequencing to determine the structure and functional capacity of thermophilic archaeal-dominated microbial communities across a pH range from 2.5 to 6.......4 and to discuss specific examples where the metabolic potential correlated with measured environmental parameters and geochemical processes occurring in situ. Random shotgun metagenome sequence (∼40-45 Mb Sanger sequencing per site) was obtained from environmental DNA extracted from high-temperature sediments and...

  2. Changes in northern Gulf of Mexico sediment bacterial and archaeal communities exposed to hypoxia

    Science.gov (United States)

    Biogeochemical changes in marine sediments during coastal water hypoxia are well described, but less is known about underlying changes in microbial communities. Bacterial and archaeal communities in Louisiana continental shelf (LCS) hypoxic zone sediments were characterized by py...

  3. The essence of being extremophilic : the role of the unique archaeal membrane lipids

    NARCIS (Netherlands)

    Vossenberg, Jack L.C.M. van de; Driessen, Arnold J.M.; Konings, Wil N.

    1998-01-01

    In extreme environments, mainly Archaea are encountered. The archaeal cytoplasmic membrane contains unique ether lipids that cannot easily be degraded, are temperature- and mechanically resistant, and highly salt tolerant. Moreover, thermophilic and extreme acidophilic Archaea possess membrane-spann

  4. Response of Archaeal Communities in Beach Sediments to Spilled Oil and Bioremediation

    OpenAIRE

    Röling, Wilfred F. M.; Couto de Brito, Ivana R.; Swannell, Richard P. J.; Head, Ian M.

    2004-01-01

    While the contribution of Bacteria to bioremediation of oil-contaminated shorelines is well established, the response of Archaea to spilled oil and bioremediation treatments is unknown. The relationship between archaeal community structure and oil spill bioremediation was examined in laboratory microcosms and in a bioremediation field trial. 16S rRNA gene-based PCR and denaturing gradient gel analysis revealed that the archaeal community in oil-free laboratory microcosms was stable for 26 day...

  5. Structural and Functional Characterization of an Archaeal Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated Complex for Antiviral Defense (CASCADE)

    DEFF Research Database (Denmark)

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K;

    2011-01-01

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA....... The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5......a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2...

  6. Pyrosequencing reveals the influence of elevated atmospheric CO2 on the composition of archaeal communities in the rhizosphere of C3 and C4 crops

    Science.gov (United States)

    Nelson, D. M.; Cann, I. K.; Mackie, R. I.

    2008-12-01

    The projected increase in atmospheric CO2 concentrations throughout the 21st century is likely to increase aboveground and belowground plant productivity and cause changes in the quantity and quality of plant root exudates, although plants using C4 photosynthesis are likely to be only affected during times of drought (Leakey et al., 2006, Plant Physiology, 140, 779). Evidence is emerging from molecular tools that these changes may influence the abundance and composition of soil microbial communities that regulate key soil processes, such as nitrogen cycling (Lesaulnier et al., 2008, Environmental Microbiology, 10, 926). However, most molecular tools are not well-suited for comparing multiple samples at great sequencing depth, which is critical when considering soil microbial communities of high diversity. To overcome these limitations we used pyrosequencing and quantitative PCR (qPCR) of two genes (the V3 region of 16S rDNA and the amoA gene) to examine intra- and inter-treatment variability in the abundance and composition of microbial communities in the rhizosphere of soybean (C3) and maize (C4) grown in field conditions under ambient (~380 ppm) and elevated (~550 ppm) CO2 using FACE (free-air concentration enrichment) technology during the 2006 growing season in central Illinois. We specifically focused on archaeal communities because of their key role in nitrification (Leininger et al., 2006, Nature, 442, 806). The majority (>97%) of recovered sequences were from members of the phylum Crenarchaeota. Principle component analysis of sequence results from the V3 and amoA genes indicated significant (p<0.05) differences in the composition of rhizosphere archaeal communities between ambient and elevated CO2 beneath soybean, but not maize. qPCR suggested no significant difference in the abundance of archaea between treatments for soybean and maize. The lack of response of archaeal community composition beneath maize to elevated CO2 is consistent with relatively high

  7. Molecular basis for DNA strand displacement by NHEJ repair polymerases

    OpenAIRE

    Bartlett, Edward J.; Brissett, Nigel C.; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J.

    2015-01-01

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) re...

  8. Protein phosphorylation and its role in archaeal signal transduction.

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C; Albers, Sonja-Verena; Siebers, Bettina

    2016-09-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies.

  9. Protein phosphorylation and its role in archaeal signal transduction

    Science.gov (United States)

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C.; Albers, Sonja-Verena; Siebers, Bettina

    2016-01-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies. PMID:27476079

  10. Soil bacterial and archaeal communities of the Stringer Creek Watershed in relation to soil moisture, chemistry, and gas fluxes

    Science.gov (United States)

    Jones, R. T.; Du, Z.; Riveros-Iregui, D.; Dore, J. E.; Emanuel, R. E.; McGlynn, B. L.; McDermott, T.; Li, X.

    2013-12-01

    The Stringer Creek watershed within the Tenderfoot Creek Experimental Forest (Montana) is a highly instrumented watershed with long-term hydrologic and gas flux measurements, and is an ideal study system to incorporate microbiological characterizations into landscape scale hydrological and biogeochemical studies. As a first attempt to determine how hydrological processes, soil chemistry, and gas fluxes are correlated with bacterial and archaeal lineages in soil, we collected soil samples across the watershed (July 9 - 11, 2012) and used barcoded high-throughput DNA sequencing to characterize the bacterial and archaeal communities. Soils were collected adjacent to gas well sites at 5 cm, 20 cm, and 50 cm depths, corresponding to the depths of the wells. Gas measurements included CO2, CH4, O2, and N2O; soil measurements included water content, % carbon, and % nitrogen. We analyzed 775,000 16S rRNA gene sequences from 28 soil samples. Relative abundances of certain microbial lineages or groups (e.g. methanotrophs, methanogens, Acidobacteria, Bacteroidetes, Firmicutes, Proteobacteria, etc.) varied significantly with CO2, CH4, and O2 concentrations. Furthermore, beta-diversity analyses showed that microbial community composition was significantly governed by water content, % nitrogen, and % carbon; community composition also significantly varied with CO2, CH4, and O2 concentrations. Together, our results suggest that soil environmental factors such as water content, % carbon, and % nitrogen affect microbial community composition, and that microbial community composition correlates with CO2, O2, and CH4 concentrations. Future work will focus on characterizing microbial communities across the entire summer season as soil conditions drastically change from fully saturated to very dry.

  11. Pyrosequencing-derived bacterial, archaeal, and fungal diversity of spacecraft hardware destined for Mars.

    Science.gov (United States)

    La Duc, Myron T; Vaishampayan, Parag; Nilsson, Henrik R; Torok, Tamas; Venkateswaran, Kasthuri

    2012-08-01

    Spacecraft hardware and assembly cleanroom surfaces (233 m(2) in total) were sampled, total genomic DNA was extracted, hypervariable regions of the 16S rRNA gene (bacteria and archaea) and ribosomal internal transcribed spacer (ITS) region (fungi) were subjected to 454 tag-encoded pyrosequencing PCR amplification, and 203,852 resulting high-quality sequences were analyzed. Bioinformatic analyses revealed correlations between operational taxonomic unit (OTU) abundance and certain sample characteristics, such as source (cleanroom floor, ground support equipment [GSE], or spacecraft hardware), cleaning regimen applied, and location about the facility or spacecraft. National Aeronautics and Space Administration (NASA) cleanroom floor and GSE surfaces gave rise to a larger number of diverse bacterial communities (619 OTU; 20 m(2)) than colocated spacecraft hardware (187 OTU; 162 m(2)). In contrast to the results of bacterial pyrosequencing, where at least some sequences were generated from each of the 31 sample sets examined, only 13 and 18 of these sample sets gave rise to archaeal and fungal sequences, respectively. As was the case for bacteria, the abundance of fungal OTU in the GSE surface samples dramatically diminished (9× less) once cleaning protocols had been applied. The presence of OTU representative of actinobacteria, deinococci, acidobacteria, firmicutes, and proteobacteria on spacecraft surfaces suggests that certain bacterial lineages persist even following rigorous quality control and cleaning practices. The majority of bacterial OTU observed as being recurrent belonged to actinobacteria and alphaproteobacteria, supporting the hypothesis that the measures of cleanliness exerted in spacecraft assembly cleanrooms (SAC) inadvertently select for the organisms which are the most fit to survive long journeys in space.

  12. Mechanism of DNA loading by the DNA repair helicase XPD.

    Science.gov (United States)

    Constantinescu-Aruxandei, Diana; Petrovic-Stojanovska, Biljana; Penedo, J Carlos; White, Malcolm F; Naismith, James H

    2016-04-01

    The xeroderma pigmentosum group D (XPD) helicase is a component of the transcription factor IIH complex in eukaryotes and plays an essential role in DNA repair in the nucleotide excision repair pathway. XPD is a 5' to 3' helicase with an essential iron-sulfur cluster. Structural and biochemical studies of the monomeric archaeal XPD homologues have aided a mechanistic understanding of this important class of helicase, but several important questions remain open. In particular, the mechanism for DNA loading, which is assumed to require large protein conformational change, is not fully understood. Here, DNA binding by the archaeal XPD helicase fromThermoplasma acidophilumhas been investigated using a combination of crystallography, cross-linking, modified substrates and biochemical assays. The data are consistent with an initial tight binding of ssDNA to helicase domain 2, followed by transient opening of the interface between the Arch and 4FeS domains, allowing access to a second binding site on helicase domain 1 that directs DNA through the pore. A crystal structure of XPD fromSulfolobus acidocaldiariusthat lacks helicase domain 2 has an otherwise unperturbed structure, emphasizing the stability of the interface between the Arch and 4FeS domains in XPD. PMID:26896802

  13. Composition of bacterial and archaeal communities during landfill refuse decomposition processes.

    Science.gov (United States)

    Song, Liyan; Wang, Yangqing; Zhao, Heping; Long, David T

    2015-12-01

    Little is known about the archaeal and the bacterial diversities in a landfill during different phases of decomposition. In this study, the archaeal and the bacterial diversities of Laogang landfill (Shanghai, China) at two different decomposition phases (i.e., initial methanogenic phase (IMP) and stable methanogenic phase (SMP)), were culture-independently examined using PCR-based 454 pyrosequencing. A total of 47,753 sequences of 16S rRNA genes were retrieved from 69,954 reads and analyzed to evaluate the diversities of the archaeal and bacterial communities. The most predominant types of archaea were hydrogenotrophic Methanomicrobiales, and of bacteria were Proteobacteria, Firmicutes, and Bacteroidetes. As might be expected, their abundances varied at decomposition phases. Archaea Methanomicrobiales accounts for 97.6% of total archaeal population abundance in IMP and about 57.6% in SMP. The abundance of archaeal genus Halobacteriale was 0.1% in IMP and was 20.3% in the SMP. The abundance of Firmicutes was 21.3% in IMP and was 4.3% in SMP. The abundance of Bacteroidetes represented 11.5% of total bacterial in IMP and was dominant (49.4%) in SMP. Both the IMP and SMP had unique cellulolytic bacteria compositions. IMP consisted of members of Bacillus, Fibrobacter, and Eubacterium, while SMP harbored groups of Microbacterium. Both phases had Clostridium with different abundance, 4-5 folds higher in SMP.

  14. Virus-mediated archaeal hecatomb in the deep seafloor

    Science.gov (United States)

    Danovaro, Roberto; Dell’Anno, Antonio; Corinaldesi, Cinzia; Rastelli, Eugenio; Cavicchioli, Ricardo; Krupovic, Mart; Noble, Rachel T.; Nunoura, Takuro; Prangishvili, David

    2016-01-01

    Viruses are the most abundant biological entities in the world’s oceans, and they play a crucial role in global biogeochemical cycles. In deep-sea ecosystems, archaea and bacteria drive major nutrient cycles, and viruses are largely responsible for their mortality, thereby exerting important controls on microbial dynamics. However, the relative impact of viruses on archaea compared to bacteria is unknown, limiting our understanding of the factors controlling the functioning of marine systems at a global scale. We evaluate the selectivity of viral infections by using several independent approaches, including an innovative molecular method based on the quantification of archaeal versus bacterial genes released by viral lysis. We provide evidence that, in all oceanic surface sediments (from 1000- to 10,000-m water depth), the impact of viral infection is higher on archaea than on bacteria. We also found that, within deep-sea benthic archaea, the impact of viruses was mainly directed at members of specific clades of Marine Group I Thaumarchaeota. Although archaea represent, on average, ~12% of the total cell abundance in the top 50 cm of sediment, virus-induced lysis of archaea accounts for up to one-third of the total microbial biomass killed, resulting in the release of ~0.3 to 0.5 gigatons of carbon per year globally. Our results indicate that viral infection represents a key mechanism controlling the turnover of archaea in surface deep-sea sediments. We conclude that interactions between archaea and their viruses might play a profound, previously underestimated role in the functioning of deep-sea ecosystems and in global biogeochemical cycles. PMID:27757416

  15. Effects of Diets Supplemented with Ensiled Mulberry Leaves and Sun-Dried Mulberry Fruit Pomace on the Ruminal Bacterial and Archaeal Community Composition of Finishing Steers.

    Science.gov (United States)

    Niu, Yuhong; Meng, Qingxiang; Li, Shengli; Ren, Liping; Zhou, Bo; Schonewille, Thomas; Zhou, Zhenming

    2016-01-01

    This study investigated the effects of ensiled mulberry leaves (EML) and sun-dried mulberry fruit pomace (SMFP) on the ruminal bacterial and archaeal community composition of finishing steers. Corn grain- and cotton meal-based concentrate was partially replaced with EML or SMFP. The diets had similar crude protein (CP), neutral detergent fiber (NDF), and metabolizable energy. Following the feeding trial, the steers were slaughtered and ruminal liquid samples were collected to study the ruminal microbiome. Extraction of DNA, amplification of the V4 region of the 16S rRNA gene, and Illumina MiSeq pyrosequencing were performed for each sample. Following sequence de-noising, chimera checking, and quality trimming, an average of 209,610 sequences were generated per sample. Quantitative real-time PCR was performed to examine the selected bacterial species in the rumen. Our results showed that the predominant phyla were Bacteroidetes (43.90%), Firmicutes (39.06%), Proteobacteria (4.31%), and Tenericutes (2.04%), and the predominant genera included Prevotella (13.82%), Ruminococcus (2.51%), Butyrivibrio (2.38%), and Succiniclasticum (2.26%). Compared to the control group, EML and SMFP groups had a higher abundance of total bacteria (p composition was similar among the three groups. At the phylum level, there were no significant differences in Firmicutes (p = 0.7932), Bacteroidetes (p = 0.2330), Tenericutes (p = 0.2811), or Proteobacteria (p = 0.0680) levels among the three groups; however, Fibrobacteres decreased in EML (p = 0.0431). At the genus level, there were no differences in Prevotella (p = 0.4280), Ruminococcus (p = 0.2639), Butyrivibrio (p = 0.4433), or Succiniclasticum (p = 0.0431) levels among the groups. Additionally, the dietary treatments had no significant effects on the archaeal community composition in the rumen. Therefore, EML and SMFP supplementation had no significant effects on the ruminal bacterial or archaeal community composition of finishing steers.

  16. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs

    NARCIS (Netherlands)

    Frade, P.R.; Roll, K.; Bergauer, K.; Herndl, G.

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associatedwith the surface mucus layer of corals have rarely taken place. It has thereforeremained enigmatic whether mucus-associated archaeal and bacterial communities exhibita similar specificity towards coral hosts a

  17. The Primary Results of Analyses on The Archaeal and Bacterial Diversity of Active Cave Environments Settled in Limestones at Southern Turkey

    Science.gov (United States)

    Tok, Ezgi; Kurt, Halil; Tunga Akarsubasi, A.

    2016-04-01

    The microbial diversity of cave sediments which are obtained from three different caves named Insuyu, Balatini and Altınbeşik located at Southern Turkey has been investigated using molecular methods for biomineralization . The total number of 22 samples were taken in duplicates from the critical zones of the caves at where the water activity is observed all year round. Microbial communities were monitored by 16S rRNA gene based PCR-DGGE (Polymerase Chain Reaction - Denaturating Gradient Gel Electrophoresis) methodology. DNA were extracted from the samples by The PowerSoil® DNA Isolation Kit (MO BIO Laboratories inc., CA) with the modifications on the producer's protocol. The synthetic DNA molecule poly-dIdC was used to increase the yield of PCR amplification via blocking the reaction between CaCO3 and DNA molecules. Thereafter samples were amplified by using both Archaeal and Bacterial universal primers (ref). Subsequently, archaeal and bacterial diversities in cave sediments, were investigated to be able to compare with respect to their similarities by using DGGE. DGGE patterns were analysed with BioNumerics software 5.1. Similarity matrix and dendograms of the DGGE profiles were generated based on the Dice correlation coefficient (band-based) and unweighted pair-group method with arithmetic mean (UPGMA). The structural diversity of the microbial community was examined by the Shannon index of general diversity (H). Similtaneously, geochemical analyses of the sediment samples were performed within the scope of this study. Total organic carbon (TOC), x-ray diffraction spectroscopy (XRD) and x-ray fluorescence spectroscopy (XRF) analysis of sediments were also implemented. The extensive results will be obtained at the next stages of the study currently carried on.

  18. Liquid but Durable: Molecular Dynamics Simulations Explain the Unique Properties of Archaeal-Like Membranes

    Science.gov (United States)

    Chugunov, Anton O.; Volynsky, Pavel E.; Krylov, Nikolay A.; Boldyrev, Ivan A.; Efremov, Roman G.

    2014-12-01

    Archaeal plasma membranes appear to be extremely durable and almost impermeable to water and ions, in contrast to the membranes of Bacteria and Eucaryota. Additionally, they remain liquid within a temperature range of 0-100°C. These are the properties that have most likely determined the evolutionary fate of Archaea, and it may be possible for bionanotechnology to adopt these from nature. In this work, we use molecular dynamics simulations to assess at the atomistic level the structure and dynamics of a series of model archaeal membranes with lipids that have tetraether chemical nature and ``branched'' hydrophobic tails. We conclude that the branched structure defines dense packing and low water permeability of archaeal-like membranes, while at the same time ensuring a liquid-crystalline state, which is vital for living cells. This makes tetraether lipid systems promising in bionanotechnology and material science, namely for design of new and unique membrane nanosystems.

  19. Turnover of microbial lipids in the deep biosphere and growth of benthic archaeal populations.

    Science.gov (United States)

    Xie, Sitan; Lipp, Julius S; Wegener, Gunter; Ferdelman, Timothy G; Hinrichs, Kai-Uwe

    2013-04-01

    Deep subseafloor sediments host a microbial biosphere with unknown impact on global biogeochemical cycles. This study tests previous evidence based on microbial intact polar lipids (IPLs) as proxies of live biomass, suggesting that Archaea dominate the marine sedimentary biosphere. We devised a sensitive radiotracer assay to measure the decay rate of ([(14)C]glucosyl)-diphytanylglyceroldiether (GlcDGD) as an analog of archaeal IPLs in continental margin sediments. The degradation kinetics were incorporated in model simulations that constrained the fossil fraction of subseafloor IPLs and rates of archaeal turnover. Simulating the top 1 km in a generic continental margin sediment column, we estimated degradation rate constants of GlcDGD being one to two orders of magnitude lower than those of bacterial IPLs, with half-lives of GlcDGD increasing with depth to 310 ky. Given estimated microbial community turnover times of 1.6-73 ky in sediments deeper than 1 m, 50-96% of archaeal IPLs represent fossil signals. Consequently, previous lipid-based estimates of global subseafloor biomass probably are too high, and the widely observed dominance of archaeal IPLs does not rule out a deep biosphere dominated by Bacteria. Reverse modeling of existing concentration profiles suggest that archaeal IPL synthesis rates decline from around 1,000 pg⋅mL(-1) sediment⋅y(-1) at the surface to 0.2 pg⋅mL(-1)⋅y(-1) at 1 km depth, equivalent to production of 7 × 10(5) to 140 archaeal cells⋅mL(-1) sediment⋅y(-1), respectively. These constraints on microbial growth are an important step toward understanding the relationship between the deep biosphere and the carbon cycle.

  20. Differences in the Composition of Archaeal Communities in Sediments from Contrasting Zones of Lake Taihu

    Science.gov (United States)

    Fan, Xianfang; Xing, Peng

    2016-01-01

    In shallow lakes, different primary producers might impact the physiochemical characteristics of the sediment and the associated microbial communities. Until now, little was known about the features of sediment Archaea and their variation across different primary producer-dominated ecosystems. Lake Taihu provides a suitable study area with cyanobacteria- and macrophyte-dominated zones co-occurring in one ecosystem. The composition of the sediment archaeal community was assessed using 16S rRNA gene amplicon sequencing technology, based on which the potential variation with respect to the physiochemical characteristics of the sediment was analyzed. Euryarchaeota (30.19% of total archaeal sequences) and Bathyarchaeota (28.00%) were the two most abundant phyla, followed by Crenarchaeota (11.37%), Aigarchaeota (10.24%) and Thaumarchaeota (5.98%). The differences found in the composition of the archaeal communities between the two zones was significant (p = 0.005). Sediment from macrophyte-dominated zones had high TOC and TN content and an abundance of archaeal lineages potentially involved in the degradation of complex organic compounds, such as the order Thermoplasmatales. In the area dominated by Cyanobacteria, archaeal lineages related to sulfur metabolism, for example, Sulfolobales and Desulfurococcales, were significantly enriched. Among Bathyarchaeota, subgroups MCG-6 and MCG-15 were significantly accumulated in the sediment of areas dominated by macrophytes whereas MCG-4 was consistently dominant in both type of sediments. The present study contributes to the knowledge of sediment archaeal communities with different primary producers and their possible biogeochemical functions in sediment habitats. PMID:27708641

  1. Molecular basis for DNA strand displacement by NHEJ repair polymerases.

    Science.gov (United States)

    Bartlett, Edward J; Brissett, Nigel C; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J

    2016-03-18

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) resects these products to ensure that efficient ligation occurs. Here, we describe the crystal structures of these archaeal (Methanocella paludicola) NHEJ nuclease and polymerase enzymes, demonstrating their strict structural conservation with their bacterial NHEJ counterparts. Structural analysis, in conjunction with biochemical studies, has uncovered the molecular basis for DNA strand displacement synthesis in AP-NHEJ, revealing the mechanisms that enable Pol and PE to displace annealed bases to facilitate their respective roles in DSB repair. PMID:26405198

  2. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    Directory of Open Access Journals (Sweden)

    Sonu Bhatia

    2015-09-01

    Full Text Available The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  3. Pyrosequencing reveals the influence of elevated atmospheric CO2 on the composition of archaeal communities in the rhizosphere of C3 and C4 crops

    Science.gov (United States)

    Nelson, D. M.; Cann, I. K.; Mackie, R. I.

    2008-12-01

    The projected increase in atmospheric CO2 concentrations throughout the 21st century is likely to increase aboveground and belowground plant productivity and cause changes in the quantity and quality of plant root exudates, although plants using C4 photosynthesis are likely to be only affected during times of drought (Leakey et al., 2006, Plant Physiology, 140, 779). Evidence is emerging from molecular tools that these changes may influence the abundance and composition of soil microbial communities that regulate key soil processes, such as nitrogen cycling (Lesaulnier et al., 2008, Environmental Microbiology, 10, 926). However, most molecular tools are not well-suited for comparing multiple samples at great sequencing depth, which is critical when considering soil microbial communities of high diversity. To overcome these limitations we used pyrosequencing and quantitative PCR (qPCR) of two genes (the V3 region of 16S rDNA and the amoA gene) to examine intra- and inter-treatment variability in the abundance and composition of microbial communities in the rhizosphere of soybean (C3) and maize (C4) grown in field conditions under ambient (~380 ppm) and elevated (~550 ppm) CO2 using FACE (free-air concentration enrichment) technology during the 2006 growing season in central Illinois. We specifically focused on archaeal communities because of their key role in nitrification (Leininger et al., 2006, Nature, 442, 806). The majority (>97%) of recovered sequences were from members of the phylum Crenarchaeota. Principle component analysis of sequence results from the V3 and amoA genes indicated significant (psoybean, but not maize. qPCR suggested no significant difference in the abundance of archaea between treatments for soybean and maize. The lack of response of archaeal community composition beneath maize to elevated CO2 is consistent with relatively high soil moisture availability throughout the summer of 2006, whereas the significant influence of elevated CO2 on

  4. Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

    Science.gov (United States)

    Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

    2016-09-01

    Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing. PMID:27338271

  5. Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE).

    Science.gov (United States)

    Lintner, Nathanael G; Kerou, Melina; Brumfield, Susan K; Graham, Shirley; Liu, Huanting; Naismith, James H; Sdano, Matthew; Peng, Nan; She, Qunxin; Copié, Valérie; Young, Mark J; White, Malcolm F; Lawrence, C Martin

    2011-06-17

    In response to viral infection, many prokaryotes incorporate fragments of virus-derived DNA into loci called clustered regularly interspaced short palindromic repeats (CRISPRs). The loci are then transcribed, and the processed CRISPR transcripts are used to target invading viral DNA and RNA. The Escherichia coli "CRISPR-associated complex for antiviral defense" (CASCADE) is central in targeting invading DNA. Here we report the structural and functional characterization of an archaeal CASCADE (aCASCADE) from Sulfolobus solfataricus. Tagged Csa2 (Cas7) expressed in S. solfataricus co-purifies with Cas5a-, Cas6-, Csa5-, and Cas6-processed CRISPR-RNA (crRNA). Csa2, the dominant protein in aCASCADE, forms a stable complex with Cas5a. Transmission electron microscopy reveals a helical complex of variable length, perhaps due to substoichiometric amounts of other CASCADE components. A recombinant Csa2-Cas5a complex is sufficient to bind crRNA and complementary ssDNA. The structure of Csa2 reveals a crescent-shaped structure unexpectedly composed of a modified RNA-recognition motif and two additional domains present as insertions in the RNA-recognition motif. Conserved residues indicate potential crRNA- and target DNA-binding sites, and the H160A variant shows significantly reduced affinity for crRNA. We propose a general subunit architecture for CASCADE in other bacteria and Archaea.

  6. Planktonic Euryarchaeota are a significant source of archaeal tetraether lipids in the ocean

    Science.gov (United States)

    Lincoln, Sara A.; Wai, Brenner; Eppley, John M.; Church, Matthew J.; Summons, Roger E.; DeLong, Edward F.

    2014-01-01

    Archaea are ubiquitous in marine plankton, and fossil forms of archaeal tetraether membrane lipids in sedimentary rocks document their participation in marine biogeochemical cycles for >100 million years. Ribosomal RNA surveys have identified four major clades of planktonic archaea but, to date, tetraether lipids have been characterized in only one, the Marine Group I Thaumarchaeota. The membrane lipid composition of the other planktonic archaeal groups—all uncultured Euryarchaeota—is currently unknown. Using integrated nucleic acid and lipid analyses, we found that Marine Group II Euryarchaeota (MG-II) contributed significantly to the tetraether lipid pool in the North Pacific Subtropical Gyre at shallow to intermediate depths. Our data strongly suggested that MG-II also synthesize crenarchaeol, a tetraether lipid previously considered to be a unique biomarker for Thaumarchaeota. Metagenomic datasets spanning 5 y indicated that depth stratification of planktonic archaeal groups was a stable feature in the North Pacific Subtropical Gyre. The consistent prevalence of MG-II at depths where the bulk of exported organic matter originates, together with their ubiquitous distribution over diverse oceanic provinces, suggests that this clade is a significant source of tetraether lipids to marine sediments. Our results are relevant to archaeal lipid biomarker applications in the modern oceans and the interpretation of these compounds in the geologic record. PMID:24946804

  7. The effect of maturity and depositional redox conditions on archaeal tetraether lipid palaeothermometry

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Schouten, S.; Hopmans, E.C.

    2004-01-01

    Recently we proposed a new organic sea surface temperature proxy, TEX86, based on the distribution of archaeal tetraether lipids. Here, we have examined the effect of oxic degradation and maturity on this new temperature proxy. Our results show that oxic degradation does not appear to affect the TEX

  8. Effect of soil properties and hydrology on Archaeal community composition in three temperate grasslands on peat

    DEFF Research Database (Denmark)

    Görres, Carolyn-Monika; Conrad, Ralf; Petersen, Søren O

    2013-01-01

    Grasslands established on drained peat soils are regarded as negligible methane (CH4) sources; however, they can still exhibit considerable soil CH4 dynamics. We investigated archaeal community composition in two different fen peat soils and one bog peat soil under permanent grassland in Denmark...

  9. Archaeal and bacterial diversity in hot springs on the Tibetan Plateau, China.

    Science.gov (United States)

    Huang, Qiuyuan; Dong, Christina Z; Dong, Raymond M; Jiang, Hongchen; Wang, Shang; Wang, Genhou; Fang, Bin; Ding, Xiaoxue; Niu, Lu; Li, Xin; Zhang, Chuanlun; Dong, Hailiang

    2011-09-01

    The diversity of archaea and bacteria was investigated in ten hot springs (elevation >4600 m above sea level) in Central and Central-Eastern Tibet using 16S rRNA gene phylogenetic analysis. The temperature and pH of these hot springs were 26-81°C and close to neutral, respectively. A total of 959 (415 and 544 for bacteria and archaea, respectively) clone sequences were obtained. Phylogenetic analysis showed that bacteria were more diverse than archaea and that these clone sequences were classified into 82 bacterial and 41 archaeal operational taxonomic units (OTUs), respectively. The retrieved bacterial clones were mainly affiliated with four known groups (i.e., Firmicutes, Proteobacteria, Cyanobacteria, Chloroflexi), which were similar to those in other neutral-pH hot springs at low elevations. In contrast, most of the archaeal clones from the Tibetan hot springs were affiliated with Thaumarchaeota, a newly proposed archaeal phylum. The dominance of Thaumarchaeota in the archaeal community of the Tibetan hot springs appears to be unique, although the exact reasons are not yet known. Statistical analysis showed that diversity indices of both archaea and bacteria were not statistically correlated with temperature, which is consistent with previous studies.

  10. Metagenomic evaluation of bacterial and archaeal diversity in the geothermal hot springs of manikaran, India.

    Science.gov (United States)

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Green, Stefan J; Joshi, Amit; Chauhan, Ashvini

    2015-02-19

    Bacterial and archaeal diversity in geothermal spring water were investigated using 16S rRNA gene amplicon metagenomic sequencing. This revealed the dominance of Firmicutes, Aquificae, and the Deinococcus-Thermus group in this thermophilic environment. A number of sequences remained taxonomically unresolved, indicating the presence of potentially novel microbes in this unique habitat.

  11. CrAgDb--a database of annotated chaperone repertoire in archaeal genomes.

    Science.gov (United States)

    Rani, Shikha; Srivastava, Abhishikha; Kumar, Manish; Goel, Manisha

    2016-03-01

    Chaperones are a diverse class of ubiquitous proteins that assist other cellular proteins in folding correctly and maintaining their native structure. Many different chaperones cooperate to constitute the 'proteostasis' machinery in the cells. It has been proposed earlier that archaeal organisms could be ideal model systems for deciphering the basic functioning of the 'protein folding machinery' in higher eukaryotes. Several chaperone families have been characterized in archaea over the years but mostly one protein at a time, making it difficult to decipher the composition and mechanistics of the protein folding system as a whole. In order to deal with these lacunae, we have developed a database of all archaeal chaperone proteins, CrAgDb (Chaperone repertoire in Archaeal genomes). The data have been presented in a systematic way with intuitive browse and search facilities for easy retrieval of information. Access to these curated datasets should expedite large-scale analysis of archaeal chaperone networks and significantly advance our understanding of operation and regulation of the protein folding machinery in archaea. Researchers could then translate this knowledge to comprehend the more complex protein folding pathways in eukaryotic systems. The database is freely available at http://14.139.227.92/mkumar/cragdb/. PMID:26862144

  12. Identification of archaeal proteins that affect the exosome function in vitro

    Directory of Open Access Journals (Sweden)

    Palhano Fernando L

    2010-05-01

    Full Text Available Abstract Background The archaeal exosome is formed by a hexameric RNase PH ring and three RNA binding subunits and has been shown to bind and degrade RNA in vitro. Despite extensive studies on the eukaryotic exosome and on the proteins interacting with this complex, little information is yet available on the identification and function of archaeal exosome regulatory factors. Results Here, we show that the proteins PaSBDS and PaNip7, which bind preferentially to poly-A and AU-rich RNAs, respectively, affect the Pyrococcus abyssi exosome activity in vitro. PaSBDS inhibits slightly degradation of a poly-rA substrate, while PaNip7 strongly inhibits the degradation of poly-A and poly-AU by the exosome. The exosome inhibition by PaNip7 appears to depend at least partially on its interaction with RNA, since mutants of PaNip7 that no longer bind RNA, inhibit the exosome less strongly. We also show that FITC-labeled PaNip7 associates with the exosome in the absence of substrate RNA. Conclusions Given the high structural homology between the archaeal and eukaryotic proteins, the effect of archaeal Nip7 and SBDS on the exosome provides a model for an evolutionarily conserved exosome control mechanism.

  13. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    Directory of Open Access Journals (Sweden)

    Thiago Rodrigues

    2014-01-01

    Full Text Available The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked differences between the archaeal communities found in the two seasons. I.1a and I.1c Thaumarchaeota were found in greater numbers in the transition period, while MCG Archaea was dominant on the dry season. Methanogens were only found in the dry season. Analysis of 16S rRNA sequences revealed lower diversity on the transition period. We detected archaeal amoA sequences in both seasons, but there were more OTUs during the dry season. These sequences were within the same cluster as Nitrosotalea devanaterra’s amoA gene. The principal coordinate analysis (PCoA test revealed significant differences between samples from different seasons. These results provide information on archaeal diversity in freshwater lake sediments of the Cerrado and indicates that rain is likely a factor that impacts these communities.

  14. ENERGY-TRANSDUCING PROPERTIES OF PRIMARY PROTON PUMPS RECONSTITUTED INTO ARCHAEAL BIPOLAR LIPID VESICLES

    NARCIS (Netherlands)

    ELFERINK, MGL; DEWIT, JG; DRIESSEN, AJM; KONINGS, WN; Elferink, Marieke G.L.

    1993-01-01

    Archaeal lipids differ considerably from eubacterial and eukaryotic lipids in their structure and physical properties. From the membranes of the extreme thermophilic archaea Sulfolobus acidocaldarius a tetraether lipid fraction was isolated, which can form closed and stable monolayer liposomes in aq

  15. Archaeal Ammonia Oxidizers and Total Production of N2O and CH4 in Arctic Polar Desert Soils

    Science.gov (United States)

    Brummell, Martin; Robert, Stan; Bodrossy, Levente; Abell, Guy; Siciliano, Steven

    2014-05-01

    Ammonia-oxidizing Archaea are abundant in Arctic desert soils and appear to be responsible for the majority of ammonia oxidation activity in these cold and dry ecosystems. We used DNA microarrays to characterize the microbial community consisting of ammonia-oxidizing Archaea and methane-oxidizing Bacteria in three polar deserts from Ellesmere Island, Canada. Patterns of net greenhouse gas production, including production and consumption of CO2, CH4, and N2O were compared with community relative richness and abundance in a structural equation model that tested causal hypotheses relating edaphic factors to the biological community and net gas production. We extracted and amplified DNA sequences from soils collected at three polar deserts on Ellesmere Island in the Canadian high Arctic, and characterized the community structure using DNA microarrays. The functional genes Archaeal AmoA and pMMO were used to compare patterns of biological community structure to the observed patterns of net greenhouse gas production from those soils, as measured in situ. Edaphic factors including water content, bulk density, pH, and nutrient levels such as nitrate, ammonia, and extractable organic carbon were also measured for each soil sample, resulting in a highly multivariate dataset. Both concentration and net production of the three greenhouse gases were correlated, suggesting underlying causal factors. Edaphic factors such as soil moisture and pH had important, direct effects on the community composition of both functional groups of microorganisms, and pH further had a direct effect on N2O production. The structural relationship between the examined microbial communities and net production of both N2O and CH4 was strong and consistent between varying model structures and matrices, providing high confidence that this model relationship accurately reflects processes occurring in Arctic desert soils.

  16. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards.

    Science.gov (United States)

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-11-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle.

  17. Functional interaction of yeast and human TATA-binding proteins with an archaeal RNA polymerase and promoter.

    OpenAIRE

    Wettach, J; Gohl, H P; Tschochner, H; Thomm, M

    1995-01-01

    TATA boxes are common structural features of eucaryal class II and archaeal promoters. In addition, a gene encoding a polypeptide with sequence similarity to eucaryal TATA-binding protein (TBP) has recently been detected in Archaea, but its relationship to the archaeal transcription factors A (aTFA) and B (aTFB) was unclear. Here, we demonstrate that yeast and human TBP can substitute for aTFB in a Methanococcus-derived archaeal cell-free transcription system. Template-commitment studies show...

  18. Archaeal communities of Arctic methane-containing permafrost.

    Science.gov (United States)

    Shcherbakova, Victoria; Yoshimura, Yoshitaka; Ryzhmanova, Yana; Taguchi, Yukihiro; Segawa, Takahiro; Oshurkova, Victoria; Rivkina, Elizaveta

    2016-10-01

    In the present study, we used culture-independent methods to investigate the diversity of methanogenic archaea and their distribution in five permafrost samples collected from a borehole in the Kolyma River Lowland (north-east of Russia). Total DNA was extracted from methane-containing permafrost samples of different age and amplified by PCR. The resulting DNA fragments were cloned. Phylogenetic analysis of the sequences showed the presence of archaea in all studied samples; 60%-95% of sequences belonged to the Euryarchaeota. Methanogenic archaea were novel representatives of Methanosarcinales, Methanomicrobiales, Methanobacteriales and Methanocellales orders. Bathyarchaeota (Miscellaneous Crenarchaeota Group) representatives were found among nonmethanogenic archaea in all the samples studied. The Thaumarchaeota representatives were not found in the upper sample, whereas Woesearchaeota (formerly DHVEG-6) were found in the three deepest samples. Unexpectedly, the greatest diversity of archaea was observed at a depth of 22.3 m, probably due to the availability of the labile organic carbon and/or due to the migration of the microbial cells during the freezing front towards the bottom. PMID:27312964

  19. A transposon-derived DNA polymerase from Entamoeba histolytica displays intrinsic strand displacement, processivity and lesion bypass.

    Directory of Open Access Journals (Sweden)

    Guillermo Pastor-Palacios

    Full Text Available Entamoeba histolytica encodes four family B2 DNA polymerases that vary in amino acid length from 813 to 1279. These DNA polymerases contain a N-terminal domain with no homology to other proteins and a C-terminal domain with high amino acid identity to archetypical family B2 DNA polymerases. A phylogenetic analysis indicates that these family B2 DNA polymerases are grouped with DNA polymerases from transposable elements dubbed Polintons or Mavericks. In this work, we report the cloning and biochemical characterization of the smallest family B2 DNA polymerase from E. histolytica. To facilitate its characterization we subcloned its 660 amino acids C-terminal region that comprises the complete exonuclease and DNA polymerization domains, dubbed throughout this work as EhDNApolB2. We found that EhDNApolB2 displays remarkable strand displacement, processivity and efficiently bypasses the DNA lesions: 8-oxo guanosine and abasic site.Family B2 DNA polymerases from T. vaginalis, G. lambia and E. histolytica contain a Terminal Region Protein 2 (TPR2 motif twice the length of the TPR2 from φ29 DNA polymerase. Deletion studies demonstrate that as in φ29 DNA polymerase, the TPR2 motif of EhDNApolB2 is solely responsible of strand displacement and processivity. Interestingly the TPR2 of EhDNApolB2 is also responsible for efficient abasic site bypass. These data suggests that the 21 extra amino acids of the TPR2 motif may shape the active site of EhDNApolB2 to efficiently incorporate and extended opposite an abasic site. Herein we demonstrate that an open reading frame derived from Politons-Mavericks in parasitic protozoa encode a functional enzyme and our findings support the notion that the introduction of novel motifs in DNA polymerases can confer specialized properties to a conserved scaffold.

  20. The Vertical Distribution of Sediment Archaeal Community in the “Black Bloom” Disturbing Zhushan Bay of Lake Taihu

    Science.gov (United States)

    Fan, Xianfang; Xing, Peng

    2016-01-01

    Using the Illumina sequencing technology, we investigated the vertical distribution of archaeal community in the sediment of Zhushan Bay of Lake Taihu, where the black bloom frequently occurred in summer. Overall, the Miscellaneous Crenarchaeotal Group (MCG), Deep Sea Hydrothermal Vent Group 6 (DHVEG-6), and Methanobacterium dominated the archaeal community. However, we observed significant difference in composition of archaeal community among different depths of the sediment. DHVEG-6 dominated in the surface layer (0–3 cm) sediment. Methanobacterium was the dominating archaeal taxa in the L2 (3–6 cm) and L3 (6–10) sediment. MCG was most abundant in the L4 (10–15 cm) and L5 (15–20 cm) sediment. Besides, DHVEG-6 was significantly affected by the concentration of total phosphorus (TP). And loss on ignition (LOI) was an important environmental factor for Methanobacterium. As the typical archaeal taxa in the surface layer sediment, DHVEG-6 and Methanobacterium might be more adapted to abundant substrate supply from cyanobacterial blooms and take active part in the biomass transformation. We propose that DHVEG-6 and Methanobacterium could be the key archaeal taxa correlated with the “black bloom” formation in Zhushan Bay. PMID:26884723

  1. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota. PMID:26494757

  2. Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome-centric metagenomics.

    Science.gov (United States)

    Evans, Paul N; Parks, Donovan H; Chadwick, Grayson L; Robbins, Steven J; Orphan, Victoria J; Golding, Suzanne D; Tyson, Gene W

    2015-10-23

    Methanogenic and methanotrophic archaea play important roles in the global flux of methane. Culture-independent approaches are providing deeper insight into the diversity and evolution of methane-metabolizing microorganisms, but, until now, no compelling evidence has existed for methane metabolism in archaea outside the phylum Euryarchaeota. We performed metagenomic sequencing of a deep aquifer, recovering two near-complete genomes belonging to the archaeal phylum Bathyarchaeota (formerly known as the Miscellaneous Crenarchaeotal Group). These genomes contain divergent homologs of the genes necessary for methane metabolism, including those that encode the methyl-coenzyme M reductase (MCR) complex. Additional non-euryarchaeotal MCR-encoding genes identified in a range of environments suggest that unrecognized archaeal lineages may also contribute to global methane cycling. These findings indicate that methane metabolism arose before the last common ancestor of the Euryarchaeota and Bathyarchaeota.

  3. A human CCT5 gene mutation causing distal neuropathy impairs hexadecamer assembly in an archaeal model.

    Science.gov (United States)

    Min, Wonki; Angileri, Francesca; Luo, Haibin; Lauria, Antonino; Shanmugasundaram, Maruda; Almerico, Anna Maria; Cappello, Francesco; de Macario, Everly Conway; Lednev, Igor K; Macario, Alberto J L; Robb, Frank T

    2014-10-27

    Chaperonins mediate protein folding in a cavity formed by multisubunit rings. The human CCT has eight non-identical subunits and the His147Arg mutation in one subunit, CCT5, causes neuropathy. Knowledge is scarce on the impact of this and other mutations upon the chaperone's structure and functions. To make progress, experimental models must be developed. We used an archaeal mutant homolog and demonstrated that the His147Arg mutant has impaired oligomeric assembly, ATPase activity, and defective protein homeostasis functions. These results establish for the first time that a human chaperonin gene defect can be reproduced and studied at the molecular level with an archaeal homolog. The major advantage of the system, consisting of rings with eight identical subunits, is that it amplifies the effects of a mutation as compared with the human counterpart, in which just one subunit per ring is defective. Therefore, the slight deficit of a non-lethal mutation can be detected and characterized.

  4. An archaeal tRNA-synthetase complex that enhances aminoacylation under extreme conditions

    DEFF Research Database (Denmark)

    Godinic-Mikulcic, Vlatka; Jaric, Jelena; Hausmann, Corinne D;

    2011-01-01

    Aminoacyl-tRNA synthetases (aaRSs) play an integral role in protein synthesis, functioning to attach the correct amino acid with its cognate tRNA molecule. AaRSs are known to associate into higher-order multi-aminoacyl-tRNA synthetase complexes (MSC) involved in archaeal and eukaryotic translation...... the catalytic efficiency of serine attachment to tRNA, but had no effect on the activity of MtArgRS. Further, the most pronounced improvements in the aminoacylation activity of MtSerRS induced by MtArgRS were observed under conditions of elevated temperature and osmolarity. These data indicate that......, although the precise biological role remains largely unknown. To gain further insights into archaeal MSCs, possible protein-protein interactions with the atypical Methanothermobacter thermautotrophicus seryl-tRNA synthetase (MtSerRS) were investigated. Yeast two-hybrid analysis revealed arginyl-tRNA...

  5. Methanopyrus kandleri: an archaeal methanogen unrelated to all other known methanogens

    Science.gov (United States)

    Burggraf, S.; Stetter, K. O.; Rouviere, P.; Woese, C. R.

    1991-01-01

    Analysis of its 16S rRNA sequence shows that the newly discovered hyperthermophilic methanogen, Methanopryus kandleri, is phylogenetically unrelated to any other known methanogen. The organism represents a separate lineage originating near the root of the archaeal tree. Although the 16S rRNA sequence of Mp. kandleri resembles euryarchaeal 16S rRNAs more than it does crenarchaeal, it shows more crenarchaeal signature features than any known euryarchaeal rRNA. Attempts to place it in relation to the root of the archaeal tree show that the Mp. kandleri lineage likely arises from the euryarchaeal branch of the tree. While the existence of so deeply branching a methanogenic lineage brings into question the thesis that methanogenesis evolved from an earlier metabolism similar to that seen in Thermococcus, it at the same time reinforces the notion that the aboriginal [correction of aborginal] archaeon was a thermophile.

  6. Expression, purification and crystallization of an archaeal-type phosphoenolpyruvate carboxylase

    International Nuclear Information System (INIS)

    The expression, purification, crystallization and preliminary diffraction analysis of an archaeal-type phosphoenolpyruvate carboxylase are described. Complete highly redundant X-ray data have been measured from a crystal diffracting to 3.13 Å resolution. An archaeal-type phosphoenolpyruvate carboxylase (PepcA) from Clostridium perfringens has been expressed in Escherichia coli in a soluble form with an amino-terminal His tag. The recombinant protein is enzymatically active and two crystal forms have been obtained. Complete diffraction data extending to 3.13 Å resolution have been measured from a crystal soaked in KAu(CN)2, using radiation at a wavelength just above the Au LIII edge. The asymmetric unit contains two tetramers of PepcA

  7. Fossilization and degradation of archaeal intact polar tetraether lipids in deeply buried marine sediments (Peru Margin)

    OpenAIRE

    Lengger, S. K.; Hopmans, E.C.; Sinninghe Damsté, J.S.; Schouten, S.

    2014-01-01

    Glycerol dibiphytanyl glycerol tetraether (GDGT) lipids are part of the cellular membranes of Thaumarchaeota, an archaeal phylum composed of aerobic ammonia oxidizers, and are used in the paleotemperature proxy TEX86. GDGTs in live cells possess polar head groups and are called intact polar lipids (IPL-GDGTs). Their transformation to core lipids (CL) by cleavage of the head group was assumed to proceed rapidly after cell death, but it has been suggested that some of these IPL-GDGTs can, just ...

  8. Activation of archaeal transcription mediated by recruitment of transcription factor B.

    Science.gov (United States)

    Ochs, Simon M; Thumann, Sybille; Richau, Renate; Weirauch, Matt T; Lowe, Todd M; Thomm, Michael; Hausner, Winfried

    2012-05-25

    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  9. Archaeal Transcription: Function of an Alternative Transcription Factor B from Pyrococcus furiosus▿

    OpenAIRE

    Micorescu, Michael; Grünberg, Sebastian; Franke, Andreas; Cramer, Patrick; Thomm, Michael; Bartlett, Michael

    2007-01-01

    The genome of the hyperthermophile archaeon Pyrococcus furiosus encodes two transcription factor B (TFB) paralogs, one of which (TFB1) was previously characterized in transcription initiation. The second TFB (TFB2) is unusual in that it lacks recognizable homology to the archaeal TFB/eukaryotic TFIIB B-finger motif. TFB2 functions poorly in promoter-dependent transcription initiation, but photochemical cross-linking experiments indicated that the orientation and occupancy of transcription com...

  10. The σ enigma: Bacterial σ factors, archaeal TFB and eukaryotic TFIIB are homologs

    OpenAIRE

    Burton, Samuel P; Burton, Zachary F.

    2014-01-01

    Structural comparisons of initiating RNA polymerase complexes and structure-based amino acid sequence alignments of general transcription initiation factors (eukaryotic TFIIB, archaeal TFB and bacterial σ factors) show that these proteins are homologs. TFIIB and TFB each have two-five-helix cyclin-like repeats (CLRs) that include a C-terminal helix-turn-helix (HTH) motif (CLR/HTH domains). Four homologous HTH motifs are present in bacterial σ factors that are relics of CLR/HTH domains. Sequen...

  11. Factors Controlling the Distribution of Archaeal Tetraethers in Terrestrial Hot Springs▿

    OpenAIRE

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, Wenjun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L.

    2008-01-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, i...

  12. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest

    OpenAIRE

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2010-01-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees wer...

  13. Nitrification of archaeal ammonia oxidizers in a high- temperature hot spring

    Science.gov (United States)

    Chen, Shun; Peng, Xiaotong; Xu, Hengchao; Ta, Kaiwen

    2016-04-01

    The oxidation of ammonia by microbes has been shown to occur in diverse natural environments. However, the link of in situ nitrification activity to taxonomic identities of ammonia oxidizers in high-temperature environments remains poorly understood. Here, we studied in situ ammonia oxidation rates and the diversity of ammonia-oxidizing Archaea (AOA) in surface and bottom sediments at 77 °C in the Gongxiaoshe hot spring, Tengchong, Yunnan, China. The in situ ammonia oxidation rates measured by the 15N-NO3- pool dilution technique in the surface and bottom sediments were 4.80 and 5.30 nmol N g-1 h-1, respectively. Real-time quantitative polymerase chain reaction (qPCR) indicated that the archaeal 16S rRNA genes and amoA genes were present in the range of 0.128 to 1.96 × 108 and 2.75 to 9.80 × 105 gene copies g-1 sediment, respectively, while bacterial amoA was not detected. Phylogenetic analysis of 16S rRNA genes showed high sequence similarity to thermophilic Candidatus Nitrosocaldus yellowstonii, which represented the most abundant operational taxonomic units (OTU) in both surface and bottom sediments. The archaeal predominance was further supported by fluorescence in situ hybridization (FISH) visualization. The cell-specific rate of ammonia oxidation was estimated to range from 0.410 to 0.790 fmol N archaeal cell-1 h-1, higher than those in the two US Great Basin hot springs. These results suggest the importance of archaeal rather than bacterial ammonia oxidation in driving the nitrogen cycle in terrestrial geothermal environments.

  14. Significance of archaeal nitrification in hypoxic waters of the Baltic Sea

    OpenAIRE

    Berg, Carlo; Vandieken, Verona; Thamdrup, Bo; Jürgens, Klaus

    2014-01-01

    Ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota are widespread, and their abundance in many terrestrial and aquatic ecosystems suggests a prominent role in nitrification. AOA also occur in high numbers in oxygen-deficient marine environments, such as the pelagic redox gradients of the central Baltic Sea; however, data on archaeal nitrification rates are scarce and little is known about the factors, for example sulfide, that regulate nitrification in this system. In the present wo...

  15. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards* #

    OpenAIRE

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-01-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profili...

  16. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea

    OpenAIRE

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Pierre E Galand; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-01-01

    International audience To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacte...

  17. Abundance and Composition of Epiphytic Bacterial and Archaeal Ammonia Oxidizers of Marine Red and Brown Macroalgae

    OpenAIRE

    Trias, R. (Rosalía); García-Lledó A. (Arantzazu); Sánchez, N.; López-Jurado, J. L.; Hallin, S. (Sara); Bañeras, Ll. (Lluís)

    2012-01-01

    Ammonia-oxidizing bacteria (AOB) and archaea (AOA) are important for nitrogen cycling in marine ecosystems. Little is known about the diversity and abundance of these organisms on the surface of marine macroalgae, despite the algae’s potential importance to create surfaces and local oxygen-rich environments supporting ammonia oxidation at depths with low dissolved oxygen levels. We determined the abundance and composition of the epiphytic bacterial and archaeal ammonia-oxidizing communities o...

  18. Global Occurrence of Archaeal amoA Genes in Terrestrial Hot Springs▿

    OpenAIRE

    Zhang, Chuanlun L.; Ye, Qi; Huang, Zhiyong; Li, Wenjun; Chen, Jinquan; Song, Zhaoqi; Zhao, Weidong; Bagwell, Christopher; Inskeep, William P.; Ross, Christian; Gao, Lei; Wiegel, Juergen; Romanek, Christopher S.; Shock, Everett L.; Hedlund, Brian P.

    2008-01-01

    Despite the ubiquity of ammonium in geothermal environments and the thermodynamic favorability of aerobic ammonia oxidation, thermophilic ammonia-oxidizing microorganisms belonging to the crenarchaeota kingdom have only recently been described. In this study, we analyzed microbial mats and surface sediments from 21 hot spring samples (pH 3.4 to 9.0; temperature, 41 to 86°C) from the United States, China, and Russia and obtained 846 putative archaeal ammonia monooxygenase large-subunit (amoA) ...

  19. Biogas production and methanogenic archaeal community in mesophilic and thermophilic anaerobic co-digestion processes.

    Science.gov (United States)

    Yu, D; Kurola, J M; Lähde, K; Kymäläinen, M; Sinkkonen, A; Romantschuk, M

    2014-10-01

    Over 258 Mt of solid waste are generated annually in Europe, a large fraction of which is biowaste. Sewage sludge is another major waste fraction. In this study, biowaste and sewage sludge were co-digested in an anaerobic digestion reactor (30% and 70% of total wet weight, respectively). The purpose was to investigate the biogas production and methanogenic archaeal community composition in the anaerobic digestion reactor under meso- (35-37 °C) and thermophilic (55-57 °C) processes and an increasing organic loading rate (OLR, 1-10 kg VS m(-3) d(-1)), and also to find a feasible compromise between waste treatment capacity and biogas production without causing process instability. In summary, more biogas was produced with all OLRs by the thermophilic process. Both processes showed a limited diversity of the methanogenic archaeal community which was dominated by Methanobacteriales and Methanosarcinales (e.g. Methanosarcina) in both meso- and thermophilic processes. Methanothermobacter was detected as an additional dominant genus in the thermophilic process. In addition to operating temperatures, the OLRs, the acetate concentration, and the presence of key substrates like propionate also affected the methanogenic archaeal community composition. A bacterial cell count 6.25 times higher than archaeal cell count was observed throughout the thermophilic process, while the cell count ratio varied between 0.2 and 8.5 in the mesophilic process. This suggests that the thermophilic process is more stable, but also that the relative abundance between bacteria and archaea can vary without seriously affecting biogas production.

  20. Exploring microbial dark matter to resolve the deep archaeal ancestry of eukaryotes.

    Science.gov (United States)

    Saw, Jimmy H; Spang, Anja; Zaremba-Niedzwiedzka, Katarzyna; Juzokaite, Lina; Dodsworth, Jeremy A; Murugapiran, Senthil K; Colman, Dan R; Takacs-Vesbach, Cristina; Hedlund, Brian P; Guy, Lionel; Ettema, Thijs J G

    2015-09-26

    The origin of eukaryotes represents an enigmatic puzzle, which is still lacking a number of essential pieces. Whereas it is currently accepted that the process of eukaryogenesis involved an interplay between a host cell and an alphaproteobacterial endosymbiont, we currently lack detailed information regarding the identity and nature of these players. A number of studies have provided increasing support for the emergence of the eukaryotic host cell from within the archaeal domain of life, displaying a specific affiliation with the archaeal TACK superphylum. Recent studies have shown that genomic exploration of yet-uncultivated archaea, the so-called archaeal 'dark matter', is able to provide unprecedented insights into the process of eukaryogenesis. Here, we provide an overview of state-of-the-art cultivation-independent approaches, and demonstrate how these methods were used to obtain draft genome sequences of several novel members of the TACK superphylum, including Lokiarchaeum, two representatives of the Miscellaneous Crenarchaeotal Group (Bathyarchaeota), and a Korarchaeum-related lineage. The maturation of cultivation-independent genomics approaches, as well as future developments in next-generation sequencing technologies, will revolutionize our current view of microbial evolution and diversity, and provide profound new insights into the early evolution of life, including the enigmatic origin of the eukaryotic cell. PMID:26323759

  1. Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun

    2013-04-01

    Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs.

  2. Archaeal community structures in the solfataric acidic hot springs with different temperatures and elemental compositions.

    Science.gov (United States)

    Satoh, Tomoko; Watanabe, Keiko; Yamamoto, Hideo; Yamamoto, Shuichi; Kurosawa, Norio

    2013-01-01

    Archaeal 16S rRNA gene compositions and environmental factors of four distinct solfataric acidic hot springs in Kirishima, Japan were compared. The four ponds were selected by differences of temperature and total dissolved elemental concentration as follows: (1) Pond-A: 93°C and 1679 mg L(-1), (2) Pond-B: 66°C and 2248 mg L(-1), (3) Pond-C: 88°C and 198 mg L(-1), and (4) Pond-D: 67°C and 340 mg L(-1). In total, 431 clones of 16S rRNA gene were classified into 26 phylotypes. In Pond-B, the archaeal diversity was the highest among the four, and the members of the order Sulfolobales were dominant. The Pond-D also showed relatively high diversity, and the most frequent group was uncultured thermoacidic spring clone group. In contrast to Pond-B and Pond-D, much less diverse archaeal clones were detected in Pond-A and Pond-C showing higher temperatures. However, dominant groups in these ponds were also different from each other. The members of the order Sulfolobales shared 89% of total clones in Pond-A, and the uncultured crenarchaeal groups shared 99% of total Pond-C clones. Therefore, species compositions and biodiversity were clearly different among the ponds showing different temperatures and dissolved elemental concentrations.

  3. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm.

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  4. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Science.gov (United States)

    Tupinambá, Daiva Domenech; Cantão, Maurício Egídio; Costa, Ohana Yonara Assis; Bergmann, Jessica Carvalho; Kruger, Ricardo Henrique; Kyaw, Cynthia Maria; Barreto, Cristine Chaves; Quirino, Betania Ferraz

    2016-01-01

    This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7%) were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers) were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest) and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area). More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied. PMID:27006640

  5. Temporal Dynamics of Active Prokaryotic Nitrifiers and Archaeal Communities from River to Sea.

    Science.gov (United States)

    Hugoni, Mylène; Agogué, Hélène; Taib, Najwa; Domaizon, Isabelle; Moné, Anne; Galand, Pierre E; Bronner, Gisèle; Debroas, Didier; Mary, Isabelle

    2015-08-01

    To test if different niches for potential nitrifiers exist in estuarine systems, we assessed by pyrosequencing the diversity of archaeal gene transcript markers for taxonomy (16S ribosomal RNA (rRNA)) during an entire year along a salinity gradient in surface waters of the Charente estuary (Atlantic coast, France). We further investigated the potential for estuarine prokaryotes to oxidize ammonia and hydrolyze urea by quantifying thaumarchaeal amoA and ureC and bacterial amoA transcripts. Our results showed a succession of different nitrifiers from river to sea with bacterial amoA transcripts dominating in the freshwater station while archaeal transcripts were predominant in the marine station. The 16S rRNA sequence analysis revealed that Thaumarchaeota marine group I (MGI) were the most abundant overall but other archaeal groups like Methanosaeta were also potentially active in winter (December-March) and Euryarchaeota marine group II (MGII) were dominant in seawater in summer (April-August). Each station also contained different Thaumarchaeota MGI phylogenetic clusters, and the clusters' microdiversity was associated to specific environmental conditions suggesting the presence of ecotypes adapted to distinct ecological niches. The amoA and ureC transcript dynamics further indicated that some of the Thaumarchaeota MGI subclusters were involved in ammonia oxidation through the hydrolysis of urea. Our findings show that ammonia-oxidizing Archaea and Bacteria were adapted to contrasted conditions and that the Thaumarchaeota MGI diversity probably corresponds to distinct metabolisms or life strategies. PMID:25851445

  6. Archaeal Community Changes Associated with Cultivation of Amazon Forest Soil with Oil Palm

    Directory of Open Access Journals (Sweden)

    Daiva Domenech Tupinambá

    2016-01-01

    Full Text Available This study compared soil archaeal communities of the Amazon forest with that of an adjacent area under oil palm cultivation by 16S ribosomal RNA gene pyrosequencing. Species richness and diversity were greater in native forest soil than in the oil palm-cultivated area, and 130 OTUs (13.7% were shared between these areas. Among the classified sequences, Thaumarchaeota were predominant in the native forest, whereas Euryarchaeota were predominant in the oil palm-cultivated area. Archaeal species diversity was 1.7 times higher in the native forest soil, according to the Simpson diversity index, and the Chao1 index showed that richness was five times higher in the native forest soil. A phylogenetic tree of unclassified Thaumarchaeota sequences showed that most of the OTUs belong to Miscellaneous Crenarchaeotic Group. Several archaeal genera involved in nutrient cycling (e.g., methanogens and ammonia oxidizers were identified in both areas, but significant differences were found in the relative abundances of Candidatus Nitrososphaera and unclassified Soil Crenarchaeotic Group (prevalent in the native forest and Candidatus Nitrosotalea and unclassified Terrestrial Group (prevalent in the oil palm-cultivated area. More studies are needed to culture some of these Archaea in the laboratory so that their metabolism and physiology can be studied.

  7. The Korarchaeota: Archaeal orphans representing an ancestral lineage of life

    Energy Technology Data Exchange (ETDEWEB)

    Elkins, James G.; Kunin, Victor; Anderson, Iain; Barry, Kerrie; Goltsman, Eugene; Lapidus, Alla; Hedlund, Brian; Hugenholtz, Phil; Kyrpides, Nikos; Graham, David; Keller, Martin; Wanner, Gerhard; Richardson, Paul; Stetter, Karl O.

    2007-05-01

    Based on conserved cellular properties, all life on Earth can be grouped into different phyla which belong to the primary domains Bacteria, Archaea, and Eukarya. However, tracing back their evolutionary relationships has been impeded by horizontal gene transfer and gene loss. Within the Archaea, the kingdoms Crenarchaeota and Euryarchaeota exhibit a profound divergence. In order to elucidate the evolution of these two major kingdoms, representatives of more deeply diverged lineages would be required. Based on their environmental small subunit ribosomal (ss RNA) sequences, the Korarchaeota had been originally suggested to have an ancestral relationship to all known Archaea although this assessment has been refuted. Here we describe the cultivation and initial characterization of the first member of the Korarchaeota, highly unusual, ultrathin filamentous cells about 0.16 {micro}m in diameter. A complete genome sequence obtained from enrichment cultures revealed an unprecedented combination of signature genes which were thought to be characteristic of either the Crenarchaeota, Euryarchaeota, or Eukarya. Cell division appears to be mediated through a FtsZ-dependent mechanism which is highly conserved throughout the Bacteria and Euryarchaeota. An rpb8 subunit of the DNA-dependent RNA polymerase was identified which is absent from other Archaea and has been described as a eukaryotic signature gene. In addition, the representative organism possesses a ribosome structure typical for members of the Crenarchaeota. Based on its gene complement, this lineage likely diverged near the separation of the two major kingdoms of Archaea. Further investigations of these unique organisms may shed additional light onto the evolution of extant life.

  8. Evolution of DNA replication protein complexes in eukaryotes and Archaea.

    Directory of Open Access Journals (Sweden)

    Nicholas Chia

    Full Text Available BACKGROUND: The replication of DNA in Archaea and eukaryotes requires several ancillary complexes, including proliferating cell nuclear antigen (PCNA, replication factor C (RFC, and the minichromosome maintenance (MCM complex. Bacterial DNA replication utilizes comparable proteins, but these are distantly related phylogenetically to their archaeal and eukaryotic counterparts at best. METHODOLOGY/PRINCIPAL FINDINGS: While the structures of each of the complexes do not differ significantly between the archaeal and eukaryotic versions thereof, the evolutionary dynamic in the two cases does. The number of subunits in each complex is constant across all taxa. However, they vary subtly with regard to composition. In some taxa the subunits are all identical in sequence, while in others some are homologous rather than identical. In the case of eukaryotes, there is no phylogenetic variation in the makeup of each complex-all appear to derive from a common eukaryotic ancestor. This is not the case in Archaea, where the relationship between the subunits within each complex varies taxon-to-taxon. We have performed a detailed phylogenetic analysis of these relationships in order to better understand the gene duplications and divergences that gave rise to the homologous subunits in Archaea. CONCLUSION/SIGNIFICANCE: This domain level difference in evolution suggests that different forces have driven the evolution of DNA replication proteins in each of these two domains. In addition, the phylogenies of all three gene families support the distinctiveness of the proposed archaeal phylum Thaumarchaeota.

  9. Spatiotemporal dynamics of bacterial and archaeal communities in household biogas digesters from tropical and subtropical regions of Yunnan Province, China.

    Science.gov (United States)

    Tian, Guangliang; Li, Qiumin; Dong, Minghua; Wu, Yan; Yang, Bin; Zhang, Lijuan; Li, Yingjuan; Yin, Fang; Zhao, Xingling; Wang, Yongxia; Xiao, Wei; Cui, Xiaolong; Zhang, Wudi

    2016-06-01

    A combination of 16S rRNA gene PCR-based techniques and the determination of abiotic factors were used to study community composition, richness, and evenness and the correlation between biotic and abiotic factors in 19 household biogas digesters in tropical and subtropical regions of Yunnan Province, China. The results revealed that both bacterial and archaeal community composition differed between regions and archaeal community composition was more affected by season than bacterial; regardless of sampling location, the dominant bacterial phyla included Chloroflexi, Bacteroidetes, Firmicutes, and Proteobacteria, and the most dominant archaeal phylum was Euryarchaeota; in digesters from both regions, Chloroflexi as the first or second most dominant bacteria accounted for 21.50-26.10 % of bacterial library sequences, and the phylum Crenarchaeota as the second most dominant archaea accounted for 17.65-19.77 % of archaeal library sequences; the species Methanosaeta concilii as the most dominant archaeal species accounted for 67.80-72.80 % of the sequences. This study found that most of the abundant microbial communities in 19 biogas digesters are similar, and this result will provide enlightenment for finding the universal nature in rural biogas digesters at tropical and subtropical regions in China. PMID:26916266

  10. Bacterial and archaeal communities in the deep-sea sediments of inactive hydrothermal vents in the Southwest India Ridge.

    Science.gov (United States)

    Zhang, Likui; Kang, Manyu; Xu, Jiajun; Xu, Jian; Shuai, Yinjie; Zhou, Xiaojian; Yang, Zhihui; Ma, Kesen

    2016-01-01

    Active deep-sea hydrothermal vents harbor abundant thermophilic and hyperthermophilic microorganisms. However, microbial communities in inactive hydrothermal vents have not been well documented. Here, we investigated bacterial and archaeal communities in the two deep-sea sediments (named as TVG4 and TVG11) collected from inactive hydrothermal vents in the Southwest India Ridge using the high-throughput sequencing technology of Illumina MiSeq2500 platform. Based on the V4 region of 16S rRNA gene, sequence analysis showed that bacterial communities in the two samples were dominated by Proteobacteria, followed by Bacteroidetes, Actinobacteria and Firmicutes. Furthermore, archaeal communities in the two samples were dominated by Thaumarchaeota and Euryarchaeota. Comparative analysis showed that (i) TVG4 displayed the higher bacterial richness and lower archaeal richness than TVG11; (ii) the two samples had more divergence in archaeal communities than bacterial communities. Bacteria and archaea that are potentially associated with nitrogen, sulfur metal and methane cycling were detected in the two samples. Overall, we first provided a comparative picture of bacterial and archaeal communities and revealed their potentially ecological roles in the deep-sea environments of inactive hydrothermal vents in the Southwest Indian Ridge, augmenting microbial communities in inactive hydrothermal vents.

  11. Bacterial and archaeal communities in the deep-sea sediments of inactive hydrothermal vents in the Southwest India Ridge

    Science.gov (United States)

    Zhang, Likui; Kang, Manyu; Xu, Jiajun; Xu, Jian; Shuai, Yinjie; Zhou, Xiaojian; Yang, Zhihui; Ma, Kesen

    2016-05-01

    Active deep-sea hydrothermal vents harbor abundant thermophilic and hyperthermophilic microorganisms. However, microbial communities in inactive hydrothermal vents have not been well documented. Here, we investigated bacterial and archaeal communities in the two deep-sea sediments (named as TVG4 and TVG11) collected from inactive hydrothermal vents in the Southwest India Ridge using the high-throughput sequencing technology of Illumina MiSeq2500 platform. Based on the V4 region of 16S rRNA gene, sequence analysis showed that bacterial communities in the two samples were dominated by Proteobacteria, followed by Bacteroidetes, Actinobacteria and Firmicutes. Furthermore, archaeal communities in the two samples were dominated by Thaumarchaeota and Euryarchaeota. Comparative analysis showed that (i) TVG4 displayed the higher bacterial richness and lower archaeal richness than TVG11; (ii) the two samples had more divergence in archaeal communities than bacterial communities. Bacteria and archaea that are potentially associated with nitrogen, sulfur metal and methane cycling were detected in the two samples. Overall, we first provided a comparative picture of bacterial and archaeal communities and revealed their potentially ecological roles in the deep-sea environments of inactive hydrothermal vents in the Southwest Indian Ridge, augmenting microbial communities in inactive hydrothermal vents.

  12. Denaturing gradient gel electrophoresis and barcoded pyrosequencing reveal unprecedented archaeal diversity in mangrove sediment and rhizosphere samples.

    Science.gov (United States)

    Pires, Ana C C; Cleary, Daniel F R; Almeida, Adelaide; Cunha, Angela; Dealtry, Simone; Mendonça-Hagler, Leda C S; Smalla, Kornelia; Gomes, Newton C M

    2012-08-01

    Mangroves are complex ecosystems that regulate nutrient and sediment fluxes to the open sea. The importance of bacteria and fungi in regulating nutrient cycles has led to an interest in their diversity and composition in mangroves. However, very few studies have assessed Archaea in mangroves, and virtually nothing is known about whether mangrove rhizospheres affect archaeal diversity and composition. Here, we studied the diversity and composition of Archaea in mangrove bulk sediment and the rhizospheres of two mangrove trees, Rhizophora mangle and Laguncularia racemosa, using denaturing gradient gel electrophoresis (DGGE) and pyrosequencing of archaeal 16S rRNA genes with a nested-amplification approach. DGGE profiles revealed significant structural differences between bulk sediment and rhizosphere samples, suggesting that roots of both mangrove species influence the sediment archaeal community. Nearly all of the detected sequences obtained with pyrosequencing were identified as Archaea, but most were unclassified at the level of phylum or below. Archaeal richness was, furthermore, the highest in the L. racemosa rhizosphere, intermediate in bulk sediment, and the lowest in the R. mangle rhizosphere. This study shows that rhizosphere microhabitats of R. mangle and L. racemosa, common plants in subtropical mangroves located in Rio de Janeiro, Brazil, hosted distinct archaeal assemblages. PMID:22660713

  13. Factors Controlling the Distribution of Archaeal Tetraethers in Terrestrial Hot Springs▿

    Science.gov (United States)

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, WenJun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L.

    2008-01-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, including Yellowstone National Park (United States), the Great Basin of Nevada and California (United States), Kamchatka (Russia), Tengchong thermal field (China), and Thailand. These samples had temperatures of 36.5 to 87°C and pH values of 3.0 to 9.2. GDGT abundances also were determined for three soil samples adjacent to some of the hot springs. Principal component analysis identified four factors that accounted for most of the variance among nine individual GDGTs, temperature, and pH. Significant correlations were observed between pH and the GDGTs crenarchaeol and GDGT-4 (four cyclopentane rings, m/z 1,294); pH correlated positively with crenarchaeol and inversely with GDGT-4. Weaker correlations were observed between temperature and the four factors. Three of the four GDGTs used in the marine TEX86 paleotemperature index (GDGT-1 to -3, but not crenarchaeol isomer) were associated with a single factor. No correlation was observed for GDGT-0 (acyclic caldarchaeol): it is effectively its own variable. The biosynthetic mechanisms and exact archaeal community structures leading to these relationships remain unknown. However, the data in general show promise for the continued development of GDGT lipid-based physiochemical proxies for archaeal evolution and for paleo-ecology or paleoclimate studies. PMID:18390673

  14. Factors controlling the distribution of archaeal tetraethers in terrestrial hot springs.

    Science.gov (United States)

    Pearson, Ann; Pi, Yundan; Zhao, Weidong; Li, WenJun; Li, Yiliang; Inskeep, William; Perevalova, Anna; Romanek, Christopher; Li, Shuguang; Zhang, Chuanlun L

    2008-06-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) found in hot springs reflect the abundance and community structure of Archaea in these extreme environments. The relationships between GDGTs, archaeal communities, and physical or geochemical variables are underexamined to date and when reported often result in conflicting interpretations. Here, we examined profiles of GDGTs from pure cultures of Crenarchaeota and from terrestrial geothermal springs representing a wide distribution of locations, including Yellowstone National Park (United States), the Great Basin of Nevada and California (United States), Kamchatka (Russia), Tengchong thermal field (China), and Thailand. These samples had temperatures of 36.5 to 87 degrees C and pH values of 3.0 to 9.2. GDGT abundances also were determined for three soil samples adjacent to some of the hot springs. Principal component analysis identified four factors that accounted for most of the variance among nine individual GDGTs, temperature, and pH. Significant correlations were observed between pH and the GDGTs crenarchaeol and GDGT-4 (four cyclopentane rings, m/z 1,294); pH correlated positively with crenarchaeol and inversely with GDGT-4. Weaker correlations were observed between temperature and the four factors. Three of the four GDGTs used in the marine TEX(86) paleotemperature index (GDGT-1 to -3, but not crenarchaeol isomer) were associated with a single factor. No correlation was observed for GDGT-0 (acyclic caldarchaeol): it is effectively its own variable. The biosynthetic mechanisms and exact archaeal community structures leading to these relationships remain unknown. However, the data in general show promise for the continued development of GDGT lipid-based physiochemical proxies for archaeal evolution and for paleo-ecology or paleoclimate studies. PMID:18390673

  15. Plant genotype-specific archaeal and bacterial endophytes but similar Bacillus antagonists colonize Mediterranean olive trees

    Directory of Open Access Journals (Sweden)

    Henry eMueller

    2015-03-01

    Full Text Available Endophytes have an intimate and often symbiotic interaction with their hosts. Less is known about the composition and function of endophytes in trees. In order to evaluate our hypothesis that plant genotype and origin have a strong impact on both, endophytes of leaves from 10 Olea europaea L. cultivars from the Mediterranean basin growing at a single agricultural site in Spain and from nine wild olive trees located in natural habitats in Greece, Cyprus and on Madeira Island were studied. The composition of the bacterial endophytic communities as revealed by 16S rRNA gene amplicon sequencing and the subsequent PCoA analysis showed a strong correlation to the plant genotypes. The bacterial distribution patterns were congruent with the plant origins in Eastern and Western areas of the Mediterranean basin. Subsequently, the endophytic microbiome of wild olives was shown to be closely related to those of cultivated olives of the corresponding geographic origins. The olive leaf endosphere harbored mostly Proteobacteria, followed by Firmicutes, Actinobacteria and Bacteroidetes. The detection of a high portion of archaeal taxa belonging to the phyla Thaumarchaeota, Crenarchaeota and Euryarchaeota in the amplicon libraries was an unexpected discovery, which was confirmed by quantitative real-time PCR revealing an archaeal portion of up to 35.8%. Although the function of these Archaea for their host plant remains speculative, this finding suggests a significant relevance of archaeal endophytes for plant-microbe interactions. In addition, the antagonistic potential of culturable endophytes was determined; all isolates with antagonistic activity against the olive-pathogenic fungus Verticillium dahliae Kleb. belong to Bacillus amyloliquefaciens. In contrast to the specific global structural diversity, BOX-fingerprints of the antagonistic Bacillus isolates were highly similar and independent of the olive genotype from which they were isolated.

  16. Response of Archaeal and Bacterial Soil Communities to Changes Associated with Outdoor Cattle Overwintering.

    Directory of Open Access Journals (Sweden)

    Alica Chroňáková

    Full Text Available Archaea and bacteria are important drivers for nutrient transformations in soils and catalyse the production and consumption of important greenhouse gases. In this study, we investigate changes in archaeal and bacterial communities of four Czech grassland soils affected by outdoor cattle husbandry. Two show short-term (3 years; STI and long-term impact (17 years; LTI, one is regenerating from cattle impact (REG and a control is unaffected by cattle (CON. Cattle manure (CMN, the source of allochthonous microbes, was collected from the same area. We used pyrosequencing of 16S rRNA genes to assess the composition of archaeal and bacterial communities in each soil type and CMN. Both short- and long- term cattle impact negatively altered archaeal and bacterial diversity, leading to increase of homogenization of microbial communities in overwintering soils over time. Moreover, strong shifts in the prokaryotic communities were observed in response to cattle overwintering, with the greatest impact on archaea. Oligotrophic and acidophilic microorganisms (e.g. Thaumarchaeota, Acidobacteria, and α-Proteobacteria dominated in CON and expressed strong negative response to increased pH, total C and N. Whereas copiotrophic and alkalophilic microbes (e.g. methanogenic Euryarchaeota, Firmicutes, Chloroflexi, Actinobacteria, and Bacteroidetes were common in LTI showing opposite trends. Crenarchaeota were also found in LTI, though their trophic interactions remain cryptic. Firmicutes, Bacteroidetes, Methanobacteriaceae, and Methanomicrobiaceae indicated the introduction and establishment of faecal microbes into the impacted soils, while Chloroflexi and Methanosarcinaceae suggested increased abundance of soil-borne microbes under altered environmental conditions. The observed changes in prokaryotic community composition may have driven corresponding changes in soil functioning.

  17. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    OpenAIRE

    Hongming WANG; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated read...

  18. Effect of Tree Species and Mycorrhizal Colonization on the Archaeal Population of Boreal Forest Rhizospheres▿

    OpenAIRE

    Bomberg, Malin; Timonen, Sari

    2008-01-01

    Group 1.1c Crenarchaeota are the predominating archaeal group in acidic boreal forest soils. In this study, we show that the detection frequency of 1.1c crenarchaeotal 16S rRNA genes in the rhizospheres of the boreal forest trees increased following colonization by the ectomycorrhizal fungus Paxillus involutus. This effect was very clear in the fine roots of Pinus sylvestris, Picea abies, and Betula pendula, the most common forest trees in Finland. The nonmycorrhizal fine roots had a clearly ...

  19. Seasonal Effects in a Lake Sediment Archaeal Community of the Brazilian Savanna

    OpenAIRE

    Thiago Rodrigues; Elisa Catão; Mercedes M. C. Bustamante; Quirino, Betania F.; Kruger, Ricardo H; Kyaw, Cynthia M

    2014-01-01

    The Cerrado is a biome that corresponds to 24% of Brazil’s territory. Only recently microbial communities of this biome have been investigated. Here we describe for the first time the diversity of archaeal communities from freshwater lake sediments of the Cerrado in the dry season and in the transition period between the dry and rainy seasons, when the first rains occur. Gene libraries were constructed, using Archaea-specific primers for the 16S rRNA and amoA genes. Analysis revealed marked ...

  20. Acidianus Tailed Spindle Virus: a New Archaeal Large Tailed Spindle Virus Discovered by Culture-Independent Methods

    Science.gov (United States)

    Hochstein, Rebecca A.; Amenabar, Maximiliano J.; Munson-McGee, Jacob H.; Boyd, Eric S.

    2016-01-01

    ABSTRACT The field of viral metagenomics has expanded our understanding of viral diversity from all three domains of life (Archaea, Bacteria, and Eukarya). Traditionally, viral metagenomic studies provide information about viral gene content but rarely provide knowledge about virion morphology and/or cellular host identity. Here we describe a new virus, Acidianus tailed spindle virus (ATSV), initially identified by bioinformatic analysis of viral metagenomic data sets from a high-temperature (80°C) acidic (pH 2) hot spring located in Yellowstone National Park, followed by more detailed characterization using only environmental samples without dependency on culturing. Characterization included the identification of the large tailed spindle virion morphology, determination of the complete 70.8-kb circular double-stranded DNA (dsDNA) viral genome content, and identification of its cellular host. Annotation of the ATSV genome revealed a potential three-domain gene product containing an N-terminal leucine-rich repeat domain, followed by a likely posttranslation regulatory region consisting of high serine and threonine content, and a C-terminal ESCRT-III domain, suggesting interplay with the host ESCRT system. The host of ATSV, which is most closely related to Acidianus hospitalis, was determined by a combination of analysis of cellular clustered regularly interspaced short palindromic repeat (CRISPR)/Cas loci and dual viral and cellular fluorescence in situ hybridization (viral FISH) analysis of environmental samples and confirmed by culture-based infection studies. This work provides an expanded pathway for the discovery, isolation, and characterization of new viruses using culture-independent approaches and provides a platform for predicting and confirming virus hosts. IMPORTANCE Virus discovery and characterization have been traditionally accomplished by using culture-based methods. While a valuable approach, it is limited by the availability of culturable hosts. In

  1. Environmental and Genetic Influences of Archaeal Lipid Distribution in Natural and Artificial Marine Environments

    Science.gov (United States)

    Warren, C.; Pagani, M.

    2012-12-01

    TEX86 is a proxy of sea surface temperature based on refractory glycerol dibiphytanyl glycerol tetraethers (GDGT) in the cell membranes of low-temperature dwelling (non-hyperthermophilic) Archaea. The degree to which environmental signals other than temperature influence the distribution of GDGT compounds is poorly understood. Few representatives of the Thaumarchaeota — the clade to which the dominant GDGT production has been attributed — have been described or isolated in pure culture, and the role of genetic lineage in the synthesis and distribution of GDGTs is unknown. For this project we collected water, filter and substrate samples from tank systems in non-profit and commercial aquariums around the United States. This analysis compares GDGT core lipids and intact polar lipid distributions with Archaeal genetic sequence data processed using rRNA and 454 Pyrosequencing. Environmental attributes (such as dissolved oxygen concentration, salinity, organic density, etc.) specific to each tank are also compared to lipid analyses and the presence of specific lineages within select tank systems. Our preliminary results demonstrate that archaeal GDGTs are present and abundant within a range of environmental conditions, including artificial saline and brackish waters derived from municipal sources. Comparisons of existing TEX86 calibration values with known temperatures suggest that residuals vary based on non-temperature parameters. Branched compounds are absent in most aquarium systems, but dominate in systems prepared with municipal water.

  2. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    Science.gov (United States)

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  3. Archaeal Populations in Hypersaline Sediments Underlying Orange Microbial Mats in the Napoli Mud Volcano▿†

    Science.gov (United States)

    Lazar, Cassandre Sara; L'Haridon, Stéphane; Pignet, Patricia; Toffin, Laurent

    2011-01-01

    Microbial mats in marine cold seeps are known to be associated with ascending sulfide- and methane-rich fluids. Hence, they could be visible indicators of anaerobic oxidation of methane (AOM) and methane cycling processes in underlying sediments. The Napoli mud volcano is situated in the Olimpi Area that lies on saline deposits; from there, brine fluids migrate upward to the seafloor. Sediments associated with a brine pool and microbial orange mats of the Napoli mud volcano were recovered during the Medeco cruise. Based on analysis of RNA-derived sequences, the “active” archaeal community was composed of many uncultured lineages, such as rice cluster V or marine benthic group D. Function methyl coenzyme M reductase (mcrA) genes were affiliated with the anaerobic methanotrophic Archaea (ANME) of the ANME-1, ANME-2a, and ANME-2c groups, suggesting that AOM occurred in these sediment layers. Enrichment cultures showed the presence of viable marine methylotrophic Methanococcoides in shallow sediment layers. Thus, the archaeal community diversity seems to show that active methane cycling took place in the hypersaline microbial mat-associated sediments of the Napoli mud volcano. PMID:21335391

  4. Co-expression and co-purification of archaeal and eukaryal box C/D RNPs.

    Directory of Open Access Journals (Sweden)

    Yu Peng

    Full Text Available Box C/D ribonucleoprotein particles (RNPs are 2'-O-methylation enzymes required for maturation of ribosomal and small nuclear RNA. Previous biochemical and structural studies of the box C/D RNPs were limited by the unavailability of purified intact RNPs. We developed a bacterial co-expression strategy based on the combined use of a multi-gene expression system and a tRNA-scaffold construct that allowed the expression and purification of homogeneous archaeal and human box C/D RNPs. While the co-expressed and co-purified archaeal box C/D RNP was found to be fully active in a 2'-O-methylation assay, the intact human U14 box C/D RNP showed no detectable catalytic activity, consistent with the earlier findings that assembly of eukaryotic box C/D RNPs is nonspontaneous and requires additional protein factors. Our systems provide a means for further biochemical and structural characterization of box C/D RNPs and their assembly factors.

  5. Phylogeny of bacterial and archaeal genomes using conserved genes: supertrees and supermatrices.

    Directory of Open Access Journals (Sweden)

    Jenna Morgan Lang

    Full Text Available Over 3000 microbial (bacterial and archaeal genomes have been made publically available to date, providing an unprecedented opportunity to examine evolutionary genomic trends and offering valuable reference data for a variety of other studies such as metagenomics. The utility of these genome sequences is greatly enhanced when we have an understanding of how they are phylogenetically related to each other. Therefore, we here describe our efforts to reconstruct the phylogeny of all available bacterial and archaeal genomes. We identified 24, single-copy, ubiquitous genes suitable for this phylogenetic analysis. We used two approaches to combine the data for the 24 genes. First, we concatenated alignments of all genes into a single alignment from which a Maximum Likelihood (ML tree was inferred using RAxML. Second, we used a relatively new approach to combining gene data, Bayesian Concordance Analysis (BCA, as implemented in the BUCKy software, in which the results of 24 single-gene phylogenetic analyses are used to generate a "primary concordance" tree. A comparison of the concatenated ML tree and the primary concordance (BUCKy tree reveals that the two approaches give similar results, relative to a phylogenetic tree inferred from the 16S rRNA gene. After comparing the results and the methods used, we conclude that the current best approach for generating a single phylogenetic tree, suitable for use as a reference phylogeny for comparative analyses, is to perform a maximum likelihood analysis of a concatenated alignment of conserved, single-copy genes.

  6. Archaeal membrane-associated proteases: insights on Haloferax volcanii and other haloarchaea

    Directory of Open Access Journals (Sweden)

    Maria Ines Giménez

    2015-02-01

    Full Text Available The function of membrane proteases range from general house-keeping to regulation of cellular processes. Although the biological role of these enzymes in archaea is poorly understood, some of them are implicated in the biogenesis of the archaeal cell envelope and surface structures. The membrane-bound ATP-dependent Lon protease is essential for cell viability and affects membrane carotenoid content in Haloferax volcanii. At least two different proteases are needed in this archaeon to accomplish the posttranslational modifications of the S-layer glycoprotein. The rhomboid protease RhoII is involved in the N-glycosylation of the S-layer protein with a sulfoquinovose-containing oligosaccharide while archaeosortase ArtA mediates the proteolytic processing coupled-lipid modification of this glycoprotein facilitating its attachment to the archaeal cell surface. Interestingly, two different signal peptidase I homologs exist in H. volcanii, Sec11a and Sec11b, which likely play distinct physiological roles. Type IV prepilin peptidase PibD processes flagellin/pilin precursors, being essential for the biogenesis and function of the archaellum and other cell surface structures in H. volcanii.

  7. Ecological structuring of bacterial and archaeal taxa in surface ocean waters.

    Science.gov (United States)

    Yilmaz, Pelin; Iversen, Morten H; Hankeln, Wolfgang; Kottmann, Renzo; Quast, Christian; Glöckner, Frank O

    2012-08-01

    The Global Ocean Sampling (GOS) expedition is currently the largest and geographically most comprehensive metagenomic dataset, including samples from the Atlantic, Pacific, and Indian Oceans. This study makes use of the wide range of environmental conditions and habitats encompassed within the GOS sites in order to investigate the ecological structuring of bacterial and archaeal taxon ranks. Community structures based on taxonomically classified 16S ribosomal RNA (rRNA) gene fragments at phylum, class, order, family, and genus rank levels were examined using multivariate statistical analysis, and the results were inspected in the context of oceanographic environmental variables and structured habitat classifications. At all taxon rank levels, community structures of neritic, oceanic, estuarine biomes, as well as other exotic biomes (salt marsh, lake, mangrove), were readily distinguishable from each other. A strong structuring of the communities with chlorophyll a concentration and a weaker yet significant structuring with temperature and salinity were observed. Furthermore, there were significant correlations between community structures and habitat classification. These results were used for further investigation of one-to-one relationships between taxa and environment and provided indications for ecological preferences shaped by primary production for both cultured and uncultured bacterial and archaeal clades. PMID:22416918

  8. Geographic distribution of archaeal ammonia oxidizing ecotypes in the Atlantic Ocean

    Directory of Open Access Journals (Sweden)

    Eva eSintes

    2016-02-01

    Full Text Available In marine ecosystems, Thaumarchaeota are most likely the major ammonia oxidizers. While ammonia concentrations vary by about two orders of magnitude in the oceanic water column, archaeal ammonia oxidizers (AOA vary by only one order of magnitude from surface to bathypelagic waters. Thus, the question arises whether the key enzyme responsible for ammonia oxidation, ammonia monooxygenase (amo, exhibits different affinities to ammonia along the oceanic water column and consequently, whether there are different ecotypes of AOA present in the oceanic water column. We determined the abundance and phylogeny of archaeal ammonia oxidizers (AOA based on their amoA gene. Two ecotypes of AOA exhibited a distribution pattern reflecting the reported availability of ammonia and the physico-chemical conditions throughout the Atlantic, and from epi- to bathypelagic waters. The distinction between these two ecotypes was not only detectable at the nucleotide level. Consistent changes were also detected at the amino acid level. These changes include substitutions of polar to hydrophobic amino acid, and glycine substitutions that could have an effect on the configuration of the amo protein and thus, on its activity. Although we cannot identify the specific effect, the ratio of non-synonymous to synonymous substitutions (dN/dS between the two ecotypes indicates a strong positive selection between them. Consequently, our results point to a certain degree of environmental selection on these two ecotypes that have led to their niche specialization.

  9. Bacterial and archaeal dynamics in phylogeny and function in the North Atlantic deep waters

    Science.gov (United States)

    Herndl, G. J.; Brink, M.; Agogue, H.

    2009-04-01

    The diversity and specific functional aspects linked to the N cycle of the bacterio- and archaeoplankton were investigated in the major deep water masses of the North Atlantic following the main driver of the thermohaline circulation, the North Atlantic Deep Water, from 65°N to 5°S. The phylogenetic composition of Bacteria and Archaea is not only depth-dependent but, specific water masses harbor specific prokaryotic communities. The specific composition of these communities in a particular water mass is maintained even over large distances. The distribution of archaeal and bacterial amoA genes were also determined. Archaeal amoA copy numbers decreased drastically with depth especially in the eastern subtropical Atlantic. This coincides with the lower nutrient concentration of the deep waters in the southern parts of the North Atlantic and the older age of the deep-water masses there. These data demonstrate that the diversity and potential nitrification activity are closely linked to the hydrology and chemical characteristics of the major water masses in the North Atlantic.

  10. Archaeal Life on Tangkuban Perahu- Sampling and Culture Growth in Indonesian Laboratories

    Directory of Open Access Journals (Sweden)

    SRI HANDAYANI

    2012-09-01

    Full Text Available The aim of the expedition to Tangkuban Perahu, West Java was to obtain archaeal samples from the solfatara fields located in Domas crater. This was one of the places, where scientists from the University of Regensburg Germany had formerly isolated Indonesian archaea, especially Thermoplasma and Sulfolobus species but not fully characterized. We collected five samples from mud holes with temperatures from 57 to 88 oC and pH of 1.5-2. A portion of each sample was grown at the University of Regensburg in modified Allen’s medium at 80 oC. From four out of five samples enrichment cultures were obtained, autotrophically on elemental sulphur and heterotrophically on sulfur and yeast extract; electron micrographs are presented. In the laboratories of Universitas Indonesia the isolates were cultured at 55-60 oC in order to grow tetraetherlipid synthesizing archaea, both Thermoplasmatales and Sulfolobales. Here, we succeeded to culture the same type of archaeal cells, which had been cultured in Regensburg, probably a Sulfolobus species and in Freundt’s medium, Thermoplasma species. The harvested cells are documented by phase contrast microscope equipped with a digital camera. Our next steps will be to further characterize genetically the cultured cells from Tangkuban Perahu isolates.

  11. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    Science.gov (United States)

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane.

  12. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  13. Archaeal tetraether membrane lipid fluxes in the northeastern Pacific and the Arabian Sea: implications for TEX86 paleothermometry

    NARCIS (Netherlands)

    Wuchter, C.; Schouten, S.; Wakeham, S.G.; Sinninghe Damsté, J.S.

    2006-01-01

    The newly introduced temperature proxy, the tetraether index of archaeal lipids with 86 carbon atoms (TEX86), is based on the number of cyclopentane moieties in the glycerol dialkyl glycerol tetraether (GDGT) lipids of marine Crenarchaeota. The composition of sedimentary GDGTs used for TEX86 paleoth

  14. Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle

    DEFF Research Database (Denmark)

    Prangishvili, David; Vestergaard, Gisle Alberg; Häring, Monika;

    2006-01-01

    A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long...

  15. Spatial isolation and environmental factors drive distinct bacterial and archaeal communities in different types of petroleum reservoirs in China

    Science.gov (United States)

    Gao, Peike; Tian, Huimei; Wang, Yansen; Li, Yanshu; Li, Yan; Xie, Jinxia; Zeng, Bing; Zhou, Jiefang; Li, Guoqiang; Ma, Ting

    2016-02-01

    To investigate the spatial distribution of microbial communities and their drivers in petroleum reservoir environments, we performed pyrosequencing of microbial partial 16S rRNA, derived from 20 geographically separated water-flooding reservoirs, and two reservoirs that had not been flooded, in China. The results indicated that distinct underground microbial communities inhabited the different reservoirs. Compared with the bacteria, archaeal alpha-diversity was not strongly correlated with the environmental variables. The variation of the bacterial and archaeal community compositions was affected synthetically, by the mining patterns, spatial isolation, reservoir temperature, salinity and pH of the formation brine. The environmental factors explained 64.22% and 78.26% of the total variance for the bacterial and archaeal communities, respectively. Despite the diverse community compositions, shared populations (48 bacterial and 18 archaeal genera) were found and were dominant in most of the oilfields. Potential indigenous microorganisms, including Carboxydibrachium, Thermosinus, and Neptunomonas, were only detected in a reservoir that had not been flooded with water. This study indicates that: 1) the environmental variation drives distinct microbial communities in different reservoirs; 2) compared with the archaea, the bacterial communities were highly heterogeneous within and among the reservoirs; and 3) despite the community variation, some microorganisms are dominant in multiple petroleum reservoirs.

  16. Detection and analysis of elusive members of a novel and diverse archaeal community within a thermal spring streamer consortium.

    Science.gov (United States)

    Colman, Daniel R; Thomas, Raquela; Maas, Kendra R; Takacs-Vesbach, Cristina D

    2015-03-01

    Recent metagenomic analyses of Yellowstone National Park (YNP) thermal spring communities suggested the presence of minor archaeal populations that simultaneous PCR-based assays using traditional 'universal' 16S rRNA gene primers failed to detect. Here we use metagenomics to identify PCR primers effective at detecting elusive members of the Archaea, assess their efficacy, and describe the diverse and novel archaeal community from a circum-neutral thermal spring from the Bechler region of YNP. We determined that a less commonly used PCR primer, Arch349F, captured more diversity in this spring than the widely used A21F primer. A search of the PCR primers against the RDP 16S rRNA gene database indicated that Arch349F also captured the largest percentage of Archaea, including 41 % more than A21F. Pyrosequencing using the Arch349F primer recovered all of the phylotypes present in the clone-based portion of the study and the metagenome of this spring in addition to several other populations of Archaea, some of which are phylogenetically novel. In contrast to the lack of amplification with traditional 16S rRNA gene primers, our comprehensive analyses suggested a diverse archaeal community in the Bechler spring, with implications for recently discovered groups such as the Geoarchaeota and other undescribed archaeal groups.

  17. Archaeal ammonia oxidation in volcanic grassland soils of Iceland. Effects of elevated temperature and N availability on processes and organisms

    NARCIS (Netherlands)

    Daebeler, A.

    2014-01-01

    Thaumarchaea are recognized today as the most abundant and ubiquitously dis­tributed archaeal organisms, especially in the oceans and soil. Their phylogenetic placement as a phylum, the capability of all cultivated Thaumarchaea to oxidize ammonia for energy conservation as well as many further aspec

  18. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    NARCIS (Netherlands)

    Sintes, Eva; Bergauer, Kristin; De Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotype

  19. Forest strata drive spatial structure of bacterial and archaeal communities and microbial methane cycling in neotropical bromeliad wetlands

    Science.gov (United States)

    Martinson, Guntars; Brandt, Franziska; Conrad, Ralf

    2016-04-01

    Several thousands of tank bromeliads per hectare of neotropical forest create a unique wetland ecosystem that harbors diverse communities of archaea and bacteria and emit substantial amounts of methane. We studied spatial distribution of archaeal and bacterial communities, microbial methane cycling and their environmental drivers in tank bromeliad wetlands. We selected tank bromeliads of different species and functional types (terrestrial and canopy bromeliads) in a neotropical montane forest of Southern Ecuador and sampled the organic tank slurry. Archaeal and bacterial communities were characterized using terminal-restriction fragment length polymorphism (T-RFLP) and Illumina MiSeq sequencing, respectively, and linked with physico-chemical tank-slurry properties. Additionally, we performed tank-slurry incubations to measure methane production potential, stable carbon isotope fractionation and pathway of methane formation. Archaeal and bacterial community composition in bromeliad wetlands was dominated by methanogens and by Alphaproteobacteria, respectively, and did not differ between species but between functional types. Hydrogenotrophic Methanomicrobiales were the dominant methanogens among all bromeliads but the relative abundance of aceticlastic Methanosaetaceae increased in terrestrial bromeliads. Complementary, hydrogenotrophic methanogenesis was the dominant pathway of methane formation but the relative contribution of aceticlastic methanogenesis increased in terrestrial bromeliads and led to a concomitant increase in total methane production. Rhodospirillales were characteristic for canopy bromeliads, Planctomycetales and Actinomycetalis for terrestrial bromeliads. While nitrogen concentration and pH explained 32% of the archaeal community variability, 29% of the bacterial community variability was explained by nitrogen, acetate and propionate concentrations. Our study demonstrates that bromeliad functional types, associated with different forest strata

  20. Archaeal community in a human-disturbed watershed in southeast China: diversity, distribution, and responses to environmental changes.

    Science.gov (United States)

    Hu, Anyi; Wang, Hongjie; Li, Jiangwei; Liu, Jing; Chen, Nengwang; Yu, Chang-Ping

    2016-05-01

    The response of freshwater bacterial community to anthropogenic disturbance has been well documented, yet the studies of freshwater archaeal community are rare, especially in lotic environments. Here, we investigated planktonic and benthic archaeal communities in a human-perturbed watershed (Jiulong River Watershed, JRW) of southeast China by using Illumina 16S ribosomal RNA gene amplicon sequencing. The results of taxonomic assignments indicated that SAGMGC-1, Methanobacteriaceae, Methanospirillaceae, and Methanoregulaceae were the four most abundant families in surface waters, accounting for 12.65, 23.21, 18.58 and 10.97 % of planktonic communities, whereas Nitrososphaeraceae and Miscellaneous Crenarchaeotic Group occupied more than 49 % of benthic communities. The compositions of archaeal communities and populations in waters and sediments were significantly different from each other. Remarkably, the detection frequencies of families Methanobacteriaceae and Methanospirillaceae, and genera Methanobrevibacter and Methanosphaera in planktonic communities correlated strongly with bacterial fecal indicator, suggesting some parts of methanogenic Archaea may come from fecal contamination. Because soluble reactive phosphorus (SRP) and the ratio of dissolved inorganic nitrogen to SRP instead of nitrogen nutrients showed significant correlation with several planktonic Nitrosopumilus- and Nitrosotalea-like OTUs, Thaumarchaeota may play an unexplored role in biogeochemical cycling of river phosphorus. Multivariate statistical analyses revealed that the variation of α-diversity of planktonic archaeal community was best explained by water temperature, whereas nutrient concentrations and stoichiometry were the significant drivers of β-diversity of planktonic and benthic communities. Taken together, these results demonstrate that the structure of archaeal communities in the JRW is sensitive to anthropogenic disturbances caused by riparian human activities. PMID:26810199

  1. A study of archaeal enzymes involved in polar lipid synthesis linking amino acid sequence information, genomic contexts and lipid composition

    Directory of Open Access Journals (Sweden)

    Hiromi Daiyasu

    2005-01-01

    Full Text Available Cellular membrane lipids, of which phospholipids are the major constituents, form one of the characteristic features that distinguish Archaea from other organisms. In this study, we focused on the steps in archaeal phospholipid synthetic pathways that generate polar lipids such as archaetidylserine, archaetidylglycerol, and archaetidylinositol. Only archaetidylserine synthase (ASS, from Methanothermobacter thermautotrophicus, has been experimentally identified. Other enzymes have not been fully examined. Through database searching, we detected many archaeal hypothetical proteins that show sequence similarity to members of the CDP alcohol phosphatidyltransferase family, such as phosphatidylserine synthase (PSS, phosphatidylglycerol synthase (PGS and phosphatidylinositol synthase (PIS derived from Bacteria and Eukarya. The archaeal hypothetical proteins were classified into two groups, based on the sequence similarity. Members of the first group, including ASS from M. thermautotrophicus, were closely related to PSS. The rough agreement between PSS homologue distribution within Archaea and the experimentally identified distribution of archaetidylserine suggested that the hypothetical proteins are ASSs. We found that an open reading frame (ORF tends to be adjacent to that of ASS in the genome, and that the order of the two ORFs is conserved. The sequence similarity of phosphatidylserine decarboxylase to the product of the ORF next to the ASS gene, together with the genomic context conservation, suggests that the ORF encodes archaetidylserine decarboxylase, which may transform archaetidylserine to archaetidylethanolamine. The second group of archaeal hypothetical proteins was related to PGS and PIS. The members of this group were subjected to molecular phylogenetic analysis, together with PGSs and PISs and it was found that they formed two distinct clusters in the molecular phylogenetic tree. The distribution of members of each cluster within Archaea

  2. The influence of vegetation restoration on soil archaeal communities in Fuyun earthquake fault zone of Xinjiang%新疆富蕴地震断裂带植被恢复对土壤古菌群落的影响

    Institute of Scientific and Technical Information of China (English)

    林青; 曾军; 张涛; 马晶; 王重; 娄恺

    2013-01-01

    trend was the nutrients in most plants' rhizosphere soil was significantly ( P<0. 05 ) higher than control. Archaeal 16S rDNA fragments could be amplified only in the rhizosphere soils. The diversity indices (include richness, Shannon-Weiner index, Simpson index and evenness) were vary with different enzymes digestion. The similarities of archaeal communities calculated by the Sorensen formula were low among different rhizosphere soils and most numerous were in Geranium sibiricum's rhizosphere with 18 species and minimum were in Seriphidium nitrosum with 2 species. Crenarchaeota and Euryarchaeota were the main possible archaeal groups identified by MiCA ( Microbial Community Analysis) online analysis. Canonical correspondence analysis ( CCA) showed that soil organic matter, available phosphorus, total nitrogen and pH can significantly affect the archaeal communities. Especially soil organic matter had the greatest impact on the distribution of dominant archaeal groups (Hha Ⅰ digestion; r = 0. 94; Rsa I digestion; r = 0. 74) . Correlation analysis showed that soil available phosphorus content was positively correlated with all diversity indices of archaeal communities (P<0.05) , and total nitrogen content showed a significant positive correlation ( P<0. 05 ) to the evenness index in Hha I digestion. These results indicated that recovery of vegetation not only could affect archaeal communities' composition, structure and distribution in earthquake fault zone of Xinjiang, but also could improve the soil fertility and possible reasons were related to rhizosphere's chemical properties.%选取新疆富蕴地震断裂带8种次生植物根际土壤,以同土层裸地为对照,测量土壤化学性质,利用末端限制性片段长度多态性技术研究塌陷区次生植物对土壤古菌群落的影响.结果表明,多数植物根际土壤养分显著(P<0.05)高于对照,其主要古菌类群为泉古菌门(Crenarchaeota)和广古菌门(Euryarchaeota),群落间多样性

  3. The σ enigma: bacterial σ factors, archaeal TFB and eukaryotic TFIIB are homologs.

    Science.gov (United States)

    Burton, Samuel P; Burton, Zachary F

    2014-01-01

    Structural comparisons of initiating RNA polymerase complexes and structure-based amino acid sequence alignments of general transcription initiation factors (eukaryotic TFIIB, archaeal TFB and bacterial σ factors) show that these proteins are homologs. TFIIB and TFB each have two-five-helix cyclin-like repeats (CLRs) that include a C-terminal helix-turn-helix (HTH) motif (CLR/HTH domains). Four homologous HTH motifs are present in bacterial σ factors that are relics of CLR/HTH domains. Sequence similarities clarify models for σ factor and TFB/TFIIB evolution and function and suggest models for promoter evolution. Commitment to alternate modes for transcription initiation appears to be a major driver of the divergence of bacteria and archaea. PMID:25483602

  4. Biological Membranes in Extreme Conditions: Simulations of Anionic Archaeal Tetraether Lipid Membranes.

    Directory of Open Access Journals (Sweden)

    Luis Felipe Pineda De Castro

    Full Text Available In contrast to the majority of organisms that have cells bound by di-ester phospholipids, archaeal membranes consist of di- and tetraether phospholipids. Originating from organisms that withstand harsh conditions (e.g., low pH and a wide range of temperatures such membranes have physical properties that make them attractive materials for biological research and biotechnological applications. We developed force-field parameters based on the widely used Generalized Amber Force Field (GAFF to enable the study of anionic tetraether membranes of the model archaean Sulfolobus acidocaldarius by computer simulations. The simulations reveal that the physical properties of these unique membranes depend on the number of cyclopentane rings included in each lipid unit, and on the size of cations that are used to ensure charge neutrality. This suggests that the biophysical properties of Sulfolobus acidocaldarius cells depend not only on the compositions of their membranes but also on the media in which they grow.

  5. Archaeal Abundance across a pH Gradient in an Arable Soil and Its Relationship to Bacterial and Fungal Growth Rates

    OpenAIRE

    Bengtson, Per; Sterngren, Anna E.; Rousk, Johannes

    2012-01-01

    Soil pH is one of the most influential factors for the composition of bacterial and fungal communities, but the influence of soil pH on the distribution and composition of soil archaeal communities has yet to be systematically addressed. The primary aim of this study was to determine how total archaeal abundance (quantitative PCR [qPCR]-based estimates of 16S rRNA gene copy numbers) is related to soil pH across a pH gradient (pH 4.0 to 8.3). Secondarily, we wanted to assess how archaeal abund...

  6. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest.

    Science.gov (United States)

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2011-03-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees were monitored at bimonthly intervals through 16S rRNA gene-based terminal restriction fragment length polymorphism profiling and quantitative PCR analysis. Effects on nitrifying and denitrifying groups were assessed by measuring the abundances of nirS and nosZ genes as well as bacterial and archaeal amoA genes. Seasonal dynamics displayed by key phylogenetic and nitrogen (N) cycling functional groups were found to be tightly coupled with seasonal alterations in labile C and N pools as well as with variation in soil temperature and soil moisture. In particular, archaea and acidobacteria were highly responsive to soil nutritional and soil climatic changes associated with seasonality, indicating their high metabolic versatility and capability to adapt to environmental changes. For these phyla, significant interrelations with soil chemical and microbial process data were found suggesting their potential, but poorly described contribution to nitrification or denitrification in temperate forest soils. In conclusion, our extensive approach allowed us to get novel insights into effects of seasonality and resource availability on the microbial community, in particular on hitherto poorly studied bacterial phyla and functional groups.

  7. A novel type of replicative enzyme harbouring ATPase, primase and DNA polymerase activity

    Science.gov (United States)

    Lipps, Georg; Röther, Susanne; Hart, Christina; Krauss, Gerhard

    2003-01-01

    Although DNA replication is a process common in all domains of life, primase and replicative DNA polymerase appear to have evolved independently in the bacterial domain versus the archaeal/eukaryal branch of life. Here, we report on a new type of replication protein that constitutes the first member of the DNA polymerase family E. The protein ORF904, encoded by the plasmid pRN1 from the thermoacidophile archaeon Sulfolobus islandicus, is a highly compact multifunctional enzyme with ATPase, primase and DNA polymerase activity. Recombinant purified ORF904 hydrolyses ATP in a DNA-dependent manner. Deoxynucleotides are preferentially used for the synthesis of primers ∼8 nucleotides long. The DNA polymerase activity of ORF904 synthesizes replication products of up to several thousand nucleotides in length. The primase and DNA polymerase activity are located in the N-terminal half of the protein, which does not show homology to any known DNA polymerase or primase. ORF904 constitutes a new type of replication enzyme, which could have evolved indepen dently from the eubacterial and archaeal/eukaryal proteins of DNA replication. PMID:12743045

  8. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li;

    2014-01-01

    Replication factor C (RFC) is known to function in loading proliferating cell nuclear antigen (PCNA) onto primed DNA, allowing PCNA to tether DNA polymerase for highly processive DNA synthesis in eukaryotic and archaeal replication. In this report, we show that an RFC complex from the...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....... hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...

  9. Archaeal and bacterial tetraether lipids in tropical ponds with contrasted salinity (Guadeloupe, French West Indies): Implications for tetraether-based environmental proxies

    OpenAIRE

    Huguet, Arnaud; Grossi, Vincent; Belmahdi, Imène; Fosse, Céline; Derenne, Sylvie

    2015-01-01

    International audience The occurrence and distribution of archaeal and bacterial glycerol dialkyl glycerol tetraether lipids (GDGTs) in continental saline environments have been rarely investigated. Here, the abundance and distribution of archaeal isoprenoid GDGTs (iGDGTs) and archaeol, and of bacterial branched GDGTs (brGDGTs) in four tropical water ponds of contrasting salinity in two islands from the French Western Indies, Grande-Terre and La Désirade, have been determined. The sediment...

  10. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs

    OpenAIRE

    Frade, Pedro R.; Katharina Roll; Kristin Bergauer; Herndl, Gerhard J.

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP) and ...

  11. Responses of bacterial and archaeal communities to nitrate stimulation after oil pollution in mangrove sediment revealed by Illumina sequencing.

    Science.gov (United States)

    Wang, Lei; Huang, Xu; Zheng, Tian-Ling

    2016-08-15

    This study aimed to investigate microbial responses to nitrate stimulation in oiled mangrove mesocosm. Both supplementary oil and nitrate changed the water and sediment chemical properties contributing to the shift of microbial communities. Denitrifying genes nirS and nirK were increased several times by the interaction of oil spiking and nitrate addition. Bacterial chao1 was reduced by oil spiking and further by nitrate stimulation, whereas archaeal chao1 was only inhibited by oil pollution on early time. Sampling depth explained most of variation and significantly impacted bacterial and archaeal communities, while oil pollution only significantly impacted bacterial communities (pexplaining less variation, nitrate addition coupled with oil spiking enhanced the growth of hydrocarbon degraders in mangrove. The findings demonstrate the impacts of environmental factors and their interactions in shaping microbial communities during nitrate stimulation. Our study suggests introducing genera Desulfotignum and Marinobacter into oiled mangrove for bioaugmentation. PMID:27262497

  12. Responses of bacterial and archaeal communities to nitrate stimulation after oil pollution in mangrove sediment revealed by Illumina sequencing.

    Science.gov (United States)

    Wang, Lei; Huang, Xu; Zheng, Tian-Ling

    2016-08-15

    This study aimed to investigate microbial responses to nitrate stimulation in oiled mangrove mesocosm. Both supplementary oil and nitrate changed the water and sediment chemical properties contributing to the shift of microbial communities. Denitrifying genes nirS and nirK were increased several times by the interaction of oil spiking and nitrate addition. Bacterial chao1 was reduced by oil spiking and further by nitrate stimulation, whereas archaeal chao1 was only inhibited by oil pollution on early time. Sampling depth explained most of variation and significantly impacted bacterial and archaeal communities, while oil pollution only significantly impacted bacterial communities (poil spiking enhanced the growth of hydrocarbon degraders in mangrove. The findings demonstrate the impacts of environmental factors and their interactions in shaping microbial communities during nitrate stimulation. Our study suggests introducing genera Desulfotignum and Marinobacter into oiled mangrove for bioaugmentation.

  13. Crystal structure of the S. solfataricus archaeal exosome reveals conformational flexibility in the RNA-binding ring.

    Directory of Open Access Journals (Sweden)

    Changrui Lu

    Full Text Available BACKGROUND: The exosome complex is an essential RNA 3'-end processing and degradation machinery. In archaeal organisms, the exosome consists of a catalytic ring and an RNA-binding ring, both of which were previously reported to assume three-fold symmetry. METHODOLOGY/PRINCIPAL FINDINGS: Here we report an asymmetric 2.9 A Sulfolobus solfataricus archaeal exosome structure in which the three-fold symmetry is broken due to combined rigid body and thermal motions mainly within the RNA-binding ring. Since increased conformational flexibility was also observed in the RNA-binding ring of the related bacterial PNPase, we speculate that this may reflect an evolutionarily conserved mechanism to accommodate diverse RNA substrates for degradation. CONCLUSION/SIGNIFICANCE: This study clearly shows the dynamic structures within the RNA-binding domains, which provides additional insights on mechanism of asymmetric RNA binding and processing.

  14. Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition-induced artifacts

    Science.gov (United States)

    Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.

    1991-01-01

    A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.

  15. Non-extremophilic 'extremophiles' - Archaeal dominance in the subsurface and their implication for life

    Science.gov (United States)

    Reitschuler, Christoph; Lins, Philipp; Illmer, Paul

    2014-05-01

    Archaea - besides bacteria and eukaryota constituting the third big domain of life - were so far regarded as typical inhabitants of extreme environments, as indicated by the name (Archaeon, Greek: 'original', 'primal'). Previous research and cultivation successes were basically carried out in habitats characterized by extreme temperature, pH and salinity regimes. Such extreme conditions, as expected at the beginning of the Earth's evolution, are occasionally also prevalent on extraterrestrial planets and moons and make the Archaeal domain a key group to be studied concerning life's evolution and the most likely pioneer organisms to colonize environments that are regarded as hostile. However, in recent years it became obvious that Archaea, in particular non-extremophilic species, can be found almost ubiquitously in marine, freshwater, terrestrial and also subsurface habitats and occasionally outnumber other microbial domains and hold key positions in globally relevant energy and nutrient cycles. Besides extreme environments - the big question remains how to define a parameter as extreme - subsurface and cave environments present a window to the past, where adaptions to early life's conditions can be studied and how microbiomes may be structured in a habitat that represents a refugium on extraterrestrial celestial bodies, were surface conditions might be at first sight too extreme for life. The lower part of the alpine Hundsalm cave in Tyrol (Austria) offered a unique opportunity to study an almost pristine cave habitat, which is separated from the touristic part of the ice cave. The main focus of our research was laid on the microbial communities that were supposed to be in connection with secondary carbonate precipitations ('moonmilk'). For the ascertainment of these so far poorly evaluated structures a multiple approach assessment was chosen to generate a virtually complete picture of these subsurface microbiomes. Thereby, a combination of different cultivation

  16. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet

    2006-01-01

    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  17. Archaeal tetraether membrane lipid fluxes in the northeastern Pacific and the Arabian Sea: implications for TEX86 paleothermometry

    OpenAIRE

    Wuchter, C.; Schouten, S.; Wakeham, S.G.; Sinninghe Damsté, J.S.

    2006-01-01

    The newly introduced temperature proxy, the tetraether index of archaeal lipids with 86 carbon atoms (TEX86), is based on the number of cyclopentane moieties in the glycerol dialkyl glycerol tetraether (GDGT) lipids of marine Crenarchaeota. The composition of sedimentary GDGTs used for TEX86 paleothermometry is thought to reflect sea surface temperature (SST). However, marine Crenarchaeota occur ubiquitously in the world oceans over the entire depth range and not just in surface waters. We an...

  18. [Effects of long-term fertilization on bacterial and archaeal diversity and community structure within subtropical red paddy soils].

    Science.gov (United States)

    Yuan, Hong-zhao; Wu, Hao; Ge, Ti-da; Li, Ke-lin; Wu, Jin-shui; Wang, Jiu-rong

    2015-06-01

    Paddy soils not only function as an important sink for "missing carbon" but also play an important role in the production of greenhouse gases such as N2O and CH4. Dynamic changes in greenhouse gases in the atmosphere are closely related to microbially mediated carbon and nitrogen transformation processes occurring in soil. Using soil samples collected from a long-term fertilization experimental site in Taojiang County, subtropical China (established in 1986), we determined the effects of long-term (>25 years) non-fertilization (CK), chemical fertilization (NPK), and NPK combined with rice straw residues (NPKS) on soil bacterial and archaeal community structures. The 16S rRNA genotypes from the three differently treated soils were divided into 9 bacterial phylotypes, mainly including Proteobacteria, Acidobacteria, Chloroflexi, and archaea of Crenarchaeota and Euryarchaeota. The relative abundance of Proteobacteria, Acidobacteria and Crenarchaeota increased in the soils under NPK and NPKS treatments, with the increase being greater in the latter treatment. LUBSHUFF statistical analyses also demonstrated that there was significant difference among the microbial community compositions in CK-, NPK- and NPKS-treated soils. The abundance of bacterial and archaeal 16S rRNA genes ranged from 0.58 x 10(10) to 1.06 x 10(10) copies · g(-1) dry soil and from 1.16 x 10(6) to 1.72 x 10(6) copies · g(-1) dry soil, respectively. Application of fertilizers increased the bacterial and archaeal abundance and diversity in the treated soils, with NPKS > NPK. Long-term chemical and organic applications significantly affected the abundance, diversity and composition of bacterial and archaeal communities in paddy ecosystems. PMID:26572036

  19. Archaeal and bacterial community dynamics and bioprocess performance of a bench-scale two-stage anaerobic digester.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Garcia-Ruiz, Maria Jesus; Rodriguez-Sanchez, Alejandro; Osorio, Francisco; Gonzalez-Lopez, Jesus

    2016-07-01

    Two-stage technologies have been developed for anaerobic digestion of waste-activated sludge. In this study, the archaeal and bacterial community structure dynamics and bioprocess performance of a bench-scale two-stage anaerobic digester treating urban sewage sludge have been studied by the means of high-throughput sequencing techniques and physicochemical parameters such as pH, dried sludge, volatile dried sludge, acid concentration, alkalinity, and biogas generation. The coupled analyses of archaeal and bacterial communities and physicochemical parameters showed a direct relationship between archaeal and bacterial populations and bioprocess performance during start-up and working operation of a two-stage anaerobic digester. Moreover, results demonstrated that archaeal and bacterial community structure was affected by changes in the acid/alkalinity ratio in the bioprocess. Thus, a predominance of the acetoclastic methanogen Methanosaeta was observed in the methanogenic bioreactor at high-value acid/alkaline ratio, while a predominance of Methanomassilicoccaeceae archaea and Methanoculleus genus was observed in the methanogenic bioreactor at low-value acid/alkaline ratio. Biodiversity tag-iTag sequencing studies showed that methanogenic archaea can be also detected in the acidogenic bioreactor, although its biological activity was decreased after 4 months of operation as supported by physicochemical analyses. Also, studies of the VFA producers and VFA consumers microbial populations showed as these microbiota were directly affected by the physicochemical parameters generated in the bioreactors. We suggest that the results obtained in our study could be useful for future implementations of two-stage anaerobic digestion processes at both bench- and full-scale. PMID:26940050

  20. Similarities and Contrasts in the Archaeal Community of Two Japanese Mountains: Mt. Norikura Compared to Mt. Fuji.

    Science.gov (United States)

    Singh, Dharmesh; Takahashi, Koichi; Park, Jungok; Adams, Jonathan M

    2016-02-01

    The community ecology, abundance, and diversity patterns of soil archaea are poorly understood-despite the fact that they are a major branch of life that is ubiquitous and important in nitrogen cycling in terrestrial ecosystems. We set out to investigate the elevational patterns of archaeal ecology, and how these compare with other groups of organisms. Many studies of different groups of organisms (plants, birds, etc.) have shown a series of distinct communities with elevation, and often a diversity maximum in mid-elevations. We investigated the soil archaeal communities on Mt. Norikura, Japan, using 454 pyrosequencing of the 16S ribosomal RNA (rRNA) gene. There was a strong mid-elevation maximum in diversity, and a mid-elevation maximum in abundance of soil archaea 16S rRNA and amoA genes. These diversity and abundance maximums could not be correlated with any identifiable soil parameter, nor plant diversity. Discrete, predictable communities of archaea occurred at each elevational level, also not explicable in terms of pH or major nutrients. When we compared the archaeal community and diversity patterns with those found in an earlier study of Mt Fuji, both mountains showed mid-elevation maximums in diversity and abundance of archaea, possibly a result of some common environmental factor such as soil disturbance frequency. However, they showed distinct sets of archaeal communities at similar elevational sampling points. Presumably, the difference reflects their distinct geology (Norikura being andesitic, while Fuji is basaltic) and the resulting combinations of soil chemistry and environmental conditions, although no explanatory variable was found. Clearly, many soil archaea have strongly defined niches and will only occur in a narrow subset of the range of possible climate and soil conditions. The findings of a mid-elevation diversity maximum on Norikura provides a further instance of how widespread this unexplained pattern is in nature, in a wide variety of

  1. Seasonal Changes of Freshwater Ammonia-Oxidizing Archaeal Assemblages and Nitrogen Species in Oligotrophic Alpine Lakes▿ †

    OpenAIRE

    Auguet, Jean-Christophe; Nomokonova, Natalya; Camarero, Lluis; Casamayor, Emilio O.

    2011-01-01

    The annual changes in the composition and abundance of ammonia-oxidizing archaea (AOA) were analyzed monthly in surface waters of three high mountain lakes within the Limnological Observatory of the Pyrenees (LOOP; northeast Spain) using both 16S rRNA and functional (ammonia monooxygenase gene, amoA) gene sequencing as well as quantitative PCR amplification. The set of biological data was related to changes in nitrogen species and to other relevant environmental variables. The whole archaeal ...

  2. Quantitative and phylogenetic study of the Deep Sea Archaeal Group in sediments of the arctic mid-ocean spreading ridge

    Directory of Open Access Journals (Sweden)

    Steffen Leth eJørgensen

    2013-10-01

    Full Text Available In marine sediments archaea often constitute a considerable part of the microbial community, of which the Deep Sea Archaeal Group (DSAG is one of the most predominant. Despite their high abundance no members from this archaeal group have so far been characterized and thus their metabolism is unknown. Here we show that the relative abundance of DSAG marker genes can be correlated with geochemical parameters, allowing prediction of both the potential electron donors and acceptors of these organisms. We estimated the abundance of 16S rRNA genes from Archaea, Bacteria and DSAG in 52 sediment horizons from two cores collected at the slow-spreading Arctic Mid-Ocean Ridge, using qPCR. The results indicate that members of the DSAG make up the entire archaeal population in certain horizons and constitute up to ~ 50% of the total microbial community. The quantitative data were correlated to 30 different geophysical and geochemical parameters obtained from the same sediment horizons. We observed a significant correlation between the relative abundance of DSAG 16S rRNA genes and the content of organic carbon (p < 0.0001. Further, significant co-variation with iron oxide, and dissolved iron and manganese (all p < 0.0000, indicated a direct or indirect link to iron and manganese cycling. Neither of these parameters correlated with the relative abundance of archaeal or bacterial 16S rRNA genes, nor did any other major electron donor or acceptor measured. Phylogenetic analysis of DSAG 16S rRNA gene sequences reveals three monophyletic lineages with no apparent habitat-specific distribution. In this study we support the hypothesis that members of the DSAG are tightly linked to the content of organic carbon and directly or indirectly involved in the cycling of iron and/or manganese compounds. Further, we provide a molecular tool to assess their abundance in environmental samples and enrichment cultures.

  3. Insights into archaeal evolution and symbiosis from the genomes of a Nanoarchaeon and its crenarchaeal host from Yellowstone National Park

    Energy Technology Data Exchange (ETDEWEB)

    Podar, Mircea [ORNL; Graham, David E [ORNL; Reysenbach, Anna-Louise [Portland State University; Koonin, Eugene [National Center for Biotechnology Information; Wolf, Yuri [National Center for Biotechnology Information; Makarova, Kira S. [National Center for Biotechnology Information

    2013-01-01

    A hyperthemophilic member of the Nanoarchaeota from Obsidian Pool, a thermal feature in Yellowstone National Park was characterized using single cell isolation and sequencing, together with its putative host, a Sulfolobales archaeon. This first representative of a non-marine Nanoarchaeota (Nst1) resembles Nanoarchaeum equitans by lacking most biosynthetic capabilities, the two forming a deep-branching archaeal lineage. However, the Nst1 genome is over 20% larger, encodes a complete gluconeogenesis pathway and a full complement of archaeal flagellum proteins. Comparison of the two genomes suggests that the marine and terrestrial Nanoarchaeota lineages share a common ancestor that was already a symbiont of another archaeon. With a larger genome, a smaller repertoire of split protein encoding genes and no split non-contiguous tRNAs, Nst1 appears to have experienced less severe genome reduction than N. equitans. The inferred host of Nst1 is potentially autotrophic, with a streamlined genome and simplified central and energetic metabolism as compared to other Sulfolobales. The two distinct Nanoarchaeota-host genomic data sets offer insights into the evolution of archaeal symbiosis and parasitism and will further enable studies of the cellular and molecular mechanisms of these relationships.

  4. Archaeal diversity and abundance within different layers of summer sea-ice and seawater from Prydz Bay, Antarctica

    Institute of Scientific and Technical Information of China (English)

    MA Jifei; DU Zongjun; LUO Wei; YU Yong; ZENG Yixin; CHEN Bo; LI Huirong

    2014-01-01

    Fluorescence in-situ hybridization (FISH) and 16S rRNA gene clone library analyses were used to determine the abundance and diversity of archaea in Prydz Bay, Antarctica. Correlation analysis was also performed to assess links between physicochemical parameters and archaeal abundance and diversity within the sea-ice. Samples of sea-ice and seawater were collected during the 26th Chinese National Antarctic Research Expedition. The results of FISH showed that archaea were relatively abundant within the top layer of the sea-ice, and correlation analysis suggested that the concentration of 4NH+ might be one of the main factors underlying this distribution pattern. However, using 16S rRNA gene libraries, archaea were not detected in the top and middle layers of the sea-ice. All archaeal clones obtained from the bottom layer of the sea-ice were grouped into the Marine Group I Crenarchaeota while the archaeal clones from seawater were assigned to Marine Group I Crenarchaeota, Marine Group II Euryarchaeota, and Marine Group III Euryarchaeota. Overall, the ifndings of this study showed that the diversity of archaea in the sea-ice in Prydz Bay was low.

  5. Biosynthesis of ribose-5-phosphate and erythrose-4-phosphate in archaea: a phylogenetic analysis of archaeal genomes

    Directory of Open Access Journals (Sweden)

    Tim Soderberg

    2005-01-01

    Full Text Available A phylogenetic analysis of the genes encoding enzymes in the pentose phosphate pathway (PPP, the ribulose monophosphate (RuMP pathway, and the chorismate pathway of aromatic amino acid biosynthesis, employing data from 13 complete archaeal genomes, provides a potential explanation for the enigmatic phylogenetic patterns of the PPP genes in archaea. Genomic and biochemical evidence suggests that three archaeal species (Methanocaldococcus jannaschii, Thermoplasma acidophilum and Thermoplasma volcanium produce ribose-5-phosphate via the nonoxidative PPP (NOPPP, whereas nine species apparently lack an NOPPP but may employ a reverse RuMP pathway for pentose synthesis. One species (Halobacterium sp. NRC-1 lacks both the NOPPP and the RuMP pathway but may possess a modified oxidative PPP (OPPP, the details of which are not yet known. The presence of transketolase in several archaeal species that are missing the other two NOPPP genes can be explained by the existence of differing requirements for erythrose-4-phosphate (E4P among archaea: six species use transketolase to make E4P as a precursor to aromatic amino acids, six species apparently have an alternate biosynthetic pathway and may not require the ability to make E4P, and one species (Pyrococcus horikoshii probably does not synthesize aromatic amino acids at all.

  6. Divergent responses of methanogenic archaeal communities in two rice cultivars to elevated ground-level O3.

    Science.gov (United States)

    Zhang, Jianwei; Tang, Haoye; Zhu, Jianguo; Lin, Xiangui; Feng, Youzhi

    2016-06-01

    Inhibitive effect of elevated ground-level ozone (O3) on paddy methane (CH4) emission varies with rice cultivars. However, little information is available on its microbial mechanism. For this purpose, the responses of methane-metabolizing microorganisms, methanogenic archaea and methanotrophic bacteria to O3 pollution were investigated in the O3-tolerant (YD6) and the O3-sensitive (IIY084) cultivars at two rice growth stages in Free Air Concentration Elevation of O3 (O3-FACE) system of China. It was found that O3 pollution didn't change the abundances of Type I and Type II methanotrophic bacteria at two rice stages. For methanogenic archaea, their abundances in both cultivars were decreased by O3 pollution at the tillering stage. Furthermore, a greater negative influence on methanogenic archaeal community was observed on IIY084 than on YD6: at tillering stage, the alpha diversity indices of methanogenic archaeal community in IIY084 was decreased to a greater extent than in YD6; IIY084 shifted methanogenic archaeal community composition and decreased the abundances and the diversities of Methanosarcinaceae and Methanosaetaceae as well as the abundance of Methanomicrobiales, while the diversity of Methanocellaceae were increased in YD6. These findings indicate that the variations in the responses of paddy CH4 emission to O3 pollution between cultivars could result from the divergent responses of their methanogenic archaea. PMID:26895536

  7. A role for archaeal organisms in development of atherosclerotic vulnerable plaques and myxoid matrices Um papel para organismos de arqueia no desenvolvimento de placas ateroscleróticas vulner��veis e matriz mixomatosa

    Directory of Open Access Journals (Sweden)

    Maria L Higuchi

    2006-10-01

    Full Text Available PURPOSE: Vulnerable plaques are characterized by a myxoid matrix, necrotic lipidic core, reactive oxygen species, and high levels of microorganisms. Aerobic microbes such as Chlamydophila pneumoniae and Mycoplasma pneumoniae usually do not survive in oxidative stress media. Archaea are anaerobic microbes with powerful anti-oxidative enzymes that allow detoxification of free radicals whose presence might favor the survival of aerobic microorganisms. We searched for archaeal organisms in vulnerable plaques, and possible associations with myxoid matrix, chlamydia, and mycoplasma bodies. METHODS: Twenty-nine tissue samples from 13 coronary artherectomies from large excentric ostial or bifurcational lesions were studied using optical and electron microscopy. Infectious agents compatible with archaea, chlamydia, and mycoplasma were semiquantified using electron micrographs and correlated with the amounts of fibromuscular tissue, myxoid matrix, and foam cells, as determined from semi-thin sections. Six of the cases were also submitted to polymerase chain reaction with archaeal primers. RESULTS: All 13 specimens showed archaeal-compatible structures and chlamydial and mycoplasmal bodies in at least 1 sample. There was a positive correlation between extent of the of myxoid matrix and archaeal bodies (r = 0.44, P = 0.02; between archaeal and mycoplasmal bodies (r = 0.41, P = 0.03, and between chlamydial bodies and foam cells (r = 0.42; P = 0.03. The PCR test was positive for archaeal DNA in 4 of the 6 fragments. DISCUSSION: DNA and forms suggestive of archaea are present in vulnerable plaques and may have a fundamental role in the proliferation of mycoplasma and chlamydia. This seems to be the first description of apparently pathogenic archaea in human internal organ lesions.PROPOSTA: Placas vulneráveis são caracterizadas por matriz mixomatosa, centro lipídico necrótico, espécies reativas de oxigênio e alto níveis de microorganismos. Micróbios aer

  8. Genome wide DNA methylation analysis of Haloferax volcanii H26 and identification of DNA methyltransferase related PD-(D/EXK nuclease family protein HVO_A0006

    Directory of Open Access Journals (Sweden)

    Matthew eOuellette

    2015-04-01

    Full Text Available Restriction-modification (RM systems have evolved to protect the cell from invading DNAs and are composed of two enzymes: a DNA methyltransferase and a restriction endonuclease. Although RM systems are present in both archaeal and bacterial genomes, DNA methylation in archaea has not been well defined. In order to characterize the function of RM systems in archaeal species, we have made use of the model haloarchaeon Haloferax volcanii. A genomic DNA methylation analysis of H. volcanii strain H26 was performed using PacBio single molecule real-time (SMRT sequencing. This analysis was also performed on a strain of H. volcanii in which an annotated DNA methyltransferase gene HVO_A0006 was deleted from the genome. Sequence analysis of H26 revealed two motifs which are modified in the genome: Cm4TAG and GCAm6BN6VTGC. Analysis of the ∆HVO_A0006 strain indicated that it exhibited reduced adenine methylation compared to the parental strain and altered the detected adenine motif. However, protein domain architecture analysis and amino acid alignments revealed that HVO_A0006 is homologous only to the N-terminal endonuclease region of Type IIG RM proteins and contains a PD-(D/EXK nuclease motif, suggesting that HVO_A0006 is a PD-(D/EXK nuclease family protein. Further bioinformatic analysis of the HVO_A0006 gene demonstrating that the gene is rare among the Halobacteria. It is surrounded by two transposition genes suggesting that HVO_A0006 is a fragment of a Type IIG RM gene, which has likely been acquired through gene transfer, and affects restriction-modification activity by interacting with another RM system component(s. Here, we present the first genome-wide characterization of DNA methylation in an archaeal species and examine the function of a DNA methyltransferase related gene HVO_A0006.

  9. Plant nitrogen-use strategy as a driver of rhizosphere archaeal and bacterial ammonia oxidiser abundance.

    Science.gov (United States)

    Thion, Cécile E; Poirel, Jessica D; Cornulier, Thomas; De Vries, Franciska T; Bardgett, Richard D; Prosser, James I

    2016-07-01

    The influence of plants on archaeal (AOA) and bacterial (AOB) ammonia oxidisers (AO) is poorly understood. Higher microbial activity in the rhizosphere, including organic nitrogen (N) mineralisation, may stimulate both groups, while ammonia uptake by plants may favour AOA, considered to prefer lower ammonia concentration. We therefore hypothesised (i) higher AOA and AOB abundances in the rhizosphere than bulk soil and (ii) that AOA are favoured over AOB in the rhizosphere of plants with an exploitative strategy and high N demand, especially (iii) during early growth, when plant N uptake is higher. These hypotheses were tested by growing 20 grassland plants, covering a spectrum of resource-use strategies, and determining AOA and AOB amoA gene abundances, rhizosphere and bulk soil characteristics and plant functional traits. Joint Bayesian mixed models indicated no increase in AO in the rhizosphere, but revealed that AOA were more abundant in the rhizosphere of exploitative plants, mostly grasses, and less abundant under conservative plants. In contrast, AOB abundance in the rhizosphere and bulk soil depended on pH, rather than plant traits. These findings provide a mechanistic basis for plant-ammonia oxidiser interactions and for links between plant functional traits and ammonia oxidiser ecology.

  10. Cooperative adsorption of critical metal ions using archaeal poly-γ-glutamate.

    Science.gov (United States)

    Hakumai, Yuichi; Oike, Shota; Shibata, Yuka; Ashiuchi, Makoto

    2016-06-01

    Antimony, beryllium, chromium, cobalt (Co), gallium (Ga), germanium, indium (In), lithium, niobium, tantalum, the platinoids, the rare-earth elements (including dysprosium, Dy), and tungsten are generally regarded to be critical (rare) metals, and the ions of some of these metals are stabilized in acidic solutions. We examined the adsorption capacities of three water-soluble functional polymers, namely archaeal poly-γ-glutamate (L-PGA), polyacrylate (PAC), and polyvinyl alcohol (PVA), for six valuable metal ions (Co(2+), Ni(2+), Mn(2+), Ga(3+), In(3+), and Dy(3+)). All three polymers showed apparently little or no capacity for divalent cations, whereas L-PGA and PAC showed the potential to adsorb trivalent cations, implying the beneficial valence-dependent selectivity of anionic polyelectrolytes with multiple carboxylates for metal ions. PVA did not adsorb metal ions, indicating that the crucial role played by carboxyl groups in the adsorption of crucial metal ions cannot be replaced by hydroxyl groups under the conditions. In addition, equilibrium studies using the non-ideal competitive adsorption model indicated that the potential for L-PGA to be used for the removal (or collection) of water-soluble critical metal ions (e.g., Ga(3+), In(3+), and Dy(3+)) was far superior to that of any other industrially-versatile PAC materials. PMID:27013333

  11. Archaeal enrichment in the hypoxic zone in the northern Gulf of Mexico.

    Science.gov (United States)

    Gillies, Lauren E; Thrash, J Cameron; deRada, Sergio; Rabalais, Nancy N; Mason, Olivia U

    2015-10-01

    Areas of low oxygen have spread exponentially over the past 40 years, and are cited as a key stressor on coastal ecosystems. The world's second largest coastal hypoxic (≤ 2 mg of O2 l(-1)) zone occurs annually in the northern Gulf of Mexico. The net effect of hypoxia is the diversion of energy flow away from higher trophic levels to microorganisms. This energy shunt is consequential to the overall productivity of hypoxic water masses and the ecosystem as a whole. In this study, water column samples were collected at 39 sites in the nGOM, 21 of which were hypoxic. Analysis of the microbial community along a hypoxic to oxic dissolved oxygen gradient revealed that the relative abundance (iTag) of Thaumarchaeota species 16S rRNA genes (> 40% of the microbial community in some hypoxic samples), the absolute abundance (quantitative polymerase chain reaction; qPCR) of Thaumarchaeota 16S rRNA genes and archaeal ammonia-monooxygenase gene copy number (qPCR) were significantly higher in hypoxic samples. Spatial interpolation of the microbial and chemical data revealed a continuous, shelfwide band of low dissolved oxygen waters that were dominated by Thaumarchaeota (and Euryarchaeota), amoA genes and high concentrations of phosphate in the nGOM, thus implicating physicochemical forcing on microbial abundance. PMID:25818237

  12. Plant nitrogen-use strategy as a driver of rhizosphere archaeal and bacterial ammonia oxidiser abundance.

    Science.gov (United States)

    Thion, Cécile E; Poirel, Jessica D; Cornulier, Thomas; De Vries, Franciska T; Bardgett, Richard D; Prosser, James I

    2016-07-01

    The influence of plants on archaeal (AOA) and bacterial (AOB) ammonia oxidisers (AO) is poorly understood. Higher microbial activity in the rhizosphere, including organic nitrogen (N) mineralisation, may stimulate both groups, while ammonia uptake by plants may favour AOA, considered to prefer lower ammonia concentration. We therefore hypothesised (i) higher AOA and AOB abundances in the rhizosphere than bulk soil and (ii) that AOA are favoured over AOB in the rhizosphere of plants with an exploitative strategy and high N demand, especially (iii) during early growth, when plant N uptake is higher. These hypotheses were tested by growing 20 grassland plants, covering a spectrum of resource-use strategies, and determining AOA and AOB amoA gene abundances, rhizosphere and bulk soil characteristics and plant functional traits. Joint Bayesian mixed models indicated no increase in AO in the rhizosphere, but revealed that AOA were more abundant in the rhizosphere of exploitative plants, mostly grasses, and less abundant under conservative plants. In contrast, AOB abundance in the rhizosphere and bulk soil depended on pH, rather than plant traits. These findings provide a mechanistic basis for plant-ammonia oxidiser interactions and for links between plant functional traits and ammonia oxidiser ecology. PMID:27130939

  13. Geographic Distribution of Archaeal Ammonia Oxidizing Ecotypes in the Atlantic Ocean.

    Science.gov (United States)

    Sintes, Eva; De Corte, Daniele; Haberleitner, Elisabeth; Herndl, Gerhard J

    2016-01-01

    In marine ecosystems, Thaumarchaeota are most likely the major ammonia oxidizers. While ammonia concentrations vary by about two orders of magnitude in the oceanic water column, archaeal ammonia oxidizers (AOA) vary by only one order of magnitude from surface to bathypelagic waters. Thus, the question arises whether the key enzyme responsible for ammonia oxidation, ammonia monooxygenase (amo), exhibits different affinities to ammonia along the oceanic water column and consequently, whether there are different ecotypes of AOA present in the oceanic water column. We determined the abundance and phylogeny of AOA based on their amoA gene. Two ecotypes of AOA exhibited a distribution pattern reflecting the reported availability of ammonia and the physico-chemical conditions throughout the Atlantic, and from epi- to bathypelagic waters. The distinction between these two ecotypes was not only detectable at the nucleotide level. Consistent changes were also detected at the amino acid level. These changes include substitutions of polar to hydrophobic amino acid, and glycine substitutions that could have an effect on the configuration of the amo protein and thus, on its activity. Although we cannot identify the specific effect, the ratio of non-synonymous to synonymous substitutions (dN/dS) between the two ecotypes indicates a strong positive selection between them. Consequently, our results point to a certain degree of environmental selection on these two ecotypes that have led to their niche specialization. PMID:26903961

  14. Potential radiocarbon chronology tool using archaeal tetraether lipids for the western Arctic Ocean sediment

    Science.gov (United States)

    Uchida, M.; Kondo, M.; Utsumi, M.; Shibata, Y.

    2011-12-01

    The Arctic Ocean plays a major role in global climate changes by changing global energy balance through ice-albedo feedback and by affecting the oceanic thermohaline circulation through the water exchange with the Atlantic and Pacific Ocean. For future prediction of those changes in Arctic Ocean it is necessary to reconstruct details of past climate history with accurate age model. However, it is not easy to make age model of sediment cores covering late Pleistocene-Holocene transition including global abrupt climate change because preservation of carbonate fossil such as planktonic foraminifera is very limited. In the glacial time, foraminifera is almost barren. Thus, so far climate history in the Arctic Ocean environment is poorly understood. For these reasons, we are looking for alternative chronological target instead of foraminifera. In this study, radiocarbon contents of archaeal glycerol dibiphytanyl glycerol tetraether lipids (GDGTs) from Arctic surface sediments, which is also used for paleothermometry, were measured and compared with those of dissolved inorganic carbon (DIC) of sea water, planktonic and benthic foraminifera, shell, and bulk organic matter in the same horizons. We will discuss potential as chronology using the GDGTs and carbon sources of these compounds.

  15. Rapid fold and structure determination of the archaeal translation elongation factor 1β from Methanobacterium thermoautotrophicum

    International Nuclear Information System (INIS)

    The tertiary fold of the elongation factor, aEF-1β, from Methanobacterium thermoautotrophicum was determined in a high-throughput fashion using a minimal set of NMR experiments. NMR secondary structure prediction, deuterium exchange experiments and the analysis of chemical shift perturbations were combined to identify the protein fold as an alpha-beta sandwich typical of many RNA binding proteins including EF-G. Following resolution of the tertiary fold, a high resolution structure of aEF-1β was determined using heteronuclear and homonuclear NMR experiments and a semi-automated NOESY assignment strategy. Analysis of the aEF-1β structure revealed close similarity to its human analogue, eEF-1β. In agreement with studies on EF-Ts and human EF-1β, a functional mechanism for nucleotide exchange is proposed wherein Phe46 on an exposed loop acts as a lever to eject GDP from the associated elongation factor G-protein, aEF-1α. aEF-1β was also found to bind calcium in the groove between helix α2 and strand β4. This novel feature was not observed previously and may serve a structural function related to protein stability or may play a functional role in archaeal protein translation

  16. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Directory of Open Access Journals (Sweden)

    Pedro R Frade

    Full Text Available Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%. About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater, host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity.

  17. Archaeal and Bacterial Communities Associated with the Surface Mucus of Caribbean Corals Differ in Their Degree of Host Specificity and Community Turnover Over Reefs.

    Science.gov (United States)

    Frade, Pedro R; Roll, Katharina; Bergauer, Kristin; Herndl, Gerhard J

    2016-01-01

    Comparative studies on the distribution of archaeal versus bacterial communities associated with the surface mucus layer of corals have rarely taken place. It has therefore remained enigmatic whether mucus-associated archaeal and bacterial communities exhibit a similar specificity towards coral hosts and whether they vary in the same fashion over spatial gradients and between reef locations. We used microbial community profiling (terminal-restriction fragment length polymorphism, T-RFLP) and clone library sequencing of the 16S rRNA gene to compare the diversity and community structure of dominant archaeal and bacterial communities associating with the mucus of three common reef-building coral species (Porites astreoides, Siderastrea siderea and Orbicella annularis) over different spatial scales on a Caribbean fringing reef. Sampling locations included three reef sites, three reef patches within each site and two depths. Reference sediment samples and ambient water were also taken for each of the 18 sampling locations resulting in a total of 239 samples. While only 41% of the bacterial operational taxonomic units (OTUs) characterized by T-RFLP were shared between mucus and the ambient water or sediment, for archaeal OTUs this percentage was 2-fold higher (78%). About half of the mucus-associated OTUs (44% and 58% of bacterial and archaeal OTUs, respectively) were shared between the three coral species. Our multivariate statistical analysis (ANOSIM, PERMANOVA and CCA) showed that while the bacterial community composition was determined by habitat (mucus, sediment or seawater), host coral species, location and spatial distance, the archaeal community composition was solely determined by the habitat. This study highlights that mucus-associated archaeal and bacterial communities differ in their degree of community turnover over reefs and in their host-specificity. PMID:26788724

  18. Cleaving DNA with DNA

    Science.gov (United States)

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-03-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

  19. CoBaltDB: Complete bacterial and archaeal orfeomes subcellular localization database and associated resources

    Directory of Open Access Journals (Sweden)

    Lucchetti-Miganeh Céline

    2010-03-01

    Full Text Available Abstract Background The functions of proteins are strongly related to their localization in cell compartments (for example the cytoplasm or membranes but the experimental determination of the sub-cellular localization of proteomes is laborious and expensive. A fast and low-cost alternative approach is in silico prediction, based on features of the protein primary sequences. However, biologists are confronted with a very large number of computational tools that use different methods that address various localization features with diverse specificities and sensitivities. As a result, exploiting these computer resources to predict protein localization accurately involves querying all tools and comparing every prediction output; this is a painstaking task. Therefore, we developed a comprehensive database, called CoBaltDB, that gathers all prediction outputs concerning complete prokaryotic proteomes. Description The current version of CoBaltDB integrates the results of 43 localization predictors for 784 complete bacterial and archaeal proteomes (2.548.292 proteins in total. CoBaltDB supplies a simple user-friendly interface for retrieving and exploring relevant information about predicted features (such as signal peptide cleavage sites and transmembrane segments. Data are organized into three work-sets ("specialized tools", "meta-tools" and "additional tools". The database can be queried using the organism name, a locus tag or a list of locus tags and may be browsed using numerous graphical and text displays. Conclusions With its new functionalities, CoBaltDB is a novel powerful platform that provides easy access to the results of multiple localization tools and support for predicting prokaryotic protein localizations with higher confidence than previously possible. CoBaltDB is available at http://www.umr6026.univ-rennes1.fr/english/home/research/basic/software/cobalten.

  20. Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands.

    Science.gov (United States)

    Hartmann, Martin; Lee, Sangwon; Hallam, Steven J; Mohn, William W

    2009-12-01

    Disturbances caused by timber harvesting have critical long-term effects on the forest soil microbiota and alter fundamental ecosystem services provided by these communities. This study assessed the effects of organic matter removal and soil compaction on microbial community structures in different soil horizons 13 years after timber harvesting at the long-term soil productivity site at Skulow Lake, British Columbia. A harvested stand was compared with an unmanaged forest stand. Ribosomal intergenic spacer profiles of bacteria, archaea and eukarya indicated significantly different community structures in the upper three soil horizons of the two stands, with differences decreasing with depth. Large-scale sequencing of the ribosomal intergenic spacers coupled to small-subunit ribosomal RNA genes allowed taxonomic identification of major microbial phylotypes affected by harvesting or varying among soil horizons. Actinobacteria and Gemmatimonadetes were the predominant phylotypes in the bacterial profiles, with the relative abundance of these groups highest in the unmanaged stand, particularly in the deeper soil horizons. Predominant eukaryal phylotypes were mainly assigned to known mycorrhizal and saprotrophic species of Basidiomycetes and Ascomycetes. Harvesting affected Basidiomycetes to a minor degree but had stronger effects on some Ascomycetes. Archaeal profiles had low diversity with only a few predominant crenarchaeal phylotypes whose abundance appeared to increase with depth. Detection of these effects 13 years after harvesting may indicate a long-term change in processes mediated by the microbial community with important consequences for forest productivity. These effects warrant more comprehensive investigation of the effects of harvesting on the structure of forest soil microbial communities and the functional consequences. PMID:19659501

  1. Biochemical characterisation of LigN, an NAD+-dependent DNA ligase from the halophilic euryarchaeon Haloferax volcanii that displays maximal in vitro activity at high salt concentrations

    DEFF Research Database (Denmark)

    Poidevin, L.; MacNeill, S. A.

    2006-01-01

    Background DNA ligases are required for DNA strand joining in all forms of cellular life. NAD+-dependent DNA ligases are found primarily in eubacteria but also in some eukaryotic viruses, bacteriophage and archaea. Among the archaeal NAD+-dependent DNA ligases is the LigN enzyme of the halophilic...... assays using ¿ DNA restriction fragments with 12 bp cos cohesive ends were used to show that LigN activity was dependent on addition of divalent cations and salt. No activity was detected in the absence of KCl, whereas maximum activity could be detected at 3.2 M KCl, close to the intracellular KCl...

  2. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park.

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M; Fields, Matthew W

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  3. Archaeal and anaerobic methane oxidizer communities in the Sonora Margin cold seeps, Guaymas Basin (Gulf of California).

    Science.gov (United States)

    Vigneron, Adrien; Cruaud, Perrine; Pignet, Patricia; Caprais, Jean-Claude; Cambon-Bonavita, Marie-Anne; Godfroy, Anne; Toffin, Laurent

    2013-08-01

    Cold seeps, located along the Sonora Margin transform fault in the Guaymas Basin, were extensively explored during the 'BIG' cruise in June 2010. They present a seafloor mosaic pattern consisting of different faunal assemblages and microbial mats. To investigate this mostly unknown cold and hydrocarbon-rich environment, geochemical and microbiological surveys of the sediments underlying two microbial mats and a surrounding macrofaunal habitat were analyzed in detail. The geochemical measurements suggest biogenic methane production and local advective sulfate-rich fluxes in the sediments. The distributions of archaeal communities, particularly those involved in the methane cycle, were investigated at different depths (surface to 18 cm below the sea floor (cmbsf)) using complementary molecular approaches, such as Automated method of Ribosomal Intergenic Spacer Analysis (ARISA), 16S rRNA libraries, fluorescence in situ hybridization and quantitative polymerase chain reaction with new specific primer sets targeting methanogenic and anaerobic methanotrophic lineages. Molecular results indicate that metabolically active archaeal communities were dominated by known clades of anaerobic methane oxidizers (archaeal anaerobic methanotroph (ANME)-1, -2 and -3), including a novel 'ANME-2c Sonora' lineage. ANME-2c were found to be dominant, metabolically active and physically associated with syntrophic Bacteria in sulfate-rich shallow sediment layers. In contrast, ANME-1 were more prevalent in the deepest sediment samples and presented a versatile behavior in terms of syntrophic association, depending on the sulfate concentration. ANME-3 were concentrated in small aggregates without bacterial partners in a restricted sediment horizon below the first centimetres. These niche specificities and syntrophic behaviors, depending on biological surface assemblages and environmental availability of electron donors, acceptors and carbon substrates, suggest that ANME could support

  4. Controls on bacterial and archaeal community structure and greenhouse gas production in natural, mined, and restored Canadian peatlands

    Directory of Open Access Journals (Sweden)

    Nathan eBasiliko

    2013-07-01

    Full Text Available Northern peatlands are important global C reservoirs, largely because of their slow rates of microbial C mineralization. Particularly in sites that are heavily influenced by anthropogenic disturbances, there is scant information about microbial ecology and whether or not microbial community structure influences greenhouse gas production. This work characterized communities of bacteria and archaea using terminal restriction fragment length polymorphism and sequence analysis of 16S rRNA and functional genes across eight natural, mined, or restored peatlands in two locations in eastern Canada. Correlations were explored among chemical properties of peat, bacterial and archaeal community structure, and carbon dioxide and methane production rates under oxic and anoxic conditions. Bacteria and archaea similar to those found in other peat soil environments were detected. In contrast to other reports, methanogen diversity was low in our study, with only 2 groups of known or suspected methanogens. Although mining and restoration affected substrate availability and microbial activity, these land-uses did not consistently affect bacterial or archaeal community composition. In fact, larger differences were observed between the two locations and between oxic and anoxic peat samples than between mined and restored sites, with anoxic samples characterized by less detectable bacterial diversity and stronger dominance by members of the phylum Acidobacteria. There were also no apparent strong linkages between prokaryote community structure and methane or carbon dioxide production, suggesting that different organisms exhibit functional redundancy and/or that the same taxa function at very different rates when exposed to different peat substrates. In contrast to other earlier work focusing on fungal communities across similar mined and restored peatlands, bacterial and archaeal communities appeared to be more resistant or resilient to peat substrate changes brought

  5. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Science.gov (United States)

    Bowen De León, Kara; Gerlach, Robin; Peyton, Brent M.; Fields, Matthew W.

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park (YNP), Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatures (44°C, 63°C, 75°C). The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi) at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus) at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44 and 63°C springs and a thermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different) to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts. PMID:24282404

  6. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    Directory of Open Access Journals (Sweden)

    Kara Bowen De León

    2013-11-01

    Full Text Available The Heart Lake Geyser Basin (HLGB is remotely located at the base of Mount Sheridan in southern Yellowstone National Park, Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5 hot springs with varying temperatures (44°C, 63°C, 75°C. The bacterial populations were generally stable over time, but varied by temperature. The dominant bacterial community changed from moderately thermophilic and photosynthetic members (Cyanobacteria and Chloroflexi at 44°C to a mixed photosynthetic and thermophilic community (Deinococcus-Thermus at 63°C and a non-photosynthetic thermophilic community at 75°C. The archaeal community was more variable across time and was predominantly a methanogenic community in the 44°C and 63°C springs and a hyperthermophilic community in the 75°C spring. The 75°C spring demonstrated large shifts in the archaeal populations and was predominantly Candidatus Nitrosocaldus, an ammonia-oxidizing crenarchaeote, in the 2007 sample, and almost exclusively Thermofilum or Candidatus Caldiarchaeum in the 2009 sample, depending on SSU rRNA gene region examined. The majority of sequences were dissimilar (≥10% different to any known organisms suggesting that HLGB possesses numerous new phylogenetic groups that warrant cultivation efforts.

  7. Archaeal and bacterial communities in three alkaline hot springs in Heart Lake Geyser Basin, Yellowstone National Park

    OpenAIRE

    Kara Bowen De León; Robin eGerlach; Peyton, Brent M.; Matthew W Fields

    2013-01-01

    The Heart Lake Geyser Basin (HLGB) is remotely located at the base of Mount Sheridan in southern Yellowstone National Park, Wyoming, USA and is situated along Witch Creek and the northwestern shore of Heart Lake. Likely because of its location, little is known about the microbial community structure of springs in the HLGB. Bacterial and archaeal populations were monitored via small subunit (SSU) rRNA gene pyrosequencing over 3 years in 3 alkaline (pH 8.5) hot springs with varying temperatur...

  8. Archaeal amoA gene diversity points to distinct biogeography of ammonia-oxidizing Crenarchaeota in the ocean

    OpenAIRE

    Sintes, Eva; Bergauer, Kristin; de Corte, Daniele; Yokokawa, Taichi; Herndl, Gerhard J.

    2013-01-01

    Mesophilic ammonia-oxidizing Archaea (AOA) are abundant in a diverse range of marine environments, including the deep ocean, as revealed by the quantification of the archaeal amoA gene encoding the alpha-subunit of the ammonia monooxygenase. Using two different amoA primer sets, two distinct ecotypes of marine Crenarchaeota Group I (MCGI) were detected in the waters of the tropical Atlantic and the coastal Arctic. The HAC-AOA ecotype (high ammonia concentration AOA) was ≍ 8000 times and 15 ti...

  9. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes...

  10. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming;

    2013-01-01

    enzymes already impaired cell growth, highlighting their important roles in archaeal DNA repair. Systematically characterizing these mutants and generating mutants lacking two or more DNA repair genes will yield further insights into the genetic mechanisms of DNA repair in this model organism.......Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...... their phenotype. We found that this archaeon may not encode a eukarya-type of NER (nucleotide excision repair) pathway because depleting each of the eukaryal NER homologues XPD, XPB and XPF did not impair the DNA repair capacity in their mutants. However, among seven homologous recombination proteins...

  11. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  12. Dark matter in archaeal genomes: a rich source of novel mobile elements, defense systems and secretory complexes.

    Science.gov (United States)

    Makarova, Kira S; Wolf, Yuri I; Forterre, Patrick; Prangishvili, David; Krupovic, Mart; Koonin, Eugene V

    2014-09-01

    Microbial genomes encompass a sizable fraction of poorly characterized, narrowly spread fast-evolving genes. Using sensitive methods for sequences comparison and protein structure prediction, we performed a detailed comparative analysis of clusters of such genes, which we denote "dark matter islands", in archaeal genomes. The dark matter islands comprise up to 20% of archaeal genomes and show remarkable heterogeneity and diversity. Nevertheless, three classes of entities are common in these genomic loci: (a) integrated viral genomes and other mobile elements; (b) defense systems, and (c) secretory and other membrane-associated systems. The dark matter islands in the genome of thermophiles and mesophiles show similar general trends of gene content, but thermophiles are substantially enriched in predicted membrane proteins whereas mesophiles have a greater proportion of recognizable mobile elements. Based on this analysis, we predict the existence of several novel groups of viruses and mobile elements, previously unnoticed variants of CRISPR-Cas immune systems, and new secretory systems that might be involved in stress response, intermicrobial conflicts and biogenesis of novel, uncharacterized membrane structures.

  13. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    Science.gov (United States)

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)].

  14. Distribution of bacterial and archaeal ether lipids in soils and surface sediments of Tibetan lakes: Implications for GDGT-based proxies in saline high mountain lakes

    NARCIS (Netherlands)

    Günther, F.; Thiele, A.; Gleixner, G.; Xu, B.Q.; Yao, T.; Schouten, S.

    2014-01-01

    Bacterial and archaeal lipids, such as glycerol dialkyl glycerol tetraethers (GDGTs) and dialkyl glycerol diethers, are increasingly used as proxies for specific environmental parameters, such as air temperature and soil pH in lacustrine environments. Little is known, however, about the distribution

  15. Effect of supplementing coconut or krabok oil, rich in medium-chain fatty acids on ruminal fermentation, protozoa and archaeal population of bulls

    NARCIS (Netherlands)

    Panyakaew, P.; Boon, N.; Goel, G.; Yuangklang, C.; Schonewille, J.T.; Hendriks, W.H.; Fievez, V.

    2013-01-01

    Medium-chain fatty acids (MCFA), for example, capric acid (C10:0), myristic (C14:0) and lauric (C12:0) acid, have been suggested to decrease rumen archaeal abundance and protozoal numbers. This study aimed to compare the effect of MCFA, either supplied through krabok (KO) or coconut (CO) oil, on rum

  16. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    Science.gov (United States)

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  17. Variability in abundance of the Bacterial and Archaeal 16S rRNA and amoA genes in water columns of northern South China Sea

    Science.gov (United States)

    Liu, H.; Yang, C.; Chen, S.; Xie, W.; Wang, P.; Zhang, C. L.

    2014-12-01

    Recent advances in marine microbial ecology have shown that ammonia-oxidizing Archaea (AOA) are more abundant than ammonia-oxidizing bacteria (AOB), although total Bacteria are more abundant than total Archaea in marine environments. This study aimed to examine the spatial distribution and abundance of planktonic archaeal and bacterial 16S rRNA- and amoA genes in the northern South China Sea. Water samples were collected at different depths at six stations (maximum depth ranging from 1800 m to 3200 m)with four stations (B2, B3, B6, B7) located along a transect from the northeastern continental slope to the Bashi Strait and the other two (D3, D5) located southwest of this transect. Quantitative PCR of the 16S rRNA- and amoA genes was used to estimate the abundances of total Archaea, total Bacteria, and AOA and AOB, respectively. At the B series stations, the abundance of bacterial 16S rRNA gene was twofold to 36fold higher than that of the archaeal 16S rRNA gene while fivefold lower to sixfold higher at the two D stations, with both genes showing peak values slightly below sea surface (5-75 m depths) at all stations. The archaeal amoA gene had similar variations with the archaeal 16S rRNA gene, but was 1-4 orders of magnitude lower than the archaeal 16S rRNA gene at all stations. Bacterial amoA gene was below the detection at all stations. Our results also show the difference in depth profiles among these stations, which may be caused by the difference in water movement between these regions. The non-detection of bacterial amoA gene indicates that ammonia-oxidizing Archaea are the dominant group of microorganisms in nitrification of the South China Sea, which is consistent with observations in other oceans.

  18. Interactions of archaeal chromatin proteins Alba1 and Alba2 with nucleic acids.

    Directory of Open Access Journals (Sweden)

    Miha Črnigoj

    Full Text Available BACKGROUND: Architectural proteins have important roles in compacting and organising chromosomal DNA. There are two potential histone counterpart peptide sequences (Alba1 and Alba2 in the Aeropyrum pernix genome (APE1832.1 and APE1823. METHODOLOGY/PRINCIPAL FINDINGS: THESE TWO PEPTIDES WERE EXPRESSED AND THEIR INTERACTIONS WITH VARIOUS DNAS WERE STUDIED USING A COMBINATION OF VARIOUS EXPERIMENTAL TECHNIQUES: surface plasmon resonance, UV spectrophotometry, circular dichroism-spectropolarimetry, gel-shift assays, and isothermal titration calorimetry. CONCLUSIONS/SIGNIFICANCE: Our data indicate that there are significant differences in the properties of the Alba1 and Alba2 proteins. Both of these Alba proteins can thermally stabilise DNA polynucleotides, as seen from UV melting curves. Alba2 and equimolar mixtures of Alba1/Alba2 have greater effects on the thermal stability of poly(dA-dT.poly(dA-dT. Surface plasmon resonance sensorgrams for binding of Alba1, Alba2, and equimolar mixtures of Alba1/Alba2 to DNA oligonucleotides show different binding patterns. Circular dichroism indicates that Alba2 has a less-ordered secondary structure than Alba1. The secondary structures of the Alba proteins are not significantly influenced by DNA binding, even at high temperatures. Based on these data, we conclude that Alba1, Alba2, and equimolar mixtures of Alba1/Alba2 show different properties in their binding to various DNAs.

  19. Assessment of methods to recover DNA from bacteria, fungi and archaea in complex environmental samples.

    Science.gov (United States)

    Guillén-Navarro, Karina; Herrera-López, David; López-Chávez, Mariana Y; Cancino-Gómez, Máximo; Reyes-Reyes, Ana L

    2015-11-01

    DNA extraction from environmental samples is a critical step for metagenomic analysis to study microbial communities, including those considered uncultivable. Nevertheless, obtaining good quality DNA in sufficient quantities for downstream methodologies is not always possible, and it depends on the complexity and stability of each ecosystem, which could be more problematic for samples from tropical regions because those ecosystems are less stable and more complex. Three laboratory methods for the extraction of nucleic acids from samples representing unstable (decaying coffee pulp and mangrove sediments) and relatively stable (compost and soil) environments were tested. The results were compared with those obtained using two commercial DNA extraction kits. The quality of the extracted DNA was evaluated by PCR amplification to verify the recovery of bacterial, archaeal, and fungal genetic material. The laboratory method that gave the best results used a lysis procedure combining physical, chemical, and enzymatic steps.

  20. Assessment of methods to recover DNA from bacteria, fungi and archaea in complex environmental samples.

    Science.gov (United States)

    Guillén-Navarro, Karina; Herrera-López, David; López-Chávez, Mariana Y; Cancino-Gómez, Máximo; Reyes-Reyes, Ana L

    2015-11-01

    DNA extraction from environmental samples is a critical step for metagenomic analysis to study microbial communities, including those considered uncultivable. Nevertheless, obtaining good quality DNA in sufficient quantities for downstream methodologies is not always possible, and it depends on the complexity and stability of each ecosystem, which could be more problematic for samples from tropical regions because those ecosystems are less stable and more complex. Three laboratory methods for the extraction of nucleic acids from samples representing unstable (decaying coffee pulp and mangrove sediments) and relatively stable (compost and soil) environments were tested. The results were compared with those obtained using two commercial DNA extraction kits. The quality of the extracted DNA was evaluated by PCR amplification to verify the recovery of bacterial, archaeal, and fungal genetic material. The laboratory method that gave the best results used a lysis procedure combining physical, chemical, and enzymatic steps. PMID:26014885

  1. A shift in the archaeal nitrifier community in response to natural and anthropogenic disturbances in the northern Gulf of Mexico.

    Science.gov (United States)

    Newell, Silvia E; Eveillard, Damien; McCarthy, Mark J; Gardner, Wayne S; Liu, Zhanfei; Ward, Bess B

    2014-02-01

    The Gulf of Mexico is affected by hurricanes and suffers seasonal hypoxia. The Deepwater Horizon oil spill impacted every trophic level in the coastal region. Despite their importance in bioremediation and biogeochemical cycles, it is difficult to predict the responses of microbial communities to physical and anthropogenic disturbances. Here, we quantify sediment ammonia-oxidizing archaeal (AOA) community diversity, resistance and resilience, and important geochemical factors after major hurricanes and the oil spill. Dominant AOA archetypes correlated with different geochemical factors, suggesting that different AOA are constrained by distinct parameters. Diversity was lowest after the hurricanes, showing weak resistance to physical disturbances. However, diversity was highest during the oil spill and coincided with a community shift, suggesting a new alternative stable state sustained for at least 1 year. The new AOA community was not significantly different from that at the spill site 1 year after the spill. This sustained shift in nitrifier community structure may be a result of oil exposure. PMID:24596268

  2. Specific bacterial, archaeal, and eukaryotic communities in tidal-flat sediments along a vertical profile of several meters.

    Science.gov (United States)

    Wilms, Reinhard; Sass, Henrik; Köpke, Beate; Köster, Jürgen; Cypionka, Heribert; Engelen, Bert

    2006-04-01

    The subsurface of a tidal-flat sediment was analyzed down to 360 cm in depth by molecular and geochemical methods. A community structure analysis of all three domains of life was performed using domain-specific PCR followed by denaturing gradient gel electrophoresis analysis and sequencing of characteristic bands. The sediment column comprised horizons easily distinguishable by lithology that were deposited in intertidal and salt marsh environments. The pore water profile was characterized by a subsurface sulfate peak at a depth of about 250 cm. Methane and sulfate profiles were opposed, showing increased methane concentrations in the sulfate-free layers. The availability of organic carbon appeared to have the most pronounced effect on the bacterial community composition in deeper sediment layers. In general, the bacterial community was dominated by fermenters and syntrophic bacteria. The depth distribution of methanogenic archaea correlated with the sulfate profile and could be explained by electron donor competition with sulfate-reducing bacteria. Sequences affiliated with the typically hydrogenotrophic Methanomicrobiales were present in sulfate-free layers. Archaea belonging to the Methanosarcinales that utilize noncompetitive substrates were found along the entire anoxic-sediment column. Primers targeting the eukaryotic 18S rRNA gene revealed the presence of a subset of archaeal sequences in the deeper part of the sediment cores. The phylogenetic distance to other archaeal sequences indicates that these organisms represent a new phylogenetic group, proposed as "tidal-flat cluster 1." Eukarya were still detectable at 360 cm, even though their diversity decreased with depth. Most of the eukaryotic sequences were distantly related to those of grazers and deposit feeders.

  3. Analysis of Bacterial and Archaeal Communities along a High-Molecular-Weight Polyacrylamide Transportation Pipeline System in an Oil Field

    Directory of Open Access Journals (Sweden)

    Cai-Yun Li

    2015-04-01

    Full Text Available Viscosity loss of high-molecular-weight partially hydrolyzed polyacrylamide (HPAM solution was observed in a water injection pipeline before being injected into subterranean oil wells. In order to investigate the possible involvement of microorganisms in HPAM viscosity loss, both bacterial and archaeal community compositions of four samples collected from different points of the transportation pipeline were analyzed using PCR-amplification of the 16S rRNA gene and clone library construction method together with the analysis of physicochemical properties of HPAM solution and environmental factors. Further, the relationship between environmental factors and HPAM properties with microorganisms were delineated by canonical correspondence analysis (CCA. Diverse bacterial and archaeal groups were detected in the four samples. The microbial community of initial solution S1 gathered from the make-up tank is similar to solution S2 gathered from the first filter, and that of solution S3 obtained between the first and the second filter is similar to that of solution S4 obtained between the second filter and the injection well. Members of the genus Acinetobacter sp. were detected with high abundance in S3 and S4 in which HPAM viscosity was considerably reduced, suggesting that they likely played a considerable role in HPAM viscosity loss. This study presents information on microbial community diversity in the HPAM transportation pipeline and the possible involvement of microorganisms in HPAM viscosity loss and biodegradation. The results will help to understand the microbial community contribution made to viscosity change and are beneficial for providing information for microbial control in oil fields.

  4. Spatial distribution of archaeal and bacterial ammonia oxidizers in the littoral buffer zone of a nitrogen-rich lake

    Institute of Scientific and Technical Information of China (English)

    Yu Wang; Guibing Zhu; Lei Ye; Xiaojuan Feng; Huub J. M. Op den Camp; Chengqing Yin

    2012-01-01

    The spatial distribution and diversity of archaeal and bacterial ammonia oxidizers (AOA and AOB) were evaluated targeting amoA genes in the gradient of a littoral buffer zone which has been identified as a hot spot for N cycling.Here we found high spatial heterogeneity in the nitrification rate and abundance of ammonia oxidizers in the five sampling sites.The bacterial amoA gene was numerically dominant in most of the surface soil but decreased dramatically in deep layers.Higher nitrification potentials were detected in two sites near the land/water interface at 4.4-6.1 μg NO2--N/(g dry weight soil.hr),while only 1.0-1.7 μg NO2- -N/(gdry weight soil·hr) was measured at other sites.The potential nitrification rates were proportional to the amoA gene abundance for AOB,hut with no significant correlation with AOA.The NH4+ concentration was the most determinative parameter for the abundance of AOB and potential nitrification rates in this study.Higher richness in the surface layer was found in the analysis of biodiversity.Phylogenetic analysis revealed that most of the bacterial amoA sequences in surface soil were affiliated with the genus of Nitrosopira while the archaeal sequences were almost equally affiliated with Candidatus ‘Nitrososphaera gargensis' and Candidatus ‘Nitrosoealdus yellowstonii'.The spatial distribution of AOA and AOB indicated that bacteria may play a more important role in nitrification in the littoral buffer zone of a N-rich lake.

  5. Archaeal diversity and the extent of iron and manganese pyritization in sediments from a tropical mangrove creek (Cardoso Island, Brazil)

    Science.gov (United States)

    Otero, X. L.; Lucheta, A. R.; Ferreira, T. O.; Huerta-Díaz, M. A.; Lambais, M. R.

    2014-06-01

    Even though several studies on the geochemical processes occurring in mangrove soils and sediments have been performed, information on the diversity of Archaea and their functional roles in these ecosystems, especially in subsurface environments, is scarce. In this study, we have analyzed the depth distribution of Archaea and their possible relationships with the geochemical transformations of Fe and Mn in a sediment core from a tropical mangrove creek, using 16S rRNA gene profiling and sequential extraction of different forms of Fe and Mn. A significant shift in the archaeal community structure was observed in the lower layers (90-100 cm), coinciding with a clear decrease in total organic carbon (TOC) content and an increase in the percentage of sand. The comparison of the archaeal communities showed a dominance of methanogenic Euryarchaeota in the upper layers (0-20 cm), whereas Crenarchaeota was the most abundant taxon in the lower layers. The dominance of methanogenic Euryarchaeota in the upper layer of the sediment suggests the occurrence of methanogenesis in anoxic microenvironments. The concentrations of Fe-oxyhydroxides in the profile were very low, and showed positive correlation with the concentrations of pyrite and degrees of Fe and Mn pyritization. Additionally, a partial decoupling of pyrite formation from organic matter concentration was observed, suggesting excessive Fe pyritization. This overpyritization of Fe can be explained either by the anoxic oxidation of methane by sulfate and/or by detrital pyrite tidal transportation from the surrounding mangrove soils. The higher pyritization levels observed in deeper layers of the creek sediment were also in agreement with its Pleistocenic origin.

  6. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  7. DNA binding properties of the small cascade subunit Csa5.

    Directory of Open Access Journals (Sweden)

    Michael Daume

    Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.

  8. Evolutionary genomics of archaeal viruses: unique viral genomes in the third domain of life

    DEFF Research Database (Denmark)

    Prangishvili, D.; Garrett, R. A.; Koonin, E.

    2006-01-01

    . In accord with this distinction, the sequenced genomes of euryarchaeal viruses encode many proteins homologous to bacteriophage capsid proteins. In contrast, initial analysis of the crenarchaeal viral genomes revealed no relationships with bacteriophages and, generally, very few proteins with detectable......In terms of virion morphology, the known viruses of archaea fall into two distinct classes: viruses of mesophilic and moderately thermophilic Eueryarchaeota closely resemble head-and-tail bacteriophages whereas viruses of hyperthermophilic Crenarchaeota show a variety of unique morphotypes...... of bacteriophages. The proteins encoded by the genes belonging to this pool include predicted transcription regulators, ATPases implicated in viral DNA replication and packaging, enzymes of DNA precursor metabolism, RNA modification enzymes, and glycosylases. In addition, each of the crenarchaeal viruses encodes...

  9. Application of a novel microtitre plate-based assay for the discovery of new inhibitors of DNA gyrase and DNA topoisomerase VI.

    Directory of Open Access Journals (Sweden)

    James A Taylor

    Full Text Available DNA topoisomerases are highly exploited targets for antimicrobial drugs. The spread of antibiotic resistance represents a significant threat to public health and necessitates the discovery of inhibitors that target topoisomerases in novel ways. However, the traditional assays for topoisomerase activity are not suitable for the high-throughput approaches necessary for drug discovery. In this study we validate a novel assay for screening topoisomerase inhibitors. A library of 960 compounds was screened against Escherichia coli DNA gyrase and archaeal Methanosarcina mazei DNA topoisomerase VI. Several novel inhibitors were identified for both enzymes, and subsequently characterised in vitro and in vivo. Inhibitors from the M. mazei topoisomerase VI screen were tested for their ability to inhibit Arabidopsis topoisomerase VI in planta. The data from this work present new options for antibiotic drug discovery and provide insight into the mechanism of topoisomerase VI.

  10. Application of a novel microtitre plate-based assay for the discovery of new inhibitors of DNA gyrase and DNA topoisomerase VI.

    Science.gov (United States)

    Taylor, James A; Mitchenall, Lesley A; Rejzek, Martin; Field, Robert A; Maxwell, Anthony

    2013-01-01

    DNA topoisomerases are highly exploited targets for antimicrobial drugs. The spread of antibiotic resistance represents a significant threat to public health and necessitates the discovery of inhibitors that target topoisomerases in novel ways. However, the traditional assays for topoisomerase activity are not suitable for the high-throughput approaches necessary for drug discovery. In this study we validate a novel assay for screening topoisomerase inhibitors. A library of 960 compounds was screened against Escherichia coli DNA gyrase and archaeal Methanosarcina mazei DNA topoisomerase VI. Several novel inhibitors were identified for both enzymes, and subsequently characterised in vitro and in vivo. Inhibitors from the M. mazei topoisomerase VI screen were tested for their ability to inhibit Arabidopsis topoisomerase VI in planta. The data from this work present new options for antibiotic drug discovery and provide insight into the mechanism of topoisomerase VI.

  11. Horizontal gene transfer of a chloroplast DnaJ-Fer protein to Thaumarchaeota and the evolutionary history of the DnaK chaperone system in Archaea

    Directory of Open Access Journals (Sweden)

    Petitjean Céline

    2012-11-01

    Full Text Available Abstract Background In 2004, we discovered an atypical protein in metagenomic data from marine thaumarchaeotal species. This protein, referred as DnaJ-Fer, is composed of a J domain fused to a Ferredoxin (Fer domain. Surprisingly, the same protein was also found in Viridiplantae (green algae and land plants. Because J domain-containing proteins are known to interact with the major chaperone DnaK/Hsp70, this suggested that a DnaK protein was present in Thaumarchaeota. DnaK/Hsp70, its co-chaperone DnaJ and the nucleotide exchange factor GrpE are involved, among others, in heat shocks and heavy metal cellular stress responses. Results Using phylogenomic approaches we have investigated the evolutionary history of the DnaJ-Fer protein and of interacting proteins DnaK, DnaJ and GrpE in Thaumarchaeota. These proteins have very complex histories, involving several inter-domain horizontal gene transfers (HGTs to explain the contemporary distribution of these proteins in archaea. These transfers include one from Cyanobacteria to Viridiplantae and one from Viridiplantae to Thaumarchaeota for the DnaJ-Fer protein, as well as independent HGTs from Bacteria to mesophilic archaea for the DnaK/DnaJ/GrpE system, followed by HGTs among mesophilic and thermophilic archaea. Conclusions We highlight the chimerical origin of the set of proteins DnaK, DnaJ, GrpE and DnaJ-Fer in Thaumarchaeota and suggest that the HGT of these proteins has played an important role in the adaptation of several archaeal groups to mesophilic and thermophilic environments from hyperthermophilic ancestors. Finally, the evolutionary history of DnaJ-Fer provides information useful for the relative dating of the diversification of Archaeplastida and Thaumarchaeota.

  12. Community Composition and Abundance of Bacterial, Archaeal and Nitrifying Populations in Savanna Soils on Contrasting Bedrock Material in Kruger National Park, South Africa

    Science.gov (United States)

    Rughöft, Saskia; Herrmann, Martina; Lazar, Cassandre S.; Cesarz, Simone; Levick, Shaun R.; Trumbore, Susan E.; Küsel, Kirsten

    2016-01-01

    Savannas cover at least 13% of the global terrestrial surface and are often nutrient limited, especially by nitrogen. To gain a better understanding of their microbial diversity and the microbial nitrogen cycling in savanna soils, soil samples were collected along a granitic and a basaltic catena in Kruger National Park (South Africa) to characterize their bacterial and archaeal composition and the genetic potential for nitrification. Although the basaltic soils were on average 5 times more nutrient rich than the granitic soils, all investigated savanna soil samples showed typically low nutrient availabilities, i.e., up to 38 times lower soil N or C contents than temperate grasslands. Illumina MiSeq amplicon sequencing revealed a unique soil bacterial community dominated by Actinobacteria (20–66%), Chloroflexi (9–29%), and Firmicutes (7–42%) and an increase in the relative abundance of Actinobacteria with increasing soil nutrient content. The archaeal community reached up to 14% of the total soil microbial community and was dominated by the thaumarchaeal Soil Crenarchaeotic Group (43–99.8%), with a high fraction of sequences related to the ammonia-oxidizing genus Nitrosopshaera sp. Quantitative PCR targeting amoA genes encoding the alpha subunit of ammonia monooxygenase also revealed a high genetic potential for ammonia oxidation dominated by archaea (~5 × 107 archaeal amoA gene copies g−1 soil vs. mostly < 7 × 104 bacterial amoA gene copies g−1 soil). Abundances of archaeal 16S rRNA and amoA genes were positively correlated with soil nitrate, N and C contents. Nitrospira sp. was detected as the most abundant group of nitrite oxidizing bacteria. The specific geochemical conditions and particle transport dynamics at the granitic catena were found to affect soil microbial communities through clay and nutrient relocation along the hill slope, causing a shift to different, less diverse bacterial and archaeal communities at the footslope. Overall, our

  13. 高浓度酒精废水厌氧处理工程系统中古菌多样性及其代谢特征%Archaeal diversity and metabolic function in anaerobic digest process treating high concentration ethanol wastewater

    Institute of Scientific and Technical Information of China (English)

    高瑞芳; 袁旭峰; 王小芬; 朱万斌; 程序; 崔宗均

    2011-01-01

    Fast conformation, good shock resistance and good suspensibility of anaerobic granular sludge are the important characteristics of a new anaerobic treatment plant dealing with high concentration organic wastewater. In order to investigate the diversity and functional characteristics of archaea,most important component of granular sludge, total archaeal genomic DNA was extracted from sample.The community structure was studied by polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) and cloning-sequencing based 16S rDNA. The results showed that archaeal community clones were classified into Methanosaeta, Methanosarcina, Methanobacterium and Methanomethylovorans all four clusters, accounting for 58.2%, 23.6%, 12.7% and 3.6% of the clone library capacity separately, one clone with 1.8% proportion could not be found the most sinilar strain. The sequences blast results and phylogenetic analysis of archaea showed that clones C10, C11, C13 and C19 had high similarity with the known strains FJ61882 l, AB479397, AJ244290 and AB447878 separately and their relative taxonomy groups also be found. Methanosaeta and Methanosarcina were the main clusters in archaeal community, so methane production approach was acetic acid-based. Intermediate metabolites VFAs analysis was combined with different metabolic functions comparison, which confirmed the corresponding relationship between archaeal community diversity and its metabolism function.%颗粒污泥形成快、抗冲击能力强、悬浮性好是新型高浓度有机废水厌氧处理系统的重要特征.为了研究颗粒污泥中古茵组成多样性及其功能特征,采集活性污泥样品,提取总基因组DNA,应用PCR-DGGE和16S rDNA克隆测序技术对系统内古菌群落进行研究.结果表明:古菌克隆文库中克隆子的近缘种归属于Methanosaeta、Methanosarcina、Methanobacterium和Methanomethylovorans 4个类群,所占文库容量比例依次为58.2%、23.6%、12.7%和3

  14. Dissection of the functional domains of an archaeal holliday junction helicase

    DEFF Research Database (Denmark)

    Hong, Ye; Chu, Mingzhu; Li, Yansheng;

    2012-01-01

    Helicases and nucleases form complexes that play very important roles in DNA repair pathways some of which interact with each other at Holliday junctions. In this study, we present in vitro and in vivo analysis of Hjm and its interaction with Hjc in Sulfolobus. In vitro studies employed Hjm from...... propagation assay, suggesting that Hjm/Hjc mediated resolution of stalled replication forks is of crucial importance in archaea. A tentative pathway with which Hjm/Hjc interaction could have occurred at stalled replication forks is discussed....

  15. Identification, expression and characterization of archaeal-type opsins of Chlamydomonas reinhardtii

    OpenAIRE

    Kateriya, Suneel

    2005-01-01

    Phototaxis and photophobic responses of green algae are mediated by rhodopsin-based photoreceptors that use microbial-type chromophores (all-trans retinal). Analysis of stimuli-response curves of the C. reinhardtii photoreceptor current led to the suggestion that they are based on two photosystems, one of which is more active at low flash intensities, whereas the other dominates at high flash energies. Two cDNA sequences were identified in the EST database of the C.reinhardtii that encoded mi...

  16. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent d...

  17. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.;

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  18. Spatial Variations in Archaeal Lipids of Surface Water and Core-Top Sediments in the South China Sea and Their Implications for Paleoclimate Studies▿†

    OpenAIRE

    Wei, Yuli; Wang, Jinxiang; Liu, Jie; Dong, Liang; Li, Li; Wang, Hui; Wang, Peng; Zhao, Meixun; Zhang, Chuanlun L.

    2011-01-01

    The South China Sea (SCS) is the largest marginal sea of the western Pacific Ocean, yet little is known about archaeal distributions and TEX86-based temperatures in this unique oceanic setting. Here we report findings of abundances in both core lipids (CL) and intact polar lipids (IPL) of Archaea from surface water (CL only) and core-top sediments from different regions of the SCS. TEX86-derived temperatures were also calculated for these samples. The surface water had extremely low abundance...

  19. Promoter recognition in archaea is mediated by transcription factors: identification of transcription factor aTFB from Methanococcus thermolithotrophicus as archaeal TATA-binding protein.

    OpenAIRE

    Gohl, H P; Gröndahl, B; Thomm, M

    1995-01-01

    At least two transcription factors, aTFB and aTFA, are required for accurate and faithful in vitro transcription of homologous templates in cell-free extracts from the methanogenic Archaeon Methanococcus thermolithotrophicus. We have recently shown that the function of aTFB can be replaced by eucaryal TATA-binding proteins. Here we demonstrate using template commitment experiments that promoter recognition in an Archaeon is mediated by transcription factors. The archaeal TATA box was identifi...

  20. Diversity and Abundance of Ammonia-Oxidizing Archaeal Nitrite Reductase (nirK) Genes in Estuarine Sediments of San Francisco Bay

    Science.gov (United States)

    Reji, L.; Lee, J. A.; Damashek, J.; Francis, C. A.

    2013-12-01

    Nitrification, the microbially-mediated aerobic oxidation of ammonia to nitrate via nitrite, is an integral component of the global biogeochemical nitrogen cycle. The first and rate-limiting step of nitrification, ammonia oxidation, is carried out by two distinct microbial groups: ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA). Molecular ecological studies targeting the amoA gene have revealed the abundance and ubiquity of AOA in terrestrial as well as aquatic environments. In addition to the ammonia oxidation machinery that includes the amoA gene, AOA also encode a gene for copper-containing nitrite reductase (nirK). The distribution patterns and functional role of nirK in AOA remain mostly unknown; proposed functions include the indirect involvement in ammonia oxidation through the production of nitric oxide during nitrite reduction, and (2) nitrite detoxification. In the present study, the diversity and abundance of archaeal nirK genes in estuarine sediments were investigated using quantitative polymerase chain reaction, cloning and sequencing approaches. In sediment samples collected from the San Francisco Bay estuary, two archaeal nirK variants (AnirKa and AnirKb) were amplified using specific primer sets. Overall, AnirKa was observed to be significantly more abundant than AnirKb in the sediment samples, with variation in relative abundance spanning two to three orders of magnitude between sampling sites. Phylogenetic analysis revealed a number of unique archaeal nirK sequence types, as well as many that clustered with sequences from previous estuarine studies and cultured AOA isolates, such as Nitrosopumilus maritimus. This study yielded new insights into the diversity and abundance of archaeal nirK genes in estuarine sediments, and highlights the importance of further investigating the physiological role of this gene in AOA, as well as its suitability as a marker gene for studying AOA in the environment.

  1. Novel archaeal macrocyclic diether core membrane lipids in a methane-derived carbonate crust from a mud volcano in the Sorokin Trough, NE Black Sea

    Directory of Open Access Journals (Sweden)

    Alina Stadnitskaia

    2003-01-01

    Full Text Available A methane-derived carbonate crust was collected from the recently discovered NIOZ mud volcano in the Sorokin Trough, NE Black Sea during the 11th Training-through-Research cruise of the R/V Professor Logachev. Among several specific bacterial and archaeal membrane lipids present in this crust, two novel macrocyclic diphytanyl glycerol diethers, containing one or two cyclopentane rings, were detected. Their structures were tentatively identified based on the interpretation of mass spectra, comparison with previously reported mass spectral data, and a hydrogenation experiment. This macrocyclic type of archaeal core membrane diether lipid has so far been identified only in the deep-sea hydrothermal vent methanogen Methanococcus jannaschii. Here, we provide the first evidence that these macrocyclic diethers can also contain internal cyclopentane rings. The molecular structure of the novel diethers resembles that of dibiphytanyl tetraethers in which biphytane chains, containing one and two pentacyclic rings, also occur. Such tetraethers were abundant in the crust. Compound-specific isotope measurements revealed δ13C values of –104 to –111‰ for these new archaeal lipids, indicating that they are derived from methanotrophic archaea acting within anaerobic methane-oxidizing consortia, which subsequently induce authigenic carbonate formation.

  2. [DNA computing].

    Science.gov (United States)

    Błasiak, Janusz; Krasiński, Tadeusz; Popławski, Tomasz; Sakowski, Sebastian

    2011-01-01

    Biocomputers can be an alternative for traditional "silicon-based" computers, which continuous development may be limited due to further miniaturization (imposed by the Heisenberg Uncertainty Principle) and increasing the amount of information between the central processing unit and the main memory (von Neuman bottleneck). The idea of DNA computing came true for the first time in 1994, when Adleman solved the Hamiltonian Path Problem using short DNA oligomers and DNA ligase. In the early 2000s a series of biocomputer models was presented with a seminal work of Shapiro and his colleguas who presented molecular 2 state finite automaton, in which the restriction enzyme, FokI, constituted hardware and short DNA oligomers were software as well as input/output signals. DNA molecules provided also energy for this machine. DNA computing can be exploited in many applications, from study on the gene expression pattern to diagnosis and therapy of cancer. The idea of DNA computing is still in progress in research both in vitro and in vivo and at least promising results of these research allow to have a hope for a breakthrough in the computer science. PMID:21735816

  3. DNA probes

    International Nuclear Information System (INIS)

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  4. Effect of supplementing coconut or krabok oil, rich in medium-chain fatty acids on ruminal fermentation, protozoa and archaeal population of bulls.

    Science.gov (United States)

    Panyakaew, P; Boon, N; Goel, G; Yuangklang, C; Schonewille, J Th; Hendriks, W H; Fievez, V

    2013-12-01

    Medium-chain fatty acids (MCFA), for example, capric acid (C10:0), myristic (C14:0) and lauric (C12:0) acid, have been suggested to decrease rumen archaeal abundance and protozoal numbers. This study aimed to compare the effect of MCFA, either supplied through krabok (KO) or coconut (CO) oil, on rumen fermentation, protozoal counts and archaeal abundance, as well as their diversity and functional organization. KO contains similar amounts of C12:0 as CO (420 and 458 g/kg FA, respectively), but has a higher proportion of C14:0 (464 v. 205 g/kg FA, respectively). Treatments contained 35 g supplemental fat per kg DM: a control diet with tallow (T); a diet with supplemental CO; and a diet with supplemental KO. A 4th treatment consisted of a diet with similar amounts of MCFA (i.e. C10:0+C12:0+C14:0) from CO and KO. To ensure isolipidic diets, extra tallow was supplied in the latter treatment (KO+T). Eight fistulated bulls (two bulls per treatment), fed a total mixed ration predominantly based on cassava chips, rice straw, tomato pomace, rice bran and soybean meal (1.5% of BW), were used. Both KO and CO increased the rumen volatile fatty acids, in particular propionate and decreased acetate proportions. Protozoal numbers were reduced through the supplementation of an MCFA source (CO, KO and KO+T), with the strongest reduction by KO. Quantitative real-time polymerase chain reaction assays based on archaeal primers showed a decrease in abundance of Archaea when supplementing with KO and KO+T compared with T and CO. The denaturing gradient gel electrophoresis profiles of the rumen archaeal population did not result in a grouping of treatments. Richness indices were calculated from the number of DGGE bands, whereas community organization was assessed from the Pareto-Lorenz evenness curves on the basis of DGGE band intensities. KO supplementation (KO and KO+T treatments) increased richness and evenness within the archaeal community. Further research including methane

  5. Impacts of temperature and pH on the distribution of archaeal lipids in Yunnan hot springs, China.

    Science.gov (United States)

    Wu, Weiyan; Zhang, Chuanlun L; Wang, Huanye; He, Liu; Li, Wenjun; Dong, Hailiang

    2013-01-01

    In culture experiments and many low temperature environments, the distribution of isoprenoid glycerol dialkyl glycerol tetraethers (GDGTs) commonly shows a strong correlation with temperature; however, this is often not the case in hot springs. We studied 26 hot springs in Yunnan, China, in order to determine whether temperature or other factors control the distribution of GDGTs in these environments. The hot springs ranged in temperature from 39.0 to 94.0°C, and in pH from 2.35 to 9.11. Water chemistry including nitrogen-, sulfur-, and iron species was also determined. Lipids from the samples were analyzed using liquid chromatography-mass spectrometry (LC-MS). Distributions of GDGTs in these hot springs were examined using cluster analysis, which resulted in two major groups. Group 1 was characterized by the lack of dominance of any individual GDGTs, while Group 2 was defined by the dominance of GDGT-0 or thaumarchaeol. Temperature was the main control on GDGT distribution in Group 1, whereas pH played an important role in the distribution of GDGTs in Group 2. However, no correlations were found between the distribution of GDGTs and any of the nitrogen-, sulfur-, or iron species. Results of this study indicate the dominance of temperature or pH control on archaeal lipid distribution, which can be better evaluated in the context of lipid classification.

  6. Impacts of temperature and pH on the distribution of archaeal lipids in Yunnan hot springs, China

    Directory of Open Access Journals (Sweden)

    Weiyan eWu

    2013-10-01

    Full Text Available In culture experiments and many low temperature environments, the distribution of isoprenoid glycerol dialkyl glycerol tetraethers (GDGTs commonly shows a strong correlation with temperature; however, this is often not the case in hot springs. We studied 26 hot springs in Yunnan, China, in order to determine whether temperature or other factors control the distribution of GDGTs in these environments. The hot springs ranged in temperature from 39°C to 94°C, and in pH from 2.35 to 9.11. Water chemistry including nitrogen-, sulfur- and iron species was also determined. Lipids from the samples were analyzed using LC-MS (liquid chromatography-mass spectrometry. Distributions of GDGTs in these hot springs were examined using cluster analysis, which resulted in two major groups. Group 1 was characterized by the lack of dominance of any individual GDGTs, while Group 2 was defined by the dominance of GDGT-0 or thaumarchaeol. Temperature was the main control on GDGT distribution in Group 1, whereas pH played an important role in the distribution of GDGTs in Group 2. However, no correlations were found between the distribution of GDGTs and any of the nitrogen-, sulfur- or iron species. Results of this study indicate the predominance of temperature or pH control on archaeal lipid distribution, which can be better evaluated in the context of lipid classification.

  7. S-layers at second glance? Altiarchaeal grappling hooks (hami resemble archaeal S-layer proteins in structure and sequence

    Directory of Open Access Journals (Sweden)

    Alexandra Kristin Perras

    2015-06-01

    Full Text Available The uncultivated Ca. Altiarchaeum hamiconexum (formerly known as SM1 Euryarchaeon carries highly specialized nano-grappling hooks (hami on its cell surface. Until now little is known about the major protein forming these structured fibrous cell surface appendages, the genes involved or membrane anchoring of these filaments. These aspects were analyzed in depth in this study using environmental transcriptomics combined with imaging methods. Since a laboratory culture of this archaeon is not yet available, natural biofilm samples with high Ca. A. hamiconexum abundance were used for the entire analyses. The filamentous surface appendages spanned both membranes of the cell, which are composed of glycosyl-archaeol. The hami consisted of multiple copies of the same protein, the corresponding gene of which was identified via metagenome-mapped transcriptome analysis. The hamus subunit proteins, which are likely to self-assemble due to their predicted beta sheet topology, revealed no similiarity to known microbial flagella-, archaella-, fimbriae- or pili-proteins, but a high similarity to known S-layer proteins of the archaeal phylum at their N-terminal region (47-44% identity. Our results provide new insights into the structure of the unique hami and their major protein and indicate their divergent evolution with S-layer proteins.

  8. Archaeal Diversity in Biofilm Technologies Applied to Treat Urban and Industrial Wastewater: Recent Advances and Future Prospects

    Directory of Open Access Journals (Sweden)

    Jesús González-López

    2013-09-01

    Full Text Available Biological wastewater treatment (WWT frequently relies on biofilms for the removal of anthropogenic contaminants. The use of inert carrier materials to support biofilm development is often required, although under certain operating conditions microorganisms yield structures called granules, dense aggregates of self-immobilized cells with the characteristics of biofilms maintained in suspension. Molecular techniques have been successfully applied in recent years to identify the prokaryotic communities inhabiting biofilms in WWT plants. Although methanogenic Archaea are widely acknowledged as key players for the degradation of organic matter in anaerobic bioreactors, other biotechnological functions fulfilled by Archaea are less explored, and research on their significance and potential for WWT is largely needed. In addition, the occurrence of biofilms in WWT plants can sometimes be a source of operational problems. This is the case for membrane bioreactors (MBR, an advanced technology that combines conventional biological treatment with membrane filtration, which is strongly limited by biofouling, defined as the undesirable accumulation of microbial biofilms and other materials on membrane surfaces. The prevalence and spatial distribution of archaeal communities in biofilm-based WWT as well as their role in biofouling are reviewed here, in order to illustrate the significance of this prokaryotic cellular lineage in engineered environments devoted to WWT.

  9. Human settlement as driver of bacterial, but not of archaeal, ammonia oxidizers abundance and community structure in tropical stream sediments

    Directory of Open Access Journals (Sweden)

    Mariana De Paula Reis

    2015-08-01

    Full Text Available Ammonia-oxidizing archaea (AOA and bacteria (AOB are a diverse and functionally important group in the nitrogen cycle. Nevertheless, AOA and AOB communities driving this process remain uncharacterized in tropical freshwater sediment. Here, the effect of human settlement on the AOA and AOB diversity and abundance have been assessed by phylogenetic and quantitative PCR analyses, using archaeal and bacterial amoA and 16S rRNA genes. Overall, each environment contained specific clades of amoA and 16S rRNA genes sequences, suggesting that selective pressures lead to AOA and AOB inhabiting distinct ecological niches. Human settlement activities, as derived from increased metal and mineral nitrogen contents, appear to cause a response among the AOB community, with Nitrosomonas taking advantage over Nitrosospira in impacted environments. We also observed a dominance of AOB over AOA in mining-impacted sediments, suggesting that AOB might be the primary drivers of ammonia oxidation in these sediments. In addition, ammonia concentrations demonstrated to be the driver for the abundance of AOA, with an inversely proportional correlation between them. Our findings also revealed the presence of novel ecotypes of Thaumarchaeota, such as those related to the obligate acidophilic Nitrosotalea devanaterra at ammonia-rich places of circumneutral pH. These data add significant new information regarding AOA and AOB from tropical freshwater sediments, albeit future studies would be required to provide additional insights into the niche differentiation among these microorganisms.

  10. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    Directory of Open Access Journals (Sweden)

    Elisabeth W. Vissers

    2013-01-01

    Full Text Available Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO. This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA and bacteria (AOB over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton.

  11. High Oxygen Concentration Increases the Abundance and Activity of Bacterial Rather than Archaeal Nitrifiers in Rice Field Soil.

    Science.gov (United States)

    Ke, Xiubin; Lu, Wei; Conrad, Ralf

    2015-11-01

    Oxygen is considered as a limiting factor for nitrification in rice paddy soil. However, little is known about how the nitrifying microbial community responds to different oxygen concentrations at community and transcript level. In this study, soil and roots were harvested from 50-day-old rice microcosms and were incubated for up to 45 days under two oxygen concentrations: 2 % O(2) and 20 % O(2) (ambient air). Nitrification rates were measured from the accumulation of nitrite plus nitrate. The population dynamics of bacterial (AOB) and archaeal (AOA) ammonia oxidizers was determined from the abundance (using quantitative PCR (qPCR)) and composition (using terminal restriction fragment length polymorphism and cloning/sequencing) of their amoA genes, that of nitrite oxidizers (NOB) by quantifying the nxrA gene of Nitrobacter spp. and the 16S rRNA gene of Nitrospira spp. The activity of the nitrifiers was determined by quantifying the copy numbers of amoA and nxrA transcripts (using RT-qPCR). Different oxygen concentrations did not affect the community compositions of AOB, AOA, and NOB, which however were different between surface soil, bottom soil, and rice roots. However, nitrification rates were higher under ambient air than 2 % O(2), and abundance and transcript activities of AOB, but not of AOA, were also higher. Abundance and transcript copy numbers of Nitrobacter were also higher at ambient air. These results indicate that AOB and NOB, but not AOA, were sensitive to oxygen availability. PMID:26054702

  12. Quantification of bacterial and archaeal symbionts in high and low microbial abundance sponges using real-time PCR

    KAUST Repository

    Bayer, Kristina

    2014-07-09

    In spite of considerable insights into the microbial diversity of marine sponges, quantitative information on microbial abundances and community composition remains scarce. Here, we established qPCR assays for the specific quantification of four bacterial phyla of representative sponge symbionts as well as the kingdoms Eubacteria and Archaea. We could show that the 16S rRNA gene numbers of Archaea, Chloroflexi, and the candidate phylum Poribacteria were 4-6 orders of magnitude higher in high microbial abundance (HMA) than in low microbial abundance (LMA) sponges and that actinobacterial 16S rRNA gene numbers were 1-2 orders higher in HMA over LMA sponges, while those for Cyanobacteria were stable between HMA and LMA sponges. Fluorescence in situ hybridization of Aplysina aerophoba tissue sections confirmed the numerical dominance of Chloroflexi, which was followed by Poribacteria. Archaeal and actinobacterial cells were detected in much lower numbers. By use of fluorescence-activated cell sorting as a primer- and probe-independent approach, the dominance of Chloroflexi, Proteobacteria, and Poribacteria in A. aerophoba was confirmed. Our study provides new quantitative insights into the microbiology of sponges and contributes to a better understanding of the HMA/LMA dichotomy. The authors quantified sponge symbionts in eight sponge species from three different locations by real time PCR targetting 16S rRNA genes. Additionally, FISH was performed and diversity and abundance of singularized microbial symbionts from Aplysina aerophoba was determined for a comprehensive quantification work. © 2014 Federation of European Microbiological Societies.

  13. Crystal structure of the sugar binding domain of the archaeal transcriptional regulator TrmB.

    Science.gov (United States)

    Krug, Michael; Lee, Sung-Jae; Diederichs, Kay; Boos, Winfried; Welte, Wolfram

    2006-04-21

    TrmB is an alpha-glucoside-sensing transcriptional regulator controlling two operons encoding maltose/trehalose and maltodextrin ABC transporters of Pyrococcus furiosus. The crystal structure of an N-terminal truncated derivative of TrmB (amino acids 2-109 deleted; TrmB(delta2-109)) was solved at 1.5 A resolution. This protein has lost its DNA binding domain but has retained its sugar recognition site. The structure represents a novel sugar-binding fold. TrmB(delta2-109) bound maltose, glucose, sucrose, and maltotriose, exhibiting Kd values of 6.8, 25, 34, and 160 microM, respectively. TrmB(delta2-109) behaved as a monomer in dilute buffer solution in contrast to the full-length protein, which is a dimer. Co-crystallization with bound maltose identified a binding site involving seven amino acid residues: Ser229, Asn305, Gly320, Met321, Val324, Ile325, and Glu326. Six of these residues interact with the nonreducing glucosyl residue of maltose. The nonreducing glucosyl residue is shared by all substrates bound to TrmB, suggesting it as a common recognition motif.

  14. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  15. Induction of the Sulfolobus shibatae virus SSV1 DNA replication by mitomycin C

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The temperate virus SSV1 from the hyperthermophilic archaeon Sulfolobus shibatae provides a useful model system for the study of archaeal DNA replication. Southern hybridization showed that SSV1 existed primarily as a provirus in its host that was grown without shaking. Upon UV or mitomycin C induction, the cellular level of free SSV1 DNA increased drastically whereas that of integrated viral DNA remained unchanged. The results of mitomycin C induction were more reproducible than those of UV induction. We found that, when the cells that had been grown without shaking were shaken, the replication of SSV1 DNA was also induced. Based on our results, we developed a method for the induction of SSV1 DNA replication by mitomycin C. When the S. shibatae virus production was induced using this method, the cellular level of free SSV1 DNA started to increase 10 h after induction, and peaked after 12-15 h. A fully induced S. shibatae cell contained ~50 molecules of free SSV1 DNA. The development of this induction method and the description of the process of SSV1 DNA replication following induction are valuable to the analysis of the origin and mode of replication of the virus.

  16. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  17. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  18. DNA and RNA sensor

    Institute of Scientific and Technical Information of China (English)

    LIU; Tao; LIN; Lin; ZHAO; Hong; JIANG; Long

    2005-01-01

    This review summarizes recent advances in DNA sensor. Major areas of DNA sensor covered in this review include immobilization methods of DNA, general techniques of DNA detection and application of nanoparticles in DNA sensor.

  19. Transcriptome changes and cAMP oscillations in an archaeal cell cycle

    Directory of Open Access Journals (Sweden)

    Soppa Jörg

    2007-06-01

    Full Text Available Abstract Background The cell cycle of all organisms includes mass increase by a factor of two, replication of the genetic material, segregation of the genome to different parts of the cell, and cell division into two daughter cells. It is tightly regulated and typically includes cell cycle-specific oscillations of the levels of transcripts, proteins, protein modifications, and signaling molecules. Until now cell cycle-specific transcriptome changes have been described for four eukaryotic species ranging from yeast to human, but only for two prokaryotic species. Similarly, oscillations of small signaling molecules have been identified in very few eukaryotic species, but not in any prokaryote. Results A synchronization procedure for the archaeon Halobacterium salinarum was optimized, so that nearly 100% of all cells divide in a time interval that is 1/4th of the generation time of exponentially growing cells. The method was used to characterize cell cycle-dependent transcriptome changes using a genome-wide DNA microarray. The transcript levels of 87 genes were found to be cell cycle-regulated, corresponding to 3% of all genes. They could be clustered into seven groups with different transcript level profiles. Cluster-specific sequence motifs were detected around the start of the genes that are predicted to be involved in cell cycle-specific transcriptional regulation. Notably, many cell cycle genes that have oscillating transcript levels in eukaryotes are not regulated on the transcriptional level in H. salinarum. Synchronized cultures were also used to identify putative small signaling molecules. H. salinarum was found to contain a basal cAMP concentration of 200 μM, considerably higher than that of yeast. The cAMP concentration is shortly induced directly prior to and after cell division, and thus cAMP probably is an important signal for cell cycle progression. Conclusion The analysis of cell cycle-specific transcriptome changes of H. salinarum

  20. DNA vaccines

    Science.gov (United States)

    Gregersen, Jens-Peter

    2001-12-01

    Immunization by genes encoding immunogens, rather than with the immunogen itself, has opened up new possibilities for vaccine research and development and offers chances for new applications and indications for future vaccines. The underlying mechanisms of antigen processing, immune presentation and regulation of immune responses raise high expectations for new and more effective prophylactic or therapeutic vaccines, particularly for vaccines against chronic or persistent infectious diseases and tumors. Our current knowledge and experience of DNA vaccination is summarized and critically reviewed with particular attention to basic immunological mechanisms, the construction of plasmids, screening for protective immunogens to be encoded by these plasmids, modes of application, pharmacokinetics, safety and immunotoxicological aspects. DNA vaccines have the potential to accelerate the research phase of new vaccines and to improve the chances of success, since finding new immunogens with the desired properties is at least technically less demanding than for conventional vaccines. However, on the way to innovative vaccine products, several hurdles have to be overcome. The efficacy of DNA vaccines in humans appears to be much less than indicated by early studies in mice. Open questions remain concerning the persistence and distribution of inoculated plasmid DNA in vivo, its potential to express antigens inappropriately, or the potentially deleterious ability to insert genes into the host cell's genome. Furthermore, the possibility of inducing immunotolerance or autoimmune diseases also needs to be investigated more thoroughly, in order to arrive at a well-founded consensus, which justifies the widespread application of DNA vaccines in a healthy population.

  1. DNA nanotechnology

    Directory of Open Access Journals (Sweden)

    Nadrian C Seeman

    2003-01-01

    We are all aware that the DNA found in cells is a double helix consisting of two antiparallel strands held together by specific hydrogen-bonded base pairs; adenine (A always pairs with thymine (T, and guanine (G always pairs with cytosine (C. The specificity of this base pairing and the ability to ensure that it occurs in this fashion (and not some other1 is key to the use of DNA in materials applications. The double helical arrangement of the two molecules leads to a linear helix axis, linear not in the geometrical sense of being a straight line, but in the topological sense of being unbranched. Genetic engineers discovered in the 1970s how to splice together pieces of DNA to add new genes to DNA molecules2, and synthetic chemists worked out convenient syntheses for short pieces of DNA (up to ∼100–150 units in the 1980s3. Regardless of the impact of these technologies on biological systems, hooking together linear molecules leads only to longer linear molecules, with circles, knots, and catenanes perhaps resulting from time to time.

  2. Phylogenetic analysis of bacterial and archaeal arsC gene sequences suggests an ancient, common origin for arsenate reductase

    Directory of Open Access Journals (Sweden)

    Dugas Sandra L

    2003-07-01

    Full Text Available Abstract Background The ars gene system provides arsenic resistance for a variety of microorganisms and can be chromosomal or plasmid-borne. The arsC gene, which codes for an arsenate reductase is essential for arsenate resistance and transforms arsenate into arsenite, which is extruded from the cell. A survey of GenBank shows that arsC appears to be phylogenetically widespread both in organisms with known arsenic resistance and those organisms that have been sequenced as part of whole genome projects. Results Phylogenetic analysis of aligned arsC sequences shows broad similarities to the established 16S rRNA phylogeny, with separation of bacterial, archaeal, and subsequently eukaryotic arsC genes. However, inconsistencies between arsC and 16S rRNA are apparent for some taxa. Cyanobacteria and some of the γ-Proteobacteria appear to possess arsC genes that are similar to those of Low GC Gram-positive Bacteria, and other isolated taxa possess arsC genes that would not be expected based on known evolutionary relationships. There is no clear separation of plasmid-borne and chromosomal arsC genes, although a number of the Enterobacteriales (γ-Proteobacteria possess similar plasmid-encoded arsC sequences. Conclusion The overall phylogeny of the arsenate reductases suggests a single, early origin of the arsC gene and subsequent sequence divergence to give the distinct arsC classes that exist today. Discrepancies between 16S rRNA and arsC phylogenies support the role of horizontal gene transfer (HGT in the evolution of arsenate reductases, with a number of instances of HGT early in bacterial arsC evolution. Plasmid-borne arsC genes are not monophyletic suggesting multiple cases of chromosomal-plasmid exchange and subsequent HGT. Overall, arsC phylogeny is complex and is likely the result of a number of evolutionary mechanisms.

  3. Archaeal Viruses Contribute to the Novel Viral Assemblage Inhabiting Oceanic, Basalt-Hosted Deep Subsurface Crustal Fluids

    Science.gov (United States)

    Nigro, O. D.; Rappe, M. S.; Jungbluth, S.; Lin, H. T.; Steward, G.

    2015-12-01

    Fluids contained in the basalt-hosted deep subsurface of the world's oceans represent one of the most inaccessible and understudied biospheres on earth. Recent improvements in sampling infrastructure have allowed us to collect large volumes of crustal fluids (~104 L) from Circulation Obviation Retrofit Kits (CORKs) placed in boreholes located on the eastern flank of the Juan de Fuca Ridge (JdFR). We detected viruses within these fluids by TEM and epifluorescence microscopy in samples collected from 2010 to 2014. Viral abundance, determined by epifluorescence counts, indicated that concentrations of viruses in subsurface basement fluids (~105 ml-1) are lower than the overlying seawater, but are higher in abundance than microbial cells in the same samples. Analysis of TEM images revealed distinct viral morphologies (rod and spindle-shaped) that resemble the morphologies of viral families infecting archaea. There are very few, if any, direct observations of these viral morphologies in marine samples, although they have been observed in enrichment cultures and their signature genes detected in metagenomic studies from hydrothermal vents and marine sediments. Analysis of metagenomes from the JdFR crustal fluids revealed sequences with homology to archaeal viruses from the rudiviridae, bicaudaviridae and fuselloviridae. Prokaryotic communities in fluids percolating through the basaltic basement rock of the JdFR flank are distinct from those inhabiting the overlying sediments and seawater. Similarly, our data support the idea that the viral assemblage in these fluids is distinct from viral assemblages in other marine and terrestrial aquatic environments. Our data also suggest that viruses contribute to the mortality of deep subsurface prokaryotes through cell lysis, and viruses may alter the genetic potential of their hosts through the processes of lysogenic conversion and horizontal gene transfer.

  4. Bacterial CS2 hydrolases from Acidithiobacillus thiooxidans strains are homologous to the archaeal catenane CS2 hydrolase.

    Science.gov (United States)

    Smeulders, Marjan J; Pol, Arjan; Venselaar, Hanka; Barends, Thomas R M; Hermans, John; Jetten, Mike S M; Op den Camp, Huub J M

    2013-09-01

    Carbon disulfide (CS(2)) and carbonyl sulfide (COS) are important in the global sulfur cycle, and CS(2) is used as a solvent in the viscose industry. These compounds can be converted by sulfur-oxidizing bacteria, such as Acidithiobacillus thiooxidans species, to carbon dioxide (CO(2)) and hydrogen sulfide (H2S), a property used in industrial biofiltration of CS(2)-polluted airstreams. We report on the mechanism of bacterial CS(2) conversion in the extremely acidophilic A. thiooxidans strains S1p and G8. The bacterial CS(2) hydrolases were highly abundant. They were purified and found to be homologous to the only other described (archaeal) CS(2) hydrolase from Acidianus strain A1-3, which forms a catenane of two interlocked rings. The enzymes cluster in a group of β-carbonic anhydrase (β-CA) homologues that may comprise a subclass of CS(2) hydrolases within the β-CA family. Unlike CAs, the CS(2) hydrolases did not hydrate CO(2) but converted CS(2) and COS with H(2)O to H(2)S and CO(2). The CS(2) hydrolases of A. thiooxidans strains G8, 2Bp, Sts 4-3, and BBW1, like the CS(2) hydrolase of Acidianus strain A1-3, exist as both octamers and hexadecamers in solution. The CS(2) hydrolase of A. thiooxidans strain S1p forms only octamers. Structure models of the A. thiooxidans CS(2) hydrolases based on the structure of Acidianus strain A1-3 CS(2) hydrolase suggest that the A. thiooxidans strain G8 CS(2) hydrolase may also form a catenane. In the A. thiooxidans strain S1p enzyme, two insertions (positions 26 and 27 [PD] and positions 56 to 61 [TPAGGG]) and a nine-amino-acid-longer C-terminal tail may prevent catenane formation.

  5. Archaeal and bacterial diversity in an arsenic-rich shallow-sea hydrothermal system undergoing phase separation

    Directory of Open Access Journals (Sweden)

    Roy Edward Price

    2013-07-01

    Full Text Available Phase separation is a ubiquitous process in seafloor hydrothermal vents, creating a large range of salinities. Toxic elements (e.g., arsenic partition into the vapor phase, and thus can be enriched in both high and low salinity fluids. However, investigations of microbial diversity at sites associated with phase separation are rare. We evaluated prokaryotic diversity in arsenic-rich shallow-sea vents off Milos Island (Greece by comparative analysis of 16S rRNA clone sequences from two vent sites with similar pH and temperature but marked differences in salinity. Clone sequences were also obtained for aioA-like functional genes (AFGs. Bacteria in the surface sediments (0 to 1.5 cm at the high salinity site consisted of mainly Epsilonproteobacteria (Arcobacter sp., which transitioned to almost exclusively Firmicutes (Bacillus sp. at ~10 cm depth. However, the low salinity site consisted of Bacteroidetes (Flavobacteria in the surface and Epsilonproteobacteria (Arcobacter sp. at ~10 cm depth. Archaea in the high salinity surface sediments were dominated by the orders Archaeoglobales and Thermococcales, transitioning to Thermoproteales and Desulfurococcales (Staphylothermus sp. in the deeper sediments. In contrast, the low salinity site was dominated by Thermoplasmatales in the surface and Thermoproteales at depth. Similarities in gas and redox chemistry suggest that salinity and/or arsenic concentrations may select for microbial communities that can tolerate these parameters. Many of the archaeal 16S rRNA sequences contained inserts, possibly introns, including members of the Euryarchaeota. Clones containing AFGs affiliated with either Alpha- or Betaproteobacteria, although most were only distantly related to published representatives. Most clones (89% originated from the deeper layer of the low salinity, highest arsenic site. This is the only sample with overlap in 16S rRNA data, suggesting arsenotrophy as an important metabolism in similar

  6. DNA nanotechnology

    OpenAIRE

    Seeman, Nadrian C.

    2003-01-01

    Since Watson and Crick’s determination of its structure nearly 50 years ago, DNA has come to fill our lives in many areas, from genetic counseling to forensics, from genomics to gene therapy. These, and other ways in which DNA affects human activities, are related to its function as genetic material, not just our genetic material, but the genetic material of all living organisms. Here, we will ignore DNA’s biological role; rather, we will discuss how the properties that make it so successful ...

  7. Human single-stranded DNA binding proteins: guardians of genome stability

    Institute of Scientific and Technical Information of China (English)

    Yuanzhong Wu; Jinping Lu; Tiebang Kang

    2016-01-01

    Single-stranded DNA-binding proteins (SSBs) are essential for maintaining the integrity of the genome in all organisms.All processes related to DNA,such as replication,excision,repair,and recombination,require the participation of SSBs whose oligonucleotideaoligosaccharide-binding (OB)-fold domain is responsible for the interaction with single-stranded DNA (ssDNA).For a long time,the heterotrimeric replication protein A (RPA) complex was believed to be the only nuclear SSB in eukanyotes to participate in ssDNA processing,while mitochondrial SSBs that are consewed with prokaryotic SSBs were shown to be essential for maintaining genome stability in eukaryotic mitochondria.In recent years,two new proteins,hSSB1 and hSSB2 (human SSBs 1/2),were identified and have better sequence similarity to bacterial and archaeal SSBs than RPA.This review summarizes the current understanding of these human SSBs in DNA damage repair and in cell-cycle checkpoint activation following DNA damage,as well as their relationships with cancer.

  8. Spatial Variations in Archaeal Lipids of Surface Water and Core-Top Sediments in the South China Sea and Their Implications for Paleoclimate Studies▿†

    Science.gov (United States)

    Wei, Yuli; Wang, Jinxiang; Liu, Jie; Dong, Liang; Li, Li; Wang, Hui; Wang, Peng; Zhao, Meixun; Zhang, Chuanlun L.

    2011-01-01

    The South China Sea (SCS) is the largest marginal sea of the western Pacific Ocean, yet little is known about archaeal distributions and TEX86-based temperatures in this unique oceanic setting. Here we report findings of abundances in both core lipids (CL) and intact polar lipids (IPL) of Archaea from surface water (CL only) and core-top sediments from different regions of the SCS. TEX86-derived temperatures were also calculated for these samples. The surface water had extremely low abundances of CL (average of 0.05 ± 0.13 ng/liter; n = 75), with higher values present in regions where upwelling is known to occur. The core-top sediments had CL values of 0.1 to 0.9 μg/g, which are on the low end of CL concentrations reported for other marine sediments and may reflect the oligotrophic nature of the open SCS. The IPL of Archaea accounted for 6 to 36.4% of total lipids (CL plus IPL), indicating that the majority of archaeal lipids in core-top sediments were derived from nonliving cells. The TEX86-based temperatures of surface water were overall lower than satellite-based sea surface temperatures or CTD-measured in situ temperatures. The core-top sediment samples, however, had TEX86 temperatures very close to the mean annual sea surface temperatures, except for samples with water depths of less than 100 m. Our results demonstrated low and heterogeneous distributions of archaeal lipids in surface water and core-top sediments of the SCS, which may reflect local or regional differences in productivity of Archaea. While TEX86-based temperatures for core-top marine sediments at deep water depths (>100 m) generally reflected mean annual sea surface temperatures, TEX86 temperatures in surface water varied basin wide and underestimated sea surface temperatures in most locations for the season when surface water samples were collected. PMID:21890672

  9. Novel PCR primers for the archaeal phylum Thaumarchaeota designed based on the comparative analysis of 16S rRNA gene sequences.

    Directory of Open Access Journals (Sweden)

    Jin-Kyung Hong

    Full Text Available Based on comparative phylogenetic analysis of 16S rRNA gene sequences deposited in an RDP database, we constructed a local database of thaumarchaeotal 16S rRNA gene sequences and developed a novel PCR primer specific for the archaeal phylum Thaumarchaeota. Among 9,727 quality-filtered (chimeral-checked, size >1.2 kb archaeal sequences downloaded from the RDP database, 1,549 thaumarchaeotal sequences were identified and included in our local database. In our study, Thaumarchaeota included archaeal groups MG-I, SAGMCG-I, SCG, FSCG, RC, and HWCG-III, forming a monophyletic group in the phylogenetic tree. Cluster analysis revealed 114 phylotypes for Thaumarchaeota. The majority of the phylotypes (66.7% belonged to the MG-I and SCG, which together contained most (93.9% of the thaumarchaeotal sequences in our local database. A phylum-directed primer was designed from a consensus sequence of the phylotype sequences, and the primer's specificity was evaluated for coverage and tolerance both in silico and empirically. The phylum-directed primer, designated THAUM-494, showed >90% coverage for Thaumarchaeota and 95% of the amplified sequences belonged to Thaumarchaeota. The most frequently sampled thaumarchaeotal subgroups in our samples were SCG, MG-I, and SAGMCG-I. To our knowledge, THAUM-494 is the first phylum-level primer for Thaumarchaeota. Furthermore, the high coverage and low tolerance of THAUM-494 will make it a potentially valuable tool in understanding the phylogenetic diversity and ecological niche of Thaumarchaeota.

  10. Temperature increases from 55 to 75 C in a two-phase biogas reactor result in fundamental alterations within the bacterial and archaeal community structure

    Energy Technology Data Exchange (ETDEWEB)

    Rademacher, Antje [Leibniz-Institut fuer Agrartechnik Potsdam-Bornim e.V. (ATB), Potsdam (Germany). Abt. Bioverfahrenstechnik; Technische Univ. Berlin (Germany). Inst. fuer Technischen Umweltschutz; Nolte, Christine; Schoenberg, Mandy; Klocke, Michael [Leibniz-Institut fuer Agrartechnik Potsdam-Bornim e.V. (ATB), Potsdam (Germany). Abt. Bioverfahrenstechnik

    2012-10-15

    Agricultural biogas plants were operated in most cases below their optimal performance. An increase in the fermentation temperature and a spatial separation of hydrolysis/acetogenesis and methanogenesis are known strategies in improving and stabilizing biogas production. In this study, the dynamic variability of the bacterial and archaeal community was monitored within a two-phase leach bed biogas reactor supplied with rye silage and straw during a stepwise temperature increase from 55 to 75 C within the leach bed reactor (LBR), using TRFLP analyses. To identify the terminal restriction fragments that were obtained, bacterial and archaeal 16S rRNA gene libraries were constructed. Above 65 C, the bacterial community structure changed from being Clostridiales-dominated toward being dominated by members of the Bacteroidales, Clostridiales, and Thermotogales orders. Simultaneously, several changes occurred, including a decrease in the total cell count, degradation rate, and biogas yield along with alterations in the intermediate production. A bioaugmentation with compost at 70 C led to slight improvements in the reactor performance; these did not persist at 75 C. However, the archaeal community within the downstream anaerobic filter reactor (AF), operated constantly at 55 C, altered by the temperature increase in the LBR. At an LBR temperature of 55 C, members of the Methanobacteriales order were prevalent in the AF, whereas at higher LBR temperatures Methanosarcinales prevailed. Altogether, the best performance of this two-phase reactor was achieved at an LBR temperature of below 65 C, which indicates that this temperature range has a favorable effect on the microbial community responsible for the production of biogas. (orig.)

  11. Archaeal and Bacterial Diversity and Enzymatic Activities Associated With Particulate Matter in the Laptev Sea, a River-Impacted Arctic Shelf Environment

    Science.gov (United States)

    Evans, C. T.; Deming, J. W.

    2006-12-01

    Arctic Ocean shelves are influenced by riverine input of terrestrial, relatively refractory particulate organic matter (POM) as well as fresh material from marine phytoplankton blooms. The fate of organic particles and aggregates depends in large part on their associated microbes and the effectiveness of hydrolytic enzymes. The Laptev Sea provides an ideal setting to test for connections between Archaeal and Bacterial communities, the quality of the POM they colonize, and the activities of extracellular enzymes. Aboard the Russian icebreaker Kapitan Dranitsyn during the NABOS 2005 cruise to the Laptev Sea, we sampled various size fractions of particulate matter, from 0.2 to 70 μm. Patterns of Archaeal and Bacterial diversity were analyzed using terminal restriction fragment length polymorphism (T-RFLP). Extracellular enzymatic activities were evaluated using fluorescent substrate analogs. Thus far, we have observed a statistically significant difference between particle-associated and free-living Bacteria, many of which appear (by clone library) to be gamma-proteobacteria or CFB. Bacterial community richness associated with the largest particle fractions, where protease and glucosidase activities were the highest, was best explained by indicators of primary productivity (chlorophyll a and phaeopigments), while richness associated with smaller size fractions was best explained by general particle indicators (and depth and salinity). In contrast, particle-associated Archaea were not significantly different from their free-living counterparts. Archaeal clone library results indicate a predominance of Marine Group 1 Crenarchaea, the group containing a recently isolated nitrifying Archaeon. Given all these results, we hypothesize that in the Laptev Sea cold-active Bacteria are the primary agents in the enzymatic degradation of POM, whether terrestrial or marine, while Archaea play other roles in the elemental cycles of Arctic waters, perhaps especially in the nitrogen

  12. Algal and archaeal polyisoprenoids in a recent marine sediment: Molecular isotopic evidence for anaerobic oxidation of methane RID C-7675-2009

    DEFF Research Database (Denmark)

    Bian, LQ; Hinrichs, KU; Xie, TM;

    2001-01-01

    Analyses of C-13 contents of individual organic molecules in a marine sediment show that crocetane, 2,6,11,15-tetramethylhexadecane, an isomer of phytane, is produced by microorganisms that use methane as their main source of carbon. The sediments lie at a water depth of 68 m in the Kattegat......-consuming member of the microbial consortium responsible for the anaerobic oxidation of methane [Hoehler et al., 1994], in which, as first demonstrated quantitatively in these sediments [Iversen and Jørgensen, 1985], electrons are transferred from methane to sulfate. The presence of archaeal biomass throughout...

  13. 印度尼西亚Padang Cermin热泉古菌多样性分析%Phylogenetic Diversity of Archaeal Community in the Hot Spring in Padang Cermin, Sumatra, Indonesia

    Institute of Scientific and Technical Information of China (English)

    沈继红; 宋维志; 林学政; 王帅; Dewi Seswita Zilda

    2012-01-01

    通过印度尼西亚苏门答腊岛Padang Cermin热泉环境基因组DNA构建古菌16S rRNA基因文库,并利用PCR-RFLP技术对其古菌多样性和系统发育分析进行了研究.根据限制性内切酶AluⅠ和MspⅠ的特征性酶切图谱,将62个阳性克隆归类为14个分类操作单位(operational taxonomic unit,OTU),文库的覆盖度达90.32%.克隆文库的优势类群为OTU2和OTU1,分别占克隆文库的27.42%和20.96%.从每个OUT中选取一个代表性克隆进行16S rRNA基因的序列测定与系统发育分析,结果表明,测定的Padang Cermin热泉中的古菌均属于泉古菌门,包括热变形菌目(Thermoproteales)、硫还原球菌目(Desulfurococcales)、杂色泉古菌(miscellaneous crenarchaeotic group,MCG)和未培养泉古菌(uncultured Crenarchaeota,UC),该热泉代表性克隆与GenBank数据库已有16S rRNA序列的相似性为91.9%~97.8%,而且与其相似性最高的序列均来自未培养的古菌克隆,由结果可见,Padang Cermin热泉古菌群落与已报道的其他热泉古菌群落的相似性较低,表明该热泉可能具有某些独特的特征,存在着特殊的古菌生态类群.%Diversity and phylogenetic analysis of archaea in the hot spring in Padang Cermin, Sumatra, Indonesia are investigated by constructing the 16S rRNA gene library of metagenomic DNA and using PCR-RFLP technique. Total 62 positive clones are classified into 14 operational taxonomic units (OTUs) according to their distinct restriction patterns of two kinds of restriction enzymes Alu Ⅰ and MspⅠ . A representative clone from each OTU is sequenced. The phylogenetic analysis shows that all archaea in the hot spring in Padang Cermin belong to Crenarchaeota, including Thermoproteales, Desulfurococcales, miscellaneous crenarchaeotic group (MCG) and some unidentified families. The similarities between the representative clone sequences from the hot spring in Padang Cermin and their closest sequences deposited in Gen

  14. Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

    Science.gov (United States)

    Robinson, Nicholas P

    2013-01-01

    Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

  15. Conversion of upland to paddy field specifically alters the community structure of archaeal ammonia oxidizers in an acid soil

    Directory of Open Access Journals (Sweden)

    M. S. Alam

    2013-08-01

    Full Text Available The function of ammonia-oxidizing archaea (AOA and bacteria (AOB depends on the major energy-generating compounds (i.e., ammonia and oxygen. The diversification of AOA and AOB communities along ecological gradients of substrate availability in a complex environment have been much debated but rarely tested. In this study, two ecosystems of maize and rice crops under different fertilization regimes were selected to investigate the community diversification of soil AOA and AOB upon conversion of an upland field to a paddy field and long-term field fertilization in an acid soil. Real-time quantitative polymerase chain reaction of ammonia monooxygenase (amoA genes demonstrated that the abundance of AOA was significantly stimulated after conversion of upland to paddy soils for more than 100 yr, whereas a slight decline in AOB numbers was observed. Denaturing gradient gel electrophoresis fingerprints of amoA genes further revealed remarkable changes in the community compositions of AOA after conversion of aerobic upland to flooded paddy field. Sequencing analysis revealed that upland soil was dominated by AOA within the soil group 1.1b lineage, whereas the marine group 1.1a-associated lineage predominated in AOA communities in paddy soils. Irrespective of whether the soil was upland or paddy soil, long-term field fertilization led to increased abundance of amoA genes in AOA and AOB compared with control treatments (no fertilization, whereas archaeal amoA gene abundances outnumbered their bacterial counterparts in all samples. Phylogenetic analyses of amoA genes showed that Nitrosospira cluster-3-like AOB dominated bacterial ammonia oxidizers in both paddy and upland soils, regardless of fertilization treatment. The results of this study suggest that the marine group 1.1a-associated AOA will be better adapted to the flooded paddy field than AOA ecotypes of the soil group 1.1b lineage, and indicate that long-term flooding is the dominant selective force

  16. Conversion of upland to paddy field specifically alters the community structure of archaeal ammonia oxidizers in an acid soil

    Science.gov (United States)

    Alam, M. S.; Ren, G. D.; Lu, L.; Zheng, Y.; Peng, X. H.; Jia, Z. J.

    2013-08-01

    The function of ammonia-oxidizing archaea (AOA) and bacteria (AOB) depends on the major energy-generating compounds (i.e., ammonia and oxygen). The diversification of AOA and AOB communities along ecological gradients of substrate availability in a complex environment have been much debated but rarely tested. In this study, two ecosystems of maize and rice crops under different fertilization regimes were selected to investigate the community diversification of soil AOA and AOB upon conversion of an upland field to a paddy field and long-term field fertilization in an acid soil. Real-time quantitative polymerase chain reaction of ammonia monooxygenase (amoA) genes demonstrated that the abundance of AOA was significantly stimulated after conversion of upland to paddy soils for more than 100 yr, whereas a slight decline in AOB numbers was observed. Denaturing gradient gel electrophoresis fingerprints of amoA genes further revealed remarkable changes in the community compositions of AOA after conversion of aerobic upland to flooded paddy field. Sequencing analysis revealed that upland soil was dominated by AOA within the soil group 1.1b lineage, whereas the marine group 1.1a-associated lineage predominated in AOA communities in paddy soils. Irrespective of whether the soil was upland or paddy soil, long-term field fertilization led to increased abundance of amoA genes in AOA and AOB compared with control treatments (no fertilization), whereas archaeal amoA gene abundances outnumbered their bacterial counterparts in all samples. Phylogenetic analyses of amoA genes showed that Nitrosospira cluster-3-like AOB dominated bacterial ammonia oxidizers in both paddy and upland soils, regardless of fertilization treatment. The results of this study suggest that the marine group 1.1a-associated AOA will be better adapted to the flooded paddy field than AOA ecotypes of the soil group 1.1b lineage, and indicate that long-term flooding is the dominant selective force driving the

  17. Sedimentary archaeal amoA gene abundance reflects historic nutrient level and salinity fluctuations in Qinghai Lake, Tibetan Plateau

    OpenAIRE

    Jian Yang; Hongchen Jiang; Hailiang Dong; Weiguo Hou; Gaoyuan Li; Geng Wu

    2015-01-01

    Integration of DNA derived from ancient phototrophs with their characteristic lipid biomarkers has been successfully employed to reconstruct paleoenvironmental conditions. However, it is poorly known that whether the DNA and lipids of microbial functional aerobes (such as ammonia-oxidizing archaea: AOA) can be used for reconstructing past environmental conditions. Here we identify and quantify the AOA amoA genes (encoding the alpha subunit of ammonia monooxygenases) preserved in a 5.8-m sedim...

  18. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  19. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

    International Nuclear Information System (INIS)

    A hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from S. solfataricus P1 has been crystallized as a recombinant protein with a vector-derived long N-terminal extension region. The P43212 crystals of recombinant ARF diffracted to 1.85 Å resolution using synchrotron radiation. The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule

  20. Transcriptome-wide mapping of 5-methylcytidine RNA modifications in bacteria, archaea, and yeast reveals m5C within archaeal mRNAs.

    Directory of Open Access Journals (Sweden)

    Sarit Edelheit

    2013-06-01

    Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.

  1. Abundance and Diversity of Bacterial, Archaeal, and Fungal Communities Along an Altitudinal Gradient in Alpine Forest Soils: What Are the Driving Factors?

    Science.gov (United States)

    Siles, José A; Margesin, Rosa

    2016-07-01

    Shifts in soil microbial communities over altitudinal gradients and the driving factors are poorly studied. Their elucidation is indispensable to gain a comprehensive understanding of the response of ecosystems to global climate change. Here, we investigated soil archaeal, bacterial, and fungal communities at four Alpine forest sites representing a climosequence, over an altitudinal gradient from 545 to 2000 m above sea level (asl), regarding abundance and diversity by using qPCR and Illumina sequencing, respectively. Archaeal community was dominated by Thaumarchaeota, and no significant shifts were detected in abundance or community composition with altitude. The relative bacterial abundance increased at higher altitudes, which was related to increasing levels of soil organic matter and nutrients with altitude. Shifts in bacterial richness and diversity as well as community structure (comprised basically of Proteobacteria, Acidobacteria, Actinobacteria, and Bacteroidetes) significantly correlated with several environmental and soil chemical factors, especially soil pH. The site at the lowest altitude harbored the highest bacterial richness and diversity, although richness/diversity community properties did not show a monotonic decrease along the gradient. The relative size of fungal community also increased with altitude and its composition comprised Ascomycota, Basidiomycota, and Zygomycota. Changes in fungal richness/diversity and community structure were mainly governed by pH and C/N, respectively. The variation of the predominant bacterial and fungal classes over the altitudinal gradient was the result of the environmental and soil chemical factors prevailing at each site. PMID:26961712

  2. Comparison of Fecal Methanogenic Archaeal Community Between Erhualian and Landrace Pigs Using Denaturing Gradient Gel Electrophoresis and Real-Time PCR Analysis

    Institute of Scientific and Technical Information of China (English)

    SU Yong; Hauke Smidt; ZHU Wei-Yun

    2014-01-01

    Erhualian and Landrace breeds are typical genetically obese and lean pigs, respectively. To compare the fecal methanogenic Archaeal community between these two pig breeds, fecal samples from different growth phase pigs were collected and used for PCR-denaturing gradient gel electrophoresis (DGGE) with two primer pairs (344fGC/519r and 519f/915rGC) and real-time PCR analysis. Results showed that a better separation and higher quality of bands pattern were obtained in DGGE proifles using primers 344fGC/519r as compared with primers 519f/915rGC. Sequencing of DGGE bands showed that the predominant methanogens in the feces of Erhualian and Landrace pigs belonged to Methanobrevibacter spp. and Methanosphaera spp. Real-time PCR analysis revealed that there was no signiifcant difference in the numbers of fecal total methanogens between Erhualian and Landrace pigs;however, pig growth phase affected the numbers of 16S rRNA genes of total methanogens and Methanobrevibacter smithii. Dissociation curves of methyl coenzyme-M reductase subunit A (mcrA) gene fragments ampliifed with real-time PCR showed all samples possessed a single peak at 82°C, which might be associated with M. smithii. Samples from the same growth phase of each breed showed good replicative dissociation curves. The results suggest that the growth phase (including diet factor) other than genotype of pig may affect the fecal methanogenic Archaeal community of pigs.

  3. Structures of minimal catalytic fragments of topoisomerase V reveals conformational changes relevant for DNA binding.

    Science.gov (United States)

    Rajan, Rakhi; Taneja, Bhupesh; Mondragón, Alfonso

    2010-07-14

    Topoisomerase V is an archaeal type I topoisomerase that is unique among topoisomerases due to presence of both topoisomerase and DNA repair activities in the same protein. It is organized as an N-terminal topoisomerase domain followed by 24 tandem helix-hairpin-helix (HhH) motifs. Structural studies have shown that the active site is buried by the (HhH) motifs. Here we show that the N-terminal domain can relax DNA in the absence of any HhH motifs and that the HhH motifs are required for stable protein-DNA complex formation. Crystal structures of various topoisomerase V fragments show changes in the relative orientation of the domains mediated by a long bent linker helix, and these movements are essential for the DNA to enter the active site. Phosphate ions bound to the protein near the active site helped model DNA in the topoisomerase domain and show how topoisomerase V may interact with DNA.

  4. DNA Microarrays

    Science.gov (United States)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  5. 海南东寨港红树林不同植被土壤微生物群落结构比较%Comparison of bacterial and archaeal community of mangrove soil under different vegetation in Dongzhaigang,Hainan Island

    Institute of Scientific and Technical Information of China (English)

    任健; 阎冰; 洪葵

    2012-01-01

    [Objective] We compared bacterial and archaeal diversity and community structure of mangrove soil under different vegetation, and to reveal better understanding of microbial resources. [Methods] Bacterial and arehaeal 16S rRNA gene libraries were constructed and analyzed for soils under Kandelia candel trees. Sonneratia apetala trees, and naked tideland, in Dongzhaigang Mangrove National Nature Reserve of Hainan Island. Template DNA was directly extracted from soil samples. PCR were amplified using primers 27F/1492R (bacterial) and Arch21F/Arch958R (archaeal). [ Results ] A total of 16 phyla dominated by Proteobacteria and Chloroflexi were detected in bacterial libraries, and 6 groups of Crenarchaeota and 7 groups of Euryarchaeota, predominated by Marine Benthic Group C and Marine Benthic Group D, respectively were found in archaeal libraries. 5hannon-Wiener index (H') and Srhaul estimator indicated that soil microbial diversity under the introduced species Sonneratia apetala was much lower than indigenous species Kandelia candel, even lower than naked tidal flat sediment near mangrove. Distinct differences in microbial community structure under different vegetation were observed. Soil microbial community structure under Kandelia candel was much similar with that of naked tideland. [ Conclusion ] Mangrove soil contained rich population of bacteria and archaea; there existed distinct differences in mangrove soil microbial community structure and diversity among different vegetation.%[目的]比较不同植被下红树林土壤细菌和古菌的多样性及群落结构,认识红树林土壤微生物资源多样性.[方法]直接提取红树林土壤总DNA,采用细菌通用引物27F/1492R和古菌通用引物Arch21 F/Arch958R进行PCR扩增,构建细菌和古菌16S rRNA基因文库,对海南东寨港自然保护区秋茄林、无瓣海桑林和无红树林裸滩土壤的细菌和古菌多样性和群落结构进行分析和比较.[结果]3种土壤样品的细菌类

  6. 利用小亚基核糖体RNA技术分析温室黄瓜近根土壤古菌和真菌多样性%Diversity analysis of archaeal and fungal communities in adjacent cucumber root soil samples in greenhouse by small-subunit rRNA gene cloning

    Institute of Scientific and Technical Information of China (English)

    赵志祥; 芦晓飞; 陈国华; 茆振川; 杨宇红; 刘二明; 谢丙炎

    2011-01-01

    土壤古菌和真菌在温室生态系统是仅次于细菌的微生物,具有类似于细菌的重要生态功能.通过构建古菌16S rRNA和真菌18S rRNA基因克隆文库,分析温室黄瓜近根土壤古菌和真菌群落结构组成,为开发利用温室这一特殊的生态环境中丰富的微生物资源以及理解微生物与植物间的互作提供参考依据.采用研磨-冻融-溶菌酶-蛋白酶K-SDS热处理以及CTAB处理等理化方法,提取和纯化微生物总DNA,构建古菌16S rRNA和真菌18S rRNA基因克隆文库.利用DOTUR软件将古菌和真菌序列按照相似性97%的标准分成若干个可操作分类单元(OTUs).土壤古菌克隆文库主要包括泉古菌门和未分类的古菌两大类,并有少部分广域古菌类群,所有泉古菌均属于热变形菌纲,共45个OTUs;真菌克隆文库包括真菌门的大多数亚门真菌,共24个OTUs,未发现担子菌亚门真菌.古菌多样性比较丰富,且发现少量的广域古菌(甲烷菌),这一情况可能与温室长期高温高湿,高有机质含量,土壤处于缺氧环境有关;土壤真菌的优势种群为子囊菌,占到土壤真菌的80%以上,这可能与绝大多数植物真菌性病害属于土传病害,通过菌丝体、菌核或子囊壳在土壤病残体中越冬有一定的关系.%Soil archaea and fungi play important roles in the greenhouse soil ecosystem. To develop and apply rich microbial resources in greenhouse ecological environment, and to understand the interaction between microbes and plants, we constructed archaeal 16S rRNA and fungai 18S rRNA gene libraries to analyze the compositions of archaeal and fungal communityies. Total greenhouse soil DNA was directly extracted and purified by skiving-thawing-lysozyme-proteinase K-SDS hot treatment and treatment of cetyltriethylammnonium bromide (CTAB). After PCR amplification, retrieving, ligating, transforming, screening of white clones, archaeal 16S rRNA and fungai 18S rRNA gene libraries were

  7. Mechanisms for the export of archaeal lipids down the water column in the upwelling area off Cape Blanc, North-West Africa

    Science.gov (United States)

    Ebersbach, Friederike; Goldenstein, Nadine; Iversen, Morten; Mollenhauer, Gesine; Hinrichs, Kai-Uwe

    2016-04-01

    Transport mechanisms of microbial membrane lipids from surface waters to the seafloor are poorly understood. In particular, pelagic archaeal glycerol dibiphytanyl glycerol tetraethers (GDGTs) from planktonic archaea are frequently used for reconstruction of ancient sea surface temperatures (Schouten et al. 2013). Because planktonic archaea are too small and neutrally buoyant to sink independently, transport vehicles for efficient export of fossil archaeal biomarkers to the sediment are required. The surface ocean is coupled with the deep ocean through biogenic sinking particles, a process known as the biological pump (Volk and Hoffert 1985). Two different pathways for particle formation, mainly taking place in the mesopelagic zone, are distinguished: Direct aggregation of phytoplankton blooms or grazing, resulting in phyto-detrital aggregates or reprocessed faecal material, respectively. Grazing and packaging into sinking particles is a possible export mechanism for GDGTs (Huguet et al. 2006). Moreover, it is assumed that phyto-detrital aggregates also play an important role in transporting GDGTs to the deep (Mollenhauer et al. 2015), but processes behind this pathway remain unclear. However, there are only few studies that link GDGT signals in sinking particles to the composition of the exported particulate matter (e.g. Yamamoto et al., 2012; Mollenhauer et al. 2015). Here we investigate sinking particles and suspended particulate matter (SPM) from spring blooms in 2012 and 2013 in the upwelling region in the Atlantic Ocean off Cape Blanc, Mauritania. We compare for the first time material from free-floating sediment traps (100, 200 and 400 m; purely sinking particles) with sinking particles and SPM from size fractionated in-situ pump (ISP) filters (several depths between 40 and 2350 m). This setup allows to relate the signal from archaeal lipids to (i) the flux of particulate organic carbon and the particle assemblages as revealed by the characterisation of

  8. The oxidative pentose phosphate pathway in the haloarchaeon Haloferax volcanii involves a novel type of glucose-6-phosphate dehydrogenase--The archaeal Zwischenferment.

    Science.gov (United States)

    Pickl, Andreas; Schönheit, Peter

    2015-04-28

    The oxidative pentose phosphate pathway (OPPP), catalyzing the oxidation of glucose-6-phosphate to ribulose-5-phosphate is ubiquitous in eukarya and bacteria but has not yet been reported in archaea. In haloarchaea a putative 6-phosphogluconate dehydrogenase (6PGDH) is annotated, whereas a gene coding for glucose-6-phosphate dehydrogenase (Glc6PDH) could not be identified. Here we report the purification and characterization of a novel type of Glc6PDH in Haloferax volcanii that is not related to bacterial and eukaryal Glc6PDHs and the encoding gene is designated as azf (archaeal zwischenferment). Further, recombinant H. volcanii 6PGDH was characterized. Deletion mutant analyses indicate that both, Glc6PDH and 6PGDH, are functionally involved in pentose phosphate formation in vivo. This is the first report on the operation of the OPPP in the domain of archaea.

  9. Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains.

    Science.gov (United States)

    Whitman, William B; Woyke, Tanja; Klenk, Hans-Peter; Zhou, Yuguang; Lilburn, Timothy G; Beck, Brian J; De Vos, Paul; Vandamme, Peter; Eisen, Jonathan A; Garrity, George; Hugenholtz, Philip; Kyrpides, Nikos C

    2015-01-01

    The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity.

  10. Exploring the biotechnologial applications in the archaeal domain Explorando as aplicações biotecnológicas do domínio archaea

    Directory of Open Access Journals (Sweden)

    S.M.C. Alquéres

    2007-09-01

    Full Text Available Archaea represent a considerable fraction of the prokaryotic world in marine and terrestrial ecosystems, indicating that organisms from this domain might have a large impact on global energy cycles. The extremophilic nature of many archaea has stimulated intense efforts to understand the physiological adaptations for living in extreme environments. Their unusual properties make them a potentially valuable resource in the development of novel biotechnological processes and industrial applications as new pharmaceuticals, cosmetics, nutritional supplements, molecular probes, enzymes, and fine chemicals. In the present mini-review, we show and discuss some exclusive characteristics of Archaea domain and the current knowledge about the biotechnological uses of the archaeal enzymes. The topics are: archaeal characteristics, phylogenetic division, biotechnological applications, isolation and cultivation of new microbes, achievements in genomics, and metagenomic.As arqueas representam uma considerável fração dos procariotos nos ecossistemas marinhos e terrestes, indicando que estes organismos devem possuir um grande impacto nos ciclos energéticos. A natureza extremofílica de muitas arqueas tem estimulado intensos esforços para compreender sua adaptação fisiológica a ambientes extremos. Suas propriedades incomus as tornam uma fonte valiosa no desenvolvimento de novos processos biotecnológicos e aplicações industriais como novos fármacos, cosméticos, suplementos nutricionais, sondas moleculares, enzimas e reagentes. Na presente mini-revisão, mostramos e discutimos algumas de suas características exclusivas correlacionando-as com seu potencial biotecnológico e aplicação industrial. Os tópicos são: características das arqueas, divisão filogenética, aplicações biotecnológicas, isolamento e cultivo de novos microrganismos, genoma e metagenoma.

  11. Sperm DNA oxidative damage and DNA adducts.

    Science.gov (United States)

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-12-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps=0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps=0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps=0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm

  12. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  13. DNA encoding a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  14. Characterization of large-insert DNA libraries from soil for environmental genomic studies of Archaea

    DEFF Research Database (Denmark)

    Treusch, Alexander H; Kletzin, Arnulf; Raddatz, Guenter;

    2004-01-01

    of taxonomic marker genes (other than 16S rRNA) has been identified that allows the assignment of genome fragments to specific lineages. The complete sequences of two genome fragments identified as being affiliated with Archaea, based on a gene encoding a CDC48 homologue and a thermosome subunit, respectively......Complex genomic libraries are increasingly being used to retrieve complete genes, operons or large genomic fragments directly from environmental samples, without the need to cultivate the respective microorganisms. We report on the construction of three large-insert fosmid libraries in total...... covering 3 Gbp of community DNA from two different soil samples, a sandy ecosystem and a mixed forest soil. In a fosmid end sequencing approach including 5376 sequence tags of approximately 700 bp length, we show that mostly bacterial and, to a much lesser extent, archaeal and eukaryotic genome fragments...

  15. Establishment of a method for extracting goat rumen microbial DNA used in direct PCR amplification%一种直接用于PCR扩增的山羊瘤胃微生物DNA提取方法的建立

    Institute of Scientific and Technical Information of China (English)

    许发芝; 吴胜国; 李吕木; 丁小玲

    2012-01-01

    目的 建立提取高质量的瘤胃微生物DNA的方法,为采用免培养技术研究山羊瘤胃微生物奠定基础.方法 采集山羊瘤胃内容物,用SDS高盐法提取微生物总DNA,以通用引物扩增细菌和古细菌的16S rDNA.结果 提取到的瘤胃微生物总DNA片段大于23 kb,PCR能够扩增出细菌和古细菌的16S rDNA片段.结论 用该提取方法得到的山羊瘤胃微生物总DNA能够满足后续实验的需要.%Objective To establish a method for extraction of high quality DNA, and lay a foundation for the research on goat rumen microorganism with uncultured technology. Method Goat rumen contents were collected and total microbial DNA was extracted with a high salt extraction of SDS. The 16S rDNA of bacteria and archaeal were amplified by the universal primer. Result The total rumen microbial DNA fragments extracted were larger than 23 kb. The fragments of bacterial and archaeal 16S rDNA could be amplified by PCR. Conclusion The rumen microbial total DNA extracted by this method can satisfy the need of the subsequent research.

  16. Modeling DNA Repair: Approaching In Vivo Techniques in the Hyperthermophile Sulfolobus Solfataricus

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, J.; Fuss, J.; Yannone, S.M.; Tainer, J.A.; Cooper, P.K.

    2005-01-01

    Archaea are found in some of the most extreme environments on earth and represent a third domain of life distinct from Eukarya and Eubacteria. The hyperthermophilic archaeon Sulfolobus solfataricus, isolated from acidic hot springs (80oC, pH 3) in Yellowstone National Park, has emerged as a potential model system for studying human DNA repair processes. Archaea are more closely related to Eukarya than to Eubacteria, suggesting that archaeal DNA repair machinery may model the complex human system much more closely than that of other prokaryotes. DNA repair requires coordinated protein-protein interactions that are frequently transient. Protein complexes that are transient at extreme temperatures where archaea thrive may be more stable at room temperature, allowing for the characterization of otherwise short-lived complexes. However, characterization of these systems in archaea has been limited by the absence of a stable in vivo transformation and expression system. The work presented here is a pilot study in gene cloning and recombinant protein expression in S. solfataricus. Three genes associated with DNA repair were selected for expression: MRE11, PCNA1, and a putative CSB homologue. Though preparation of these recombinant genes followed standard methods, preparation of a suitable vector proved more challenging. The shuttle vector pSSV64, derived from the SSV1 virus and the E. coli vector pBSSK+, was most successfully isolated from the DH5α E. coli strain. Currently, alternative vectors are being designed for more efficient genetic manipulations in S. solfataricus.

  17. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  18. DNA loops and semicatenated DNA junctions

    Directory of Open Access Journals (Sweden)

    Strauss François

    2000-07-01

    Full Text Available Abstract Background Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA · poly(TG DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA · poly(TG can vary markedly from the classical right handed DNA double helix and adopt diverse alternative conformations. Here we have studied the mechanism of formation and the structure of an alternative DNA structure, named Form X, which was observed previously by polyacrylamide gel electrophoresis of DNA fragments containing a tract of the CA microsatellite poly(CA · poly(TG but had not yet been characterized. Results Formation of Form X was found to occur upon reassociation of the strands of a DNA fragment containing a tract of poly(CA · poly(TG, in a process strongly stimulated by the nuclear proteins HMG1 and HMG2. By inserting Form X into DNA minicircles, we show that the DNA strands do not run fully side by side but instead form a DNA knot. When present in a closed DNA molecule, Form X becomes resistant to heating to 100°C and to alkaline pH. Conclusions Our data strongly support a model of Form X consisting in a DNA loop at the base of which the two DNA duplexes cross, with one of the strands of one duplex passing between the strands of the other duplex, and reciprocally, to form a semicatenated DNA junction also called a DNA hemicatenane.

  19. Characterisation of the microbial diversity in a pig manure storage pit using small subunit rDNA sequence analysis.

    Science.gov (United States)

    Snell-Castro, Raúl; Godon, Jean-Jacques; Delgenès, Jean-Philippe; Dabert, Patrick

    2005-04-01

    The microbial community structure of pig manure slurry (PMS) was determined with comparative analysis of 202 bacterial, 44 archaeal and 33 eukaryotic small subunit (SSU) rDNA partial sequences. Based on a criterion of 97% of sequence similarity, the phylogenetic analyses revealed a total of 108, eight and five phylotypes for the Bacteria, Archaea and Eukarya lineages, respectively. Only 36% of the bacterial phylotypes were closely related (>or=97% similarity) to any previously known sequence in databases. The bacterial groups most often represented in terms of phylotype and clone abundance were the Eubacterium (22% of total sequences), the Clostridium (15% of sequences), the Bacillus-Lactobacillus-Streptococcus subdivision (20% of sequences), theMycoplasma and relatives (10% of sequences) and the Flexibacter-Cytophaga-Bacteroides (20% of sequences). The global microbial community structure and phylotype diversity show a close relationship to the pig gastrointestinal tract ecosystem whereas phylotypes from the Acholeplasma-Anaeroplasma and the Clostridium purinolyticum groups appear to be better represented in manure. Archaeal diversity was dominated by three phylotypes clustering with a group of uncultured microorganisms of unknown activity and only distantly related to the Thermoplasmales and relatives. Other Archaea were methanogenic H2/CO2 utilisers. No known acetoclastic Archaea methanogen was found. Eukaryotic diversity was represented by a pluricellular nematode, two Alveolata, a Blastocystis and an Entamoebidae. Manure slurry physico-chemical characteristics were analysed. Possible inhibitory effects of acetate, sulphide and ammonia concentrations on the microbial anaerobic ecosystem are discussed. PMID:16329909

  20. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

    Science.gov (United States)

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie

    2014-04-01

    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

  1. Sedimentary archaeal amoA gene abundance reflects historic nutrient level and salinity fluctuations in Qinghai Lake, Tibetan Plateau

    Science.gov (United States)

    Yang, Jian; Jiang, Hongchen; Dong, Hailiang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng

    2015-12-01

    Integration of DNA derived from ancient phototrophs with their characteristic lipid biomarkers has been successfully employed to reconstruct paleoenvironmental conditions. However, it is poorly known that whether the DNA and lipids of microbial functional aerobes (such as ammonia-oxidizing archaea: AOA) can be used for reconstructing past environmental conditions. Here we identify and quantify the AOA amoA genes (encoding the alpha subunit of ammonia monooxygenases) preserved in a 5.8-m sediment core (spanning the last 18,500 years) from Qinghai Lake. Parallel analyses revealed that low amoA gene abundance corresponded to high total organic carbon (TOC) and salinity, while high amoA gene abundance corresponded to low TOC and salinity. In the Qinghai Lake region, TOC can serve as an indicator of paleo-productivity and paleo-precipitation, which is related to historic nutrient input and salinity. So our data suggest that temporal variation of AOA amoA gene abundance preserved in Qinghai Lake sediment may reflect the variations of nutrient level and salinity throughout the late Pleistocene and Holocene in the Qinghai Lake region.

  2. DNA extraction by zinc.

    OpenAIRE

    Kejnovský, E; Kypr, J

    1997-01-01

    A fast, very simple and efficient method of DNA extraction is described which takes advantage of DNA sedimentation induced by millimolar concentrations of ZnCl2. The zinc-induced sedimentation is furthermore strongly promoted by submillimolar phosphate anion concentrations. Within 90% of DNA irrespective of whether a plasmid DNA or short oligonucleotides are the extracted material. The method works with plasmid DNA and oligonucleotide concentrations as low as 100 ng/ml and 10 microg/ml, respe...

  3. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    International Nuclear Information System (INIS)

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  4. DNA fragmentation in apoptosis

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Cleavage of chromosomal DNA into oligonucleosomal size fragments is an integral part of apoptosis. Elegant biochemical work identified the DNA fragmentation factor (DFF) as a major apoptotic endonuclease for DNA fragmentation in vitro. Genetic studies in mice support the importance of DFF in DNA fragmentation and possibly in apoptosis in vivo. Recent work also suggests the existence of additional endonucleases for DNA degradation. Understanding the roles of individual endonucleases in apoptosis, and how they might coordinate to degrade DNA in different tissues during normal development and homeostasis, as well as in various diseased states, will be a major research focus in the near future.

  5. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants

    Science.gov (United States)

    Holman, Devin B.; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W.

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers’ grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills. PMID:27300323

  6. Novel viral genomes identified from six metagenomes reveal wide distribution of archaeal viruses and high viral diversity in terrestrial hot springs.

    Science.gov (United States)

    Gudbergsdóttir, Sóley Ruth; Menzel, Peter; Krogh, Anders; Young, Mark; Peng, Xu

    2016-03-01

    Limited by culture-dependent methods the number of viruses identified from thermophilic Archaea and Bacteria is still very small. In this study we retrieved viral sequences from six hot spring metagenomes isolated worldwide, revealing a wide distribution of four archaeal viral families, Ampullaviridae, Bicaudaviridae, Lipothrixviridae and Rudiviridae. Importantly, we identified 10 complete or near complete viral genomes allowing, for the first time, an assessment of genome conservation and evolution of the Ampullaviridae family as well as Sulfolobus Monocaudavirus 1 (SMV1)-related viruses. Among the novel genomes, one belongs to a putative thermophilic virus infecting the bacterium Hydrogenobaculum, for which no virus has been reported in the literature. Moreover, a high viral diversity was observed in the metagenomes, especially among the Lipothrixviridae, as indicated by the large number of unique contigs and the lack of a completely assembled genome for this family. This is further supported by the large number of novel genes in the complete and partial genomes showing no sequence similarities to public databases. CRISPR analysis revealed hundreds of novel CRISPR loci and thousands of novel CRISPR spacers from each metagenome, reinforcing the notion of high viral diversity in the thermal environment.

  7. Characterization of Bacterial, Archaeal and Eukaryote Symbionts from Antarctic Sponges Reveals a High Diversity at a Three-Domain Level and a Particular Signature for This Ecosystem

    Science.gov (United States)

    Rodríguez-Marconi, Susana; De la Iglesia, Rodrigo; Díez, Beatriz; Fonseca, Cássio A.; Hajdu, Eduardo; Trefault, Nicole

    2015-01-01

    Sponge-associated microbial communities include members from the three domains of life. In the case of bacteria, they are diverse, host specific and different from the surrounding seawater. However, little is known about the diversity and specificity of Eukarya and Archaea living in association with marine sponges. This knowledge gap is even greater regarding sponges from regions other than temperate and tropical environments. In Antarctica, marine sponges are abundant and important members of the benthos, structuring the Antarctic marine ecosystem. In this study, we used high throughput ribosomal gene sequencing to investigate the three-domain diversity and community composition from eight different Antarctic sponges. Taxonomic identification reveals that they belong to families Acarnidae, Chalinidae, Hymedesmiidae, Hymeniacidonidae, Leucettidae, Microcionidae, and Myxillidae. Our study indicates that there are different diversity and similarity patterns between bacterial/archaeal and eukaryote microbial symbionts from these Antarctic marine sponges, indicating inherent differences in how organisms from different domains establish symbiotic relationships. In general, when considering diversity indices and number of phyla detected, sponge-associated communities are more diverse than the planktonic communities. We conclude that three-domain microbial communities from Antarctic sponges are different from surrounding planktonic communities, expanding previous observations for Bacteria and including the Antarctic environment. Furthermore, we reveal differences in the composition of the sponge associated bacterial assemblages between Antarctic and tropical-temperate environments and the presence of a highly complex microbial eukaryote community, suggesting a particular signature for Antarctic sponges, different to that reported from other ecosystems. PMID:26421612

  8. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Science.gov (United States)

    Holman, Devin B; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills. PMID:27300323

  9. Crystallization and preliminary X-ray diffraction analysis of an archaeal tRNA-modification enzyme, TiaS, complexed with tRNAIle2 and ATP

    International Nuclear Information System (INIS)

    A. fulgidus TiaS was cocrystallized with tRNAIle2 and ATP and X-ray diffraction data were collected to 2.9 Å resolution using a synchrotron-radiation source. The cytidine at the first anticodon position of archaeal tRNAIle2, which decodes the isoleucine AUA codon, is modified to 2-agmatinylcytidine (agm2C) to guarantee the fidelity of protein biosynthesis. This post-transcriptional modification is catalyzed by tRNAIle-agm2C synthetase (TiaS) using ATP and agmatine as substrates. Archaeoglobus fulgidus TiaS was overexpressed in Escherichia coli cells and purified. tRNAIle2 was prepared by in vitro transcription with T7 RNA polymerase. TiaS was cocrystallized with both tRNAIle2 and ATP by the vapour-diffusion method. The crystals of the TiaS–tRNAIle2–ATP complex diffracted to 2.9 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the primitive hexagonal space group P3221, with unit-cell parameters a = b = 131.1, c = 86.6 Å. The asymmetric unit is expected to contain one TiaS–tRNAIle2–ATP complex, with a Matthews coefficient of 2.8 Å3 Da−1 and a solvent content of 61%

  10. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Science.gov (United States)

    Holman, Devin B; Hao, Xiying; Topp, Edward; Yang, Hee Eun; Alexander, Trevor W

    2016-01-01

    Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills.

  11. Effect of Co-Composting Cattle Manure with Construction and Demolition Waste on the Archaeal, Bacterial, and Fungal Microbiota, and on Antimicrobial Resistance Determinants.

    Directory of Open Access Journals (Sweden)

    Devin B Holman

    Full Text Available Agricultural operations generate large quantities of manure which must be eliminated in a manner that is consistent with public health guidelines. Meanwhile, construction and demolition waste makes up about 25% of total solid municipal waste. Co-composting of manure with construction and demolition waste offers a potential means to make manure safe for soil amendment and also divert construction and demolition waste from municipal landfills. Therefore, the archaeal, bacterial, and fungal microbiota of two different types of composted cattle manure and one co-composted with construction and demolition waste, were assessed over a 99-day composting period. The microbiota of the three compost mixtures did not differ, but significant changes over time and by sampling depth were observed. Bacillus and Halocella, however, were more relatively abundant in composted manure from cattle fed dried distillers' grains and solubles. Proteobacteria and Bacteroidetes were enriched at day 0 and Firmicutes at day 99. The fungal genus Kernia was the most relatively abundant overall and was enriched at day 0. The concentration of 12 antimicrobial resistance determinants in the compost mixtures was also determined, and 10 of these determinants decreased significantly from days 0 to 99. The addition of construction and demolition waste did not affect the persistence of antimicrobial resistance genes or community structure of the compost microbiota and therefore co-composting construction and demolition waste with cattle manure offers a safe, viable way to divert this waste from landfills.

  12. Exploring Archaeal Communities And Genomes Across Five Deep-Sea Brine Lakes Of The Red Sea With A Focus On Methanogens

    KAUST Repository

    Guan, Yue

    2015-12-15

    The deep-sea hypersaline lakes in the Red Sea are among the most challenging, extreme, and unusual environments on the planet Earth. Despite their harshness to life, they are inhabited by diverse and novel members of prokaryotes. Methanogenesis was proposed as one of the main metabolic pathways that drive microbial colonization in similar habitats. However, not much is known about the identities of the methane-producing microbes in the Red Sea, let alone the way in which they could adapt to such poly extreme environments. Combining a range of microbial community assessment, cultivation and omics (genomics, transcriptomics, and single amplified genomics) approaches, this dissertation seeks to fill these gaps in our knowledge by studying archaeal composition, particularly methanogens, their genomic capacities and transcriptomic characteristics in order to elucidate their diversity, function, and adaptation to the deep-sea brines of the Red Sea. Although typical methanogens are not abundant in the samples collected from brine pool habitats of the Red Sea, the pilot cultivation experiment has revealed novel halophilic methanogenic species of the domain Archaea. Their physiological traits as well as their genomic and transcriptomic features unveil an interesting genetic and functional adaptive capacity that allows them to thrive in the unique deep-sea hypersaline environments in the Red Sea.

  13. Bacterial and Archaeal Communities Variability Associated with Upwelling and Anthropogenic Pressures in the Protection Area of Arraial do Cabo (Cabo Frio region - RJ).

    Science.gov (United States)

    Coelho-Souza, Sergio A; Araújo, Fábio V; Cury, Juliano C; Jesus, Hugo E; Pereira, Gilberto C; Guimarães, Jean R D; Peixoto, Raquel S; Dávila, Alberto M R; Rosado, Alexandre S

    2015-09-01

    Upwelling systems contain a high diversity of pelagic microorganisms and their composition and activity are defined by factors like temperature and nutrient concentration. Denaturing gradient gel electrophoresis (DGGE) technique was used to verify the spatial and temporal genetic variability of Bacteria and Archaea in two stations of the Arraial do Cabo coastal region, one under upwelling pressure and another under anthropogenic pressure. In addition, biotic and abiotic variables were measured in surface and deep waters from three other stations between these stations. Six samplings were done during a year and adequately represented the degrees of upwelling and anthropogenic pressures to the system. Principal Component Analysis (PCA) showed negative correlations between the concentrations of ammonia and phosphorous with prokaryotic secondary production and the total heterotrophic bacteria. PCA also showed negative correlation between temperature and the abundance of prokaryotic cells. Bacterial and archaeal compositions were changeable as were the oceanographic conditions, and upwelling had a regional pressure while anthropogenic pressure was punctual. We suggest that the measurement of prokaryotic secondary production was associated with both Bacteria and Archaea activities, and that substrate availability and temperature determine nutrients cycling. PMID:26375020

  14. Investigation of Archaeal and Bacterial community structure of five different small drinking water networks with special regard to the nitrifying microorganisms.

    Science.gov (United States)

    Nagymáté, Zsuzsanna; Homonnay, Zalán G; Márialigeti, Károly

    2016-01-01

    Total microbial community structure, and particularly nitrifying communities inhabiting five different small drinking water networks characterized with different water physical and chemical parameters was investigated, using cultivation-based methods and sequence aided Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis. Ammonium ion, originated from well water, was only partially oxidized via nitrite to nitrate in the drinking water distribution systems. Nitrification occurred at low ammonium ion concentration (27-46μM), relatively high pH (7.6-8.2) and over a wide range of dissolved oxygen concentrations (0.4-9.0mgL(-1)). The nitrifying communities of the distribution systems were characterized by variable most probable numbers (2×10(2)-7.1×10(4) MPN L(-1)) and probably originated from the non-treated well water. The sequence aided T-RFLP method revealed that ammonia-oxidizing microorganisms and nitrite-oxidizing Bacteria (Nitrosomonas oligotropha, Nitrosopumilus maritimus, and Nitrospira moscoviensis, 'Candidatus Nitrospira defluvii') were present in different ratios in the total microbial communities of the distinct parts of the water network systems. The nitrate generated by nitrification was partly utilized by nitrate-reducing (and denitrifying) Bacteria, present in low MPN and characterized by sequence aided T-RFLP as Comamonas sp. and Pseudomonas spp. Different environmental factors, like pH, chemical oxygen demand, calculated total inorganic nitrogen content (moreover nitrite and nitrate concentration), temperature had important effect on the total bacterial and archaeal community distribution. PMID:27296965

  15. [Uracil-DNA glycosylases].

    Science.gov (United States)

    Pytel, Dariusz; Słupianek, Artur; Ksiazek, Dominika; Skórski, Tomasz; Błasiak, Janusz

    2008-01-01

    Uracil is one of four nitrogen bases, most frequently found in normal RNA. Uracyl can be found also in DNA as a result of enzymatic or non-enzymatic deamination of cytosine as well as misincorporation of dUMP instead of dTMP during DNA replication. Uracil from DNA can be removed by DNA repair enzymes with apirymidine site as an intermediate. However, if uracil is not removed from DNA a pair C:G in parental DNA can be changed into a T:A pair in the daughter DNA molecule. Therefore, uracil in DNA may lead to a mutation. Uracil in DNA, similarly to thymine, forms energetically most favorable hydrogen bonds with adenine, therefore uracil does not change the coding properties of DNA. Uracil in DNA is recognized by uracil DNA glycosylase (UDGs), which initiates DNA base excision repair, leading to removing of uracil from DNA and replacing it by thymine or cytosine, when arose as a result of cytosine deamination. Eukaryotes have at least four nuclear UDGs: UNG2, SMUG1, TDG i MBD4, while UNG1 operates in the mitochondrium. UNG2 is involved in DNA repair associated with DNA replication and interacts with PCNA and RPA proteins. Uracil can also be an intermediate product in the process of antigen-dependent antibody diversification in B lymphocytes. Enzymatic deamination of viral DNA by host cells can be a defense mechanism against viral infection, including HIV-1. UNG2, MBD4 and TDG glycosylases may cooperate with mismatch repair proteins and TDG can be involved in nucleotide excision repair system.

  16. DNA damage and autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely [Redox Biology Center and School of Veterinary Medicine and Biomedical Sciences, University of Nebraska-Lincoln, Lincoln, NE 68583 (United States); Panayiotidis, Mihalis I. [School of Community Health Sciences, University of Nevada, Reno, NV 89557 (United States); Franco, Rodrigo, E-mail: rfrancocruz2@unl.edu [Redox Biology Center and School of Veterinary Medicine and Biomedical Sciences, University of Nebraska-Lincoln, Lincoln, NE 68583 (United States)

    2011-06-03

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  17. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic

  18. A virus of hyperthermophilic archaea with a unique architecture among DNA viruses.

    Science.gov (United States)

    Rensen, Elena Ilka; Mochizuki, Tomohiro; Quemin, Emmanuelle; Schouten, Stefan; Krupovic, Mart; Prangishvili, David

    2016-03-01

    Viruses package their genetic material in diverse ways. Most known strategies include encapsulation of nucleic acids into spherical or filamentous virions with icosahedral or helical symmetry, respectively. Filamentous viruses with dsDNA genomes are currently associated exclusively with Archaea. Here, we describe a filamentous hyperthermophilic archaeal virus, Pyrobaculum filamentous virus 1 (PFV1), with a type of virion organization not previously observed in DNA viruses. The PFV1 virion, 400 ± 20 × 32 ± 3 nm, contains an envelope and an inner core consisting of two structural units: a rod-shaped helical nucleocapsid formed of two 14-kDa major virion proteins and a nucleocapsid-encompassing protein sheath composed of a single major virion protein of 18 kDa. The virion organization of PFV1 is superficially similar to that of negative-sense RNA viruses of the family Filoviridae, including Ebola virus and Marburg virus. The linear dsDNA of PFV1 carries 17,714 bp, including 60-bp-long terminal inverted repeats, and contains 39 predicted ORFs, most of which do not show similarities to sequences in public databases. PFV1 is a lytic virus that completely disrupts the host cell membrane at the end of the infection cycle.

  19. Analysis of dsDNA and RNA viromes in methanogenic digesters reveals novel viral genetic diversity.

    Science.gov (United States)

    Calusinska, Magdalena; Marynowska, Martyna; Goux, Xavier; Lentzen, Esther; Delfosse, Philippe

    2016-04-01

    Although viruses are not the key players of the anaerobic digestion process, they may affect the dynamics of bacterial and archaeal populations involved in biogas production. Until now viruses have received very little attention in this specific habitat; therefore, as a first step towards their characterization, we optimized a virus filtration protocol from anaerobic sludge. Afterwards, to assess dsDNA and RNA viral diversity in sludge samples from nine different reactors fed either with waste water, agricultural residues or solid municipal waste plus agro-food residues, we performed metagenomic analyses. As a result we showed that, while the dsDNA viromes (21 assigned families in total) were dominated by dsDNA phages of the order Caudovirales, RNA viruses (14 assigned families in total) were less diverse and were for the main part plant-infecting viruses. Interestingly, less than 2% of annotated contigs were assigned as putative human and animal pathogens. Our study greatly extends the existing view of viral genetic diversity in methanogenic reactors and shows that these viral assemblages are distinct not only among the reactor types but also from nearly 30 other environments already studied, including the human gut, fermented food, deep sea sediments and other aquatic habitats. PMID:26568175

  20. Epigenetic Switch Driven by DNA Inversions Dictates Phase Variation in Streptococcus pneumoniae.

    Science.gov (United States)

    Li, Jing; Li, Jing-Wen; Feng, Zhixing; Wang, Juanjuan; An, Haoran; Liu, Yanni; Wang, Yang; Wang, Kailing; Zhang, Xuegong; Miao, Zhun; Liang, Wenbo; Sebra, Robert; Wang, Guilin; Wang, Wen-Ching; Zhang, Jing-Ren

    2016-07-01

    DNA methylation is an important epigenetic mechanism for phenotypic diversification in all forms of life. We previously described remarkable cell-to-cell heterogeneity in epigenetic pattern within a clonal population of Streptococcus pneumoniae, a leading human pathogen. We here report that the epigenetic diversity is caused by extensive DNA inversions among hsdSA, hsdSB, and hsdSC, three methyltransferase hsdS genes in the Spn556II type-I restriction modification (R-M) locus. Because hsdSA encodes the sequence recognition subunit of this type-I R-M DNA methyltransferase, these site-specific recombinations generate pneumococcal cells with variable HsdSA alleles and thereby diverse genome methylation patterns. Most importantly, the DNA methylation pattern specified by the HsdSA1 allele leads to the formation of opaque colonies, whereas the pneumococci lacking HsdSA1 produce transparent colonies. Furthermore, this HsdSA1-dependent phase variation requires intact DNA methylase activity encoded by hsdM in the Spn556II (renamed colony opacity determinant or cod) locus. Thus, the DNA inversion-driven ON/OFF switch of the hsdSA1 allele in the cod locus and resulting epigenetic switch dictate the phase variation between the opaque and transparent phenotypes. Phase variation has been well documented for its importance in pneumococcal carriage and invasive infection, but its molecular basis remains unclear. Our work has discovered a novel epigenetic cause for this significant pathobiology phenomenon in S. pneumoniae. Lastly, our findings broadly represents a significant advancement in our understanding of bacterial R-M systems and their potential in shaping epigenetic and phenotypic diversity of the prokaryotic organisms because similar site-specific recombination systems widely exist in many archaeal and bacterial species. PMID:27427949

  1. Epigenetic Switch Driven by DNA Inversions Dictates Phase Variation in Streptococcus pneumoniae

    Science.gov (United States)

    Wang, Juanjuan; An, Haoran; Liu, Yanni; Wang, Kailing; Miao, Zhun; Liang, Wenbo; Sebra, Robert; Wang, Guilin; Wang, Wen-Ching; Zhang, Jing-Ren

    2016-01-01

    DNA methylation is an important epigenetic mechanism for phenotypic diversification in all forms of life. We previously described remarkable cell-to-cell heterogeneity in epigenetic pattern within a clonal population of Streptococcus pneumoniae, a leading human pathogen. We here report that the epigenetic diversity is caused by extensive DNA inversions among hsdSA, hsdSB, and hsdSC, three methyltransferase hsdS genes in the Spn556II type-I restriction modification (R-M) locus. Because hsdSA encodes the sequence recognition subunit of this type-I R-M DNA methyltransferase, these site-specific recombinations generate pneumococcal cells with variable HsdSA alleles and thereby diverse genome methylation patterns. Most importantly, the DNA methylation pattern specified by the HsdSA1 allele leads to the formation of opaque colonies, whereas the pneumococci lacking HsdSA1 produce transparent colonies. Furthermore, this HsdSA1-dependent phase variation requires intact DNA methylase activity encoded by hsdM in the Spn556II (renamed colony opacity determinant or cod) locus. Thus, the DNA inversion-driven ON/OFF switch of the hsdSA1 allele in the cod locus and resulting epigenetic switch dictate the phase variation between the opaque and transparent phenotypes. Phase variation has been well documented for its importance in pneumococcal carriage and invasive infection, but its molecular basis remains unclear. Our work has discovered a novel epigenetic cause for this significant pathobiology phenomenon in S. pneumoniae. Lastly, our findings broadly represents a significant advancement in our understanding of bacterial R-M systems and their potential in shaping epigenetic and phenotypic diversity of the prokaryotic organisms because similar site-specific recombination systems widely exist in many archaeal and bacterial species. PMID:27427949

  2. Modeling DNA Replication.

    Science.gov (United States)

    Bennett, Joan

    1998-01-01

    Recommends the use of a model of DNA made out of Velcro to help students visualize the steps of DNA replication. Includes a materials list, construction directions, and details of the demonstration using the model parts. (DDR)

  3. HPV DNA test

    Science.gov (United States)

    The HPV DNA test is used to check for high-risk HPV infection in women. HPV infection around the genitals is ... warts spread when you have sex. The HPV-DNA test is generally not recommended for detecting low- ...

  4. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  5. Recombinant DNA in Medicine

    OpenAIRE

    Cederbaum, Stephen D.; Fareed, George C.; Lovett, Michael A.; Shapiro, Larry J.

    1984-01-01

    Studies in bacteria and bacterial viruses have led to methods to manipulate and recombine DNA in unique and reproducible ways and to amplify these recombined molecules millions of times. Once properly identified, the recombinant DNA molecules can be used in various ways useful in medicine and human biology. There are many applications for recombinant DNA technology. Cloned complementary DNA has been used to produce various human proteins in microorganisms. Insulin and growth hormone have been...

  6. DNA Damage Response

    OpenAIRE

    Giglia-Mari, Giuseppina; Zotter, Angelika; Vermeulen, Wim

    2011-01-01

    Structural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network of DNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance processes, and cell-cycle checkpoints safeguard genomic integrity. Like transcription and replication, DDR is a chromatin-associated process that is generally tightly controlled in time and space. As DNA damag...

  7. DNA-Mediated Electrochemistry

    OpenAIRE

    Gorodetsky, Alon A.; Buzzeo, Marisa C.; Barton, Jacqueline K.

    2008-01-01

    The base pair stack of DNA has been demonstrated as a medium for long-range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here, we discuss the characteristi...

  8. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  9. DNA damage response

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); A. Zotter (Angelika); W. Vermeulen (Wim)

    2011-01-01

    textabstractStructural changes to DNA severely affect its functions, such as replication and transcription, and play a major role in age-related diseases and cancer. A complicated and entangled network ofDNA damage response (DDR) mechanisms, including multiple DNA repair pathways, damage tolerance p

  10. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir;

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  11. Seasonal changes in bacterial and archaeal gene expression patterns across salinity gradients in the Columbia River coastal margin.

    Directory of Open Access Journals (Sweden)

    Maria W Smith

    Full Text Available Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM. A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April and late summer (August. Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition

  12. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    NARCIS (Netherlands)

    Vlijm, R.; Torre, J.; Dekker, C.

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, h

  13. Racemic DNA crystallography.

    Science.gov (United States)

    Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

    2014-12-22

    Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA.

  14. Electronic Transport in DNA

    OpenAIRE

    Klotsa, Daphne; Römer, Rudolf A.; Turner, Matthew S.

    2005-01-01

    We study the electronic properties of DNA by way of a tight-binding model applied to four particular DNA sequences. The charge transfer properties are presented in terms of localisation lengths, crudely speaking the length over which electrons travel. Various types of disorder, including random potentials, are employed to account for different real environments. We have performed calculations on poly(dG)-poly(dC), telomeric-DNA, random-ATGC DNA and lambda-DNA. We find that random and lambda-D...

  15. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske;

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  16. DNA in Nanoscale Electronics

    Science.gov (United States)

    Slinker, Jason

    2012-10-01

    DNA, the quintessential molecule of life, possesses a number of attractive properties for use in nanoscale circuits. Charge transport (CT) through DNA itself is of both fundamental and practical interest. Fundamentally, DNA has a unique configuration of π-stacked bases in a well ordered, double helical structure. Given its unparalleled importance to life processes and its arrangement of conjugated subunits, DNA has been a compelling target of conductivity studies. In addition, further understanding of DNA CT will elucidate the biological implications of this process and advance its use in sensing technologies. We have investigated the fundamentals of DNA CT by measuring the electrochemistry of DNA monolayers under biologically-relevant conditions. We have uncovered both fundamental kinetic parameters to distinguish between competing models of operation as well as the practical implications of DNA CT for sensing. Furthermore, we are leveraging our studies of DNA conductivity for the manufacture of nanoscale circuits. We are investigating the electrical properties and self-assembly of DNA nanowires containing artificial base pair surrogates, which can be prepared through low cost and high throughput automated DNA synthesis. This unique and economically viable approach will establish a new paradigm for the scalable manufacture of nanoscale semiconductor devices.

  17. Biophysics of DNA

    CERN Document Server

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  18. Pyrosequencing of mcrA and archaeal 16S rRNA genes reveals diversity and substrate preferences of methanogen communities in anaerobic digesters.

    Science.gov (United States)

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng; Lee, Patrick K H

    2015-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield.

  19. Temporal changes in abundance and composition of ammonia-oxidizing bacterial and archaeal communities in a drained peat soil in relation to N{sub 2}O emissions

    Energy Technology Data Exchange (ETDEWEB)

    Andert, Janet [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Microbiology; Max-Planck-Institute of Colloids and Interfaces, Potsdam (Germany); Wessen, Ella; Hallin, Sara [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Microbiology; Boerjesson, Gunnar [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Soil and Environment

    2011-12-15

    Boreal peat soils comprise about 3% of the terrestrial environments, and when drained, they become sources of the greenhouse gas nitrous oxide (N{sub 2}O). Ammonia oxidation can result in N{sub 2}O emissions, either directly or by fuelling denitrification, but we know little about the ecology of ammonia-oxidizing bacteria (AOB) and archaea (AOA) in peat soils. Our aim was to determine temporal alterations in abundance and composition of these communities in a drained and forested peat soil in relation to N{sub 2}O emissions and ammonia oxidation activity. Materials and methods The peat was sampled at three different depths in the upper 0.5 m over a period of 9 months covering two summer and two winter samplings. Community composition and abundance were determined by T-RFLP and quantitative real-time PCR of the bacterial and archaeal amoA genes. Potential ammonia oxidation rates were measured using the chlorate inhibition technique, and in situ N{sub 2}O emission was determined using chambers. Results and discussion The soil parameters displayed little spatial and temporal heterogeneity, which probably explained why there were no depth-related effects on the abundance, composition, or activity of the ammonia oxidizers. In contrast to most terrestrial environments, the AOB dominated numerically over the AOA. Both groups changed in community composition between sampling occasions, although the AOB showed more significant seasonal signatures than the AOA. Temporal changes in abundance were only observed for the AOB, with a decrease in numbers from May to March. Such differences were not reflected by the activity or N{sub 2}O emissions. Conclusions The high ammonium concentrations in the peat soil likely favored the AOB over the AOA, and we hypothesize that they were more active than the AOA and therefore responded to climatic and environmental changes. However, other processes rather than ammonia oxidation were likely responsible for N{sub 2}O emissions at the site.

  20. The Effect of Dietary Replacement of Ordinary Rice with Red Yeast Rice on Nutrient Utilization, Enteric Methane Emission and Rumen Archaeal Diversity in Goats

    Science.gov (United States)

    Wang, L. Z.; Zhou, M. L.; Wang, J. W.; Wu, D.; Yan, T.

    2016-01-01

    Twenty castrated Boer crossbred goats were used in the present study with two treatments to examine the effect of dietary replacement of ordinary rice with red yeast rice on nutrient utilization, enteric methane emission and ruminal archaea structure and composition. Two treatment diets contained (DM basis) 70.0% of forage, 21.8% of concentrates and 8.2% of either ordinary rice (control) or red yeast rice (RYR). Nutrient utilization was measured and enteric methane emissions were determined in respiration chambers. Results showed that RYR had significantly lower digestibility of N and organic matter compared to control group. However, feeding red yeast rice did not affect N retention as g/d or a proportion of N intake, and reduced heat production as MJ/d or as a proportion of metabolizable energy intake, thus leading to a higher proportion of metabolizable energy intake to be retained in body tissue. RYR also had significantly lower methane emissions either as g/d, or as a proportion of feed intake. Although feeding red yeast rice had no negative effect on any rumen fermentation variables, it decreased serum contents of total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol. In the present study, 75616 archaeal sequences were generated and clustered into 2364 Operational Taxonomic Units. At the genus level, the predominant archaea in the rumen of goats was Methanobrevibacter, which was significantly inhibited with the supplementation of red yeast rice. In conclusion, red yeast rice is a potential feed ingredient for mitigation of enteric methane emissions of goats. However, caution should be taken when it is used because it may inhibit the digestibility of some nutrients. Further studies are required to evaluate its potential with different diets and animal species, as well as its effects on animal health and food safety. PMID:27467559

  1. The Effect of Dietary Replacement of Ordinary Rice with Red Yeast Rice on Nutrient Utilization, Enteric Methane Emission and Rumen Archaeal Diversity in Goats.

    Science.gov (United States)

    Wang, L Z; Zhou, M L; Wang, J W; Wu, D; Yan, T

    2016-01-01

    Twenty castrated Boer crossbred goats were used in the present study with two treatments to examine the effect of dietary replacement of ordinary rice with red yeast rice on nutrient utilization, enteric methane emission and ruminal archaea structure and composition. Two treatment diets contained (DM basis) 70.0% of forage, 21.8% of concentrates and 8.2% of either ordinary rice (control) or red yeast rice (RYR). Nutrient utilization was measured and enteric methane emissions were determined in respiration chambers. Results showed that RYR had significantly lower digestibility of N and organic matter compared to control group. However, feeding red yeast rice did not affect N retention as g/d or a proportion of N intake, and reduced heat production as MJ/d or as a proportion of metabolizable energy intake, thus leading to a higher proportion of metabolizable energy intake to be retained in body tissue. RYR also had significantly lower methane emissions either as g/d, or as a proportion of feed intake. Although feeding red yeast rice had no negative effect on any rumen fermentation variables, it decreased serum contents of total cholesterol, triglycerides, HDL-cholesterol and LDL-cholesterol. In the present study, 75616 archaeal sequences were generated and clustered into 2364 Operational Taxonomic Units. At the genus level, the predominant archaea in the rumen of goats was Methanobrevibacter, which was significantly inhibited with the supplementation of red yeast rice. In conclusion, red yeast rice is a potential feed ingredient for mitigation of enteric methane emissions of goats. However, caution should be taken when it is used because it may inhibit the digestibility of some nutrients. Further studies are required to evaluate its potential with different diets and animal species, as well as its effects on animal health and food safety. PMID:27467559

  2. Impact of age-associated cyclopurine lesions on DNA repair helicases.

    Science.gov (United States)

    Khan, Irfan; Suhasini, Avvaru N; Banerjee, Taraswi; Sommers, Joshua A; Kaplan, Daniel L; Kuper, Jochen; Kisker, Caroline; Brosh, Robert M

    2014-01-01

    8,5' cyclopurine deoxynucleosides (cPu) are locally distorting DNA base lesions corrected by nucleotide excision repair (NER) and proposed to play a role in neurodegeneration prevalent in genetically defined Xeroderma pigmentosum (XP) patients. In the current study, purified recombinant helicases from different classifications based on sequence homology were examined for their ability to unwind partial duplex DNA substrates harboring a single site-specific cPu adduct. Superfamily (SF) 2 RecQ helicases (RECQ1, BLM, WRN, RecQ) were inhibited by cPu in the helicase translocating strand, whereas helicases from SF1 (UvrD) and SF4 (DnaB) tolerated cPu in either strand. SF2 Fe-S helicases (FANCJ, DDX11 (ChlR1), DinG, XPD) displayed marked differences in their ability to unwind the cPu DNA substrates. Archaeal Thermoplasma acidophilum XPD (taXPD), homologue to the human XPD helicase involved in NER DNA damage verification, was impeded by cPu in the non-translocating strand, while FANCJ was uniquely inhibited by the cPu in the translocating strand. Sequestration experiments demonstrated that FANCJ became trapped by the translocating strand cPu whereas RECQ1 was not, suggesting the two SF2 helicases interact with the cPu lesion by distinct mechanisms despite strand-specific inhibition for both. Using a protein trap to simulate single-turnover conditions, the rate of FANCJ or RECQ1 helicase activity was reduced 10-fold and 4.5-fold, respectively, by cPu in the translocating strand. In contrast, single-turnover rates of DNA unwinding by DDX11 and UvrD helicases were only modestly affected by the cPu lesion in the translocating strand. The marked difference in effect of the translocating strand cPu on rate of DNA unwinding between DDX11 and FANCJ helicase suggests the two Fe-S cluster helicases unwind damaged DNA by distinct mechanisms. The apparent complexity of helicase encounters with an unusual form of oxidative damage is likely to have important consequences in the

  3. Impact of age-associated cyclopurine lesions on DNA repair helicases.

    Directory of Open Access Journals (Sweden)

    Irfan Khan

    Full Text Available 8,5' cyclopurine deoxynucleosides (cPu are locally distorting DNA base lesions corrected by nucleotide excision repair (NER and proposed to play a role in neurodegeneration prevalent in genetically defined Xeroderma pigmentosum (XP patients. In the current study, purified recombinant helicases from different classifications based on sequence homology were examined for their ability to unwind partial duplex DNA substrates harboring a single site-specific cPu adduct. Superfamily (SF 2 RecQ helicases (RECQ1, BLM, WRN, RecQ were inhibited by cPu in the helicase translocating strand, whereas helicases from SF1 (UvrD and SF4 (DnaB tolerated cPu in either strand. SF2 Fe-S helicases (FANCJ, DDX11 (ChlR1, DinG, XPD displayed marked differences in their ability to unwind the cPu DNA substrates. Archaeal Thermoplasma acidophilum XPD (taXPD, homologue to the human XPD helicase involved in NER DNA damage verification, was impeded by cPu in the non-translocating strand, while FANCJ was uniquely inhibited by the cPu in the translocating strand. Sequestration experiments demonstrated that FANCJ became trapped by the translocating strand cPu whereas RECQ1 was not, suggesting the two SF2 helicases interact with the cPu lesion by distinct mechanisms despite strand-specific inhibition for both. Using a protein trap to simulate single-turnover conditions, the rate of FANCJ or RECQ1 helicase activity was reduced 10-fold and 4.5-fold, respectively, by cPu in the translocating strand. In contrast, single-turnover rates of DNA unwinding by DDX11 and UvrD helicases were only modestly affected by the cPu lesion in the translocating strand. The marked difference in effect of the translocating strand cPu on rate of DNA unwinding between DDX11 and FANCJ helicase suggests the two Fe-S cluster helicases unwind damaged DNA by distinct mechanisms. The apparent complexity of helicase encounters with an unusual form of oxidative damage is likely to have important consequences in

  4. Forensic DNA analysis.

    Science.gov (United States)

    McDonald, Jessica; Lehman, Donald C

    2012-01-01

    Before the routine use of DNA profiling, blood typing was an important forensic tool. However, blood typing was not very discriminating. For example, roughly 30% of the United States population has type A-positive blood. Therefore, if A-positive blood were found at a crime scene, it could have come from 30% of the population. DNA profiling has a much better ability for discrimination. Forensic laboratories no longer routinely determine blood type. If blood is found at a crime scene, DNA profiling is performed. From Jeffrey's discovery of DNA fingerprinting to the development of PCR of STRs to the formation of DNA databases, our knowledge of DNA and DNA profiling have expanded greatly. Also, the applications for which we use DNA profiling have increased. DNA profiling is not just used for criminal case work, but it has expanded to encompass paternity testing, disaster victim identification, monitoring bone marrow transplants, detecting fetal cells in a mother's blood, tracing human history, and a multitude of other areas. The future of DNA profiling looks expansive with the development of newer instrumentation and techniques. PMID:22693781

  5. Recording of climate and diagenesis through fossil pigments and sedimentary DNA at Laguna Potrok Aike, Argentina

    Science.gov (United States)

    Vuillemin, A.; Ariztegui, D.; Leavitt, P. R.; Bunting, L.; Pasado Science Team

    2015-11-01

    Aquatic sediments record past climatic conditions while providing a wide range of ecological niches for microorganisms. Although marine sedimentary microbial assemblages are often defined by their surrounding geochemical conditions, the influence of environmental features upon microbial development and post-depositional survival remains largely unknown in the lacustrine realm. Due to long-term microbial activity, the composition of environmental DNA can be expected to evolve with sediment depth and over time and therefore should reflect both ancient and extant microbial populations, but this hypothesis has rarely been tested using a multiproxy approach. Here geomicrobiological and phylogenetic analyses of a Patagonian maar lake were used to indicate that the different sedimentary microbial assemblages derive from specific lacustrine regimes during defined climatic periods. Two well defined climatic intervals whose sediments harboured active microbial populations and measurable ATP were sampled for a comparative environmental study based on fossil pigments and 16S rRNA gene sequences. Bacterial and archaeal 16S rRNA gene sequences recovered from the Holocene record revealed a microbial community adapted to subsaline conditions actively producing methane during organic matter degradation. These characteristics were associated with sediments resulting from endorheic lake conditions with high evaporative stress and concomitant high algal productivity. Moreover, archaeal clone libraries established throughout the Holocene record indicate an age-related stratification of these populations, consistent with a gradual use of organic substrates after deposition. In contrast, sulphate-reducing bacteria and lithotrophic Archaea were predominant in sediments dated from the Last Glacial Maximum, in which pelagic clays alternated with fine volcanic material characteristic of a lake level highstand and freshwater conditions, but reduced water column productivity. These patterns

  6. DNA media storage

    Institute of Scientific and Technical Information of China (English)

    Christy M.Bogard; Eric C.Rouchka; Benjamin Arazi

    2008-01-01

    In 1994. University of Southern California computer scientist,Dr.Leonard Adleman solved the Hamiltonian path problem using DNA as a computational mechanism.He proved the principle that DNA computing could be used to solve computationally complex problems.Because of the limitations in discovery time,resource requirements,and sequence mismatches,DNA computing has not yet become a commonly accepted practice.However,advancements are continually being discovered that are evolving the field of DNA computing.Practical applications of DNA are not restricted to computation alone.This research presents a novel approach in which DNA could be used as a means of storing files.Through the use of multiple sequence alignment combined with intelligent heuristics,the most probabilistic file contents can be determined with minimal errors.

  7. DNA profiles from fingermarks.

    Science.gov (United States)

    Templeton, Jennifer E L; Linacre, Adrian

    2014-11-01

    Criminal investigations would be considerably improved if DNA profiles could be routinely generated from single fingermarks. Here we report a direct DNA profiling method that was able to generate interpretable profiles from 71% of 170 fingermarks. The data are based on fingermarks from all 5 digits of 34 individuals. DNA was obtained from the fingermarks using a swab moistened with Triton-X, and the fibers were added directly to one of two commercial DNA profiling kits. All profiles were obtained without increasing the number of amplification cycles; therefore, our method is ideally suited for adoption by the forensic science community. We indicate the use of the technique in a criminal case in which a DNA profile was generated from a fingermark on tape that was wrapped around a drug seizure. Our direct DNA profiling approach is rapid and able to generate profiles from touched items when current forensic practices have little chance of success. PMID:25391915

  8. Electrocatalysis in DNA Sensors.

    Science.gov (United States)

    Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

    2014-12-14

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  9. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... to promote genome integrity during DNA replication. This includes suppressing new replication origin firing, stabilization of replicating forks, and the safe restart of forks to prevent any loss of genetic information. Here, we describe mechanisms by which oncogenes can interfere with DNA replication thereby...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  10. Innovations. DNA detectives.

    OpenAIRE

    May, M

    1999-01-01

    To understand the many potential causes and resulting consequences of DNA damage, scientists first need methods to detect it. Canadian scientists X. Chris Le and Michael Weinfeld, with help from U.S. molecular biologist Steven Leadon, developed a selective, sensitive technique for measuring DNA damage. The scientists combined a thymine glycol antibody with thymine glycol to selectively tag a specific type of DNA damage. They then added a second antibody with fluorescing properties, and used l...

  11. Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

    Directory of Open Access Journals (Sweden)

    DasSarma Shiladitya

    2007-06-01

    Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten

  12. DNA Microarray Technique

    Directory of Open Access Journals (Sweden)

    Thakare SP

    2012-11-01

    Full Text Available DNA Microarray is the emerging technique in Biotechnology. The many varieties of DNA microarray or DNA chip devices and systems are described along with their methods for fabrication and their use. It also includes screening and diagnostic applications. The DNA microarray hybridization applications include the important areas of gene expression analysis and genotyping for point mutations, single nucleotide polymorphisms (SNPs, and short tandem repeats (STRs. In addition to the many molecular biological and genomic research uses, this review covers applications of microarray devices and systems for pharmacogenomic research and drug discovery, infectious and genetic disease and cancer diagnostics, and forensic and genetic identification purposes.

  13. The Bacillus subtilis DnaD and DnaB Proteins Exhibit Different DNA Remodelling Activities

    OpenAIRE

    Zhang, Wenke; Carneiro, Maria J. V. M.; Turner, Ian J.; ALLEN, Stephanie; Roberts, Clive J.; Soultanas, Panos

    2005-01-01

    Primosomal protein cascades load the replicative helicase onto DNA. In Bacillus subtilis a putative primosomal cascade involving the DnaD-DnaB-DnaI proteins has been suggested to participate in both the DnaA and PriA-dependent loading of the replicative helicase DnaC onto the DNA. Recently we discovered that DnaD has a global remodelling DNA activity suggesting a more widespread role in bacterial nucleoid architecture. Here, we show that DnaB forms a “square-like” tetramer with a hole in the ...

  14. Phylogenetic diversity of archaeal 16S rRNA and ammonia monooxygenase genes from tropical estuarine sediments on the central west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Verma, P.; Ramaiah, N.; Anil, A.C.; Shouche, Y.S.

    extraction Two replicates of ~0.5 to 1 g sub-samples of all six samples were subjected to DNA extraction. The MOBIO soil DNA extraction kit (MO BIO, USA) was used for extraction as per the protocol provided by the manufacturer. DNA extracts from each sub... manufacturer’s instructions. PCR primers Arch-amoAF: 5’-STAATGGTCTGGCTTAGACG and Arch-amoAR: 5’- GCGGCCATCCATCTGTATGT were used for amplifying AamoA-gene fragments following Francis et al. (2005). The PCR products were pooled and purified as done for 16S r...

  15. DNA-cell conjugates

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  16. Characterization of muntjac DNA

    International Nuclear Information System (INIS)

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange

  17. Routine DNA testing

    Science.gov (United States)

    Routine DNA testing. It’s done once you’ve Marker-Assisted Breeding Pipelined promising Qantitative Trait Loci within your own breeding program and thereby established the performance-predictive power of each DNA test for your germplasm under your conditions. By then you are ready to screen your par...

  18. DNA sequences encoding erythropoietin

    Energy Technology Data Exchange (ETDEWEB)

    Lin, F.K.

    1987-10-27

    A purified and isolated DNA sequence is described consisting essentially of a DNA sequence encoding a polypeptide having an amino acid sequence sufficiently duplicative of that of erythropoietin to allow possession of the biological property of causing bone marrow cells to increase production of reticulocytes and red blood cells, and to increase hemoglobin synthesis or iron uptake.

  19. Recombinant DNA for Teachers.

    Science.gov (United States)

    Duvall, James G., III

    1992-01-01

    A science teacher describes his experience at a workshop to learn to teach the Cold Spring Harbor DNA Science Laboratory Protocols. These protocols lead students through processes for taking E. coli cells and transforming them into a new antibiotic resistant strain. The workshop featured discussions of the role of DNA recombinant technology in…

  20. Protein–DNA Interactions

    NARCIS (Netherlands)

    Kovacic, L.; Boelens, R.

    2012-01-01

    The recognition of specific DNA sequences by proteins and the coupling to signaling events are fundamental occurrences that lie at the root of many cellular processes. Many examples of tight control by protein–DNA interactions can be found in such dynamic processes as transcription, replication and

  1. Characterization of muntjac DNA

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  2. Workshop on DNA repair.

    NARCIS (Netherlands)

    A.R. Lehmann (Alan); J.H.J. Hoeijmakers (Jan); A.A. van Zeeland (Albert); C.M.P. Backendorf (Claude); B.A. Bridges; A. Collins; R.P.D. Fuchs; G.P. Margison; R. Montesano; E. Moustacchi; A.T. Natarajan; M. Radman; A. Sarasin; E. Seeberg; C.A. Smith; M. Stefanini (Miria); L.H. Thompson; G.P. van der Schans; C.A. Weber (Christine); M.Z. Zdzienika

    1992-01-01

    textabstractA workshop on DNA repair with emphasis on eukaryotic systems was held, under the auspices of the EC Concerted Action on DNA Repair and Cancer, at Noordwijkerhout (The Netherlands) 14-19 April 1991. The local organization of the meeting was done under the auspices of the Medical Genetic C

  3. Extended DNA Tile Actuators

    DEFF Research Database (Denmark)

    Kristiansen, Martin; Kryger, Mille; Zhang, Zhao;

    2012-01-01

    A dynamic linear DNA tile actuator is expanded to three new structures of higher complexity. The original DNA actuator was constructed from a central roller strand which hybridizes with two piston strands by forming two half-crossover junctions. A linear expansion of the actuator is obtained...

  4. Premeltons in DNA.

    Science.gov (United States)

    Sobell, Henry M

    2016-03-01

    Premeltons are examples of emergent-structures (i.e., structural-solitons) that arise spontaneously in DNA due to the presence of nonlinear-excitations in its structure. They are of two kinds: B-B (or A-A) premeltons form at specific DNA-regions to nucleate site-specific DNA melting. These are stationary and, being globally-nontopological, undergo breather-motions that allow drugs and dyes to intercalate into DNA. B-A (or A-B) premeltons, on the other hand, are mobile, and being globally-topological, act as phase-boundaries transforming B- into A-DNA during the structural phase-transition. They are not expected to undergo breather motions. A key feature of both types of premeltons is the presence of an intermediate structural-form in their central regions (proposed as being a transition-state intermediate in DNA-melting and in the B- to A-transition), which differs from either A- or B-DNA. Called beta-DNA, this is both metastable and hyperflexible--and contains an alternating sugar-puckering pattern along the polymer backbone combined with the partial unstacking (in its lower energy-forms) of every-other base-pair. Beta-DNA is connected to either B- or to A-DNA on either side by boundaries possessing a gradation of nonlinear structural-change, these being called the kink and the antikink regions. The presence of premeltons in DNA leads to a unifying theory to understand much of DNA physical chemistry and molecular biology. In particular, premeltons are predicted to define the 5' and 3' ends of genes in naked-DNA and DNA in active-chromatin, this having important implications for understanding physical aspects of the initiation, elongation and termination of RNA-synthesis during transcription. For these and other reasons, the model will be of broader interest to the general-audience working in these areas. The model explains a wide variety of data, and carries with it a number of experimental predictions--all readily testable--as will be described in this review.

  5. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  6. Effects of growth phase on the membrane lipid composition of the thaumarchaeon Nitrosopumilus maritimus and their implications for archaeal lipid distributions in the marine environment

    Science.gov (United States)

    Elling, Felix J.; Könneke, Martin; Lipp, Julius S.; Becker, Kevin W.; Gagen, Emma J.; Hinrichs, Kai-Uwe

    2014-09-01

    The characteristic glycerol dibiphytanyl glycerol tetraether membrane lipids (GDGTs) of marine ammonia-oxidizing archaea (AOA) are widely used as biomarkers for studying their occurrence and distribution in marine environments and for reconstructing past sea surface temperatures using the TEX86 index. Despite an increasing use of GDGT biomarkers in microbial ecology and paleoceanography, the physiological and environmental factors influencing lipid composition in AOA, in particular the cyclization of GDGTs, remain unconstrained. We investigated the effect of metabolic state on the composition of intact polar and core lipids and the resulting TEX86 paleothermometer in pure cultures of the marine AOA Nitrosopumilus maritimus as a function of growth phase. The cellular lipid content ranged from 0.9 to 1.9 fg cell-1 and increased during growth but was lower in the stationary phases, indicating changes in average cell size in response to metabolic status. The relative abundances of monoglycosidic GDGTs increased from 27% in early growth phase to 60% in late stationary phase, while monohydroxylated GDGTs increased only slightly. The proportions of characteristic hexose-phosphohexose GDGTs were up to 7-fold higher during growth than in stationary phase, suggesting that they are valuable biomarkers for the metabolically active fraction of AOA assemblages in the environment. Methoxy archaeol was identified as novel, genuine archaeal lipid of yet unknown function; it is one of the most abundant single compounds in the lipidome of N. maritimus. TEX86 values of individual intact GDGTs and total GDGTs differed substantially, were generally lower during early and late growth phases than in stationary phase, and did not reflect growth temperature. Consequently, our results strongly suggest that biosynthesis is at least partially responsible for the systematic offsets in TEX86 values between different intact polar GDGT classes observed previously in environmental samples

  7. Archaeal diversity in deep-sea hydrothermal sediments from the East Pacific Rise%东太平洋海隆深海热液区沉积物古菌多样性分析

    Institute of Scientific and Technical Information of China (English)

    刘青; 谢运标; 陈逍遥; 周梅先

    2014-01-01

    Archaeal diversity of deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise was investiga-ted and analyzed with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).Phyloge-netic analyses revealed that a total of 296 random 16S rRNA gene clones were assigned to Thaumarchaeota (47.64%),Euryarchaeota (44.93%),Crenarchaeota (6.77%)and unclassified Archaea (0.68%).Among them,the genus Nitrosopumilus belonging to the phylum Thaumarchaeota and the class Thermoplasmata belonging to the phylum Euryarchaeota were the dominant groups,representing 35.47% and 27.03% of archaeal clones,re-spectively.In addition,some archaeal 16S rRNA gene sequences were affiliated with deep-sea hydrothermal vent Euryarchaeota 3,5 and 6 (DHVE3,DHVE5 and DHVE6),and Marine Benthic Group B and G (MBGB and MB-GE ).Archaeal communities in sediments from 3 sites on East Pacific Rise were clearly distinct from each other.97 archaeal clones from S5-TVG1 site were divided to Thaumarchaeota (49.48%),Euryarchaeota (49.48%)and Crenarchaeota (1.03%).103 archaeal clones from S14-TVG10 site belonged to Thaumarchaeota(84.47%)and Euryarchaeota (15.53%).96 archaeal clones from S16-TVG12 site were assigned to Euryarchaeota(71.88%), Crenarchaeota (19.79%),Thaumarchaeota (6.25%)and unclassified Archaea (2.08%).Our results indicate that Archaea is abundant and there are a lot of novel archaeal groups in deep-sea hydrothermal sediments from 3 sites on the East Pacific Rise,and the distinct community structure and diversity of Archaea in deep-sea hydrother-mal sediments suggested that the sampling area was influenced by hydrothermalism.%采用PCR-RFLP方法对东太平洋海隆深海热液区3个站位沉积物中的古菌多样性进行了初步研究.结果显示,从古菌16S rRNA基因文库中随机挑取的296个阳性克隆分属奇古菌门(Thaumar-chaeota,47.64%)、广古菌门(Euryarchaeota,44.93%)、泉古菌门(Crenarchaeota,6.77

  8. DNA vaccines against influenza.

    Science.gov (United States)

    Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka

    2014-01-01

    Genetic vaccine technology has been considerably developed within the last two decades. This cost effective and promising strategy can be applied for therapy of cancers and for curing allergy, chronic and infectious diseases, such as a seasonal and pandemic influenza. Despite numerous advantages, several limitations of this technology reduce its performance and can retard its commercial exploitation in humans and its veterinary applications. Inefficient delivery of the DNA vaccine into cells of immunized individuals results in low intracellular supply of suitable expression cassettes encoding an antigen, in its low expression level and, in turn, in reduced immune responses against the antigen. Improvement of DNA delivery into the host cells might significantly increase effectiveness of the DNA vaccine. A vast array of innovative methods and various experimental strategies have been applied in order to enhance the effectiveness of DNA vaccines. They include various strategies improving DNA delivery as well as expression and immunogenic potential of the proteins encoded by the DNA vaccines. Researchers focusing on DNA vaccines against influenza have applied many of these strategies. Recent examples of the most successful modern approaches are discussed in this review.

  9. DNA mini-barcodes.

    Science.gov (United States)

    Hajibabaei, Mehrdad; McKenna, Charly

    2012-01-01

    Conventional DNA barcoding uses an approximately 650 bp DNA barcode of the mitochondrial gene COI for species identification in animal groups. Similar size fragments from chloroplast genes have been proposed as barcode markers for plants. While PCR amplification and sequencing of a 650 bp fragment is consistent in freshly collected and well-preserved specimens, it is difficult to obtain a full-length barcode in older museum specimens and samples which have been preserved in formalin or similar DNA-unfriendly preservatives. A comparable issue may prevent effective DNA-based authentication and testing in processed biological materials, such as food products, pharmaceuticals, and nutraceuticals. In these cases, shorter DNA sequences-mini-barcodes-have been robustly recovered and shown to be effective in identifying majority of specimens to a species level. Furthermore, short DNA regions can be utilized via high-throughput sequencing platforms providing an inexpensive and comprehensive means of large-scale species identification. These properties of mini-barcodes, coupled with the availability of standardized and universal primers make mini-barcodes a feasible option for DNA barcode analysis in museum samples and applied diagnostic and environmental biodiversity analysis.

  10. HIV DNA Integration

    Science.gov (United States)

    Craigie, Robert; Bushman, Frederic D.

    2012-01-01

    Retroviruses are distinguished from other viruses by two characteristic steps in the viral replication cycle. The first is reverse transcription, which results in the production of a double-stranded DNA copy of the viral RNA genome, and the second is integration, which results in covalent attachment of the DNA copy to host cell DNA. The initial catalytic steps of the integration reaction are performed by the virus-encoded integrase (IN) protein. The chemistry of the IN-mediated DNA breaking and joining steps is well worked out, and structures of IN-DNA complexes have now clarified how the overall complex assembles. Methods developed during these studies were adapted for identification of IN inhibitors, which received FDA approval for use in patients in 2007. At the chromosomal level, HIV integration is strongly favored in active transcription units, which may promote efficient viral gene expression after integration. HIV IN binds to the cellular factor LEDGF/p75, which promotes efficient infection and tethers IN to favored target sites. The HIV integration machinery must also interact with many additional host factors during infection, including nuclear trafficking and pore proteins during nuclear entry, histones during initial target capture, and DNA repair proteins during completion of the DNA joining steps. Models for some of the molecular mechanisms involved have been proposed, but important details remain to be clarified. PMID:22762018

  11. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  12. What Controls DNA Looping?

    Directory of Open Access Journals (Sweden)

    Pamela J. Perez

    2014-08-01

    Full Text Available The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional structures and fluctuations of protein and DNA allow us to examine the likely means of enhancing such communication. Here, we describe the application of these approaches to the looping of a 92 base-pair DNA segment between the headpieces of the tetrameric Escherichia coli Lac repressor protein. The distortions of the double helix induced by a second protein—the nonspecific nucleoid protein HU—increase the computed likelihood of looping by several orders of magnitude over that of DNA alone. Large-scale deformations of the repressor, sequence-dependent features in the DNA loop, and deformability of the DNA operators also enhance looping, although to lesser degrees. The correspondence between the predicted looping propensities and the ease of looping derived from gene-expression and single-molecule measurements lends credence to the derived structural picture.

  13. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  14. DNA-PK assay

    Science.gov (United States)

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  15. Apoptosis and DNA Methylation

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Huan X.; Hackett, James A. [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Nestor, Colm [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Dunican, Donncha S.; Madej, Monika; Reddington, James P. [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Pennings, Sari [Queen' s Medical Research Institute, University of Edinburgh, Edinburgh EH16 4TJ (United Kingdom); Harrison, David J. [Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Meehan, Richard R., E-mail: Richard.Meehan@hgu.mrc.ac.uk [MRC Human Genetics Unit, IGMM, Western General Hospital, Edinburgh EH4 2XU (United Kingdom); Breakthrough Research Unit, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU (United Kingdom)

    2011-04-01

    Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  16. Apoptosis and DNA Methylation

    Directory of Open Access Journals (Sweden)

    Richard R. Meehan

    2011-04-01

    Full Text Available Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG.

  17. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Olsen, Maia E.; Bengtsson, Camilla Friis; Bertelsen, Mads Frost;

    2012-01-01

    feathers. As with nail and hair, we demonstrate that although DNA can, in general, be recovered from all parts of the feather, the quality of such DNA varies. As such, although one can expect a priori that genetic analyses are possible on the feather, for PCR based analyses, it is extremely difficult...... to predict the size of amplicon that can be used in such analyses. However, PCR-free genetic analyses that can exploit much smaller DNA fragments may promise to be a powerful tool for future exploitation....

  18. "Artifactual" arsenate DNA

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2012-01-01

    The recent claim by Wolfe-Simon et al. that the Halomonas bacterial strain GFAJ-1 when grown in arsenate-containing medium with limiting phosphate is able to substitute phosphate with arsenate in biomolecules including nucleic acids and in particular DNA(1) arose much skepticism, primarily due...... to the very limited chemical stability of arsenate esters (see ref. 2 and references therein). A major part of the criticisms was concerned with the insufficient (bio)chemical evidence in the Wolfe-Simon study for the actual chemical incorporation of arsenate in DNA (and/or RNA). Redfield et al. now present...... evidence that the identification of arsenate DNA was artifactual....

  19. Archaeal nitrification in the ocean

    OpenAIRE

    Wuchter, C.; Abbas, B.; M J L Coolen; Herfort, L.; van Bleijswijk, J.; Timmers, P.; Strous, M.; E. Teira; Herndl, G. J.; Middelburg, J. J.; Schouten, S; Sinninghe Damsté, J.S.

    2006-01-01

    Marine Crenarchaeota are the most abundant single group of prokaryotes in the ocean, but their physiology and role in marine biogeochemical cycles are unknown. Recently, a member of this clade was isolated from a sea aquarium and shown to be capable of nitrification, tentatively suggesting that Crenarchaeota may play a role in the oceanic nitrogen cycle. We enriched a crenarchaeote from North Sea water and showed that its abundance, and not that of bacteria, correlates with ammonium oxidation...

  20. Archaeal nitrification in the ocean

    NARCIS (Netherlands)

    Wuchter, C.; Abbas, B.; Coolen, M.J.L.; Herfort, L.; Bleijswijk, J. van; Timmers, P.; Strous, M.; Teira, E.; Herndl, G.J.; Middelburg, J.J.; Schouten, S.; Sinninghe Damsté, J.S.

    2006-01-01

    Marine Crenarchaeota are the most abundant single group of prokaryotes in the ocean, but their physiology and role in marine biogeochemical cycles are unknown. Recently, a member of this clade was isolated from a sea aquarium and shown to be capable of nitrification, tentatively suggesting that Cren

  1. Bacterial/archaeal/organellar polyadenylation.

    Science.gov (United States)

    Mohanty, Bijoy K; Kushner, Sidney R

    2011-01-01

    Although the first poly(A) polymerase (PAP) was discovered in Escherichia coli in 1962, the study of polyadenylation in bacteria was largely ignored for the next 30 years. However, with the identification of the structural gene for E. coli PAP I in 1992, it became possible to analyze polyadenylation using both biochemical and genetic approaches. Subsequently, it has been shown that polyadenylation plays a multifunctional role in prokaryotic RNA metabolism. Although the bulk of our current understanding of prokaryotic polyadenylation comes from studies on E. coli, recent limited experiments with Cyanobacteria, organelles, and Archaea have widened our view on the diversity, complexity, and universality of the polyadenylation process. For example, the identification of polynucleotide phosphorylase (PNPase), a reversible phosphorolytic enzyme that is highly conserved in bacteria, as an additional PAP in E. coli caught everyone by surprise. In fact, PNPase has now been shown to be the source of post-transcriptional RNA modifications in a wide range of cells of prokaryotic origin including those that lack a eubacterial PAP homolog. Accordingly, the past few years have witnessed increased interest in the mechanism and role of post-transcriptional modifications in all species of prokaryotic origin. However, the fact that many of the poly(A) tails are very short and unstable as well as the presence of polynucleotide tails has posed significant technical challenges to the scientific community trying to unravel the mystery of polyadenylation in prokaryotes. This review discusses the current state of knowledge regarding polyadenylation and its functions in bacteria, organelles, and Archaea.

  2. DNA Sampling Hook

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The DNA Sampling Hook is a significant improvement on a method of obtaining a tissue sample from a live fish in situ from an aquatic environment. A tissue sample...

  3. Whose DNA is this?

    DEFF Research Database (Denmark)

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle;

    2013-01-01

    evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly......This communication seeks to draw the attention of researchers and practitioners dealing with forensic DNA profiling analyses to the following question: is a scientist's report, offering support to a hypothesis according to which a particular individual is the source of DNA detected during...... the analysis of a stain, relevant from the point of view of a Court of Justice? This question relates to skeptical views previously voiced by commentators mainly in the judicial area, but is avoided by a large majority of forensic scientists. Notwithstanding, the pivotal role of this question has recently been...

  4. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  5. DNA damage and carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Stelow, R B

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10/sup 4/ fold.

  6. FBI's DNA analysis program

    Science.gov (United States)

    Brown, John R.

    1994-03-01

    Forensic DNA profiling technology is a significant law enforcement tool due to its superior discriminating power. Applying the principles of population genetics to the DNA profile obtained in violent crime investigations results in low frequency of occurrence estimates for the DNA profile. These estimates often range from a frequency of occurrence of 1 in 50 unrelated individuals to 1 in a million unrelated individuals or even smaller. It is this power to discriminate among individuals in the population that has propelled forensic DNA technology to the forefront of forensic testing in violent crime cases. Not only is the technology extremely powerful in including or excluding a criminal suspect as the perpetrator, but it also gives rise to the potential of identifying criminal suspects in cases where the investigators of unknown suspect cases have exhausted all other available leads.

  7. Kink solitons in DNA

    CERN Document Server

    Zdravković, S; Daniel, M

    2012-01-01

    We here examine the nonlinear dynamics of artificial homogeneous DNA chain relying on the plain-base rotator model. It is shown that such dynamics can exhibit kink and antikink solitons of sine-Gordon type. In that respect we propose possible experimental assays based on single molecule micromanipulation techniques. The aim of these experiments is to excite the rotational waves and to determine their speeds along excited DNA. We propose that these experiments should be conducted either for the case of double stranded (DS) or single stranded (SS) DNA. A key question is to compare the corresponding velocities of the rotational waves indicating which one is bigger. The ratio of these velocities appears to be related with the sign of the model parameter representing ratio of the hydrogen-bonding and the covalent-bonding interaction within the considered DNA chain.

  8. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup;

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  9. DNA synthesis on discontinuous templates by human DNA polymerases: implications for non-homologous DNA recombination.

    OpenAIRE

    Islas, L; Fairley, C F; Morgan, W. F.

    1998-01-01

    DNA polymerases catalyze the synthesis of DNA using a continuous uninterrupted template strand. However, it has been shown that a 3'-->5' exonuclease-deficient form of the Klenow fragment of Escherichia coli DNA polymerase I as well as DNA polymerase of Thermus aquaticus can synthesize DNA across two unlinked DNA templates. In this study, we used an oligonucleotide-based assay to show that discontinuous DNA synthesis was present in HeLa cell extracts. DNA synthesis inhibitor studies as well a...

  10. Interaction of DNA and DNA-anti-DNA complexes to fibronectin

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, R.C.; Simpson, W.A.; Raghow, R.; Hasty, K.

    1986-03-01

    Fibronectin (Fn) is a large multidomain glycoprotein found in the basement membrane, on cell surface and in plasma. The interactions of Fn with DNA may be significant in glomerular deposition of DNA-anti-DNA complexes in patients with systemic lupus erythematosus (SLE). The authors examined the binding of DNA and DNA-anti-DNA complexes to Fn by a solid phase assay in which Fn was coated to microtiter plates and reacted with (/sup 3/H)DNA or DNA complexes with a monoclonal anti-DNA antibody. The optimal interaction of DNA with Fn occurs at <0.1M NaCl suggesting that the binding is charge dependent; the specificity of this binding was shown by competitive inhibition and locking experiments using anti-Fn. The binding was maximum at pH 6.5 and in the absence of Ca/sup 2 +/. The addition of Clq enhanced the binding of DNA and DNA-anti-DNA complexes to Fn, whereas heparan sulfate inhibited such binding. The monomeric or aggregated IgC did not bind Fn but aggregated IgG bound to Fn in the presence of Clq. Furthermore, DNA-anti-DNA complexes in sera from active SLE patients bound Fn which was enhanced in the presence of Clq; DNase abolished this binding indicating that the interaction of these complexes was mediated by DNA. These observations may partially explain the molecular mechanism(s) of the deposition of DNA-anti-DNA complexes in basement membrane.

  11. Patterning nanocrystals using DNA

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Shara Carol

    2003-09-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  12. Expansion of the DNA Alphabet beyond Natural DNA Recognition.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Sugimoto, Naoki

    2016-07-15

    Simple and inexpensive DNA fibres: New, stable DNA structures are created by the binding of a small molecule to poly(A). Because these DNA fibres are formed from inexpensive materials by using very simple methods, DNA materials suitable for practical use such as information storage should be possible in the near future. PMID:27061868

  13. Ejer jeg mit DNA?

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2010-01-01

    Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie......Havasupai-indianerne har så lidt som nogen andre mennesker selv frembragt deres DNA. Det repræsenterer en form for biologisk viden opsamlet gennem milliuoner af års forhistorie...

  14. What Controls DNA Looping?

    OpenAIRE

    Perez, Pamela J.; Nicolas Clauvelin; Grosner, Michael A.; Colasanti, Andrew V.; Olson, Wilma K.

    2014-01-01

    The looping of DNA provides a means of communication between sequentially distant genomic sites that operate in tandem to express, copy, and repair the information encoded in the DNA base sequence. The short loops implicated in the expression of bacterial genes suggest that molecular factors other than the naturally stiff double helix are involved in bringing the interacting sites into close spatial proximity. New computational techniques that take direct account of the three-dimensional stru...

  15. DNA-Origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Gothelf, Kurt Vesterager

    2010-01-01

    DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau.......DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau....

  16. Photofootprinting of DNA triplexes.

    OpenAIRE

    Lyamichev, V I; Voloshin, O N; Frank-Kamenetskii, M D; Soyfer, V N

    1991-01-01

    We have used a photofootprinting assay to study intermolecular and intramolecular DNA triplexes. The assay is based on the fact that the DNA duplex is protected against photodamage (specifically, against the formation of the (6-4) pyrimidine photoproducts) within a triplex structure. We have shown that this is the case for PyPuPu (YRR) as well as PyPuPy (YRY) triplexes. Using the photofootprinting assay, we have studied the triplex formation under a variety of experimentally defined condition...

  17. PDA: Pooled DNA analyzer

    Directory of Open Access Journals (Sweden)

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  18. Introduction to DNA methods

    International Nuclear Information System (INIS)

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  19. Editing of misaligned 3'-termini by an intrinsic 3'-5' exonuclease activity residing in the PHP domain of a family X DNA polymerase.

    Science.gov (United States)

    Baños, Benito; Lázaro, José M; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

    2008-10-01

    Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolX(Bs)), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolX(Bs) possesses an intrinsic 3'-5' exonuclease activity specialized in resecting unannealed 3'-termini in a gapped DNA substrate. Biochemical analysis of a PolX(Bs) deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3'-5' exonuclease activity of PolX(Bs) resides in its PHP domain. Furthermore, site-directed mutagenesis of PolX(Bs) His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3'-termini resection by the 3'-5' exonuclease activity of PolX(Bs) in the DNA repair context are discussed.

  20. DNA vaccines and intradermal vaccination by DNA tattooing.

    Science.gov (United States)

    Oosterhuis, K; van den Berg, J H; Schumacher, T N; Haanen, J B A G

    2012-01-01

    Over the past two decades, DNA vaccination has been developed as a method for the induction of immune responses. However, in spite of high expectations based on their efficacy in preclinical models, immunogenicity of first generation DNA vaccines in clinical trials was shown to be poor, and no DNA vaccines have yet been licensed for human use. In recent years significant progress has been made in the development of second generation DNA vaccines and DNA vaccine delivery methods. Here we review the key characteristics of DNA vaccines as compared to other vaccine platforms, and recent insights into the prerequisites for induction of immune responses by DNA vaccines will be discussed. We illustrate the development of second generation DNA vaccines with the description of DNA tattooing as a novel DNA delivery method. This technique has shown great promise both in a small animal model and in non-human primates and is currently under clinical evaluation.

  1. Origin DNA Melting and Unwinding in DNA Replication

    OpenAIRE

    Gai, Dahai; Chang, Y Paul; Chen, Xiaojiang S.

    2010-01-01

    Genomic DNA replication is a necessary step in the life cycles of all organisms. To initiate DNA replication, the double-stranded DNA (dsDNA) at the origin of replication must be separated or melted; this melted region is propagated and a mature replication fork is formed. To accomplish origin recognition, initial DNA melting, and the eventual formation of a replication fork, coordinated activity of initiators, helicases, and other cellular factors are required. In this review, we focus on re...

  2. DNA display I. Sequence-encoded routing of DNA populations.

    OpenAIRE

    Halpin, David R; Pehr B Harbury

    2004-01-01

    Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools ...

  3. Evolution of the B3 DNA binding superfamily: new insights into REM family gene diversification.

    Directory of Open Access Journals (Sweden)

    Elisson A C Romanel

    Full Text Available BACKGROUND: The B3 DNA binding domain includes five families: auxin response factor (ARF, abscisic acid-insensitive3 (ABI3, high level expression of sugar inducible (HSI, related to ABI3/VP1 (RAV and reproductive meristem (REM. The release of the complete genomes of the angiosperm eudicots Arabidopsis thaliana and Populus trichocarpa, the monocot Orysa sativa, the bryophyte Physcomitrella patens,the green algae Chlamydomonas reinhardtii and Volvox carteri and the red algae Cyanidioschyzon melorae provided an exceptional opportunity to study the evolution of this superfamily. METHODOLOGY: In order to better understand the origin and the diversification of B3 domains in plants, we combined comparative phylogenetic analysis with exon/intron structure and duplication events. In addition, we investigated the conservation and divergence of the B3 domain during the origin and evolution of each family. CONCLUSIONS: Our data indicate that showed that the B3 containing genes have undergone extensive duplication events, and that the REM family B3 domain has a highly diverged DNA binding. Our results also indicate that the founding member of the B3 gene family is likely to be similar to the ABI3/HSI genes found in C. reinhardtii and V. carteri. Among the B3 families, ABI3, HSI, RAV and ARF are most structurally conserved, whereas the REM family has experienced a rapid divergence. These results are discussed in light of their functional and evolutionary roles in plant development.

  4. Simultaneous RNA-DNA FISH.

    Science.gov (United States)

    Lai, Lan-Tian; Meng, Zhenyu; Shao, Fangwei; Zhang, Li-Feng

    2016-01-01

    A highly useful tool for studying lncRNAs is simultaneous RNA-DNA FISH, which reveals the localization and quantitative information of RNA and DNA in cellular contexts. However, a simple combination of RNA FISH and DNA FISH often generates disappointing results because the fragile RNA signals are often damaged by the harsh conditions used in DNA FISH for denaturing the DNA. Here, we describe a robust and simple RNA-DNA FISH protocol, in which amino-labeled nucleic acid probes are used for RNA FISH. The method is suitable to detect single-RNA molecules simultaneously with DNA.

  5. Defects of mitochondrial DNA replication.

    Science.gov (United States)

    Copeland, William C

    2014-09-01

    Mitochondrial DNA is replicated by DNA polymerase γ in concert with accessory proteins such as the mitochondrial DNA helicase, single-stranded DNA binding protein, topoisomerase, and initiating factors. Defects in mitochondrial DNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mitochondrial DNA deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mitochondrial DNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mitochondrial DNA deletion disorders, such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. This review focuses on our current knowledge of genetic defects of mitochondrial DNA replication (POLG, POLG2, C10orf2, and MGME1) that cause instability of mitochondrial DNA and mitochondrial disease.

  6. Forensic DNA profiling and database.

    Science.gov (United States)

    Panneerchelvam, S; Norazmi, M N

    2003-07-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection.

  7. Forensic DNA Profiling and Database

    OpenAIRE

    Panneerchelvam, S.; Norazmi, M. N.

    2003-01-01

    The incredible power of DNA technology as an identification tool had brought a tremendous change in crimnal justice . DNA data base is an information resource for the forensic DNA typing community with details on commonly used short tandem repeat (STR) DNA markers. This article discusses the essential steps in compilation of COmbined DNA Index System (CODIS) on validated polymerase chain amplified STRs and their use in crime detection.

  8. DNA Nanotechnology for Cancer Therapy

    OpenAIRE

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as sta...

  9. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    NARCIS (Netherlands)

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  10. Programmable Quantitative DNA Nanothermometers.

    Science.gov (United States)

    Gareau, David; Desrosiers, Arnaud; Vallée-Bélisle, Alexis

    2016-07-13

    Developing molecules, switches, probes or nanomaterials that are able to respond to specific temperature changes should prove of utility for several applications in nanotechnology. Here, we describe bioinspired strategies to design DNA thermoswitches with programmable linear response ranges that can provide either a precise ultrasensitive response over a desired, small temperature interval (±0.05 °C) or an extended linear response over a wide temperature range (e.g., from 25 to 90 °C). Using structural modifications or inexpensive DNA stabilizers, we show that we can tune the transition midpoints of DNA thermometers from 30 to 85 °C. Using multimeric switch architectures, we are able to create ultrasensitive thermometers that display large quantitative fluorescence gains within small temperature variation (e.g., > 700% over 10 °C). Using a combination of thermoswitches of different stabilities or a mix of stabilizers of various strengths, we can create extended thermometers that respond linearly up to 50 °C in temperature range. Here, we demonstrate the reversibility, robustness, and efficiency of these programmable DNA thermometers by monitoring temperature change inside individual wells during polymerase chain reactions. We discuss the potential applications of these programmable DNA thermoswitches in various nanotechnology fields including cell imaging, nanofluidics, nanomedecine, nanoelectronics, nanomaterial, and synthetic biology. PMID:27058370

  11. Active DNA demethylation by DNA repair: Facts and uncertainties.

    Science.gov (United States)

    Schuermann, David; Weber, Alain R; Schär, Primo

    2016-08-01

    Pathways that control and modulate DNA methylation patterning in mammalian cells were poorly understood for a long time, although their importance in establishing and maintaining cell type-specific gene expression was well recognized. The discovery of proteins capable of converting 5-methylcytosine (5mC) to putative substrates for DNA repair introduced a novel and exciting conceptual framework for the investigation and ultimate discovery of molecular mechanisms of DNA demethylation. Against the prevailing notion that DNA methylation is a static epigenetic mark, it turned out to be dynamic and distinct mechanisms appear to have evolved to effect global and locus-specific DNA demethylation. There is compelling evidence that DNA repair, in particular base excision repair, contributes significantly to the turnover of 5mC in cells. By actively demethylating DNA, DNA repair supports the developmental establishment as well as the maintenance of DNA methylation landscapes and gene expression patterns. Yet, while the biochemical pathways are relatively well-established and reviewed, the biological context, function and regulation of DNA repair-mediated active DNA demethylation remains uncertain. In this review, we will thus summarize and critically discuss the evidence that associates active DNA demethylation by DNA repair with specific functional contexts including the DNA methylation erasure in the early embryo, the control of pluripotency and cellular differentiation, the maintenance of cell identity, and the nuclear reprogramming. PMID:27247237

  12. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  13. Optimality in DNA repair.

    Science.gov (United States)

    Richard, Morgiane; Fryett, Matthew; Miller, Samantha; Booth, Ian; Grebogi, Celso; Moura, Alessandro

    2012-01-01

    DNA within cells is subject to damage from various sources. Organisms have evolved a number of mechanisms to repair DNA damage. The activity of repair enzymes carries its own risk, however, because the repair of two nearby lesions may lead to the breakup of DNA and result in cell death. We propose a mathematical theory of the damage and repair process in the important scenario where lesions are caused in bursts. We use this model to show that there is an optimum level of repair enzymes within cells which optimises the cell's response to damage. This optimal level is explained as the best trade-off between fast repair and a low probability of causing double-stranded breaks. We derive our results analytically and test them using stochastic simulations, and compare our predictions with current biological knowledge. PMID:21945337

  14. Synapsis of DNA ends by DNA-dependent protein kinase

    OpenAIRE

    DeFazio, Lisa G.; Stansel, Rachel M.; Griffith, Jack D.; Chu, Gilbert

    2002-01-01

    The catalytic subunit of DNA-dependent protein kinase (DNA-PKCS) is required for a non-homologous end-joining pathway that repairs DNA double-strand breaks produced by ionizing radiation or V(D)J recombination; however, its role in this pathway has remained obscure. Using a neutravidin pull-down assay, we found that DNA-PKCS mediates formation of a synaptic complex containing two DNA molecules. Furthermore, kinase activity was cooperative with respect to DNA concentration, suggesting that act...

  15. DNA display I. Sequence-encoded routing of DNA populations.

    Directory of Open Access Journals (Sweden)

    David R Halpin

    2004-07-01

    Full Text Available Recently reported technologies for DNA-directed organic synthesis and for DNA computing rely on routing DNA populations through complex networks. The reduction of these ideas to practice has been limited by a lack of practical experimental tools. Here we describe a modular design for DNA routing genes, and routing machinery made from oligonucleotides and commercially available chromatography resins. The routing machinery partitions nanomole quantities of DNA into physically distinct subpools based on sequence. Partitioning steps can be iterated indefinitely, with worst-case yields of 85% per step. These techniques facilitate DNA-programmed chemical synthesis, and thus enable a materials biology that could revolutionize drug discovery.

  16. DNA repair and DNA antibodies during experimental mycoplasma arthritis

    International Nuclear Information System (INIS)

    To clarify the pathogenesis of a mycoplasma induced arthritis in rats, investigations were carried out on the influence of mycoplasma infection on DNA repair and the occurrence of DNA antibodies. During acute and subacute stage of the experimentally induced arthritis an inhibition of DNA repair could be observed. Besides the results indicated a correlation between reduced or inhibited DNA repair and the appearance of DNA antibodies could be found. The DNA-repair behaviour after the mycoplasma infection was compared with the influence of γ-irradiation

  17. DNA-mediated charge transport for DNA repair

    OpenAIRE

    Boon, Elizabeth M; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S](2+) cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is approximate to275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S](3+/2+)...

  18. DNA templated magnetic nanoparticles

    Science.gov (United States)

    Kinsella, Joseph M.

    Recent discoveries in nanoscience are predicted to potentially revolutionize future technologies in an extensive number of fields. These developments are contingent upon discovering new and often unconventional methods to synthesize and control nanoscale components. Nature provides several examples of working nanotechnology such as the use of programmed self assembly to build and deconstruct complex molecular systems. We have adopted a method to control the one dimensional assembly of magnetic nanoparticles using DNA as a scaffold molecule. With this method we have demonstrated the ability to organize 5 nm particles into chains that stretch up to ˜20 mum in length. One advantage of using DNA compared is the ability of the molecule to interact with other biomolecules. After assembling particles onto DNA we have been able to cleave the molecule into smaller fragments using restriction enzymes. Using ligase enzymes we have re-connected these fragments, coated with either gold or iron oxide, to form long one-dimensional arrangements of the two different types of nanoparticles on a single molecular guide. We have also created a sensitive magnetic field sensor by incorporating magnetic nanoparticle coated DNA strands with microfabricated electrodes. The IV characteristics of the aligned nanoparticles are dependant on the magnitude of an externally applied magnetic field. This transport phenomenon known as tunneling magnetoresistance (TMR) shows room temperature resistance of our devices over 80% for cobalt ferrite coated DNA when a field of 20 kOe is applied. In comparison, studies using two dimensional nanoparticle films of irox oxides xii only exhibit a 35% MR effect. Confinement into one dimension using the DNA guide produces a TMR mechanism which produces significant increases in magnetoresistance. This property can be utilized for applications in magnetic field sensing, data storage, and logic elements.

  19. Rigidity of melting DNA

    Science.gov (United States)

    Pal, Tanmoy; Bhattacharjee, Somendra M.

    2016-05-01

    The temperature dependence of DNA flexibility is studied in the presence of stretching and unzipping forces. Two classes of models are considered. In one case the origin of elasticity is entropic due to the polymeric correlations, and in the other the double-stranded DNA is taken to have an intrinsic rigidity for bending. In both cases single strands are completely flexible. The change in the elastic constant for the flexible case due to thermally generated bubbles is obtained exactly. For the case of intrinsic rigidity, the elastic constant is found to be proportional to the square root of the bubble number fluctuation.

  20. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted;

    2011-01-01

    systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...

  1. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla Friis; Olsen, Maia E.; Brandt, Luise Ørsted;

    2012-01-01

    systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle - although little...

  2. DNA Topoisomerases in Transcription

    DEFF Research Database (Denmark)

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...

  3. The Y-Family DNA Polymerase Dpo4 Uses a Template Slippage Mechanism To Create Single-Base Deletions

    Energy Technology Data Exchange (ETDEWEB)

    Y Wu; R Wilson; J Pata

    2011-12-31

    The Y-family polymerases help cells tolerate DNA damage by performing translesion synthesis, yet they also can be highly error prone. One distinctive feature of the DinB class of Y-family polymerases is that they make single-base deletion errors at high frequencies in repetitive sequences, especially those that contain two or more identical pyrimidines with a 5? flanking guanosine. Intriguingly, different deletion mechanisms have been proposed, even for two archaeal DinB polymerases that share 54% sequence identity and originate from two strains of Sulfolobus. To reconcile these apparent differences, we have characterized Dpo4 from Sulfolobus solfataricus using the same biochemical and crystallographic approaches that we have used previously to characterize Dbh from Sulfolobus acidocaldarius. In contrast to previous suggestions that Dpo4 uses a deoxynucleoside triphosphate (dNTP)-stabilized misalignment mechanism when creating single-base deletions, we find that Dpo4 predominantly uses a template slippage deletion mechanism when replicating repetitive DNA sequences, as was previously shown for Dbh. Dpo4 stabilizes the skipped template base in an extrahelical conformation between the polymerase and the little-finger domains of the enzyme. This contrasts with Dbh, in which the extrahelical base is stabilized against the surface of the little-finger domain alone. Thus, despite sharing a common deletion mechanism, these closely related polymerases use different contacts with the substrate to accomplish the same result.

  4. Quantification of human mitochondrial DNA using synthesized DNA standards.

    Science.gov (United States)

    Kavlick, Mark F; Lawrence, Helen S; Merritt, R Travis; Fisher, Constance; Isenberg, Alice; Robertson, James M; Budowle, Bruce

    2011-11-01

    Successful mitochondrial DNA (mtDNA) forensic analysis depends on sufficient quantity and quality of mtDNA. A real-time quantitative PCR assay was developed to assess such characteristics in a DNA sample, which utilizes a duplex, synthetic DNA to ensure optimal quality assurance and quality control. The assay's 105-base pair target sequence facilitates amplification of degraded DNA and is minimally homologous to nonhuman mtDNA. The primers and probe hybridize to a region that has relatively few sequence polymorphisms. The assay can also identify the presence of PCR inhibitors and thus indicate the need for sample repurification. The results show that the assay provides information down to 10 copies and provides a dynamic range spanning seven orders of magnitude. Additional experiments demonstrated that as few as 300 mtDNA copies resulted in successful hypervariable region amplification, information that permits sample conservation and optimized downstream PCR testing. The assay described is rapid, reliable, and robust.

  5. DNA tagged microparticles

    Energy Technology Data Exchange (ETDEWEB)

    Farquar, George R.; Leif, Roald N.; Wheeler, Elizabeth

    2016-03-22

    In one embodiment, a product includes a plurality of particles, each particle including: a carrier that includes a non-toxic material; and at least one DNA barcode coupled to the carrier, where the particles each have a diameter in a range from about 1 nanometer to about 100 microns.

  6. Field Deployable DNA analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, E; Christian, A; Marion, J; Sorensen, K; Arroyo, E; Vrankovich, G; Hara, C; Nguyen, C

    2005-02-09

    This report details the feasibility of a field deployable DNA analyzer. Steps for swabbing cells from surfaces and extracting DNA in an automatable way are presented. Since enzymatic amplification reactions are highly sensitive to environmental contamination, sample preparation is a crucial step to make an autonomous deployable instrument. We perform sample clean up and concentration in a flow through packed bed. For small initial samples, whole genome amplification is performed in the packed bed resulting in enough product for subsequent PCR amplification. In addition to DNA, which can be used to identify a subject, protein is also left behind, the analysis of which can be used to determine exposure to certain substances, such as radionuclides. Our preparative step for DNA analysis left behind the protein complement as a waste stream; we determined to learn if the proteins themselves could be analyzed in a fieldable device. We successfully developed a two-step lateral flow assay for protein analysis and demonstrate a proof of principle assay.

  7. Making environmental DNA count.

    Science.gov (United States)

    Kelly, Ryan P

    2016-01-01

    The arc of reception for a new technology or method--like the reception of new information itself--can pass through predictable stages, with audiences' responses evolving from 'I don't believe it', through 'well, maybe' to 'yes, everyone knows that' to, finally, 'old news'. The idea that one can sample a volume of water, sequence DNA out of it, and report what species are living nearby has experienced roughly this series of responses among biologists, beginning with the microbial biologists who developed genetic techniques to reveal the unseen microbiome. 'Macrobial' biologists and ecologists--those accustomed to dealing with species they can see and count--have been slower to adopt such molecular survey techniques, in part because of the uncertain relationship between the number of recovered DNA sequences and the abundance of whole organisms in the sampled environment. In this issue of Molecular Ecology Resources, Evans et al. (2015) quantify this relationship for a suite of nine vertebrate species consisting of eight fish and one amphibian. Having detected all of the species present with a molecular toolbox of six primer sets, they consistently find DNA abundances are associated with species' biomasses. The strength and slope of this association vary for each species and each primer set--further evidence that there is no universal parameter linking recovered DNA to species abundance--but Evans and colleagues take a significant step towards being able to answer the next question audiences tend to ask: 'Yes, but how many are there?'

  8. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E.; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  9. DNA supercoiling and its role in DNA decatenation and unknotting

    OpenAIRE

    Witz, Guillaume; Stasiak, Andrzej

    2009-01-01

    Chromosomal and plasmid DNA molecules in bacterial cells are maintained under torsional tension and are therefore supercoiled. With the exception of extreme thermophiles, supercoiling has a negative sign, which means that the torsional tension diminishes the DNA helicity and facilitates strand separation. In consequence, negative supercoiling aids such processes as DNA replication or transcription that require global- or local-strand separation. In extreme thermophiles, DNA is positively supe...

  10. Lipophilic DNA-conjugates: DNA controlled assembly of liposomes

    DEFF Research Database (Denmark)

    Vogel, Stefan; Jakobsen, Ulla

    2009-01-01

    DNA detection systems based on encoded solid particles have been reported but require often tedious and not generally applicable surface chemistry. In the present study a system comprised of a lipid-modified DNA probe sequence and unmodified DNA target sequences is used to non-covalently assemble...

  11. Emerging roles of DNA-PK besides DNA repair.

    Science.gov (United States)

    Kong, Xianming; Shen, Ying; Jiang, Na; Fei, Xin; Mi, Jun

    2011-08-01

    The DNA-dependent protein kinase (DNA-PK) is a DNA-activated serine/threonine protein kinase, and abundantly expressed in almost all mammalian cells. The roles of DNA-PK in DNA-damage repair pathways, including non-homologous end-joining (NHEJ) repair and homologous recombinant (HR) repair, have been studied intensively. However, the high levels of DNA-PK in human cells are somewhat paradoxical in that it does not impart any increased ability to repair DNA damage. If DNA-PK essentially exceeds the demand for DNA damage repair, why do human cells universally express such high levels of this huge complex? DNA-PK has been recently reported to be involved in metabolic gene regulation in response to feeding/insulin stimulation; our studies have also suggested a role of DNA-PK in the regulation of the homeostasis of cell proliferation. These novel findings expand our horizons about the importance of DNA-PK. PMID:21514376

  12. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication.

    OpenAIRE

    Sweasy, J B; Chen, M.; Loeb, L A

    1995-01-01

    We previously demonstrated that mammalian DNA polymerase beta can substitute for DNA polymerase I of Escherichia coli in DNA replication and in base excision repair. We have now obtained genetic evidence suggesting that DNA polymerase beta can substitute for E. coli DNA polymerase I in the initiation of replication of a plasmid containing a pMB1 origin of DNA replication. Specifically, we demonstrate that a plasmid with a pMB1 origin of replication can be maintained in an E. coli polA mutant ...

  13. Thermodynamic comparison of PNA/DNA and DNA/DNA hybridization reactions at ambient temperature.

    OpenAIRE

    Schwarz, F. P.; Robinson, S; Butler, J. M.

    1999-01-01

    The thermodynamics of 13 hybridization reactions between 10 base DNA sequences of design 5'-ATGCXYATGC-3' with X, Y = A, C, G, T and their complementary PNA and DNA sequences were determined from isothermal titration calorimetry (ITC) measurements at ambient temperature. For the PNA/DNA hybridization reactions, the binding constants range from 1.8 x 10(6)M(-1)for PNA(TT)/DNA to 4.15 x 10(7)M(-1)for PNA(GA)/DNA and the binding enthalpies range from -194 kJ mol(-1)for PNA(CG)/DNA to -77 kJ mol(...

  14. Esitleti kakskeelset luulekogu "Luule DNA"

    Index Scriptorium Estoniae

    2007-01-01

    Magrelli, Valerio. Luule DNA = Il DNA della poesia / tõlkinud [ja saatesõna:] Maarja Kangro ja Kalju Kruusa. Tallinn : Koma, 2006. Sisaldab autori teksti. Esitlus 24. jaan. Kirjanike majas Tallinnas

  15. Structural diversity of supercoiled DNA

    Science.gov (United States)

    Irobalieva, Rossitza N.; Fogg, Jonathan M.; Catanese, Daniel J.; Sutthibutpong, Thana; Chen, Muyuan; Barker, Anna K.; Ludtke, Steven J.; Harris, Sarah A.; Schmid, Michael F.; Chiu, Wah; Zechiedrich, Lynn

    2015-10-01

    By regulating access to the genetic code, DNA supercoiling strongly affects DNA metabolism. Despite its importance, however, much about supercoiled DNA (positively supercoiled DNA, in particular) remains unknown. Here we use electron cryo-tomography together with biochemical analyses to investigate structures of individual purified DNA minicircle topoisomers with defined degrees of supercoiling. Our results reveal that each topoisomer, negative or positive, adopts a unique and surprisingly wide distribution of three-dimensional conformations. Moreover, we uncover striking differences in how the topoisomers handle torsional stress. As negative supercoiling increases, bases are increasingly exposed. Beyond a sharp supercoiling threshold, we also detect exposed bases in positively supercoiled DNA. Molecular dynamics simulations independently confirm the conformational heterogeneity and provide atomistic insight into the flexibility of supercoiled DNA. Our integrated approach reveals the three-dimensional structures of DNA that are essential for its function.

  16. Alterations of ultraviolet irradiated DNA

    International Nuclear Information System (INIS)

    Thymine dimers production has been studied in several DNA-3H irradiated at various wave lenght of U.V. Light. The influence of dimers on the hydrodynamic and optic properties, thermal structural stability and transformant capacity of DNA have been studied too. At last the recognition and excision of dimers by the DNA-UV-Endonuclease and DNA-Polimerase-I was also studied. (author)

  17. Interpreting DNA Evidence: A Review

    OpenAIRE

    Foreman, L.A.; Champod, C.; Evett, I.W.; Lambert, J.A.; Pope, S.

    2003-01-01

    The paper provides a review of current issues relating to the use of DNA profiling in forensic science. A short historical section gives the main statistical milestones that occurred during a rapid development of DNA technology and operational uses. Greater detail is then provided for interpretation issues involving STR DNA profiles, including: ¶ methods that take account of population substructure in DNA calculations; ¶ parallel work carried out by the US National Research ...

  18. Forensic trace DNA: a review

    OpenAIRE

    van Oorschot Roland AH; Ballantyne Kaye N; Mitchell R John

    2010-01-01

    Abstract DNA analysis is frequently used to acquire information from biological material to aid enquiries associated with criminal offences, disaster victim identification and missing persons investigations. As the relevance and value of DNA profiling to forensic investigations has increased, so too has the desire to generate this information from smaller amounts of DNA. Trace DNA samples may be defined as any sample which falls below recommended thresholds at any stage of the analysis, from ...

  19. Event extraction for DNA methylation

    OpenAIRE

    Ohta Tomoko; Pyysalo Sampo; Miwa Makoto; Tsujii Jun’ichi

    2011-01-01

    Abstract Background We consider the task of automatically extracting DNA methylation events from the biomedical domain literature. DNA methylation is a key mechanism of epigenetic control of gene expression and implicated in many cancers, but there has been little study of automatic information extraction for DNA methylation. Results We present an annotation scheme for DNA methylation following the representation of the BioNLP shared task on event extraction, select a set of 200 abstracts inc...

  20. Recoiling DNA Molecule: Simulation & Experiment

    OpenAIRE

    Neto, Jose Coelho; Dickman, Ronald; Mesquita, O. N.

    2002-01-01

    Single molecule DNA experiments often generate data from force versus extension measurements involving the tethering of a microsphere to one end of a single DNA molecule while the other is attached to a substrate. We show that the persistence length of single DNA molecules can also be measured based on the recoil dynamics of these DNA-microsphere complexes if appropriate corrections are made to the friction coefficient of the microsphere in the vicinity of the substrate. Comparison between co...

  1. Supramolecular Polymers in DNA Nanotechnology

    OpenAIRE

    Vyborna, Yuliia; Vybornyi, Mykhailo; Häner, Robert

    2016-01-01

    Creation of biocompatible functional materials is an important task in supramolecular chemistry. In this contribution, we report on noncovalent synthesis of DNA-grafted supramolecular polymers (SPs). DNA-grafted SPs enable programmed arrangement of oligonucleotides in a regular, tightly packed one-dimensional array. Further interactions of DNA-grafted SPs with complementary DNA strands leads to the formation of networks through highly cooperative G-C blunt-end stacking interactions. The struc...

  2. Dipole relaxation losses in DNA

    OpenAIRE

    Briman, M.; N. P. Armitage; Helgren, E.; Gruner, G.

    2003-01-01

    The electrodynamic response of DNA in the millimeter wave range is investigated. By performing measurements under a wide range of humidity conditions and comparing the response of single strand DNA and double strand DNA, we show that the appreciable AC conductivity of DNA is not due to photon activated hopping between localized states, but instead due to dissipation from dipole motion in the surrounding water helix. Such a result, where the conductivity is due to the constrained motion of ove...

  3. Mechanisms for DNA Charge Transport

    OpenAIRE

    Genereux, Joseph C.; Barton, Jacqueline K.

    2010-01-01

    DNA charge transport (CT) chemistry has received considerable attention by scientific researchers over the past 15 years since our first provocative publication on long range CT in a DNA assembly.1,2 This interest, shared by physicists, chemists and biologists, reflects the potential of DNA CT to provide a sensitive route for signaling, whether in the construction of nanoscale biosensors or as an enzymatic tool to detect damage in the genome. Research into DNA CT chemistry began as a quest to...

  4. DNA-based hybrid catalysis

    NARCIS (Netherlands)

    Rioz-Martínez, Ana; Roelfes, Gerard

    2015-01-01

    In the past decade, DNA-based hybrid catalysis has merged as a promising novel approach to homogeneous (asymmetric) catalysis. A DNA hybrid catalysts comprises a transition metal complex that is covalently or supramolecularly bound to DNA. The chiral microenvironment and the second coordination sphe

  5. Environmental influences on DNA curvature

    DEFF Research Database (Denmark)

    Ussery, David; Higgins, C.F.; Bolshoy, A.

    1999-01-01

    DNA curvature plays an important role in many biological processes. To study environmentalinfluences on DNA curvature we compared the anomalous migration on polyacrylamide gels ofligation ladders of 11 specifically-designed oligonucleotides. At low temperatures (25 degreesC and below) most...... for DNAcurvature and for environmentally-sensitive DNA conformations in the regulation of geneexpression....

  6. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.;

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  7. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards%不同肥料处理下茶园土壤细菌和古菌群落的时间变化研究

    Institute of Scientific and Technical Information of China (English)

    Hua WANG; Shao-hui YANG; Jing-ping YANG; Ya-min LV; Xing ZHAO; Ji-liang PANG

    2014-01-01

    研究目的:研究化学肥料和有机肥处理条件下,茶园酸性土壤细菌和古菌群落结构,以及氮素转化相关功能酶基因丰度的时间变化规律。  创新要点:研究肥料、土壤温度及土壤含水量对茶园酸性土壤细菌和古菌群落结构,以及氮素转化相关功能酶基因丰度的影响。  研究方法:应用末端限制性片段长度多态性(T-RFLP)技术分析茶园酸性土壤中细菌和古菌群落结构随时间的变化规律,应用荧光定量聚合酶链式反应(PCR)技术,研究茶园酸性土壤细菌、古菌、硝化作用功能酶基因(细菌和古菌amoA基因)和细菌反硝化作用功能酶基因(narG、nirK、nirS和nosZ基因)丰度的时间变化规律。  重要结论:茶园土壤细菌和古菌群落结构受到肥料的影响,并随着取样时间有显著的变化。细菌、古菌和古菌的amoA基因的丰度在7月份最小,而细菌的amoA基因和反硝化作用功能酶基因(除nirK基因)的丰度在9月份最小。有机肥处理增加了细菌、古菌和氮素转化相关功能酶基因的丰度,但化学肥料的施用对菌群及功能酶基因丰度的影响较小。土壤温度显著影响了土壤细菌和古菌的群落结构。土壤含水量与细菌反硝化作用功能酶基因有显著的相关性。土壤有机碳含量与细菌、古菌及功能酶基因丰度之间有显著的相关性。%It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total

  8. Fleet DNA (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Walkokwicz, K.; Duran, A.

    2014-06-01

    The Fleet DNA project objectives include capturing and quantifying drive cycle and technology variation for the multitude of medium- and heavy-duty vocations; providing a common data storage warehouse for medium- and heavy-duty vehicle fleet data across DOE activities and laboratories; and integrating existing DOE tools, models, and analyses to provide data-driven decision making capabilities. Fleet DNA advantages include: for Government - providing in-use data for standard drive cycle development, R&D, tech targets, and rule making; for OEMs - real-world usage datasets provide concrete examples of customer use profiles; for fleets - vocational datasets help illustrate how to maximize return on technology investments; for Funding Agencies - ways are revealed to optimize the impact of financial incentive offers; and for researchers -a data source is provided for modeling and simulation.

  9. Tops and Writhing DNA

    Science.gov (United States)

    Samuel, Joseph; Sinha, Supurna

    2011-04-01

    The torsional elasticity of semiflexible polymers like DNA is of biological significance. A mathematical treatment of this problem was begun by Fuller using the relation between link, twist and writhe, but progress has been hindered by the non-local nature of the writhe. This stands in the way of an analytic statistical mechanical treatment, which takes into account thermal fluctuations, in computing the partition function. In this paper we use the well known analogy with the dynamics of tops to show that when subjected to stretch and twist, the polymer configurations which dominate the partition function admit a local writhe formulation in the spirit of Fuller and thus provide an underlying justification for the use of Fuller's "local writhe expression" which leads to considerable mathematical simplification in solving theoretical models of DNA and elucidating their predictions. Our result facilitates comparison of the theoretical models with single molecule micromanipulation experiments and computer simulations.

  10. Tops and Writhing DNA

    OpenAIRE

    Samuel, Joseph; Sinha, Supurna

    2010-01-01

    The torsional elasticity of semiflexible polymers like DNA is of biological significance. A mathematical treatment of this problem was begun by Fuller using the relation between link, twist and writhe, but progress has been hindered by the non-local nature of the writhe. This stands in the way of an analytic statistical mechanical treatment, which takes into account thermal fluctuations, in computing the partition function. In this paper we use the well known analogy with the dynamics of tops...

  11. Electrocatalysis in DNA sensors

    OpenAIRE

    Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.

    2014-01-01

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge tr...

  12. Geant4-DNA simulations using complex DNA geometries generated by the DnaFabric tool

    Science.gov (United States)

    Meylan, S.; Vimont, U.; Incerti, S.; Clairand, I.; Villagrasa, C.

    2016-07-01

    Several DNA representations are used to study radio-induced complex DNA damages depending on the approach and the required level of granularity. Among all approaches, the mechanistic one requires the most resolved DNA models that can go down to atomistic DNA descriptions. The complexity of such DNA models make them hard to modify and adapt in order to take into account different biological conditions. The DnaFabric project was started to provide a tool to generate, visualise and modify such complex DNA models. In the current version of DnaFabric, the models can be exported to the Geant4 code to be used as targets in the Monte Carlo simulation. In this work, the project was used to generate two DNA fibre models corresponding to two DNA compaction levels representing the hetero and the euchromatin. The fibres were imported in a Geant4 application where computations were performed to estimate the influence of the DNA compaction on the amount of calculated DNA damage. The relative difference of the DNA damage computed in the two fibres for the same number of projectiles was found to be constant and equal to 1.3 for the considered primary particles (protons from 300 keV to 50 MeV). However, if only the tracks hitting the DNA target are taken into account, then the relative difference is more important for low energies and decreases to reach zero around 10 MeV. The computations were performed with models that contain up to 18,000 DNA nucleotide pairs. Nevertheless, DnaFabric will be extended to manipulate multi-scale models that go from the molecular to the cellular levels.

  13. Compressive Sensing DNA Microarrays

    Directory of Open Access Journals (Sweden)

    Richard G. Baraniuk

    2009-01-01

    Full Text Available Compressive sensing microarrays (CSMs are DNA-based sensors that operate using group testing and compressive sensing (CS principles. In contrast to conventional DNA microarrays, in which each genetic sensor is designed to respond to a single target, in a CSM, each sensor responds to a set of targets. We study the problem of designing CSMs that simultaneously account for both the constraints from CS theory and the biochemistry of probe-target DNA hybridization. An appropriate cross-hybridization model is proposed for CSMs, and several methods are developed for probe design and CS signal recovery based on the new model. Lab experiments suggest that in order to achieve accurate hybridization profiling, consensus probe sequences are required to have sequence homology of at least 80% with all targets to be detected. Furthermore, out-of-equilibrium datasets are usually as accurate as those obtained from equilibrium conditions. Consequently, one can use CSMs in applications in which only short hybridization times are allowed.

  14. Next generation DNA led technologies

    CERN Document Server

    Jyothsna, G; Kashyap, Amita

    2016-01-01

    This brief highlights advances in DNA technologies and their wider applications. DNA is the source of life and has been studied since a generation, but very little is known as yet. Several sophisticated technologies of the current era have laid their foundations on the principle of DNA based mechanisms. DNA based technologies are bringing a new revolution of Advanced Science and Technology. Forensic Investigation, Medical Diagnosis, Paternity Disputes, Individual Identity, Health insurance, Motor Insurance have incorporated the DNA testing and profiling technologies for settling the issues.

  15. A physicist's view of DNA

    CERN Document Server

    Mashaghi, Alireza

    2013-01-01

    Nucleic acids, like DNA and RNA, are molecules that are present in any life form. Their most notable function is to encode biological information. Why then would a physicist be interested in these molecules? As we will see, DNA is an interesting molecular tool for physicists to test and explore physical laws and theories, like the ergodic theorem, the theory of elasticity and information theory. DNA also has unique material properties, which attract material scientists, nanotechnologists and engineers. Among interesting developments in this field are DNA-based hybrid materials and DNA origami.

  16. DNA adducts-chemical addons

    OpenAIRE

    T. R. Rajalakshmi; N AravindhaBabu; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could b...

  17. DNA nanotechnology and fluorescence applications.

    Science.gov (United States)

    Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf

    2016-06-01

    Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. PMID:26773303

  18. Stimulation of mouse DNA primase-catalyzed oligoribonucleotide synthesis by mouse DNA helicase B.

    OpenAIRE

    Saitoh, A; S. Tada; Katada, T; Enomoto, T.

    1995-01-01

    Many prokaryotic and viral DNA helicases involved in DNA replication stimulate their cognate DNA primase activity. To assess the stimulation of DNA primase activity by mammalian DNA helicases, we analyzed the synthesis of oligoribonucleotides by mouse DNA polymerase alpha-primase complex on single-stranded circular M13 DNA in the presence of mouse DNA helicase B. DNA helicase B was purified by sequential chromatography through eight columns. When the purified DNA helicase B was applied to a M...

  19. Mitochondrial DNA in Sensitive Forensic Analysis

    OpenAIRE

    Nilsson, Martina

    2007-01-01

    Genetic profiling is commonly performed on the autosomes using multiple DNA markers. Although routine forensic DNA analysis is robust and based on reliable technologies, samples with degraded or limited amounts of DNA often fail. In these cases, the analysis of mitochondrial DNA (mtDNA) can be very valuable due to the high copy number per cell. This thesis describes evaluation and modifications of existing technologies that are useful in forensic DNA typing, mainly focusing on mtDNA. DNA quan...

  20. DNA adducts-chemical addons

    Directory of Open Access Journals (Sweden)

    T R Rajalakshmi

    2015-01-01

    Full Text Available DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde. This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers.