Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves

Directory of Open Access Journals (Sweden)

Francesca Secchi

2016-04-01

Full Text Available The aquaporin specific control on water versus carbon pathways in leaves is pivotal in controlling gas exchange and leaf hydraulics. We investigated whether Nicotiana tabacum aquaporin 1 (NtAQP1 and Nicotiana tabacum plasma membrane intrinsic protein 2;1 (NtPIP2;1 gene expression varies in tobacco leaves subjected to treatments with different CO2 concentrations (ranging from 0 to 800 ppm, inducing changes in photosynthesis, stomatal regulation and water evaporation from the leaf. Changes in air CO2 concentration ([CO2] affected net photosynthesis (Pn and leaf substomatal [CO2] (Ci. Pn was slightly negative at 0 ppm air CO2; it was one-third that of ambient controls at 200 ppm, and not different from controls at 800 ppm. Leaves fed with 800 ppm [CO2] showed one-third reduced stomatal conductance (gs and transpiration (E, and their gs was in turn slightly lower than in 200 ppm– and in 0 ppm–treated leaves. The 800 ppm air [CO2] strongly impaired both NtAQP1 and NtPIP2;1 gene expression, whereas 0 ppm air [CO2], a concentration below any in vivo possible conditions and specifically chosen to maximize the gene expression alteration, increased only the NtAQP1 transcript level. We propose that NtAQP1 expression, an aquaporin devoted to CO2 transport, positively responds to CO2 scarcity in the air in the whole range 0–800 ppm. On the contrary, expression of NtPIP2;1, an aquaporin not devoted to CO2 transport, is related to water balance in the leaf, and changes in parallel with gs. These observations fit in a model where upregulation of leaf aquaporins is activated at low Ci, while downregulation occurs when high Ci saturates photosynthesis and causes stomatal closure.

Boron toxicity tolerance in barley through reduced expression of the multifunctional aquaporin HvNIP2;1.

Science.gov (United States)

Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A; Tyerman, Stephen D; Langridge, Peter; Sutton, Tim

2010-08-01

Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley.

Aquaporin Protein-Protein Interactions

Directory of Open Access Journals (Sweden)

Jennifer Virginia Roche

2017-10-01

Full Text Available Aquaporins are tetrameric membrane-bound channels that facilitate transport of water and other small solutes across cell membranes. In eukaryotes, they are frequently regulated by gating or trafficking, allowing for the cell to control membrane permeability in a specific manner. Protein–protein interactions play crucial roles in both regulatory processes and also mediate alternative functions such as cell adhesion. In this review, we summarize recent knowledge about aquaporin protein–protein interactions; dividing the interactions into three types: (1 interactions between aquaporin tetramers; (2 interactions between aquaporin monomers within a tetramer (hetero-tetramerization; and (3 transient interactions with regulatory proteins. We particularly focus on the structural aspects of the interactions, discussing the small differences within a conserved overall fold that allow for aquaporins to be differentially regulated in an organism-, tissue- and trigger-specific manner. A deep knowledge about these differences is needed to fully understand aquaporin function and regulation in many physiological processes, and may enable design of compounds targeting specific aquaporins for treatment of human disease.

Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients

Institute of Scientific and Technical Information of China (English)

Miao Li; Weiheng Su; Jie Wang; Francesco Pisani; Antonio Frigeri; Tonghui Ma

2013-01-01

In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica.

Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients.

Science.gov (United States)

Li, Miao; Su, Weiheng; Wang, Jie; Pisani, Francesco; Frigeri, Antonio; Ma, Tonghui

2013-03-15

In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica.

Detection of anti-aquaporin-4 autoantibodies in the sera of Chinese neuromyelitis optica patients★

Science.gov (United States)

Li, Miao; Su, Weiheng; Wang, Jie; Pisani, Francesco; Frigeri, Antonio; Ma, Tonghui

2013-01-01

In this study, we recruited 10 neuromyelitis optica patients, two multiple sclerosis patients and two myelitis patients. Chinese hamster lung fibroblast (V79) cells transfected with a human aquaporin-4-mCherry fusion protein gene were used to detect anti-aquaporin-4 antibody in neuromyelitis optica patient sera by immunofluorescence. Anti-aquaporin-4 autoantibody was stably detected by immunofluorescence in neuromyelitis optica patient sera exclusively. The sensitivity of the assay for neuromyelitis optica was 90% and the specificity for neuromyelitis optica was 100%. The anti-aquaporin-4 antibody titers in sera were tested with serial dilutions until the signal disappeared. A positive correlation was detected between Expanded Disability Status Scale scores and serum anti-aquaporin-4 antibody titers. The anti-aquaporin-4 antibody assay is highly sensitive and specific in the sera of Chinese neuromyelitis optica patients. Detection of aquaporin-4 autoantibody is important for the diagnosis and treatment of neuromyelitis optica. PMID:25206717

Boron Toxicity Tolerance in Barley through Reduced Expression of the Multifunctional Aquaporin HvNIP2;11[W

Science.gov (United States)

Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A.; Tyerman, Stephen D.; Langridge, Peter; Sutton, Tim

2010-01-01

Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley. PMID:20581256

Plant aquaporins: roles in plant physiology.

Science.gov (United States)

Li, Guowei; Santoni, Véronique; Maurel, Christophe

2014-05-01

Aquaporins are membrane channels that facilitate the transport of water and small neutral molecules across biological membranes of most living organisms. Here, we present comprehensive insights made on plant aquaporins in recent years, pointing to their molecular and physiological specificities with respect to animal or microbial counterparts. In plants, aquaporins occur as multiple isoforms reflecting a high diversity of cellular localizations and various physiological substrates in addition to water. Of particular relevance for plants is the transport by aquaporins of dissolved gases such as carbon dioxide or metalloids such as boric or silicic acid. The mechanisms that determine the gating and subcellular localization of plant aquaporins are extensively studied. They allow aquaporin regulation in response to multiple environmental and hormonal stimuli. Thus, aquaporins play key roles in hydraulic regulation and nutrient transport in roots and leaves. They contribute to several plant growth and developmental processes such as seed germination or emergence of lateral roots. Plants with genetically altered aquaporin functions are now tested for their ability to improve plant resistance to stresses. This article is part of a Special Issue entitled Aquaporins. Copyright © 2013 Elsevier B.V. All rights reserved.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Heterologous expression of the wheat aquaporin gene TaTIP2;2 compromises the abiotic stress tolerance of Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Chunhui Xu

Full Text Available Aquaporins are channel proteins which transport water across cell membranes. We show that the bread wheat aquaporin gene TaTIP2;2 maps to the long arm of chromosome 7b and that its product localizes to the endomembrane system. The gene is expressed constitutively in both the root and the leaf, and is down-regulated by salinity and drought stress. Salinity stress induced an increased level of C-methylation within the CNG trinucleotides in the TaTIP2;2 promoter region. The heterologous expression of TaTIP2;2 in Arabidopsis thaliana compromised its drought and salinity tolerance, suggesting that TaTIP2;2 may be a negative regulator of abiotic stress. The proline content of transgenic A. thaliana plants fell, consistent with the down-regulation of P5CS1, while the expression of SOS1, SOS2, SOS3, CBF3 and DREB2A, which are all stress tolerance-related genes acting in an ABA-independent fashion, was also down-regulated. The supply of exogenous ABA had little effect either on TaTIP2;2 expression in wheat or on the phenotype of transgenic A. thaliana. The expression level of the ABA signalling genes ABI1, ABI2 and ABF3 remained unaltered in the transgenic A. thaliana plants. Thus TaTIP2;2 probably regulates the response to stress via an ABA-independent pathway(s.

Ammonia and urea permeability of mammalian aquaporins

DEFF Research Database (Denmark)

Litman, Thomas; Søgaard, Rikke; Zeuthen, Thomas

2009-01-01

significant at alkaline pH. It is debated whether the H(+) ion passes via the aquaporin or by some external route; the investigation of this problem requires the aquaporin-expressing cell to be voltage-clamped. The ammonia-permeable aquaporins differ from other aquaporins by having a less restrictive aromatic...... groups differ in the amino acid composition of their aromatic/arginine regions. The location of the ammonia-permeable aquaporins in the body parallels that of the Rh proteins. This applies to erythrocytes and to cells associated with nitrogen homeostasis and high rates of anabolism. In the liver, AQPs 8...

MzPIP2;1: An Aquaporin Involved in Radial Water Movement in Both Water Uptake and Transportation, Altered the Drought and Salt Tolerance of Transgenic Arabidopsis.

Directory of Open Access Journals (Sweden)

Lin Wang

Full Text Available Plants are unavoidably subjected to various abiotic stressors, including high salinity, drought and low temperature, which results in water deficit and even death. Water uptake and transportation play a critical role in response to these stresses. Many aquaporin proteins, localized at different tissues, function in various transmembrane water movements. We targeted at the key aquaporin in charge of both water uptake in roots and radial water transportation from vascular tissues through the whole plant.The MzPIP2;1 gene encoding a plasma membrane intrinsic protein was cloned from salt-tolerant apple rootstock Malus zumi Mats. The GUS gene was driven by MzPIP2;1 promoter in transgenic Arabidopsis. It indicated that MzPIP2;1 might function in the epidermal and vascular cells of roots, parenchyma cells around vessels through the stems and vascular tissues of leaves. The ectopically expressed MzPIP2;1 conferred the transgenic Arabidopsis plants enhanced tolerance to slight salt and drought stresses, but sensitive to moderate salt stress, which was indicated by root length, lateral root number, fresh weight and K+/Na+ ratio. In addition, the possible key cis-elements in response to salt, drought and cold stresses were isolated by the promoter deletion experiment.The MzPIP2;1 protein, as a PIP2 aquaporins subgroup member, involved in radial water movement, controls water absorption and usage efficiency and alters transgenic plants drought and salt tolerance.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

Directory of Open Access Journals (Sweden)

Zhi Zou

Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

Trafficking of plant plasma membrane aquaporins: multiple regulation levels and complex sorting signals.

Science.gov (United States)

Chevalier, Adrien S; Chaumont, François

2015-05-01

Aquaporins are small channel proteins which facilitate the diffusion of water and small neutral molecules across biological membranes. Compared with animals, plant genomes encode numerous aquaporins, which display a large variety of subcellular localization patterns. More specifically, plant aquaporins of the plasma membrane intrinsic protein (PIP) subfamily were first described as plasma membrane (PM)-resident proteins, but recent research has demonstrated that the trafficking and subcellular localization of these proteins are complex and highly regulated. In the past few years, PIPs emerged as new model proteins to study subcellular sorting and membrane dynamics in plant cells. At least two distinct sorting motifs (one cytosolic, the other buried in the membrane) are required to direct PIPs to the PM. Hetero-oligomerization and interaction with SNAREs (soluble N-ethylmaleimide-sensitive factor protein attachment protein receptors) also influence the subcellular trafficking of PIPs. In addition to these constitutive processes, both the progression of PIPs through the secretory pathway and their dynamics at the PM are responsive to changing environmental conditions. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Aquaporins in Digestive System.

Science.gov (United States)

Zhu, Shuai; Ran, Jianhua; Yang, Baoxue; Mei, Zhechuan

2017-01-01

In this chapter, we mainly discuss the expression and function of aquaporins (AQPs ) expressed in digestive system . AQPs in gastrointestinal tract include four members of aquaporin subfamily: AQP1, AQP4, AQP5 and AQP8, and a member of aquaglyceroporin subfamily: AQP3. In the digestive glands, especially the liver, we discuss three members of aquaporin subfamily: AQP1, AQP5 and AQP8, a member of aquaglyceroporin subfamily: AQP9. AQP3 is involved in the diarrhea and inflammatory bowel disease; AQP5 is relevant to gastric carcinoma cell proliferation and migration; AQP9 plays considerable role in glycerol metabolism , urea transport and hepatocellular carcinoma. Further investigation is necessary for specific locations and functions of AQPs in digestive system.

Osmotic water transport in aquaporins

DEFF Research Database (Denmark)

Zeuthen, Thomas; Alsterfjord, Magnus; Beitz, Eric

2013-01-01

Abstract  We test a novel, stochastic model of osmotic water transport in aquaporins. A solute molecule present at the pore mouth can either be reflected or permeate the pore. We assume that only reflected solute molecules induce osmotic transport of water through the pore, while permeating solute...... molecules give rise to no water transport. Accordingly, the rate of water transport is proportional to the reflection coefficient σ, while the solute permeability, P(S), is proportional to 1 - σ. The model was tested in aquaporins heterologously expressed in Xenopus oocytes. A variety of aquaporin channel...... sizes and geometries were obtained with the two aquaporins AQP1 and AQP9 and mutant versions of these. Osmotic water transport was generated by adding 20 mM of a range of different-sized osmolytes to the outer solution. The osmotic water permeability and the reflection coefficient were measured...

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Novel Commercial Aquaporin Flat-Sheet Membrane for Forward Osmosis

DEFF Research Database (Denmark)

Xia, Lingling; Andersen, Mads Friis; Hélix-Nielsen, Claus

2017-01-01

Aquaporin proteins are of great interest to the membrane science community because of their unique characteristics of high water permeability and perfect molecular selectivity. Although these characteristics make aquaporins particularly valuable for desalination applications, none of these aquapo...... was found to exhibit water and reverse solute flux performances similar to those of other commercially available varieties, although this membrane represents one of the few TFC membranes that is available to the academic community for FO testing at the time of this writing.......Aquaporin proteins are of great interest to the membrane science community because of their unique characteristics of high water permeability and perfect molecular selectivity. Although these characteristics make aquaporins particularly valuable for desalination applications, none...... of these aquaporin-based membrane designs has been produced at a large scale. In this work, we report on the recently designed and commercially available Aquaporin Inside flat-sheet membrane designed for forward osmosis (FO) by Aquaporin A/S, Lyngby, Denmark. The Aquaporin Inside flat-sheet membrane is the first...

Aquaporin-3 and aquaporin-4 are sorted differently and separately in the trans-Golgi network

DEFF Research Database (Denmark)

Christensen, Eva Arnspang; Sundbye, S.; Nelson, W. J.

2013-01-01

Aquaporin-3 (AQP3) and aquaporin-4 (AQP4) are homologous proteins expressed in the basolateral plasma membrane of kidney collecting duct principal cells, where they mediate the exit pathway for apically reabsorbed water. Although both proteins are localized to the same plasma membrane domain, it ...

Genome-Wide Identification and Expression Analyses of Aquaporin Gene Family during Development and Abiotic Stress in Banana

Science.gov (United States)

Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

2015-01-01

Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

Science.gov (United States)

Deokar, Amit A; Tar'an, Bunyamin

2016-01-01

Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

Analysis of aquaporins from the euryhaline barnacle Balanus improvisus reveals differential expression in response to changes in salinity.

Directory of Open Access Journals (Sweden)

Ulrika Lind

Full Text Available Barnacles are sessile macro-invertebrates, found along rocky shores in coastal areas worldwide. The euryhaline bay barnacle Balanus improvisus (Darwin, 1854 (= Amphibalanus improvisus can tolerate a wide range of salinities, but the molecular mechanisms underlying the osmoregulatory capacity of this truly brackish species are not well understood. Aquaporins are pore-forming integral membrane proteins that facilitate transport of water, small solutes and ions through cellular membranes, and that have been shown to be important for osmoregulation in many organisms. The knowledge of the function of aquaporins in crustaceans is, however, limited and nothing is known about them in barnacles. We here present the repertoire of aquaporins from a thecostracan crustacean, the barnacle B. improvisus, based on genome and transcriptome sequencing. Our analyses reveal that B. improvisus contains eight genes for aquaporins. Phylogenetic analysis showed that they represented members of the classical water aquaporins (Aqp1, Aqp2, the aquaglyceroporins (Glp1, Glp2, the unorthodox aquaporin (Aqp12 and the arthropod-specific big brain aquaporin (Bib. Interestingly, we also found two big brain-like proteins (BibL1 and BibL2 constituting a new group of aquaporins not yet described in arthropods. In addition, we found that the two water-specific aquaporins were expressed as C-terminal splice variants. Heterologous expression of some of the aquaporins followed by functional characterization showed that Aqp1 transported water and Glp2 water and glycerol, agreeing with the predictions of substrate specificity based on 3D modeling and phylogeny. To investigate a possible role for the B. improvisus aquaporins in osmoregulation, mRNA expression changes in adult barnacles were analysed after long-term acclimation to different salinities. The most pronounced expression difference was seen for AQP1 with a substantial (>100-fold decrease in the mantle tissue in low salinity (3

Genome Wide Identification, Phylogeny, and Expression of Aquaporin Genes in Common Carp (Cyprinus carpio.

Directory of Open Access Journals (Sweden)

Chuanju Dong

Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Desalination by biomimetic aquaporin membranes: Review of status and prospects

DEFF Research Database (Denmark)

Tang, C.Y.; Zhao, Y.; Wang, R.

2013-01-01

Based on their unique combination of offering high water permeability and high solute rejection aquaporin proteins have attracted considerable interest over the last years as functional building blocks of biomimetic membranes for water desalination and reuse. The purpose of this review is to prov......Based on their unique combination of offering high water permeability and high solute rejection aquaporin proteins have attracted considerable interest over the last years as functional building blocks of biomimetic membranes for water desalination and reuse. The purpose of this review...... is to provide an overview of the properties of aquaporins, their preparation and characterization. We discuss the challenges in exploiting the remarkable properties of aquaporin proteins for membrane separation processes and we present various attempts to construct aquaporin in membranes for desalination......; including an overview of our own recent developments in aquaporin-based membranes. Finally we outline future prospects of aquaporin based biomimetic membrane for desalination and water reuse....

Silicon-mediated Improvement in Plant Salinity Tolerance: The Role of Aquaporins

Directory of Open Access Journals (Sweden)

Juan J. Rios

2017-06-01

Full Text Available Silicon (Si is an abundant and differentially distributed element in soils that is believed to have important biological functions. However, the benefits of Si and its essentiality in plants are controversial due to differences among species in their ability to take up this element. Despite this, there is a consensus that the application of Si improves the water status of plants under abiotic stress conditions. Hence, plants treated with Si are able to maintain a high stomatal conductance and transpiration rate under salt stress, suggesting that a reduction in Na+ uptake occurs due to deposition of Si in the root. In addition, root hydraulic conductivity increases when Si is applied. As a result, a Si-mediated upregulation of aquaporin (PIP gene expression is observed in relation to increased root hydraulic conductivity and water uptake. Aquaporins of the subclass nodulin 26-like intrinsic proteins are further involved in allowing Si entry into the cell. Therefore, on the basis of available published results and recent developments, we propose a model to explain how Si absorption alleviates stress in plants grown under saline conditions through the conjugated action of different aquaporins.

Plasma membrane aquaporins mediates vesicle stability in broccoli.

Directory of Open Access Journals (Sweden)

Maria Del Carmen Martínez-Ballesta

Full Text Available The use of in vitro membrane vesicles is attractive because of possible applications in therapies. Here we aimed to compare the stability and functionality of plasma membrane vesicles extracted from control and salt-treated broccoli. The impact of the amount of aquaporins was related to plasma membrane osmotic water permeability and the stability of protein secondary structure. Here, we describe for first time an increase in plant aquaporins acetylation under high salinity. Higher osmotic water permeability in NaCl vesicles has been related to higher acetylation, upregulation of aquaporins, and a more stable environment to thermal denaturation. Based on our findings, we propose that aquaporins play an important role in vesicle stability.

Expression patterns of the aquaporin gene family during renal development: influence of genetic variability.

Science.gov (United States)

Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier

2009-08-01

High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Robust High Performance Aquaporin based Biomimetic Membranes

DEFF Research Database (Denmark)

Helix Nielsen, Claus; Zhao, Yichun; Qiu, C.

2013-01-01

on top of a support membrane. Control membranes, either without aquaporins or with the inactive AqpZ R189A mutant aquaporin served as controls. The separation performance of the membranes was evaluated by cross-flow forward osmosis (FO) and reverse osmosis (RO) tests. In RO the ABM achieved a water......Aquaporins are water channel proteins with high water permeability and solute rejection, which makes them promising for preparing high-performance biomimetic membranes. Despite the growing interest in aquaporin-based biomimetic membranes (ABMs), it is challenging to produce robust and defect...... permeability of ~ 4 L/(m2 h bar) with a NaCl rejection > 97% at an applied hydraulic pressure of 5 bar. The water permeability was ~40% higher compared to a commercial brackish water RO membrane (BW30) and an order of magnitude higher compared to a seawater RO membrane (SW30HR). In FO, the ABMs had > 90...

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

The Aquaporin Gene Family of the Yellow Fever Mosquito, Aedes aegypti

OpenAIRE

Drake, Lisa L.; Boudko, Dmitri Y.; Marinotti, Osvaldo; Carpenter, Victoria K.; Dawe, Angus L.; Hansen, Immo A.

2010-01-01

Background The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT). Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs) are a family of membrane transporters that regulate the flow of water, glycerol and other small...

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Molybdenum Sulfide Induce Growth Enhancement Effect of Rice ( Oryza sativa L.) through Regulating the Synthesis of Chlorophyll and the Expression of Aquaporin Gene.

Science.gov (United States)

Li, Yadong; Jin, Qian; Yang, Desong; Cui, Jianghu

2018-04-25

Molybdenum sulfide (MoS 2 ) has been applied widely in industrial and environmental application, leading to increasing release into environment. So far, no studies have been investigated with regard to the potential effect of MoS 2 on plants. Herein, we studied the impact of MoS 2 on the growth, chlorophyll content, lipid peroxidation, antioxidase system, and aquaporins of rice for the first time. Results showed that MoS 2 did not significantly affect the germination of rice seeds, malonaldehyde (MDA) content, and the antioxidant enzyme activity. While the length and biomass of rice root and shoot, chlorophyll content index (CCI), and expression of aquaporin genes were significantly increased. Based on these results, we concluded that MoS 2 promoted rice growth through (i) the promotion of nitrogen source assimilation, (ii) the enhancement of photosynthesis, enzymatic-related biochemical reactions, and metabolic processes, subsequently, (iii) the acceleration of cell division and expansion, furthermore (iv) no abiotic stress and favorable condition of antioxidant enzyme system. These results provided an important insight into the further application of MoS 2 on agriculture and environment.

Fine-scale mapping of natural variation in fly fecundity identifies neuronal domain of expression and function of an aquaporin.

Directory of Open Access Journals (Sweden)

Alan O Bergland

Full Text Available To gain insight into the molecular genetic basis of standing variation in fitness related traits, we identify a novel factor that regulates the molecular and physiological basis of natural variation in female Drosophila melanogaster fecundity. Genetic variation in female fecundity in flies derived from a wild orchard population is heritable and largely independent of other measured life history traits. We map a portion of this variation to a single QTL and then use deficiency mapping to further refine this QTL to 5 candidate genes. Ubiquitous expression of RNAi against only one of these genes, an aquaporin encoded by Drip, reduces fecundity. Within our mapping population Drip mRNA level in the head, but not other tissues, is positively correlated with fecundity. We localize Drip expression to a small population of corazonin producing neurons located in the dorsolateral posterior compartments of the protocerebrum. Expression of Drip-RNAi using both the pan-neuronal ELAV-Gal4 and the Crz-Gal4 drivers reduces fecundity. Low-fecundity RILs have decreased Crz expression and increased expression of pale, the enzyme encoding the rate-limiting step in the production of dopamine, a modulator of insect life histories. Taken together these data suggest that natural variation in Drip expression in the corazonin producing neurons contributes to standing variation in fitness by altering the concentration of two neurohormones.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Genetic forms of nephrogenic diabetes insipidus (NDI): Vasopressin receptor defect (X-linked) and aquaporin defect (autosomal recessive and dominant).

Science.gov (United States)

Bichet, Daniel G; Bockenhauer, Detlef

2016-03-01

Nephrogenic diabetes insipidus (NDI), which can be inherited or acquired, is characterized by an inability to concentrate urine despite normal or elevated plasma concentrations of the antidiuretic hormone, arginine vasopressin (AVP). Polyuria with hyposthenuria and polydipsia are the cardinal clinical manifestations of the disease. About 90% of patients with congenital NDI are males with X-linked NDI who have mutations in the vasopressin V2 receptor (AVPR2) gene encoding the vasopressin V2 receptor. In less than 10% of the families studied, congenital NDI has an autosomal recessive or autosomal dominant mode of inheritance with mutations in the aquaporin-2 (AQP2) gene. When studied in vitro, most AVPR2 and AQP2 mutations lead to proteins trapped in the endoplasmic reticulum and are unable to reach the plasma membrane. Prior knowledge of AVPR2 or AQP2 mutations in NDI families and perinatal mutation testing is of direct clinical value and can avert the physical and mental retardation associated with repeated episodes of dehydration. Copyright © 2016 Elsevier Ltd. All rights reserved.

Regulation of Aquaporin Z osmotic permeability in ABA tri-block copolymer

Directory of Open Access Journals (Sweden)

Wenyuan Xie

2015-08-01

Full Text Available Aquaporins are transmembrane water channel proteins present in biological plasma membranes that aid in biological water filtration processes by transporting water molecules through at high speeds, while selectively blocking out other kinds of solutes. Aquaporin Z incorporated biomimetic membranes are envisaged to overcome the problem of high pressure needed, and holds great potential for use in water purification processes, giving high flux while keeping energy consumption low. The functionality of aquaporin Z in terms of osmotic permeability might be regulated by factors such as pH, temperature, crosslinking and hydrophobic thickness of the reconstituted bilayers. Hence, we reconstituted aquaporin Z into vesicles that are made from a series of amphiphilic block copolymers PMOXA-PDMS-PMOXAs with various hydrophobic molecular weights. The osmotic permeability of aquaporin Z in these vesicles was determined through a stopped-flow spectroscopy. In addition, the temperature and pH value of the vesicle solutions were adjusted within wide ranges to investigate the regulation of osmotic permeability of aquaporin Z through external conditions. Our results show that aquaporin Z permeability was enhanced by hydrophobic mismatch. In addition, the water filtration mechanism of aquaporin Z is significantly affected by the concentration of H+ and OH- ions.

Aquaporin-11: A channel protein lacking apparent transport function expressed in brain

Directory of Open Access Journals (Sweden)

Tsunenari Takashi

2006-05-01

Full Text Available Abstract Background The aquaporins are a family of integral membrane proteins composed of two subfamilies: the orthodox aquaporins, which transport only water, and the aquaglyceroporins, which transport glycerol, urea, or other small solutes. Two recently described aquaporins, numbers 11 and 12, appear to be more distantly related to the other mammalian aquaporins and aquaglyceroporins. Results We report on the characterization of Aquaporin-11 (AQP11. AQP11 RNA and protein is found in multiple rat tissues, including kidney, liver, testes and brain. AQP11 has a unique distribution in brain, appearing in Purkinje cell dendrites, hippocampal neurons of CA1 and CA2, and cerebral cortical neurons. Immunofluorescent staining of Purkinje cells indicates that AQP11 is intracellular. Unlike other aquaporins, Xenopus oocytes expressing AQP11 in the plasma membrane failed to transport water, glycerol, urea, or ions. Conclusion AQP11 is functionally distinct from other proteins of the aquaporin superfamily and could represent a new aquaporin subfamily. Further studies are necessary to elucidate the role of AQP11 in the brain.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Electrostatics of aquaporin and aquaglyceroporin channels correlates with their transport selectivity

Science.gov (United States)

Oliva, Romina; Calamita, Giuseppe; Thornton, Janet M.; Pellegrini-Calace, Marialuisa

2010-01-01

Aquaporins are homotetrameric channel proteins, which allow the diffusion of water and small solutes across biological membranes. According to their transport function, aquaporins can be divided into “orthodox aquaporins”, which allow the flux of water molecules only, and “aquaglyceroporins”, which facilitate the diffusion of glycerol and other small solutes in addition to water. The contribution of individual residues in the pore to the selectivity of orthodox aquaporins and aquaglyceroporins is not yet fully understood. To gain insights into aquaporin selectivity, we focused on the sequence variation and electrostatics of their channels. The continuum Poisson-Boltzmann electrostatic potential along the channel was calculated and compared for ten three-dimensional-structures which are representatives of different aquaporin subfamilies, and a panel of functionally characterized mutants, for which high-accuracy three-dimensional-models could be derived. Interestingly, specific electrostatic profiles associated with the main selectivity to water or glycerol could be identified. In particular: (i) orthodox aquaporins showed a distinctive electrostatic potential maximum at the periplasmic side of the channel around the aromatic/Arg (ar/R) constriction site; (ii) aquaporin-0 (AQP0), a mammalian aquaporin with considerably low water permeability, had an additional deep minimum at the cytoplasmic side; (iii) aquaglyceroporins showed a rather flat potential all along the channel; and (iv) the bifunctional protozoan PfAQP had an unusual all negative profile. Evaluation of electrostatics of the mutants, along with a thorough sequence analysis of the aquaporin pore-lining residues, illuminated the contribution of specific residues to the electrostatics of the channels and possibly to their selectivity. PMID:20147624

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

The Aquaporin gene family of the yellow fever mosquito, Aedes aegypti.

Directory of Open Access Journals (Sweden)

Lisa L Drake

2010-12-01

Full Text Available The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT. Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs are a family of membrane transporters that regulate the flow of water, glycerol and other small molecules across cellular membranes in both prokaryotic and eukaryotic cells. Our aim was to identify aquaporins that function as water channels, mediating transcellular water transport in MTs of adult female Ae. aegypti.Using a bioinformatics approach we screened genome databases and identified six putative AQPs in the genome of Ae. aegypti. Phylogenetic analysis showed that five of the six Ae. aegypti AQPs have high similarity to classical water-transporting AQPs of vertebrates. Using microarray, reverse transcription and real time PCR analysis we found that all six AQPs are expressed in distinct patterns in mosquito tissues/body parts. AaAQP1, 4, and 5 are strongly expressed in the adult female MT. RNAi-mediated knockdown of the MT-expressed mosquito AQPs resulted in significantly reduced diuresis.Our results support the notion that AQP1, 4, and 5 function as water transporters in the MTs of adult female Ae. aegypti mosquitoes. Our results demonstrate the importance of these AQPs for mosquito diuresis after blood ingestion and highlight their potential as targets for the development of novel vector control strategies.

The Aquaporin gene family of the yellow fever mosquito, Aedes aegypti.

Science.gov (United States)

Drake, Lisa L; Boudko, Dmitri Y; Marinotti, Osvaldo; Carpenter, Victoria K; Dawe, Angus L; Hansen, Immo A

2010-12-29

The mosquito, Aedes aegypti, is the principal vector of the Dengue and yellow fever viruses. During feeding, an adult female can take up more than its own body weight in vertebrate blood. After a blood meal females excrete large amounts of urine through their excretion system, the Malpighian tubules (MT). Diuresis starts within seconds after the mosquito starts feeding. Aquaporins (AQPs) are a family of membrane transporters that regulate the flow of water, glycerol and other small molecules across cellular membranes in both prokaryotic and eukaryotic cells. Our aim was to identify aquaporins that function as water channels, mediating transcellular water transport in MTs of adult female Ae. aegypti. Using a bioinformatics approach we screened genome databases and identified six putative AQPs in the genome of Ae. aegypti. Phylogenetic analysis showed that five of the six Ae. aegypti AQPs have high similarity to classical water-transporting AQPs of vertebrates. Using microarray, reverse transcription and real time PCR analysis we found that all six AQPs are expressed in distinct patterns in mosquito tissues/body parts. AaAQP1, 4, and 5 are strongly expressed in the adult female MT. RNAi-mediated knockdown of the MT-expressed mosquito AQPs resulted in significantly reduced diuresis. Our results support the notion that AQP1, 4, and 5 function as water transporters in the MTs of adult female Ae. aegypti mosquitoes. Our results demonstrate the importance of these AQPs for mosquito diuresis after blood ingestion and highlight their potential as targets for the development of novel vector control strategies.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

[Relationship between efficacy exertion of diuretic traditional Chinese medicines and aquaporin].

Science.gov (United States)

Wang, Peng-cheng; Zhao, Shan; Wang, Qiu-hong; Kuang, Hai-xue

2015-06-01

In recent years, the discovery and studies on aquaporin have made us have a more in-depth understanding about the physiological and pathological processes of water metabolism. Over years, however, there has been no quantitative study on the target sites of diuretic traditional Chinese medicines at the molecular level. In that case, aquaporin was found to been a new target molecule to explain the efficacy exertion of diuretic traditional Chinese medicines. By studying aquaporin, researchers can understand the implicit meaning of the diuretic effect of traditional Chinese medicines and conduct quantitative studies on the diuretic effect. So far, many scholars have conducted a series of studies in the traditional Chinese medicine field by using the findings on aquaporin and made certain advances. This article provides a summary about the efficacy exertion of diuretic traditional Chinese medicines through target molecule aquaporin.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Non-invasive imaging using reporter genes altering cellular water permeability

Science.gov (United States)

Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

2016-12-01

Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Ectopically expressing MdPIP1;3, an aquaporin gene, increased fruit size and enhanced drought tolerance of transgenic tomatoes.

Science.gov (United States)

Wang, Lin; Li, Qing-Tian; Lei, Qiong; Feng, Chao; Zheng, Xiaodong; Zhou, Fangfang; Li, Lingzi; Liu, Xuan; Wang, Zhi; Kong, Jin

2017-12-19

Water deficit severely reduces apple growth and production, is detrimental to fruit quality and size. This problem is exacerbated as global warming is implicated in producing more severe drought stress. Thus water-efficiency has becomes the major target for apple breeding. A desired apple tree can absorb and transport water efficiently, which not only confers improved drought tolerance, but also guarantees fruit size for higher income returns. Aquaporins, as water channels, control water transportation across membranes and can regulate water flow by changing their amount and activity. The exploration of molecular mechanism of water efficiency and the gene wealth will pave a way for molecular breeding of drought tolerant apple tree. In the current study, we screened out a drought inducible aquaporin gene MdPIP1;3, which specifically enhanced its expression during fruit expansion in 'Fuji' apple (Malus domestica Borkh. cv. Red Fuji). It localized on plasma membranes and belonged to PIP1 subfamily. The tolerance to drought stress enhanced in transgenic tomato plants ectopically expressing MdPIP1;3, showing that the rate of losing water in isolated transgenic leaves was slower than wild type, and stomata of transgenic plants closed sensitively to respond to drought compared with wild type. Besides, length and diameter of transgenic tomato fruits increased faster than wild type, and in final, fruit sizes and fresh weights of transgenic tomatoes were bigger than wild type. Specially, in cell levels, fruit cell size from transgenic tomatoes was larger than wild type, showing that cell number per mm 2 in transgenic fruits was less than wild type. Altogether, ectopically expressing MdPIP1;3 enhanced drought tolerance of transgenic tomatoes partially via reduced water loss controlled by stomata closure in leaves. In addition, the transgenic tomato fruits are larger and heavier with larger cells via more efficient water transportation across membranes. Our research will

Renal aquaporins and sodium transporters with special focus on urinary tract obstruction

DEFF Research Database (Denmark)

Frøkiaer, Jørgen; Li, Chunling; Shi, Yimin

2003-01-01

seven aquaporins are expressed at distinct sites in the kidney and 4 members of this family (AQP1-4) have been demonstrated to play pivotal roles in the physiology and pathophysiology for renal regulation of body water balance. Osmotic equilibration via renal aquaporins is maintained by active transport......The discovery of aquaporin-1 (AQP1) by Agre and colleagues explained the long-standing biophysical question of how water specifically crosses biological membranes. These studies led to the discovery and identification of a whole new family of membrane proteins, the aquaporins. At present, at least...

A de novo Ser111Thr variant in aquaporin-4 in a patient with intellectual disability, transient signs of brain ischemia, transient cardiac hypertrophy, and progressive gait disturbance

DEFF Research Database (Denmark)

Berland, Siren; Toft-Bertelsen, Trine L; Aukrust, Ingvild

2018-01-01

Aquaporin-4, encoded by AQP4, is the major water channel in the central nervous system and plays an important role in the brain's water balance, including edema formation and clearance. Using genomic copy-number analysis and trio-exome sequencing, we investigated a male patient with intellectual...

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Aquaporin-2 regulation in health and disease

DEFF Research Database (Denmark)

Radin, M J; Yu, Ming-Jiun; Stødkilde-Jørgensen, Lene

2012-01-01

Aquaporin-2 (AQP2), the vasopressin-regulated water channel of the renal collecting duct, is dysregulated in numerous disorders of water balance in people and animals, including those associated with polyuria (urinary tract obstruction, hypokalemia, inflammation, and lithium toxicity) and with di......Aquaporin-2 (AQP2), the vasopressin-regulated water channel of the renal collecting duct, is dysregulated in numerous disorders of water balance in people and animals, including those associated with polyuria (urinary tract obstruction, hypokalemia, inflammation, and lithium toxicity...

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Aquaporin based biomimetic membrane in forward osmosis: Chemical cleaning resistance and practical operation

DEFF Research Database (Denmark)

Li, Zhenyu; Linares, Rodrigo Valladares; Bucs, Szilard

2017-01-01

Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused, by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin...

Genome-wide identification of Jatropha curcas aquaporin genes and the comparative analysis provides insights into the gene family expansion and evolution in Hevea brasiliensis

Directory of Open Access Journals (Sweden)

Zhi eZou

2016-03-01

Full Text Available Aquaporins (AQPs are channel-forming integral membrane proteins that transport water and other small solutes across biological membranes. Despite the vital role of AQPs, to date, little is known in physic nut (Jatropha curcas L., Euphorbiaceae, an important non-edible oilseed crop with great potential for the production of biodiesel. In this study, 32 AQP genes were identified from the physic nut genome and the family number is relatively small in comparison to 51 in another Euphorbiaceae plant, rubber tree (Hevea brasiliensis Muell. Arg.. Based on the phylogenetic analysis, the JcAQPs were assigned to five subfamilies, i.e., 9 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 2 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs. Like rubber tree and other plant species, functional prediction based on the aromatic/arginine selectivity filter, Froger’s positions and specificity-determining positions showed a remarkable difference in substrate specificity among subfamilies of JcAQPs. Genome-wide comparative analysis revealed the specific expansion of PIP and TIP subfamilies in rubber tree and the specific gene loss of the XIP subfamily in physic nut. Furthermore, by analyzing deep transcriptome sequencing data, the expression evolution especially the expression divergence of duplicated HbAQP genes was also investigated and discussed. Results obtained from this study not only provide valuable information for future functional analysis and utilization of Jc/HbAQP genes, but also provide a useful reference to survey the gene family expansion and evolution in Euphorbiaceae plants and other plant species.

Can Stabilization and Inhibition of Aquaporins Contribute to Future Development of Biomimetic Membranes?

Science.gov (United States)

To, Janet; Torres, Jaume

2015-08-10

In recent years, the use of biomimetic membranes that incorporate membrane proteins, i.e., biomimetic-hybrid membranes, has increased almost exponentially. Key membrane proteins in these systems have been aquaporins, which selectively permeabilize cellular membranes to water. Aquaporins may be incorporated into synthetic lipid bilayers or to more stable structures made of block copolymers or solid-state nanopores. However, translocation of aquaporins to these alien environments has adverse consequences in terms of performance and stability. Aquaporins incorporated in biomimetic membranes for use in water purification and desalination should also withstand the harsh environment that may prevail in these conditions, such as high pressure, and presence of salt or other chemicals. In this respect, modified aquaporins that can be adapted to these new environments should be developed. Another challenge is that biomimetic membranes that incorporate high densities of aquaporin should be defect-free, and this can only be efficiently ascertained with the availability of completely inactive mutants that behave otherwise like the wild type aquaporin, or with effective non-toxic water channel inhibitors that are so far inexistent. In this review, we describe approaches that can potentially be used to overcome these challenges.

Can Stabilization and Inhibition of Aquaporins Contribute to Future Development of Biomimetic Membranes?

Directory of Open Access Journals (Sweden)

Janet To

2015-08-01

Full Text Available In recent years, the use of biomimetic membranes that incorporate membrane proteins, i.e., biomimetic-hybrid membranes, has increased almost exponentially. Key membrane proteins in these systems have been aquaporins, which selectively permeabilize cellular membranes to water. Aquaporins may be incorporated into synthetic lipid bilayers or to more stable structures made of block copolymers or solid-state nanopores. However, translocation of aquaporins to these alien environments has adverse consequences in terms of performance and stability. Aquaporins incorporated in biomimetic membranes for use in water purification and desalination should also withstand the harsh environment that may prevail in these conditions, such as high pressure, and presence of salt or other chemicals. In this respect, modified aquaporins that can be adapted to these new environments should be developed. Another challenge is that biomimetic membranes that incorporate high densities of aquaporin should be defect-free, and this can only be efficiently ascertained with the availability of completely inactive mutants that behave otherwise like the wild type aquaporin, or with effective non-toxic water channel inhibitors that are so far inexistent. In this review, we describe approaches that can potentially be used to overcome these challenges.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Recombinant production of human Aquaporin-1 to an exceptional high membrane density in Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Julie Bomholt

Full Text Available In the present paper we explored the capacity of yeast Saccharomyces cerevisiae as host for heterologous expression of human Aquaporin-1. Aquaporin-1 cDNA was expressed from a galactose inducible promoter situated on a plasmid with an adjustable copy number. Human Aquaporin-1 was C-terminally tagged with yeast enhanced GFP for quantification of functional expression, determination of sub-cellular localization, estimation of in vivo folding efficiency and establishment of a purification protocol. Aquaporin-1 was found to constitute 8.5 percent of total membrane protein content after expression at 15°C in a yeast host over-producing the Gal4p transcriptional activator and growth in amino acid supplemented minimal medium. In-gel fluorescence combined with western blotting showed that low accumulation of correctly folded recombinant Aquaporin-1 at 30°C was due to in vivo mal-folding. Reduction of the expression temperature to 15°C almost completely prevented Aquaporin-1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1 and generated a monodisperse protein preparation. A single Ni-affinity chromatography step was used to obtain almost pure Aquaporin-1. Recombinant Aquaporin-1 produced in S. cerevisiae was not N-glycosylated in contrast to the protein found in human erythrocytes.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Aquaporin-2 membrane targeting

DEFF Research Database (Denmark)

Olesen, Emma T B; Fenton, Robert A

2017-01-01

The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...... of aquaporin-2 (AQP2) to the apical plasma membrane of collecting duct (CD) principal cells (10, 20). This process is mainly regulated by the actions of AVP on the type 2 AVP receptor (V2R), although the V1a receptor may also play a minor role (26). The V2R is classified within the group of 7-transmembrane....... For example, 1) stimulation with the nonspecific AC activator forskolin increases AQP2 membrane accumulation in a mouse cortical collecting duct cell line [e.g., Norregaard et al. (16)]; 2) cAMP increases CD water permeability (15); 3) the cAMP-activated protein kinase A (PKA) can phosphorylate AQP2 on its...

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Altered aquaporins in the brains of mice submitted to intermittent hypoxia model of sleep apnea.

Science.gov (United States)

Baronio, Diego; Martinez, Denis; Fiori, Cintia Zappe; Bambini-Junior, Victorio; Forgiarini, Luiz Felipe; Pase da Rosa, Darlan; Kim, Lenise Jihe; Cerski, Marcelle Reesink

2013-01-15

Rostral fluid displacement has been proposed as a pathophysiologic mechanism of both central and obstructive sleep apnea. Aquaporins are membrane proteins that regulate water transport across the cell membrane and are involved in brain edema formation and resolution. The present study investigated the effect of intermittent hypoxia (IH), a model of sleep apnea, on brain aquaporins. Mice were exposed to intermittent hypoxia to a nadir of 7% oxygen fraction. Brain water content, Aquaporin-1 and Aquaporin-3 were measured in the cerebellum and hippocampus. Hematoxylin-eosin and immunohistochemistry stainings were performed to evaluate cell damage. Compared to the sham group, the hypoxia group presented higher brain water content, lower levels of Aquaporin-1 and similar levels of Aquaporin-3. Immunoreactivity to GFAP and S100B was stronger in the hypoxia group in areas of extensive gliosis, compatible with cytotoxic edema. These findings, although preliminary, indicate an effect of IH on aquaporins levels. Further investigation about the relevance of these data on the pathophysiology of OSA is warranted. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Correlation of Aquaporins and Transmembrane Solute Transporters Revealed by Genome-Wide Analysis in Developing Maize Leaf

Directory of Open Access Journals (Sweden)

Xun Yue

2012-01-01

Full Text Available Aquaporins are multifunctional membrane channels that facilitate the transmembrane transport of water and solutes. When transmembrane mineral nutrient transporters exhibit the same expression patterns as aquaporins under diverse temporal and physiological conditions, there is a greater probability that they interact. In this study, genome-wide temporal profiling of transcripts analysis and coexpression network-based approaches are used to examine the significant specificity correlation of aquaporins and transmembrane solute transporters in developing maize leaf. The results indicate that specific maize aquaporins are related to specific transmembrane solute transporters. The analysis demonstrates a systems-level correlation between aquaporins, nutrient transporters, and the homeostasis of mineral nutrients in developing maize leaf. Our results provide a resource for further studies into the physiological function of these aquaporins.

Recombinant Production of Human Aquaporin-1 to an Exceptional High Membrane Density in Saccharomyces Cerevisiae

DEFF Research Database (Denmark)

Bomholt, Julie; Helix Nielsen, Claus; Scharff-Poulsen, Peter

2014-01-01

prevented Aquaporin1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1 and generated a monodisperse protein preparation...

Preparative scale production of functional mouse aquaporin 4 using different cell-free expression modes.

Directory of Open Access Journals (Sweden)

Lei Kai

Full Text Available The continuous progress in the structural and functional characterization of aquaporins increasingly attracts attention to study their roles in certain mammalian diseases. Although several structures of aquaporins have already been solved by crystallization, the challenge of producing sufficient amounts of functional proteins still remains. CF (cell free expression has emerged in recent times as a promising alternative option in order to synthesize large quantities of membrane proteins, and the focus of this report was to evaluate the potential of this technique for the production of eukaryotic aquaporins. We have selected the mouse aquaporin 4 as a representative of mammalian aquaporins. The protein was synthesized in an E. coli extract based cell-free system with two different expression modes, and the efficiencies of two modes were compared. In both, the P-CF (cell-free membrane protein expression as precipitate mode generating initial aquaporin precipitates as well as in the D-CF (cell-free membrane protein expression in presence of detergent mode, generating directly detergent solubilized samples, we were able to obtain mg amounts of protein per ml of cell-free reaction. Purified aquaporin samples solubilized in different detergents were reconstituted into liposomes, and analyzed for the water channel activity. The calculated P(f value of proteoliposome samples isolated from the D-CF mode was 133 µm/s at 10°C, which was 5 times higher as that of the control. A reversible inhibitory effect of mercury chloride was observed, which is consistent with previous observations of in vitro reconstituted aquaporin 4. In this study, a fast and convenient protocol was established for functional expression of aquaporins, which could serve as basis for further applications such as water filtration.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

PIP1 and PIP2 aquaporins are differentially expressed during tobacco anther and stigma development.

Science.gov (United States)

Bots, Marc; Feron, Richard; Uehlein, Norbert; Weterings, Koen; Kaldenhoff, Ralf; Mariani, Titti

2005-01-01

Several processes during sexual reproduction in higher plants involve the movement of water between cells or tissues, such as occurs during dehiscence of the anther and hydration of the pollen grain after it is deposited on a stigma. To get more insight in these processes, a set of putative aquaporins was cloned and it was found that at least 15 are expressed in reproductive organs, which indicates that the control of water flow is important for reproduction. Functional studies in Xenopus laevis oocytes using two of the cDNAs showed that NtPIP2;1 is an efficient aquaporin, whereas NtPIP1;1 is not. Expression studies on RNA and protein levels showed that PIP1 and PIP2 genes are differently expressed in reproductive organs: PIP1 RNA accumulates in the stigma, and PIP1 and PIP2 RNA can be detected in most tissues of the anther.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Recombinant Production of Human Aquaporin-1 to an Exceptional High Membrane Density in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Bomholt, Julie; Helix Nielsen, Claus; Scharff-Poulsen, Peter

2013-01-01

of the expression temperature to 15°C almost completely prevented Aquaporin-1 mal-folding. Bioimaging of live yeast cells revealed that recombinant Aquaporin-1 accumulated in the yeast plasma membrane. A detergent screen for solubilization revealed that CYMAL-5 was superior in solubilizing recombinant Aquaporin-1...

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

NH3 and NH4+ permeability in aquaporin-expressing Xenopus oocytes

DEFF Research Database (Denmark)

Holm, Lars M.; Jahn, Thomas Paul; Møller, Anders Laurell Blom

2005-01-01

We have shown recently, in a yeast expression system, that some aquaporins are permeable to ammonia. In the present study, we expressed the mammalian aquaporins AQP8, AQQP9, AQP3, AQP1 and a plant aquaporin TIP2;1 in Xenopus oocytes to study the transport of ammonia (NH3) and ammonium (NH4+) under...... inwards currents carried by NH4+. This conductivity increased as a sigmoid function of external [NH3]: for AQP8 at a bath pH (pH(e)) of 6.5, the conductance was abolished, at pH(e) 7.4 it was half maximal and at pH(e) 7.8 it saturated. NY4+ influx was associated with oocyte swelling. In comparison, native...... oocytes as well as AQP1 and tip2;1-expressing oocytes showed small currents that were associated with small and even negative volume changes. We conclude that AQP8, AQP9, AQP3, and TIP2;1, apart from being water channels, also support significant fluxes of NH3. These aquaporins could support NH4...

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Regulation of photosynthesis and stomatal and mesophyll conductance under water stress and recovery in olive trees: correlation with gene expression of carbonic anhydrase and aquaporins.

Science.gov (United States)

Perez-Martin, Alfonso; Michelazzo, Chiara; Torres-Ruiz, Jose M; Flexas, Jaume; Fernández, José E; Sebastiani, Luca; Diaz-Espejo, Antonio

2014-07-01

The hypothesis that aquaporins and carbonic anhydrase (CA) are involved in the regulation of stomatal (g s) and mesophyll (g m) conductance to CO2 was tested in a short-term water-stress and recovery experiment in 5-year-old olive plants (Olea europaea) growing outdoors. The evolution of leaf gas exchange, chlorophyll fluorescence, and plant water status, and a quantitative analysis of photosynthesis limitations, were followed during water stress and recovery. These variables were correlated with gene expression of the aquaporins OePIP1.1 and OePIP2.1, and stromal CA. At mild stress and at the beginning of the recovery period, stomatal limitations prevailed, while the decline in g m accounted for up to 60% of photosynthesis limitations under severe water stress. However, g m was restored to control values shortly after rewatering, facilitating the recovery of the photosynthetic rate. CA was downregulated during water stress and upregulated after recovery. The use of structural equation modelling allowed us to conclude that both OePIP1.1 and OePIP2.1 expression could explain most of the variations observed for g s and g m. CA expression also had a small but significant effect on g m in olive under water-stress conditions. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Cerebrospinal fluid aquaporin-4-immunoglobulin G disrupts blood brain barrier

DEFF Research Database (Denmark)

Asgari, Nasrin; Berg, Carsten Tue; Mørch, Marlene Thorsen

2015-01-01

associated with blood-borne horseradish peroxidase leakage indicating blood-brain barrier breakdown. The cerebrospinal fluid aquaporin-4-immunoglobulin G therefore distributes widely in brain to initiate astrocytopathy and blood-brain barrier breakdown....... was evaluated. A distinct distribution pattern of aquaporin-4-immunoglobulin G deposition was observed in the subarachnoid and subpial spaces where vessels penetrate the brain parenchyma, via a paravascular route with intraparenchymal perivascular deposition. Perivascular astrocyte-destructive lesions were...

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Aquaporin-6 Expression in the Cochlear Sensory Epithelium Is Downregulated by Salicylates

Directory of Open Access Journals (Sweden)

Paola Perin

2010-01-01

Full Text Available We characterize the expression pattern of aquaporin-6 in the mouse inner ear by RT-PCR and immunohistochemistry. Our data show that in the inner ear aquaporin-6 is expressed, in both vestibular and acoustic sensory epithelia, by the supporting cells directly contacting hair cells. In particular, in the Organ of Corti, expression was strongest in Deiters' cells, which provide both a mechanical link between outer hair cells (OHCs and the Organ of Corti, and an entry point for ion recycle pathways. Since aquaporin-6 is permeable to both water and anions, these results suggest its possible involvement in regulating OHC motility, directly through modulation of water and chloride flow or by changing mechanical compliance in Deiters' cells. In further support of this role, treating mice with salicylates, which impair OHC electromotility, dramatically reduced aquaporin-6 expression in the inner ear epithelia but not in control tissues, suggesting a role for this protein in modulating OHCs' responses.

Aquaporin-6 expression in the cochlear sensory epithelium is downregulated by salicylates.

Science.gov (United States)

Perin, Paola; Tritto, Simona; Botta, Laura; Fontana, Jacopo Maria; Gastaldi, Giulia; Masetto, Sergio; Tosco, Marisa; Laforenza, Umberto

2010-01-01

We characterize the expression pattern of aquaporin-6 in the mouse inner ear by RT-PCR and immunohistochemistry. Our data show that in the inner ear aquaporin-6 is expressed, in both vestibular and acoustic sensory epithelia, by the supporting cells directly contacting hair cells. In particular, in the Organ of Corti, expression was strongest in Deiters' cells, which provide both a mechanical link between outer hair cells (OHCs) and the Organ of Corti, and an entry point for ion recycle pathways. Since aquaporin-6 is permeable to both water and anions, these results suggest its possible involvement in regulating OHC motility, directly through modulation of water and chloride flow or by changing mechanical compliance in Deiters' cells. In further support of this role, treating mice with salicylates, which impair OHC electromotility, dramatically reduced aquaporin-6 expression in the inner ear epithelia but not in control tissues, suggesting a role for this protein in modulating OHCs' responses.

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Changes in plasma membrane aquaporin gene expression under osmotic stress and blue light in tomato

Czech Academy of Sciences Publication Activity Database

Balarynová, Jana; Danihlík, J.; Fellner, Martin

2018-01-01

Roč. 40, č. 2 (2018), č. článku 27. ISSN 0137-5881 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : male-sterile mutant * arabidopsis-thaliana * seed-germination * abscisic-acid * solanum-lycopersicon * nitric-oxide * 7b-1 * protein * hypocotyl * responses * Tomato * Seed * Aquaporins * Blue light * 7B-1 mutant * Mannitol * PIPs Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.364, year: 2016

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Yeast aquaporin regulation by 4-hydroxynonenal is implicated in oxidative stress response.

Science.gov (United States)

Rodrigues, Claudia; Tartaro Bujak, Ivana; Mihaljević, Branka; Soveral, Graça; Cipak Gasparovic, Ana

2017-05-01

Reactive oxygen species, especially hydrogen peroxide (H 2 O 2 ), contribute to functional molecular impairment and cellular damage, but also are necessary in normal cellular metabolism, and in low doses play stimulatory role in cell proliferation and stress resistance. In parallel, reactive aldehydes such as 4-hydroxynonenal (HNE), are lipid peroxidation breakdown products which also contribute to regulation of numerous cellular processes. Recently, channeling of H 2 O 2 by some mammalian aquaporin isoforms has been reported and suggested to contribute to aquaporin involvement in cancer malignancies, although the mechanism by which these membrane water channels are implicated in oxidative stress is not clear. In this study, two yeast models with increased levels of membrane polyunsaturated fatty acids (PUFAs) and aquaporin AQY1 overexpression, respectively, were used to evaluate their interplay in cell's oxidative status. In particular, the aim of the study was to investigate if HNE accumulation could affect aquaporin function with an outcome in oxidative stress response. The data showed that induction of aquaporin expression by PUFAs results in increased water permeability in yeast membranes and that AQY1 activity is impaired by HNE. Moreover, AQY1 expression increases cellular sensitivity to oxidative stress by facilitating H 2 O 2 influx. On the other hand, AQY1 expression has no influence on the cellular antioxidant GSH levels and catalase activity. These results strongly suggest that aquaporins are important players in oxidative stress response and could contribute to regulation of cellular processes by regulation of H 2 O 2 influx. © 2017 IUBMB Life, 69(5):355-362, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Pancreatic Aquaporin-7: A Novel Target for Anti-diabetic Drugs?

Science.gov (United States)

Méndez-Giménez, Leire; Ezquerro, Silvia; da Silva, Inês V; Soveral, Graça; Frühbeck, Gema; Rodríguez, Amaia

2018-01-01

Aquaporins comprise a family of 13 members of water channels (AQP0-12) that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5, and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells) is composed by the islets of Langerhans, which are distributed in α, β, δ, ε, and pancreatic polypeptide (PP) cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic β-cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced β-cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion through the increase of intracytoplasmic glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function mutations of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is focused on the role

Pancreatic aquaporin-7: a novel target for anti-diabetic drugs?

Science.gov (United States)

Méndez-Giménez, Leire; Ezquerro, Silvia; da Silva, Inês V.; Soveral, Graça; Frühbeck, Gema; Rodríguez, Amaia

2018-04-01

Aquaporins comprise a family of 13 members of water channels (AQP0-12) that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5 and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells) is composed by the islets of Langerhans, which are distributed in ,, ,  and pancreatic polypeptide (PP) cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic -cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced -cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion by increasing intracellular glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function variants of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is focused on the role of

Pancreatic Aquaporin-7: A Novel Target for Anti-diabetic Drugs?

Directory of Open Access Journals (Sweden)

Leire Méndez-Giménez

2018-04-01

Full Text Available Aquaporins comprise a family of 13 members of water channels (AQP0-12 that facilitate a rapid transport of water across cell membranes. In some cases, these pores are also permeated by small solutes, particularly glycerol, urea or nitric oxide, among other solutes. Several aquaporins have been identified in the pancreas, an exocrine and endocrine organ that plays an essential role in the onset of insulin resistance and type 2 diabetes. The exocrine pancreas, which accounts for 90% of the total pancreas, secretes daily large volumes of a near-isotonic fluid containing digestive enzymes into the duodenum. AQP1, AQP5, and AQP8 contribute to fluid secretion especially from ductal cells, whereas AQP12 allows the proper maturation and exocytosis of secretory granules in acinar cells of the exocrine pancreas. The endocrine pancreas (10% of the total pancreatic cells is composed by the islets of Langerhans, which are distributed in α, β, δ, ε, and pancreatic polypeptide (PP cells that secrete glucagon, insulin, somatostatin, ghrelin and PP, respectively. AQP7, an aquaglyceroporin permeated by water and glycerol, is expressed in pancreatic β-cells and murine studies have confirmed its participation in insulin secretion, triacylglycerol synthesis and proliferation of these endocrine cells. In this regard, transgenic AQP7-knockout mice develop adult-onset obesity, hyperinsulinemia, increased intracellular triacylglycerol content and reduced β-cell mass in Langerhans islets. Moreover, we have recently reported that AQP7 upregulation in β-cells after bariatric surgery, an effective weight loss surgical procedure, contributes, in part, to the improvement of pancreatic steatosis and insulin secretion through the increase of intracytoplasmic glycerol in obese rats. Human studies remain scarce and controversial, with some rare cases of loss-of function mutations of the AQP7 gene being associated with the onset of type 2 diabetes. The present Review is

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Ménière's Disease: Molecular Analysis of Aquaporins 2, 3 and Potassium Channel KCNE1 Genes in Brazilian Patients.

Science.gov (United States)

Lopes, Karen de Carvalho; Sartorato, Edi Lúcia; da Silva-Costa, Sueli M; de Macedo Adamov, Nadya Soares; Ganança, Fernando Freitas

2016-09-01

Ménière's disease (MD) is a complex disease of unknown etiology characterized by a symptomatic tetrad of vertigo, hearing loss, tinnitus, and aural fullness. In addition to factors related to homeostasis of the inner ear, genetic factors have been implicated in its pathophysiology, including genes related to the transport of water and ionic composition maintenance of the endolymph, such as the aquaporin genes AQP2 and AQP3, and the potassium channel gene KCNE1. The aim of this study was to identify polymorphisms of these genes and determine their association with clinical characteristics of patients with MD. A case-control genetic association study was carried out, including 30 patients with definite Ménière's disease and 30 healthy controls. The coding regions of the target genes were amplified from blood samples by polymerase chain reaction (PCR), followed by direct sequencing. The associations of polymorphisms with clinical characteristics were analyzed with logistic regression. Five polymorphisms were identified: rs426496 in AQP2; rs591810 in AQP3; and rs1805127, rs1805128, and rs17173510 in KCNE1. After adjustment, rs426496 was significantly associated with tinnitus during the initial crisis and with altered electronystagmography, and rs1805127 was significantly associated with nephropathy. The genetic variant rs426496 in AQP2; rs591810 in AQP3 and rs1805127, rs1805128, and rs17173510, in KCNE1 were found in patients with Ménière's disease. The polymorphism rs426496, in AQP2, is associated with tinnitus at the onset of Ménière's disease and altered electronystagmography. In addition, rs1805127, in KCNE1, is associated with the presence of nephropathy.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

Science.gov (United States)

Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

2012-10-01

We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

Aquaporin based biomimetic membrane in forward osmosis: Chemical cleaning resistance and practical operation

DEFF Research Database (Denmark)

Li, Zhenyu; Linares, Rodrigo Valladares; Bucs, Szilard

2017-01-01

Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused, by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquapor...

Targeting Aquaporin Function : Potent Inhibition of Aquaglyceroporin-3 by a Gold-Based Compound

NARCIS (Netherlands)

Martins, Ana Paula; Marrone, Alessandro; Ciancetta, Antonella; Galan Cobo, Ana; Echevarria, Miriam; Moura, Teresa F.; Re, Nazzareno; Casini, Angela; Soveral, Graca

2012-01-01

Aquaporins (AQPs) are membrane channels that conduct water and small solutes such as glycerol and are involved in many physiological functions. Aquaporin-based modulator drugs are predicted to be of broad potential utility in the treatment of several diseases. Until today few AQP inhibitors have

Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

Science.gov (United States)

Forrest, Kerrie L; Bhave, Mrinal

2007-10-01

The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.

Aquaporin based biomimetic membrane in forward osmosis: Chemical cleaning resistance and practical operation

KAUST Repository

Li, Zhenyu

2017-07-27

Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin based biomimetic membrane in simulated membrane cleaning processes. The effects of cleaning agents on water flux and salt rejection were evaluated. The membrane showed a good resistance to the chemical agents. The water flux after chemical cleaning showed significant increases, particularly after cleaning with NaOCl and Alconox. Changes in the membrane structure and increased hydrophilicity in the surrounding areas of the aquaporin may be accountable for the increase in water permeability. The membrane shows stable salt rejection up to 99% after all cleaning agents were tested. A 15-day experiment with secondary wastewater effluent as the feed solution and seawater as the draw solution showed a stable flux and high salt rejection. The average rejection of the dissolved organic carbon from wastewater after the 15-day test was 90%. The results demonstrated that the aquaporin based biomimetic FO membrane exhibits chemical resistance for most agents used in membrane cleaning procedures, maintaining a stable flux and high salt rejection.

Aquaporin based biomimetic membrane in forward osmosis: Chemical cleaning resistance and practical operation

KAUST Repository

Li, Zhenyu; Valladares Linares, Rodrigo; Bucs, Szilard; Fortunato, Luca; Hé lix-Nielsen, Claus; Vrouwenvelder, Johannes S.; Ghaffour, NorEddine; Leiknes, TorOve; Amy, Gary

2017-01-01

Aquaporin plays a promising role in fabricating high performance biomimetic forward osmosis (FO) membranes. However, aquaporin as a protein also has a risk of denaturation caused by various chemicals, resulting in a possible decay of membrane performance. The present study tested a novel aquaporin based biomimetic membrane in simulated membrane cleaning processes. The effects of cleaning agents on water flux and salt rejection were evaluated. The membrane showed a good resistance to the chemical agents. The water flux after chemical cleaning showed significant increases, particularly after cleaning with NaOCl and Alconox. Changes in the membrane structure and increased hydrophilicity in the surrounding areas of the aquaporin may be accountable for the increase in water permeability. The membrane shows stable salt rejection up to 99% after all cleaning agents were tested. A 15-day experiment with secondary wastewater effluent as the feed solution and seawater as the draw solution showed a stable flux and high salt rejection. The average rejection of the dissolved organic carbon from wastewater after the 15-day test was 90%. The results demonstrated that the aquaporin based biomimetic FO membrane exhibits chemical resistance for most agents used in membrane cleaning procedures, maintaining a stable flux and high salt rejection.

In vitro physiological and pathophysiological models: dynamic expression of aquaporins.

OpenAIRE

Avola, Rosanna

2017-01-01

Water is the main component of biological fluids and a prerequisite of all organisms living. In 1987, Agre isolated a new integral membrane protein acting as a channel that mediates the water flux and uncharged solutes across biological membranes. This protein was called aquaporin1 and ever since its discovery, more than 300 homologues have been identified in animal, bacteria and plant. In human have been discovered 13 aquaporins (AQPs) isoform (AQP0-AQP12) widely distributed in various epith...

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Do phosphoinositides regulate membrane water permeability of tobacco protoplasts by enhancing the aquaporin pathway?

Science.gov (United States)

Ma, Xiaohong; Shatil-Cohen, Arava; Ben-Dor, Shifra; Wigoda, Noa; Perera, Imara Y; Im, Yang Ju; Diminshtein, Sofia; Yu, Ling; Boss, Wendy F; Moshelion, Menachem; Moran, Nava

2015-03-01

Enhancing the membrane content of PtdInsP 2 , the already-recognized protein-regulating lipid, increased the osmotic water permeability of tobacco protoplasts, apparently by increasing the abundance of active aquaporins in their membranes. While phosphoinositides are implicated in cell volume changes and are known to regulate some ion channels, their modulation of aquaporins activity has not yet been reported for any organism. To examine this, we compared the osmotic water permeability (P f) of protoplasts isolated from tobacco (Nicotiana tabacum) cultured cells (NT1) with different (genetically lowered or elevated relative to controls) levels of inositol trisphosphate (InsP3) and phosphatidyl inositol [4,5] bisphosphate (PtdInsP2). To achieve this, the cells were transformed with, respectively, the human InsP3 5-phosphatase ('Ptase cells') or human phosphatidylinositol (4) phosphate 5-kinase ('PIPK cells'). The mean P f of the PIPK cells was several-fold higher relative to that of controls and Ptase cells. Three results favor aquaporins over the membrane matrix as underlying this excessive P f: (1) transient expression of the maize aquaporin ZmPIP2;4 in the PIPK cells increased P f by 12-30 μm s(-1), while in the controls only by 3-4 μm s(-1). (2) Cytosol acidification-known to inhibit aquaporins-lowered the P f in the PIPK cells down to control levels. (3) The transcript of at least one aquaporin was elevated in the PIPK cells. Together, the three results demonstrate the differences between the PIPK cells and their controls, and suggest a hitherto unobserved regulation of aquaporins by phosphoinositides, which could occur through direct interaction or indirect phosphoinositides-dependent cellular effects.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Overexpression of the wheat aquaporin gene, TaAQP7, enhances drought tolerance in transgenic tobacco.

Directory of Open Access Journals (Sweden)

Shiyi Zhou

Full Text Available Aquaporin (AQP proteins have been shown to transport water and other small molecules through biological membranes, which is crucial for plants to combat stress caused by drought. However, the precise role of AQPs in drought stress response is not completely understood in plants. In this study, a PIP2 subgroup gene AQP, designated as TaAQP7, was cloned and characterized from wheat. Expression of TaAQP7-GFP fusion protein revealed its localization in the plasma membrane. TaAQP7 exhibited high water channel activity in Xenopus laevis oocytes and TaAQP7 transcript was induced by dehydration, and treatments with polyethylene glycol (PEG, abscisic acid (ABA and H(2O(2. Further, TaAQP7 was upregulated after PEG treatment and was blocked by inhibitors of ABA biosynthesis, implying that ABA signaling was involved in the upregulation of TaAQP7 after PEG treatment. Overexpression of TaAQP7 increased drought tolerance in tobacco. The transgenic tobacco lines had lower levels of malondialdehyde (MDA and H(2O(2, and less ion leakage (IL, but higher relative water content (RWC and superoxide dismutase (SOD and catalase (CAT activities when compared with the wild type (WT under drought stress. Taken together, our results show that TaAQP7 confers drought stress tolerance in transgenic tobacco by increasing the ability to retain water, reduce ROS accumulation and membrane damage, and enhance the activities of antioxidants.

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Aquaporins of the PIP2 class are required for efficient anther dehiscence in tobacco.

Science.gov (United States)

Bots, Marc; Vergeldt, Frank; Wolters-Arts, Mieke; Weterings, Koen; van As, Henk; Mariani, Celestina

2005-03-01

Several processes during sexual reproduction in higher plants involve the movement of water between cells or tissues. Before flower anthesis, anther and pollen dehydration takes place before the release of mature pollen at dehiscence. Aquaporins represent a class of proteins that mediates the movement of water over cellular membranes. Aquaporins of the plasmamembrane PIP2 family are expressed in tobacco (Nicotiana tabacum) anthers and may therefore be involved in the movement of water in this organ. To gain more insight into the role these proteins may play in this process, we have analyzed their localization using immunolocalizations and generated plants displaying RNA interference of PIP2 aquaporins. Our results indicate that PIP2 protein expression is modulated during anther development. Furthermore, in tobacco PIP2 RNA interference plants, anther dehydration was slower, and dehiscence occurred later when compared with control plants. Together, our results suggest that aquaporins of the PIP2 class are required for efficient anther dehydration prior to dehiscence.

Plant plasma membrane aquaporins in natural vesicles as potential stabilizers and carriers of glucosinolates.

Science.gov (United States)

Martínez-Ballesta, Maria Del Carmen; Pérez-Sánchez, Horacio; Moreno, Diego A; Carvajal, Micaela

2016-07-01

Their biodegradable nature and ability to target cells make biological vesicles potential nanocarriers for bioactives delivery. In this work, the interaction between proteoliposomes enriched in aquaporins derived from broccoli plants and the glucosinolates was evaluated. The vesicles were stored at different temperatures and their integrity was studied. Determination of glucosinolates, showed that indolic glucosinolates were more sensitive to degradation in aqueous solution than aliphatic glucosinolates. Glucoraphanin was stabilized by leaf and root proteoliposomes at 25°C through their interaction with aquaporins. An extensive hydrogen bond network, including different aquaporin residues, and hydrophobic interactions, as a consequence of the interaction between the linear alkane chain of glucoraphanin and Glu31 and Leu34 protein residues, were established as the main stabilizing elements. Combined our results showed that plasma membrane vesicles from leaf and root tissues of broccoli plants may be considered as suitable carriers for glucosinolate which stabilization can be potentially attributed to aquaporins. Copyright © 2016 Elsevier B.V. All rights reserved.

Tubular localization and expressional dynamics of aquaporins in the kidney of seawater-challenged Atlantic salmon

DEFF Research Database (Denmark)

Engelund, Morten Buch; Madsen, Steffen S

2015-01-01

Most vertebrate nephrons possess an inherited ability to secrete fluid in normal or pathophysiological states. We hypothesized that renal aquaporin expression and localization are functionally regulated in response to seawater and during smoltification in Atlantic salmon and thus reflect a shift...... in renal function from filtration towards secretion. We localized aquaporins (Aqp) in Atlantic salmon renal tubular segments by immunohistochemistry and monitored their expressional dynamics using RT-PCR and immunoblotting. Three aquaporins: Aqpa1aa, Aqp1ab and Aqp8b and two aquaglyceroporins Aqp3a and Aqp......10b were localized in the kidney of salmon. The staining for all aquaporins was most abundant in the proximal kidney tubules and there was no clear effect of salinity or developmental stage on localization pattern. Aqp1aa and Aqp3a were abundant apically but extended throughout the epithelial cells...

Aquaporin-1 and aquaporin-3 expressions in the temporo-mandibular joint condylar cartilage after an experimentally induced osteoarthritis.

Science.gov (United States)

Meng, Juan-hong; Ma, Xu-chen; Li, Zhi-min; Wu, Deng-cheng

2007-12-20

Over 70% of the total tissue weight in the cartilage matrix consists of water, and the early-stage osteoarthritic cartilage is characterized by swelling. Water transport in the cartilage matrix and across the membranes of chondrocytes may be important in normal and pathological conditions of cartilage. The purpose of this study was to identify aquaporin-1 (AQP1) and aquaporin-3 (AQP3) expressions in the mandibular condylar cartilage after experimentally induced osteoarthritis (OA) in rats. An experimental temporomandibular joint OA was induced by partial discectomy in rats. The pathological characteristics of the normal, early-stage, and late-stage osteoarthritic TMJ cartilages were verified by histological techniques. The AQP1 and AQP3 gene expressions in the normal and osteoarthritic cartilages were measured using quantitative real-time reverse-transcription PCR analysis. The cartilage sections were incubated in primary polyclonal antibodies to AQP3; immunofluorescent microscopy was used to examine the AQP3 expression shown by its protein level. The mRNA expression levels of AQP1 and AQP3, analyzed using quantitative PCR, revealed that AQP3 mRNA was highly up-regulated in the OA cartilage, which was considered significant. There was no notable difference in the expression of AQP1 mRNA between OA and normal controls. With the progressing of the OA, the localization of the AQP3 protein was quite different from that of the normal cartilage. Compared to the normal cartilage, the expressions of AQP3 protein were observed mainly in the proliferative zone and the upper mid-zone chondrocytes at the early-stage of OA, and were observed to appear frequently throughout the mid- and deep zone during the late-stage of OA. The high expression of AQP3 mRNA in the OA cartilage and the different localization of the AQP3 protein suggest that it may play a particular role in OA pathogenesis. Further study of AQP3 function may provide new insight into the understanding of the

Renal aquaporins and water balance disorders

DEFF Research Database (Denmark)

Kortenoeven, Marleen; Fenton, Robert A.

2013-01-01

BACKGROUND: Aquaporins (AQPs) are a family of proteins that can act as water channels. Regulation of AQPs is critical to osmoregulation and the maintenance of body water homeostasis. Eight AQPs are expressed in the kidney of which five have been shown to play a role in body water balance; AQP1, A......-solute diet and diuretics. GENERAL SIGNIFICANCE: In recent years, our understanding of the underlying mechanisms of water balance disorders has increased enormously, which has opened up several possible new treatment strategies.......BACKGROUND: Aquaporins (AQPs) are a family of proteins that can act as water channels. Regulation of AQPs is critical to osmoregulation and the maintenance of body water homeostasis. Eight AQPs are expressed in the kidney of which five have been shown to play a role in body water balance; AQP1, AQP......2, AQP3, AQP4 and AQP7. AQP2 in particular is regulated by vasopressin. SCOPE OF REVIEW: This review summarizes our current knowledge of the underlying mechanisms of various water balance disorders and their treatment strategies. MAJOR CONCLUSIONS: Dysfunctions of AQPs are involved in disorders...

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Aquaporins in the Eye

DEFF Research Database (Denmark)

Tran, Thuy Linh; Hamann, Steffen; Heegaard, Steffen

2017-01-01

The major part of the eye consists of water . Continuous movement of water and ions between the ocular compartments and to the systemic circulation is pivotal for many physiological functions in the eye. The movement of water facilitates removal of the many metabolic products of corneal-, ciliary...... pressure. In the retina, water is transported into the vitreous body and across the retinal pigment epithelium to regulate the extracellular environment and the hydration of the retina. Aquaporins (AQPs ) take part in the water transport throughout the eye....

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Increased expression of aquaporin-4 in human traumatic brain injury and brain tumors

Institute of Scientific and Technical Information of China (English)

HuaHu; Wei-PingZhang; LeiZhang; ZhongChen; Er-QingWei

2004-01-01

Aquaporin-4 (AQP4) is one of the aquaporins (AQPs), a water channel family. In the brain, AQP4 is expressed in astroeyte foot processes, and plays an important role in water homeostasis and in the formation of brain edema. In our study, AQP4 expression in human brain specimens from patients with traumatic brain injury or different brain tumors was detected

Water transport and functional dynamics of aquaporins in osmoregulatory organs of fishes

DEFF Research Database (Denmark)

Madsen, Steffen S; Engelund, Morten B; Cutler, Christopher P

2015-01-01

salty desert lakes, the challenge to obtain consensus as well as specific knowledge about aquaporin physiology in these vertebrate clades is overwhelming. Because the integumental surfaces of these animals are in intimate contact with the surrounding milieu, passive water loss and uptake represent two......Aquaporins play distinct roles for water transport in fishes as they do in mammals-both at the cellular, organ, and organismal levels. However, with over 32,000 known species of fishes inhabiting almost every aquatic environment, from tidal pools, small mountain streams, to the oceans and extreme...... of the major osmoregulatory challenges that need compensation. However, neither obligatory nor regulatory water transport nor their mechanisms have been elucidated to the same degree as, for example, ion transport in fishes. Currently fewer than 60 papers address fish aquaporins. Most of these papers identify...

Differences in distribution and regulation of astrocytic aquaporin-4 in human and rat hydrocephalic brain

DEFF Research Database (Denmark)

Skjolding, Anders Daehli; Holst, Anders Vedel; Broholm, Helle

2013-01-01

findings to human pathophysiology. This study compares expression of aquaporin-4 in hydrocephalic human brain with human controls and hydrocephalic rat brain. Methods:  Cortical biopsies from patients with chronic hydrocephalus (n=29) were sampled secondary to planned surgical intervention. Aquaporin-4...

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

Novel regulation of aquaporins during osmotic stress.

Science.gov (United States)

Vera-Estrella, Rosario; Barkla, Bronwyn J; Bohnert, Hans J; Pantoja, Omar

2004-08-01

Aquaporin protein regulation and redistribution in response to osmotic stress was investigated. Ice plant (Mesembryanthemum crystallinum) McTIP1;2 (McMIPF) mediated water flux when expressed in Xenopus leavis oocytes. Mannitol-induced water imbalance resulted in increased protein amounts in tonoplast fractions and a shift in protein distribution to other membrane fractions, suggesting aquaporin relocalization. Indirect immunofluorescence labeling also supports a change in membrane distribution for McTIP1;2 and the appearance of a unique compartment where McTIP1;2 is expressed. Mannitol-induced redistribution of McTIP1;2 was arrested by pretreatment with brefeldin A, wortmannin, and cytochalasin D, inhibitors of vesicle trafficking-related processes. Evidence suggests a role for glycosylation and involvement of a cAMP-dependent signaling pathway in McTIP1;2 redistribution. McTIP1;2 redistribution to endosomal compartments may be part of a homeostatic process to restore and maintain cellular osmolarity under osmotic-stress conditions.

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Synthesis of robust and high-performance aquaporin-based biomimetic membranes by interfacial polymerization-membrane preparation and RO performance characterization

DEFF Research Database (Denmark)

Zhao, Yang; Qiu, Changquan; Li, Xuesong

2012-01-01

-free ABMs that can be easily scaled up. In the current study, a thin film composite (TFC) ABM was prepared by the interfacial polymerization method, where AquaporinZ-containing proteoliposomes were added to the m-phenylene-diamine aqueous solution. Control membranes, either without aquaporins......Aquaporins are water channel proteins with excellent water permeability and solute rejection, which makes them promising for preparing high-performance biomimetic membranes. Despite the growing interest in aquaporin-based biomimetic membranes (ABMs), it is challenging to produce robust and defect...... or with inactive (mutant) aquaporins, were also similarly prepared. The separation performance of these membranes was evaluated by cross-flow reverse osmosis (RO) tests. Compared to the controls, the active ABM achieved significantly higher water permeability (∼4L/m2hbar) with comparable NaCl rejection (∼97...

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Transcriptome profiling of genes and pathways associated with arsenic toxicity and tolerance in Arabidopsis

Science.gov (United States)

2014-01-01

Background Arsenic (As) is a toxic metalloid found ubiquitously in the environment and widely considered an acute poison and carcinogen. However, the molecular mechanisms of the plant response to As and ensuing tolerance have not been extensively characterized. Here, we report on transcriptional changes with As treatment in two Arabidopsis accessions, Col-0 and Ws-2. Results The root elongation rate was greater for Col-0 than Ws-2 with As exposure. Accumulation of As was lower in the more tolerant accession Col-0 than in Ws-2. We compared the effect of As exposure on genome-wide gene expression in the two accessions by comparative microarray assay. The genes related to heat response and oxidative stresses were common to both accessions, which indicates conserved As stress-associated responses for the two accessions. Most of the specific response genes encoded heat shock proteins, heat shock factors, ubiquitin and aquaporin transporters. Genes coding for ethylene-signalling components were enriched in As-tolerant Col-0 with As exposure. A tolerance-associated gene candidate encoding Leucine-Rich Repeat receptor-like kinase VIII (LRR-RLK VIII) was selected for functional characterization. Genetic loss-of-function analysis of the LRR-RLK VIII gene revealed altered As sensitivity and the metal accumulation in roots. Conclusions Thus, ethylene-related pathways, maintenance of protein structure and LRR-RLK VIII-mediated signalling may be important mechanisms for toxicity and tolerance to As in the species. Here, we provide a comprehensive survey of global transcriptional regulation for As and identify stress- and tolerance-associated genes responding to As. PMID:24734953

Diabetes Insipidus in Mice with a Mutation in Aquaporin-2.

Directory of Open Access Journals (Sweden)

2005-08-01

Full Text Available Congenital nephrogenic diabetes insipidus (NDI is a disease characterized by failure of the kidney to concentrate urine in response to vasopressin. Human kindreds with nephrogenic diabetes insipidus have been found to harbor mutations in the vasopressin receptor 2 (Avpr2 gene or the vasopressin-sensitive water channel aquaporin-2 (Aqp2 gene. Development of a treatment is rendered difficult due to the lack of a viable animal model. Through forward genetic screening of ethylnitrosourea-mutagenized mice, we report the identification and characterization of a mouse model of NDI, with an F204V mutation in the Aqp2 gene. Unlike previously attempted murine models of NDI, our mice survive to adulthood and more exactly recapitulate the human disorder. Previous in vitro experiments using renal cell lines suggest recessive Aqp2 mutations result in improper trafficking of the mutant water pore. Using these animals, we have directly proven this hypothesis of improper AQP2 translocation as the molecular defect in nephrogenic diabetes insipidus in the intact organism. Additionally, using a renal cell line we show that the mutated protein, AQP2-F204V, is retained in the endoplasmic reticulum and that this abnormal localization can be rescued by wild-type protein. This novel mouse model allows for further mechanistic studies as well as testing of pharmacological and gene therapies for NDI.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Differential effects of Pseudomonas mendocina and Glomus intraradices on lettuce plants physiological response and aquaporin PIP2 gene expression under elevated atmospheric CO2 and drought.

Science.gov (United States)

Alguacil, Maria Del Mar; Kohler, Josef; Caravaca, Fuensanta; Roldán, Antonio

2009-11-01

Arbuscular mycorrhizal (AM) symbiosis and plant-growth-promoting rhizobacterium (PGPR) can alleviate the effects of water stress in plants, but it is unknown whether these benefits can be maintained at elevated CO2. Therefore, we carried out a study where seedlings of Lactuca sativa were inoculated with the AM fungus (AMF) Glomus intraradices N.C. Schenk & G.S. Sm. or the PGPR Pseudomonas mendocina Palleroni and subjected to two levels of watering and two levels of atmospheric CO2 to ascertain their effects on plant physiological parameters and gene expression of one PIP aquaporin in roots. The inoculation with PGPR produced the greatest growth in lettuce plants under all assayed treatments as well as the highest foliar potassium concentration and leaf relative water content under elevated [CO2] and drought. However, under such conditions, the PIP2 gene expression remained almost unchanged. G. intraradices increased significantly the AMF colonization, foliar phosphorus concentration and leaf relative water content in plants grown under drought and elevated [CO2]. Under drought and elevated [CO2], the plants inoculated with G. intraradices showed enhanced expression of the PIP2 gene as compared to P. mendocina or control plants. Our results suggest that both microbial inoculation treatments could help to alleviate drought at elevated [CO2]. However, the PIP2 gene expression was increased only by the AMF but not by the PGPR under these conditions.

A naturally occurring Lgr4 splice variant encodes a soluble antagonist useful for demonstrating the gonadal roles of Lgr4 in mammals.

Directory of Open Access Journals (Sweden)

Pei-Jen Hsu

Full Text Available Leucine-rich repeat containing G protein-coupled receptor 4 (LGR4 promotes the Wnt signaling through interaction with R-spondins or norrin. Using PCR amplification from rat ovarian cDNAs, we identified a naturally occurring Lgr4 splice variant encoding only the ectodomain of Lgr4, which was named Lgr4-ED. Lgr4-ED can be detected as a secreted protein in the extracts from rodent and bovine postnatal gonads, suggesting conservation of Lgr4-ED in mammals. Recombinant Lgr4-ED purified from the conditioned media of transfected 293T cells was found to dose-dependently inhibit the LGR4-mediated Wnt signaling induced by RSPO2 or norrin, suggesting that it is capable of ligand absorption and could have a potential role as an antagonist. Intraperitoneal injection of purified recombinant Lgr4-ED into newborn mice was found to significantly decrease the testicular expression of estrogen receptor alpha and aquaporin 1, which is similar to the phenotype found in Lgr4-null mice. Administration of recombinant Lgr4-ED to superovulated female rats can also decrease the expression of estrogen receptor alpha, aquaporin 1, LH receptor and other key steroidogenic genes as well as bring about the suppression of progesterone production. Thus, these findings suggest that endogenously expressed Lgr4-ED may act as an antagonist molecule and help to fine-tune the R-spondin/norrin-mediated Lgr4-Wnt signaling during gonadal development.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Aquaporin-Based Biomimetic Polymeric Membranes: Approaches and Challenges

DEFF Research Database (Denmark)

Habel, Joachim Erich Otto; Hansen, Michael; Kynde, Søren

2015-01-01

In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs...... thin film interfacial polymerization techniques. Finally, we describe some new developments in interfacial polymerization using polyhedral oligomeric silsesquioxane cages for increasing the physical and chemical durability of thin film composite membranes.......In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs...... for investigating AQP incorporation including freeze-fracture transmission electron microscopy, fluorescence correlation spectroscopy, stopped-flow light scattering, and small-angle X-ray scattering. Third, we focus on recent efforts in embedding reconstituted AQPs in membrane designs that are based on conventional...

Aquaporin-Based Biomimetic Polymeric Membranes: Approaches and Challenges

Science.gov (United States)

Habel, Joachim; Hansen, Michael; Kynde, Søren; Larsen, Nanna; Midtgaard, Søren Roi; Jensen, Grethe Vestergaard; Bomholt, Julie; Ogbonna, Anayo; Almdal, Kristoffer; Schulz, Alexander; Hélix-Nielsen, Claus

2015-01-01

In recent years, aquaporin biomimetic membranes (ABMs) for water separation have gained considerable interest. Although the first ABMs are commercially available, there are still many challenges associated with further ABM development. Here, we discuss the interplay of the main components of ABMs: aquaporin proteins (AQPs), block copolymers for AQP reconstitution, and polymer-based supporting structures. First, we briefly cover challenges and review recent developments in understanding the interplay between AQP and block copolymers. Second, we review some experimental characterization methods for investigating AQP incorporation including freeze-fracture transmission electron microscopy, fluorescence correlation spectroscopy, stopped-flow light scattering, and small-angle X-ray scattering. Third, we focus on recent efforts in embedding reconstituted AQPs in membrane designs that are based on conventional thin film interfacial polymerization techniques. Finally, we describe some new developments in interfacial polymerization using polyhedral oligomeric silsesquioxane cages for increasing the physical and chemical durability of thin film composite membranes. PMID:26264033

Novel Regulation of Aquaporins during Osmotic Stress1

Science.gov (United States)

Vera-Estrella, Rosario; Barkla, Bronwyn J.; Bohnert, Hans J.; Pantoja, Omar

2004-01-01

Aquaporin protein regulation and redistribution in response to osmotic stress was investigated. Ice plant (Mesembryanthemum crystallinum) McTIP1;2 (McMIPF) mediated water flux when expressed in Xenopus leavis oocytes. Mannitol-induced water imbalance resulted in increased protein amounts in tonoplast fractions and a shift in protein distribution to other membrane fractions, suggesting aquaporin relocalization. Indirect immunofluorescence labeling also supports a change in membrane distribution for McTIP1;2 and the appearance of a unique compartment where McTIP1;2 is expressed. Mannitol-induced redistribution of McTIP1;2 was arrested by pretreatment with brefeldin A, wortmannin, and cytochalasin D, inhibitors of vesicle trafficking-related processes. Evidence suggests a role for glycosylation and involvement of a cAMP-dependent signaling pathway in McTIP1;2 redistribution. McTIP1;2 redistribution to endosomal compartments may be part of a homeostatic process to restore and maintain cellular osmolarity under osmotic-stress conditions. PMID:15299122

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Aquaporin-mediated increase in root hydraulic conductance is involved in silicon-induced improved root water uptake under osmotic stress in Sorghum bicolor L.

Science.gov (United States)

Liu, Peng; Yin, Lina; Deng, Xiping; Wang, Shiwen; Tanaka, Kiyoshi; Zhang, Suiqi

2014-09-01

The fact that silicon application alleviates water deficit stress has been widely reported, but the underlying mechanism remains unclear. Here the effects of silicon on water uptake and transport of sorghum seedlings (Sorghum bicolor L.) growing under polyethylene glycol-simulated osmotic stress in hydroponic culture and water deficit stress in sand culture were investigated. Osmotic stress dramatically decreased dry weight, photosynthetic rate, transpiration rate, stomatal conductance, and leaf water content, but silicon application reduced these stress-induced decreases. Although silicon application had no effect on stem water transport capacity, whole-plant hydraulic conductance (Kplant) and root hydraulic conductance (Lp) were higher in silicon-treated seedlings than in those without silicon treatment under osmotic stress. Furthermore, the extent of changes in transpiration rate was similar to the changes in Kplant and Lp. The contribution of aquaporin to Lp was characterized using the aquaporin inhibitor mercury. Under osmotic stress, the exogenous application of HgCl2 decreased the transpiration rates of seedlings with and without silicon to the same level; after recovery induced by dithiothreitol (DTT), however, the transpiration rate was higher in silicon-treated seedlings than in untreated seedlings. In addition, transcription levels of several root aquaporin genes were increased by silicon application under osmotic stress. These results indicate that the silicon-induced up-regulation of aquaporin, which was thought to increase Lp, was involved in improving root water uptake under osmotic stress. This study also suggests that silicon plays a modulating role in improving plant resistance to osmotic stress in addition to its role as a mere physical barrier. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

Aquaporin-4-autoimmunity in patients with systemic lupus erythematosus

DEFF Research Database (Denmark)

Asgari, Nasrin; Jarius, Sven; Laustrup, Helle

2018-01-01

BACKGROUND: Serum immunoglobulin G targeting the astrocyte water channel aquaporin-4 (AQP4) in the central nervous system (CNS) is a biomarker for neuromyelitis optica spectrum disease (NMOSD). Co-existence of NMOSD with systemic lupus erythematosus (SLE) putatively suggests susceptibility...

Frequency and prognostic impact of antibodies to aquaporin-4 in patients with optic neuritis

DEFF Research Database (Denmark)

Jarius, Sven; Frederiksen, Jette Lautrup Battistini; Waters, Patrick

2010-01-01

Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord.......Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord....

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.

Science.gov (United States)

Mishra, Avinash; Tanna, Bhakti

2017-01-01

Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Virus-induced plasma membrane aquaporin PsPIP2;1 silencing inhibits plant water transport of Pisum sativum.

Science.gov (United States)

Song, Juanjuan; Ye, Guoliang; Qian, Zhengjiang; Ye, Qing

2016-12-01

Aquaporins (AQPs) are known to facilitate water transport across cell membranes, but the role of a single AQP in regulating plant water transport, particularly in plants other than Arabidopsis remains largely unexplored. In the present study, a virus-induced gene silencing (VIGS) technique was employed to suppress the expression of a specific plasma membrane aquaporin PsPIP2;1 of Pea plants (Pisum sativum), and subsequent effects of the gene suppression on root hydraulic conductivity (Lp r ), leaf hydraulic conductivity (K leaf ), root cell hydraulic conductivity (Lp rc ), and leaf cell hydraulic conductivity (Lp lc ) were investigated, using hydroponically grown Pea plants. Compared with control plants, VIGS-PsPIP2;1 plants displayed a significant suppression of PsPIP2;1 in both roots and leaves, while the expression of other four PIP isoforms (PsPIP1;1, PsPIP1;2, PsPIP2;2, and PsPIP2;3) that were simultaneously monitored were not altered. As a consequence, significant declines in water transport of VIGS-PsPIP2;1 plants were observed at both organ and cell levels, i.e., as compared to control plants, Lp r and K leaf were reduced by 29 %, and Lp rc and Lp lc were reduced by 20 and 29 %, respectively. Our results demonstrate that PsPIP2;1 alone contributes substantially to root and leaf water transport in Pea plants, and highlight VIGS a useful tool for investigating the role of a single AQP in regulating plant water transport.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

The Role of Aquaporins in Ocular Lens Homeostasis

Science.gov (United States)

Schey, Kevin L.; Petrova, Rosica S.; Gletten, Romell B.; Donaldson, Paul J.

2017-01-01

Aquaporins (AQPs), by playing essential roles in the maintenance of ocular lens homeostasis, contribute to the establishment and maintenance of the overall optical properties of the lens over many decades of life. Three aquaporins, AQP0, AQP1 and AQP5, each with distinctly different functional properties, are abundantly and differentially expressed in the different regions of the ocular lens. Furthermore, the diversity of AQP functionality is increased in the absence of protein turnover by age-related modifications to lens AQPs that are proposed to alter AQP function in the different regions of the lens. These regional differences in AQP functionality are proposed to contribute to the generation and directionality of the lens internal microcirculation; a system of circulating ionic and fluid fluxes that delivers nutrients to and removes wastes from the lens faster than could be achieved by passive diffusion alone. In this review, we present how regional differences in lens AQP isoforms potentially contribute to this microcirculation system by highlighting current areas of investigation and emphasizing areas where future work is required. PMID:29231874

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

Directory of Open Access Journals (Sweden)

Jiongming Sui

2018-03-01

Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

Aquaporin-2 excretion in hospitalized patients with cirrhosis

DEFF Research Database (Denmark)

Busk, Troels M; Møller, Søren; Pedersen, Erling B.

2017-01-01

Background and Aim: Urinary aquaporin-2 (AQP2) is a parameter of water transport in the principal cells in the distal part of the nephron and involved in water retention in cirrhosis and may be a marker of renal function. The aim of the study was to evaluate AQP2 as a predictor of renal insuffici...

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

Development of supported biomimetic membranes for insertion of aquaporin protein water channels for novel water filtration applications

DEFF Research Database (Denmark)

Hansen, Jesper Søndergaard

). This constitutes a new methodology to correctly and functionally reconstitute membrane proteins in controllable amounts into giant vesicles. The method for formation of giant protein vesicles subsequently led to the first functional prototype of an aquaporin-membrane water filtration device.......Aquaporins represent a class of membrane protein channels found in all living organisms that selectively transport water molecules across biological membranes. The work presented in this thesis was motivated by the conceptual idea of incorporating aquaporin water channels into biomimetic membranes...... to develop novel water separation technologies. To accomplish this, it is necessary to construct an efficient platform to handle biomimetic membranes. Moreover, general methods are required to reliable and controllable reconstitute membrane proteins into artificially made model membranes...

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

[Effects of aquaporin-4 gene knockout on behavior changes and cerebral morphology during aging in mice].

Science.gov (United States)

Su, Shengan; Lu, Yunbi; Zhang, Weiping

2013-05-01

To investigate the effects of aquaporin-4 (AQP4) gene knockout on the behavior changes and cerebral morphology during aging in mice,and to compare that of young and aged mice between AQP4 knockout mice (AQP4(-/-)) and wild type mice (AQP4(+/+)). Fifty-eight CD-1 mice were divided into four groups: young (2-3 months old) AQP4(-/-), aged (17-19 months old) AQP4(-/-), young AQP4(+/+) and aged AQP4(+/+). The activity levels and exploring behavior of mice were tested in open field. The neurons were stained with toluidine blue and NeuN, the astrocytes and microglia were stained with GFAP and Iba-1, respectively. The morphological changes of neuron, astrocyte and microglia were then analyzed. Compared with young mice, the total walking distance in open field of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 41.2% and 44.1%, respectively (Ptime in the central area of open field. The density of neuron in cortex of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 19.6% and 15.8%, respectively (P<0.05), while there was no difference in the thickness of neuron cell body in hippocampus CA1 region. The density of astrocyte in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 57.7% and 64.3%, respectively (P<0.001), while there was no difference in the area of astrocyte. The area of microglia in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 46.9% and 52.0%, respectively (P<0.01), while there was no difference in the density of microglia. Compared with AQP4(+/+) mice, the young and aged AQP4(-/-) mice showed smaller area of astrocyte in hippocampus CA3 region, reduced 18.0% in young mice and 23.6% in aged mice. There was no difference between AQP4(+/+) mice and AQP4(-/-) mice for other observed indexes. AQP4 may be involved in change of astrocyte and astrocyte-related behaviors during aging. AQP4 gene knockout may have limited effects on the change of neuron, microglia and most neuronal behaviors in aging

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Unexpected complexity of the Aquaporin gene family in the moss Physcomitrella patens

Directory of Open Access Journals (Sweden)

Johanson Urban

2008-04-01

Full Text Available Abstract Background Aquaporins, also called major intrinsic proteins (MIPs, constitute an ancient superfamily of channel proteins that facilitate the transport of water and small solutes across cell membranes. MIPs are found in almost all living organisms and are particularly abundant in plants where they form a divergent group of proteins able to transport a wide selection of substrates. Results Analyses of the whole genome of Physcomitrella patens resulted in the identification of 23 MIPs, belonging to seven different subfamilies, of which only five have been previously described. Of the newly discovered subfamilies one was only identified in P. patens (Hybrid Intrinsic Protein, HIP whereas the other was found to be present in a wide variety of dicotyledonous plants and forms a major previously unrecognized MIP subfamily (X Intrinsic Proteins, XIPs. Surprisingly also some specific groups within subfamilies present in Arabidopsis thaliana and Zea mays could be identified in P. patens. Conclusion Our results suggest an early diversification of MIPs resulting in a large number of subfamilies already in primitive terrestrial plants. During the evolution of higher plants some of these subfamilies were subsequently lost while the remaining subfamilies expanded and in some cases diversified, resulting in the formation of more specialized groups within these subfamilies.

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Heterogeneity of astrocytes: from development to injury - single cell gene expression.

Directory of Open Access Journals (Sweden)

Vendula Rusnakova

Full Text Available Astrocytes perform control and regulatory functions in the central nervous system; heterogeneity among them is still a matter of debate due to limited knowledge of their gene expression profiles and functional diversity. To unravel astrocyte heterogeneity during postnatal development and after focal cerebral ischemia, we employed single-cell gene expression profiling in acutely isolated cortical GFAP/EGFP-positive cells. Using a microfluidic qPCR platform, we profiled 47 genes encoding glial markers and ion channels/transporters/receptors participating in maintaining K(+ and glutamate homeostasis per cell. Self-organizing maps and principal component analyses revealed three subpopulations within 10-50 days of postnatal development (P10-P50. The first subpopulation, mainly immature glia from P10, was characterized by high transcriptional activity of all studied genes, including polydendrocytic markers. The second subpopulation (mostly from P20 was characterized by low gene transcript levels, while the third subpopulation encompassed mature astrocytes (mainly from P30, P50. Within 14 days after ischemia (D3, D7, D14, additional astrocytic subpopulations were identified: resting glia (mostly from P50 and D3, transcriptionally active early reactive glia (mainly from D7 and permanent reactive glia (solely from D14. Following focal cerebral ischemia, reactive astrocytes underwent pronounced changes in the expression of aquaporins, nonspecific cationic and potassium channels, glutamate receptors and reactive astrocyte markers.

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Vacuolar biogenesis and aquaporin expression at early germination of broad bean seeds.

Science.gov (United States)

Novikova, Galina V; Tournaire-Roux, Colette; Sinkevich, Irina A; Lityagina, Snejana V; Maurel, Christophe; Obroucheva, Natalie

2014-09-01

A key event in seed germination is water uptake-mediated growth initiation in embryonic axes. Vicia faba var. minor (broad bean) seeds were used for studying cell growth, vacuolar biogenesis, expression and function of tonoplast water channel proteins (aquaporins) in embryonic axes during seed imbibition, radicle emergence and growth. Hypocotyl and radicle basal cells showed vacuole restoration from protein storage vacuoles, whereas de novo vacuole formation from provacuoles was observed in cells newly produced by root meristem. cDNA fragments of seven novel aquaporin isoforms including five Tonoplast Intrinsic Proteins (TIP) from three sub-types were amplified by PCR. The expression was probed using q-RT-PCR and when possible with isoform-specific antibodies. Decreased expression of TIP3s was associated to the transformation of protein storage vacuoles to vacuoles, whereas enhanced expression of a TIP2 homologue was closely linked to the fast cell elongation. Water channel functioning checked by inhibitory test with mercuric chloride showed closed water channels prior to growth initiation and active water transport into elongating cells. The data point to a crucial role of tonoplast aquaporins during germination, especially during growth of embryonic axes, due to accelerated water uptake and vacuole enlargement resulting in rapid cell elongation. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters

Directory of Open Access Journals (Sweden)

Avinash Mishra

2017-05-01

Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

The gating mechanism of the human aquaporin 5 revealed by molecular dynamics simulations.

Directory of Open Access Journals (Sweden)

Lorant Janosi

Full Text Available Aquaporins are protein channels located across the cell membrane with the role of conducting water or other small sugar alcohol molecules (aquaglyceroporins. The high-resolution X-ray structure of the human aquaporin 5 (HsAQP5 shows that HsAQP5, as all the other known aquaporins, exhibits tetrameric structure. By means of molecular dynamics simulations we analyzed the role of spontaneous fluctuations on the structural behavior of the human AQP5. We found that different conformations within the tetramer lead to a distribution of monomeric channel structures, which can be characterized as open or closed. The switch between the two states of a channel is a tap-like mechanism at the cytoplasmic end which regulates the water passage through the pore. The channel is closed by a translation of the His67 residue inside the pore. Moreover, water permeation rate calculations revealed that the selectivity filter, located at the other end of the channel, regulates the flow rate of water molecules when the channel is open, by locally modifying the orientation of His173. Furthermore, the calculated permeation rates of a fully open channel are in good agreement with the reported experimental value.

A Comparison of Petiole Hydraulics and Aquaporin Expression in an Anisohydric and Isohydric Cultivar of Grapevine in Response to Water-Stress Induced Cavitation.

Science.gov (United States)

Shelden, Megan C; Vandeleur, Rebecca; Kaiser, Brent N; Tyerman, Stephen D

2017-01-01

We report physiological, anatomical and molecular differences in two economically important grapevine ( Vitis vinifera L.) cultivars cv. Grenache (near-isohydric) and Chardonnay (anisohydric) in their response to water-stress induced cavitation. The aim of the study was to compare organ vulnerability (petiole and stem) to cavitation by measuring ultrasonic acoustic emissions (UAE) and percent loss of conductance of potted grapevines subject to the onset of water-stress. Leaf (ψ L ) and stem water potential (ψ S ), stomatal conductance ( g s ), transpiration ( E ), petiole hydraulics ( K Pet ), and xylem diameter were also measured. Chardonnay displayed hydraulic segmentation based on UAE, with cavitation occurring at a less negative ψ L in the petiole than in the stem. Vulnerability segmentation was not observed in Grenache, with both petioles and stems equally vulnerable to cavitation. Leaf water potential that induced 50% of maximum UAE was significantly different between petioles and stems in Chardonnay (ψ 50Petiole = -1.14 and ψ 50Stem = -2.24 MPa) but not in Grenache (ψ 50Petiole = -0.73 and ψ 50Stem = -0.78 MPa). Grenache stems appeared more susceptible to water-stress induced cavitation than Chardonnay stems. Grenache displayed (on average) a higher K Pet likely due to the presence of larger xylem vessels. A close relationship between petiole hydraulic properties and vine water status was observed in Chardonnay but not in Grenache. Transcriptional analysis of aquaporins in the petioles and leaves ( VvPIP1;1, VvPIP2;1, VvPIP2;2 VvPIP2;3, VvTIP1;1 , and VvTIP2;1 ) showed differential regulation diurnally and in response to water-stress. VvPIP2;1 showed strong diurnal regulation in the petioles and leaves of both cultivars with expression highest predawn. Expression of VvPIP2;1 and VvPIP2;2 responded to ψ L and ψ S in both cultivars indicating the expression of these two genes are closely linked to vine water status. Expression of several aquaporin

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana

Directory of Open Access Journals (Sweden)

Ming Li

2016-01-01

Full Text Available Background. Water channel proteins, also called aquaporins, are integral membrane proteins from major intrinsic protein (MIP family and involved in several pathways including not only water transport but also cell signaling, reproduction, and photosynthesis. The full cDNA and protein sequences of aquaporin in Chorispora bungeana Fisch. & C.A. Mey (C. bungeana are still unknown. Results. In this study, PCR and rapid amplification of cDNA ends approaches were used to clone the full cDNA of LRB7 (GenBank accession number: EU636988 of C. bungeana. Sequence analysis indicated that it was 1235 bp, which had two introns and encoded a protein of 250 amino acids. Structure analysis revealed that the protein had two conserved NPA motifs, one of which is MIP signature sequence (SGxHxNPAVT, six membrane helix regions, and additional membrane-embedded domains. Phylogenetic analysis suggested that the protein was from TIP2 subgroup. Surprisingly, semiquantitative RT-PCR experiment and western blot analysis showed that LRB7 and TIP2 were only detectable in roots, unlike Arabidopsis and Raphanus. Connecting with our previous studies, LRB7 was supported to associate with chilling-tolerance in C. bungeana. Conclusion. This is the first time to characterize the full sequences of LRB7 gene and water channel protein in C. bungeana. Our findings contribute to understanding the water transports in plants under low temperatures.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Effects of Proteoliposome Composition and Draw Solution Types on Separation Performance of Aquaporin-Based Proteoliposomes

DEFF Research Database (Denmark)

Zhao, Yang; Vararattanavech, Ardcharaporn; Li, Xuesong

2013-01-01

Escherichia coli cells, and their separation properties were characterized by stopped-flow measurements. The current study systematically investigated the effect of proteoliposome composition (lipid type, protein-to-lipid ratio (PLR), and the addition of cholesterol) on water permeability and NaCl retention......Aquaporins are a large family of water transport proteins in cell membranes. Their high water permeability and solute rejection make them potential building blocks for high-performance biomimetic membranes for desalination. In the current study, proteoliposomes were prepared using AquaporinZ from...

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Water transport between CNS compartments: contributions of aquaporins and cotransporters

DEFF Research Database (Denmark)

MacAulay, N; Zeuthen, T

2010-01-01

or hydrocephalus. The molecular pathways by which water molecules cross the cell membranes of the brain are not well-understood, although the discovery of aquaporin 4 (AQP4) in the brain improved our understanding of some of these transport processes, particularly under pathological conditions. In the present...

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Aquaporin-5: from structure to function and dysfunction in cancer.

Science.gov (United States)

Direito, Inês; Madeira, Ana; Brito, Maria Alexandra; Soveral, Graça

2016-04-01

Aquaporins, a highly conserved group of membrane proteins, are involved in the bidirectional transfer of water and small solutes across cell membranes taking part in many biological functions all over the human body. In view of the wide range of cancer malignancies in which aquaporin-5 (AQP5) has been detected, an increasing interest in its implication in carcinogenesis has emerged. Recent publications suggest that this isoform may enhance cancer cell proliferation, migration and survival in a variety of malignancies, with strong evidences pointing to AQP5 as a promising drug target and as a novel biomarker for cancer aggressiveness with high translational potential for therapeutics and diagnostics. This review addresses the structural and functional features of AQP5, detailing its tissue distribution and functions in human body, its expression pattern in a variety of tumors, and highlighting the underlying mechanisms involved in carcinogenesis. Finally, the actual progress of AQP5 research, implications in cancer biology and potential for cancer detection and prognosis are discussed.

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Constitutive and stress-inducible overexpression of a native aquaporin gene (MusaPIP2;6) in transgenic banana plants signals its pivotal role in salt tolerance.

Science.gov (United States)

Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R

2015-05-01

High soil salinity constitutes a major abiotic stress and an important limiting factor in cultivation of crop plants worldwide. Here, we report the identification and characterization of a aquaporin gene, MusaPIP2;6 which is involved in salt stress signaling in banana. MusaPIP2;6 was firstly identified based on comparative analysis of stressed and non-stressed banana tissue derived EST data sets and later overexpression in transgenic banana plants was performed to study its tangible functions in banana plants. The overexpression of MusaPIP2;6 in transgenic banana plants using constitutive or inducible promoter led to higher salt tolerance as compared to equivalent untransformed control plants. Cellular localization assay performed using transiently transformed onion peel cells indicated that MusaPIP2;6 protein tagged with green fluorescent protein was translocated to the plasma membrane. MusaPIP2;6-overexpressing banana plants displayed better photosynthetic efficiency and lower membrane damage under salt stress conditions. Our results suggest that MusaPIP2;6 is involved in salt stress signaling and tolerance in banana.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

Role of aquaporins in oral cancer

Directory of Open Access Journals (Sweden)

Mamatha G. S. Reddy

2017-01-01

Full Text Available Aquaporins (AQP are the membrane proteins involved in the transport of water and some neutral solutes. Thirteen types of AQP are identified in various human tissues. The expression of AQP's has been studied in various tumors among one is oral cancer. These molecules are involved in cell proliferation, migration, and metastasis. AQP target inhibitors act directly or indirectly through focal adhesion kinase-mitogen-activated protein kinase signaling pathway and shown promising results along with anti-cancer drugs. However, further researches were required to verify the efficiency and safety of these AQPs-target inhibitors in clinical therapy.

Aquaporin Expression and Water Transport Pathways inside Leaves Are Affected by Nitrogen Supply through Transpiration in Rice Plants

Directory of Open Access Journals (Sweden)

Lei Ding

2018-01-01

Full Text Available The photosynthetic rate increases under high-N supply, resulting in a large CO2 transport conductance in mesophyll cells. It is less known that water movement is affected by nitrogen supply in leaves. This study investigated whether the expression of aquaporin and water transport were affected by low-N (0.7 mM and high-N (7 mM concentrations in the hydroponic culture of four rice varieties: (1 Shanyou 63 (SY63, a hybrid variant of the indica species; (2 Yangdao 6 (YD6, a variant of indica species; (3 Zhendao 11 (ZD11, a hybrid variant of japonica species; and (4 Jiuyou 418 (JY418, another hybrid of the japonica species. Both the photosynthetic and transpiration rate were increased by the high-N supply in the four varieties. The expressions of aquaporins, plasma membrane intrinsic proteins (PIPs, and tonoplast membrane intrinsic protein (TIP were higher in high-N than low-N leaves, except in SY63. Leaf hydraulic conductance (Kleaf was lower in high-N than low-N leaves in SY63, while Kleaf increased under high-N supply in the YD6 variant. Negative correlations were observed between the expression of aquaporin and the transpiration rate in different varieties. Moreover, there was a significant negative correlation between transpiration rate and intercellular air space. In conclusion, the change in expression of aquaporins could affect Kleaf and transpiration. A feedback effect of transpiration would regulate aquaporin expression. The present results imply a coordination of gas exchange with leaf hydraulic conductance.

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Aquaporin-3 in Cancer.

Science.gov (United States)

Marlar, Saw; Jensen, Helene H; Login, Frédéric H; Nejsum, Lene N

2017-10-07

Increasing evidence suggests that the water/glycerol channel aquaporin-3 (AQP3) plays a pivotal role in cancer metastasis. AQP3 knockout mice were resistant to skin tumor formation and overexpression correlated with metastasis and poor prognosis in patients with breast or gastric cancer. In cultured cancer cells, increased AQP3 expression stimulated several intracellular signaling pathways and resulted in increased cell proliferation, migration, and invasion as well as aggravation of epithelial-to-mesenchymal transition. Besides AQP facilitated water transport at the leading edge of migrating cells, AQP3 signaling mechanisms are beginning to be unraveled. Here, we give a thorough review of current knowledge regarding AQP3 expression in cancer and how AQP3 contributes to cancer progression via signaling that modulates cellular mechanisms. This review article will expand our understanding of the known pathophysiological findings regarding AQP3 in cancer.

Aquaporins and Gland Secretion.

Science.gov (United States)

Delporte, Christine

2017-01-01

Aquaporins (AQPs ) are expressed in most exocrine and endocrine secretory glands. Consequently, summarizing the expression and functions of AQPs in secretory glands represents a daunting task considering the important number of glands present in the body, as well as the number of mammalian AQPs - thirteen. The roles played by AQPs in secretory processes have been investigated in many secretory glands. However, despite considerable research, additional studies are clearly needed to pursue our understanding of the role played by AQPs in secretory processes. This book chapter will focus on summarizing the current knowledge on AQPs expression and function in the gastrointestinal tract , including salivary glands, gastric glands, Duodenal Brunner's gland, liver and gallbladder, intestinal goblets cells, exocrine and endocrine pancreas, as well as few other secretory glands including airway submucosal glands, lacrimal glands, mammary glands and eccrine sweat glands.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

Compartmentalization of Aquaporins in the Human Intestine

Directory of Open Access Journals (Sweden)

Rajendram V. Rajnarayanan

2008-06-01

Full Text Available Improper localization of water channel proteins called aquaporins (AQP induce mucosal injury which is implicated in Crohn’s disease and ulcerative colitis. The amino acid sequences of AQP3 and AQP10 are 79% similar and belong to the mammalian aquaglyceroporin subfamily. AQP10 is localized on the apical compartment of the intestinal epithelium called the glycocalyx while AQP3 is selectively targeted to the basolateral membrane. Despite the high sequence similarity and evolutionary relatedness, the molecular mechanism involved in the polarity, selective targeting and function of AQP3 and AQP10 in the intestine is largely unknown. Our hypothesis is that the differential polarity and selective targeting of AQP3 and AQP10 in the intestinal epithelial cells is influenced by amino acid signal motifs. We performed sequence and structural alignments to determine differences in signals for localization and posttranslational glycosylation. The basolateral sorting motif “YRLL” is present in AQP3 but absent in AQP10; while Nglycosylation signals are present in AQP10 but absent in AQP3. Furthermore, the C-terminal region of AQP3 is longer compared to AQP10. The sequence and structural differences between AQP3 and AQP10 provide insights into the differential compartmentalization and function of these two aquaporins commonly expressed in human intestines.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Role of Aquaporin Water Channels in Airway Fluid Transport, Humidification, and Surface Liquid Hydration

Science.gov (United States)

Song, Yuanlin; Jayaraman, Sujatha; Yang, Baoxue; Matthay, Michael A.; Verkman, A.S.

2001-01-01

Several aquaporin-type water channels are expressed in mammalian airways and lung: AQP1 in microvascular endothelia, AQP3 in upper airway epithelia, AQP4 in upper and lower airway epithelia, and AQP5 in alveolar epithelia. Novel quantitative methods were developed to compare airway fluid transport–related functions in wild-type mice and knockout mice deficient in these aquaporins. Lower airway humidification, measured from the moisture content of expired air during mechanical ventilation with dry air through a tracheotomy, was 54–56% efficient in wild-type mice, and reduced by only 3–4% in AQP1/AQP5 or AQP3/AQP4 double knockout mice. Upper airway humidification, measured from the moisture gained by dry air passed through the upper airways in mice breathing through a tracheotomy, decreased from 91 to 50% with increasing ventilation from 20 to 220 ml/min, and reduced by 3–5% in AQP3/AQP4 knockout mice. The depth and salt concentration of the airway surface liquid in trachea was measured in vivo using fluorescent probes and confocal and ratio imaging microscopy. Airway surface liquid depth was 45 ± 5 μm and [Na+] was 115 ± 4 mM in wild-type mice, and not significantly different in AQP3/AQP4 knockout mice. Osmotic water permeability in upper airways, measured by an in vivo instillation/sample method, was reduced by ∼40% by AQP3/AQP4 deletion. In doing these measurements, we discovered a novel amiloride-sensitive isosmolar fluid absorption process in upper airways (13% in 5 min) that was not affected by aquaporin deletion. These results establish the fluid transporting properties of mouse airways, and indicate that aquaporins play at most a minor role in airway humidification, ASL hydration, and isosmolar fluid absorption. PMID:11382807

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Recruitment of human aquaporin 3 to internal membranes in the Plasmodium falciparum infected erythrocyte.

Science.gov (United States)

Bietz, Sven; Montilla, Irine; Külzer, Simone; Przyborski, Jude M; Lingelbach, Klaus

2009-09-01

The molecular mechanisms underlying the formation of the parasitophorous vacuolar membrane in Plasmodium falciparum infected erythrocytes are incompletely understood, and the protein composition of this membrane is still enigmatic. Although the differentiated mammalian erythrocyte lacks the machinery required for endocytosis, some reports have described a localisation of host cell membrane proteins at the parasitophorous vacuolar membrane. Aquaporin 3 is an abundant plasma membrane protein of various cells, including mammalian erythrocytes where it is found in distinct oligomeric states. Here we show that human aquaporin 3 is internalized into infected erythrocytes, presumably during or soon after invasion. It is integrated into the PVM where it is organized in novel oligomeric states which are not found in non-infected cells.

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

The role of aquaporins in polycystic ovary syndrome - A way towards a novel drug target in PCOS.

Science.gov (United States)

Wawrzkiewicz-Jałowiecka, Agata; Kowalczyk, Karolina; Pluta, Dagmara; Blukacz, Łukasz; Madej, Paweł

2017-05-01

Aquaporins (AQPs) are transmembrane proteins, able to transport water (and in some cases also small solutes, e. g. glycerol) through the cell membrane. There are twelve types of aquaporins (AQP1-AQP12) expressed in mammalian reproductive systems. According to literature, many diseases of the reproductive organs are correlated with changes of AQPs expression and their malfunction. That is the case in the polycystic ovary syndrome (PCOS), where dysfunctions of AQPs 7-9 and alterations in its levels occur. In this work, we postulate how AQPs are involved in PCOS-related disorders, in order to emphasize their potential therapeutic meaning as a drug target. Our research allows for a surprising inference, that genetic mutation causing malfunction and/or decreased expression of aquaporins, may be incorporated in the popular insulin-dependent hypothesis of PCOS pathogenesis. What is more, changes in AQP's expression may affect the folliculogenesis and follicular atresia in PCOS. Copyright © 2017 Elsevier Ltd. All rights reserved.

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Aquaporin 3 (AQP3) participates in the cytotoxic response to nucleoside-derived drugs

International Nuclear Information System (INIS)

Pérez-Torras, Sandra; Casado, F Javier; Pastor-Anglada, Marçal

2012-01-01

Nucleoside analogs used in the chemotherapy of solid tumors, such as the capecitabine catabolite 5 ′ -deoxy-5-fluorouridine (5 ′ -DFUR) trigger a transcriptomic response that involves the aquaglyceroporin aquaporin 3 along with other p53-dependent genes. Here, we examined whether up-regulation of aquaporin 3 (AQP3) mRNA in cancer cells treated with 5 ′ -DFUR represents a collateral transcriptomic effect of the drug, or conversely, AQP3 participates in the activity of genotoxic agents. The role of AQP3 in cell volume increase, cytotoxicity and cell cycle arrest was analyzed using loss-of-function approaches. 5 ′ -DFUR and gemcitabine, but not cisplatin, stimulated AQP3 expression and cell volume, which was partially and significantly blocked by knockdown of AQP3. Moreover, AQP3 siRNA significantly blocked other effects of nucleoside analogs, including G 1 /S cell cycle arrest, p21 and FAS up-regulation, and cell growth inhibition. Short incubations with 5-fluorouracil (5-FU) also induced AQP3 expression and increased cell volume, and the inhibition of AQP3 expression significantly blocked growth inhibition triggered by this drug. To further establish whether AQP3 induction is related to cell cycle arrest and apoptosis, cells were exposed to long incubations with escalating doses of 5-FU. AQP3 was highly up-regulated at doses associated with cell cycle arrest, whereas at doses promoting apoptosis induction of AQP3 mRNA expression was reduced. Based on the results, we propose that the aquaglyceroporin AQP3 is required for cytotoxic activity of 5’-DFUR and gemcitabine in the breast cancer cell line MCF7 and the colon adenocarcinoma cell line HT29, and is implicated in cell volume increase and cell cycle arrest

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Phosphorylation of rat aquaporin-4 at Ser(111) is not required for channel gating

DEFF Research Database (Denmark)

Assentoft, Mette; Kaptan, Shreyas; Fenton, Robert A.

2013-01-01

Aquaporin 4 (AQP4) is the predominant water channel in the mammalian brain and is mainly expressed in the perivascular glial endfeet at the brain-blood interface. AQP4 has been described as an important entry and exit site for water during formation of brain edema and regulation of AQP4 is theref......Aquaporin 4 (AQP4) is the predominant water channel in the mammalian brain and is mainly expressed in the perivascular glial endfeet at the brain-blood interface. AQP4 has been described as an important entry and exit site for water during formation of brain edema and regulation of AQP4...... is therefore of therapeutic interest. Phosphorylation of some aquaporins has been proposed to regulate their water permeability via gating of the channel itself. Protein kinase (PK)-dependent phosphorylation of Ser(111) has been reported to increase the water permeability of AQP4 expressed in an astrocytic...... of activators and inhibitors of PKG and PKA. Mutation of Ser(111) to alanine or aspartate (to prevent or mimic phosphorylation) did not change the water permeability of AQP4. PKG activation had no effect on the water permeability of AQP4 in primary cultures of rat astrocytes. Molecular dynamics simulations...

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Oxygen-dependent regulation of aquaporin-3 expression

Directory of Open Access Journals (Sweden)

Hoogewijs D

2016-04-01

Full Text Available David Hoogewijs,1,2 Melanie Vogler,3 Eveline Zwenger,3 Sabine Krull,3 Anke Zieseniss3 1Institute of Physiology, University of Duisburg-Essen, Essen, Germany; 2Institute of Physiology, University of Zürich, Zürich, Switzerland; 3Institute of Cardiovascular Physiology, University Medical Center Göttingen, University of Göttingen, Göttingen, GermanyAbstract: The purpose of this study was to investigate whether aquaporin-3 (AQP3 expression is altered in hypoxia and whether hypoxia-inducible transcription factor (HIF-1 regulates the hypoxic expression. AQP3 mRNA expression was studied in L929 fibrosarcoma cells and in several tissues derived from mice that were subjected to hypoxia. Computational analysis of the AQP3 promoter revealed conserved HIF binding sites within close proximity to the translational start site, and chromatin immunoprecipitation assays confirmed binding of HIF-1 to the endogenous hypoxia response elements. Furthermore, hypoxia resulted in increased expression of AQP3 mRNA in L929 fibrosarcoma cells. Consistently, shRNA-mediated knockdown of HIF-1 greatly reduced the hypoxic induction of AQP3. In addition, mRNA analysis of organs from mice exposed to inspiratory hypoxia demonstrated pronounced hypoxia-inducible expression of AQP3 in the kidney. Overall, our findings suggest that AQP3 expression can be regulated at the transcriptional level and that AQP3 represents a novel HIF-1 target gene. Keywords: transcriptional regulation, oxygen, hypoxia-inducible factor, hypoxia response element

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

Differential down-regulation of aquaporin-2 in rat kidney zones by peripheral nociceptin/orphanin FQ receptor agonism and vasopressin type-2 receptor antagonism

DEFF Research Database (Denmark)

Hadrup, Niels; Petersen, Jørgen S; Windfeld, Søren

2007-01-01

) of the vasopressin type-2 receptor antagonist 5-dimethylamine-1-[4-(2-methylbenzoylamino)benzoyl]-2,3,4,5-tetrahydro-1H-benzapine (OPC31260) (32 nmol/kg/min). ZP120 decreased the aquaporin-2 protein level in the rat cortex/outer stripe of outer medulla and decreased apical plasma membrane localization of aquaporin-2......We previously showed that aquaresis induced by the peripherally acting nociceptin/orphanin FQ receptor agonist ZP120 is associated with a decreased protein level of aquaporin-2 (AQP2) in whole-kidney homogenates. We now examined the effects of Ac-RYYRWKKKKKKK-NH(2) (ZP120) (1 nmol/kg/min i.v. for 4...... h) on renal regional expression (cortex/outer stripe of outer medulla, inner stripe of outer medulla, and inner medulla) and subcellular localization of aquaporin-2. Responses to ZP120 were compared to the effects of an equi-aquaretic dose ( approximately 40% inhibition of distal water reabsorption...

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Overexpression of Laccaria bicolor aquaporin JQ585595 alters root water transport properties in ectomycorrhizal white spruce (Picea glauca) seedlings.

Science.gov (United States)

Xu, Hao; Kemppainen, Minna; El Kayal, Walid; Lee, Seong Hee; Pardo, Alejandro G; Cooke, Janice E K; Zwiazek, Janusz J

2015-01-01

The contribution of hyphae to water transport in ectomycorrhizal (ECM) white spruce (Picea glauca) seedlings was examined by altering expression of a major water-transporting aquaporin in Laccaria bicolor. Picea glauca was inoculated with wild-type (WT), mock transgenic or L. bicolor aquaporin JQ585595-overexpressing (OE) strains and exposed to root temperatures ranging from 5 to 20°C to examine the root water transport properties, physiological responses and plasma membrane intrinsic protein (PIP) expression in colonized plants. Mycorrhization increased shoot water potential, transpiration, net photosynthetic rates, root hydraulic conductivity and root cortical cell hydraulic conductivity in seedlings. At 20°C, OE plants had higher root hydraulic conductivity compared with WT plants and the increases were accompanied by higher expression of P. glauca PIP GQ03401_M18.1 in roots. In contrast to WT L. bicolor, the effects of OE fungi on root and root cortical cell hydraulic conductivities were abolished at 10 and 5°C in the absence of major changes in the examined transcript levels of P. glauca root PIPs. The results provide evidence for the importance of fungal aquaporins in root water transport of mycorrhizal plants. They also demonstrate links between hyphal water transport, root aquaporin expression and root water transport in ECM plants. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus.

NARCIS (Netherlands)

Kamsteeg, E.J.; Bichet, D.G.; Konings, I.B.M.; Nivet, H.; Lonergan, M.; Arthus, M.F.; Os, C.H. van; Deen, P.M.T.

2003-01-01

Vasopressin regulates body water conservation by redistributing aquaporin-2 (AQP2) water channels from intracellular vesicles to the apical surface of renal collecting ducts, resulting in water reabsorption from urine. Mutations in AQP2 cause autosomal nephrogenic diabetes insipidus (NDI), a disease

Regional expression of aquaporins 1, 4, and 9 in the brain during pregnancy

NARCIS (Netherlands)

Wiegman, Marchien J.; Bullinger, Lisa V.; Kohlmeyer, Meghan M.; Hunter, Timothy C.; Cipolla, Marilyn J.

Pregnancy is a state of physiologic adaptation, with significant changes in cardiovascular, renal, and hemodynamic systems. Aquaporins (AQPs) may play a role in facilitating these changes. Mile AQP expression has been assessed in several organs during pregnancy, little is known about its expression

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Tonoplast- and plasma membrane-localized aquaporin-family transporters in blue hydrangea sepals of aluminum hyperaccumulating plant.

Directory of Open Access Journals (Sweden)

Takashi Negishi

Full Text Available Hydrangea (Hydrangea macrophylla is tolerant of acidic soils in which toxicity generally arises from the presence of the soluble aluminum (Al ion. When hydrangea is cultivated in acidic soil, its resulting blue sepal color is caused by the Al complex formation of anthocyanin. The concentration of vacuolar Al in blue sepal cells can reach levels in excess of approximately 15 mM, suggesting the existence of an Al-transport and/or storage system. However, until now, no Al transporter has been identified in Al hyperaccumulating plants, animals or microorganisms. To identify the transporter being responsible for Al hyperaccumulation, we prepared a cDNA library from blue sepals according to the sepal maturation stage, and then selected candidate genes using a microarray analysis and an in silico study. Here, we identified the vacuolar and plasma membrane-localized Al transporters genes vacuolar Al transporter (VALT and plasma membrane Al transporter 1 (PALT1, respectively, which are both members of the aquaporin family. The localization of each protein was confirmed by the transient co-expression of the genes. Reverse transcription-PCR and immunoblotting results indicated that VALT and PALT1 are highly expressed in sepal tissue. The overexpression of VALT and PALT1 in Arabidopsis thaliana conferred Al-tolerance and Al-sensitivity, respectively.

Increased expression of aquaporin-4 in human traumatic brain injury and brain tumors

Institute of Scientific and Technical Information of China (English)

HU Hua; YAO Hong-tian; ZHANG Wei-ping; ZHANG LEI; DING Wei; ZHANG Shi-hong; CHEN Zhong; WEI Er-qing

2005-01-01

Objective: To characterize the expression of aquaporin-4 (AQP4), one of the aquaporins (AQPs), in human brain specimens from patients with traumatic brain injury or brain tumors. Methods: Nineteen human brain specimens were obtained from the patients with traumatic brain injury, brain tumors, benign meningioma or early stage hemorrhagic stroke. MRI or CT imaging was used to assess brain edema. Hematoxylin and eosin staining were used to evaluate cell damage. Immunohistochemistry was used to detect the AQP4 expression. Results: AQP4 expression was increased from 15h to at least 8 d after injury. AQP4immunoreactivity was strong around astrocytomas, ganglioglioma and metastatic adenocarcinoma. However, AQP4 immunoreactivity was only found in the centers of astrocytomas and ganglioglioma, but not in metastatic adenocarcinoma derived from lung.Conclusion: AQP4 expression increases in human brains after traumatic brain injury, within brain-derived tumors, and around brain tumors.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

A novel mutation affecting the arginine-137 residue of AVPR2 in dizygous twins leads to nephrogenic diabetes insipidus and attenuated urine exosome aquaporin-2

DEFF Research Database (Denmark)

Hinrichs, Gitte R; Hansen, Louise H; Nielsen, Maria R

2016-01-01

Mutations in the vasopressin V2 receptor gene AVPR2 may cause X-linked nephrogenic diabetes insipidus by defective apical insertion of aquaporin-2 in the renal collecting duct principal cell. Substitution mutations with exchange of arginine at codon 137 can cause nephrogenic syndrome...... of inappropriate antidiuresis or congenital X-linked nephrogenic diabetes insipidus. We present a novel mutation in codon 137 within AVPR2 with substitution of glycine for arginine in male dizygotic twins. Nephrogenic diabetes insipidus was demonstrated by water deprivation test and resistance to vasopressin...

Identification of a novel promoter from banana aquaporin family gene (MaTIP1;2) which responses to drought and salt-stress in transgenic Arabidopsis thaliana.

Science.gov (United States)

Song, Shun; Xu, Yi; Huang, Dongmei; Miao, Hongxia; Liu, Juhua; Jia, Caihong; Hu, Wei; Valarezo, Ana Valeria; Xu, Biyu; Jin, Zhiqiang

2018-07-01

Drought and salt stresses often affect plant growth and crop yields. Identification of promoters involved in drought and salt stress responses is of great significance for genetic improvement of crop resistance. Our previous studies showed that aquaporin can respond to drought and salt stresses, but its promoter has not yet been reported in plants. In the present study, cis-acting elements of MaAQP family member promoters were systematically analyzed in banana. Expression of MaTIP1; 2 was induced by drought and salt stresses but not sensitive to cold stress, waterlogging stress, or mechanical damage, and its promoter contained five stress-related cis-acting elements. The MaTIP1; 2 promoter (841 bp upstream of translation initiation site) from banana (Musa acuminata L. AAA group cv. Brazilian) was isolated through genome walking polymerase chain reaction, and found to contain a TATA Box, CAAT box, ABRE element, CCGTCC box, CGTCA motif, and TCA element. Transformation of the MaTIP1; 2 promoter into Arabidopsis to assess its function indicated that it responds to both drought and salt stress treatments. These results suggest that MaTIP1; 2 utilization may improve drought and salt stresses resistance of the transgenic plants by promoting banana aquaporin expression. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Aquaporin-11 (AQP11 Expression in the Mouse Brain

Directory of Open Access Journals (Sweden)

Shin Koike

2016-06-01

Full Text Available Aquaporin-11 (AQP11 is an intracellular aquaporin expressed in various tissues, including brain tissues in mammals. While AQP11-deficient mice have developed fatal polycystic kidneys at one month old, the role of AQP11 in the brain was not well appreciated. In this study, we examined the AQP11 expression in the mouse brain and the brain phenotype of AQP11-deficient mice. AQP11 messenger ribonucleic acid (mRNA and protein were expressed in the brain, but much less than in the thymus and kidney. Immunostaining showed that AQP11 was localized at the epithelium of the choroid plexus and at the endothelium of the brain capillary, suggesting that AQP11 may be involved in water transport at the choroid plexus and blood-brain barrier (BBB in the brain. The expression of AQP4, another brain AQP expressed at the BBB, was decreased by half in AQP11-deficient mice, thereby suggesting the presence of the interaction between AQP11 and AQP4. The brain of AQP11-deficient mice, however, did not show any morphological abnormalities and the function of the BBB was intact. Our findings provide a novel insight into a water transport mechanism mediated by AQPs in the brain, which may lead to a new therapy for brain edema.

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

Frequency and prognostic impact of antibodies to aquaporin-4 in patients with optic neuritis

DEFF Research Database (Denmark)

Jarius, Sven; Frederiksen, Jette Lautrup Battistini; Waters, Patrick

2010-01-01

Antibodies to aquaporin-4 (AQP4-Ab) are found in 60-80% of patients with neuromyelitis optica (NMO), a severely disabling inflammatory CNS disorder of putative autoimmune aetiology, which predominantly affects the optic nerves and spinal cord....

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

Science.gov (United States)

Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

2016-01-01

Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

Cholesterol can modulate mitochondrial aquaporin-8 expression in human hepatic cells.

Science.gov (United States)

Danielli, Mauro; Capiglioni, Alejo M; Marrone, Julieta; Calamita, Giuseppe; Marinelli, Raúl A

2017-05-01

Hepatocyte mitochondrial aquaporin-8 (mtAQP8) works as a multifunctional membrane channel protein that facilitates the uptake of ammonia for its detoxification to urea as well as the mitochondrial release of hydrogen peroxide. Since early oligonucleotide microarray studies in liver of cholesterol-fed mice showed an AQP8 downregulation, we tested whether alterations of cholesterol content per se modulate mtAQP8 expression in human hepatocyte-derived Huh-7 cells. Cholesterol loading with methyl-β-cyclodextrin (mβCD):cholesterol complexes downregulated the proteolytic activation of cholesterol-responsive sterol regulatory element-binding protein (SREBP) transcriptions factors 1 and 2, and the expression of the target gene 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). Under such conditions, mtAQP8 mRNA and protein expressions were significantly reduced. In contrast, cholesterol depletion using mβCD alone increased SREBP-1 and 2 activation and upregulated HMGCR and mtAQP8 mRNA and protein expressions. The results suggest that cholesterol can regulate transcriptionally human hepatocyte mtAQP8 expression likely via SREBPs. The functional implications of our findings are discussed. © 2017 IUBMB Life, 69(5):341-346, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

LENUS (Irish Health Repository)

Martin, Ronny

2011-04-01

The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

Aquaporin 4 and neuromyelitis optica

Science.gov (United States)

Papadopoulos, Marios C; Verkman, A S

2013-01-01

Neuromyelitis optica is an inflammatory demyelinating disorder of the CNS. The discovery of circulating IgG1 antibodies against the astrocyte water channel protein aquaporin 4 (AQP4) and the evidence that AQP4-IgG is involved in the development of neuromyelitis optica revolutionised our understanding of the disease. However, important unanswered questions remain—for example, we do not know the cause of AQP4-IgG-negative disease, how astrocyte damage causes demyelination, the role of T cells, why peripheral AQP4-expressing organs are undamaged, and how circulating AQP4-IgG enters neuromyelitis optica lesions. New drug candidates have emerged, such as aquaporumab (non-pathogenic antibody blocker of AQP4-IgG binding), sivelestat (neutrophil elastase inhibitor), and eculizumab (complement inhibitor). Despite rapid progress, randomised clinical trials to test new drugs will be challenging because of the small number of individuals with the disorder. PMID:22608667

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

A cohesion/tension mechanism explains the gating of water channels (aquaporins) in Chara internodes by high concentration.

Science.gov (United States)

Ye, Qing; Wiera, Boguslaw; Steudle, Ernst

2004-02-01

Isolated internodes of Chara corallina have been used to study the gating of aquaporins (water channels) in the presence of high concentrations of osmotic solutes of different size (molecular weight). Osmolytes were acetone and three glycol ethers: ethylene glycol monomethyl ether (EGMME), diethylene glycol monomethyl ether (DEGMME), and triethylene glycol monoethyl ether (TEGMEE). The 'osmotic efficiency' of osmolytes was quite different. Their reflection coefficients ranged between 0.15 (acetone), 0.59 (EGMME), 0.78 (DEGMME), and 0.80 (TEGMEE). Bulk water permeability (Lp) and diffusive permeabilities (Ps) of heavy water (HDO), hydrogen peroxide (H2O2), acetone, and glycol ethers (EGMME, DEGMME, and TEGMEE) were measured using a cell pressure probe. Cells were treated with different concentrations of osmotic solutes of up to 800 mM ( approximately 2.0 MPa of osmotic pressure). Inhibition of aquaporin activity increased with both increasing concentration and size of solutes (reflection coefficients). As cell Lp decreased, Ps increased, indicating that water and solutes used different passages across the plasma membrane. Similar to earlier findings of an osmotic gating of ion channels, a cohesion/tension model of the gating of water channels in Chara internodes by high concentration is proposed. According to the model, tensions (negative pressures) within water channels affected the open/closed state by changing the free energy between states and favoured a distorted/collapsed rather than the open state. They should have differed depending on the concentration and size of solutes that are more or less excluded from aquaporins. The bigger the solute, the lower was the concentration required to induce a reversible closure of aquaporins, as predicted by the model.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

Science.gov (United States)

Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

2016-08-01

The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Demeclocycline Attenuates Hyponatremia by Reducing Aquaporin-2 Expression in the Renal Inner Medulla

DEFF Research Database (Denmark)

Kortenoeven, Marleen L. A.; Sinke, Anne P.; Hadrup, Niels

2013-01-01

Binding of vasopressin to its type-2 receptor in renal collecting ducts induces cAMP signaling, transcription and translocation of aquaporin-2 (AQP2) water channels to the plasma membrane and water reabsorption from the pro-urine. Demeclocycline is currently used to treat hyponatremia in patients...

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

Science.gov (United States)

Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

2012-10-15

IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

Directory of Open Access Journals (Sweden)

Senta Heiss-Blanquet

Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Science.gov (United States)

Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

2015-05-01

Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Directory of Open Access Journals (Sweden)

Alene Kast

2015-05-01

Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Stabilization and immobilization of aquaporin reconstituted lipid vesicles for water purification.

Science.gov (United States)

Sun, Guofei; Chung, Tai-Shung; Jeyaseelan, Kandiah; Armugam, Arunmozhiarasi

2013-02-01

Aquaporins are water channel proteins in biological membranes that have extraordinary water permeability and selectivity. In this work, we have demonstrated that one of their family members, AquaporinZ (AqpZ), can be possibly applied in a pressure-driven water purification process. A nanofiltration membrane was designed and fabricated by immobilization of AqpZ-reconstituted liposomes on a polydopamine (PDA) coated microporous membrane. Amine-functionalized proteoliposomes were first deposited via gentle vacuum suction and subsequently conjugated on the PDA layer via an amine-catechol adduct formation. Due to the existence of a polymer network within the lipid bilayers, the membrane could sustain hydraulic pressure of 5 bar as well as the strong surface agitation in nanofiltration tests, indicating a relatively stable membrane structure. In comparison with membrane without AqpZ incorporation, the membrane with AqpZ-to-lipid weight ratio of 1:100 increased the water flux by 65% with enhanced NaCl and MgCl(2) rejections of 66.2% and 88.1%, respectively. With AqpZ incorporation, the vesicle immobilized membrane exhibits a promising strategy for high productivity water purification. Copyright © 2012 Elsevier B.V. All rights reserved.

Expression of aquaporin8 in human astrocytomas: Correlation with pathologic grade

International Nuclear Information System (INIS)

Zhu, Shu-juan; Wang, Ke-jian; Gan, Sheng-wei; Xu, Jin; Xu, Shi-ye; Sun, Shan-quan

2013-01-01

Highlights: •AQP8 is mainly distributed in the cytoplasm of human astrocytoma cells. •AQP8 over-expressed in human astrocytomas, especially glioblastoma. •The up-regulation of AQP8 is related to the pathological grade of human astrocytomas. •AQP8 may contribute to the growth and proliferation of astrocytomas. -- Abstract: Aquaporin8 (AQP8), a member of the aquaporin (AQP) protein family, is weakly distributed in mammalian brains. Previous studies on AQP8 have focused mainly on the digestive and the reproductive systems. AQP8 has a pivotal role in keeping the fluid and electrolyte balance. In this study, we investigated the expression changes of AQP8 in 75 cases of human brain astrocytic tumors using immunohistochemistry, Western blotting, and reverse transcription polymerase chain reaction. The results demonstrated that AQP8 was mainly distributed in the cytoplasm of astrocytoma cells. The expression levels and immunoreactive score of AQP8 protein and mRNA increased in low-grade astrocytomas, and further increased in high-grade astrocytomas, especially in glioblastoma. Therefore, AQP8 may contribute to the proliferation of astrocytomas, and may be a biomarker and candidate therapy target for patients with astrocytomas

Expression of aquaporin8 in human astrocytomas: Correlation with pathologic grade

Energy Technology Data Exchange (ETDEWEB)

Zhu, Shu-juan; Wang, Ke-jian; Gan, Sheng-wei; Xu, Jin; Xu, Shi-ye; Sun, Shan-quan, E-mail: sunsq2151@cqmu.edu.cn

2013-10-11

Highlights: •AQP8 is mainly distributed in the cytoplasm of human astrocytoma cells. •AQP8 over-expressed in human astrocytomas, especially glioblastoma. •The up-regulation of AQP8 is related to the pathological grade of human astrocytomas. •AQP8 may contribute to the growth and proliferation of astrocytomas. -- Abstract: Aquaporin8 (AQP8), a member of the aquaporin (AQP) protein family, is weakly distributed in mammalian brains. Previous studies on AQP8 have focused mainly on the digestive and the reproductive systems. AQP8 has a pivotal role in keeping the fluid and electrolyte balance. In this study, we investigated the expression changes of AQP8 in 75 cases of human brain astrocytic tumors using immunohistochemistry, Western blotting, and reverse transcription polymerase chain reaction. The results demonstrated that AQP8 was mainly distributed in the cytoplasm of astrocytoma cells. The expression levels and immunoreactive score of AQP8 protein and mRNA increased in low-grade astrocytomas, and further increased in high-grade astrocytomas, especially in glioblastoma. Therefore, AQP8 may contribute to the proliferation of astrocytomas, and may be a biomarker and candidate therapy target for patients with astrocytomas.

Characterization of an aquaporin-2 water channel gene mutation causing partial nephrogenic diabetes insipidus in a Mexican family: evidence of increased frequency of the mutation in the town of origin.

NARCIS (Netherlands)

Boccalandro, C.; Mattia, F.P. de; Guo, D.C.; Xue, L.; Orlander, P.; King, T.M.; Gupta, P.; Deen, P.M.T.; Lavis, V.R.; Milewicz, D.M.

2004-01-01

A Mexican family with partial congenital nephrogenic diabetes insipidus (NDI) that resulted from a mutation in the aquaporin-2 water channel (AQP2) was characterized, and the source of this rare mutation was traced to the family's town of origin in Mexico. Affected individuals with profound polyuria

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

Science.gov (United States)

Tzagoloff, A; Shtanko, A

1995-06-01

Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

Abscisic Acid Regulation of Root Hydraulic Conductivity and Aquaporin Gene Expression Is Crucial to the Plant Shoot Growth Enhancement Caused by Rhizosphere Humic Acids.

Science.gov (United States)

Olaetxea, Maite; Mora, Verónica; Bacaicoa, Eva; Garnica, María; Fuentes, Marta; Casanova, Esther; Zamarreño, Angel M; Iriarte, Juan C; Etayo, David; Ederra, Iñigo; Gonzalo, Ramón; Baigorri, Roberto; García-Mina, Jose M

2015-12-01

The physiological and metabolic mechanisms behind the humic acid-mediated plant growth enhancement are discussed in detail. Experiments using cucumber (Cucumis sativus) plants show that the shoot growth enhancement caused by a structurally well-characterized humic acid with sedimentary origin is functionally associated with significant increases in abscisic acid (ABA) root concentration and root hydraulic conductivity. Complementary experiments involving a blocking agent of cell wall pores and water root transport (polyethylenglycol) show that increases in root hydraulic conductivity are essential in the shoot growth-promoting action of the model humic acid. Further experiments involving an inhibitor of ABA biosynthesis in root and shoot (fluridone) show that the humic acid-mediated enhancement of both root hydraulic conductivity and shoot growth depended on ABA signaling pathways. These experiments also show that a significant increase in the gene expression of the main root plasma membrane aquaporins is associated with the increase of root hydraulic conductivity caused by the model humic acid. Finally, experimental data suggest that all of these actions of model humic acid on root functionality, which are linked to its beneficial action on plant shoot growth, are likely related to the conformational structure of humic acid in solution and its interaction with the cell wall at the root surface. © 2015 American Society of Plant Biologists. All Rights Reserved.

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

Antibodies against aquaporin-4 in neuromyelitis optica: distinction between recurrent and monophasic patients

NARCIS (Netherlands)

Ketelslegers, I.A.; Modderman, P.W.; Vennegoor, A.; Killestein, J.; Hamann, D.; Hintzen, R.Q.

2011-01-01

The detection of antibodies against aquaporin-4 (AQP4) has improved the diagnosis of neuromyelitis optica (NMO). We evaluated a recently established cell-based anti-AQP4 assay in 273 patients with inflammatory CNS demyelination. The assay had a specificity of 99% and a sensitivity of 56% to detect

Molecular cloning and expression analysis of the aqp1aa gene in half-smooth tongue sole (Cynoglossus semilaevis.

Directory of Open Access Journals (Sweden)

Hua Guo

Full Text Available Aquaporin 1 (AQP1 is a member of the transmembrane water channel family of proteins with special structural features, and two AQP1 paralogous genes (aqp1aa and aqp1ab are reported in teleosts. In the present study, the aqp1aa gene of half-smooth tongue sole (Cynoglossus semilaevis was cloned and characterized. The full-length cDNA of aqp1aa is 1411 bp with a 786 bp open reading frame encoding a 261-amino acid putative protein with a characteristic structure consisting of 6 membrane-spanning α-helical domains and two highly conserved asparagine-proline-alanine motifs. Real-time quantitative PCR revealed that aqp1aa mRNA is expressed predominantly in the testis of males and pseudo-males, while its expression is low in the ovary and lowest in doublesex and mab-3-related transcription factor 1(DMRT1 knock out fish and triploid males. In situ hybridization indicated that aqp1aa mRNA is expressed mainly in the germ cells of males and pseudo-males, especially in spermatozoa and spermatids. These results suggest that the aqp1aa may play a role in spermatogenesis of C. semilaevis.

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

Science.gov (United States)

de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

2002-04-15

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

Directory of Open Access Journals (Sweden)

Hongle Xu

Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

Science.gov (United States)

Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

2015-12-01

In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

Directory of Open Access Journals (Sweden)

Royah Vaezi

2013-12-01

Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

The water channel aquaporin-1 contributes to renin cell recruitment during chronic stimulation of renin production

DEFF Research Database (Denmark)

Tinning, Anne Robdrup; Jensen, Boye L; Schweda, Frank

2014-01-01

Processing and release of secretory granules involve water movement across granule membranes. It was hypothesized that the water channel aquaporin-1 (AQP-1) contributes directly to recruitment of renin-positive cells in the afferent arteriole. AQP1(-/-) and (+/+) mice were fed a low NaCl diet (LS...... to baseline with no difference between genotypes. Plasma nitrite/nitrate concentration was unaffected by genotype and LS-ACEI. In AQP1(-/-) mice, the number of afferent arterioles with recruitment was significantly lower compared to (+/+) after LS-ACEI. It is concluded that aquaporin-1 is not necessary...... for acutely stimulated renin secretion in vivo and from isolated perfused kidney, whereas recruitment of renin-positive cells in response to chronic stimulation is attenuated or delayed in AQP1(-/-) mice....

The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

DEFF Research Database (Denmark)

Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

2012-01-01

OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

Science.gov (United States)

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

Science.gov (United States)

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

Directory of Open Access Journals (Sweden)

Vera S Bogdanova

Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

Cardioprotective effect of valsartan in mice with short-term high-salt diet by regulating cardiac aquaporin 1 and angiogenic factor expression.

Science.gov (United States)

Jiang, Yong; Wang, Hui-Yan; Zheng, Sheng; Mu, Shang-Qiang; Ma, Meng-Ni; Xie, Xin; Zhang, Yang-Yang; Zhang, Chun-Xue; Cai, Jian-Hui

2015-01-01

Hypertension is the most common risk factor for various cardiovascular and cerebrovascular diseases that affects approximately 61 million, or 25% of the population in United States. The dietary salt intake is one of the most important but modifiable factors for hypertension. In the current study, we aim to elucidate the role of aquaporin 1 in high-salt-induced hypertension and cardiac injuries and whether angiotensin II receptor blocker valsartan could ameliorate the effect of high salt on blood pressure. Mice were fed with normal diet, high-salt diet in the presence or absence of valsartan for 4 weeks. The body weight gain, feeding behavior, blood pressure, and cardiac pathology changes were monitored after 4 weeks. The expression of aquaporin 1, vascular endothelial growth factor, transforming growth factor β1, and basic fibroblast growth factor were analyzed using quantitative real-time polymerase chain reaction, Western blot, and immunohistochemical staining. Valsartan partially reversed the effects of high-salt diet on hypertension, cardiac injuries such as fibrosis and inflammatory cell infiltration, and inhibition of aquaporin 1 and angiogenic factors; valsartan alone did not exert such effects. The current data demonstrated that the reduction of cardiac aquaporin 1 and angiogenic factor expression level might be associated with high-salt-induced hypertension and cardiac injuries in mice, which could be ameliorated by angiotensin II receptor blocker treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

Science.gov (United States)

Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

2012-02-01

In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

Relationship between Hexokinase and the Aquaporin PIP1 in the Regulation of Photosynthesis and Plant Growth

Science.gov (United States)

Kelly, Gilor; Sade, Nir; Attia, Ziv; Secchi, Francesca; Zwieniecki, Maciej; Holbrook, N. Michele; Levi, Asher; Alchanatis, Victor; Moshelion, Menachem; Granot, David

2014-01-01

Increased expression of the aquaporin NtAQP1, which is known to function as a plasmalemma channel for CO2 and water, increases the rate of both photosynthesis and transpiration. In contrast, increased expression of Arabidopsis hexokinase1 (AtHXK1), a dual-function enzyme that mediates sugar sensing, decreases the expression of photosynthetic genes and the rate of transpiration and inhibits growth. Here, we show that AtHXK1 also decreases root and stem hydraulic conductivity and leaf mesophyll CO2 conductance (g m). Due to their opposite effects on plant development and physiology, we examined the relationship between NtAQP1 and AtHXK1 at the whole-plant level using transgenic tomato plants expressing both genes simultaneously. NtAQP1 significantly improved growth and increased the transpiration rates of AtHXK1-expressing plants. Reciprocal grafting experiments indicated that this complementation occurs when both genes are expressed simultaneously in the shoot. Yet, NtAQP1 had only a marginal effect on the hydraulic conductivity of the double-transgenic plants, suggesting that the complementary effect of NtAQP1 is unrelated to shoot water transport. Rather, NtAQP1 significantly increased leaf mesophyll CO2 conductance and enhanced the rate of photosynthesis, suggesting that NtAQP1 facilitated the growth of the double-transgenic plants by enhancing mesophyll conductance of CO2. PMID:24498392

Relationship between hexokinase and the aquaporin PIP1 in the regulation of photosynthesis and plant growth.

Directory of Open Access Journals (Sweden)

Gilor Kelly

Full Text Available Increased expression of the aquaporin NtAQP1, which is known to function as a plasmalemma channel for CO₂ and water, increases the rate of both photosynthesis and transpiration. In contrast, increased expression of Arabidopsis hexokinase1 (AtHXK1, a dual-function enzyme that mediates sugar sensing, decreases the expression of photosynthetic genes and the rate of transpiration and inhibits growth. Here, we show that AtHXK1 also decreases root and stem hydraulic conductivity and leaf mesophyll CO₂ conductance (g(m. Due to their opposite effects on plant development and physiology, we examined the relationship between NtAQP1 and AtHXK1 at the whole-plant level using transgenic tomato plants expressing both genes simultaneously. NtAQP1 significantly improved growth and increased the transpiration rates of AtHXK1-expressing plants. Reciprocal grafting experiments indicated that this complementation occurs when both genes are expressed simultaneously in the shoot. Yet, NtAQP1 had only a marginal effect on the hydraulic conductivity of the double-transgenic plants, suggesting that the complementary effect of NtAQP1 is unrelated to shoot water transport. Rather, NtAQP1 significantly increased leaf mesophyll CO₂ conductance and enhanced the rate of photosynthesis, suggesting that NtAQP1 facilitated the growth of the double-transgenic plants by enhancing mesophyll conductance of CO₂.

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

Science.gov (United States)

Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

2016-07-01

A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

Directory of Open Access Journals (Sweden)

Haga Christopher L

2007-09-01

Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

Effects of Repeated Administration of Pilocarpine and Isoproterenol on Aquaporin-5 Expression in Rat Salivary Glands

International Nuclear Information System (INIS)

Susa, Taketo; Sawai, Nobuhiko; Aoki, Takeo; Iizuka-Kogo, Akiko; Kogo, Hiroshi; Negishi, Akihide; Yokoo, Satoshi; Takata, Kuniaki; Matsuzaki, Toshiyuki

2013-01-01

Aquaporins are water channel proteins which enable rapid water movement across the plasma membrane. Aquaporin-5 (AQP5) is the major aquaporin and is expressed on the apical membrane of salivary gland acinar cells. We examined the effects of repeated administration of pilocarpine, a clinically useful stimulant for salivary fluid secretion, and isoproterenol (IPR), a stimulant for salivary protein secretion, on the abundance of AQP5 protein in rat salivary glands by immunofluorescence microscopy and semi-quantitative immunoblotting. Unexpectedly AQP5 was decreased in pilocarpine-administered salivary glands, in which fluid secretion must be highly stimulated, implying that AQP5 might not be required for fluid secretion at least in pilocarpine-administered state. The abundance of AQP5, on the other hand, was found to be significantly increased in IPR-administered submandibular and parotid glands. To address the possible mechanism of the elevation of AQP5 abundance in IPR-administered animals, changes of AQP5 level in fasting animals, in which the exocytotic events are reduced, were examined. AQP5 was found to be decreased in fasting animals as expected. These results suggested that the elevation of cAMP and/or frequent exocytotic events could increase AQP5 protein. AQP5 expression seems to be easily changed by salivary stimulants, although these changes do not always reflect the ability in salivary fluid secretion

Expression of AQP3 gene in chronic atrophic and chronic superficial gastritis patients

Directory of Open Access Journals (Sweden)

Shijun Zhang

2007-12-01

Full Text Available BACKGROUND: Most studies about aquaporin 3 (AQP3 in the gastrointestinal tract were carried out on both in vivo and in vitro. The role of AQP3-mediated water transport in human gastrointestinal tract is still unclear. Our aim in this study was to explore the expression of AQP3 gene in chronic atrophic gastritis (CAG and chronic superficial gastritis (CSG atients and to determine its possible function in the development of gastritis.
METHODS: Twenty-two outpatients diagnosed as CSG and 12 outpatients diagnosed as CAG were selected randomly. Ten cases of healthy individuals were selected as normal control group. In all cases, AQP3 gene expression of gastric mucosa was detected by fluorescence quantitative polymerase chain reaction (FQ-PCR.
RESULTS: The AQP3 gene expression was significantly higher in gastric mucosa of CSG and healthy individuals than that in CAG (P<0.01. However, there was no significant difference in the AQP3 gene expression between helicobacter pylori positive patients and helicobacter pylori negative patients (P>0.05.
CONCLUSIONS: AQP3 expression might play certain role in the occurrence and development of gastritis.
KEY WORDS: Aquaporin 3, chronic superficial gastritis, chronic atrophic gastritis.

CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

DEFF Research Database (Denmark)

Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M

2017-01-01

these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...

Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

DEFF Research Database (Denmark)

Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

2002-01-01

The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

Trichoderma genes

Science.gov (United States)

Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

2012-06-19

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-01-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

Science.gov (United States)

Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

2002-07-01

Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

Insights into plant plasma membrane aquaporin trafficking.

Science.gov (United States)

Hachez, Charles; Besserer, Arnaud; Chevalier, Adrien S; Chaumont, François

2013-06-01

Plasma membrane intrinsic proteins (PIPs) are plant aquaporins that facilitate the diffusion of water and small uncharged solutes through the cell membrane. Deciphering the network of interacting proteins that modulate PIP trafficking to and activity in the plasma membrane is essential to improve our knowledge about PIP regulation and function. This review highlights the most recent advances related to PIP subcellular routing and dynamic redistribution, identifies some key molecular interacting proteins, and indicates exciting directions for future research in this field. A better understanding of the mechanisms by which plants optimize water movement might help in identifying new molecular players of agronomical relevance involved in the control of cellular water uptake and drought tolerance. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

Science.gov (United States)

Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

2011-01-01

Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

Science.gov (United States)

Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

2013-01-01

The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

Heterologous Expression of Two Jatropha Aquaporins Imparts Drought and Salt Tolerance and Improves Seed Viability in Transgenic Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Kasim Khan

Full Text Available Drought and high salinity are environmental conditions that cause adverse effects on the growth and productivity of crops. Aquaporins are small integral membrane proteins that belong to the family of the major intrinsic proteins (MIPs, with members in animals, plants and microbes, where they facilitate the transport of water and/or small neutral solutes thereby affecting water balance. In this study we characterized two aquaporin genes namely, plasma membrane intrinsic protein (PIP2;7 and tonoplast intrinsic protein TIP1;3 from Jatropha curcas that are localised to the plasma membrane and vacuole respectively. Transgenic Arabidopsis thaliana lines over-expressing JcPIP2;7 and JcTIP1;3 under a constitutive promoter show improved germination under high salt and mannitol compared to control seeds. These transgenic plants also show increased root length under abiotic stress conditions compared to wild type Col-0 plants. Transgenic lines exposed to drought conditions by withholding water for 20 days, were able to withstand water stress and attained normal growth after re-watering unlike control plants which could not survive. Transgenic lines also had better seed yield than control under salt stress. Importantly, seed viability of transgenic plants grown under high salt concentration was 35%-45% compared to less than 5% for control seeds obtained from plants growing under salt stress. The effect of JcPIP2;7 and JcTIP1;3 on improving germination and seed viability in drought and salinity make these important candidates for genetic manipulation of plants for growth in saline soils.

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

DEFF Research Database (Denmark)

Huebner, K; Kastury, K; Druck, T

1994-01-01

"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

Science.gov (United States)

Keebaugh, Alaine C; Thomas, James W

2010-06-01

Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

Science.gov (United States)

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

Aquaporin 2 and apical calcium-sensing receptor: new players in polyuric disorders associated with hypercalciuria.

NARCIS (Netherlands)

Procino, G.; Mastrofrancesco, L.; Mira, A.; Tamma, G.; Carmosino, M.; Emma, F.; Svelto, M.; Valenti, G.

2008-01-01

The kidney plays a critical role in regulating water homeostasis through specific proteins highly expressed in the kidney, called aquaporins, allowing water permeation at a high rate. This brief review focuses on some nephropathies associated with impaired urinary concentrating ability and in

Water fluxes through aquaporin-9 prime epithelial cells for rapid wound healing

DEFF Research Database (Denmark)

Karlsson, T.; Lagerholm, B. C.; Vikstrom, E.

2013-01-01

Cells move along surfaces both as single cells and multi-cellular units. Recent research points toward pivotal roles for water flux through aquaporins (AQPs) in single cell migration. Their expression is known to facilitate this process by promoting rapid shape changes. However, little is known...... wound healing based on AQP-induced swelling and expansion of the monolayer. (C) 2012 Elsevier Inc. All rights reserved....

Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

Directory of Open Access Journals (Sweden)

David H. Dreyfus

2017-01-01

Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

Science.gov (United States)

Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

2014-08-28

The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

Science.gov (United States)

Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

2014-03-01

The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

Directory of Open Access Journals (Sweden)

Yi-Li Li

2017-11-01

Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

Science.gov (United States)

Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

1994-02-01

We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

Science.gov (United States)

Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

1999-04-16

A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

Altered aquaporin expression in glaucoma eyes

DEFF Research Database (Denmark)

Tran, Thuy Linh; Bek, Toke; Cour, Morten la

2014-01-01

Aquaporins (AQP) are channels in the cell membrane that mainly facilitate a passive transport of water. In the eye, AQPs are expressed in the ciliary body and retina and may contribute to the pathogenesis of glaucoma and optic neuropathy. We investigated the expression of AQP1, AQP3, AQP4, AQP5......, AQP7 and AQP9 in human glaucoma eyes compared with normal eyes. Nine glaucoma eyes were examined. Of these, three eyes were diagnosed with primary open angle glaucoma; three eyes had neovascular glaucoma; and three eyes had chronic angle-closure glaucoma. Six eyes with normal intraocular pressure...... and without glaucoma were used as control. Immunohistochemistry was performed using antibodies against AQP1, AQP3, AQP4, AQP5, AQP7 and AQP9. For each specimen, optical densities of immunoprecipitates were measured using Photoshop and the staining intensities were calculated. Immunostaining showed labelling...

Tonoplast aquaporins facilitate lateral root emergence

DEFF Research Database (Denmark)

Reinhardt, Hagen; Hachez, Charles; Bienert, Manuela Désirée

2016-01-01

Aquaporins (AQPs) are water channels allowing fast and passive diffusion of water across cell membranes. It was hypothesized that AQPs contribute to cell elongation processes by allowing water influx across the plasma membrane and the tonoplast to maintain adequate turgor pressure. Here, we report...... mutants showed no or minor reduction in growth of the main root. This phenotype was due to the retardation of LRP emergence. Live cell imaging revealed that tight spatiotemporal control of TIP abundance in the tonoplast of the different LRP cells is pivotal to mediating this developmental process. While...... lateral root emergence is correlated to a reduction of AtTIP1;1 and AtTIP1;2 protein levels in LRPs, expression of AtTIP2;1 is specifically needed in a restricted cell population at the base, then later at the flanks, of developing LRPs. Interestingly, the LRP emergence phenotype of the triple tip mutants...

Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

Science.gov (United States)

Grimm, Frauke; Dobler, Nadine; Dahl, Christiane