WorldWideScience

Sample records for aperiodic optical variability

  1. Aperiodic Volume Optics

    Science.gov (United States)

    Gerke, Tim D.

    Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within

  2. Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams

    Science.gov (United States)

    Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović

    2017-08-01

    We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.

  3. Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates

    Science.gov (United States)

    Yu, Yisheng

    This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.

  4. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    International Nuclear Information System (INIS)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H.; White, Russel J.

    2014-01-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K s -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK s -band amplitudes from 0.044 to 2.31 mag and Δ(J – K s ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K s time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism

  5. PERIODIC AND APERIODIC VARIABILITY IN THE MOLECULAR CLOUD ρ OPHIUCHUS

    Energy Technology Data Exchange (ETDEWEB)

    Parks, J. Robert; Plavchan, Peter; Gee, Alan H. [Infrared Processing and Analysis Center, California Institute of Technology, Mail Code 100-22, 770 South Wilson Avenue, Pasadena, CA 91125 (United States); White, Russel J., E-mail: parksj@chara.gsu.edu [Georgia State University, Department of Physics and Astronomy, 25 Park Place, Room 605, Atlanta, GA 30303 (United States)

    2014-03-01

    Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and K{sub s} -band photometric measurements with a cadence of ∼1 day are obtained over three observing seasons spanning ∼2.5 yr; it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔK{sub s} -band amplitudes from 0.044 to 2.31 mag and Δ(J – K{sub s} ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the K{sub s} time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic ''eclipse-like'' features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief

  6. Investigation of aperiodic W/C multi-layer mirror for X-ray optics

    International Nuclear Information System (INIS)

    Wang Zhanshan; Cheng Xinbin; Zhu Jingtao; Huang Qiushi; Zhang Zhong; Chen Lingyan

    2011-01-01

    Design, fabrication and characterization of aperiodic tungsten/carbon (W/C) multi-layer mirror were studied. W/C multi-layer was designed as a broad-angle reflective supermirror for Cu-Kα line (λ = 0.154 nm) in the grazing incident angular range (0.9-1.1 deg.) using simulated annealing algorithm. To deposit the W/C depth-graded multi-layer mirror accurately, we introduce an effective layer growth rate as a function of layer thickness. This method greatly improves the reflectivity curve compared to the conventional multi-layer mirror prepared with constant growth rate. The deposited multi-layer mirror exhibits an average reflectivity of 19% over the grazing incident angle range of 0.88-1.08 deg. which mainly coincides with the designed value. Furthermore, the physical mechanisms were discussed and the re-sputtering process of light-atom layers is accounted for the modification of layer thicknesses which leads to the effective growth rates. Using this calibration method, the aperiodic multi-layer mirrors can be better fabricated for X-ray optics.

  7. Aperiodic signals processing via parameter-tuning stochastic resonance in a photorefractive ring cavity

    Directory of Open Access Journals (Sweden)

    Xuefeng Li

    2014-04-01

    Full Text Available Based on solving numerically the generalized nonlinear Langevin equation describing the nonlinear dynamics of stochastic resonance by Fourth-order Runge-Kutta method, an aperiodic stochastic resonance based on an optical bistable system is numerically investigated. The numerical results show that a parameter-tuning stochastic resonance system can be realized by choosing the appropriate optical bistable parameters, which performs well in reconstructing aperiodic signals from a very high level of noise background. The influences of optical bistable parameters on the stochastic resonance effect are numerically analyzed via cross-correlation, and a maximum cross-correlation gain of 8 is obtained by optimizing optical bistable parameters. This provides a prospective method for reconstructing noise-hidden weak signals in all-optical signal processing systems.

  8. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    Energy Technology Data Exchange (ETDEWEB)

    Findeisen, Krzysztof; Hillenbrand, Lynne [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, MC 249-17, Pasadena, CA 91125 (United States); Cody, Ann Marie, E-mail: krzys@astro.caltech.edu [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States)

    2015-01-10

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs.

  9. SIMULATED PERFORMANCE OF TIMESCALE METRICS FOR APERIODIC LIGHT CURVES

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Cody, Ann Marie

    2015-01-01

    Aperiodic variability is a characteristic feature of young stars, massive stars, and active galactic nuclei. With the recent proliferation of time-domain surveys, it is increasingly essential to develop methods to quantify and analyze aperiodic variability. We develop three timescale metrics that have been little used in astronomy—Δm-Δt plots, peak-finding, and Gaussian process regression—and present simulations comparing their effectiveness across a range of aperiodic light curve shapes, characteristic timescales, observing cadences, and signal to noise ratios. We find that Gaussian process regression is easily confused by noise and by irregular sampling, even when the model being fit reflects the process underlying the light curve, but that Δm-Δt plots and peak-finding can coarsely characterize timescales across a broad region of parameter space. We make public the software we used for our simulations, both in the spirit of open research and to allow others to carry out analogous simulations for their own observing programs

  10. Aperiodic-metamaterial-based absorber

    Directory of Open Access Journals (Sweden)

    Quanlong Yang

    2017-09-01

    Full Text Available The periodic-metamaterial-based perfect absorber has been studied broadly. Conversely, if the unit cell in the metamaterial-based absorber is arranged aperiodically (aperiodic-metamaterial-based absorber, how does it perform? Inspired by this, here we present a systematic study of the aperiodic-metamaterial-based absorber. By investigating the response of metamaterial absorbers based on periodic, Fibonacci, Thue-Morse, and quasicrystal lattices, we found that aperiodic-metamaterial-based absorbers could display similar absorption behaviors as the periodic one in one hand. However, their absorption behaviors show different tendency depending on the thicknesses of the spacer. Further studies on the angle and polarization dependence of the absorption behavior are also presented.

  11. PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)

    Science.gov (United States)

    Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj

    2010-04-01

    Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews

  12. Simulation of aperiodic bipedal sprinting.

    Science.gov (United States)

    Celik, Huseyin; Piazza, Stephen J

    2013-08-01

    Synthesis of legged locomotion through dynamic simulation is useful for exploration of the mechanical and control variables that contribute to efficient gait. Most previous simulations have made use of periodicity constraints, a sensible choice for investigations of steady-state walking or running. Sprinting from rest, however, is aperiodic by nature and this aperiodicity is central to the goal of the movement, as performance is determined in large part by a rapid acceleration phase early in the race. The purpose of this study was to create a novel simulation of aperiodic sprinting using a modified spring-loaded inverted pendulum (SLIP) biped model. The optimal control problem was to find the set of controls that minimized the time for the model to run 20 m, and this problem was solved using a direct multiple shooting algorithm that converts the original continuous time problem into piecewise discrete subproblems. The resulting nonlinear programming problem was solved iteratively using a sequential quadratic programming method. The starting point for the optimizer was an initial guess simulation that was a slow alternating-gait "jogging" simulation developed using proportional-derivative feedback to control trunk attitude, swing leg angle, and leg retraction and extension. The optimized aperiodic sprint simulation solution yielded a substantial improvement in locomotion time over the initial guess (2.79 s versus 6.64 s). Following optimization, the model produced forward impulses at the start of the sprint that were four times greater than those of the initial guess simulation, producing more rapid acceleration. Several gait features demonstrated in the optimized sprint simulation correspond to behaviors of human sprinters: forward trunk lean at the start; straightening of the trunk during acceleration; and a dive at the finish. Optimization resulted in reduced foot contact times (0.065 s versus 0.210 s), but contact times early in the optimized

  13. Structural color of a lycaenid butterfly: analysis of an aperiodic multilayer structure

    International Nuclear Information System (INIS)

    Yoshioka, S; Shimizu, Y; Kinoshita, S; Matsuhana, B

    2013-01-01

    We investigated the structural color of the green wing of the lycaenid butterfly Chrysozephyrus brillantinus. Electron microscopy revealed that the bottom plate of the cover scale on the wing consists of an alternating air–cuticle multilayer structure. However, the thicknesses of the layers were not constant but greatly differed depending on the layer, unlike the periodic multilayer designs often adopted for artificial laser-reflecting mirrors. The agreement between the experimentally determined and theoretically calculated reflectance spectra led us to conclude that the multilayer interference in the aperiodic system is the primary origin of the structural color. We analyzed optical interference in this aperiodic system using a simple analytical model and found that two spectral peaks arise from constructive interference among different parts of the multilayer structure. We discuss the advantages and disadvantages of the aperiodic system over a periodic one. (paper)

  14. Mathematics of aperiodic order

    CERN Document Server

    Lenz, Daniel; Savinien, Jean

    2015-01-01

    What is order that is not based on simple repetition, that is, periodicity? How must atoms be arranged in a material so that it diffracts like a quasicrystal? How can we describe aperiodically ordered systems mathematically? Originally triggered by the – later Nobel prize-winning – discovery of quasicrystals, the investigation of aperiodic order has since become a well-established and rapidly evolving field of mathematical research with close ties to a surprising variety of branches of mathematics and physics. This book offers an overview of the state of the art in the field of aperiodic order, presented in carefully selected authoritative surveys. It is intended for non-experts with a general background in mathematics, theoretical physics or computer science, and offers a highly accessible source of first-hand information for all those interested in this rich and exciting field. Topics covered include the mathematical theory of diffraction, the dynamical systems of tilings or Delone sets, their cohomolog...

  15. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  16. Aperiodic nanoplasmonic devices for directional colour filtering and sensing.

    Science.gov (United States)

    Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit

    2017-11-07

    Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.

  17. Aperiodic linear networked control considering variable channel delays: application to robots coordination.

    Science.gov (United States)

    Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel

    2015-05-27

    One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  18. Aperiodic Linear Networked Control Considering Variable Channel Delays: Application to Robots Coordination

    Directory of Open Access Journals (Sweden)

    Carlos Santos

    2015-05-01

    Full Text Available One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.

  19. Combinations of response-reinforcer relations in periodic and aperiodic schedules.

    Science.gov (United States)

    Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E

    2013-03-01

    Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.

  20. Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L

    2012-01-02

    We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.

  1. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    Science.gov (United States)

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  2. A method to identify aperiodic disturbances in the ionosphere

    Science.gov (United States)

    Wang, J.-S.; Chen, Z.; Huang, C.-M.

    2014-05-01

    In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.

  3. Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices

    Directory of Open Access Journals (Sweden)

    Enrique Maciá

    2015-05-01

    Full Text Available Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.

  4. Variable Stars Observed in the Galactic Disk by AST3-1 from Dome A, Antarctica

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lingzhi; Ma, Bin; Hu, Yi; Liu, Qiang; Shang, Zhaohui [Key Laboratory of Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China); Li, Gang; Fu, Jianning [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Wang, Lifan; Cui, Xiangqun; Du, Fujia; Gong, Xuefei; Li, Xiaoyan; Li, Zhengyang; Yuan, Xiangyan; Zhou, Jilin [Chinese Center for Antarctic Astronomy, Nanjing 210008 (China); Ashley, Michael C. B. [School of Physics, University of New South Wales, NSW 2052 (Australia); Pennypacker, Carl R. [Center for Astrophysics, Lawrence Berkeley National Laboratory, Berkeley, CA (United States); York, Donald G., E-mail: wanglingzhi@bao.ac.cn [Department of Astronomy and Astrophysics and Enrico Fermi Institute, University of Chicago, Chicago, IL 60637 (United States)

    2017-03-01

    AST3-1 is the second-generation wide-field optical photometric telescope dedicated to time-domain astronomy at Dome A, Antarctica. Here, we present the results of an i -band images survey from AST3-1 toward one Galactic disk field. Based on time-series photometry of 92,583 stars, 560 variable stars were detected with i magnitude ≤16.5 mag during eight days of observations; 339 of these are previously unknown variables. We tentatively classify the 560 variables as 285 eclipsing binaries (EW, EB, and EA), 27 pulsating variable stars ( δ Scuti, γ Doradus, δ Cephei variable, and RR Lyrae stars), and 248 other types of variables (unclassified periodic, multiperiodic, and aperiodic variable stars). Of the eclipsing binaries, 34 show O’Connell effects. One of the aperiodic variables shows a plateau light curve and another variable shows a secondary maximum after peak brightness. We also detected a complex binary system with an RS CVn-like light-curve morphology; this object is being followed-up spectroscopically using the Gemini South telescope.

  5. Reclaiming Spare Capacity and Improving Aperiodic Response Times in Real-Time Environments

    Directory of Open Access Journals (Sweden)

    Liu Xue

    2011-01-01

    Full Text Available Abstract Scheduling recurring task sets that allow some instances of the tasks to be skipped produces holes in the schedule which are nonuniformly distributed. Similarly, when the recurring tasks are not strictly periodic but are sporadic, there is extra processor bandwidth arising because of irregular job arrivals. The additional computation capacity that results from skips or sporadic tasks can be reclaimed to service aperiodic task requests efficiently and quickly. We present techniques for improving the response times of aperiodic tasks by identifying nonuniformly distributed spare capacity—because of skips or sporadic tasks—in the schedule and adding such extra capacity to the capacity queue of a BASH server. These gaps can account for a significant portion of aperiodic capacity, and their reclamation results in considerable improvement to aperiodic response times. We present two schemes: NCLB-CBS, which performs well in periodic real-time environments with firm tasks, and NCLB-CUS, which can be deployed when the basic task set to schedule is sporadic. Evaluation via simulations and implementation suggests that performance improvements for aperiodic tasks can be obtained with limited additional overhead.

  6. Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.

    Science.gov (United States)

    Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S

    2016-01-15

    Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.

  7. Dynamical mechanisms for sensitive response of aperiodic firing cells to external stimulation

    International Nuclear Information System (INIS)

    Xie Yong; Xu Jianxue; Hu Sanjue; Kang Yanmei; Yang Hongjun; Duan Yubin

    2004-01-01

    An interesting phenomenon that aperiodic firing neurons have a higher sensitivity to drugs than periodic firing neurons have been reported for the chronically compressed dorsal root ganglion neurons in rats. In this study, the dynamical mechanisms for such a phenomenon are uncovered from the viewpoint of dynamical systems theory. We use the Rose-Hindmarsh neuron model to illustrate our opinions. Periodic orbit theory is introduced to characterize the dynamical behavior of aperiodic firing neurons. It is considered that bifurcations, crises and sensitive dependence of chaotic motions on control parameters can be the underlying mechanisms. And then, a similar analysis is applied to the modified Chay model describing the firing behavior of pancreatic beta cells. The same dynamical mechanisms can be obtained underlying that aperiodic firing cells are more sensitive to external stimulation than periodic firing ones. As a result, we conjecture that sensitive response of aperiodic firing cells to external stimulation is a universal property of excitable cells

  8. Control, synchronization, and enhanced reliability of aperiodic oscillations in the Mercury Beating Heart system

    Science.gov (United States)

    Kumar, Pawan; Parmananda, P.

    2018-04-01

    Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.

  9. Coupled nanopillar waveguides: optical properties and applications

    DEFF Research Database (Denmark)

    Chigrin, Dmitry N.; Zhukovsky, Sergei V.; Lavrinenko, Andrei

    2007-01-01

    , while guided modes dispersion is strongly affected by the waveguide structure. We present a systematic analysis of the optical properties of coupled nanopillar waveguides and discuss their possible applications for integrated optics. (C) 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim......In this paper we review basic properties of coupled periodic and aperiodic nanopillar waveguides. A coupled nanopillar waveguide consists of several rows of periodically or aperiodically placed dielectric rods (pillars). In such a waveguide, light confinement is due to the total internal reflection...

  10. Band structures and localization properties of aperiodic layered phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yan Zhizhong, E-mail: zzyan@bit.edu.cn [Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57078 Siegen (Germany)

    2012-03-15

    The band structures and localization properties of in-plane elastic waves with coupling of longitudinal and transverse modes oblique propagating in aperiodic phononic crystals based on Thue-Morse and Rudin-Shapiro sequences are studied. Using transfer matrix method, the concept of the localization factor is introduced and the correctness is testified through the Rytov dispersion relation. For comparison, the perfect periodic structure and the quasi-periodic Fibonacci system are also considered. In addition, the influences of the random disorder, local resonance, translational and/or mirror symmetries on the band structures of the aperiodic phononic crystals are analyzed in this paper.

  11. Aperiodicity Correction for Rotor Tip Vortex Measurements

    Science.gov (United States)

    Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.

    2011-01-01

    The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.

  12. Spectral characterisation of aperiodic normal-incidence Sb/B4C multilayer mirrors for the λ < 124 Å range

    Science.gov (United States)

    Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.

    2018-03-01

    Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.

  13. Improving emission uniformity and linearizing band dispersion in nanowire arrays using quasi-aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, P. Duke [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Koleske, Daniel D. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Povinelli, Michelle L. [Univ. of Southern California, Los Angeles, CA (United States). Ming Hsieh Dept. of Electrical Engineering; Subramania, Ganapathi [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However, in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.

  14. Broad-Band Variability in Accreting Compact Objects

    Directory of Open Access Journals (Sweden)

    S. Scaringi

    2015-02-01

    Full Text Available Cataclysmic variable stars are in many ways similar to X-ray binaries. Both types of systems possess an accretion disk, which in most cases can reach the surface (or event horizon of the central compact object. The main difference is that the embedded gravitational potential well in X-ray binaries is much deeper than those found in cataclysmic variables. As a result, X-ray binaries emit most of their radiation at X-ray wavelengths, as opposed to cataclysmic variables which emit mostly at optical/ultraviolet wavelengths. Both types of systems display aperiodic broad-band variability which can be associated to the accretion disk. Here, the properties of the observed X-ray variability in XRBs are compared to those observed at optical wavelengths in CVs. In most cases the variability properties of both types of systems are qualitatively similar once the relevant timescales associated with the inner accretion disk regions have been taken into account. The similarities include the observed power spectral density shapes, the rms-flux relation as well as Fourier-dependant time lags. Here a brief overview on these similarities is given, placing them in the context of the fluctuating accretion disk model which seeks to reproduce the observed variability.

  15. An aperiodic phenomenon of the unscented Kalman filter in filtering noisy chaotic signals

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A non-periodic oscillatory behavior of the unscented Kalman filter (UKF) when used to filter noisy contaminated chaotic signals is reported. We show both theoretically and experimentally that the gain of the UKF may not converge or diverge but oscillate aperiodically. More precisely, when a nonlinear system is periodic, the Kalman gain and error covariance of the UKF converge to zero. However, when the system being considered is chaotic, the Kalman gain either converges to a fixed point with a magnitude larger than zero or oscillates aperiodically.

  16. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  17. Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell

    Science.gov (United States)

    Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.

    2016-08-01

    In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.

  18. Simulation of photonic waveguides with deterministic aperiodic nanostructures for biosensing

    DEFF Research Database (Denmark)

    Neustock, Lars Thorben; Paulsen, Moritz; Jahns, Sabrina

    2016-01-01

    Photonic waveguides with deterministic aperiodic corrugations offer rich spectral characteristics under surface-normal illumination. The finite-element method (FEM), the finite-difference time-domain (FDTD) method and a rigorous coupled wave algorithm (RCWA) are compared for computing the near...

  19. Outer synchronization of complex networks with internal delay and coupling delay via aperiodically intermittent pinning control

    Science.gov (United States)

    Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu

    This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.

  20. Non-commutative Chern numbers for generic aperiodic discrete systems

    Science.gov (United States)

    Bourne, Chris; Prodan, Emil

    2018-06-01

    The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.

  1. Topological aperiodicity for product systems over semigroups of Ore type

    DEFF Research Database (Denmark)

    Kwasniewski, Bartosz; Szymanski, Wojciech

    2016-01-01

    aperiodicity condition on the latter, we obtain the uniqueness theorem and a simplicity criterion for the algebras in question. These results generalize the corresponding ones for crossed products by discrete groups, due to Archbold and Spielberg, and for Exel's crossed products, due to Exel and Vershik...

  2. Aperiodic spin state ordering of bistable molecules and its photoinducede erasing

    Czech Academy of Sciences Publication Activity Database

    Collet, E.; Watanabe, H.; Bréfuel, N.; Palatinus, Lukáš; Roudaut, L.; Toupet, L.; Tanaka, K.; Tuchagues, J.-P.; Fertey, P.; Ravy, S.; Toudic, B.; Cailleau, H.

    2012-01-01

    Roč. 109, č. 25 (2012), "257206-1"-"257206-5" ISSN 0031-9007 Institutional research plan: CEZ:AV0Z10100521 Keywords : photocrystallography * aperiodic structure * spin-state ordering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.943, year: 2012

  3. Diffuse scattering from periodic and aperiodic crystals

    International Nuclear Information System (INIS)

    Frey, F.

    1997-01-01

    A (selective) review on diffuse scattering from periodic and aperiodic crystalline solids is given to demonstrate the wide field of applications in basic and applied research. After a general introduction in this field each topic is exemplified by one or two examples. Main emphasis is laid on recent work. More established work, e.g., on diffuse scattering from metals and alloys, polytypes, stacking disorder from layered structures, etc. is omitted due to the availability of excellent textbooks and reviews. Finally a short summary of recent developments of experimental methods and evaluation techniques is presented. (orig.)

  4. High performance EUV multilayer structures insensitive to capping layer optical parameters.

    Science.gov (United States)

    Pelizzo, Maria Guglielmina; Suman, Michele; Monaco, Gianni; Nicolosi, Piergiorgio; Windt, David L

    2008-09-15

    We have designed and tested a-periodic multilayer structures containing protective capping layers in order to obtain improved stability with respect to any possible changes of the capping layer optical properties (due to oxidation and contamination, for example)-while simultaneously maximizing the EUV reflection efficiency for specific applications, and in particular for EUV lithography. Such coatings may be particularly useful in EUV lithographic apparatus, because they provide both high integrated photon flux and higher stability to the harsh operating environment, which can affect seriously the performance of the multilayer-coated projector system optics. In this work, an evolutive algorithm has been developed in order to design these a-periodic structures, which have been proven to have also the property of stable performance with respect to random layer thickness errors that might occur during coating deposition. Prototypes have been fabricated, and tested with EUV and X-ray reflectometry, and secondary electron spectroscopy. The experimental results clearly show improved performance of our new a-periodic coatings design compared with standard periodic multilayer structures.

  5. Near-to far-field transformation in the aperiodic Fourier modal method

    NARCIS (Netherlands)

    Rook, R.; Pisarenco, M.; Setija, I.D.

    2013-01-01

    This paper addresses the task of obtaining the far-field spectrum for a finite structure given the near-field calculated by the aperiodic Fourier modal method in contrast-field formulation (AFMM-CFF). The AFMM-CFF efficiently calculates the solution to Maxwell's equations for a finite structure by

  6. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2013-01-01

    This paper presents the details of a new real-time stability assessment method. The method assesses a particular mechanism of stability: each generator’s capability to generate sufficient steady state electromechanical torque. The lack of sufficient steady state torque causes aperiodic increase...... of multiple operating points is derived in the paper. Finally, results from time-domain simulation of instability scenarios in the Nordic32 test system are presented and results used for testing the assessment method. The results illustrate the method’s capability to efficiently identify the location...... in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators’ operating points that enables informative visualization...

  7. ENERGY-DEPENDENT POWER SPECTRAL STATES AND ORIGIN OF APERIODIC VARIABILITY IN BLACK HOLE BINARIES

    International Nuclear Information System (INIS)

    Yu Wenfei; Zhang Wenda

    2013-01-01

    We found that the black hole candidate MAXI J1659–152 showed distinct power spectra, i.e., power-law noise (PLN) versus band-limited noise (BLN) plus quasi-periodic oscillations (QPOs) below and above about 2 keV, respectively, in observations with Swift and the Rossi X-ray Timing Explorer during the 2010 outburst, indicating a high energy cutoff of the PLN and a low energy cutoff of the BLN and QPOs around 2 keV. The emergence of the PLN and the fading of the BLN and QPOs initially took place below 2 keV when the source entered the hard intermediate state and settled in the soft state three weeks later. The evolution was accompanied by the emergence of the disk spectral component and decreases in the amplitudes of variability in the soft and hard X-ray bands. Our results indicate that the PLN is associated with an optically thick disk in both hard and intermediate states, and the power spectral state is independent of the X-ray energy spectral state in a broadband view. We suggest that in the hard or intermediate state, the BLN and QPOs emerge from the innermost hot flow subjected to Comptonization, while the PLN originates from the optically thick disk farther out. The energy cutoffs of the PLN and the BLN or QPOs then follow the temperature of the seed photons from the inner edge of the optically thick disk, while the high frequency cutoff of the PLN follows the orbital frequency of the inner edge of the optically thick disk as well.

  8. Synchronization of coupled stochastic complex-valued dynamical networks with time-varying delays via aperiodically intermittent adaptive control

    Science.gov (United States)

    Wang, Pengfei; Jin, Wei; Su, Huan

    2018-04-01

    This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.

  9. Compact plasmonic variable optical attenuator

    DEFF Research Database (Denmark)

    Leosson, Kristjan; Rosenzveig, Tiberiu; Hermannsson, Pétur Gordon

    2008-01-01

    We demonstrate plasmonic nanowire-based thermo-optic variable optical attenuators operating in the 1525-1625 nm wavelength range. The devices have a footprint as low as 1 mm, extinction ratio exceeding 40 dB, driving voltage below 3 V, and full modulation bandwidth of 1 kHz. The polarization...

  10. Two methods for studying the X-ray variability

    NARCIS (Netherlands)

    Yan, Shu-Ping; Ji, Li; Méndez, Mariano; Wang, Na; Liu, Siming; Li, Xiang-Dong

    2016-01-01

    The X-ray aperiodic variability and quasi-periodic oscillation (QPO) are the important tools to study the structure of the accretion flow of X-ray binaries. However, the origin of the complex X-ray variability from X-ray binaries remains yet unsolved. We proposed two methods for studying the X-ray

  11. Ultrastrong extraordinary transmission and reflection in PT-symmetric Thue-Morse optical waveguide networks.

    Science.gov (United States)

    Wu, Jiaye; Yang, Xiangbo

    2017-10-30

    In this paper, we construct a 1D PT-symmetric Thue-Morse aperiodic optical waveguide network (PTSTMAOWN) and mainly investigate the ultrastrong extraordinary transmission and reflection. We propose an approach to study the photonic modes and solve the problem of calculating photonic modes distributions in aperiodic networks due to the lack of dispersion functions and find that in a PTSTMAOWN there exist more photonic modes and more spontaneous PT-symmetric breaking points, which are quite different from other reported PT-symmetric optical systems. Additionally, we develop a method to sort spontaneous PT-symmetric breaking point zones to seek the strongest extraordinary point and obtain that at this point the strongest extraordinary transmission and reflection arrive at 2.96316 × 10 5 and 1.32761 × 10 5 , respectively, due to the PT-symmetric coupling resonance and the special symmetry pattern of TM networks. These enormous gains are several orders of magnitude larger than the previous results. This optical system may possess potential in designing optical amplifier, optical logic elements in photon computers and ultrasensitive optical switches with ultrahigh monochromatity.

  12. Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances

    Science.gov (United States)

    Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong

    2017-11-01

    Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.

  13. Wide-Area Assessment of Aperiodic Small Signal Rotor Angle Stability in Real-Time

    DEFF Research Database (Denmark)

    Jóhannsson, Hjörtur; Nielsen, Arne Hejde; Østergaard, Jacob

    2014-01-01

    in rotor angle and a loss of synchronism, referred to as aperiodic small signal instability. The paper provides the theoretical background of the method and an analytical assessment criterion. Furthermore, a mathematical mapping of the generators' operating points that enables informative visualization...

  14. Wide Area Prosumption Control and Sensitivities of Aperiodic Small Signal Stability Indicators

    DEFF Research Database (Denmark)

    Wittrock, Martin Lindholm; Jóhannsson, Hjörtur; Nielsen, Arne Hejde

    2014-01-01

    and patterns, stability indicators for aperiodic small signal angular stability (ASSA) are examined, while the concept of prosumption is described. The methodology presented is shown to be able to assess the margin to instability and to predict how this margin can be affected if a load is changed in the grid...

  15. Non-diffractive optically variable security devices

    NARCIS (Netherlands)

    Renesse, R.L. van

    1991-01-01

    At the past optical security conferences attention was focused on diffractive structures, e.g. holograms, embossed gratings and thin—film devices, as security elements on valuable documents. The main reasons for this emphasis are, that the iridescent effect of such diffractive optically variable

  16. Elastic wave localization in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity

    International Nuclear Information System (INIS)

    Yan Zhizhong; Zhang Chuanzeng; Wang Yuesheng

    2011-01-01

    The band structures of in-plane elastic waves propagating in two-dimensional phononic crystals with one-dimensional random disorder and aperiodicity are analyzed in this paper. The localization of wave propagation is discussed by introducing the concept of the localization factor, which is calculated by the plane-wave-based transfer-matrix method. By treating the random disorder and aperiodicity as the deviation from the periodicity in a special way, three kinds of aperiodic phononic crystals that have normally distributed random disorder, Thue-Morse and Rudin-Shapiro sequence in one direction and translational symmetry in the other direction are considered and the band structures are characterized using localization factors. Besides, as a special case, we analyze the band gap properties of a periodic planar layered composite containing a periodic array of square inclusions. The transmission coefficients based on eigen-mode matching theory are also calculated and the results show the same behaviors as the localization factor does. In the case of random disorders, the localization degree of the normally distributed random disorder is larger than that of the uniformly distributed random disorder although the eigenstates are both localized no matter what types of random disorders, whereas, for the case of Thue-Morse and Rudin-Shapiro structures, the band structures of Thue-Morse sequence exhibit similarities with the quasi-periodic (Fibonacci) sequence not present in the results of the Rudin-Shapiro sequence.

  17. Periodic optical variability of radio-detected ultracool dwarfs

    International Nuclear Information System (INIS)

    Harding, L. K.; Golden, A.; Singh, Navtej; Sheehan, B.; Butler, R. F.; Hallinan, G.; Boyle, R. P.; Zavala, R. T.

    2013-01-01

    A fraction of very low mass stars and brown dwarfs are known to be radio active, in some cases producing periodic pulses. Extensive studies of two such objects have also revealed optical periodic variability, and the nature of this variability remains unclear. Here, we report on multi-epoch optical photometric monitoring of six radio-detected dwarfs, spanning the ∼M8-L3.5 spectral range, conducted to investigate the ubiquity of periodic optical variability in radio-detected ultracool dwarfs. This survey is the most sensitive ground-based study carried out to date in search of periodic optical variability from late-type dwarfs, where we obtained 250 hr of monitoring, delivering photometric precision as low as ∼0.15%. Five of the six targets exhibit clear periodicity, in all cases likely associated with the rotation period of the dwarf, with a marginal detection found for the sixth. Our data points to a likely association between radio and optical periodic variability in late-M/early-L dwarfs, although the underlying physical cause of this correlation remains unclear. In one case, we have multiple epochs of monitoring of the archetype of pulsing radio dwarfs, the M9 TVLM 513–46546, spanning a period of 5 yr, which is sufficiently stable in phase to allow us to establish a period of 1.95958 ± 0.00005 hr. This phase stability may be associated with a large-scale stable magnetic field, further strengthening the correlation between radio activity and periodic optical variability. Finally, we find a tentative spin-orbit alignment of one component of the very low mass binary, LP 349–25.

  18. Periodic optical variability of radio-detected ultracool dwarfs

    Energy Technology Data Exchange (ETDEWEB)

    Harding, L. K.; Golden, A.; Singh, Navtej; Sheehan, B.; Butler, R. F. [Centre for Astronomy, National University of Ireland, Galway, University Road, Galway (Ireland); Hallinan, G. [Cahill Center for Astrophysics, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Boyle, R. P. [Vatican Observatory Research Group, Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Zavala, R. T., E-mail: lkh@astro.caltech.edu [United States Naval Observatory, Flagstaff Station, Flagstaff, AZ 86001 (United States)

    2013-12-20

    A fraction of very low mass stars and brown dwarfs are known to be radio active, in some cases producing periodic pulses. Extensive studies of two such objects have also revealed optical periodic variability, and the nature of this variability remains unclear. Here, we report on multi-epoch optical photometric monitoring of six radio-detected dwarfs, spanning the ∼M8-L3.5 spectral range, conducted to investigate the ubiquity of periodic optical variability in radio-detected ultracool dwarfs. This survey is the most sensitive ground-based study carried out to date in search of periodic optical variability from late-type dwarfs, where we obtained 250 hr of monitoring, delivering photometric precision as low as ∼0.15%. Five of the six targets exhibit clear periodicity, in all cases likely associated with the rotation period of the dwarf, with a marginal detection found for the sixth. Our data points to a likely association between radio and optical periodic variability in late-M/early-L dwarfs, although the underlying physical cause of this correlation remains unclear. In one case, we have multiple epochs of monitoring of the archetype of pulsing radio dwarfs, the M9 TVLM 513–46546, spanning a period of 5 yr, which is sufficiently stable in phase to allow us to establish a period of 1.95958 ± 0.00005 hr. This phase stability may be associated with a large-scale stable magnetic field, further strengthening the correlation between radio activity and periodic optical variability. Finally, we find a tentative spin-orbit alignment of one component of the very low mass binary, LP 349–25.

  19. Shape control in wafer-based aperiodic 3D nanostructures

    International Nuclear Information System (INIS)

    Jeong, Hyeon-Ho; Mark, Andrew G; Gibbs, John G; Fischer, Peer; Reindl, Thomas; Waizmann, Ulrike; Weis, Jürgen

    2014-01-01

    Controlled local fabrication of three-dimensional (3D) nanostructures is important to explore and enhance the function of single nanodevices, but is experimentally challenging. We present a scheme based on e-beam lithography (EBL) written seeds, and glancing angle deposition (GLAD) grown structures to create nanoscale objects with defined shapes but in aperiodic arrangements. By using a continuous sacrificial corral surrounding the features of interest we grow isolated 3D nanostructures that have complex cross-sections and sidewall morphology that are surrounded by zones of clean substrate. (papers)

  20. Characteristics of aperiodic sequence of slip events caused by interaction between seismic patches and that caused be self-organized stress heterogeneity

    Science.gov (United States)

    Kato, N.

    2017-12-01

    Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.

  1. CHARACTERIZING THE OPTICAL VARIABILITY OF BRIGHT BLAZARS: VARIABILITY-BASED SELECTION OF FERMI ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Ruan, John J.; Anderson, Scott F.; MacLeod, Chelsea L.; Becker, Andrew C.; Davenport, James R. A.; Ivezić, Željko; Burnett, T. H.; Kochanek, Christopher S.; Plotkin, Richard M.; Sesar, Branimir; Stuart, J. Scott

    2012-01-01

    We investigate the use of optical photometric variability to select and identify blazars in large-scale time-domain surveys, in part to aid in the identification of blazar counterparts to the ∼30% of γ-ray sources in the Fermi 2FGL catalog still lacking reliable associations. Using data from the optical LINEAR asteroid survey, we characterize the optical variability of blazars by fitting a damped random walk model to individual light curves with two main model parameters, the characteristic timescales of variability τ, and driving amplitudes on short timescales σ-circumflex. Imposing cuts on minimum τ and σ-circumflex allows for blazar selection with high efficiency E and completeness C. To test the efficacy of this approach, we apply this method to optically variable LINEAR objects that fall within the several-arcminute error ellipses of γ-ray sources in the Fermi 2FGL catalog. Despite the extreme stellar contamination at the shallow depth of the LINEAR survey, we are able to recover previously associated optical counterparts to Fermi active galactic nuclei with E ≥ 88% and C = 88% in Fermi 95% confidence error ellipses having semimajor axis r < 8'. We find that the suggested radio counterpart to Fermi source 2FGL J1649.6+5238 has optical variability consistent with other γ-ray blazars and is likely to be the γ-ray source. Our results suggest that the variability of the non-thermal jet emission in blazars is stochastic in nature, with unique variability properties due to the effects of relativistic beaming. After correcting for beaming, we estimate that the characteristic timescale of blazar variability is ∼3 years in the rest frame of the jet, in contrast with the ∼320 day disk flux timescale observed in quasars. The variability-based selection method presented will be useful for blazar identification in time-domain optical surveys and is also a probe of jet physics.

  2. Characterizing the Optical Variability of Bright Blazars: Variability-based Selection of Fermi Active Galactic Nuclei

    Science.gov (United States)

    Ruan, John J.; Anderson, Scott F.; MacLeod, Chelsea L.; Becker, Andrew C.; Burnett, T. H.; Davenport, James R. A.; Ivezić, Željko; Kochanek, Christopher S.; Plotkin, Richard M.; Sesar, Branimir; Stuart, J. Scott

    2012-11-01

    We investigate the use of optical photometric variability to select and identify blazars in large-scale time-domain surveys, in part to aid in the identification of blazar counterparts to the ~30% of γ-ray sources in the Fermi 2FGL catalog still lacking reliable associations. Using data from the optical LINEAR asteroid survey, we characterize the optical variability of blazars by fitting a damped random walk model to individual light curves with two main model parameters, the characteristic timescales of variability τ, and driving amplitudes on short timescales \\hat{\\sigma }. Imposing cuts on minimum τ and \\hat{\\sigma } allows for blazar selection with high efficiency E and completeness C. To test the efficacy of this approach, we apply this method to optically variable LINEAR objects that fall within the several-arcminute error ellipses of γ-ray sources in the Fermi 2FGL catalog. Despite the extreme stellar contamination at the shallow depth of the LINEAR survey, we are able to recover previously associated optical counterparts to Fermi active galactic nuclei with E >= 88% and C = 88% in Fermi 95% confidence error ellipses having semimajor axis r beaming. After correcting for beaming, we estimate that the characteristic timescale of blazar variability is ~3 years in the rest frame of the jet, in contrast with the ~320 day disk flux timescale observed in quasars. The variability-based selection method presented will be useful for blazar identification in time-domain optical surveys and is also a probe of jet physics.

  3. A MODEL FOR (QUASI-)PERIODIC MULTIWAVELENGTH PHOTOMETRIC VARIABILITY IN YOUNG STELLAR OBJECTS

    Energy Technology Data Exchange (ETDEWEB)

    Kesseli, Aurora Y. [Boston University, 725 Commonwealth Ave, Boston, MA 02215 (United States); Petkova, Maya A.; Wood, Kenneth; Gregory, Scott G. [SUPA, School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, Fife, KY16 9AD (United Kingdom); Whitney, Barbara A. [Department of Astronomy, University of Wisconsin-Madison, 475 N. Charter St, Madison, WI 53706 (United States); Hillenbrand, L. A. [Astronomy Department, California Institute of Technology, Pasadena, CA 91125 (United States); Stauffer, J. R.; Morales-Calderon, M.; Rebull, L. [Spitzer Science Center, California Institute of Technology, CA 91125 (United States); Alencar, S. H. P., E-mail: aurorak@bu.com [Departamento de Física—ICEx—UFMG, Av. Antônio Carlos, 6627, 30270-901, Belo Horizonte, MG (Brazil)

    2016-09-01

    We present radiation transfer models of rotating young stellar objects (YSOs) with hot spots in their atmospheres, inner disk warps, and other three-dimensional effects in the nearby circumstellar environment. Our models are based on the geometry expected from magneto-accretion theory, where material moving inward in the disk flows along magnetic field lines to the star and creates stellar hot spots upon impact. Due to rotation of the star and magnetosphere, the disk is variably illuminated. We compare our model light curves to data from the Spitzer YSOVAR project to determine if these processes can explain the variability observed at optical and mid-infrared wavelengths in young stars. We focus on those variables exhibiting “dipper” behavior that may be periodic, quasi-periodic, or aperiodic. We find that the stellar hot-spot size and temperature affects the optical and near-infrared light curves, while the shape and vertical extent of the inner disk warp affects the mid-IR light curve variations. Clumpy disk distributions with non-uniform fractal density structure produce more stochastic light curves. We conclude that magneto-accretion theory is consistent with certain aspects of the multiwavelength photometric variability exhibited by low-mass YSOs. More detailed modeling of individual sources can be used to better determine the stellar hot-spot and inner disk geometries of particular sources.

  4. Optimized emission in nanorod arrays through quasi-aperiodic inverse design.

    Science.gov (United States)

    Anderson, P Duke; Povinelli, Michelle L

    2015-06-01

    We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.

  5. Computational Modeling of Bloch Surface Waves in One-Dimensional Periodic and Aperiodic Multilayer Structures

    Science.gov (United States)

    Koju, Vijay

    Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi

  6. Electrowetting Variable Optics for Visible and Infrared Applications

    Science.gov (United States)

    Watson, Alexander Maxwell

    Miniaturized variable optical devices are important for the fields of medical technology, optical communication, and consumer imaging devices. Areas ranging from endoscopy and optogenetics to atomic clocks and imaging all benefit from versatile optical systems. These applications all require precise and rapid control of imaging focal depth and lateral scanning. Electrowetting variable optics is one emergent technology that has the capability to provide focus tuning, beam steering, and even phase modulation in a small and robust package which requires no moving parts. Furthermore, electrowetting based devices there are attractive due to their transmissive nature, polarization insensitivity, low insertion loss, low electrical power requirements, and high optical quality. These features mean that electrowetting adaptive optical components are an attractive solution, compared with MEMS and liquid crystal optical components. Electrowetting is a technique that enables control of the shape of a liquid droplet with applied voltage. A conductive droplet on a dielectric surface alters its contact angle due to charges that build up between an underlying electrode and the surface of the droplet. This effect can be used to tune the curvature and tilt of liquids within cavities. The liquid boundary creates a high quality surface to use for lensing or steering applications. This thesis will focus on the development of electrowetting based lenses and prisms and applications in imaging for both visible and infrared wavelengths. Within this dissertation is the first demonstration of electrowetting lenses for phase control, as well as the investigation of non-aqueous electrowetting lens liquids for electrowetting lenses operation in the infrared. Key considerations that affect the performance and reliability are dielectric material and thickness, liquid selection and source of ionic conduction. The optical devices presented herein utilize judicious selection of dielectric material

  7. BLAZAR OPTICAL VARIABILITY IN THE PALOMAR-QUEST SURVEY

    International Nuclear Information System (INIS)

    Bauer, Anne; Baltay, Charles; Coppi, Paolo; Ellman, Nancy; Jerke, Jonathan; Rabinowitz, David; Scalzo, Richard

    2009-01-01

    We study the ensemble optical variability of 276 flat-spectrum radio quasars (FSRQs) and 86 BL Lacs in the Palomar-QUEST Survey with the goal of searching for common fluctuation properties, examining the range of behavior across the sample, and characterizing the appearance of blazars in such a survey so that future work can more easily identify such objects. The survey, which covers 15,000 deg 2 multiple times over 3.5 years, allows for the first ensemble blazar study of this scale. Variability amplitude distributions are shown for the FSRQ and BL Lac samples for numerous time lags, and also studied through structure function analyses. Individual blazars show a wide range of variability amplitudes, timescales, and duty cycles. Of the best-sampled objects, 35% are seen to vary by more than 0.4 mag; for these, the fraction of measurements contributing to the high-amplitude variability ranges constantly from about 5% to 80%. Blazar variability has some similarities to that of type I quasi-stellar objects (QSOs) but includes larger amplitude fluctuations on all timescales. FSRQ variability amplitudes are particularly similar to those of QSOs on timescales of several months, suggesting significant contributions from the accretion disk to the variable flux at these timescales. Optical variability amplitudes are correlated with the maximum apparent velocities of the radio jet for the subset of FSRQs with MOJAVE Very Long Baseline Array measurements, implying that the optically variable flux's strength is typically related to that of the radio emission. We also study CRATES radio-selected FSRQ candidates, which show similar variability characteristics to known FSRQs; this suggests a high purity for the CRATES sample.

  8. Dual-wavelength green laser with a 4.5 THz frequency difference based on self-frequency- doubling in Nd3+ -doped aperiodically poled lithium niobate.

    Science.gov (United States)

    Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J

    2008-05-01

    We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.

  9. Influences of Fundamental Frequency, Formant Frequencies, Aperiodicity, and Spectrum Level on the Perception of Voice Gender

    Science.gov (United States)

    Skuk, Verena G.; Schweinberger, Stefan R.

    2014-01-01

    Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…

  10. Radiation-disorder and aperiodicity in irradiated ceramics

    International Nuclear Information System (INIS)

    Hobbs, L.W.

    1992-01-01

    This final technical report documents the accomplishments of the program of research entitled ''Radiation Disorder and Aperiodicity in Irradiated Ceramics'' for the period June 22, 1989--June 21, 1992. This research forms the latest part on an on-going program, begun at MIT in 1983 under DOE support, which has had as its objectives investigation of the responses in radiation environments of ceramics heavily-irradiated with electrons, neutrons and ions, with potential applications to fusion energy technology and high-level nuclear waste storage. Materials investigated have included SiO 2 , MgAl 2 O 4 , Al 23 O 27 N 5 , SiC, BeO, LiAlO 2 , Li 2 ZrO 3 , CaTiO 3 KTaO 3 and Ca(Zr, Pu)Ti 2 O 7 . The program initially proposed for 1989 had as its major objectives two main thrusts: (1) research on defect aggregation in irradiated non-oxide ceramics, and (2) research on irradiation-induced amorphization of network silicas and phosphates

  11. Development of variable-magnification X-ray Bragg optics.

    Science.gov (United States)

    Hirano, Keiichi; Yamashita, Yoshiki; Takahashi, Yumiko; Sugiyama, Hiroshi

    2015-07-01

    A novel X-ray Bragg optics is proposed for variable-magnification of an X-ray beam. This X-ray Bragg optics is composed of two magnifiers in a crossed arrangement, and the magnification factor, M, is controlled through the azimuth angle of each magnifier. The basic properties of the X-ray optics such as the magnification factor, image transformation matrix and intrinsic acceptance angle are described based on the dynamical theory of X-ray diffraction. The feasibility of the variable-magnification X-ray Bragg optics was verified at the vertical-wiggler beamline BL-14B of the Photon Factory. For X-ray Bragg magnifiers, Si(220) crystals with an asymmetric angle of 14° were used. The magnification factor was calculated to be tunable between 0.1 and 10.0 at a wavelength of 0.112 nm. At various magnification factors (M ≥ 1.0), X-ray images of a nylon mesh were observed with an air-cooled X-ray CCD camera. Image deformation caused by the optics could be corrected by using a 2 × 2 transformation matrix and bilinear interpolation method. Not only absorption-contrast but also edge-contrast due to Fresnel diffraction was observed in the magnified images.

  12. Analysis of blocking probability for OFDM-based variable bandwidth optical network

    Science.gov (United States)

    Gong, Lei; Zhang, Jie; Zhao, Yongli; Lin, Xuefeng; Wu, Yuyao; Gu, Wanyi

    2011-12-01

    Orthogonal Frequency Division Multiplexing (OFDM) has recently been proposed as a modulation technique. For optical networks, because of its good spectral efficiency, flexibility, and tolerance to impairments, optical OFDM is much more flexible compared to traditional WDM systems, enabling elastic bandwidth transmissions, and optical networking is the future trend of development. In OFDM-based optical network the research of blocking rate has very important significance for network assessment. Current research for WDM network is basically based on a fixed bandwidth, in order to accommodate the future business and the fast-changing development of optical network, our study is based on variable bandwidth OFDM-based optical networks. We apply the mathematical analysis and theoretical derivation, based on the existing theory and algorithms, research blocking probability of the variable bandwidth of optical network, and then we will build a model for blocking probability.

  13. Theoretical and experimental study of bent fully aperiodic large-pitch fibers for enhancing the high-order modes delocalization

    Science.gov (United States)

    du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe

    2018-02-01

    The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.

  14. Continuous variable multipartite entanglement and optical implementations of quantum communication networks

    International Nuclear Information System (INIS)

    Lian Yimin; Xie Changde; Peng Kunchi

    2007-01-01

    A variety of optical quantum information networks based on the multipartite entanglement of amplitude and phase quadratures of an electromagnetic field have been proposed and experimentally realized in recent years. The multipartite entanglement of optical continuous variables provides flexible and reliable quantum resources for developing unconditional quantum information networks. In this paper, we review the generation schemes of the multipartite entangled states of optical continuous quantum variables and some applications in the quantum communication networks with emphasis on the experimental implementations

  15. Linking optical and infrared observations with gravitational wave sources through transient variability

    International Nuclear Information System (INIS)

    Stubbs, C W

    2008-01-01

    Optical and infrared observations have thus far detected more celestial cataclysms than have been seen in gravity waves (GW). This argues that we should search for gravity wave signatures that correspond to transient variables seen at optical wavelengths, at precisely known positions. There is an unknown time delay between the optical and gravitational transient, but knowing the source location precisely specifies the corresponding time delays across the gravitational antenna network as a function of the GW-to-optical arrival time difference. Optical searches should detect virtually all supernovae that are plausible gravitational radiation sources. The transient optical signature expected from merging compact objects is not as well understood, but there are good reasons to expect detectable transient optical/IR emission from most of these sources as well. The next generation of deep wide-field surveys (for example PanSTARRS and LSST) will be sensitive to subtle optical variability, but we need to fill the 'blind spots' that exist in the galactic plane, and for optically bright transient sources. In particular, a galactic plane variability survey at λ∼ 2 μm seems worthwhile. Science would benefit from closer coordination between the various optical survey projects and the gravity wave community

  16. PRECISION PHOTOMETRIC MONITORING OF VERY LOW MASS σ ORIONIS CLUSTER MEMBERS: VARIABILITY AND ROTATION AT A FEW Myr

    International Nuclear Information System (INIS)

    Cody, Ann Marie; Hillenbrand, Lynne A.

    2010-01-01

    We present high-precision photometry on 107 variable low-mass stars and brown dwarfs in the ∼3 Myr σ Orionis open cluster. We have carried out I-band photometric monitoring within two fields, encompassing 153 confirmed or candidate members of the low-mass cluster population, from 0.02 to 0.5 M sun . We are sensitive to brightness changes on timescales from 10 minutes to two weeks with amplitudes as low as 0.004 mag, and find variability on these timescales in nearly 70% of cluster members. We identify both periodic and aperiodic modes of variability, as well as semi-periodic rapid fading events that are not accounted for by the standard explanations of rotational modulation of surface features or accretion. We have incorporated both optical and infrared color data to uncover trends in variability with mass and circumstellar disks. While the data confirm that the lowest-mass objects (M sun ) rotate more rapidly than the 0.2-0.5 M sun members, they do not support a direct connection between rotation rate and the presence of a disk. Finally, we speculate on the origin of irregular variability in cluster members with no evidence for disks or accretion.

  17. Visuo-manual tracking: does intermittent control with aperiodic sampling explain linear power and non-linear remnant without sensorimotor noise?

    Science.gov (United States)

    Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D

    2017-11-01

    A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed

  18. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  19. Multi-Band Intra-Night Optical Variability of BL Lacertae

    Directory of Open Access Journals (Sweden)

    Haritma Gaur

    2017-12-01

    Full Text Available We monitored BL Lacertae frequently during 2014–2016 when it was generally in a high state. We searched for intra-day variability for 43 nights using quasi-simultaneous measurements in the B, V, R, and I bands (totaling 143 light curves; the typical sampling interval was about eight minutes. On hour-like timescales, BL Lac exhibited significant variations during 13 nights in various optical bands. Significant spectral variations are seen during most of these nights such that the optical spectrum becomes bluer when brighter. The amplitude of variability is usually greater for longer observations but is lower when BL Lac is brighter. No evidence for periodicities or characteristic variability time-scales in the light curves was found. The color variations are mildly chromatic on long timescales.

  20. Variable-coefficient higher-order nonlinear Schroedinger model in optical fibers: Variable-coefficient bilinear form, Baecklund transformation, brightons and symbolic computation

    International Nuclear Information System (INIS)

    Tian Bo; Gao Yitian; Zhu Hongwu

    2007-01-01

    Symbolically investigated in this Letter is a variable-coefficient higher-order nonlinear Schroedinger (vcHNLS) model for ultrafast signal-routing, fiber laser systems and optical communication systems with distributed dispersion and nonlinearity management. Of physical and optical interests, with bilinear method extend, the vcHNLS model is transformed into a variable-coefficient bilinear form, and then an auto-Baecklund transformation is constructed. Constraints on coefficient functions are analyzed. Potentially observable with future optical-fiber experiments, variable-coefficient brightons are illustrated. Relevant properties and features are discussed as well. Baecklund transformation and other results of this Letter will be of certain value to the studies on inhomogeneous fiber media, core of dispersion-managed brightons, fiber amplifiers, laser systems and optical communication links with distributed dispersion and nonlinearity management

  1. Variability of Optical Properties within the Littoral Environment

    National Research Council Canada - National Science Library

    Zaneveld, Ronald

    1997-01-01

    The goals of the proposed research are to: (1) determine the regions within the water column that have the highest variability in optical and hydrographic parameters as a function of total water depth, (2...

  2. VARIABILITY OF OPTICAL COUNTERPARTS IN THE CHANDRA GALACTIC BULGE SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Britt, C. T.; Hynes, R. I.; Johnson, C. B.; Baldwin, A.; Collazzi, A.; Gossen, L. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803-4001 (United States); Jonker, P. G.; Torres, M. A. P. [SRON, Netherlands Institute for Space Research, Sorbonnelaan 2, 3584 CA Utrecht (Netherlands); Nelemans, G. [Department of Astrophysics, IMAPP, Radboud University Nijmegen, Heyendaalseweg 135, 6525 AJ, Nijmegen (Netherlands); Maccarone, T. [Department of Physics, Texas Tech University, Box 41051, Science Building, Lubbock, TX 79409-1051 (United States); Steeghs, D.; Greiss, S. [Astronomy and Astrophysics, Department of Physics, University of Warwick, Coventry, CV4 7AL (United Kingdom); Heinke, C. [Department of Physics, University of Alberta, CCIS 4-183, Edmonton, AB T6G 2E1 (Canada); Bassa, C. G. [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, University of Manchester, Manchester M13 9PL (United Kingdom); Villar, A. [Department of Physics, Massachussettes Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139-4307 (United States); Gabb, M. [Department of Physics, Florida Atlantic University, 777 Glades Road, Boca Raton, FL 33431-0991 (United States)

    2014-09-01

    We present optical light curves of variable stars consistent with the positions of X-ray sources identified with the Chandra X-ray Observatory for the Chandra Galactic Bulge Survey (GBS). Using data from the Mosaic-II instrument on the Blanco 4 m Telescope at CTIO, we gathered time-resolved photometric data on timescales from ∼2 hr to 8 days over the 3/4 of the X-ray survey containing sources from the initial GBS catalog. Among the light curve morphologies we identify are flickering in interacting binaries, eclipsing sources, dwarf nova outbursts, ellipsoidal variations, long period variables, spotted stars, and flare stars. Eighty-seven percent of X-ray sources have at least one potential optical counterpart. Twenty-seven percent of these candidate counterparts are detectably variable; a much greater fraction than expected for randomly selected field stars, which suggests that most of these variables are real counterparts. We discuss individual sources of interest, provide variability information on candidate counterparts, and discuss the characteristics of the variable population.

  3. The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles

    Science.gov (United States)

    Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.

    2017-12-01

    The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness

  4. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    Science.gov (United States)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  5. Correlated radio and optical variability in the BL Lacertae object 0716 + 714

    International Nuclear Information System (INIS)

    Quirrenbach, A.; Witzel, A.; Krichbaum, T.P.; Wagner, S.; Sanchez-pons, F.

    1991-01-01

    Results are presented from simultaneous optical and radio observations of the BL Lacertae object 0716 + 714. During a 4-week period of continuous monitoring the source displayed in both wavelength regimes a transition between states of fast and slow variability with a change of the typical variability time scale from about 1 day to about 7 days. The simultaneous transition is interpreted as evidence for intrinsic source variability, and some consequences for the optical and radio emission regions are discussed. 19 refs

  6. Optical Variability of Narrow-line and Broad-line Seyfert 1 Galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Rakshit, Suvendu; Stalin, C. S., E-mail: suvenduat@gmail.com [Indian Institute of Astrophysics, Block II, Koramangala, Bangalore-560034 (India)

    2017-06-20

    We studied the optical variability (OV) of a large sample of narrow-line Seyfert 1 (NLSy1) and broad-line Seyfert 1 (BLSy1) galaxies with z < 0.8 to investigate any differences in their OV properties. Using archival optical V -band light curves from the Catalina Real Time Transient Survey that span 5–9 years and modeling them using damped random walk, we estimated the amplitude of variability. We found that NLSy1 galaxies as a class show lower amplitude of variability than their broad-line counterparts. In the sample of both NLSy1 and BLSy1 galaxies, radio-loud sources are found to have higher variability amplitude than radio-quiet sources. Considering only sources that are detected in the X-ray band, NLSy1 galaxies are less optically variable than BLSy1 galaxies. The amplitude of variability in the sample of both NLSy1 and BLSy1 galaxies is found to be anti-correlated with Fe ii strength but correlated with the width of the H β line. The well-known anti-correlation of variability–luminosity and the variability–Eddington ratio is present in our data. Among the radio-loud sample, variability amplitude is found to be correlated with radio-loudness and radio-power, suggesting that jets also play an important role in the OV in radio-loud objects, in addition to the Eddington ratio, which is the main driving factor of OV in radio-quiet sources.

  7. Variable optical attenuator fabricated by direct UV writing

    DEFF Research Database (Denmark)

    Svalgaard, Mikael; Færch, Kjartan Ullitz; Andersen, L.U.

    2003-01-01

    It is demonstrated that direct ultraviolet writing of waveguides is a method suitable for mass production of compact variable optical attenuators with low insertion loss, low polarization-dependent loss, and high dynamic range. The fabrication setup is shown to be robust, providing good device...

  8. Real-time remedial action against aperiodic small signal rotor angle instability

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    This paper presents a method that in real-time determines remedial actions, which restore stable operation with respect to aperiodic small signal rotor angle stability (ASSRAS) when insecure or unstable operation has been detected. An ASSRAS assessment method is used to monitor the stability...... impedance plane to determine an active power redispatch among selected generators to restore stable and secure operation. Since the method is purely based on analytically derived expression, the computation of the remedial actions is fast and well suited for real-time operation. The method was tested...... boundary for each generator in real-time. The ASSRAS boundary represents the condition when a generator reaches the maximum steady state active power injection. The proposed control method exploits analytically derived expressions for the ASSRAS boundary and other characteristic curves in the injection...

  9. Development and application of variable-magnification x-ray Bragg optics

    Energy Technology Data Exchange (ETDEWEB)

    Hirano, Keiichi, E-mail: keiichi.hirano@kek.jp; Takahashi, Yumiko; Sugiyama, Hiroshi [Institute of Materials Structure Science, High Energy Accelerator Research Organization, Tsukuba, Ibaraki 305-0801 (Japan); Yamashita, Yoshiki [RIKEN SPring-8 Center, Sayo-gun, Hyogo 679-5148 (Japan)

    2016-07-27

    A novel x-ray Bragg optics was developed for variable-magnification of an x-ray beam, and was combined with a module of the PILATUS pixel detector. A feasibility test of this optical system was carried out at the vertical-wiggler beamline BL-14B of the Photon Factory. By tuning the magnification factor, we could successfully control the spatial resolution of the optical system between 28 μm and 280 μm. X-ray absorption-contrast images of a leaf were observed at various magnification factors.

  10. DISCOVERING THE MISSING 2.2 < z < 3 QUASARS BY COMBINING OPTICAL VARIABILITY AND OPTICAL/NEAR-INFRARED COLORS

    International Nuclear Information System (INIS)

    Wu Xuebing; Wang Ran; Bian Fuyan; Jiang Linhua; Fan Xiaohui; Schmidt, Kasper B.

    2011-01-01

    The identification of quasars in the redshift range 2.2 < z < 3 is known to be very inefficient because the optical colors of such quasars are indistinguishable from those of stars. Recent studies have proposed using optical variability or near-infrared (near-IR) colors to improve the identification of the missing quasars in this redshift range. Here we present a case study combining both methods. We select a sample of 70 quasar candidates from variables in Sloan Digital Sky Survey (SDSS) Stripe 82, which are non-ultraviolet excess sources and have UKIDSS near-IR public data. They are clearly separated into two parts on the Y - K/g - z color-color diagram, and 59 of them meet or lie close to a newly proposed Y - K/g - z selection criterion for z < 4 quasars. Of these 59 sources, 44 were previously identified as quasars in SDSS DR7, and 35 of them are quasars at 2.2 < z < 3. We present spectroscopic observations of 14 of 15 remaining quasar candidates using the Bok 2.3 m telescope and the MMT 6.5 m telescope, and successfully identify all of them as new quasars at z = 2.36-2.88. We also apply this method to a sample of 643 variable quasar candidates with SDSS-UKIDSS nine-band photometric data selected from 1875 new quasar candidates in SDSS Stripe 82 given by Butler and Bloom based on the time-series selections, and find that 188 of them are probably new quasars with photometric redshifts at 2.2 < z < 3. Our results indicate that the combination of optical variability and optical/near-IR colors is probably the most efficient way to find 2.2 < z < 3 quasars and is very helpful for constructing a complete quasar sample. We discuss its implications for ongoing and upcoming large optical and near-IR sky surveys.

  11. OPTICAL POLARIZATION AND SPECTRAL VARIABILITY IN THE M87 JET

    International Nuclear Information System (INIS)

    Perlman, Eric S.; Cara, Mihai; Bourque, Matthew; Simons, Raymond C.; Adams, Steven C.; Harris, D. E.; Madrid, Juan P.; Clausen-Brown, Eric; Cheung, C. C.; Stawarz, Lukasz; Georganopoulos, Markos; Sparks, William B.; Biretta, John A.

    2011-01-01

    During the last decade, M87's jet has been the site of an extraordinary variability event, with one knot (HST-1) increasing by over a factor 100 in brightness. Variability has also been seen on timescales of months in the nuclear flux. Here we discuss the optical-UV polarization and spectral variability of these components, which show vastly different behavior. HST-1 shows a highly significant correlation between flux and polarization, with P increasing from ∼20% at minimum to >40% at maximum, while the orientation of its electric vector stayed constant. HST-1's optical-UV spectrum is very hard (α UV-O ∼ 0.5, F ν ∝ν –α ), and displays 'hard lags' during epochs 2004.9-2005.5, including the peak of the flare, with soft lags at later epochs. We interpret the behavior of HST-1 as enhanced particle acceleration in a shock, with cooling from both particle aging and the relaxation of the compression. We set 2σ upper limits of 0.5δ pc and 1.02c on the size and advance speed of the flaring region. The slight deviation of the electric vector orientation from the jet position angle (P.A.) makes it likely that on smaller scales the flaring region has either a double or twisted structure. By contrast, the nucleus displays much more rapid variability, with a highly variable electric vector orientation and 'looping' in the (I, P) plane. The nucleus has a much steeper spectrum (α UV-O ∼ 1.5) but does not show UV-optical spectral variability. Its behavior can be interpreted as either a helical distortion to a steady jet or a shock propagating through a helical jet.

  12. OPTICAL POLARIZATION AND SPECTRAL VARIABILITY IN THE M87 JET

    Energy Technology Data Exchange (ETDEWEB)

    Perlman, Eric S.; Cara, Mihai; Bourque, Matthew; Simons, Raymond C. [Department of Physics and Space Sciences, 150 W. University Blvd., Florida Institute of Technology, Melbourne, FL 32901 (United States); Adams, Steven C. [Department of Physics and Astronomy, University of Georgia, Athens, GA 30605 (United States); Harris, D. E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Madrid, Juan P. [Center for Astrophysics and Supercomputing, Swinburne University of Technology, Hawthorn, VIC 3122 (Australia); Clausen-Brown, Eric [Department of Physics, Purdue University, West Lafayette, IN 47907 (United States); Cheung, C. C. [National Academy of Sciences, Washington, DC 20001 (United States); Stawarz, Lukasz [Institute of Space and Astronautical Science, JAXA, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Georganopoulos, Markos [Department of Physics, University of Maryland-Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 (United States); Sparks, William B.; Biretta, John A., E-mail: eperlman@fit.edu [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2011-12-20

    During the last decade, M87's jet has been the site of an extraordinary variability event, with one knot (HST-1) increasing by over a factor 100 in brightness. Variability has also been seen on timescales of months in the nuclear flux. Here we discuss the optical-UV polarization and spectral variability of these components, which show vastly different behavior. HST-1 shows a highly significant correlation between flux and polarization, with P increasing from {approx}20% at minimum to >40% at maximum, while the orientation of its electric vector stayed constant. HST-1's optical-UV spectrum is very hard ({alpha}{sub UV-O} {approx} 0.5, F{sub {nu}}{proportional_to}{nu}{sup -{alpha}}), and displays 'hard lags' during epochs 2004.9-2005.5, including the peak of the flare, with soft lags at later epochs. We interpret the behavior of HST-1 as enhanced particle acceleration in a shock, with cooling from both particle aging and the relaxation of the compression. We set 2{sigma} upper limits of 0.5{delta} pc and 1.02c on the size and advance speed of the flaring region. The slight deviation of the electric vector orientation from the jet position angle (P.A.) makes it likely that on smaller scales the flaring region has either a double or twisted structure. By contrast, the nucleus displays much more rapid variability, with a highly variable electric vector orientation and 'looping' in the (I, P) plane. The nucleus has a much steeper spectrum ({alpha}{sub UV-O} {approx} 1.5) but does not show UV-optical spectral variability. Its behavior can be interpreted as either a helical distortion to a steady jet or a shock propagating through a helical jet.

  13. Clinical variability in hereditary optic neuropathies: Two novel mutations in two patients with dominant optic atrophy and Wolfram syndrome.

    Science.gov (United States)

    Galvez-Ruiz, Alberto

    2015-01-01

    Dominant optic atrophy (DOA) and Wolfram syndrome share a great deal of clinical variability, including an association with hearing loss and the presence of optic atrophy at similar ages. The objective of this paper was to discuss the phenotypic variability of these syndromes with respect to the presentation of two clinical cases. We present two patients, each with either DOA or Wolfram syndrome, and contribute to the research literature through our findings of two novel mutations. The overlapping of several clinical characteristics in hereditary optic neuropathies can complicate the differential diagnosis. Future studies are needed to better determine the genotype-phenotype correlation for these diseases.

  14. Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene

    Science.gov (United States)

    Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel

    2016-01-01

    We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.

  15. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    Science.gov (United States)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  16. Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number

    Science.gov (United States)

    Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.

    2017-09-01

    Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.

  17. Wave propagation in one-dimensional solid-fluid quasi-periodic and aperiodic phononic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Chen Ali, E-mail: alchen@bjtu.edu.cn [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Wang Yuesheng [Institute of Engineering Mechanics, Beijing Jiaotong University, Beijing 100044 (China); Zhang Chuanzeng [Department of Civil Engineering, University of Siegen, D-57068 Siegen (Germany)

    2012-02-01

    The propagation of the elastic waves in one-dimensional (1D) solid-fluid quasi-periodic phononic crystals is studied by employing the concept of the localization factor, which is calculated by the transfer matrix method. The solid-fluid interaction effect at the interfaces between the solid and the fluid components is considered. For comparison, the periodic systems and aperiodic Thue-Morse sequence are also analyzed in this paper. The splitting phenomenon of the pass bands and bandgaps are discussed for these 1D solid-fluid systems. At last the influences of the material impedance ratios on the band structures of the 1D solid-fluid quasi-periodic phononic crystals arranged as Fibonacci sequence are discussed.

  18. Universal continuous-variable quantum computation: Requirement of optical nonlinearity for photon counting

    International Nuclear Information System (INIS)

    Bartlett, Stephen D.; Sanders, Barry C.

    2002-01-01

    Although universal continuous-variable quantum computation cannot be achieved via linear optics (including squeezing), homodyne detection, and feed-forward, inclusion of ideal photon-counting measurements overcomes this obstacle. These measurements are sometimes described by arrays of beam splitters to distribute the photons across several modes. We show that such a scheme cannot be used to implement ideal photon counting and that such measurements necessarily involve nonlinear evolution. However, this requirement of nonlinearity can be moved ''off-line,'' thereby permitting universal continuous-variable quantum computation with linear optics

  19. Design of variable-weight quadratic congruence code for optical CDMA

    Science.gov (United States)

    Feng, Gang; Cheng, Wen-Qing; Chen, Fu-Jun

    2015-09-01

    A variable-weight code family referred to as variable-weight quadratic congruence code (VWQCC) is constructed by algebraic transformation for incoherent synchronous optical code division multiple access (OCDMA) systems. Compared with quadratic congruence code (QCC), VWQCC doubles the code cardinality and provides the multiple code-sets with variable code-weight. Moreover, the bit-error rate (BER) performance of VWQCC is superior to those of conventional variable-weight codes by removing or padding pulses under the same chip power assumption. The experiment results show that VWQCC can be well applied to the OCDMA with quality of service (QoS) requirements.

  20. Achieving sub-50 nm controlled diameter of aperiodic Si nanowire arrays by ultrasonic catalyst removal for photonic applications

    Science.gov (United States)

    Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit

    2018-05-01

    We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.

  1. Phase-only SLM Generating Variable Patterns Applied in Optical Connection

    International Nuclear Information System (INIS)

    Liu, B H; Wu, L Y; Zhang, J

    2006-01-01

    An adaptive optical communication system is proposed. The system sends spatial information by emitting multiple variable laser beams generated from a programmable diffractive optical element (DOE): phase-only liquid crystal Spatial Light Modulator (SLM). Laser beams carrying signals are programmable by an optimal algorithm based on an iterative Fourier transformation algorithm. The system has the advantage in redundancy of signal by the means of broadcast. It can adaptively seek position and transmit information in parallel

  2. Longterm and spatial variability of Aerosol optical properties measured by sky radiometer in Japan sites

    Science.gov (United States)

    Aoki, K.

    2016-12-01

    Aerosols and cloud play an important role in the climate change. We started the long-term monitoring of aerosol and cloud optical properties since 1990's by using sky radiometer (POM-01, 02; Prede Co. Ltd., Japan). We provide the information, in this presentation, on the aerosol optical properties with respect to their temporal and spatial variability in Japan site (ex. Sapporo, Toyama, Kasuga and etc). The global distributions of aerosols have been derived from earth observation satellite and have been simulated in numerical models, which assume optical parameters. However, these distributions are difficult to derive because of variability in time and space. Therefore, Aerosol optical properties were investigated using the measurements from ground-based and ship-borne sky radiometer. The sky radiometer is an automatic instrument that takes observations only in daytime under the clear sky conditions. Observation of diffuse solar intensity interval was made every ten or five minutes by once. The aerosol optical properties were computed using the SKYRAD.pack version 4.2. The obtained Aerosol optical properties (Aerosol optical thickness, Ångström exponent, Single scattering albedo, and etc.) and size distribution volume clearly showed spatial and temporal variability in Japan area. In this study, we present the temporal and spatial variability of Aerosol optical properties at several Japan sites, applied to validation of satellite and numerical models. This project is validation satellite of GCOM-C, JAXA. The GCOM-C satellite scheduled to be launched in early 2017.

  3. On the algebraic characterization of aperiodic tilings related to ADE-root systems

    International Nuclear Information System (INIS)

    Kellendonk, J.

    1992-09-01

    The algebraic characterization of sets of locally equivalent aperiodic tilings, being examples of quantum spaces, is conducted for a certain type of tilings in a manner proposed by A. Connes. These 2-dimensional tilings are obtained by application of the strip method to the root lattice of an ADE-Coxeter group. The plane along which the strip is constructed is determined by the canonical Coxeter element leading to the result that a 2- dimensional tiling decomposes into a cartesian product of two 1- dimensional tilings. The properties of the tilings are investigated, including selfsimilarity, and the determination of the relevant algebraic is considered, namely the ordered K 0 -group of an algebra naturaly assigned to the quantum space. The result also yields an application of the 2-dimensional abstract gap labelling theorem. (orig.)

  4. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  5. Scalable Active Optical Access Network Using Variable High-Speed PLZT Optical Switch/Splitter

    Science.gov (United States)

    Ashizawa, Kunitaka; Sato, Takehiro; Tokuhashi, Kazumasa; Ishii, Daisuke; Okamoto, Satoru; Yamanaka, Naoaki; Oki, Eiji

    This paper proposes a scalable active optical access network using high-speed Plumbum Lanthanum Zirconate Titanate (PLZT) optical switch/splitter. The Active Optical Network, called ActiON, using PLZT switching technology has been presented to increase the number of subscribers and the maximum transmission distance, compared to the Passive Optical Network (PON). ActiON supports the multicast slot allocation realized by running the PLZT switch elements in the splitter mode, which forces the switch to behave as an optical splitter. However, the previous ActiON creates a tradeoff between the network scalability and the power loss experienced by the optical signal to each user. It does not use the optical power efficiently because the optical power is simply divided into 0.5 to 0.5 without considering transmission distance from OLT to each ONU. The proposed network adopts PLZT switch elements in the variable splitter mode, which controls the split ratio of the optical power considering the transmission distance from OLT to each ONU, in addition to PLZT switch elements in existing two modes, the switching mode and the splitter mode. The proposed network introduces the flexible multicast slot allocation according to the transmission distance from OLT to each user and the number of required users using three modes, while keeping the advantages of ActiON, which are to support scalable and secure access services. Numerical results show that the proposed network dramatically reduces the required number of slots and supports high bandwidth efficiency services and extends the coverage of access network, compared to the previous ActiON, and the required computation time for selecting multicast users is less than 30msec, which is acceptable for on-demand broadcast services.

  6. Nonlinear polarization effects in a birefringent single mode optical fiber

    International Nuclear Information System (INIS)

    Ishiekwene, G.C.; Mensah, S.Y.; Brown, C.S.

    2001-04-01

    The nonlinear polarization effects in a birefringent single mode optical fiber is studied using Jacobi elliptic functions. We find that the polarization state of the propagating beam depends on the initial polarization as well as the intensity of the input light in a complicated way. The Stokes polarization parameters are either periodic or aperiodic depending on the value of the Jacobian modulus. Our calculations suggest that the effective beat length of the fiber can become infinite at a higher critical value of the input power when polarization dependent losses are considered. (author)

  7. A liquid lens switching-based motionless variable fiber-optic delay line

    Science.gov (United States)

    Khwaja, Tariq Shamim; Reza, Syed Azer; Sheikh, Mumtaz

    2018-05-01

    We present a Variable Fiber-Optic Delay Line (VFODL) module capable of imparting long variable delays by switching an input optical/RF signal between Single Mode Fiber (SMF) patch cords of different lengths through a pair of Electronically Controlled Tunable Lenses (ECTLs) resulting in a polarization-independent operation. Depending on intended application, the lengths of the SMFs can be chosen accordingly to achieve the desired VFODL operation dynamic range. If so desired, the state of the input signal polarization can be preserved with the use of commercially available polarization-independent ECTLs along with polarization-maintaining SMFs (PM-SMFs), resulting in an output polarization that is identical to the input. An ECTL-based design also improves power consumption and repeatability. The delay switching mechanism is electronically-controlled, involves no bulk moving parts, and can be fully-automated. The VFODL module is compact due to the use of small optical components and SMFs that can be packaged compactly.

  8. The WFCAM multiwavelength Variable Star Catalog

    Science.gov (United States)

    Ferreira Lopes, C. E.; Dékány, I.; Catelan, M.; Cross, N. J. G.; Angeloni, R.; Leão, I. C.; De Medeiros, J. R.

    2015-01-01

    Context. Stellar variability in the near-infrared (NIR) remains largely unexplored. The exploitation of public science archives with data-mining methods offers a perspective for a time-domain exploration of the NIR sky. Aims: We perform a comprehensive search for stellar variability using the optical-NIR multiband photometric data in the public Calibration Database of the WFCAM Science Archive (WSA), with the aim of contributing to the general census of variable stars and of extending the current scarce inventory of accurate NIR light curves for a number of variable star classes. Methods: Standard data-mining methods were applied to extract and fine-tune time-series data from the WSA. We introduced new variability indices designed for multiband data with correlated sampling, and applied them for preselecting variable star candidates, i.e., light curves that are dominated by correlated variations, from noise-dominated ones. Preselection criteria were established by robust numerical tests for evaluating the response of variability indices to the colored noise characteristic of the data. We performed a period search using the string-length minimization method on an initial catalog of 6551 variable star candidates preselected by variability indices. Further frequency analysis was performed on positive candidates using three additional methods in combination, in order to cope with aliasing. Results: We find 275 periodic variable stars and an additional 44 objects with suspected variability with uncertain periods or apparently aperiodic variation. Only 44 of these objects had been previously known, including 11 RR Lyrae stars on the outskirts of the globular cluster M 3 (NGC 5272). We provide a preliminary classification of the new variable stars that have well-measured light curves, but the variability types of a large number of objects remain ambiguous. We classify most of the new variables as contact binary stars, but we also find several pulsating stars, among which

  9. Searching for intermediate-mass black holes via optical variability

    Science.gov (United States)

    Adler-Levine, Ryan; Moran, Edward C.; Kay, Laura

    2018-01-01

    A handful of nearby dwarf galaxies with intermediate-mass black holes (IMBHs) in their nuclei display significant optical variability on short timescales. To investigate whether dwarf galaxy AGNs as a class exhibit similar variability, we have monitored a sample of low-mass galaxies that possess spectroscopically confirmed type 1 AGNs. However, because of the variations in seeing, focus, and guiding errors that occur in images taken at different epochs, analyses based on aperture photometry are ineffective. We have thus developed a new method for matching point-spread functions in images that permits use of image subtraction photometry techniques. Applying this method to our photometric data, we have confirmed that several galaxies with IMBHs are indeed variable, which suggests that variability can be used to search for IMBHs in low-mass galaxies whose emission-line properties are ambiguous.

  10. Searching for faint AGN in the CDFS: an X-ray (Chandra) vs optical variability (HST) comparison.

    Science.gov (United States)

    Georgantopoulos, I.; Pouliasis, E.; Bonanos, A.; Sokolovsky, K.; Yang, M.; Hatzidimitriou, D.; Bellas, I.; Gavras, P.; Spetsieri, Z.

    2017-10-01

    X-ray surveys are believed to be the most efficient way to detect AGN. Recently though, optical variability studies are claimed to probe even fainter AGN. We are presenting results from an HST study aimed to identify Active Galactic Nuclei (AGN) through optical variability selection in the CDFS.. This work is part of the 'Hubble Catalogue of Variables'project of ESA that aims to identify variable sources in the Hubble Source Catalogue.' In particular, we used Hubble Space Telescope (HST) z-band images taken over 5 epochs and performed aperture photometry to derive the lightcurves of the sources. Two statistical methods (standard deviation & interquartile range) resulting in a final sample of 175 variable AGN candidates, having removed the artifacts by visual inspection and known stars and supernovae. The fact that the majority of the sources are extended and variable indicates AGN activity. We compare the efficiency of the method by comparing with the 7Ms Chandra detections. Our work shows that the optical variability probes AGN at comparable redshifts but at deeper optical magnitudes. Our candidate AGN (non detected in X-rays) have luminosities of L_x<6×10^{40} erg/sec at z˜0.7 suggesting that these are associated with low luminosity Seyferts and LINERS.

  11. Variable-length code construction for incoherent optical CDMA systems

    Science.gov (United States)

    Lin, Jen-Yung; Jhou, Jhih-Syue; Wen, Jyh-Horng

    2007-04-01

    The purpose of this study is to investigate the multirate transmission in fiber-optic code-division multiple-access (CDMA) networks. In this article, we propose a variable-length code construction for any existing optical orthogonal code to implement a multirate optical CDMA system (called as the multirate code system). For comparison, a multirate system where the lower-rate user sends each symbol twice is implemented and is called as the repeat code system. The repetition as an error-detection code in an ARQ scheme in the repeat code system is also investigated. Moreover, a parallel approach for the optical CDMA systems, which is proposed by Marić et al., is also compared with other systems proposed in this study. Theoretical analysis shows that the bit error probability of the proposed multirate code system is smaller than other systems, especially when the number of lower-rate users is large. Moreover, if there is at least one lower-rate user in the system, the multirate code system accommodates more users than other systems when the error probability of system is set below 10 -9.

  12. Diffractive optical variable image devices generated by maskless interferometric lithography for optical security

    Science.gov (United States)

    Cabral, Alexandre; Rebordão, José M.

    2011-05-01

    In optical security (protection against forgery and counterfeit of products and documents) the problem is not exact reproduction but the production of something sufficiently similar to the original. Currently, Diffractive Optically Variable Image Devices (DOVID), that create dynamic chromatic effects which may be easily recognized but are difficult to reproduce, are often used to protect important products and documents. Well known examples of DOVID for security are 3D or 2D/3D holograms in identity documents and credit cards. Others are composed of shapes with different types of microstructures yielding by diffraction to chromatic dynamic effects. A maskless interferometric lithography technique to generate DOVIDs for optical security is presented and compared to traditional techniques. The approach can be considered as a self-masking focused holography on planes tilted with respect to the reference optical axes of the system, and is based on the Scheimpflug and Hinge rules. No physical masks are needed to ensure optimum exposure of the photosensitive film. The system built to demonstrate the technique relies on the digital mirrors device MOEMS technology from Texas Instruments' Digital Light Processing. The technique is linear on the number of specified colors and does not depend either on the area of the device or the number of pixels, factors that drive the complexity of dot-matrix based systems. The results confirmed the technique innovation and capabilities in the creation of diffractive optical elements for security against counterfeiting and forgery.

  13. Continuous-variable quantum cloning of coherent states with phase-conjugate input modes using linear optics

    International Nuclear Information System (INIS)

    Chen, Haixia; Zhang, Jing

    2007-01-01

    We propose a scheme for continuous-variable quantum cloning of coherent states with phase-conjugate input modes using linear optics. The quantum cloning machine yields M identical optimal clones from N replicas of a coherent state and N replicas of its phase conjugate. This scheme can be straightforwardly implemented with the setups accessible at present since its optical implementation only employs simple linear optical elements and homodyne detection. Compared with the original scheme for continuous-variable quantum cloning with phase-conjugate input modes proposed by Cerf and Iblisdir [Phys. Rev. Lett. 87, 247903 (2001)], which utilized a nondegenerate optical parametric amplifier, our scheme loses the output of phase-conjugate clones and is regarded as irreversible quantum cloning

  14. MASTER OPTICAL POLARIZATION VARIABILITY DETECTION IN THE MICROQUASAR V404 CYG/GS 2023+33

    Energy Technology Data Exchange (ETDEWEB)

    Lipunov, Vladimir M.; Kornilov, V.; Vlasenko, D. [M.V. Lomonosov Moscow State University, Physics Department, Leninskie gory, GSP-1, Moscow, 119991 (Russian Federation); Gorbovskoy, E.; Tiurina, N.; Balanutsa, P.; Kuznetsov, A. [M.V. Lomonosov Moscow State University, Sternberg Astronomical Institute, Universitetsky pr., 13, Moscow, 119234 (Russian Federation); Krushinskiy, V. [Kourovka Astronomical Observatory, Ural Federal University, Lenin ave. 51, Ekaterinburg 620000 (Russian Federation); Budnev, N.; Gress, O.; Ivanov, K.; Yazev, S. [Applied Physics Institute, Irkutsk State University, 20, Gagarin blvd, 664003, Irkutsk (Russian Federation); Tlatov, A. [Kislovodsk Solar Station of the Main (Pulkovo) Observatory RAS, P.O. Box 45, ul. Gagarina 100, Kislovodsk 357700 (Russian Federation); Rebolo Lopez, R.; Serra-Ricart, M.; Israelyan, G.; Lodieu, N. [Instituto de Astrofsica de Canarias, C/Via Lctea, s/n E-38205, La Laguna, Tenerife (Spain); Buckley, D. A. H. [South African Astronomical Observatory, P.O. Box 9, Observatory 7935, Cape Town (South Africa); Sergienko, Yu.; Gabovich, A. [Blagoveschensk State Pedagogical University, Lenin str., 104, Amur Region, Blagoveschensk 675000 (Russian Federation); and others

    2016-12-20

    On 2015 June 15, the Swift space observatory discovered that the Galactic black hole candidate V404 Cyg was undergoing another active X-ray phase, after 25 years of inactivity. The 12 telescopes of the MASTER Global Robotic Net located at six sites across four continents were the first ground-based observatories to start optical monitoring of the microquasar after its gamma-ray wake up at 18{sup h} 34{sup m} 09{sup s} U.T. on 2015 June 15. In this paper, we report, for the first time, the discovery of variable optical linear polarization, changing by 4%–6% over a timescale of ∼1 hr, on two different epochs. We can conclude that the additional variable polarization arises from the relativistic jet generated by the black hole in V404 Cyg. The polarization variability correlates with optical brightness changes, increasing when the flux decreases.

  15. Complex optical/UV and X-ray variability of the Seyfert 1 galaxy 1H 0419-577

    Science.gov (United States)

    Pal, Main; Dewangan, Gulab C.; Kembhavi, Ajit K.; Misra, Ranjeev; Naik, Sachindra

    2018-01-01

    We present detailed broad-band UV/optical to X-ray spectral variability of the Seyfert 1 galaxy 1H 0419-577 using six XMM-Newton observations performed during 2002-2003. These observations covered a large amplitude variability event in which the soft X-ray (0.3-2 keV) count rate increased by a factor of ∼4 in six months. The X-ray spectra during the variability are well described by a model consisting of a primary power law, blurred and distant reflection. The 2-10 keV power-law flux varied by a factor of ∼7 while the 0.3-2 keV soft X-ray excess flux derived from the blurred reflection component varied only by a factor of ∼2. The variability event was also observed in the optical and UV bands but the variability amplitudes were only at the 6-10 per cent level. The variations in the optical and UV bands appear to follow the variations in the X-ray band. During the rising phase, the optical bands appear to lag behind the UV band but during the declining phase, the optical bands appear to lead the UV band. Such behaviour is not expected in the reprocessing models where the optical/UV emission is the result of reprocessing of X-ray emission in the accretion disc. The delayed contribution of the broad emission lines in the UV band or the changes in the accretion disc/corona geometry combined with X-ray reprocessing may give rise to the observed behaviour of the variations.

  16. Tunneling in quantum superlattices with variable lacunarity

    Energy Technology Data Exchange (ETDEWEB)

    Villatoro, Francisco R. [Departamento de Lenguajes y Ciencias de la Computacion, Universidad de Malaga, E-29071 Malaga (Spain); Monsoriu, Juan A. [Departamento de Fisica Aplicada, Universidad Politecnica de Valencia, E-46022 Valencia (Spain)], E-mail: jmonsori@fis.upv.es

    2008-05-19

    Fractal superlattices are composite, aperiodic structures comprised of alternating layers of two semiconductors following the rules of a fractal set. The scattering properties of polyadic Cantor fractal superlattices with variable lacunarity are determined. The reflection coefficient as a function of the particle energy and the lacunarity parameter present tunneling curves, which may be classified as vertical, arc, and striation nulls. Approximate analytical formulae for such curves are derived using the transfer matrix method. Comparison with numerical results shows good accuracy. The new results may be useful in the development of band-pass energy filters for electrons, semiconductor solar cells, and solid-state radiation sources up to THz frequencies.

  17. Optical Variability of Narrow-line and Broad-line Seyfert 1 Galaxies

    Science.gov (United States)

    Rakshit, Suvendu; Stalin, C. S.

    2017-06-01

    We studied the optical variability (OV) of a large sample of narrow-line Seyfert 1 (NLSy1) and broad-line Seyfert 1 (BLSy1) galaxies with z anti-correlated with Fe II strength but correlated with the width of the Hβ line. The well-known anti-correlation of variability-luminosity and the variability-Eddington ratio is present in our data. Among the radio-loud sample, variability amplitude is found to be correlated with radio-loudness and radio-power, suggesting that jets also play an important role in the OV in radio-loud objects, in addition to the Eddington ratio, which is the main driving factor of OV in radio-quiet sources.

  18. A New Statistical Approach to the Optical Spectral Variability in Blazars

    Directory of Open Access Journals (Sweden)

    Jose A. Acosta-Pulido

    2016-12-01

    Full Text Available We present a spectral variability study of a sample of about 25 bright blazars, based on optical spectroscopy. Observations cover the period from the end of 2008 to mid 2015, with an approximately monthly cadence. Emission lines have been identified and measured in the spectra, which permits us to classify the sources into BL Lac-type or FSRQs, according to the commonly used EW limit. We have obtained synthetic photometry and produced colour-magnitude diagrams which show different trends associated with the object classes: generally, BL Lacs tend to become bluer when brighter and FSRQs become redder when brighter, although several objects exhibit both trends, depending on brightness. We have also applied a pattern recognition algorithm to obtain the minimum number of physical components which can explain the variability of the optical spectrum. We have used NMF (Non-Negative Matrix Factorization instead of PCA (Principal Component Analysis to avoid un-realistic negative components. For most targets we found that 2 or 3 meta-components are enough to explain the observed spectral variability.

  19. Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers

    Science.gov (United States)

    Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.

    2018-02-01

    Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.

  20. V2492 Cygni: Optical BVRI Variability During the Period 2010-2017

    Science.gov (United States)

    Ibryamov, Sunay I.; Semkov, Evgeni H.; Peneva, Stoyanka P.

    2018-02-01

    Results from BVRI photometric observations of the young stellar object V2492 Cyg collected during the period from August 2010 to December 2017 are presented. The star is located in the field of the Pelican Nebula and it was discovered in 2010 due to its remarkable increase in the brightness by more than 5 mag in R-band. According to the first hypothesis of the variability, V2492 Cyg is an FUor candidate. During subsequent observations, it was reported that the star shows the characteristics inherent to EXor- and UXor-type variables. The optical data show that during the whole time of observations the star exhibits multiple large amplitude increases and drops in the brightness. In the beginning of 2017, we registered a significant increase in the optical brightness of V2492 Cyg, which seriously exceeds the maximal magnitudes registered after 2010.

  1. Valley- and spin-polarized oscillatory magneto-optical absorption in monolayer MoS2 quantum rings

    Science.gov (United States)

    Oliveira, D.; Villegas-Lelovsky, L.; Soler, M. A. G.; Qu, Fanyao

    2018-03-01

    Besides optical valley selectivity, strong spin-orbit interaction along with Berry curvature effects also leads to unconventional valley- and spin-polarized Landau levels in monolayer transition metal dichalcogenides (TMDCs) under a perpendicular magnetic field. We find that these unique properties are inherited to the magneto-optical absorption spectrum of the TMDC quantum rings (QRs). In addition, it is robust against variation of the magnetic flux and of the QR geometry. In stark contrast to the monolayer bulk material, the MoS2 QRs manifest themselves in both the optical valley selectivity and unprecedented size tunability of the frequency of the light absorbed. We also find that when the magnetic field setup is changed, the phase transition from Aharonov-Bohm (AB) quantum interference to aperiodic oscillation of magneto-optical absorption spectrum takes place. The exciton spectrum in a realistic finite thickness MoS2 QR is also discussed.

  2. The Pagoda Sequence: a Ramble through Linear Complexity, Number Walls, D0L Sequences, Finite State Automata, and Aperiodic Tilings

    Directory of Open Access Journals (Sweden)

    Fred Lunnon

    2009-06-01

    Full Text Available We review the concept of the number wall as an alternative to the traditional linear complexity profile (LCP, and sketch the relationship to other topics such as linear feedback shift-register (LFSR and context-free Lindenmayer (D0L sequences. A remarkable ternary analogue of the Thue-Morse sequence is introduced having deficiency 2 modulo 3, and this property verified via the re-interpretation of the number wall as an aperiodic plane tiling.

  3. 1×4 Optical packet switching of variable length 640 Gbit/s data packets using in-band optical notch-filter labeling

    DEFF Research Database (Denmark)

    Medhin, Ashenafi Kiros; Kamchevska, Valerija; Galili, Michael

    2014-01-01

    We experimentally perform 1×4 optical packet switching of variable length 640 Gbit/s OTDM data packets using in-band notch-filter labeling with only 2.7-dB penalty. Up to 8 notches are employed to demonstrate scalability of the labeling scheme to 1×256 switching operation.......We experimentally perform 1×4 optical packet switching of variable length 640 Gbit/s OTDM data packets using in-band notch-filter labeling with only 2.7-dB penalty. Up to 8 notches are employed to demonstrate scalability of the labeling scheme to 1×256 switching operation....

  4. On the relationship between optical variability, visual saliency, and eye fixations: a computational approach.

    Science.gov (United States)

    Garcia-Diaz, Antón; Leborán, Víctor; Fdez-Vidal, Xosé R; Pardo, Xosé M

    2012-06-12

    A hierarchical definition of optical variability is proposed that links physical magnitudes to visual saliency and yields a more reductionist interpretation than previous approaches. This definition is shown to be grounded on the classical efficient coding hypothesis. Moreover, we propose that a major goal of contextual adaptation mechanisms is to ensure the invariance of the behavior that the contribution of an image point to optical variability elicits in the visual system. This hypothesis and the necessary assumptions are tested through the comparison with human fixations and state-of-the-art approaches to saliency in three open access eye-tracking datasets, including one devoted to images with faces, as well as in a novel experiment using hyperspectral representations of surface reflectance. The results on faces yield a significant reduction of the potential strength of semantic influences compared to previous works. The results on hyperspectral images support the assumptions to estimate optical variability. As well, the proposed approach explains quantitative results related to a visual illusion observed for images of corners, which does not involve eye movements.

  5. Optically variable threads and polarization effects

    Science.gov (United States)

    Kretschmar, Friedrich; Burchard, Theodor; Heim, Manfred

    2006-02-01

    Based on common criteria for efficient security elements for banknotes the set-up of a state-of-the-art holographic security thread is described - as first representative of window embedded OVD. We continue with new colour-shifting OVD-threads - based on physical vapour deposition thin-film and liquid crystal technology. These three then form the family of optically variable threads following the same set of requirements for efficiency, durability, service to all authentication levels and economics. In addition to this set of OVD threads we introduce how liquid crystal based phase retarding layer can be used to install new authentication channels for the public use up-to machine authentication. Also we show the perspective how those development can be used to install similar sets of OVD families of foil elements on banknotes.

  6. Multifrequency observation of the optically violent variable quasar 3C 446

    International Nuclear Information System (INIS)

    Bregman, J.N.; Glassgold, A.E.; Huggins, P.J.; Kinney, A.L.; Mchardy, I.

    1988-01-01

    Nearly 20 years of optical and radio monitoring data as well as seven multifrequency spectra of the violently variable quasar 3C 446 are reported. The monitoring data suggest a correlation between the radio and optical outbursts, with the optical flare preceding the radio activity by 400-600 days. Considerable processing occurs in the optical-emitting plasma before it becomes radio-emitting plasma. Within the radio band, outbursts proceed from high to low frequencies. The flat radio spectrum turns over at 3-10 x 10 to the 11th Hz and the continuum steepens with frequency. The X-ray emission lies an order of magnitude above an extrapolation of the optical-UV spectrum and has a harder spectrum. The power is primarily concentrated in the submillimeter and infrared region. The data suggest that the X-rays are produced by the inverse Compton process from an emitting region smaller than but related to the synchrotron-emitting UV-IR region. The characteristic size of the emitting region increases with decreasing frequency. 36 references

  7. Optical photometric variability of 2S 0114+65

    Science.gov (United States)

    Taylor, M.; Finley, J. P.; Kurt, C.; Koenigsberger, G.

    1995-01-01

    In this paper we present Johnson V photometry of the Be/x-ray binary star system 2S 0114+65. Although this star exhibits periodic variations in x-rays, optical studies have failed to reveal fluctuations greater than 5 millimag. The data presented in this paper provide the first evidence for periodic optical variability in 2S 0114+65. On each of four nights in October 1993, we find low amplitude variations with a period of 2.77 +/- 0.48 h and with a semiamplitude of 4 millimag. This period is in good agreement with results of a comprehensive study of the x-ray data. We explore the possibility that this period represents the pulsational period of the B-star primary and the possibility that it is the rotational period of the neutron star. If the latter is the correct interpretation, we calculate a spin-up time scale of 5 x 10(exp 5) yr.

  8. Compact silicon photonic resonance-sssisted variable optical attenuator.

    Science.gov (United States)

    Wang, Xiaoxi; Aguinaldo, Ryan; Lentine, Anthony; DeRose, Christopher; Starbuck, Andrew L; Trotter, Douglas; Pomerene, Andrew; Mookherjea, Shayan

    2016-11-28

    A two-part silicon photonic variable optical attenuator is demonstrated in a compact footprint which can provide a high extinction ratio at wavelengths between 1520 nm and 1620 nm. The device was made by following the conventional p-i-n waveguide section by a high-extinction-ratio second-order microring filter section. The rings provide additional on-off contrast by utilizing a thermal resonance shift, which harvested the heat dissipated by current injection in the p-i-n junction. We derive and discuss a simple thermal-resistance model in explanation of these effects.

  9. Temporal and vertical variability in optical properties of New England shelf waters during late summer and spring

    Science.gov (United States)

    Sosik, Heidi M.; Green, Rebecca E.; Pegau, W. Scott; Roesler, Collin S.

    2001-05-01

    Relationships between optical and physical properties were examined on the basis of intensive sampling at a site on the New England continental shelf during late summer 1996 and spring 1997. During both seasons, particles were found to be the primary source of temporal and vertical variability in optical properties since light absorption by dissolved material, though significant in magnitude, was relatively constant. Within the particle pool, changes in phytoplankton were responsible for much of the observed optical variability. Physical processes associated with characteristic seasonal patterns in stratification and mixing contributed to optical variability mostly through effects on phytoplankton. An exception to this generalization occurred during summer as the passage of a hurricane led to a breakdown in stratification and substantial resuspension of nonphytoplankton particulate material. Prior to the hurricane, conditions in summer were highly stratified with subsurface maxima in absorption and scattering coefficients. In spring, stratification was much weaker but increased over the sampling period, and a modest phytoplankton bloom caused surface layer maxima in absorption and scattering coefficients. These seasonal differences in the vertical distribution of inherent optical properties were evident in surface reflectance spectra, which were elevated and shifted toward blue wavelengths in the summer. Some seasonal differences in optical properties, including reflectance spectra, suggest that a significant shift toward a smaller particle size distribution occurred in summer. Shorter timescale optical variability was consistent with a variety of influences including episodic events such as the hurricane, physical processes associated with shelfbreak frontal dynamics, biological processes such as phytoplankton growth, and horizontal patchiness combined with water mass advection.

  10. Optically Variable Inks (OVI): versatility in formulation and usage

    Science.gov (United States)

    Degott, Pierre

    2000-04-01

    Optically Variable Inks (OVI) are printing inks containing high precision, multi-layer interference filters as their constituent pigment. They display a strong and unique color change form a normal to an angled viewing position. During the last 10 years OVI has gained wide acceptance as an overt protection for numerous value documents including banknotes and ID cards. Meanwhile, continuous improvement has taken place over the last two years in a variety of areas.

  11. Short-term variability and mass loss in Be stars. II. Physical taxonomy of photometric variability observed by the Kepler spacecraft

    Science.gov (United States)

    Rivinius, Th.; Baade, D.; Carciofi, A. C.

    2016-09-01

    Context. Classical Be stars have been established as pulsating stars. Space-based photometric monitoring missions contributed significantly to that result. However, whether Be stars are just rapidly rotating SPB or β Cep stars, or whether they have to be understood differently, remains debated in the view of their highly complex power spectra. Aims: Kepler data of three known Be stars are re-visited to establish their pulsational nature and assess the properties of additional, non-pulsational variations. The three program stars turned out to be one inactive Be star, one active, continuously outbursting Be star, and one Be star transiting from a non-outbursting into an outbursting phase, thus forming an excellent sample to distill properties of Be stars in the various phases of their life-cycle. Methods: The Kepler data was first cleaned from any long-term variability with Lomb-Scargle based pre-whitening. Then a Lomb-Scargle analysis of the remaining short-term variations was compared to a wavelet analysis of the cleaned data. This offers a new view on the variability, as it enables us to see the temporal evolution of the variability and phase relations between supposed beating phenomena, which are typically not visualized in a Lomb-Scargle analysis. Results: The short-term photometric variability of Be stars must be disentangled into a stellar and a circumstellar part. The stellar part is on the whole not different from what is seen in non-Be stars. However, some of the observed phenomena might be to be due to resonant mode coupling, a mechanism not typically considered for B-type stars. Short-term circumstellar variability comes in the form of either a group of relatively well-defined, short-lived frequencies during outbursts, which are called Štefl frequencies, and broad bumps in the power spectra, indicating aperiodic variability on a time scale similar to typical low-order g-mode pulsation frequencies, rather than true periodicity. Conclusions: From a

  12. Additional security features for optically variable foils

    Science.gov (United States)

    Marshall, Allan C.; Russo, Frank

    1998-04-01

    For thousands of years, man has exploited the attraction and radiance of pure gold to adorn articles of great significance. Today, designers decorate packaging with metallic gold foils to maintain the prestige of luxury items such as perfumes, chocolates, wine and whisky, and to add visible appeal and value to wide range of products. However, today's products do not call for the hand beaten gold leaf of the Ancient Egyptians, instead a rapid production technology exists which makes use of accurately coated thin polymer films and vacuum deposited metallic layers. Stamping Foils Technology is highly versatile since several different layers may be combined into one product, each providing a different function. Not only can a foil bring visual appeal to an article, it can provide physical and chemical resistance properties and also protect an article from human forms of interference, such as counterfeiting, copying or tampering. Stamping foils have proved to be a highly effective vehicle for applying optical devices to items requiring this type of protection. Credit cards, bank notes, personal identification documents and more recently high value packaged items such as software and perfumes are protected by optically variable devices applied using stamping foil technology.

  13. Computing Optical Variable Periods of BL Lac Object S5 0716+ 714 ...

    Indian Academy of Sciences (India)

    Computing Optical Variable Periods of BL Lac Object S5 0716+ 714 ... The study of long-term periodical variation is an important way to get the charac- ... continuous Fourier transform together, define a window function, and finally obtain.

  14. SYSTEMATIC STUDY OF GAMMA-RAY-BRIGHT BLAZARS WITH OPTICAL POLARIZATION AND GAMMA-RAY VARIABILITY

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, Ryosuke; Fukazawa, Yasushi; Kanda, Yuka; Shiki, Kensei; Kawabata, Miho; Nakaoka, Tatsuya; Takaki, Katsutoshi; Takata, Koji; Ui, Takahiro [Department of Physical Science, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Nalewajko, Krzysztof; Madejski, Greg M. [Kavli Institute for Particle Astrophysics and Cosmology, SLAC National Accelerator Laboratory, Stanford University, 2575 Sand Hill Road M/S 29, Menlo Park, CA 94025 (United States); Uemura, Makoto; Tanaka, Yasuyuki T.; Kawabata, Koji S.; Akitaya, Hiroshi; Ohsugi, Takashi [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Schinzel, Frank K. [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States); Moritani, Yuki [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan); Sasada, Mahito [Institute for Astrophysical Research, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Yamanaka, Masayuki, E-mail: itoh@hep01.hepl.hiroshima-u.ac.jp, E-mail: itoh@hp.phys.titech.ac.jp [Department of Physics, Faculty of Science and Engineering, Konan University, Okamoto, Kobe, Hyogo 658-8501 (Japan); and others

    2016-12-10

    Blazars are highly variable active galactic nuclei that emit radiation at all wavelengths from radio to gamma rays. Polarized radiation from blazars is one key piece of evidence for synchrotron radiation at low energies, and it also varies dramatically. The polarization of blazars is of interest for understanding the origin, confinement, and propagation of jets. However, even though numerous measurements have been performed, the mechanisms behind jet creation, composition, and variability are still debated. We performed simultaneous gamma-ray and optical photopolarimetry observations of 45 blazars between 2008 July and 2014 December to investigate the mechanisms of variability and search for a basic relation between the several subclasses of blazars. We identify a correlation between the maximum degree of optical linear polarization and the gamma-ray luminosity or the ratio of gamma-ray to optical fluxes. Since the maximum polarization degree depends on the condition of the magnetic field (chaotic or ordered), this result implies a systematic difference in the intrinsic alignment of magnetic fields in parsec-scale relativistic jets between different types of blazars (flat-spectrum radio quasars vs. BL Lacs) and consequently between different types of radio galaxies (FR I versus FR II).

  15. Application of the three-dimensional aperiodic Fourier modal method using arc elements in curvilinear coordinates.

    Science.gov (United States)

    Bucci, Davide; Martin, Bruno; Morand, Alain

    2012-03-01

    This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.

  16. Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups

    Science.gov (United States)

    Ward, Jonathan A.; Grindrod, Peter

    2014-07-01

    Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance

  17. Time variability of X-ray binaries: observations with INTEGRAL. Modeling

    International Nuclear Information System (INIS)

    Cabanac, Clement

    2007-01-01

    The exact origin of the observed X and Gamma ray variability in X-ray binaries is still an open debate in high energy astrophysics. Among others, these objects are showing aperiodic and quasi-periodic luminosity variations on timescales as small as the millisecond. This erratic behavior must put constraints on the proposed emission processes occurring in the vicinity of the neutrons star or the stellar mass black-hole held by these objects. We propose here to study their behavior following 3 different ways: first we examine the evolution of a particular X-ray source discovered by INTEGRAL, IGR J19140+0951. Using timing and spectral data given by different instruments, we show that the source type is plausibly consistent with a High Mass X-ray Binary hosting a neutrons star. Subsequently, we propose a new method dedicated to the study of timing data coming from coded mask aperture instruments. Using it on INTEGRAL/ISGRI real data, we detect the presence of periodic and quasi-periodic features in some pulsars and micro-quasars at energies as high as a hundred keV. Finally, we suggest a model designed to describe the low frequency variability of X-ray binaries in their hardest state. This model is based on thermal comptonization of soft photons by a warm corona in which a pressure wave is propagating in cylindrical geometry. By computing both numerical simulations and analytical solution, we show that this model should be suitable to describe some of the typical features observed in X-ray binaries power spectra in their hard state and their evolution such as aperiodic noise and low frequency quasi-periodic oscillations. (author) [fr

  18. Optical and tribomechanical stability of optically variable interference security devices prepared by dual ion beam sputtering.

    Science.gov (United States)

    Çetinörgü-Goldenberg, Eda; Baloukas, Bill; Zabeida, Oleg; Klemberg-Sapieha, Jolanta; Martinu, Ludvik

    2011-07-01

    Optical security devices applied to banknotes and other documents are exposed to different types of harsh environments involving the cycling of temperature, humidity, chemical agents, and tribomechanical intrusion. In the present work, we study the stability of optically variable devices, namely metameric interference filters, prepared by dual ion beam sputtering onto polycarbonate and glass substrates. Specifically, we assess the color difference as well as the changes in the mechanical properties and integrity of all-dielectric and metal-dielectric systems due to exposure to bleach, detergent and acetone agents, and heat and humidity. The results underline a significant role of the substrate material, of the interfaces, and of the nature and microstructure of the deposited films in long term stability under everyday application conditions.

  19. Paraxial design of an optical element with variable focal length and fixed position of principal planes.

    Science.gov (United States)

    Mikš, Antonín; Novák, Pavel

    2018-05-10

    In this article, we analyze the problem of the paraxial design of an active optical element with variable focal length, which maintains the positions of its principal planes fixed during the change of its optical power. Such optical elements are important in the process of design of complex optical systems (e.g., zoom systems), where the fixed position of principal planes during the change of optical power is essential for the design process. The proposed solution is based on the generalized membrane tunable-focus fluidic lens with several membrane surfaces.

  20. Observations of regional and local variability in the optical properties of maritime clouds

    Energy Technology Data Exchange (ETDEWEB)

    White, A.B. [Univ. of Colorado at Boulder/National Oceanic and Atmospheric Administration, Boulder, CO (United States); Fairall, C.W. [Environmental Technology Lab., Boulder, CO (United States)

    1996-04-01

    White and Fairall (1995) calculated the optical properties of the marine boundary layer (MBL) clouds observed during the Atlantic Stratocumulus Transition Experiment (ASTEX) and compared their results with the results obtained by Fairall et al. for the MBL clouds observed during the First International Satellite Climatology Program (ISSCP) Regional Experiment (FIRE). They found a factor of two difference in the optical depth versus liquid water relationship that applies to the clouds observed in each case. In the present study, we present evidence to support this difference. We also investigate the local variability exhibited in the ASTEX optical properties using measurements of the boundary layer aerosol concentration.

  1. The growth of optically variable features on banknotes

    Science.gov (United States)

    Lancaster, Ian M.; Mitchell, Astrid

    2004-06-01

    Public verification features are part of a matrix of security features on banknotes which allow the authenticity of legitimate banknotes to be established. They are characterised by being overt and easy to verify -- no examination tool or equipment is required even though the devices themselves are invariably highly sophisticated. Recent developments, though, combine overt and covert elements which may reqire inspection tools. Traditionally, banknote issuers were reluctant to involve the general public in the checking of banknotes, preferring to rely on those employed to handle them, experts and machinery to authenticate the various (normally undisclosed) features. This has now changed as the ability to counterfeit has moved from those highly skilled in printing to anyone with a scanner and computer -- the incidence of counterfeiting has grown exponentially in the last decade. Three techniques for what can be categorized as public verification features have been used for banknotes for many decades and continue to provide a barrier to counterfeiting: (1) the optical effects of watermarks; (2) the appearance and tactile characteristics of cylinder mould-made paper; (3) the tactile characteristics of intaglio print. Since the 1980s the emergence of threads and optically variable features have added to the available features which can be utilized on banknotes for public verification purposes. OVDs fall broadly into the two categories of diffraction and color shift. Products which utilize the former include holograms, kinegrams and other devices originated with similar techniques and bearing a variety of proprietary names, but collectively known as diffractive optically variable image devices (DOVIDs). All share the fundamental characteristic of changing in appearance according to the viewing angle, providing an effective barrier to the increasingly common use of digital reprographic technology as a counterfeiting tool as well as a simple means for verification by the

  2. Development of electrothermal actuation based planar variable optical attenuators (VOAs)

    International Nuclear Information System (INIS)

    Lee, Chengkuo; Yeh, J Andrew

    2006-01-01

    Several sorts of MEMS (Microelectromechanical Systems) based have been demonstrated by using electrostatic actuation scheme up to date. The comb drive and parallel plate are the two most common electrostatic actuators that have been well studied in variable optical attenuator (VOA) applications. In addition to the known retro-reflection type of optical attenuation being realized by our new devices driven by electrothermal actuators in present study, a novel planar tilted mirror with rotational and translation moving capability is proposed by using electrothermal actuators as well. Using electrothermal actuators to provide said planar tilted mirror with rotational and translational displacement has granted us a more efficient way to perform the light attenuation for in-plane structure. The static and transient characteristics of devices operated at ambient room temperature environment show good repeatability and stability

  3. WEATHER ON OTHER WORLDS. III. A SURVEY FOR T DWARFS WITH HIGH-AMPLITUDE OPTICAL VARIABILITY

    International Nuclear Information System (INIS)

    Heinze, Aren N.; Metchev, Stanimir; Kellogg, Kendra

    2015-01-01

    We have monitored 12 T dwarfs with the Kitt Peak 2.1 m telescope using an F814W filter (0.7-0.95 μm) to place in context the remarkable 10%-20% variability exhibited by the nearby T dwarf Luhman 16B in this wavelength regime. The motivation was the poorly known red optical behavior of T dwarfs, which have been monitored almost exclusively at infrared wavelengths, where variability amplitudes greater than 10% have been found to be very rare. We detect highly significant variability in two T dwarfs. The T2.5 dwarf 2MASS 13243559+6358284 shows consistent ∼17% variability on two consecutive nights. The T2 dwarf 2MASS J16291840+0335371 exhibits ∼10% variability that may evolve from night to night, similarly to Luhman 16B. Both objects were previously known to be variable in the infrared, but with considerably lower amplitudes. We also find evidence for variability in the T6 dwarf J162414.37+002915.6, but since it has lower significance, we conservatively refrain from claiming this object as a variable. We explore and rule out various telluric effects, demonstrating that the variations we detect are astrophysically real. We suggest that high-amplitude photometric variability for T dwarfs is likely more common in the red optical than at longer wavelengths. The two new members of the growing class of high-amplitude variable T dwarfs offer excellent prospects for further study of cloud structures and their evolution

  4. WEATHER ON OTHER WORLDS. III. A SURVEY FOR T DWARFS WITH HIGH-AMPLITUDE OPTICAL VARIABILITY

    Energy Technology Data Exchange (ETDEWEB)

    Heinze, Aren N.; Metchev, Stanimir [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794-3800 (United States); Kellogg, Kendra, E-mail: aren.heinze@stonybrook.edu, E-mail: smetchev@uwo.ca [Department of Physics and Astronomy, The University of Western Ontario, 1151 Richmond St, London, ON N6A 3K7 (Canada)

    2015-03-10

    We have monitored 12 T dwarfs with the Kitt Peak 2.1 m telescope using an F814W filter (0.7-0.95 μm) to place in context the remarkable 10%-20% variability exhibited by the nearby T dwarf Luhman 16B in this wavelength regime. The motivation was the poorly known red optical behavior of T dwarfs, which have been monitored almost exclusively at infrared wavelengths, where variability amplitudes greater than 10% have been found to be very rare. We detect highly significant variability in two T dwarfs. The T2.5 dwarf 2MASS 13243559+6358284 shows consistent ∼17% variability on two consecutive nights. The T2 dwarf 2MASS J16291840+0335371 exhibits ∼10% variability that may evolve from night to night, similarly to Luhman 16B. Both objects were previously known to be variable in the infrared, but with considerably lower amplitudes. We also find evidence for variability in the T6 dwarf J162414.37+002915.6, but since it has lower significance, we conservatively refrain from claiming this object as a variable. We explore and rule out various telluric effects, demonstrating that the variations we detect are astrophysically real. We suggest that high-amplitude photometric variability for T dwarfs is likely more common in the red optical than at longer wavelengths. The two new members of the growing class of high-amplitude variable T dwarfs offer excellent prospects for further study of cloud structures and their evolution.

  5. A search for optical variability of type 2 quasars in SDSS stripe 82

    International Nuclear Information System (INIS)

    Barth, Aaron J.; Carson, Daniel J.; Voevodkin, Alexey; Woźniak, Przemysław

    2014-01-01

    Hundreds of Type 2 quasars have been identified in Sloan Digital Sky Survey (SDSS) data, and there is substantial evidence that they are generally galaxies with highly obscured central engines, in accord with unified models for active galactic nuclei (AGNs). A straightforward expectation of unified models is that highly obscured Type 2 AGNs should show little or no optical variability on timescales of days to years. As a test of this prediction, we have carried out a search for variability in Type 2 quasars in SDSS Stripe 82 using difference-imaging photometry. Starting with the Type 2 AGN catalogs of Zakamska et al. and Reyes et al., we find evidence of significant g-band variability in 17 out of 173 objects for which light curves could be measured from the Stripe 82 data. To determine the nature of this variability, we obtained new Keck spectropolarimetry observations for seven of these variable AGNs. The Keck data show that these objects have low continuum polarizations (p ≲ 1% in most cases) and all seven have broad Hα and/or Mg II emission lines in their total (unpolarized) spectra, indicating that they should actually be classified as Type 1 AGNs. We conclude that the primary reason variability is found in the SDSS-selected Type 2 AGN samples is that these samples contain a small fraction of Type 1 AGNs as contaminants, and it is not necessary to invoke more exotic possible explanations such as a population of 'naked' or unobscured Type 2 quasars. Aside from misclassified Type 1 objects, the Type 2 quasars do not generally show detectable optical variability over the duration of the Stripe 82 survey.

  6. The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns

    Science.gov (United States)

    Duarte, Fabiola; Lemus, Luis

    2017-01-01

    The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406

  7. Photonic crystals: role of architecture and disorder on spectral properties.

    Science.gov (United States)

    Verma, Rupesh; Audhkhasi, Romil; Thyagarajan, Krishna; Banerjee, Varsha

    2018-03-01

    Many of the present-day optical devices use photonic crystals. These are multilayers of dielectric media that control the reflection and transmission of light falling on them. In this paper, we study the optical properties of periodic, fractal, and aperiodic photonic crystals and compare them based on their attributes. Our calculations of the band reflectivity and degree of robustness reveal novel features, e.g., fractal photonic crystals are found to reflect the maximum amount of incident light. On the other hand, aperiodic photonic crystals have the largest immunity to disorder. We believe that such properties will be useful in a variety of applications in the field of optical communication.

  8. OPTICAL SETI OBSERVATIONS OF THE ANOMALOUS STAR KIC 8462852

    International Nuclear Information System (INIS)

    Schuetz, Marlin; Vakoch, Douglas A.; Shostak, Seth; Richards, Jon

    2016-01-01

    To explore the hypothesis that KIC 8462852's aperiodic dimming is caused by artificial megastructures in orbit, rather than a natural cause such as cometary fragments in a highly elliptical orbit, we searched for electromagnetic signals from KIC 8462852 indicative of extraterrestrial intelligence. The primary observations were in the visible optical regime using the Boquete Optical SETI Observatory in Panama. In addition, as a recommended preparatory exercise for the possible future detection of a candidate signal, three of six observing runs simultaneously searched radio frequencies at the Allen Telescope Array in California. No periodic optical signals greater than 67 photons m −2 within a time frame of 25 ns were seen. If, for example, any inhabitants of KIC 8462852 were targeting our solar system with 5 MJ laser pulses, locally illuminating an approximately 3 au diameter disk, the signal could have been detected at the Boquete Observatory. The limits on narrowband radio signals were 180–300 Jy Hz at 1 and 8 GHz, respectively. While the power requirement for a detectable, isotropic narrowband radio transmission from KIC 8462852 is quite high, even modest targeting on the part of the putative extraterrestrials can lower this power substantially.

  9. Optical SETI Observations of the Anomalous Star KIC 8462852

    Science.gov (United States)

    Schuetz, Marlin; Vakoch, Douglas A.; Shostak, Seth; Richards, Jon

    2016-07-01

    To explore the hypothesis that KIC 8462852's aperiodic dimming is caused by artificial megastructures in orbit, rather than a natural cause such as cometary fragments in a highly elliptical orbit, we searched for electromagnetic signals from KIC 8462852 indicative of extraterrestrial intelligence. The primary observations were in the visible optical regime using the Boquete Optical SETI Observatory in Panama. In addition, as a recommended preparatory exercise for the possible future detection of a candidate signal, three of six observing runs simultaneously searched radio frequencies at the Allen Telescope Array in California. No periodic optical signals greater than 67 photons m-2 within a time frame of 25 ns were seen. If, for example, any inhabitants of KIC 8462852 were targeting our solar system with 5 MJ laser pulses, locally illuminating an approximately 3 au diameter disk, the signal could have been detected at the Boquete Observatory. The limits on narrowband radio signals were 180-300 Jy Hz at 1 and 8 GHz, respectively. While the power requirement for a detectable, isotropic narrowband radio transmission from KIC 8462852 is quite high, even modest targeting on the part of the putative extraterrestrials can lower this power substantially.

  10. A novel scenario of aperiodical impacts appearance in the turbine draft tube

    Science.gov (United States)

    Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.

    2016-11-01

    The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.

  11. R Aquarii - the large-scale optical nebula and the Mira variable position

    International Nuclear Information System (INIS)

    Michalitsianos, A.G.; Oliversen, R.J.; Hollis, J.M.; Kafatos, M.; Crull, H.E.

    1988-01-01

    The R Aquarii symbiotic star system is surrounded by a large-scale optical nebula. Observations of the nebular forbidden O III structure are presented and its morphological significance are discussed in context with previously observed small-scale radio-continuum features, which may be related. It is suggested that a precessing accretion disk may explain the global features of both the large-scale optical emission and the small-scale radio emission. Moreover, an accurate position has been determined of the system's Mira, which suggests that a recent theoretical model, yielding an egg-shaped central H II region for symbiotic systems with certain physical parameters, may apply to R Aquarii. The optical position of the 387 d period Mira variable is consistent with previous findings in the radio, that SiO maser emission is far removed from the Mira photosphere. 25 references

  12. Soil temperature variability in complex terrain measured using fiber-optic distributed temperature sensing

    Science.gov (United States)

    Soil temperature (Ts) exerts critical controls on hydrologic and biogeochemical processes but magnitude and nature of Ts variability in a landscape setting are rarely documented. Fiber optic distributed temperature sensing systems (FO-DTS) potentially measure Ts at high density over a large extent. ...

  13. Stochastic resonance in a bistable system subject to multi-time-delayed feedback and aperiodic signal

    International Nuclear Information System (INIS)

    Li Jianlong; Zeng Lingzao

    2010-01-01

    We discuss in detail the effects of the multi-time-delayed feedback driven by an aperiodic signal on the output of a stochastic resonance (SR) system. The effective potential function and dynamical probability density function (PDF) are derived. To measure the performance of the SR system in the presence of a binary random signal, the bit error rate (BER) defined by the dynamical PDF is employed, as is commonly used in digital communications. We find that the delay time, strength of the feedback, and number of time-delayed terms can change the effective potential function and the effective amplitude of the signal, and then affect the BER of the SR system. The numerical simulations strongly support the theoretical results. The goal of this investigation is to explore the effects of the multi-time-delayed feedback on SR and give a guidance to nonlinear systems in the application of information processing.

  14. Estimation of macular pigment optical density in the elderly: test-retest variability and effect of optical blur in pseudophakic subjects

    NARCIS (Netherlands)

    Gallaher, Kevin T.; Mura, Marco; Todd, Wm Andrew; Harris, Tarsha L.; Kenyon, Emily; Harris, Tamara; Johnson, Karen C.; Satterfield, Suzanne; Kritchevsky, Stephen B.; Iannaccone, Alessandro

    2007-01-01

    The reproducibility of macular pigment optical density (MPOD) estimates in the elderly was assessed in 40 subjects (age: 79.1+/-3.5). Test-retest variability was good (Pearson's r coefficient: 0.734), with an average coefficient of variation (CV) of 18.4% and an intraclass correlation coefficient

  15. Rapid Multiwaveband Polarization Variability in the Quasar PKS 0420-014: Optical Emission from the Compact Radio Jet

    Science.gov (United States)

    D'Arcangelo, Francesca D.; Marscher, Alan P.; Jorstad, Svetlana G.; Smith, Paul S.; Larionov, Valeri M.; Hagen-Thorn, Vladimir A.; Kopatskaya, Eugenia N.; Williams, G. Grant; Gear, Walter K.

    2007-04-01

    An 11 day monitoring campaign in late 2005 reveals clear correlation in polarization between the optical emission and the region of the intensity peak (the ``pseudocore'') at the upstream end of the jet in 43 GHz VLBA (Very Long Baseline Array) images in the highly variable quasar PKS 0420-014. The electric-vector position angle (EVPA) of the pseudocore rotated by about 80° in four VLBA observations over a period of 9 days, matching the trend of the optical EVPA. In addition, the 43 GHz EVPAs agree well with the optical values when we correct the former for Faraday rotation. Fluctuations in the polarization at both wave bands are consistent with the variable emission arising from a standing conical shock wave that compresses magnetically turbulent plasma in the ambient jet. The volume of the variable component is the same at both wave bands, although only ~20% of the total 43 GHz emission arises from this site. The remainder of the 43 GHz flux density must originate in a separate region with very low polarization. If 0420-014 is a typical case, the nonthermal optical emission from blazars originates primarily in and near the pseudocore rather than closer to the central engine where the flow collimates and accelerates.

  16. Optical Variability Signatures from Massive Black Hole Binaries

    Science.gov (United States)

    Kasliwal, Vishal P.; Frank, Koby Alexander; Lidz, Adam

    2017-01-01

    The hierarchical merging of dark matter halos and their associated galaxies should lead to a population of supermassive black hole binaries (MBHBs). We consider plausible optical variability signatures from MBHBs at sub-parsec separations and search for these using data from the Catalina Real-Time Transient Survey (CRTS). Specifically, we model the impact of relativistic Doppler beaming on the accretion disk emission from the less massive, secondary black hole. We explore whether this Doppler modulation may be separated from other sources of stochastic variability in the accretion flow around the MBHBs, which we describe as a damped random walk (DRW). In the simple case of a circular orbit, relativistic beaming leads to a series of broad peaks — located at multiples of the orbital frequency — in the fluctuation power spectrum. We extend our analysis to the case of elliptical orbits and discuss the effect of beaming on the flux power spectrum and auto-correlation function using simulations. We present a code to model an observed light curve as a stochastic DRW-type time series modulated by relativistic beaming and apply the code to CRTS data.

  17. Intra-night optical variability properties of X-ray bright Narrow-line Seyfert 1 galaxies

    Science.gov (United States)

    Ojha, Vineet; Chand, Hum; Gopal-Krishna

    2018-04-01

    We present Intra Night Optical Variability (INOV) study of the 9 Narrow-line Seyfert 1 (NLSy 1) galaxies which are detected in X-ray at more than 3σ level. Our observations cover a total of 9 nights ( 36 hr) with each NLSy 1 monitored for ≥ 3.5 hr in each night. After applying F-test to assess variability status of these sources, we found none of these sources to be variable. Such non-variability nature of X-ray detected NLSy 1 galaxies suggests the lack of jet dominance as far as X-ray emission is concerned. Higher photometric accuracy for these faint sources, achievable with the newly installed ARIES 3.6m DOT will be helpful.

  18. Correlated X-ray/UV/optical emission and short-term variability in a Seyfert 1 galaxy NGC 4593

    Science.gov (United States)

    Pal, Main; Naik, Sachindra

    2018-03-01

    We present a detailed multifrequency analysis of an intense monitoring programme of Seyfert 1 galaxy NGC 4593 over a duration of nearly for a month with Swift observatory. We used 185 pointings to study the variability in six ultraviolet/optical and two soft (0.3-1.5 keV) and hard X-ray (1.5-10 keV) bands. The amplitude of the observed variability is found to decrease from high energy to low energy (X-ray to optical) bands. Count-count plots of ultraviolet/optical bands with hard X-rays clearly suggest the presence of a mixture of two major components: (i) highly variable component such as hard X-ray emission, and (ii) slowly varying disc-like component. The variations observed in the ultraviolet/optical emission are strongly correlated with the hard X-ray band. Cross-correlation analysis provides the lags for the longer wavelengths compared to the hard X-rays. Such lags clearly suggest that the changes in the ultraviolet/optical bands follow the variations in the hard X-ray band. This implies that the observed variation in longer wavelengths is due to X-ray reprocessing. Though, the measured lag spectrum (lag versus wavelength) is well described by λ4/3 as expected from the standard disc model, the observed lags are found to be longer than the predicted values from standard disc model. This implies that the actual size of the disc of NGC 4593 is larger than the estimated size of standard thin disc as reported in active galactic nuclei such as NGC 5548 and Fairall 9.

  19. OPTICAL SETI OBSERVATIONS OF THE ANOMALOUS STAR KIC 8462852

    Energy Technology Data Exchange (ETDEWEB)

    Schuetz, Marlin; Vakoch, Douglas A. [METI International, 100 Pine Street, Suite 1250, San Francisco, CA 94111-5235 (United States); Shostak, Seth; Richards, Jon, E-mail: dvakoch@meti.org [Center for SETI Research, SETI Institute, 189 Bernardo Avenue, Mountain View, CA 94043 (United States)

    2016-07-01

    To explore the hypothesis that KIC 8462852's aperiodic dimming is caused by artificial megastructures in orbit, rather than a natural cause such as cometary fragments in a highly elliptical orbit, we searched for electromagnetic signals from KIC 8462852 indicative of extraterrestrial intelligence. The primary observations were in the visible optical regime using the Boquete Optical SETI Observatory in Panama. In addition, as a recommended preparatory exercise for the possible future detection of a candidate signal, three of six observing runs simultaneously searched radio frequencies at the Allen Telescope Array in California. No periodic optical signals greater than 67 photons m{sup −2} within a time frame of 25 ns were seen. If, for example, any inhabitants of KIC 8462852 were targeting our solar system with 5 MJ laser pulses, locally illuminating an approximately 3 au diameter disk, the signal could have been detected at the Boquete Observatory. The limits on narrowband radio signals were 180–300 Jy Hz at 1 and 8 GHz, respectively. While the power requirement for a detectable, isotropic narrowband radio transmission from KIC 8462852 is quite high, even modest targeting on the part of the putative extraterrestrials can lower this power substantially.

  20. Discovery of Fast, Large-amplitude Optical Variability of V648 Car (=SS73-17)

    Science.gov (United States)

    Angeloni, R.; Di Mille, F.; Ferreira Lopes, C. E.; Masetti, N.

    2012-09-01

    We report on the discovery of large-amplitude flickering from V648 Car (= SS73-17), a poorly studied object listed among the very few hard X-ray-emitting symbiotic stars. We performed millimagnitude precision optical photometry with the Swope Telescope at the Las Campanas Observatory, Chile, and found that V648 Car shows large U-band variability over timescales of minutes. To our knowledge, it exhibits some of the largest flickering of a symbiotic star ever reported. Our finding supports the hypothesis that symbiotic white dwarfs producing hard X-rays are predominantly powered by accretion, rather than quasi-steady nuclear burning, and have masses close to the Chandrasekhar limit. No significant periodicity is evident from the flickering light curve. The All Sky Automated Survey long-term V light curve suggests the presence of a tidally distorted giant accreting via Roche lobe overflow, and a binary period of ~520 days. On the basis of the outstanding physical properties of V648 Car as hinted at by its fast and long-term optical variability, as well as by its nature as a hard X-ray emitter, we therefore call for simultaneous follow-up observations in different bands, ideally combined with time-resolved optical spectroscopy.

  1. DISCOVERY OF FAST, LARGE-AMPLITUDE OPTICAL VARIABILITY OF V648 Car (=SS73-17)

    International Nuclear Information System (INIS)

    Angeloni, R.; Di Mille, F.; Ferreira Lopes, C. E.; Masetti, N.

    2012-01-01

    We report on the discovery of large-amplitude flickering from V648 Car (= SS73-17), a poorly studied object listed among the very few hard X-ray-emitting symbiotic stars. We performed millimagnitude precision optical photometry with the Swope Telescope at the Las Campanas Observatory, Chile, and found that V648 Car shows large U-band variability over timescales of minutes. To our knowledge, it exhibits some of the largest flickering of a symbiotic star ever reported. Our finding supports the hypothesis that symbiotic white dwarfs producing hard X-rays are predominantly powered by accretion, rather than quasi-steady nuclear burning, and have masses close to the Chandrasekhar limit. No significant periodicity is evident from the flickering light curve. The All Sky Automated Survey long-term V light curve suggests the presence of a tidally distorted giant accreting via Roche lobe overflow, and a binary period of ∼520 days. On the basis of the outstanding physical properties of V648 Car as hinted at by its fast and long-term optical variability, as well as by its nature as a hard X-ray emitter, we therefore call for simultaneous follow-up observations in different bands, ideally combined with time-resolved optical spectroscopy.

  2. Intra-Night Variability of OJ 287 with Long-Term Multiband Optical Monitoring

    Directory of Open Access Journals (Sweden)

    Wei Zeng

    2017-11-01

    Full Text Available We present long-term optical multi-band photometric monitoring of the blazar OJ 287 from 6 March 2010 to 3 April 2016, with high temporal resolution in the V R I -bands. The flux variations and colour-magnitude variations on long and short timescales were investigated to understand the emission mechanisms. In our observation, the major outbursts occurred in January 2016, as predicted by the binary pair of black holes model for OJ 287, with F v a r of 1.3∼2.1%, and variability amplitude (Amp of 5.8∼9.0%. The intra-night variability (IDV durations were from 18.5 to 51.3 min, and the minimal variability timescale was about 4.7 min. The colour-magnitude variation showed a weak positive correlation on the long timescale with Pearson’s r = 0 . 450 , while a negative correlation was found on intra-night timescales. We briefly discuss the possible physical mechanisms that are most likely to be responsible for the observed flux and colour-magnitude correlation variability.

  3. Modeling the optical radiation of the precataclysmic variable SDSS J212531-010745

    Science.gov (United States)

    Shimansky, V. V.; Borisov, N. V.; Nurtdinova, D. N.; Solovyeva, Yu. N.; Sakhibullin, N. A.; Spiridonova, O. I.

    2015-03-01

    Optical observations are analyzed to derive a set of basic parameters for the precataclysmic variable star SDSS J212531-010745, whose primary is a PG1159-type star. Spectroscopic and multiband photometric observations of the star were performed in 2008-2011 with the 6-m telescope and the Zeiss-1000 telescope of the Special Astrophysical Observatory. The shape of the binary's orbital light curves is nearly sinusoidal, with the amplitude increasing with wavelength from Δ m = 0.40 m in the B band to Δ m = 0.73 m in the R band. The spectra contain absorption lines of HeII and neutral atoms, along with HI, HeI, CII, MgII, FeII emission lines, whose intensity increases synchronously with the brightness of the system. The optical radiation from SDSS J212531-010745 has a composite nature, corresponding to a model for a pre-cataclysmic variable with strong reflection effects. Cross-correlation techniques are used to measure the radial velocities and derive the component masses. Numerical modeling of the binary's light curves, radial velocities, and spectra is performed, and a complete set of parameters determined. Considerable abundance anomalies (to 1 dex) were detected for the secondary. The primary's characteristics correspond to the evolutionary predictions for DAO dwarfs with masses M ≈ 0.5 M ⊙, and the secondary's characteristics to low-mass, main-sequence stars with the solar metallicity.

  4. Construction and performance analysis of variable-weight optical orthogonal codes for asynchronous OCDMA systems

    Science.gov (United States)

    Li, Chuan-qi; Yang, Meng-jie; Zhang, Xiu-rong; Chen, Mei-juan; He, Dong-dong; Fan, Qing-bin

    2014-07-01

    A construction scheme of variable-weight optical orthogonal codes (VW-OOCs) for asynchronous optical code division multiple access (OCDMA) system is proposed. According to the actual situation, the code family can be obtained by programming in Matlab with the given code weight and corresponding capacity. The formula of bit error rate (BER) is derived by taking account of the effects of shot noise, avalanche photodiode (APD) bulk, thermal noise and surface leakage currents. The OCDMA system with the VW-OOCs is designed and improved. The study shows that the VW-OOCs have excellent performance of BER. Despite of coming from the same code family or not, the codes with larger weight have lower BER compared with the other codes in the same conditions. By taking simulation, the conclusion is consistent with the analysis of BER in theory. And the ideal eye diagrams are obtained by the optical hard limiter.

  5. Soil Temperature Variability in Complex Terrain measured using Distributed a Fiber-Optic Distributed Temperature Sensing

    Science.gov (United States)

    Seyfried, M. S.; Link, T. E.

    2013-12-01

    Soil temperature (Ts) exerts critical environmental controls on hydrologic and biogeochemical processes. Rates of carbon cycling, mineral weathering, infiltration and snow melt are all influenced by Ts. Although broadly reflective of the climate, Ts is sensitive to local variations in cover (vegetative, litter, snow), topography (slope, aspect, position), and soil properties (texture, water content), resulting in a spatially and temporally complex distribution of Ts across the landscape. Understanding and quantifying the processes controlled by Ts requires an understanding of that distribution. Relatively few spatially distributed field Ts data exist, partly because traditional Ts data are point measurements. A relatively new technology, fiber optic distributed temperature system (FO-DTS), has the potential to provide such data but has not been rigorously evaluated in the context of remote, long term field research. We installed FO-DTS in a small experimental watershed in the Reynolds Creek Experimental Watershed (RCEW) in the Owyhee Mountains of SW Idaho. The watershed is characterized by complex terrain and a seasonal snow cover. Our objectives are to: (i) evaluate the applicability of fiber optic DTS to remote field environments and (ii) to describe the spatial and temporal variability of soil temperature in complex terrain influenced by a variable snow cover. We installed fiber optic cable at a depth of 10 cm in contrasting snow accumulation and topographic environments and monitored temperature along 750 m with DTS. We found that the DTS can provide accurate Ts data (+/- .4°C) that resolves Ts changes of about 0.03°C at a spatial scale of 1 m with occasional calibration under conditions with an ambient temperature range of 50°C. We note that there are site-specific limitations related cable installation and destruction by local fauna. The FO-DTS provide unique insight into the spatial and temporal variability of Ts in a landscape. We found strong seasonal

  6. Statistical optics

    Science.gov (United States)

    Goodman, J. W.

    This book is based on the thesis that some training in the area of statistical optics should be included as a standard part of any advanced optics curriculum. Random variables are discussed, taking into account definitions of probability and random variables, distribution functions and density functions, an extension to two or more random variables, statistical averages, transformations of random variables, sums of real random variables, Gaussian random variables, complex-valued random variables, and random phasor sums. Other subjects examined are related to random processes, some first-order properties of light waves, the coherence of optical waves, some problems involving high-order coherence, effects of partial coherence on imaging systems, imaging in the presence of randomly inhomogeneous media, and fundamental limits in photoelectric detection of light. Attention is given to deterministic versus statistical phenomena and models, the Fourier transform, and the fourth-order moment of the spectrum of a detected speckle image.

  7. Measurement of high-departure aspheres using subaperture stitching with the Variable Optical Null (VON)

    Science.gov (United States)

    Kulawiec, Andrew; Murphy, Paul; DeMarco, Michael

    2010-10-01

    Aspheric surfaces are proven to provide significant benefits to a wide variety of optical systems, but the ability to produce high-precision aspheric surfaces has historically been limited by the ability (or lack thereof) to measure them. Traditionally, aspheric measurements have required dedicated null optics, but the cost, lead time, and calibration difficulty of using null optics has made the use of aspheres more challenging and less attractive. In the past three years, QED has developed the Subaperture Stitching Interferometer for Aspheres (SSI-A®) to help address this limitation, providing flexible aspheric measurement capability of up to 200 waves of aspheric departure from best-fit sphere. Some aspheres, however, have thousands of waves of departure. We have recently developed Variable Optical Null (VON) technology that can null much of the aspheric departure in a subaperture. The VON is automatically configurable and is adjusted to nearly null each specific subaperture of an asphere. This ability to nearly null a local subaperture of an asphere provides a significant boost in aspheric measurement capability, enabling aspheres with up to 1000 waves of departure to be measured, without the use of dedicated null optics. We outline the basic principles of subaperture stitching and VON technology, demonstrate the extended capability provided by the VON, and present measurement results from the new Aspheric Stitching Interferometer (ASI®).

  8. Tidal Marsh Outwelling of Dissolved Organic Matter and Resulting Temporal Variability in Coastal Water Optical and Biogeochemical Properties

    Science.gov (United States)

    Tzortziou, Maria; Neale, Patrick J.; Megonigal, J. Patrick; Butterworth, Megan; Jaffe, Rudolf; Yamashita, Youhei

    2010-01-01

    Coastal wetlands are highly dynamic environments at the land-ocean interface where human activities, short-term physical forcings and intense episodic events result in high biological and chemical variability. Long being recognized as among the most productive ecosystems in the world, tidally-influenced coastal marshes are hot spots of biogeochemical transformation and exchange. High temporal resolution observations that we performed in several marsh-estuarine systems of the Chesapeake Bay revealed significant variability in water optical and biogeochemical characteristics at hourly time scales, associated with tidally-driven hydrology. Water in the tidal creek draining each marsh was sampled every hour during several semi-diurnal tidal cycles using ISCO automated samplers. Measurements showed that water leaving the marsh during ebbing tide was consistently enriched in dissolved organic carbon (DOC), frequently by more than a factor of two, compared to water entering the marsh during flooding tide. Estimates of DOC fluxes showed a net DOC export from the marsh to the estuary during seasons of both low and high biomass of marsh vegetation. Chlorophyll amounts were typically lower in the water draining the marsh, compared to that entering the marsh during flooding tide, suggesting that marshes act as transformers of particulate to dissolved organic matter. Moreover, detailed optical and compositional analyses demonstrated that marshes are important sources of optically and chemically distinctive, relatively complex, high molecular weight, aromatic-rich and highly colored dissolved organic compounds. Compared to adjacent estuarine waters, marsh-exported colored dissolved organic matter (CDOM) was characterized by considerably stronger absorption (more than a factor of three in some cases), larger DOC-specific absorption, lower exponential spectral slope, larger fluorescence signal, lower fluorescence per unit absorbance, and higher fluorescence at visible wavelengths

  9. Use efficiency of variable rate of nitrogen prescribed by optical sensor in corn

    Directory of Open Access Journals (Sweden)

    Jardes Bragagnolo

    2016-02-01

    Full Text Available ABSTRACT The efficiency of nitrogen fertilizer in corn is usually low, negatively affecting plant nutrition, the economic return, and the environment. In this context, a variable rate of nitrogen, prescribed by crop sensors, has been proposed as an alternative to the uniform rate of nitrogen traditionally used by farmers. This study tested the hypothesis that variable rate of nitrogen, prescribed by optical sensor, increases the nitrogen use efficiency and grain yield as compared to uniform rate of nitrogen. The following treatments were evaluated: 0; 70; 140; and 210 kg ha-1 under uniform rate of nitrogen, and 140 kg ha -1 under variable rate of nitrogen. The nitrogen source was urea applied on the soil surface using a distributor equipped with the crop sensor. In this study, the grain yield ranged from 10.2 to 15.5 Mg ha-1, with linear response to nitrogen rates. The variable rate of nitrogen increased by 11.8 and 32.6% the nitrogen uptake and nitrogen use efficiency, respectively, compared to the uniform rate of nitrogen. However, no significant increase in grain yield was observed, indicating that the major benefit of the variable rate of nitrogen was reducing the risk of environmental impact of fertilizer.

  10. EXTraS: Exploring the X-ray Transient and variable Sky

    Science.gov (United States)

    De Luca, A.; Salvaterra, R.; Tiengo, A.; D'Agostino, D.; Watson, M.; Haberl, F.; Wilms, J.

    2017-10-01

    The EXTraS project extracted all temporal domain information buried in the whole database collected by the EPIC cameras onboard the XMM-Newton mission. This included a search and characterisation of variability, both periodic and aperiodic, in hundreds of thousands of sources spanning more than eight orders of magnitude in time scale and six orders of magnitude in flux, as well as a search for fast transients, missed by standard image analysis. Phenomenological classification of variable sources, based on X-ray and multiwavelength information, has also been performed. All results and products of EXTraS are made available to the scientific community through a web public data archive. A dedicated science gateway will allow scientists to apply EXTraS pipelines on new observations. EXTraS is the most comprehensive analysis of variability, on the largest ever sample of soft X-ray sources. The resulting archive and tools disclose an enormous scientific discovery space to the community, with applications ranging from the search for rare events to population studies, with impact on the study of virtually all astrophysical source classes. EXTraS, funded within the EU/FP7 framework, is carried out by a collaboration including INAF (Italy), IUSS (Italy), CNR/IMATI (Italy), University of Leicester (UK), MPE (Germany) and ECAP (Germany).

  11. The intermediate-age pre-cataclysmic variables SDSS J172406+562003 and RE J2013+4002

    Science.gov (United States)

    Shimansky, V. V.; Borisov, N. V.; Nurtdinova, D. N.; Mitrofanova, A. A.; Vlasyuk, V. V.; Spiridonova, O. I.

    2012-06-01

    We have analyzed the physical status of the pre-cataclysmic variables SDSSJ172406+562003 and RE J2013+4002, which have evolved after their common-envelope stage a time t = 106-107 years. Spectroscopy and photometry of these systems were performed with the 6-m and 1-m telescopes of the Special Astrophysical Observatory. We demonstrate that emission lines in the spectra were formed solely by the reflection of radiation emitted by the white dwarfs on the surfaces of their cool companions, under conditions close to local thermodynamic equilibrium. These effects are also responsible for most of the objects' photometric variability amplitude. However, comparing the light curves of SDSS 172406 from different epochs, we find aperiodic brightness variations, probably due to spottedness of the surface of the secondary. Jointly analyzing the spectra, radial-velocity curves, and light curves of the pre-cataclysmic variables and modeling the reflection effects, we have derived their fundamental parameters. We demonstrate that the secondaries in these systems are consistent with evolutionary models for main-sequence stars and do not have the luminosity excesses characteristic of cool stars in young pre-cataclysmic variables.

  12. Competition model for aperiodic stochastic resonance in a Fitzhugh-Nagumo model of cardiac sensory neurons.

    Science.gov (United States)

    Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N

    2001-04-01

    Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.

  13. Compact 6 dB Two-Color Continuous Variable Entangled Source Based on a Single Ring Optical Resonator

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2018-02-01

    Full Text Available Continuous-variable entangled optical beams at the degenerate wavelength of 0.8 μm or 1.5 μm have been investigated extensively, but separately. The two-color entangled states of these two useful wavelengths, with sufficiently high degrees of entanglement, still lag behind. In this work, we analyze the various limiting factors that affect the entanglement degree. On the basis of this, we successfully achieve 6 dB of two-color quadrature entangled light beams by improving the escape efficiency of the nondegenerate optical amplifier, the stability of the phase-locking servo system, and the detection efficiency. Our entangled source is constructed only from a single ring optical resonator, and thus is highly compact, which is suitable for applications in long-distance quantum communication networks.

  14. Temporal variability in SeaWiFS derived apparent optical properties in European seas

    Science.gov (United States)

    Vantrepotte, V.; Mélin, F.

    2010-02-01

    The 10-year record of ocean color data provided by the SeaWiFS mission is an important asset for monitoring and research activities conducted on the optically complex European seas. This study makes use of the SeaWiFS data set of normalized water leaving radiances LWN to study the major characteristics of temporal variability associated with optical properties across the entire European domain. Specifically, the time series of LWN and associated band ratios are decomposed into terms representing a fixed seasonal cycle, irregular variations and trends, and the contribution of these components to the total variance is described for the various basins. The diversity of the European waters is fully reflected by the range of results varying with regions and wavelengths. Generally, the Mediterranean and Baltic seas appear as two end-members with, respectively, high and low contributions of the seasonal component to the total variance. The existence of linear trends affecting the satellite products is also explored for each basin. By focusing the analysis on LWN and band ratios, the validity of the results is not limited by the varying levels of uncertainty that characterize derived products such as the concentration of chlorophyll a in optically complex waters. Statistically significant, and in some cases large, trends are detected in the Atlantic Ocean west of the European western shelf, the central North Sea, the English Channel, the Black Sea, the northern Adriatic, and various regions of the Mediterranean Sea and the northern Baltic Sea, revealing changes in the concentrations of optically significant constituents in these regions.

  15. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.; Fernandez, P.B.

    1992-01-01

    A variable-metric (VM) crystal is one in which the spacing between the crystalline planes changes with position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes of interest and can be produced by either introducing a thermal gradient in the crystal or by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. A series of experiments were performed in the laboratory to demonstrate the principle of the variable-metric crystal and its potential use in synchrotron beam lines. One of the most useful applications of the VM crystal is to increase the number of photons per unit bandwidth in a diffracted beam without losing any of the overall intensity. In a normal synchrotron beam line that uses a two-crystal monochromator, the bandwidth of the diffracted photon beam is determined by the vertical opening angle of the beam which is typically 0.10--0.30 mrad or 20--60 arcsec. When the VM crystal approach is applied, the bandwidth of the beam can be made as narrow as the rocking curve of the diffracting crystal, which is typically 0.005--0.050 mrad or 1--10 arcsec. Thus a very large increase of photons per unit bandwidth (or per unit energy) can be achieved through the use of VM crystals. When the VM principle is used with bent crystals, new kinds of x-ray optical elements can be generated that can focus and defocus x-ray beams much like simple lenses where the focal length of the lens can be changed to match its application. Thus both large magnifications and large demagnifications can be achieved as well as parallel beams with narrow bandwidths

  16. Different stimulation frequencies alter synchronous fluctuations in motor evoked potential amplitude of intrinsic hand muscles – a TMS study.

    Directory of Open Access Journals (Sweden)

    Martin Victor Sale

    2016-03-01

    Full Text Available The amplitude of motor-evoked potentials (MEPs elicited with transcranial magnetic stimulation (TMS varies from trial-to-trial. Synchronous oscillations in cortical neuronal excitability contribute to this variability, however it is not known how different frequencies of stimulation influence MEP variability, and whether these oscillations are rhythmic or aperiodic. We stimulated the motor cortex with TMS at different regular (i.e., rhythmic rates, and compared this with pseudo-random (aperiodic timing. In 18 subjects, TMS was applied at three regular frequencies (0.05 Hz, 0.2 Hz, 1 Hz and one aperiodic frequency (mean 0.2 Hz. MEPs (n = 50 were recorded from three intrinsic hand muscles of the left hand with different functional and anatomical relations. MEP amplitude correlation was highest for the functionally related muscle pair, less for the anatomically related muscle pair and least for the functionally- and anatomically-unrelated muscle pair. MEP correlations were greatest with 1 Hz, and least for stimulation at 0.05 Hz. Corticospinal neuron synchrony is higher with shorter TMS intervals. Further, corticospinal neuron synchrony is similar irrespective of whether the stimulation is periodic or aperiodic. These findings suggest TMS frequency is a crucial consideration for studies using TMS to probe correlated activity between muscle pairs.

  17. Different Stimulation Frequencies Alter Synchronous Fluctuations in Motor Evoked Potential Amplitude of Intrinsic Hand Muscles—a TMS Study

    Science.gov (United States)

    Sale, Martin V.; Rogasch, Nigel C.; Nordstrom, Michael A.

    2016-01-01

    The amplitude of motor-evoked potentials (MEPs) elicited with transcranial magnetic stimulation (TMS) varies from trial-to-trial. Synchronous oscillations in cortical neuronal excitability contribute to this variability, however it is not known how different frequencies of stimulation influence MEP variability, and whether these oscillations are rhythmic or aperiodic. We stimulated the motor cortex with TMS at different regular (i.e., rhythmic) rates, and compared this with pseudo-random (aperiodic) timing. In 18 subjects, TMS was applied at three regular frequencies (0.05 Hz, 0.2 Hz, 1 Hz) and one aperiodic frequency (mean 0.2 Hz). MEPs (n = 50) were recorded from three intrinsic hand muscles of the left hand with different functional and anatomical relations. MEP amplitude correlation was highest for the functionally related muscle pair, less for the anatomically related muscle pair and least for the functionally- and anatomically-unrelated muscle pair. MEP correlations were greatest with 1 Hz, and least for stimulation at 0.05 Hz. Corticospinal neuron synchrony is higher with shorter TMS intervals. Further, corticospinal neuron synchrony is similar irrespective of whether the stimulation is periodic or aperiodic. These findings suggest TMS frequency is a crucial consideration for studies using TMS to probe correlated activity between muscle pairs. PMID:27014031

  18. Performance Analysis of an Optical CDMA MAC Protocol With Variable-Size Sliding Window

    Science.gov (United States)

    Mohamed, Mohamed Aly A.; Shalaby, Hossam M. H.; Abdel-Moety El-Badawy, El-Sayed

    2006-10-01

    A media access control protocol for optical code-division multiple-access packet networks with variable length data traffic is proposed. This protocol exhibits a sliding window with variable size. A model for interference-level fluctuation and an accurate analysis for channel usage are presented. Both multiple-access interference (MAI) and photodetector's shot noise are considered. Both chip-level and correlation receivers are adopted. The system performance is evaluated using a traditional average system throughput and average delay. Finally, in order to enhance the overall performance, error control codes (ECCs) are applied. The results indicate that the performance can be enhanced to reach its peak using the ECC with an optimum number of correctable errors. Furthermore, chip-level receivers are shown to give much higher performance than that of correlation receivers. Also, it has been shown that MAI is the main source of signal degradation.

  19. A MEMS and agile optics-based dual-mode variable optical power splitter with no moving parts

    Science.gov (United States)

    Khwaja, Tariq S.; Suleman, Hamid; Reza, Syed Azer

    2017-06-01

    In this paper, we present a novel design of an optical power splitter. Owing to the inherent variable power split ratios that the proposed design delivers, it is ideal for use in communications, sensing and signal processing applications where variable power splitting is often quintessential. The proposed power splitter module is dual mode as it combines the use of a Micro-Electro-Mechanical Systems (MEMS) based Digital Micro-mirror Device (DMD) and an Electronically Controlled Tunable Lens (ECTL) to split the power of an input optical signal between two output ports - the designated port and the surplus port. The use of a reflective Digital Spatial Light Modulator (DSLM) such as the DMD provides a motion-free digital control of the split ratio between the two output ports. Although the digital step between two possible successive split ratios can be fairly minimal with the use of a high resolution DMD but it is a challenge to correctly ascertain the exact image pattern on the DMD to obtain any desired specific split ratio. To counter this challenge, we propose the synchronized use of a circular pattern on the DMD, which serves as a circular clear aperture with a tunable radius, and an ECTL. The radius of the circular pattern on the DMD provides a digital control of the split ratio between the two ports whereas the ECTL, depending on its controller, can provide either an analog or a digital control by altering the beam radius which is incident at the DMD circular pattern. The radius of the circular pattern on the DMD can be minimally changed by one micro-pixel thickness. Setting the radius of the circular pattern on the DMD to an appropriate value provides the closest "ball-park" split ratio whereas further tuning the ECTL aids in slightly altering from this digitally set value to obtain the exact desired split ratio in-between any two digitally-set successive split ratios that correspond to any clear aperture radius of the DMD pattern and its incremental minimal

  20. Identification of Young Stellar Variables with KELT for K2 . I. Taurus Dippers and Rotators

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, Joseph E.; Cargile, Phillip A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Ansdell, Megan [Institute for Astronomy, University of Hawaií at Manoa, Honolulu, HI 96822 (United States); Oelkers, Ryan J.; Somers, Garrett; Lund, Michael B.; Stassun, Keivan G. [Department of Physics and Astronomy, Vanderbilt University, 6301 Stevenson Center, Nashville, TN 37235 (United States); Gaidos, Eric [Department of Geology and Geophysics, University of Hawaií at Manoa, Honolulu, HI 96822 (United States); Cody, Ann Marie [NASA Ames Research Center, Mountain View, CA 94035 (United States); Stevens, Daniel J.; Gaudi, B. Scott [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); James, David [Astronomy Department, University of Washington, Box 351580, Seattle, WA 98195 (United States); Beatty, Thomas G. [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States); Siverd, Robert J. [Las Cumbres Observatory Global Telescope Network, 6740 Cortona Drive, Suite 102, Santa Barbara, CA 93117 (United States); Kuhn, Rudolf B. [South African Astronomical Observatory, PO Box 9, Observatory 7935 (South Africa); Pepper, Joshua [Department of Physics, Lehigh University, 16 Memorial Drive East, Bethlehem, PA 18015 (United States)

    2017-10-20

    One of the most well-studied young stellar associations, Taurus–Auriga, was observed by the extended Kepler mission, K2 , in the spring of 2017. K2 Campaign 13 (C13) is a unique opportunity to study many stars in this young association at high photometric precision and cadence. Using observations from the Kilodegree Extremely Little Telescope (KELT) survey, we identify “dippers,” aperiodic and periodic variables among K2 C13 target stars. This release of the KELT data (light curve data in e-tables) provides the community with long-time baseline observations to assist in the understanding of the more exotic variables in the association. Transient-like phenomena on timescales of months to years are known characteristics in the light curves of young stellar objects, making contextual pre- and post- K2 observations critical to understanding their underlying processes. We are providing a comprehensive set of the KELT light curves for known Taurus–Auriga stars in K2 C13. The combined data sets from K2 and KELT should permit a broad array of investigations related to star formation, stellar variability, and protoplanetary environments.

  1. Identification of Young Stellar Variables with KELT for K2 . I. Taurus Dippers and Rotators

    International Nuclear Information System (INIS)

    Rodriguez, Joseph E.; Cargile, Phillip A.; Ansdell, Megan; Oelkers, Ryan J.; Somers, Garrett; Lund, Michael B.; Stassun, Keivan G.; Gaidos, Eric; Cody, Ann Marie; Stevens, Daniel J.; Gaudi, B. Scott; James, David; Beatty, Thomas G.; Siverd, Robert J.; Kuhn, Rudolf B.; Pepper, Joshua

    2017-01-01

    One of the most well-studied young stellar associations, Taurus–Auriga, was observed by the extended Kepler mission, K2 , in the spring of 2017. K2 Campaign 13 (C13) is a unique opportunity to study many stars in this young association at high photometric precision and cadence. Using observations from the Kilodegree Extremely Little Telescope (KELT) survey, we identify “dippers,” aperiodic and periodic variables among K2 C13 target stars. This release of the KELT data (light curve data in e-tables) provides the community with long-time baseline observations to assist in the understanding of the more exotic variables in the association. Transient-like phenomena on timescales of months to years are known characteristics in the light curves of young stellar objects, making contextual pre- and post- K2 observations critical to understanding their underlying processes. We are providing a comprehensive set of the KELT light curves for known Taurus–Auriga stars in K2 C13. The combined data sets from K2 and KELT should permit a broad array of investigations related to star formation, stellar variability, and protoplanetary environments.

  2. Improvement of two-way continuous-variable quantum key distribution using optical amplifiers

    International Nuclear Information System (INIS)

    Zhang, Yi-Chen; Yu, Song; Gu, Wanyi; Li, Zhengyu; Sun, Maozhu; Peng, Xiang; Guo, Hong; Weedbrook, Christian

    2014-01-01

    The imperfections of a receiver's detector affect the performance of two-way continuous-variable (CV) quantum key distribution (QKD) protocols and are difficult to adjust in practical situations. We propose a method to improve the performance of two-way CV-QKD by adding a parameter-adjustable optical amplifier at the receiver. A security analysis is derived against a two-mode collective entangling cloner attack. Our simulations show that the proposed method can improve the performance of protocols as long as the inherent noise of the amplifier is lower than a critical value, defined as the tolerable amplifier noise. Furthermore, the optimal performance can approach the scenario where a perfect detector is used. (paper)

  3. Light refraction in sapphire plates with a variable angle of crystal optical axis to the surface

    International Nuclear Information System (INIS)

    Vetrov, V. N.; Ignatenkov, B. A.

    2013-01-01

    The modification of sapphire by inhomogeneous plastic deformation makes it possible to obtain plates with a variable angle of inclination of the crystal optical axis to the plate surface. The refraction of light in this plate at perpendicular and oblique incidence of a parallel beam of rays is considered. The algorithm of calculating the refractive index of extraordinary ray and the birefringence is proposed.

  4. Quantum discord and classical correlation signatures of mobility edges in one-dimensional aperiodic single-electron systems

    International Nuclear Information System (INIS)

    Gong, Longyan; Zhu, Hao; Zhao, Shengmei; Cheng, Weiwen; Sheng, Yubo

    2012-01-01

    We investigate numerically the quantum discord and the classical correlation in a one-dimensional slowly varying potential model and a one-dimensional Soukoulis–Economou ones, respectively. There are well-defined mobility edges in the slowly varying potential model, while there are discrepancies on mobility edges in the Soukoulis–Economou ones. In the slowly varying potential model, we find that extended and localized states can be distinguished by both the quantum discord and the classical correlation. There are sharp transitions in the quantum discord and the classical correlation at mobility edges. Based on these, we study “mobility edges” in the Soukoulis–Economou model using the quantum discord and the classical correlation, which gives another perspectives for these “mobility edges”. All these provide us good quantities, i.e., the quantum discord and the classical correlation, to reflect mobility edges in these one-dimensional aperiodic single-electron systems. Moreover, our studies propose a consistent interpretation of the discrepancies between previous numerical results about the Soukoulis–Economou model. -- Highlights: ► Quantum discord and classical correlation can signal mobility edges in two models. ► An interpretation for mobility edges in the Soukoulis–Economou model is proposed. ► Quantum discord and classical correlation can reflect well localization properties.

  5. A deep staring campaign in the σ Orionis cluster. Variability in substellar members

    Science.gov (United States)

    Elliott, P.; Scholz, A.; Jayawardhana, R.; Eislöffel, J.; Hébrard, E. M.

    2017-12-01

    Context. The young star cluster near σ Orionis is one of the primary environments to study the properties of young brown dwarfs down to masses comparable to those of giant planets. Aims: Deep optical imaging is used to study time-domain properties of young brown dwarfs over typical rotational timescales and to search for new substellar and planetary-mass cluster members. Methods: We used the Visible Multi Object Spectrograph (VIMOS) at the Very Large Telescope (VLT) to monitor a 24'× 16' field in the I-band. We stared at the same area over a total integration time of 21 h, spanning three observing nights. Using the individual images from this run we investigated the photometric time series of nine substellar cluster members with masses from 10 to 60 MJup. The deep stacked image shows cluster members down to ≈5 MJup. We searched for new planetary-mass objects by combining our deep I-band photometry with public J-band magnitudes and by examining the nearby environment of known very low mass members for possible companions. Results: We find two brown dwarfs, with significantly variable, aperiodic light curves, both with masses around 50 MJup, one of which was previously unknown to be variable. The physical mechanism responsible for the observed variability is likely to be different for the two objects. The variability of the first object, a single-lined spectroscopic binary, is most likely linked to its accretion disc; the second may be caused by variable extinction by large grains. We find five new candidate members from the colour-magnitude diagram and three from a search for companions within 2000 au. We rule all eight sources out as potential members based on non-stellar shape and/or infrared colours. The I-band photometry is made available as a public dataset. Conclusions: We present two variable brown dwarfs. One is consistent with ongoing accretion, the other exhibits apparent transient variability without the presence of an accretion disc. Our analysis

  6. Diurnal variability in riverine dissolved organic matter composition determined by in situ optical measurement in the San Joaquin River (California, USA)

    Science.gov (United States)

    Spencer, R.G.M.; Pellerin, B.A.; Bergamaschi, B.A.; Downing, B.D.; Kraus, T.E.C.; Smart, D.R.; Dahlgren, R.A.; Hernes, P.J.

    2007-01-01

    Dissolved organic matter (DOM) concentration and composition in riverine and stream systems are known to vary with hydrological and productivity cycles over the annual and interannual time scales. Rivers are commonly perceived as homogeneous with respect to DOM concentration and composition, particularly under steady flow conditions over short time periods. However, few studies have evaluated the impact of short term variability ( DOC) measurement alone. The in situ optical measurements described in this study clearly showed for the first time diurnal variations in DOM measurements, which have previously been related to both composition and concentration, even though diurnal changes were not well reflected in bulk DOC concentrations. An apparent asynchronous trend of DOM absorbance and chlorophyll-a in comparison to chromophoric dissolved organic matter (CDOM) fluorescence and spectral slope S290-350 suggests that no one specific CDOM spectrophotometric measurement explains absolutely DOM diurnal variation in this system; the measurement of multiple optical parameters is therefore recommended. The observed diurnal changes in DOM composition, measured by in situ optical instrumentation likely reflect both photochemical and biologically-mediated processes. The results of this study highlight that short-term variability in DOM composition may complicate trends for studies aiming to distinguish different DOM sources in riverine systems and emphasizes the importance of sampling specific study sites to be compared at the same time of day. The utilization of in situ optical technology allows short-term variability in DOM dynamics to be monitored and serves to increase our understanding of its processing and fundamental role in the aquatic environment. Copyright ?? 2007 John Wiley & Sons, Ltd.

  7. Spectral tailoring of nanoscale EUV and soft x-ray multilayer optics

    Science.gov (United States)

    Huang, Qiushi; Medvedev, Viacheslav; van de Kruijs, Robbert; Yakshin, Andrey; Louis, Eric; Bijkerk, Fred

    2017-03-01

    Extreme ultraviolet and soft X-ray (XUV) multilayer optics have experienced significant development over the past few years, particularly on controlling the spectral characteristics of light for advanced applications like EUV photolithography, space observation, and accelerator- or lab-based XUV experiments. Both planar and three dimensional multilayer structures have been developed to tailor the spectral response in a wide wavelength range. For the planar multilayer optics, different layered schemes are explored. Stacks of periodic multilayers and capping layers are demonstrated to achieve multi-channel reflection or suppression of the reflective properties. Aperiodic multilayer structures enable broadband reflection both in angles and wavelengths, with the possibility of polarization control. The broad wavelength band multilayer is also used to shape attosecond pulses for the study of ultrafast phenomena. Narrowband multilayer monochromators are delivered to bridge the resolution gap between crystals and regular multilayers. High spectral purity multilayers with innovated anti-reflection structures are shown to select spectrally clean XUV radiation from broadband X-ray sources, especially the plasma sources for EUV lithography. Significant progress is also made in the three dimensional multilayer optics, i.e., combining micro- and nanostructures with multilayers, in order to provide new freedom to tune the spectral response. Several kinds of multilayer gratings, including multilayer coated gratings, sliced multilayer gratings, and lamellar multilayer gratings are being pursued for high resolution and high efficiency XUV spectrometers/monochromators, with their advantages and disadvantages, respectively. Multilayer diffraction optics are also developed for spectral purity enhancement. New structures like gratings, zone plates, and pyramids that obtain full suppression of the unwanted radiation and high XUV reflectance are reviewed. Based on the present achievement

  8. VARIABILITY IN FOVEAL AVASCULAR ZONE AND CAPILLARY DENSITY USING OPTICAL COHERENCE TOMOGRAPHY ANGIOGRAPHY MACHINES IN HEALTHY EYES.

    Science.gov (United States)

    Magrath, George N; Say, Emil Anthony T; Sioufi, Kareem; Ferenczy, Sandor; Samara, Wasim A; Shields, Carol L

    2017-11-01

    To evaluate the variability in foveal avascular zone (FAZ) and capillary density measurements on optical coherence tomography angiography using Optovue RTVue XR Avanti (OA) (Optovue) and Zeiss Cirrus HD-OCT 5000 (ZC) (Carl Zeiss Meditec). In this prospective, comparative case series, parafoveal (3 × 3 mm) optical coherence tomography angiography scans were obtained on healthy volunteers using both the Avanti and Cirrus. The FAZ area and capillary density at the level of both the superficial and deep capillary plexus were measured automatically using the built-in ReVue software (Optovue) with the Avanti as well as manually using ImageJ (National Institutes of Health) with both machines. There were 50 eyes in 25 healthy volunteers included in the analysis. Mean subject age was 33 years and there were 14 women (56%). On optical coherence tomography, mean central macular thickness was significantly greater on OA (259.1 μm) than ZC (257.6 μm, P = 0.0228). On optical coherence tomography angiography, mean superficial and deep plexus FAZ measured 0.2855 mm and 0.3465 mm on Avanti automated (A-A), 0.2739 mm and 0.3637 mm on Avanti manual (A-M), and 0.2657 mm and 0.3993 mm on Cirrus manual (C-M), respectively. There were no statistically significant differences in superficial plexus FAZ measurements between the A-A and A-M (P = 0.4019) or A-A and C-M (P = 0.1336). The A-M measured significantly larger than C-M (P = 0.0396). Deep plexus FAZ measurements were similar on A-A and A-M (P = 0.6299), but both were significantly less compared with C-M (P machine and technique are consistent and reliable between fellow eyes, significant variability exists in FAZ and capillary density measurements among different machines and techniques. Comparison of measurements across machines and techniques should be considered with caution.

  9. Fast optical and X-ray variability in the UCXB 4U0614+09

    Science.gov (United States)

    Hakala, P. J.; Charles, P. A.; Muhli, P.

    2011-09-01

    We present results from several years of fast optical photometry of 4U0614+091 (V1055 Orionis), a candidate ultracompact X-ray binary most likely consisting of a neutron star and a degenerate secondary. We find evidence for strong accretion-driven variability at all epochs, which manifests itself as red noise. This flickering produces transient peaks in the observed power spectrum in the 15-65 min period range. Only in one of our 12 optical data sets can we see evidence for a period that cannot be reproduced using the red noise model. This period of 51 min coincides with the strongest period detected by Shahbaz et al. and can thus be taken as the prime candidate for the orbital period of the system. Furthermore, we find some tentative evidence for the X-ray versus optical flux anticorrelation discovered by Machin et al. using our data together with the all-sky X-ray monitoring data from RXTE/All Sky Monitor. We propose that the complex time series behaviour of 4U0614+09 is a result of drastic changes in the accretion disc geometry/structure on time-scales from hours to days. Finally, we want to draw attention to the interpretation of moderately strong peaks in the power spectra of especially accreting sources. Many of such 'periods' can probably be attributed to the presence of red noise (i.e. correlated events) in the data. Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias. Uses results provided by the ASM/RXTE teams at MIT and at the RXTE SOF and GOF at NASA's GSFC.

  10. Improving Continuous-Variable Measurement-Device-Independent Multipartite Quantum Communication with Optical Amplifiers*

    Science.gov (United States)

    Guo, Ying; Zhao, Wei; Li, Fei; Huang, Duan; Liao, Qin; Xie, Cai-Lang

    2017-08-01

    The developing tendency of continuous-variable (CV) measurement-device-independent (MDI) quantum cryptography is to cope with the practical issue of implementing scalable quantum networks. Up to now, most theoretical and experimental researches on CV-MDI QKD are focused on two-party protocols. However, we suggest a CV-MDI multipartite quantum secret sharing (QSS) protocol use the EPR states coupled with optical amplifiers. More remarkable, QSS is the real application in multipartite CV-MDI QKD, in other words, is the concrete implementation method of multipartite CV-MDI QKD. It can implement a practical quantum network scheme, under which the legal participants create the secret correlations by using EPR states connecting to an untrusted relay via insecure links and applying the multi-entangled Greenberger-Horne-Zeilinger (GHZ) state analysis at relay station. Even if there is a possibility that the relay may be completely tampered, the legal participants are still able to extract a secret key from network communication. The numerical simulation indicates that the quantum network communication can be achieved in an asymmetric scenario, fulfilling the demands of a practical quantum network. Additionally, we illustrate that the use of optical amplifiers can compensate the partial inherent imperfections of detectors and increase the transmission distance of the CV-MDI quantum system.

  11. Dark solitons for a variable-coefficient higher-order nonlinear Schrödinger equation in the inhomogeneous optical fiber

    Science.gov (United States)

    Sun, Yan; Tian, Bo; Wu, Xiao-Yu; Liu, Lei; Yuan, Yu-Qiang

    2017-04-01

    Under investigation in this paper is a variable-coefficient higher-order nonlinear Schrödinger equation, which has certain applications in the inhomogeneous optical fiber communication. Through the Hirota method, bilinear forms, dark one- and two-soliton solutions for such an equation are obtained. We graphically study the solitons with d1(z), d2(z) and d3(z), which represent the variable coefficients of the group-velocity dispersion, third-order dispersion and fourth-order dispersion, respectively. With the different choices of the variable coefficients, we obtain the parabolic, periodic and V-shaped dark solitons. Head-on and overtaking collisions are depicted via the dark two soliton solutions. Velocities of the dark solitons are linearly related to d1(z), d2(z) and d3(z), respectively, while the amplitudes of the dark solitons are not related to such variable coefficients.

  12. Optical crop sensor for variable-rate nitrogen fertilization in corn: II - indices of fertilizer efficiency and corn yield

    Directory of Open Access Journals (Sweden)

    Jardes Bragagnolo

    2013-10-01

    Full Text Available Generally, in tropical and subtropical agroecosystems, the efficiency of nitrogen (N fertilization is low, inducing a temporal variability of crop yield, economic losses, and environmental impacts. Variable-rate N fertilization (VRF, based on optical spectrometry crop sensors, could increase the N use efficiency (NUE. The objective of this study was to evaluate the corn grain yield and N fertilization efficiency under VRF determined by an optical sensor in comparison to the traditional single-application N fertilization (TSF. With this purpose, three experiments with no-tillage corn were carried out in the 2008/09 and 2010/11 growing seasons on a Hapludox in South Brazil, in a completely randomized design, at three different sites that were analyzed separately. The following crop properties were evaluated: aboveground dry matter production and quantity of N uptake at corn flowering, grain yield, and vegetation index determined by an N-Sensor® ALS optical sensor. Across the sites, the corn N fertilizer had a positive effect on corn N uptake, resulting in increased corn dry matter and grain yield. However, N fertilization induced lower increases of corn grain yield at site 2, where there was a severe drought during the growing period. The VRF defined by the optical crop sensor increased the apparent N recovery (NRE and agronomic efficiency of N (NAE compared to the traditional fertilizer strategy. In the average of sites 1 and 3, which were not affected by drought, VRF promoted an increase of 28.0 and 41.3 % in NAE and NRE, respectively. Despite these results, no increases in corn grain yield were observed by the use of VRF compared to TSF.

  13. Long-Period Solar Variability

    Energy Technology Data Exchange (ETDEWEB)

    GAUTHIER,JOHN H.

    2000-07-20

    Terrestrial climate records and historical observations of the Sun suggest that the Sun undergoes aperiodic oscillations in radiative output and size over time periods of centuries and millenia. Such behavior can be explained by the solar convective zone acting as a nonlinear oscillator, forced at the sunspot-cycle frequency by variations in heliomagnetic field strength. A forced variant of the Lorenz equations can generate a time series with the same characteristics as the solar and climate records. The timescales and magnitudes of oscillations that could be caused by this mechanism are consistent with what is known about the Sun and terrestrial climate.

  14. Leaf optical properties shed light on foliar trait variability at individual to global scales

    Science.gov (United States)

    Shiklomanov, A. N.; Serbin, S.; Dietze, M.

    2017-12-01

    Recent syntheses of large trait databases have contributed immensely to our understanding of drivers of plant function at the global scale. However, the global trade-offs revealed by such syntheses, such as the trade-off between leaf productivity and resilience (i.e. "leaf economics spectrum"), are often absent at smaller scales and fail to correlate with actual functional limitations. An improved understanding of how traits vary among communities, species, and individuals is critical to accurate representations of vegetation ecophysiology and ecological dynamics in ecosystem models. Spectral data from both field observations and remote sensing platforms present a rich and widely available source of information on plant traits. Here, we apply Bayesian inversion of the PROSPECT leaf radiative transfer model to a large global database of over 60,000 field spectra and plant traits to (1) comprehensively assess the accuracy of leaf trait estimation using PROSPECT spectral inversion; (2) investigate the correlations between optical traits estimable from PROSPECT and other important foliar traits such as nitrogen and lignin concentrations; and (3) identify dominant sources of variability and characterize trade-offs in optical and non-optical foliar traits. Our work provides a key methodological contribution by validating physically-based retrieval of plant traits from remote sensing observations, and provides insights about trait trade-offs related to plant acclimation, adaptation, and community assembly.

  15. On the influence of cloud fraction diurnal cycle and sub-grid cloud optical thickness variability on all-sky direct aerosol radiative forcing

    International Nuclear Information System (INIS)

    Min, Min; Zhang, Zhibo

    2014-01-01

    The objective of this study is to understand how cloud fraction diurnal cycle and sub-grid cloud optical thickness variability influence the all-sky direct aerosol radiative forcing (DARF). We focus on the southeast Atlantic region where transported smoke is often observed above low-level water clouds during burning seasons. We use the CALIOP observations to derive the optical properties of aerosols. We developed two diurnal cloud fraction variation models. One is based on sinusoidal fitting of MODIS observations from Terra and Aqua satellites. The other is based on high-temporal frequency diurnal cloud fraction observations from SEVIRI on board of geostationary satellite. Both models indicate a strong cloud fraction diurnal cycle over the southeast Atlantic region. Sensitivity studies indicate that using a constant cloud fraction corresponding to Aqua local equatorial crossing time (1:30 PM) generally leads to an underestimated (less positive) diurnal mean DARF even if solar diurnal variation is considered. Using cloud fraction corresponding to Terra local equatorial crossing time (10:30 AM) generally leads overestimation. The biases are a typically around 10–20%, but up to more than 50%. The influence of sub-grid cloud optical thickness variability on DARF is studied utilizing the cloud optical thickness histogram available in MODIS Level-3 daily data. Similar to previous studies, we found the above-cloud smoke in the southeast Atlantic region has a strong warming effect at the top of the atmosphere. However, because of the plane-parallel albedo bias the warming effect of above-cloud smoke could be significantly overestimated if the grid-mean, instead of the full histogram, of cloud optical thickness is used in the computation. This bias generally increases with increasing above-cloud aerosol optical thickness and sub-grid cloud optical thickness inhomogeneity. Our results suggest that the cloud diurnal cycle and sub-grid cloud variability are important factors

  16. Influence of a variable Rayleigh scattering-loss coefficient on the light backscattering in multimode optical fibers.

    Science.gov (United States)

    Bisyarin, M A; Kotov, O I; Hartog, A H; Liokumovich, L B; Ushakov, N A

    2017-06-01

    The recently developed diffraction technique of analytical investigation of the Rayleigh backscattering produced by an incident fundamental mode in a multimode optical fiber with an arbitrary refractive index profile is supplemented by taking into account the Rayleigh scattering-loss coefficient, which could be variable within the fiber cross section. The relative changes in various radial and azimuthal modes' excitation levels, due to some typical radial dependences of this coefficient, are computed for the quadratic- and step-index fibers. It is stated that the excitation efficiency could either rise or decay for different modes. The effect of the variable Rayleigh scattering-loss coefficient is shown to be more noticeable in the fibers with a quadratic refractive index profile, whereas it is negligible in actual multimode step-index fibers.

  17. Molecular Dynamics of Flexible Polar Cations in a Variable Confined Space: Toward Exceptional Two-Step Nonlinear Optical Switches.

    Science.gov (United States)

    Xu, Wei-Jian; He, Chun-Ting; Ji, Cheng-Min; Chen, Shao-Li; Huang, Rui-Kang; Lin, Rui-Biao; Xue, Wei; Luo, Jun-Hua; Zhang, Wei-Xiong; Chen, Xiao-Ming

    2016-07-01

    The changeable molecular dynamics of flexible polar cations in the variable confined space between inorganic chains brings about a new type of two-step nonlinear optical (NLO) switch with genuine "off-on-off" second harmonic generation (SHG) conversion between one NLO-active state and two NLO-inactive states. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An electro-magnetic micromachined actuator monolithically integrated with a vertical shutter for variable optical attenuation

    International Nuclear Information System (INIS)

    Hung, Shao Hsuan; Hsieh, Hsin-Ta; John Su, Guo-Dung

    2008-01-01

    The design, fabrication and test results of an electromagnetic-actuated micromachined variable optical attenuator (VOA) are reported in this paper. Optical attenuation is achieved by moving a shutter into the light path between a pair of single mode fiber collimators. The shutter, consisting of a 500 µm × 1200 µm vertical micromirror, is monolithically integrated with an actuation flap. The micromirror was made by tetra-methyl ammonium hydroxide (TMAH) anisotropic wet etching with a sharp edge and a smooth reflecting surface. By arranging fiber collimators in different configurations, the reported VOA can be used as either normally-on or normally-off modes due to its relatively large shutter surface. The insertion loss of the VOA is 0.2 dB and 0.4 dB for normally-on and normally-off modes, respectively. Both optical and mechanical simulation models of the device were discussed, and the theoretical calculations based on these models offered an efficient way to predict the performance of the shutter-type VOA. The controllable attenuation range is approximately 40 dB with a driving voltage less than 0.5 V, and the driving power is less than 2 mW. A response time of 5 ms is achieved by applying proper driving waveform

  19. Continuous Variable Quantum Communication and Computation

    DEFF Research Database (Denmark)

    Andersen, Ulrik Lund; Dong, Ruifang; Jezek, Miroslav

    2011-01-01

    We use squeezed states of light to implement a robust continuous variable quantum key distribution scheme and an optical Hadamard gate based on coherent state qubits.......We use squeezed states of light to implement a robust continuous variable quantum key distribution scheme and an optical Hadamard gate based on coherent state qubits....

  20. Optical nutation in the exciton range of spectrum

    International Nuclear Information System (INIS)

    Khadzhi, P. I.; Vasiliev, V. V.

    2013-01-01

    Optical nutation in the exciton range of spectrum is studied in the mean field approximation taking into account exciton-photon and elastic exciton-exciton interactions. It is shown that the features of nutation development are determined by the initial exciton and photon densities, the resonance detuning, the nonlinearity parameter, and the initial phase difference. For nonzero initial exciton and photon concentrations, three regimes of temporal evolution of excitons and photons exist: periodic conversion of excitons to photons and vice versa, aperiodic conversion of photons to excitons, and the rest regime. In the rest regime, the initial exciton and photon densities are nonzero and do not change with time. The oscillation amplitudes and periods of particle densities determined by the system parameters are found. The exciton self-trapping and photon trapping appearing in the system at threshold values of the nonlinearity parameter were predicted. As this parameter increases, the oscillation amplitudes of the exciton and photon densities sharply change at the critical value of the nonlinearity parameter. These two phenomena are shown to be caused by the elastic exciton-exciton interaction, resulting in the dynamic concentration shift of the exciton level

  1. Soliton-like solutions of a generalized variable-coefficient higher order nonlinear Schroedinger equation from inhomogeneous optical fibers with symbolic computation

    International Nuclear Information System (INIS)

    Li Juan; Zhang Haiqiang; Xu Tao; Zhang, Ya-Xing; Tian Bo

    2007-01-01

    For the long-distance communication and manufacturing problems in optical fibers, the propagation of subpicosecond or femtosecond optical pulses can be governed by the variable-coefficient nonlinear Schroedinger equation with higher order effects, such as the third-order dispersion, self-steepening and self-frequency shift. In this paper, we firstly determine the general conditions for this equation to be integrable by employing the Painleve analysis. Based on the obtained 3 x 3 Lax pair, we construct the Darboux transformation for such a model under the corresponding constraints, and then derive the nth-iterated potential transformation formula by the iterative process of Darboux transformation. Through the one- and two-soliton-like solutions, we graphically discuss the features of femtosecond solitons in inhomogeneous optical fibers

  2. The effect of virtual reality on gait variability.

    Science.gov (United States)

    Katsavelis, Dimitrios; Mukherjee, Mukul; Decker, Leslie; Stergiou, Nicholas

    2010-07-01

    Optic Flow (OF) plays an important role in human locomotion and manipulation of OF characteristics can cause changes in locomotion patterns. The purpose of the study was to investigate the effect of the velocity of optic flow on the amount and structure of gait variability. Each subject underwent four conditions of treadmill walking at their self-selected pace. In three conditions the subjects walked in an endless virtual corridor, while a fourth control condition was also included. The three virtual conditions differed in the speed of the optic flow displayed as follows--same speed (OFn), faster (OFf), and slower (OFs) than that of the treadmill. Gait kinematics were tracked with an optical motion capture system. Gait variability measures of the hip, knee and ankle range of motion and stride interval were analyzed. Amount of variability was evaluated with linear measures of variability--coefficient of variation, while structure of variability i.e., its organization over time, were measured with nonlinear measures--approximate entropy and detrended fluctuation analysis. The linear measures of variability, CV, did not show significant differences between Non-VR and VR conditions while nonlinear measures of variability identified significant differences at the hip, ankle, and in stride interval. In response to manipulation of the optic flow, significant differences were observed between the three virtual conditions in the following order: OFn greater than OFf greater than OFs. Measures of structure of variability are more sensitive to changes in gait due to manipulation of visual cues, whereas measures of the amount of variability may be concealed by adaptive mechanisms. Visual cues increase the complexity of gait variability and may increase the degrees of freedom available to the subject. Further exploration of the effects of optic flow manipulation on locomotion may provide us with an effective tool for rehabilitation of subjects with sensorimotor issues.

  3. Fabrication of synthetic diffractive elements using advanced matrix laser lithography

    International Nuclear Information System (INIS)

    Škeren, M; Svoboda, J; Kveton, M; Fiala, P

    2013-01-01

    In this paper we present a matrix laser writing device based on a demagnified projection of a micro-structure from a computer driven spatial light modulator. The device is capable of writing completely aperiodic micro-structures with resolution higher than 200 000 DPI. An optical system is combined with ultra high precision piezoelectric stages with an elementary step ∼ 4 nm. The device operates in a normal environment, which significantly decreases the costs compared to competitive technologies. Simultaneously, large areas can be exposed up to 100 cm2. The capabilities of the constructed device will be demonstrated on particular elements fabricated for real applications. The optical document security is the first interesting field, where the synthetic image holograms are often combined with sophisticated aperiodic micro-structures. The proposed technology can easily write simple micro-gratings creating the color and kinetic visual effects, but also the diffractive cryptograms, waveguide couplers, and other structures recently used in the field of optical security. A general beam shaping elements and special photonic micro-structures are another important applications which will be discussed in this paper.

  4. Fabrication of synthetic diffractive elements using advanced matrix laser lithography

    Science.gov (United States)

    Škereň, M.; Svoboda, J.; Květoň, M.; Fiala, P.

    2013-02-01

    In this paper we present a matrix laser writing device based on a demagnified projection of a micro-structure from a computer driven spatial light modulator. The device is capable of writing completely aperiodic micro-structures with resolution higher than 200 000 DPI. An optical system is combined with ultra high precision piezoelectric stages with an elementary step ~ 4 nm. The device operates in a normal environment, which significantly decreases the costs compared to competitive technologies. Simultaneously, large areas can be exposed up to 100 cm2. The capabilities of the constructed device will be demonstrated on particular elements fabricated for real applications. The optical document security is the first interesting field, where the synthetic image holograms are often combined with sophisticated aperiodic micro-structures. The proposed technology can easily write simple micro-gratings creating the color and kinetic visual effects, but also the diffractive cryptograms, waveguide couplers, and other structures recently used in the field of optical security. A general beam shaping elements and special photonic micro-structures are another important applications which will be discussed in this paper.

  5. Optical properties of marine waters and the development of bio-optical algorithms

    Digital Repository Service at National Institute of Oceanography (India)

    Desa, E.

    This paper presents the primary optical variables used in the measurement of the optical properties of marine waters. How can in-situ measurements be used in the optical recognition of coastal and open ocean waters. We then look at bio...

  6. EXPERIMENTAL RESEARCHES OF ELECTRO-THERMAL RESISTIBILITY OF SEND-OFFS AND CABLES TO ACTION RATIONED ON THE INTERNATIONAL STANDARD OF IEC 62305-1-2010 OF APERIODIC IMPULSE OF CURRENT OF ARTIFICIAL LIGHTNING

    Directory of Open Access Journals (Sweden)

    M.I. Baranov

    2016-03-01

    Full Text Available Purpose. Experimental researches of electro-thermal resistibility of cable-explorer products, applied in the power electric circuits of objects of electric-power industry, to action on its copper and aluminum parts bearings a current rationed on the International Standard of IEC 62305-1-2010 aperiodic impulse 10/350 μs of current of artificial lightning. Methodology. Electrophysics bases of technique of high tensions and high pulsed currents (HPC, and also scientific and technical bases of planning of devices of high-voltage impulsive technique and measuring HPC in them. Results. Experimental a way the quantitative levels of maximal values maximum of possible and critical closenesses of aperiodic impulse 10/350 μs of current of artificial lightning with rationed on the international standard of IEC 62305-1-2010 peak-temporal parameters and admittances on them in copper (aluminum parts bearings a current of send-offs and cables with a polyethylene (PET and polyvinylchloride (PVCH isolation. Originality. First in world practice on the unique powerful high-voltage generator of HPC of artificial lightning experimental researches of resistibility to lightning of pre-production models of send-offs (cables are conducted with copper (aluminum tendons, PET and PVCH by an isolation, in-use in power electric circuits of electric-power industry objects. Practical value. The use in practice of protecting from lightning of the got results will allow substantially to promote functional and fire-prevention safety of engineering communications of objects of industrial electroenergy in the conditions of action on them of short shots of linear lightning.

  7. Short-timescale variability in cataclysmic binaries

    International Nuclear Information System (INIS)

    Cordova, F.A.; Mason, K.O.

    1982-01-01

    Rapid variability, including flickering and pulsations, has been detected in cataclysmic binaries at optical and x-ray frequencies. In the case of the novalike variable TT Arietis, simultaneous observations reveal that the x-ray and optical flickering activity is strongly correlated, while short period pulsations are observed that occur at the same frequencies in both wavelength bands

  8. Dark-dark solitons for a coupled variable-coefficient higher-order nonlinear Schrödinger system in an inhomogeneous optical fiber

    Science.gov (United States)

    Li, Ming-Zhen; Tian, Bo; Qu, Qi-Xing; Chai, Han-Peng; Liu, Lei; Du, Zhong

    2017-12-01

    In this paper, under investigation is a coupled variable-coefficient higher-order nonlinear Schrödinger system, which describes the simultaneous propagation of optical pulses in an inhomogeneous optical fiber. Based on the Lax pair and binary Darboux transformation, we present the nondegenerate N-dark-dark soliton solutions. With the graphical simulation, soliton propagation and interaction are discussed with the group velocity dispersion and fourth-order dispersion effects, which affect the velocity but have no effect on the amplitude. Linear, parabolic and periodic one dark-dark solitons are displayed. Interactions between the two solitons are presented as well, which are all elastic.

  9. Optical variability of the Seyfert galaxy nuclei

    International Nuclear Information System (INIS)

    Lyutyj, V.M.

    1979-01-01

    The results of the UBV observations of compact Seyfert galaxies during 1968-78 are given. The full amplitude ΔB approximately 2sup(m) of the variability of the nucleus of 3C 120 is considerably larger than that of any other Seyfert galaxy. The minimum brightness of 3C 120 in 1978, B=16sup(m).25 was observed for the first time during the photometric history of the object since 1900. The time delay Δt < or approximately 70sup(d) of the variability of colour index U-B of the nucleus of 3C 120 relatively to that of B and B-V have been discovered. This time delay is interpreted as the variability of the Balmer continuum. The nucleus of 2 Zw 136 appears to show such a variability also. The location of 3C 120 and 2 Zw 136 on two-colour diagram corresponds to the combined colours of hot (05) and cold (K-M) stars, if the time delay of U-B variability is taken into account. The colour indices of the nucleus of 3C 120 during the minimum of 1978 (B=16sup(m).25) correspond to those of the ring between the 7''-30'' apertures. This indicates to a very small contributions of the variable source during the 1978 minimum

  10. Evidence for deterministic chaos in aperiodic oscillations of acute lymphoblastic leukemia cells in long-term culture

    Science.gov (United States)

    Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.

    Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.

  11. Integrated MEMS-based variable optical attenuator and 10Gb/s receiver

    Science.gov (United States)

    Aberson, James; Cusin, Pierre; Fettig, H.; Hickey, Ryan; Wylde, James

    2005-03-01

    MEMS devices can be successfully commercialized in favour of competing technologies only if they offer an advantage to the customer in terms of lower cost or increased functionality. There are limited markets where MEMS can be manufactured cheaper than similar technologies due to large volumes: automotive, printing technology, wireless communications, etc. However, success in the marketplace can also be realized by adding significant value to a system at minimal cost or leverging MEMS technology when other solutions simply will not work. This paper describes a thermally actuated, MEMS based, variable optical attenuator that is co-packaged with existing opto-electronic devices to develop an integrated 10Gb/s SONET/SDH receiver. The configuration of the receiver opto-electronics and relatively low voltage availability (12V max) in optical systems bar the use of LCD, EO, and electro-chromic style attenuators. The device was designed and fabricated using a silicon-on-insulator (SOI) starting material. The design and performance of the device (displacement, power consumption, reliability, physical geometry) was defined by the receiver parameters geometry. This paper will describe how these design parameters (hence final device geometry) were determined in light of both the MEMS device fabrication process and the receiver performance. Reference will be made to the design tools used and the design flow which was a joint effort between the MEMS vendor and the end customer. The SOI technology offered a robust, manufacturable solution that gave the required performance in a cost-effective process. However, the singulation of the devices required the development of a new singulation technique that allowed large volumes of silicon to be removed during fabrication yet still offer high singulation yields.

  12. Quasi-periodic Pulse Amplitude Modulation in the Accreting Millisecond Pulsar IGR J00291+5934

    Energy Technology Data Exchange (ETDEWEB)

    Bult, Peter [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Doesburgh, Marieke van; Klis, Michiel van der [Anton Pannekoek Institute, University of Amsterdam, Postbus 94249, 1090 GE Amsterdam (Netherlands)

    2017-08-20

    We introduce a new method for analyzing the aperiodic variability of coherent pulsations in accreting millisecond X-ray pulsars (AMXPs). Our method involves applying a complex frequency correction to the time-domain light curve, allowing for the aperiodic modulation of the pulse amplitude to be robustly extracted in the frequency domain. We discuss the statistical properties of the resulting modulation spectrum and show how it can be correlated with the non-pulsed emission to determine if the periodic and aperiodic variability are coupled processes. Using this method, we study the 598.88 Hz coherent pulsations of the AMXP IGR J00291+5934 as observed with the Rossi X-ray Timing Explorer and XMM-Newton . We demonstrate that our method easily confirms the known coupling between the pulsations and a strong 8 mHz quasi-periodic oscillation (QPO) in XMM-Newton observations. Applying our method to the RXTE observations, we further show, for the first time, that the much weaker 20 mHz QPO and its harmonic are also coupled with the pulsations. We discuss the implications of this coupling and indicate how it may be used to extract new information on the underlying accretion process.

  13. ENSEMBLE VARIABILITY OF NEAR-INFRARED-SELECTED ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Kouzuma, S.; Yamaoka, H.

    2012-01-01

    We present the properties of the ensemble variability V for nearly 5000 near-infrared active galactic nuclei (AGNs) selected from the catalog of Quasars and Active Galactic Nuclei (13th Edition) and the SDSS-DR7 quasar catalog. From three near-infrared point source catalogs, namely, Two Micron All Sky Survey (2MASS), Deep Near Infrared Survey (DENIS), and UKIDSS/LAS catalogs, we extract 2MASS-DENIS and 2MASS-UKIDSS counterparts for cataloged AGNs by cross-identification between catalogs. We further select variable AGNs based on an optimal criterion for selecting the variable sources. The sample objects are divided into subsets according to whether near-infrared light originates by optical emission or by near-infrared emission in the rest frame; and we examine the correlations of the ensemble variability with the rest-frame wavelength, redshift, luminosity, and rest-frame time lag. In addition, we also examine the correlations of variability amplitude with optical variability, radio intensity, and radio-to-optical flux ratio. The rest-frame optical variability of our samples shows negative correlations with luminosity and positive correlations with rest-frame time lag (i.e., the structure function, SF), and this result is consistent with previous analyses. However, no well-known negative correlation exists between the rest-frame wavelength and optical variability. This inconsistency might be due to a biased sampling of high-redshift AGNs. Near-infrared variability in the rest frame is anticorrelated with the rest-frame wavelength, which is consistent with previous suggestions. However, correlations of near-infrared variability with luminosity and rest-frame time lag are the opposite of these correlations of the optical variability; that is, the near-infrared variability is positively correlated with luminosity but negatively correlated with the rest-frame time lag. Because these trends are qualitatively consistent with the properties of radio-loud quasars reported

  14. Short time-scale optical variability properties of the largest AGN sample observed with Kepler/K2

    Science.gov (United States)

    Aranzana, E.; Körding, E.; Uttley, P.; Scaringi, S.; Bloemen, S.

    2018-05-01

    We present the first short time-scale (˜hours to days) optical variability study of a large sample of active galactic nuclei (AGNs) observed with the Kepler/K2 mission. The sample contains 252 AGN observed over four campaigns with ˜30 min cadence selected from the Million Quasar Catalogue with R magnitude <19. We performed time series analysis to determine their variability properties by means of the power spectral densities (PSDs) and applied Monte Carlo techniques to find the best model parameters that fit the observed power spectra. A power-law model is sufficient to describe all the PSDs of our sample. A variety of power-law slopes were found indicating that there is not a universal slope for all AGNs. We find that the rest-frame amplitude variability in the frequency range of 6 × 10-6-10-4 Hz varies from 1to10 per cent with an average of 1.7 per cent. We explore correlations between the variability amplitude and key parameters of the AGN, finding a significant correlation of rest-frame short-term variability amplitude with redshift. We attribute this effect to the known `bluer when brighter' variability of quasars combined with the fixed bandpass of Kepler data. This study also enables us to distinguish between Seyferts and blazars and confirm AGN candidates. For our study, we have compared results obtained from light curves extracted using different aperture sizes and with and without detrending. We find that limited detrending of the optimal photometric precision light curve is the best approach, although some systematic effects still remain present.

  15. A hydro-optical model for deriving water quality variables from satellite images (HydroSat): A case study of the Nile River demonstrating the future Sentinel-2 capabilities

    NARCIS (Netherlands)

    Salama, M.; Radwan, M.; van der Velde, R.

    2012-01-01

    This paper describes a hydro-optical model for deriving water quality variables from satellite images, hereafter HydroSat. HydroSat corrects images for atmospheric interferences and simultaneously retrieves water quality variables. An application of HydroSat to Landsat Enhanced Thematic Mapper (ETM)

  16. THE TIME-DOMAIN SPECTROSCOPIC SURVEY: UNDERSTANDING THE OPTICALLY VARIABLE SKY WITH SEQUELS IN SDSS-III

    International Nuclear Information System (INIS)

    Ruan, John J.; Anderson, Scott F.; Davenport, James R. A.; Green, Paul J.; Morganson, Eric; Eracleous, Michael; Brandt, William N.; Myers, Adam D.; Badenes, Carles; Bershady, Matthew A.; Chambers, Kenneth C.; Flewelling, Heather; Kaiser, Nick; Dawson, Kyle S.; Heckman, Timothy M.; Isler, Jedidah C.; Kneib, Jean-Paul; MacLeod, Chelsea L.; Ross, Nicholas P.; Paris, Isabelle

    2016-01-01

    The Time-Domain Spectroscopic Survey (TDSS) is an SDSS-IV eBOSS subproject primarily aimed at obtaining identification spectra of ∼220,000 optically variable objects systematically selected from SDSS/Pan-STARRS1 multi-epoch imaging. We present a preview of the science enabled by TDSS, based on TDSS spectra taken over ∼320 deg 2 of sky as part of the SEQUELS survey in SDSS-III, which is in part a pilot survey for eBOSS in SDSS-IV. Using the 15,746 TDSS-selected single-epoch spectra of photometrically variable objects in SEQUELS, we determine the demographics of our variability-selected sample and investigate the unique spectral characteristics inherent in samples selected by variability. We show that variability-based selection of quasars complements color-based selection by selecting additional redder quasars and mitigates redshift biases to produce a smooth quasar redshift distribution over a wide range of redshifts. The resulting quasar sample contains systematically higher fractions of blazars and broad absorption line quasars than from color-selected samples. Similarly, we show that M dwarfs in the TDSS-selected stellar sample have systematically higher chromospheric active fractions than the underlying M-dwarf population based on their H α emission. TDSS also contains a large number of RR Lyrae and eclipsing binary stars with main-sequence colors, including a few composite-spectrum binaries. Finally, our visual inspection of TDSS spectra uncovers a significant number of peculiar spectra, and we highlight a few cases of these interesting objects. With a factor of ∼15 more spectra, the main TDSS survey in SDSS-IV will leverage the lessons learned from these early results for a variety of time-domain science applications.

  17. Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates

    Science.gov (United States)

    Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.

    2018-06-01

    Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and ultraviolet (UV) luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20 per cent (˜37 per cent) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most approximately one-third of these periodic candidates can harbor Doppler-modulated SMBHBs.

  18. THE TIME-DOMAIN SPECTROSCOPIC SURVEY: UNDERSTANDING THE OPTICALLY VARIABLE SKY WITH SEQUELS IN SDSS-III

    Energy Technology Data Exchange (ETDEWEB)

    Ruan, John J.; Anderson, Scott F.; Davenport, James R. A. [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Green, Paul J.; Morganson, Eric [Harvard Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Eracleous, Michael; Brandt, William N. [Department of Astronomy and Astrophysics, 525 Davey Lab, The Pennsylvania State University, University Park, PA 16802 (United States); Myers, Adam D. [Department of Physics and Astronomy 3905, University of Wyoming, 1000 E. University, Laramie, WY 82071 (United States); Badenes, Carles [Department of Physics and Astronomy and Pittsburgh Particle Physics, Astrophysics, and Cosmology Center (PITT-PACC), University of Pittsburgh (United States); Bershady, Matthew A. [Department of Astronomy, University of Wisconsin-Madison, 475 N. Charter Street, Madison, WI 53706 (United States); Chambers, Kenneth C.; Flewelling, Heather; Kaiser, Nick [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Dawson, Kyle S. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Heckman, Timothy M. [Center for Astrophysical Sciences, Department of Physics and Astronomy, Johns Hopkins University, Baltimore, MD 21218 (United States); Isler, Jedidah C. [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States); Kneib, Jean-Paul [Laboratoire d’astrophysique, Ecole Polytechnique Fédérale de Lausanne Observatoire de Sauverny, 1290 Versoix (Switzerland); MacLeod, Chelsea L.; Ross, Nicholas P. [Institute for Astronomy, University of Edinburgh, Royal Observatory, Edinburgh, EH9 3HJ (United Kingdom); Paris, Isabelle, E-mail: jruan@astro.washington.edu [INAF—Osservatorio Astronomico di Trieste, Via G. B. Tiepolo 11, I-34131 Trieste (Italy); and others

    2016-07-10

    The Time-Domain Spectroscopic Survey (TDSS) is an SDSS-IV eBOSS subproject primarily aimed at obtaining identification spectra of ∼220,000 optically variable objects systematically selected from SDSS/Pan-STARRS1 multi-epoch imaging. We present a preview of the science enabled by TDSS, based on TDSS spectra taken over ∼320 deg{sup 2} of sky as part of the SEQUELS survey in SDSS-III, which is in part a pilot survey for eBOSS in SDSS-IV. Using the 15,746 TDSS-selected single-epoch spectra of photometrically variable objects in SEQUELS, we determine the demographics of our variability-selected sample and investigate the unique spectral characteristics inherent in samples selected by variability. We show that variability-based selection of quasars complements color-based selection by selecting additional redder quasars and mitigates redshift biases to produce a smooth quasar redshift distribution over a wide range of redshifts. The resulting quasar sample contains systematically higher fractions of blazars and broad absorption line quasars than from color-selected samples. Similarly, we show that M dwarfs in the TDSS-selected stellar sample have systematically higher chromospheric active fractions than the underlying M-dwarf population based on their H α emission. TDSS also contains a large number of RR Lyrae and eclipsing binary stars with main-sequence colors, including a few composite-spectrum binaries. Finally, our visual inspection of TDSS spectra uncovers a significant number of peculiar spectra, and we highlight a few cases of these interesting objects. With a factor of ∼15 more spectra, the main TDSS survey in SDSS-IV will leverage the lessons learned from these early results for a variety of time-domain science applications.

  19. Quantifying fluxes and characterizing compositional changes of dissolved organic matter in aquatic systems in situ using combined acoustic and optical measurements

    Science.gov (United States)

    Downing, B.D.; Boss, E.; Bergamaschi, B.A.; Fleck, J.A.; Lionberger, M.A.; Ganju, N.K.; Schoellhamer, D.H.; Fujii, R.

    2009-01-01

    Studying the dynamics and geochemical behavior of dissolved and particulate organic material is difficult because concentration and composition may rapidly change in response to aperiodic as well as periodic physical and biological forcing. Here we describe a method useful for quantifying fluxes and analyzing dissolved organic matter (DOM) dynamics. The method uses coupled optical and acoustic measurements that provide robust quantitative estimates of concentrations and constituent characteristics needed to investigate processes and calculate fluxes of DOM in tidal and other lotic environments. Data were collected several times per hour for 2 weeks or more, with the frequency and duration limited only by power consumption and data storage capacity. We assessed the capabilities and limitations of the method using data from a winter deployment in a natural tidal wetland of the San Francisco Bay estuary. We used statistical correlation of in situ optical data with traditional laboratory analyses of discrete water samples to calibrate optical properties suited as proxies for DOM concentrations and characterizations. Coupled with measurements of flow velocity, we calculated long-term residual horizontal fluxes of DOC into and out from a tidal wetland. Subsampling the dataset provides an estimate for the maximum sampling interval beyond which the error in flux estimate is significantly increased.?? 2009, by the American Society of Limnology and Oceanography, Inc.

  20. Intelligent Optical Systems Using Adaptive Optics

    Science.gov (United States)

    Clark, Natalie

    2012-01-01

    Until recently, the phrase adaptive optics generally conjured images of large deformable mirrors being integrated into telescopes to compensate for atmospheric turbulence. However, the development of smaller, cheaper devices has sparked interest for other aerospace and commercial applications. Variable focal length lenses, liquid crystal spatial light modulators, tunable filters, phase compensators, polarization compensation, and deformable mirrors are becoming increasingly useful for other imaging applications including guidance navigation and control (GNC), coronagraphs, foveated imaging, situational awareness, autonomous rendezvous and docking, non-mechanical zoom, phase diversity, and enhanced multi-spectral imaging. The active components presented here allow flexibility in the optical design, increasing performance. In addition, the intelligent optical systems presented offer advantages in size and weight and radiation tolerance.

  1. Variability of aerosol optical properties in the Western Mediterranean Basin

    Directory of Open Access Journals (Sweden)

    M. Pandolfi

    2011-08-01

    Full Text Available Aerosol light scattering, absorption and particulate matter (PM concentrations were measured at Montseny, a regional background site in the Western Mediterranean Basin (WMB which is part of the European Supersite for Atmospheric Aerosol Research (EUSAAR. Off line analyses of 24 h PM filters collected with Hi-Vol instruments were performed for the determination of the main chemical components of PM. Mean scattering and hemispheric backscattering coefficients (@ 635 nm were 26.6±23.2 Mm−1 and 4.3±2.7 Mm−1, respectively and the mean aerosol absorption coefficient (@ 637 nm was 2.8±2.2 Mm−1. Mean values of Single Scattering Albedo (SSA and Ångström exponent (å (calculated from 450 nm to 635 nm at MSY were 0.90±0.05 and 1.3±0.5 respectively. A clear relationship was observed between the PM1/PM10 and PM2.5/PM10 ratios as a function of the calculated Ångström exponents. Mass scattering cross sections (MSC for fine mass and sulfate at 635 nm were 2.8±0.5 m2 g−1 and 11.8±2.2 m2 g−1, respectively, while the mean aerosol absorption cross section (MAC was 10.4±2.0 m2 g−1. The variability in aerosol optical properties in the WMB were largely explained by the origin and ageing of air masses over the measurement site. The MAC values appear dependent of particles aging: similar to the expected absorption cross-section for fresh emissions under Atlantic Advection episodes and higher under aerosol pollution episodes. The analysis of the Ångström exponent as a function of the origin the air masses revealed that polluted winter anticyclonic conditions and summer recirculation scenarios typical of the WMB led to an increase of fine particles in the atmosphere (å = 1.5±0.1 while the aerosol optical properties under Atlantic Advection episodes and Saharan dust outbreaks were clearly

  2. Low power consumption 4-channel variable optical attenuator array based on planar lightwave circuit technique

    International Nuclear Information System (INIS)

    Ren Mei-Zhen; Zhang Jia-Shun; An Jun-Ming; Wang Yue; Wang Liang-Liang; Li Jian-Guang; Wu Yuan-Da; Yin XiaoJie; Hu Xiong-Wei

    2017-01-01

    The power consumption of a variable optical attenuator (VOA) array based on a silica planar lightwave circuit was investigated. The thermal field profile of the device was optimized using the finite-element analysis. The simulation results showed that the power consumption reduces as the depth of the heat-insulating grooves is deeper, the up-cladding is thinner, the down-cladding is thicker, and the width of the cladding ridge is narrower. The materials component and thickness of the electrodes were also optimized to guarantee the driving voltage under 5 V. The power consumption was successfully reduced to as low as 155 mW at an attenuation of 30 dB in the experiment. (paper)

  3. DISCOVERY OF DRAMATIC OPTICAL VARIABILITY IN SDSS J1100+4421: A PECULIAR RADIO-LOUD NARROW-LINE SEYFERT 1 GALAXY?

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Masaomi [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Morokuma, Tomoki; Doi, Mamoru; Kikuchi, Yuki [Institute of Astronomy, School of Science, University of Tokyo, Mitaka, Tokyo 181-0015 (Japan); Itoh, Ryosuke [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Akitaya, Hiroshi; Tanaka, Yasuyuki T.; Kawabata, Koji S. [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Tominaga, Nozomu [Department of Physics, Faculty of Science and Engineering, Konan University, Kobe, Hyogo 658-8501 (Japan); Saito, Yoshihiko; Kawai, Nobuyuki [Department of Physics, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551 (Japan); Stawarz, Łukasz [Institute of Space and Astronautical Science, JAXA, Sagamihara, Kanagawa 252-5210 (Japan); Gandhi, Poshak [Department of Physics, Durham University, Durham DH1-3LE (United Kingdom); Ali, Gamal; Essam, Ahmad; Hamed, Gamal [National Research Institute of Astronomy and Geophysics, Helwan, Cairo (Egypt); Aoki, Tsutomu [Kiso Observatory, Institute of Astronomy, School of Science, The University of Tokyo, Kiso, Nagano 397-0101 (Japan); Contreras, Carlos; Hsiao, Eric Y. [Carnegie Observatories, Las Campanas Observatory, Colina El Pino, Casilla 601 (Chile); Iwata, Ikuru, E-mail: masaomi.tanaka@nao.ac.jp [Subaru Telescope, National Astronomical Observatory of Japan, Hilo, HI 96720 (United States); and others

    2014-10-01

    We present our discovery of dramatic variability in SDSS J1100+4421 by the high-cadence transient survey Kiso Supernova Survey. The source brightened in the optical by at least a factor of three within about half a day. Spectroscopic observations suggest that this object is likely a narrow-line Seyfert 1 galaxy (NLS1) at z = 0.840, however, with unusually strong narrow emission lines. The estimated black hole mass of ∼10{sup 7} M {sub ☉} implies bolometric nuclear luminosity close to the Eddington limit. SDSS J1100+4421 is also extremely radio-loud, with a radio loudness parameter of R ≅ 4 × 10{sup 2}-3 × 10{sup 3}, which implies the presence of relativistic jets. Rapid and large-amplitude optical variability of the target, reminiscent of that found in a few radio- and γ-ray-loud NLS1s, is therefore produced most likely in a blazar-like core. The 1.4 GHz radio image of the source shows an extended structure with a linear size of about 100 kpc. If SDSS J1100+4421 is a genuine NLS1, as suggested here, this radio structure would then be the largest ever discovered in this type of active galaxies.

  4. Constraining the variability of optical properties in the Santa Barbara Channel, CA: A phytoplankton story

    Science.gov (United States)

    Barron, Rebecca Katherine

    approximately 16% of surface water data. Variability in CDOM spectral shape was quantified using the EOF technique, and regression analysis with EOF outputs showed that CDOM absorption intensity and spectral shape were well correlated dinoflagellate presence. Furthermore, results showed that phytoplankton biomass played a secondary role in relation to CDOM absorption, and that variability in CDOM absorption coefficients were primarily driven by community composition. CDOM quality in the SBC was also assessed using CDOM fluorescence properties via excitation emission matrix spectroscopy (EEMS). The EEMS data was analyzed using a multivariate statistical procedure, again, an EOF analysis, to identify three dominant CDOM source regimes: the surface pelagic regime, deep-water (up to 300 m) regime and kelp forest pelagic regime. This work also found that while CDOM absorption coefficient was strongly influence by which phytoplankton groups were present, DOM quality was characterized more so by the amount of phytoplankton biomass, hence indicating strong microbial component to DOM production. Lastly, with the use of the EEMS data, and characterization of CDOM absorption properties, e.g. spectral slope, S, slope ratio, SR, specific UV-absorbance, SUVA and MAA Index, we found that terrestrial sources of CDOM were very limited in the SBC. Based on this research, mineral particle concentrations that significantly correlated with IOPs were thought to be associated with suspended sediments from shoaling of the continental shelf rather than from stream/river influence. Thus, the SBC is a unique, optically complex ocean system where IOP dynamics, thus remote sensing reflectance, are strongly influenced by shifts in phytoplankton community structure.

  5. Anterior Segment Optical Coherence Tomography for Tear Meniscus Evaluation and its Correlation with other Tear Variables in Healthy Individuals

    Science.gov (United States)

    Dhasmana, Renu; Nagpal, Ramesh Chander

    2016-01-01

    Introduction Dry eye is one of the most common ocular diseases in this cyber era. Despite availability of multiple tests, no single test is accurate for the diagnosis of dry eye. Anterior segment optical coherence tomography is the recent tool which can be added in the armentarium of dry eye tests. Aim To evaluate tear meniscus with anterior segment optical coherence tomography and its correlation with other tear variables in normal healthy individuals. Materials and Methods In this prospective cross-sectional observational study, right eye of 203 consecutive patients were studied. All the patients were divided into three groups Group 1, 2 and 3 according to their age ≤20 years, 21-40 years and >40 years respectively. All patients underwent routine ophthalmologic examinations along with slit-lamp bio-microscopy for tear meniscus height measurement, tear film break up time, Schirmer’s I test (with anaesthesia) and optical coherence tomography imaging of inferior tear meniscus height. After focusing of the instrument with a Cross Line (CL) centered on lower tear meniscus at 6’0 clock of cornea, a 6 mm long scan was obtained. The tear meniscus height (μm) and tear meniscus area (mm2) were measured manually with help of callipers by joining upper corneo-meniscus junction to the lower lid-meniscus junction and tear meniscus height and area within the plotted line respectively and calculated by using the integrated analysis available in the custom software. Results There was significant decrease in the all tear variables with the increase in the age. According to age groups in group 1, the mean Schirmer’s (24.0±4.9)mm, tear film break up time (11.1±1.9) sec, tear meniscus height on slit lamp (600.2±167.3)mm were higher but decreased in group 2 (21.5±5.4,10.8±1.4, 597.5±186.3) and group 3 (19.8 ± 5.1, 10.2 ± 1.6, 485.6 ± 157.7) respectively. Schirmer’s test values and tear film break up time were similar in both sexes (p=0.1 and p= 0.9). Tear meniscus

  6. Analysis of optically variable devices using a photometric light-field approach

    Science.gov (United States)

    Soukup, Daniel; Å tolc, Svorad; Huber-Mörk, Reinhold

    2015-03-01

    Diffractive Optically Variable Image Devices (DOVIDs), sometimes loosely referred to as holograms, are popular security features for protecting banknotes, ID cards, or other security documents. Inspection, authentication, as well as forensic analysis of these security features are still demanding tasks requiring special hardware tools and expert knowledge. Existing equipment for such analyses is based either on a microscopic analysis of the grating structure or a point-wise projection and recording of the diffraction patterns. We investigated approaches for an examination of DOVID security features based on sampling the Bidirectional Reflectance Distribution Function (BRDF) of DOVIDs using photometric stereo- and light-field-based methods. Our approach is demonstrated on the practical task of automated discrimination between genuine and counterfeited DOVIDs on banknotes. For this purpose, we propose a tailored feature descriptor which is robust against several expected sources of inaccuracy but still specific enough for the given task. The suggested approach is analyzed from both theoretical as well as practical viewpoints and w.r.t. analysis based on photometric stereo and light fields. We show that especially the photometric method provides a reliable and robust tool for revealing DOVID behavior and authenticity.

  7. THE MICRO-ARCSECOND SCINTILLATION-INDUCED VARIABILITY (MASIV) SURVEY. III. OPTICAL IDENTIFICATIONS AND NEW REDSHIFTS

    Energy Technology Data Exchange (ETDEWEB)

    Pursimo, Tapio [Nordic Optical Telescope, Apartado 474, 38700 Santa Cruz de La Palma (Spain); Ojha, Roopesh [NVI Inc./U. S. Naval Observatory, 3450 Massachusetts Ave NW, Washington DC (United States); Jauncey, David L. [CSIRO Astronomy and Space Science and Mount Stromlo Observatory, Canberra ACT 0200 (Australia); Rickett, Barney J. [Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, CA 92093 (United States); Dutka, Michael S. [The Catholic University of America, 620 Michigan Ave., N.E., Washington DC 20064 (United States); Koay, Jun Yi; Bignall, Hayley E.; Macquart, Jean-Pierre [ICRAR, Curtin University, Bentley, WA 6845 (Australia); Lovell, James E. J. [School of Mathematics and Physics, University of Tasmania, TAS 7001 (Australia); Kedziora-Chudczer, Lucyna, E-mail: tpursimo@not.iac.es [School of Physics and Astrophysics, UNSW, Sydney NSW 2052 (Australia)

    2013-04-10

    Intraday variability (IDV) of the radio emission from active galactic nuclei is now known to be predominantly due to interstellar scintillation (ISS). The MASIV (The Micro-Arcsecond Scintillation-Induced Variability) survey of 443 flat spectrum sources revealed that the IDV is related to the radio flux density and redshift. A study of the physical properties of these sources has been severely handicapped by the absence of reliable redshift measurements for many of these objects. This paper presents 79 new redshifts and a critical evaluation of 233 redshifts obtained from the literature. We classify spectroscopic identifications based on emission line properties, finding that 78% of the sources have broad emission lines and are mainly FSRQs. About 16% are weak lined objects, chiefly BL Lacs, and the remaining 6% are narrow line objects. The gross properties (redshift, spectroscopic class) of the MASIV sample are similar to those of other blazar surveys. However, the extreme compactness implied by ISS favors FSRQs and BL Lacs in the MASIV sample as these are the most compact object classes. We confirm that the level of IDV depends on the 5 GHz flux density for all optical spectral types. We find that BL Lac objects tend to be more variable than broad line quasars. The level of ISS decreases substantially above a redshift of about two. The decrease is found to be generally consistent with ISS expected for beamed emission from a jet that is limited to a fixed maximum brightness temperature in the source rest frame.

  8. A mathematical model for describing the retinal nerve fiber bundle trajectories in the human eye: average course, variability, and influence of refraction, optic disc size and optic disc position.

    Science.gov (United States)

    Jansonius, Nomdo M; Schiefer, Julia; Nevalainen, Jukka; Paetzold, Jens; Schiefer, Ulrich

    2012-12-01

    Previously we developed a mathematical model for describing the retinal nerve fiber bundle trajectories in the superior-temporal and inferior-temporal regions of the human retina, based on traced trajectories extracted from fundus photographs. Aims of the current study were to (i) validate the existing model, (ii) expand the model to the entire retina and (iii) determine the influence of refraction, optic disc size and optic disc position on the trajectories. A new set of fundus photographs was collected comprising 28 eyes of 28 subjects. From these 28 photographs, 625 trajectories were extracted. Trajectories in the temporal region of the retina were compared to the existing model. In this region, 347 of 399 trajectories (87%) were within the 95% central range of the existing model. The model was extended to the nasal region. With this extension, the model can now be applied to the entire retina that corresponds to the visual field as tested with standard automated perimetry (up to approximately 30° eccentricity). There was an asymmetry between the superior and inferior hemifields and a considerable location-specific inter-subject variability. In the nasal region, we found two "singularities", located roughly at the one and five o'clock positions for the right optic disc. Here, trajectories from relatively widespread areas of the retina converge. Associations between individual deviations from the model and refraction, optic disc size and optic disc position were studied with multiple linear regression. Refraction (P = 0.021) and possibly optic disc inclination (P = 0.09) influenced the trajectories in the superior-temporal region. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Correlations between Optical Variability and Physical Parameters of ...

    Indian Academy of Sciences (India)

    ever, the predicted positive correlation between variability and black hole mass seems to be ... Introduction. Variability is one of the .... Accompanied by the slope b_X and y-axis intercept value a_X, the Pearson product- moment correlation ...

  10. Compact Spectrometers Based on Linear Variable Filters

    Data.gov (United States)

    National Aeronautics and Space Administration — Demonstrate a linear-variable spectrometer with an H2RG array. Linear Variable Filter (LVF) spectrometers provide attractive resource benefits – high optical...

  11. Realisation and optical engineering of linear variable bandpass filters in nanoporous anodic alumina photonic crystals.

    Science.gov (United States)

    Sukarno; Law, Cheryl Suwen; Santos, Abel

    2017-06-08

    We present the first realisation of linear variable bandpass filters in nanoporous anodic alumina (NAA-LVBPFs) photonic crystal structures. NAA gradient-index filters (NAA-GIFs) are produced by sinusoidal pulse anodisation and used as photonic crystal platforms to generate NAA-LVBPFs. The anodisation period of NAA-GIFs is modified from 650 to 850 s to systematically tune the characteristic photonic stopband of these photonic crystals across the UV-visible-NIR spectrum. Then, the nanoporous structure of NAA-GIFs is gradually widened along the surface under controlled conditions by wet chemical etching using a dip coating approach aiming to create NAA-LVBPFs with finely engineered optical properties. We demonstrate that the characteristic photonic stopband and the iridescent interferometric colour displayed by these photonic crystals can be tuned with precision across the surface of NAA-LVBPFs by adjusting the fabrication and etching conditions. Here, we envisage for the first time the combination of the anodisation period and etching conditions as a cost-competitive, facile, and versatile nanofabrication approach that enables the generation of a broad range of unique LVBPFs covering the spectral regions. These photonic crystal structures open new opportunities for multiple applications, including adaptive optics, hyperspectral imaging, fluorescence diagnostics, spectroscopy, and sensing.

  12. Experimental investigation of the transverse modal instabilities onset in high power fully-aperiodic-large-pitch fiber lasers

    Science.gov (United States)

    Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe

    2018-02-01

    Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.

  13. Variability-based active galactic nucleus selection using image subtraction in the SDSS and LSST era

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Yumi; Gibson, Robert R.; Becker, Andrew C.; Ivezić, Željko; Connolly, Andrew J.; Ruan, John J.; Anderson, Scott F. [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); MacLeod, Chelsea L., E-mail: ymchoi@astro.washington.edu [Physics Department, U.S. Naval Academy, 572 Holloway Road, Annapolis, MD 21402 (United States)

    2014-02-10

    With upcoming all-sky surveys such as LSST poised to generate a deep digital movie of the optical sky, variability-based active galactic nucleus (AGN) selection will enable the construction of highly complete catalogs with minimum contamination. In this study, we generate g-band difference images and construct light curves (LCs) for QSO/AGN candidates listed in Sloan Digital Sky Survey Stripe 82 public catalogs compiled from different methods, including spectroscopy, optical colors, variability, and X-ray detection. Image differencing excels at identifying variable sources embedded in complex or blended emission regions such as Type II AGNs and other low-luminosity AGNs that may be omitted from traditional photometric or spectroscopic catalogs. To separate QSOs/AGNs from other sources using our difference image LCs, we explore several LC statistics and parameterize optical variability by the characteristic damping timescale (τ) and variability amplitude. By virtue of distinguishable variability parameters of AGNs, we are able to select them with high completeness of 93.4% and efficiency (i.e., purity) of 71.3%. Based on optical variability, we also select highly variable blazar candidates, whose infrared colors are consistent with known blazars. One-third of them are also radio detected. With the X-ray selected AGN candidates, we probe the optical variability of X-ray detected optically extended sources using their difference image LCs for the first time. A combination of optical variability and X-ray detection enables us to select various types of host-dominated AGNs. Contrary to the AGN unification model prediction, two Type II AGN candidates (out of six) show detectable variability on long-term timescales like typical Type I AGNs. This study will provide a baseline for future optical variability studies of extended sources.

  14. Reflective variable optical attenuators and fibre ring lasers for wavelength-division multiplexing systems

    Science.gov (United States)

    Liu, He Liang

    Wavelength division multiplexing (WDM) optical fibre system is an important enabling technology to fulfill the demands for bandwidth in the modern information age. The main objective of this project is to study novel devices with the potential to enhance the performance of WDM systems. In particular, a novel reflective variable optical attenuator (RVOA) used for dynamic gain equalization (DGE) and fibre lasers based on an entirely new type of erbium-doped fibres with ultrawide tuning range were investigated theoretically and experimentally. We proposed a new type of RVOA device which could be potentially integrated with arrayed waveguide grating (AWG) to reduce the cost of DGE substantially. Initially, fibre-based RVOAs, fabricated with optical fibre components such as fibre coupler and Faraday rotator mirror, were investigated theoretically and experimentally. Larger attenuation range up to 22 dB was realized for fibre coupler-based ROVA with a Faraday rotator mirror and its polarization-dependent loss is about 0.5 dB. Then polymeric waveguide-based RVOAs were investigated theoretically and experimentally. Using an epoxy Novolak resin as core material and an UV-cured resin (Norland's NOA61) as cladding material, a polymeric waveguide RVOA was successfully fabricated. The dynamic 15 dB attenuation range was achieved and the PDL was less than 0.2 dB. The measured insertion loss of the polymeric waveguide RVOA was too large (about 18 dB) and was mainly induced by coupling loss, material loss and poor alignment. In the second part of the study, fibre ring lasers with continuous wavelength tuning over wide wavelength range and fibre ring lasers with discrete wavelength tuning were investigated. Tunable lasers are important devices in WDM systems because they could be employed as reserved sources and therefore avoiding the need to stock large inventory of lasers to cover the ITU-wavelength grid. In this project, erbium ions doped bismuth oxide glass fibres instead of

  15. Optical variability of the medium-bright quasar sample

    International Nuclear Information System (INIS)

    Huang, K.; Mitchell, K.J.; Usher, P.D.

    1990-01-01

    A variability study of the 32-member Medium-Bright Quasar Sample is reported. It is found that the star US 1953 has undergone a noticeable variation in the course of 26 hr. Apparent variations in the extragalactic object US 3498 may be illusory, owing to its partially resolved appearance. No other evidence for variability was detected. 34 refs

  16. Optical crop sensor for variable-rate nitrogen fertilization in corn: i - plant nutrition and dry matter production

    Directory of Open Access Journals (Sweden)

    Jardes Bragagnolo

    2013-10-01

    Full Text Available Variable-rate nitrogen fertilization (VRF based on optical spectrometry sensors of crops is a technological innovation capable of improving the nutrient use efficiency (NUE and mitigate environmental impacts. However, studies addressing fertilization based on crop sensors are still scarce in Brazilian agriculture. This study aims to evaluate the efficiency of an optical crop sensor to assess the nutritional status of corn and compare VRF with the standard strategy of traditional single-rate N fertilization (TSF used by farmers. With this purpose, three experiments were conducted at different locations in Southern Brazil, in the growing seasons 2008/09 and 2010/11. The following crop properties were evaluated: above-ground dry matter production, nitrogen (N content, N uptake, relative chlorophyll content (SPAD reading, and a vegetation index measured by the optical sensor N-Sensor® ALS. The plants were evaluated in the stages V4, V6, V8, V10, V12 and at corn flowering. The experiments had a completely randomized design at three different sites that were analyzed separately. The vegetation index was directly related to above-ground dry matter production (R² = 0.91; p<0.0001, total N uptake (R² = 0.87; p<0.0001 and SPAD reading (R² = 0.63; p<0.0001 and inversely related to plant N content (R² = 0.53; p<0.0001. The efficiency of VRF for plant nutrition was influenced by the specific climatic conditions of each site. Therefore, the efficiency of the VRF strategy was similar to that of the standard farmer fertilizer strategy at sites 1 and 2. However, at site 3 where the climatic conditions were favorable for corn growth, the use of optical sensors to determine VRF resulted in a 12 % increase in N plant uptake in relation to the standard fertilization, indicating the potential of this technology to improve NUE.

  17. All-optical delay technique for supporting multiple antennas in a hybrid optical - wireless transmission system

    DEFF Research Database (Denmark)

    Prince, Kamau; Chiuchiarelli, A; Presi, M

    2008-01-01

    We introduce a novel continuously-variable optical delay technique to support beam-forming wireless communications systems using antenna arrays. We demonstrate delay with 64-QAM modulated signals at a rate of 15 Msymbol/sec with 2.5 GHz carrier frequency.......We introduce a novel continuously-variable optical delay technique to support beam-forming wireless communications systems using antenna arrays. We demonstrate delay with 64-QAM modulated signals at a rate of 15 Msymbol/sec with 2.5 GHz carrier frequency....

  18. XMM-NEWTON AND OPTICAL OBSERVATIONS OF CATACLYSMIC VARIABLES FROM THE SLOAN DIGITAL SKY SURVEY

    International Nuclear Information System (INIS)

    Hilton, Eric J.; Szkody, Paula; Mukadam, Anjum; Henden, Arne; Dillon, William; Schmidt, Gary D.

    2009-01-01

    We report on XMM-Newton and optical results for six cataclysmic variables that were selected from Sloan Digital Sky Survey (SDSS) spectra because they showed strong He II emission lines, indicative of being candidates for containing white dwarfs with strong magnetic fields. While high X-ray background rates prevented optimum results, we are able to confirm SDSS J233325.92+152222.1 as an intermediate polar from its strong pulse signature at 21 minutes and its obscured hard X-ray spectrum. Ground-based circular polarization and photometric observations were also able to confirm SDSS J142256.31 - 022108.1 as a polar with a period near 4 hr. Photometry of SDSS J083751.00+383012.5 and SDSS J093214.82+495054.7 solidifies the orbital period of the former as 3.18 hr and confirms the latter as a high-inclination system with deep eclipses.

  19. Rapid infrared and optical variability in the bright quasar 3C273

    International Nuclear Information System (INIS)

    Courvoisier, T.J.-L.; Robson, E.I.; Hughes, D.H.; Bouchet, P.; Schwarz, H.E.; Krisciunas, K.

    1988-01-01

    We have observed variations by a factor of two in the infrared flux from the bright quasar 3C273 on a timescale as short as one day. In February 1988, the behaviour of the source changed from having a stable infrared flux and slow optical variations to a state characterized by recurrent infrared and optical flaring. The optical variations were of several per cent per day, changing from increase to decrease approximately every week. The amplitude of the repeated optical flares was 30-40%. The data are consistent with re-injection/acceleration of electrons followed by rapid cooling. The inferred magnetic field is 0.7 gauss and the data are marginally consistent with no relativistic beaming. (author)

  20. CSI 2264: simultaneous optical and infrared light curves of young disk-bearing stars in NGC 2264 with CoRoT and Spitzer—evidence for multiple origins of variability

    International Nuclear Information System (INIS)

    Cody, Ann Marie; Stauffer, John; Rebull, Luisa M.; Carey, Sean; Baglin, Annie; Micela, Giuseppina; Flaccomio, Ettore; Morales-Calderón, María; Aigrain, Suzanne; Bouvier, Jèrôme; Hillenbrand, Lynne A.; Carpenter, John; Findeisen, Krzysztof; Gutermuth, Robert; Song, Inseok; Turner, Neal; Alencar, Silvia H. P.; Zwintz, Konstanze; Plavchan, Peter; Terebey, Susan

    2014-01-01

    We present the Coordinated Synoptic Investigation of NGC 2264, a continuous 30 day multi-wavelength photometric monitoring campaign on more than 1000 young cluster members using 16 telescopes. The unprecedented combination of multi-wavelength, high-precision, high-cadence, and long-duration data opens a new window into the time domain behavior of young stellar objects. Here we provide an overview of the observations, focusing on results from Spitzer and CoRoT. The highlight of this work is detailed analysis of 162 classical T Tauri stars for which we can probe optical and mid-infrared flux variations to 1% amplitudes and sub-hour timescales. We present a morphological variability census and then use metrics of periodicity, stochasticity, and symmetry to statistically separate the light curves into seven distinct classes, which we suggest represent different physical processes and geometric effects. We provide distributions of the characteristic timescales and amplitudes and assess the fractional representation within each class. The largest category (>20%) are optical 'dippers' with discrete fading events lasting ∼1-5 days. The degree of correlation between the optical and infrared light curves is positive but weak; notably, the independently assigned optical and infrared morphology classes tend to be different for the same object. Assessment of flux variation behavior with respect to (circum)stellar properties reveals correlations of variability parameters with Hα emission and with effective temperature. Overall, our results point to multiple origins of young star variability, including circumstellar obscuration events, hot spots on the star and/or disk, accretion bursts, and rapid structural changes in the inner disk.

  1. Numerical investigation of the nonlinear dynamics of a hybrid acousto-optic Bragg cell with a variable feedback gain

    Science.gov (United States)

    Chatterjee, Monish R.; Zhou, Hao

    2014-09-01

    Since around 1979, the operation of an acousto-optic Bragg cell under positive first-order feedback via amplification and delay in the loop has been studied extensively by several groups [1-3]. In recent work, the analysis of the nonlinear dynamics (NLD) of the system was extended to include bistable maps and Lyapunov exponents, and application of the chaos for signal encryption and decryption for uniform plane waves. The present work originated with the problem of a variable photodetector aperture opening relative to the first-order light. This potentially complex problem is simplified by assuming instead a variable feedback gain ( β ~ (t)), which leads to considerably different NLD. This paper examines initially the NLD versus the (DC) bias voltage for different variable- β ~ conditions, including slow and fast rates of change of the gain with time in relation to the feedback delay. It is found that the response depends critically on the rate of rise of the feedback gain, and also that the resulting chaotic regimes are generally significantly different from those for fixed values of β ~ . We have generated constant feedback gain and the variable feedback gain (t) chaos characteristics of the hybrid A-O network. Chaos as an equivalent carrier has been used to encrypt messages for both fixed and variable β ~ . The transmitted signal is detected from the encrypted carrier using a heterodyne method, using a slave Bragg cell with matched keys to generate local chaos followed by a low pass filter and a phase inverter. Results between variable- and fixed-gain systems are compared in terms of advantages and disadvantages.

  2. Factors controlling contrail cirrus optical depth

    Directory of Open Access Journals (Sweden)

    B. Kärcher

    2009-08-01

    Full Text Available Aircraft contrails develop into contrail cirrus by depositional growth and sedimentation of ice particles and horizontal spreading due to wind shear. Factors controlling this development include temperature, ice supersaturation, thickness of ice-supersaturated layers, and vertical gradients in the horizontal wind field. An analytical microphysical cloud model is presented and validated that captures these processes. Many individual contrail cirrus are simulated that develop differently owing to the variability in the controlling factors, resulting in large samples of cloud properties that are statistically analyzed. Contrail cirrus development is studied over the first four hours past formation, similar to the ages of line-shaped contrails that were tracked in satellite imagery on regional scales. On these time scales, contrail cirrus optical depth and microphysical variables exhibit a marked variability, expressed in terms of broad and skewed probability distribution functions. Simulated mean optical depths at a wavelength of 0.55 μm range from 0.05-0.5 and a substantial fraction 20-50% of contrail cirrus stay subvisible (optical depth <0.02, depending on meteorological conditions.

    A detailed analysis based on an observational case study over the continental USA suggests that previous satellite measurements of line-shaped persistent contrails have missed about 89%, 50%, and 11% of contrails with optical depths 0-0.05, 0.05-0.1, and 0.1-0.2, respectively, amounting to 65% of contrail coverage of all optical depths. When comparing observations with simulations and when estimating the contrail cirrus climate impact, not only mean values but also the variability in optical depth and microphysical properties need to be considered.

  3. Optical bistability controlling light with light

    CERN Document Server

    Gibbs, Hyatt

    1985-01-01

    Optical Bistability: Controlling Light with Light focuses on optical bistability in nonlinear optical systems. Emphasis is on passive (non-laser) systems that exhibit reversible bistability with input intensity as the hysteresis variable, along with the physics and the potential applications of such systems for nonlinear optical signal processing. This book consists of seven chapters and begins with a historical overview of optical bistability in lasers and passive systems. The next chapter describes steady-state theories of optical bistability, including the Bonifacio-Lugiato model, as we

  4. VARIABILITY IN OPTICAL SPECTRA OF ε ORIONIS

    International Nuclear Information System (INIS)

    Thompson, Gregory B.; Morrison, Nancy D.

    2013-01-01

    We present the results of a time series analysis of 130 échelle spectra of ε Ori (B0 Ia), acquired over seven observing seasons between 1998 and 2006 at Ritter Observatory. The equivalent widths of Hα (net) and He I λ5876 were measured and radial velocities were obtained from the central absorption of He I λ5876. Temporal variance spectra (TVS) revealed significant wind variability in both Hα and He I λ5876. The He I TVS have a double-peaked profile consistent with radial velocity oscillations. A periodicity search was carried out on the equivalent width and radial velocity data, as well as on wavelength-binned spectra. This analysis has revealed several periods in the variability with timescales of two to seven days. Many of these periods exhibit sinusoidal modulation in the associated phase diagrams. Several of these periods were present in both Hα and He I, indicating a possible connection between the wind and the photosphere. Due to the harmonic nature of these periods, stellar pulsations may be the origin of some of the observed variability. Periods on the order of the rotational period were also detected in the He I line in the 1998-1999 season and in both lines during the 2004-2005 season. These periods may indicate rotational modulation due to structure in the wind.

  5. Long-term variability of aerosol optical properties and radiative effects in Northern Finland

    Science.gov (United States)

    Lihavainen, Heikki; Hyvärinen, Antti; Asmi, Eija; Hatakka, Juha; Viisanen, Yrjö

    2017-04-01

    We introduce long term dataset of aerosol scattering and absorption properties and combined aerosol optical properties measured in Pallas Atmosphere-Ecosystem Supersite in Norhern Finland. The station is located 170 km north of the Arctic Circle. The station is affected by both pristine Arctic air masses as well as long transported air pollution from northern Europe. We studied the optical properties of aerosols and their radiative effects in continental and marine air masses, including seasonal cycles and long-term trends. The average (median) scattering coefficient, backscattering fraction, absorption coefficient and single scattering albedo at the wavelength of 550 nm were 7.9 (4.4) 1/Mm, 0.13 (0.12), 0.74 (0.35) 1/Mm and 0.92 (0.93), respectively. We observed clear seasonal cycles in these variables, the scattering coefficient having high values during summer and low in fall, and absorption coefficient having high values during winter and low in fall. We found that the high values of the absorption coefficient and low values of the single scattering albedo were related to continental air masses from lower latitudes. These aerosols can induce an additional effect on the surface albedo and melting of snow. We observed the signal of the Arctic haze in marine (northern) air masses during March and April. The haze increased the value of the absorption coefficient by almost 80% and that of the scattering coefficient by about 50% compared with the annual-average values. We did not observe any long-term trend in the scattering coefficient, while our analysis showed a clear decreasing trend in the backscattering fraction and scattering Ångström exponent during winter. We also observed clear relationship with temperature and aerosol scattering coefficient. We will present also how these different features affects to aerosol direct radiative forcing.

  6. THE OPTICAL VARIABILITY OF SDSS QUASARS FROM MULTI-EPOCH SPECTROSCOPY. II. COLOR VARIATION

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Hengxiao; Gu, Minfeng, E-mail: hxguo@shao.ac.cn, E-mail: gumf@shao.ac.cn [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China)

    2016-05-01

    We investigated the optical/ultraviolet (UV) color variations for a sample of 2169 quasars based on multi-epoch spectroscopy in the Sloan Digital Sky Survey data releases seven (DR7) and nine (DR9). To correct the systematic difference between DR7 and DR9 due to the different instrumental setup, we produced a correction spectrum by using a sample of F-stars observed in both DR7 and DR9. The correction spectrum was then applied to quasars when comparing the spectra of DR7 with DR9. In each object, the color variation was explored by comparing the spectral index of the continuum power-law fit on the brightest spectrum with the faintest one, and also by the shape of their difference spectrum. In 1876 quasars with consistent color variations from two methods, we found that most sources (1755, ∼94%) show the bluer-when-brighter (BWB) trend, and the redder-when-brighter (RWB) trend is detected in only 121 objects (∼6%). The common BWB trend is supported by the composite spectrum constructed from bright spectra, which is bluer than that from faint spectra, and also by the blue composite difference spectrum. The correction spectrum is proven to be highly reliable by comparing the composite spectrum from corrected DR9 and original DR7 spectra. Assuming that the optical/UV variability is triggered by fluctuations, the RWB trend can likely be explained if the fluctuations occur first in the outer disk region, and the inner disk region has not yet fully responded when the fluctuations are being propagated inward. In contrast, the common BWB trend implies that the fluctuations likely more often happen first in the inner disk region.

  7. Intra-night Optical Variability Monitoring of Fermi Blazars: First Results from 1.3 m J. C. Bhattacharya Telescope

    Energy Technology Data Exchange (ETDEWEB)

    Paliya, Vaidehi S.; Ajello, M.; Kaur, A. [Department of Physics and Astronomy, Clemson University, Kinard Lab of Physics, Clemson, SC 29634-0978 (United States); Stalin, C. S., E-mail: vpaliya@g.clemson.edu [Indian Institute of Astrophysics, Block II, Koramangala, Bangalore-560034 (India)

    2017-07-20

    We report the first results obtained from our campaign to characterize the intra-night-optical variability (INOV) properties of Fermi detected blazars, using the observations from the recently commissioned 1.3 m J. C. Bhattacharya telescope (JCBT). During the first run, we were able to observe 17 blazars in the Bessel R filter for ∼137 hr. Using C- and scaled F -statistics, we quantify the extent of INOV and derive the duty cycle (DC), which is the fraction of time during which a source exhibits a substantial flux variability. We find a high DC of 40% for BL Lac objects and the flat spectrum radio quasars are relatively less variable (DC ∼ 15%). However, when estimated for blazars sub-classes, a high DC of ∼59% is found in low synchrotron peaked (LSP) blazars, whereas, intermediate and high synchrotron peaked objects have a low DC of ∼11% and 13%, respectively. We find evidence of the association of the high amplitude INOV with the γ -ray flaring state. We also notice a high polarization during the elevated INOV states (for the sources that have polarimetric data available), thus supporting the jet based origin of the observed variability. We plan to enlarge the sample and utilize the time availability from the small telescopes, such as 1.3 m JCBT, to strengthen/verify the results obtained in this work and those existing in the literature.

  8. Spatial and temporal variability in bio-optical properties of the Wadden Sea

    NARCIS (Netherlands)

    Hommersom, A.; Peters, S.W.M.; Wernand, M.; de Boer, J.

    2009-01-01

    The Wadden Sea, a shallow coastal area bordering the North Sea, is optically a complex area due to its shallowness, high turbidity and fast changes in concentrations of optically active substances. This study gathers information from the area on concentrations of suspended particulate matter (SPM),

  9. Quantitative assessment of inter-observer variability in target volume delineation on stereotactic radiotherapy treatment for pituitary adenoma and meningioma near optic tract

    International Nuclear Information System (INIS)

    Yamazaki, Hideya; Ogita, Mikio; Yamashita, Koichi; Kotsuma, Tadayuki; Shiomi, Hiroya; Tsubokura, Takuji; Kodani, Naohiro; Nishimura, Takuya; Aibe, Norihiro; Udono, Hiroki; Nishikata, Manabu; Baba, Yoshimi

    2011-01-01

    To assess inter-observer variability in delineating target volume and organs at risk in benign tumor adjacent to optic tract as a quality assurance exercise. We quantitatively analyzed 21 plans made by 11 clinicians in seven CyberKnife centers. The clinicians were provided with a raw data set (pituitary adenoma and meningioma) including clinical information, and were asked to delineate the lesions and create a treatment plan. Their contouring and plans (10 adenoma and 11 meningioma plans), were then compared. In addition, we estimated the influence of differences in contouring by superimposing the respective contours onto a default plan. The median planning target volume (PTV) and the ratio of the largest to the smallest contoured volume were 9.22 cm 3 (range, 7.17 - 14.3 cm 3 ) and 1.99 for pituitary adenoma, and 6.86 cm 3 (range 6.05 - 14.6 cm 3 ) and 2.41 for meningioma. PTV volume was 10.1 ± 1.74 cm 3 for group 1 with a margin of 1 -2 mm around the CTV (n = 3) and 9.28 ± 1.8 cm 3 (p = 0.51) for group 2 with no margin (n = 7) in pituitary adenoma. In meningioma, group 1 showed larger PTV volume (10.1 ± 3.26 cm 3 ) than group 2 (6.91 ± 0.7 cm 3 , p = 0.03). All submitted plan keep the irradiated dose to optic tract within the range of 50 Gy (equivalent total doses in 2 Gy fractionation). However, contours superimposed onto the dose distribution of the default plan indicated that an excessive dose 23.64 Gy (up to 268% of the default plan) in pituitary adenoma and 24.84 Gy (131% of the default plan) in meningioma to the optic nerve in the contours from different contouring. Quality assurance revealed inter-observer variability in contour delineation and their influences on planning for pituitary adenoma and meningioma near optic tract

  10. Role of optical computers in aeronautical control applications

    Science.gov (United States)

    Baumbick, R. J.

    1981-01-01

    The role that optical computers play in aircraft control is determined. The optical computer has the potential high speed capability required, especially for matrix/matrix operations. The optical computer also has the potential for handling nonlinear simulations in real time. They are also more compatible with fiber optic signal transmission. Optics also permit the use of passive sensors to measure process variables. No electrical energy need be supplied to the sensor. Complex interfacing between optical sensors and the optical computer is avoided if the optical sensor outputs can be directly processed by the optical computer.

  11. Double degree master program: Optical Design

    Science.gov (United States)

    Bakholdin, Alexey; Kujawinska, Malgorzata; Livshits, Irina; Styk, Adam; Voznesenskaya, Anna; Ezhova, Kseniia; Ermolayeva, Elena; Ivanova, Tatiana; Romanova, Galina; Tolstoba, Nadezhda

    2015-10-01

    Modern tendencies of higher education require development of master programs providing achievement of learning outcomes corresponding to quickly variable job market needs. ITMO University represented by Applied and Computer Optics Department and Optical Design and Testing Laboratory jointly with Warsaw University of Technology represented by the Institute of Micromechanics and Photonics at The Faculty of Mechatronics have developed a novel international master double-degree program "Optical Design" accumulating the expertise of both universities including experienced teaching staff, educational technologies, and experimental resources. The program presents studies targeting research and professional activities in high-tech fields connected with optical and optoelectronics devices, optical engineering, numerical methods and computer technologies. This master program deals with the design of optical systems of various types, assemblies and layouts using computer modeling means; investigation of light distribution phenomena; image modeling and formation; development of optical methods for image analysis and optical metrology including optical testing, materials characterization, NDT and industrial control and monitoring. The goal of this program is training a graduate capable to solve a wide range of research and engineering tasks in optical design and metrology leading to modern manufacturing and innovation. Variability of the program structure provides its flexibility and adoption according to current job market demands and personal learning paths for each student. In addition considerable proportion of internship and research expands practical skills. Some special features of the "Optical Design" program which implements the best practices of both Universities, the challenges and lessons learnt during its realization are presented in the paper.

  12. The in-focus variable line spacing plane grating monochromator

    International Nuclear Information System (INIS)

    Reininger, R.

    2011-01-01

    The in-focus variable line spacing plane grating monochromator is based on only two plane optical elements, a variable line spacing plane grating and a plane pre-mirror that illuminates the grating at the angle of incidence that will focus the required photon energy. A high throughput beamline requires only a third optical element after the exit slit, an aberration corrected elliptical toroid. Since plane elements can be manufactured with the smallest figure errors, this monochromator design can achieve very high resolving power. Furthermore, this optical design can correct the deformations induced by the heat load on the optics along the dispersion plane. This should allow obtaining a resolution of 10 meV at 1 keV with currently achievable figure errors on plane optics. The position of the photon source when an insertion device center is not located at the center of the straight section, a common occurrence in new insertion device beamlines, is investigated.

  13. DISK-RELATED BURSTS AND FADES IN YOUNG STARS

    International Nuclear Information System (INIS)

    Findeisen, Krzysztof; Hillenbrand, Lynne; Levitan, David; Sesar, Branimir; Ofek, Eran; Laher, Russ; Surace, Jason

    2013-01-01

    We present first results from a new, multiyear, time domain survey of young stars in the North America Nebula complex using the Palomar Transient Factory. Our survey is providing an unprecedented view of aperiodic variability in young stars on timescales of days to years. The analyzed sample covers R PTF ≈ 13.5-18 and spans a range of mid-infrared color, with larger-amplitude optical variables (exceeding 0.4 mag root mean squared) more likely to have mid-infrared evidence for circumstellar material. This paper characterizes infrared excess stars with distinct bursts above or fades below a baseline of lower-level variability, identifying 41 examples. The light curves exhibit a remarkable diversity of amplitudes, timescales, and morphologies, with a continuum of behaviors that cannot be classified into distinct groups. Among the bursters, we identify three particularly promising sources that may represent theoretically predicted short-timescale accretion instabilities. Finally, we find that fading behavior is approximately twice as common as bursting behavior on timescales of days to years, although the bursting and fading duty cycle for individual objects often varies from year to year.

  14. A Large Aperture, High Energy Laser System for Optics and Optical Component Testing

    International Nuclear Information System (INIS)

    Nostrand, M.C.; Weiland, T.L.; Luthi, R.L.; Vickers, J.L.; Sell, W.D.; Stanley, J.A.; Honig, J.; Auerbach, J.; Hackel, R.P.; Wegner, P.J.

    2003-01-01

    A large aperture, kJ-class, multi-wavelength Nd-glass laser system has been constructed at Lawrence Livermore National Lab which has unique capabilities for studying a wide variety of optical phenomena. The master-oscillator, power-amplifier (MOPA) configuration of this ''Optical Sciences Laser'' (OSL) produces 1053 nm radiation with shaped pulse lengths which are variable from 0.1-100 ns. The output can be frequency doubled or tripled with high conversion efficiency with a resultant 100 cm 2 high quality output beam. This facility can accommodate prototype hardware for large-scale inertial confinement fusion lasers allowing for investigation of integrated system issues such as optical lifetime at high fluence, optics contamination, compatibility of non-optical materials, and laser diagnostics

  15. Significant and variable linear polarization during the prompt optical flash of GRB 160625B.

    Science.gov (United States)

    Troja, E.; Lipunov, V. M.; Mundell, C. G.; Butler, N. R.; Watson, A. M.; Kobayashi, S.; Cenko, S. B.; Marshall, F. E.; Ricci, R.; Fruchter, A.; Wieringa, M. H.; Gorbovskoy, E. S.; Kornilov, V.; Kutyrev, A.; Lee, W. H.; Toy, V.; Tyurina, N. V.; Budnev, N. M.; Buckley, D. A. H.; González, J.; Gress, O.; Horesh, A.; Panasyuk, M. I.; Prochaska, J. X.; Ramirez-Ruiz, E.; Rebolo Lopez, R.; Richer, M. G.; Roman-Zuniga, C.; Serra-Ricart, M.; Yurkov, V.; Gehrels, N.

    2017-07-01

    Newly formed black holes of stellar mass launch collimated outflows (jets) of ionized matter that approach the speed of light. These outflows power prompt, brief and intense flashes of γ-rays known as γ-ray bursts (GRBs), followed by longer-lived afterglow radiation that is detected across the electromagnetic spectrum. Measuring the polarization of the observed GRB radiation provides a direct probe of the magnetic fields in the collimated jets. Rapid-response polarimetric observations of newly discovered bursts have probed the initial afterglow phase, and show that, minutes after the prompt emission has ended, the degree of linear polarization can be as high as 30 per cent - consistent with the idea that a stable, globally ordered magnetic field permeates the jet at large distances from the central source. By contrast, optical and γ-ray observations during the prompt phase have led to discordant and often controversial results, and no definitive conclusions have been reached regarding the origin of the prompt radiation or the configuration of the magnetic field. Here we report the detection of substantial (8.3 ± 0.8 per cent from our most conservative simulation), variable linear polarization of a prompt optical flash that accompanied the extremely energetic and long-lived prompt γ-ray emission from GRB 160625B. Our measurements probe the structure of the magnetic field at an early stage of the jet, closer to its central black hole, and show that the prompt phase is produced via fast-cooling synchrotron radiation in a large-scale magnetic field that is advected from the black hole and distorted by dissipation processes within the jet.

  16. Towards identification of relevant variables in the observed aerosol optical depth bias between MODIS and AERONET observations

    Science.gov (United States)

    Malakar, N. K.; Lary, D. J.; Gencaga, D.; Albayrak, A.; Wei, J.

    2013-08-01

    Measurements made by satellite remote sensing, Moderate Resolution Imaging Spectroradiometer (MODIS), and globally distributed Aerosol Robotic Network (AERONET) are compared. Comparison of the two datasets measurements for aerosol optical depth values show that there are biases between the two data products. In this paper, we present a general framework towards identifying relevant set of variables responsible for the observed bias. We present a general framework to identify the possible factors influencing the bias, which might be associated with the measurement conditions such as the solar and sensor zenith angles, the solar and sensor azimuth, scattering angles, and surface reflectivity at the various measured wavelengths, etc. Specifically, we performed analysis for remote sensing Aqua-Land data set, and used machine learning technique, neural network in this case, to perform multivariate regression between the ground-truth and the training data sets. Finally, we used mutual information between the observed and the predicted values as the measure of similarity to identify the most relevant set of variables. The search is brute force method as we have to consider all possible combinations. The computations involves a huge number crunching exercise, and we implemented it by writing a job-parallel program.

  17. Continuous variable entanglement distillation of non-Gaussian states

    DEFF Research Database (Denmark)

    Lassen, Mikael Østergaard; Dong, Ruifang; Heersink, Joel

    2009-01-01

    We experimentally demonstrate distillation of continuous variable entangled light that has undergone non-Gaussian attenuation loss. The continuous variable entanglement is generated with optical fibers and sent through a lossy channel, where the transmission is varying in time. By employing simple...

  18. VARIABILITY AT THE EDGE: OPTICAL NEAR/IR RAPID-CADENCE MONITORING OF NEWLY OUTBURSTING FU ORIONIS OBJECT HBC 722

    International Nuclear Information System (INIS)

    Green, Joel D.; Robertson, Paul; Pak, Soojong; Meschiari, Stefano; Baek, Giseon; Lee, Jeong-Eun; Pooley, David; Im, Myungshin; Jeon, Yiseul; Choi, Changsu

    2013-01-01

    We present the detection of day-timescale periodic variability in the r-band lightcurve of newly outbursting FU Orionis-type object HBC 722, taken from >42 nights of observation with the CQUEAN instrument on the McDonald Observatory 2.1 m telescope. The optical/near-IR lightcurve of HBC 722 shows a complex array of periodic variability, clustering around 5.8-day (0.044 mag amplitude) and 1.28-day (0.016 mag amplitude) periods, after removal of overall baseline variation. We attribute the unusual number of comparable strength signals to a phenomenon related to the temporary increase in accretion rate associated with FUors. We consider semi-random 'flickering', magnetic braking/field compression and rotational asymmetries in the disk instability region as potential sources of variability. Assuming that the 5.8-day period is due to stellar rotation and the 1.28-day period is indicative of Keplerian rotation at the inner radius of the accretion disk (at 2 R * ), we derive a B-field strength of 2.2-2.7 kG, slightly larger than typical T Tauri stars. If instead the 5.8-day signal is from a disk asymmetry, the instability region has an outer radius of 5.4 R * , consistent with models of FUor disks. Further exploration of the time domain in this complicated source and related objects will be key to understanding accretion processes.

  19. MINUTE-SCALE RAPID VARIABILITY OF THE OPTICAL POLARIZATION IN THE NARROW-LINE SEYFERT 1 GALAXY PMN J0948+0022

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, Ryosuke; Tanaka, Yasuyuki T.; Fukazawa, Yasushi; Kawaguchi, Kenji; Takaki, Katsutoshi; Ueno, Issei [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Kawabata, Koji S.; Moritani, Yuki; Uemura, Makoto; Akitaya, Hiroshi; Yoshida, Michitoshi; Ohsugi, Takashi [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Hanayama, Hidekazu; Miyaji, Takeshi [Ishigakijima Astronomical Observatory, National Astronomical Observatory of Japan, 1024-1 Arakawa, Ishigaki, Okinawa 907-0024 (Japan); Kawai, Nobuyuki, E-mail: itoh@hep01.hepl.hiroshima-u.ac.jp [Department of Physics, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo 152-8551 (Japan)

    2013-09-20

    We report on optical photopolarimetric results of the radio-loud narrow-line Seyfert 1 (RL-NLSy1) galaxy PMN J0948+0022 on 2012 December to 2013 February triggered by flux enhancements in the near infrared and γ-ray bands. With the one-shot polarimetry of the Hiroshima One-shot Wide field Polarimeter installed on the Kanata Telescope, we detected very rapid variability in the polarized-flux (PF) light curve on MJD 56281 (2012 December 20). The rise and decay times were about 140 s and 180 s, respectively. The polarization degree (PD) reached 36% ± 3% at the peak of the short-duration pulse, while the polarization angle remained almost constant. In addition, temporal profiles of the total flux and PD showed highly variable but well correlated behavior and discrete correlation function analysis revealed that no significant time lag of more than 10 minutes was present. The high PD and minute-scale variability in PF provides clear evidence of synchrotron radiation from a very compact emission region of ∼10{sup 14} cm size with a highly ordered magnetic field. Such micro-variability of polarization is also observed in several blazar jets, but its complex relation between total flux and PD are explained by a multi-zone model in several blazars. The implied single emission region in PMN J0948+0022 might reflect a difference of jets between RL-NLSy1s and blazars.

  20. Exploratory Spectroscopy of Magnetic Cataclysmic Variables Candidates and Other Variable Objects

    Science.gov (United States)

    Oliveira, A. S.; Rodrigues, C. V.; Cieslinski, D.; Jablonski, F. J.; Silva, K. M. G.; Almeida, L. A.; Rodríguez-Ardila, A.; Palhares, M. S.

    2017-04-01

    The increasing number of synoptic surveys made by small robotic telescopes, such as the photometric Catalina Real-Time Transient Survey (CRTS), provides a unique opportunity to discover variable sources and improves the statistical samples of such classes of objects. Our goal is the discovery of magnetic Cataclysmic Variables (mCVs). These are rare objects that probe interesting accretion scenarios controlled by the white-dwarf magnetic field. In particular, improved statistics of mCVs would help to address open questions on their formation and evolution. We performed an optical spectroscopy survey to search for signatures of magnetic accretion in 45 variable objects selected mostly from the CRTS. In this sample, we found 32 CVs, 22 being mCV candidates, 13 of which were previously unreported as such. If the proposed classifications are confirmed, it would represent an increase of 4% in the number of known polars and 12% in the number of known IPs. A fraction of our initial sample was classified as extragalactic sources or other types of variable stars by the inspection of the identification spectra. Despite the inherent complexity in identifying a source as an mCV, variability-based selection, followed by spectroscopic snapshot observations, has proved to be an efficient strategy for their discoveries, being a relatively inexpensive approach in terms of telescope time. Based on observations obtained at the Observatório do Pico dos Dias/LNA, and at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).

  1. Spatiotemporal variability and contribution of different aerosol types to the aerosol optical depth over the Eastern Mediterranean

    Directory of Open Access Journals (Sweden)

    A. K. Georgoulias

    2016-11-01

    Full Text Available This study characterizes the spatiotemporal variability and relative contribution of different types of aerosols to the aerosol optical depth (AOD over the Eastern Mediterranean as derived from MODIS (Moderate Resolution Imaging Spectroradiometer Terra (March 2000–December 2012 and Aqua (July 2002–December 2012 satellite instruments. For this purpose, a 0.1° × 0.1° gridded MODIS dataset was compiled and validated against sun photometric observations from the AErosol RObotic NETwork (AERONET. The high spatial resolution and long temporal coverage of the dataset allows for the determination of local hot spots like megacities, medium-sized cities, industrial zones and power plant complexes, seasonal variabilities and decadal averages. The average AOD at 550 nm (AOD550 for the entire region is ∼ 0.22 ± 0.19, with maximum values in summer and seasonal variabilities that can be attributed to precipitation, photochemical production of secondary organic aerosols, transport of pollution and smoke from biomass burning in central and eastern Europe and transport of dust from the Sahara and the Middle East. The MODIS data were analyzed together with data from other satellite sensors, reanalysis projects and a chemistry–aerosol-transport model using an optimized algorithm tailored for the region and capable of estimating the contribution of different aerosol types to the total AOD550. The spatial and temporal variability of anthropogenic, dust and fine-mode natural aerosols over land and anthropogenic, dust and marine aerosols over the sea is examined. The relative contribution of the different aerosol types to the total AOD550 exhibits a low/high seasonal variability over land/sea areas, respectively. Overall, anthropogenic aerosols, dust and fine-mode natural aerosols account for ∼ 51, ∼ 34 and ∼ 15 % of the total AOD550 over land, while, anthropogenic aerosols, dust and marine aerosols account ∼ 40, ∼ 34

  2. A variable partially polarizing beam splitter

    Science.gov (United States)

    Flórez, Jefferson; Carlson, Nathan J.; Nacke, Codey H.; Giner, Lambert; Lundeen, Jeff S.

    2018-02-01

    We present designs for variably polarizing beam splitters. These are beam splitters allowing the complete and independent control of the horizontal and vertical polarization splitting ratios. They have quantum optics and quantum information applications, such as quantum logic gates for quantum computing and non-local measurements for quantum state estimation. At the heart of each design is an interferometer. We experimentally demonstrate one particular implementation, a displaced Sagnac interferometer configuration, that provides an inherent instability to air currents and vibrations. Furthermore, this design does not require any custom-made optics but only common components which can be easily found in an optics laboratory.

  3. Seasonal variability in bio-optical properties along the coastal waters off Cochin

    KAUST Repository

    Vishnu, P.S.; Shaju, S.S.; Tiwari, Surya Prakash; Menon, Nandini; Nashad, M.; Joseph, C. Ajith; Raman, Mini; Hatha, Mohamed; Prabhakaran, M.P.; Mohandas, A.

    2017-01-01

    Strong seasonal upwelling, downwelling, changes in current patterns and the volume of freshwater discharge from Cochin Estuary defines the coastal waters off Cochin. These coastal waters were investigated through monthly sampling efforts during March 2015 to February 2016 to study the seasonal and spatial variability in bio-optical properties for the four different seasons mainly Spring Inter Monsoon (SIM), South West Monsoon (SWM), Fall Inter Monsoon (FIM) and Winter Monsoon (WM). The Barmouth region is the meeting place where freshwater from Cochin Estuary directly enters to the sea through a single narrow outlet, was dominated by highly turbid waters during the entire period of study. Among the four seasons, chlorophyll a (Chl_a) concentration showed a high value during SWM, ranged from 2.90 to 11.66 mg m−3 with an average value of 6.56 ± 3.51 mg m−3. During SIM the distribution of coloured dissolved organic matter (CDOM) is controlled by decomposition of phytoplankton biomass and the river discharge, whereas during SWM the temporal distribution of CDOM is controlled only by river discharge. The highest value for CDOM spectral slope (SCDOM) was observed during SWM, ranged from 0.013 to 0.020 nm−1 with an average value of 0.015 ± 0.002 nm−1. During WM, the high SCDOM with lower aCDOM (443) indicates the photo-degradation affects the absorption characteristics of CDOM. The observed nonlinearity between Chl_a and the ratio of phytoplankton absorption aph (443)/aph (670) indicating the packaging effect and changes in the intercellular composition of pigments. During the study period, aph (670) was strongly correlated with Chl_a than aph (443), which explains the accessory pigment absorption dominating more than Chl_a in the blue part of the spectrum. Similarly, the results obtained from seasonal bio-optical data indicating that Chl_a significantly contributes light attenuation of the water column during SIM, whereas detritus (ad

  4. Seasonal variability in bio-optical properties along the coastal waters off Cochin

    Science.gov (United States)

    Vishnu, P. S.; Shaju, S. S.; Tiwari, S. P.; Menon, Nandini; Nashad, M.; Joseph, C. Ajith; Raman, Mini; Hatha, Mohamed; Prabhakaran, M. P.; Mohandas, A.

    2018-04-01

    Strong seasonal upwelling, downwelling, changes in current patterns and the volume of freshwater discharge from Cochin Estuary defines the coastal waters off Cochin. These coastal waters were investigated through monthly sampling efforts during March 2015 to February 2016 to study the seasonal and spatial variability in bio-optical properties for the four different seasons mainly Spring Inter Monsoon (SIM), South West Monsoon (SWM), Fall Inter Monsoon (FIM) and Winter Monsoon (WM). The Barmouth region is the meeting place where freshwater from Cochin Estuary directly enters to the sea through a single narrow outlet, was dominated by highly turbid waters during the entire period of study. Among the four seasons, chlorophyll a (Chl_a) concentration showed a high value during SWM, ranged from 2.90 to 11.66 mg m-3 with an average value of 6.56 ± 3.51 mg m-3. During SIM the distribution of coloured dissolved organic matter (CDOM) is controlled by decomposition of phytoplankton biomass and the river discharge, whereas during SWM the temporal distribution of CDOM is controlled only by river discharge. The highest value for CDOM spectral slope (SCDOM) was observed during SWM, ranged from 0.013 to 0.020 nm-1 with an average value of 0.015 ± 0.002 nm-1. During WM, the high SCDOM with lower aCDOM (443) indicates the photo-degradation affects the absorption characteristics of CDOM. The observed nonlinearity between Chl_a and the ratio of phytoplankton absorption aph (443)/aph (670) indicating the packaging effect and changes in the intercellular composition of pigments. During the study period, aph (670) was strongly correlated with Chl_a than aph (443), which explains the accessory pigment absorption dominating more than Chl_a in the blue part of the spectrum. Similarly, the results obtained from seasonal bio-optical data indicating that Chl_a significantly contributes light attenuation of the water column during SIM, whereas detritus (ad) significantly contributes light

  5. Seasonal variability in bio-optical properties along the coastal waters off Cochin

    KAUST Repository

    Vishnu, P.S.

    2017-12-15

    Strong seasonal upwelling, downwelling, changes in current patterns and the volume of freshwater discharge from Cochin Estuary defines the coastal waters off Cochin. These coastal waters were investigated through monthly sampling efforts during March 2015 to February 2016 to study the seasonal and spatial variability in bio-optical properties for the four different seasons mainly Spring Inter Monsoon (SIM), South West Monsoon (SWM), Fall Inter Monsoon (FIM) and Winter Monsoon (WM). The Barmouth region is the meeting place where freshwater from Cochin Estuary directly enters to the sea through a single narrow outlet, was dominated by highly turbid waters during the entire period of study. Among the four seasons, chlorophyll a (Chl_a) concentration showed a high value during SWM, ranged from 2.90 to 11.66 mg m−3 with an average value of 6.56 ± 3.51 mg m−3. During SIM the distribution of coloured dissolved organic matter (CDOM) is controlled by decomposition of phytoplankton biomass and the river discharge, whereas during SWM the temporal distribution of CDOM is controlled only by river discharge. The highest value for CDOM spectral slope (SCDOM) was observed during SWM, ranged from 0.013 to 0.020 nm−1 with an average value of 0.015 ± 0.002 nm−1. During WM, the high SCDOM with lower aCDOM (443) indicates the photo-degradation affects the absorption characteristics of CDOM. The observed nonlinearity between Chl_a and the ratio of phytoplankton absorption aph (443)/aph (670) indicating the packaging effect and changes in the intercellular composition of pigments. During the study period, aph (670) was strongly correlated with Chl_a than aph (443), which explains the accessory pigment absorption dominating more than Chl_a in the blue part of the spectrum. Similarly, the results obtained from seasonal bio-optical data indicating that Chl_a significantly contributes light attenuation of the water column during SIM, whereas detritus (ad

  6. Astronomical optics and elasticity theory

    CERN Document Server

    Lemaitre, Gerard Rene

    2008-01-01

    Astronomical Optics and Elasticity Theory provides a very thorough and comprehensive account of what is known in this field. After an extensive introduction to optics and elasticity, the book discusses variable curvature and multimode deformable mirrors, as well as, in depth, active optics, its theory and applications. Further, optical design utilizing the Schmidt concept and various types of Schmidt correctors, as well as the elasticity theory of thin plates and shells are elaborated upon. Several active optics methods are developed for obtaining aberration corrected diffraction gratings. Further, a weakly conical shell theory of elasticity is elaborated for the aspherization of grazing incidence telescope mirrors. The very didactic and fairly easy-to-read presentation of the topic will enable PhD students and young researchers to actively participate in challenging astronomical optics and instrumentation projects.

  7. Optical and magneto-optical characterization of TbFeCo thin films in trilayer structures

    International Nuclear Information System (INIS)

    McGahan, W.A.; He, P.; Chen, L.; Bonafede, S.; Woollam, J.A.; Sequeda, F.; McDaniel, T.; Do, H.

    1991-01-01

    A series of TbFeCo films ranging in thickness from 100 to 800 A have been deposited in trilayer structures on silicon wafer substrates, with Si 3 N 4 being employed as the dielectric material. These films have been characterized both optically and magneto-optically by variable angle of incidence spectroscopic ellipsometry, normal angle of incidence reflectometry, and normal angle of incidence Kerr spectroscopy. From these measurements, the optical constants n and k have been determined for the TbFeCo films, as well as the magneto-optical constants Q1 and Q2. Results are presented that demonstrate the lack of dependence of these constants on the thickness of the TbFeCo film, and which can be used for calculating the expected optical and magneto-optical response of any multilayer structure containing similar TbFeCo films

  8. Einstein x-ray observations of cataclysmic variables

    International Nuclear Information System (INIS)

    Mason, K.O.; Cordova, F.A.

    1982-01-01

    Observations with the imaging x-ray detectors on the Einstein Observatory have led to a large increase in the number of low luminosity x-ray sources known to be associated with cataclysmic variable stars (CVs). The high sensitivity of the Einstein instrumentation has permitted study of their short timescale variability and spectra. The data are adding significantly to our knowledge of the accretion process in cataclysmic variables and forcing some revision in our ideas concerning the origin of the optical variability in these stars

  9. Millijansky radio variability in SDSS stripe 82

    Energy Technology Data Exchange (ETDEWEB)

    Hodge, J. A.; Becker, R. H. [University of California, 1 Shields Avenue, Davis, CA 95616 (United States); White, R. L. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Richards, G. T., E-mail: hodge@mpia.de [Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States)

    2013-06-01

    We report on a blind survey for extragalactic radio variability that was carried out by comparing two epochs of data from the Faint Images of the Radio Sky at Twenty centimeters survey with a third epoch from a new 1.4 GHz survey of SDSS Stripe 82. The three epochs are spaced seven years apart and have an overlapping area of 60 deg{sup 2}. We uncover 89 variable sources down to the millijansky level, 75 of which are newly identified, and we find no evidence for transient phenomena. This new sample of variable sources allows us to infer an upper limit to the mean characteristic timescale of active galactic nucleus radio variability of 14 yr. We find that only 1% of extragalactic sources have fractional variability f {sub var} > 3, while 44% of Galactic sources vary by this much. The variable sample contains a larger fraction of quasars than a comparable non-variable control sample, though the majority of the variable sources appear to be extended galaxies in the optical. This implies that either quasars are not the dominant contributor to the variability of the sample, or that the deep optical data allow us to detect the host galaxies of some low-z quasars. We use the new, higher resolution data to report on the morphology of the variable sources. Finally, we show that the fraction of sources that are variable remains constant or increases at low flux densities. This may imply that next generation radio surveys with telescopes like Australian Square Kilometer Array Pathfinder and MeerKAT will see a constant or even increasing fraction of variable sources down into the sub-millijansky regime.

  10. IRAS variables as galactic structure tracers - Classification of the bright variables

    Science.gov (United States)

    Allen, L. E.; Kleinmann, S. G.; Weinberg, M. D.

    1993-01-01

    The characteristics of the 'bright infrared variables' (BIRVs), a sample consisting of the 300 brightest stars in the IRAS Point Source Catalog with IRAS variability index VAR of 98 or greater, are investigated with the purpose of establishing which of IRAS variables are AGB stars (e.g., oxygen-rich Miras and carbon stars, as was assumed by Weinberg (1992)). Results of the analysis of optical, infrared, and microwave spectroscopy of these stars indicate that, out of 88 stars in the BIRV sample identified with cataloged variables, 86 can be classified as Miras. Results of a similar analysis performed for a color-selected sample of stars, using the color limits employed by Habing (1988) to select AGB stars, showed that, out of 52 percent of classified stars, 38 percent are non-AGB stars, including H II regions, planetary nebulae, supergiants, and young stellar objects, indicating that studies using color-selected samples are subject to misinterpretation.

  11. Experimental characterization of variable output refractive beamshapers using freeform elements

    Science.gov (United States)

    Shultz, Jason A.; Smilie, Paul J.; Dutterer, Brian S.; Davies, Matthew A.; Suleski, Thomas J.

    2014-09-01

    We present experimental results from variable output refractive beam shapers based on freeform optical surfaces. Two freeform elements in close proximity comprise a beam shaper that maps a circular Gaussian input to a circular `flat-top' output. Different lateral relative shifts between the elements result in a varying output diameter while maintaining the uniform irradiance distribution. We fabricated the beam shaping elements in PMMA using multi-axis milling on a Moore Nanotech 350FG diamond machining center and tested with a 632.8 nm Gaussian input. Initial optical testing confirmed both the predicted beam shaping and variable functionality, but with poor output uniformity. The effects of surface finish on optical performance were investigated using LightTrans VirtualLabTM to perform physical optics simulations of the milled freeform surfaces. These simulations provided an optimization path for determining machining parameters to improve the output uniformity of the beam shaping elements. A second variable beam shaper based on a super-Gaussian output was designed and fabricated using the newly determined machining parameters. Experimental test results from the second beam shaper showed outputs with significantly higher quality, but also suggest additional areas of study for further improvements in uniformity.

  12. Removing the Influence of Shimmer in the Calculation of Harmonics-To-Noise Ratios Using Ensemble-Averages in Voice Signals

    OpenAIRE

    Carlos Ferrer; Eduardo González; María E. Hernández-Díaz; Diana Torres; Anesto del Toro

    2009-01-01

    Harmonics-to-noise ratios (HNRs) are affected by general aperiodicity in voiced speech signals. To specifically reflect a signal-to-additive-noise ratio, the measurement should be insensitive to other periodicity perturbations, like jitter, shimmer, and waveform variability. The ensemble averaging technique is a time-domain method which has been gradually refined in terms of its sensitivity to jitter and waveform variability and required number of pulses. In this paper, shimmer is introduced ...

  13. UV, X-ray, and Optical Variability of the Young Star T Cha Produced by Inner Disk Obscuration: Results from a Coordinated HST, XMM-Newton, LCOGT, and SMARTS Observing Campaign

    Science.gov (United States)

    Brown, Alexander; France, Kevin; Walter, Frederick M.; Schneider, P. Christian; Brown, Timothy M.; Andrews, Sean M.; Wilner, David J.

    2018-06-01

    The young (7 Myr) 1.5 solar mass T Tauri star T Chamaeleontis shows dramatic variability. The optical extinction varies by at least 3 magnitudes on few hour time-scales with no obvious periodicity. The obscuration is produced by material at the inner edge of the circumstellar disk and therefore characterizing the absorbing material can reveal important clues regarding the transport of gas and dust within such disks. The inner disk of T Cha is particularly interesting, because T Cha has a transitional disk with a large gap at 0.2-15 AU in the dust disk and allows study of the gas and dust structure in the terrestrial planet formation zone during this important rapid phase of protoplanetary disk evolution. For this reason we have conducted a major multi-spectral-region observing campaign to study the UV/X-ray/optical variability of T Cha. During 2018 February/March we monitored the optical photometric and spectral variability using LCOGT (Chile/South Africa/Australia) and the SMARTS telescopes in Chile. These optical data provide a broad context within which to interpret our shorter UV and X-ray observations. We observed T Cha during 3 coordinated observations (each 5 HST orbits + 25 ksec XMM; on 2018 Feb 22, Feb 26, Mar 2) using the HST COS/STIS spectrographs to measure the FUV/NUV spectra and XMM-Newton to measure the corresponding X-ray energy distribution. The observed spectral changes are well correlated and demonstrate the influence of the same absorbing material in all the spectral regions observed. By examining which spectral features change and by how much we can determine the location of different emitting regions relative to the absorbers along the line-of-sight to the star. In this poster we provide an overview of the variability seen in the different spectral regions and quantify the dust and gas content of T Cha's inner disk edge.(This work is supported by grant HST-GO-15128 and time awarded by HST, XMM-Newton, LCOGT, and SMARTS. We acknowledge the

  14. RADIANCE AND PHOTON NOISE: Imaging in geometrical optics, physical optics, quantum optics and radiology.

    Science.gov (United States)

    Barrett, Harrison H; Myers, Kyle J; Caucci, Luca

    2014-08-17

    A fundamental way of describing a photon-limited imaging system is in terms of a Poisson random process in spatial, angular and wavelength variables. The mean of this random process is the spectral radiance. The principle of conservation of radiance then allows a full characterization of the noise in the image (conditional on viewing a specified object). To elucidate these connections, we first review the definitions and basic properties of radiance as defined in terms of geometrical optics, radiology, physical optics and quantum optics. The propagation and conservation laws for radiance in each of these domains are reviewed. Then we distinguish four categories of imaging detectors that all respond in some way to the incident radiance, including the new category of photon-processing detectors. The relation between the radiance and the statistical properties of the detector output is discussed and related to task-based measures of image quality and the information content of a single detected photon.

  15. Eliminating four-wave-mixing crosstalk in wavelength-division-multiplexing systems

    Science.gov (United States)

    Kwong, Wing C.; Yang, Guu-Chang

    1996-11-01

    To reduce four-wave-mixing crosstalk in long-haul wavelength-division multiplexing (WDM) lightwave systems, the use of unequally spaced channels has recently been proposed. Instead of being solved y integer linear programming, the unequal-spaced channel-allocation problem is here treated as constructing suitable optical orthogonal codes in optical code-division multiple-access (CDMA). Three 'algebraic' algorithms on finding the frequency locations of unequally spaced WDM channels are reported. The constructions are based on generating optical CDMA codewords with a predetermined pulse separation and 'aperiodic' autocorrelation sidelobes no greater than one. The algorithms potentially provide a fast and simple alternative to solve the problem, besides the recently reported computer-search method.

  16. Development and application of the variable focus laser leveling gage

    International Nuclear Information System (INIS)

    Gong Kun; Ma Jinglong

    2005-01-01

    The variable focus laser leveling gage was developed. The performance and structure were introduced. The several alignments and tests in KrF laser angle multi-path optical system were accomplished with them. Its application in other optical equipment was discussed too. (author)

  17. Subwavelength grating enabled on-chip ultra-compact optical true time delay line.

    Science.gov (United States)

    Wang, Junjia; Ashrafi, Reza; Adams, Rhys; Glesk, Ivan; Gasulla, Ivana; Capmany, José; Chen, Lawrence R

    2016-07-26

    An optical true time delay line (OTTDL) is a basic photonic building block that enables many microwave photonic and optical processing operations. The conventional design for an integrated OTTDL that is based on spatial diversity uses a length-variable waveguide array to create the optical time delays, which can introduce complexities in the integrated circuit design. Here we report the first ever demonstration of an integrated index-variable OTTDL that exploits spatial diversity in an equal length waveguide array. The approach uses subwavelength grating waveguides in silicon-on-insulator (SOI), which enables the realization of OTTDLs having a simple geometry and that occupy a compact chip area. Moreover, compared to conventional wavelength-variable delay lines with a few THz operation bandwidth, our index-variable OTTDL has an extremely broad operation bandwidth practically exceeding several tens of THz, which supports operation for various input optical signals with broad ranges of central wavelength and bandwidth.

  18. 318-MHz variability of complete samples of extragalactic radio sources. II

    International Nuclear Information System (INIS)

    Dennison, B.; Broderick, J.J.; Ledden, J.E.; O'Dell, S.L.; Condon, J.J.

    1981-01-01

    We report the remainder of two- and three-epoch 318-MHz observations of extragalactic sources in samples complete to 3 Jy at 1400 MHz and 1 Jy at 5000 MHz. From analysis of this low-frequency variability survey, we find that steep-spectrum (α> or =0.5) sources do not appear to vary, but about 40% of all flat-spectrum (α<0.5) sources exhibit low-frequency variability exceeding 8% over approx.5 yr. Among the flat-spectrum sources, those with inverted spectra show the largest fractional variations. We also find that the incidence of low-frequency variability is strongly correlated with the determination that a source is an optically violent variable. These statistical properties are consistent with models invoking relativistic beaming of radio and optical emission

  19. Topology of tiling spaces

    CERN Document Server

    Sadun, Lorenzo

    2008-01-01

    Aperiodic tilings are interesting to mathematicians and scientists for both theoretical and practical reasons. The serious study of aperiodic tilings began as a solution to a problem in logic. Simpler aperiodic tilings eventually revealed hidden "symmetries" that were previously considered impossible, while the tilings themselves were quite striking. The discovery of quasicrystals showed that such aperiodicity actually occurs in nature and led to advances in materials science. Many properties of aperiodic tilings can be discerned by studying one tiling at a time. However, by studying families of tilings, further properties are revealed. This broader study naturally leads to the topology of tiling spaces. This book is an introduction to the topology of tiling spaces, with a target audience of graduate students who wish to learn about the interface of topology with aperiodic order. It isn't a comprehensive and cross-referenced tome about everything having to do with tilings, which would be too big, too hard to ...

  20. Variability in leaf optical properties among 26 species from a broad range of habitats

    International Nuclear Information System (INIS)

    Knapp, A.K.; Carter, G.A.

    1998-01-01

    Leaves from 26 species with growth forms from annual herbs to trees were collected from open, intermediate, and shaded understory habitats in Mississippi and Kansas, USA. Leaf optical properties including reflectance, transmittance, and absorptance in visible and near infrared (NIR) wavelengths were measured along with leaf thickness and specific leaf mass (SLM). These leaf properties and internal light scattering have been reported to vary with light availability in studies that have focused on a limited number of species. Our objective was to determine whether these patterns in leaf optics and light availability were consistent when a greater number of species were evaluated. Leaf thickness and SLM varied by tenfold among species sampled, but within-habitat variance was high. Although there was a strong trend toward thicker leaves in open habitats, only SLM was significantly greater in open vs. understory habitats. In contrast, leaf optical properties were strikingly similar among habitats. Reflectance and reflectance/transmittance in the NIR were used to estimate internal light scattering and there were strong relationships (r2 0.65) between these optical properties and leaf thickness. We concluded that leaf thickness, which did not vary consistently among habitats, was the best predictor of NIR reflectance and internal light scattering. However, because carbon allocation to leaves was lower in understory species (low SLM) yet gross optical properties were similar among all habitats, the energy investment by shade leaves required to achieve optical equivalence with sun leaves was lower. Differences in leaf longevity and growth form within a habitat may help explain the lack of consistent patterns in leaf optics as the number of species sampled increases

  1. Optical photometric variable stars towards the Galactic H II region NGC 2282

    Science.gov (United States)

    Dutta, Somnath; Mondal, Soumen; Joshi, Santosh; Jose, Jessy; Das, Ramkrishna; Ghosh, Supriyo

    2018-05-01

    We report here CCD I-band time series photometry of a young (2-5 Myr) cluster NGC 2282, in order to identify and understand the variability of pre-main-sequence (PMS) stars. The I-band photometry, down to ˜20.5 mag, enables us to probe the variability towards the lower mass end (˜0.1 M⊙) of PMS stars. From the light curves of 1627 stars, we identified 62 new photometric variable candidates. Their association with the region was established from H α emission and infrared (IR) excess. Among 62 variables, 30 young variables exhibit H α emission, near-IR (NIR)/mid-IR (MIR) excess or both and are candidate members of the cluster. Out of 62 variables, 41 are periodic variables, with a rotation rate ranging from 0.2-7 d. The period distribution exhibits a median period at ˜1 d, as in many young clusters (e.g. NGC 2264, ONC, etc.), but it follows a unimodal distribution, unlike others that have bimodality, with slow rotators peaking at ˜6-8 d. To investigate the rotation-disc and variability-disc connection, we derived the NIR excess from Δ(I - K) and the MIR excess from Spitzer [3.6]-[4.5] μm data. No conclusive evidence of slow rotation with the presence of discs around stars and fast rotation for discless stars is obtained from our periodic variables. A clear increasing trend of the variability amplitude with IR excess is found for all variables.

  2. Optical Variability of Active Galactic Nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Kozłowski, Szymon, E-mail: simkoz@astrouw.edu.pl [Astronomical Observatory, University of Warsaw, Warsaw (Poland)

    2017-09-21

    Variability studies of active galactic nuclei (AGNs) typically use either power spectral density (PSD) and structure function (SF) analyses or direct modeling of light curves with the damped random walk (DRW) and the continuous autoregressive moving average (CARMA) models. A fair fraction of research publications on the subject are flawed, and simply report incorrect results, because they lack a deep understanding of where these methods originate from and what their limitations are. For example, SF analyses typically lack or use a wrong noise subtraction procedure, leading to flat SFs. DRW, on the other hand, can only be used if the experiment length is sufficient, at least ten times the signal decorrelation time scale τ, and if the data show the power-law SF slope of γ ≡ 0.5.

  3. Optic pathway glioma associated with orbital rhabdomyosarcoma and bilateral optic nerve sheath dural ectasia in a child with neurofibromatosis-1

    International Nuclear Information System (INIS)

    Nikas, Ioannis; Theofanopoulou, Maria; Lampropoulou, Penelope; Hadjigeorgi, Christiana; Pourtsidis, Apostolos; Kosmidis, Helen

    2006-01-01

    Neurofibromatosis-1 (NF-1) is a multisystem disorder presenting with a variety of clinical and imaging manifestations. Neural and non-neural tumours, and unusual benign miscellaneous conditions, separately or combined, are encountered in variable locations. We present a 21/2-year-old boy with NF-1 who demonstrated coexisting optic pathway glioma with involvement of the chiasm and optic nerve, orbital alveolar rhabdomyosarcoma and bilateral optic nerve sheath dural ectasia. (orig.)

  4. Combined Use of Multi-Temporal Optical and Radar Satellite Images for Grassland Monitoring

    Directory of Open Access Journals (Sweden)

    Pauline Dusseux

    2014-06-01

    Full Text Available The aim of this study was to assess the ability of optical images, SAR (Synthetic Aperture Radar images and the combination of both types of data to discriminate between grasslands and crops in agricultural areas where cloud cover is very high most of the time, which restricts the use of visible and near-infrared satellite data. We compared the performances of variables extracted from four optical and five SAR satellite images with high/very high spatial resolutions acquired during the growing season. A vegetation index, namely the NDVI (Normalized Difference Vegetation Index, and two biophysical variables, the LAI (Leaf Area Index and the fCOVER (fraction of Vegetation Cover were computed using optical time series and polarization (HH, VV, HV, VH. The polarization ratio and polarimetric decomposition (Freeman–Durden and Cloude–Pottier were calculated using SAR time series. Then, variables derived from optical, SAR and both types of remotely-sensed data were successively classified using the Support Vector Machine (SVM technique. The results show that the classification accuracy of SAR variables is higher than those using optical data (0.98 compared to 0.81. They also highlight that the combination of optical and SAR time series data is of prime interest to discriminate grasslands from crops, allowing an improved classification accuracy.

  5. Real-time optical laboratory solution of parabolic differential equations

    Science.gov (United States)

    Casasent, David; Jackson, James

    1988-01-01

    An optical laboratory matrix-vector processor is used to solve parabolic differential equations (the transient diffusion equation with two space variables and time) by an explicit algorithm. This includes optical matrix-vector nonbase-2 encoded laboratory data, the combination of nonbase-2 and frequency-multiplexed data on such processors, a high-accuracy optical laboratory solution of a partial differential equation, new data partitioning techniques, and a discussion of a multiprocessor optical matrix-vector architecture.

  6. Seasonal variability in aerosol optical and physical characteristics ...

    Indian Academy of Sciences (India)

    B. Pant Institute of Himalayan Environment and Development, Himachal Unit, Mohal-Kullu 175 126, India. 2G.B. Pant Institute of Himalayan ... ing and transport which result in a large variability in their size distribution (Meszaros 1981; ... dust aerosol due to its transport from the western deserts. The understanding of the ...

  7. Importance of representing optical depth variability for estimates of global line-shaped contrail radiative forcing.

    Science.gov (United States)

    Kärcher, Bernd; Burkhardt, Ulrike; Ponater, Michael; Frömming, Christine

    2010-11-09

    Estimates of the global radiative forcing by line-shaped contrails differ mainly due to the large uncertainty in contrail optical depth. Most contrails are optically thin so that their radiative forcing is roughly proportional to their optical depth and increases with contrail coverage. In recent assessments, the best estimate of mean contrail radiative forcing was significantly reduced, because global climate model simulations pointed at lower optical depth values than earlier studies. We revise these estimates by comparing the probability distribution of contrail optical depth diagnosed with a climate model with the distribution derived from a microphysical, cloud-scale model constrained by satellite observations over the United States. By assuming that the optical depth distribution from the cloud model is more realistic than that from the climate model, and by taking the difference between the observed and simulated optical depth over the United States as globally representative, we quantify uncertainties in the climate model's diagnostic contrail parameterization. Revising the climate model results accordingly increases the global mean radiative forcing estimate for line-shaped contrails by a factor of 3.3, from 3.5 mW/m(2) to 11.6 mW/m(2) for the year 1992. Furthermore, the satellite observations and the cloud model point at higher global mean optical depth of detectable contrails than often assumed in radiative transfer (off-line) studies. Therefore, we correct estimates of contrail radiative forcing from off-line studies as well. We suggest that the global net radiative forcing of line-shaped persistent contrails is in the range 8-20 mW/m(2) for the air traffic in the year 2000.

  8. New Variable Stars in the KP2001 Catalog from the Data Base of the Northern Sky Variability Survey

    Science.gov (United States)

    Petrosyan, G. V.

    2018-03-01

    The optical variability of stars in the KP2001 catalog is studied. Monitor data from the automatic Northern Sky Variability Survey (NSVS) are used for this purpose. Of the 257 objects that were studied, 5 are Mira Ceti variables (mirids), 33 are semiregular (SR), and 108 are irregular variables (Ir). The light curves of the other objects show no noticeable signs of variability. For the first time, 11 stars are assigned to the semiregular and 105 stars to the irregular variables. Of the irregular variables, the light curves of two, No. 8 and No. 194, are distinct and are similar to the curves for eclipsing variables. The periods and amplitudes of the mirids and semiregular variables are determined using the "VStar" program package from AAVSO. The absolute stellar magnitudes M K and distances are also estimated, along with the mass loss for the mirids. The behavior of stars from KP2001 in 2MASS and WISE color diagrams is examined.

  9. Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation

    Science.gov (United States)

    2009-09-01

    Introduction This presentation summarizes recent activity in monitoring spacecraft health status using passive remote optical nonimaging ...Approved for public release; distribution is unlimited. Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation...It is beneficial to the observer/analyst to understand the fundamental optical signature variability associated with these detection and

  10. A Miniaturized Optical Sensor with Integrated Gas Cell

    NARCIS (Netherlands)

    Ayerden, N.P.; Ghaderi, M.; De Graaf, G.; Wolffenbuttel, R.F.

    2015-01-01

    The design, fabrication and characterization of a highly integrated optical gas sensor is presented. The gas cell takes up most of the space in a microspectrometer and is the only component that has so far not been miniaturized. Using the tapered resonator cavity of a linear variable optical filter

  11. Extreme Variables in Star Forming Regions

    Science.gov (United States)

    Contreras Peña, Carlos Eduardo

    2015-01-01

    The notion that low- to intermediate-mass young stellar objects (YSOs) gain mass at a constant rate during the early stages of their evolution appears to be challenged by observations of YSOs suffering sudden increases of the rate at which they gain mass from their circumstellar discs. Also, this idea that stars spend most of their lifetime with a low accretion rate and gain most of their final mass during short-lived episodes of high accretion bursts, helps to solve some long-standing problems in stellar evolution. The original classification of eruptive variables divides them in two separate subclasses known as FU Orionis stars (FUors) and EX Lupi stars (EXors). In this classical view FUors are at an early evolutionary stage and are still gaining mass from their parent envelopes, whilst EXors are thought to be older objects only surrounded by an accretion disc. The problem with this classical view is that it excludes younger protostars which have higher accretion rates but are too deeply embedded in circumstellar matter to be observed at optical wavelengths. Optically invisible protostars have been observed to display large variability in the near-infrared. These and some recent discoveries of new eruptive variables, show characteristics that can be attributed to both of the optically-defined subclasses of eruptive variables. The new objects have been proposed to be part of a new class of eruptive variables. However, a more accepted scenario is that in fact the original classes only represent two extremes of the same phenomena. In this sense eruptive variability could be explained as arising from one physical mechanism, i.e. unsteady accretion, where a variation in the parameters of such mechanism can cause the different characteristics observed in the members of this class. With the aim of studying the incidence of episodic accretion among young stellar objects, and to characterize the nature of these eruptive variables we searched for high amplitude variability

  12. Development of multilayer optics for X-ray broadband spectrometry of plasma emission

    International Nuclear Information System (INIS)

    Emprin, Benoit

    2014-01-01

    Within the framework of the research on inertial confinement fusion, the 'Commissariat a l'energie atomique et aux energies alternatives' has studied and implemented an absolute calibrated time-Resolved broadband soft x-Ray spectrometer, called 'Diagnostic de Mesure du rayonnement X'. This diagnostic, composed of 20 measurement channels, measures the emitted radiant power from a laser created plasma in the range from 50 eV to 20 keV. We have developed additional measurement channels to obtain redundancy and an improvement in measurement accuracy. The principle of these new channels is based on an original concept to obtain spectral bounded flat-Responses. Two channels have been developed for the 2 - 4 keV and 4 - 6 keV spectral ranges, using aperiodic multilayer mirrors made at the 'Laboratoire Charles Fabry' with Cr/Sc and Ni/W/SiC/W layers respectively. These mirrors were characterized at synchrotron radiation facilities and integrated into the spectrometer. The two new channels were used during laser-Plasma experimental campaigns at the OMEGA laser facility in Rochester (USA). This allowed us to determine directly the radiant power with only one measurement within a certain spectral band, and with a better precision when compared with using standard channels. The results, in good agreement with the standard measurement channels, allowed us to validate the use of aperiodic multilayer mirrors for X-Ray broadband spectrometry. (author) [fr

  13. PREVAIL: latest electron optics results

    Science.gov (United States)

    Pfeiffer, Hans C.; Golladay, Steven D.; Gordon, Michael S.; Kendall, Rodney A.; Lieberman, Jon E.; Rockrohr, James D.; Stickel, Werner; Yamaguchi, Takeshi; Okamoto, Kazuya; Umemoto, Takaaki; Shimizu, Hiroyasu; Kojima, Shinichi; Hamashima, Muneki

    2002-07-01

    The PREVAIL electron optics subsystem developed by IBM has been installed at Nikon's facility in Kumagaya, Japan, for integration into the Nikon commercial EPL stepper. The cornerstone of the electron optics design is the Curvilinear Variable Axis Lens (CVAL) technique originally demonstrated with a proof of concept system. This paper presents the latest experimental results obtained with the electron optical subsystem at Nikon's facility. The results include micrographs illustrating proper CVAL operation through the spatial resolution achieved over the entire optical field of view. They also include data on the most critical issue of the EPL exposure approach: subfield stitching. The methodology of distortion correction will be described and both micrographs and metrology data of stitched subfields will be presented. This paper represents a progress report of the IBM/Nikon alliance activity on EPL.

  14. Maritime Aerosol optical properties measured by ship-borne sky radiometer

    Science.gov (United States)

    Aoki, K.

    2017-12-01

    Maritime aerosols play an important role in the earth climate change. We started the measurements of aerosol optical properties since 1994 by using ship-borne sky radiometer (POM-01 MK-II and III; Prede Co. Ltd., Japan) over the ocean. We report the results of an aerosol optical properties over the ocean by using Research Vessel of the ship-borne sky radiometers. Aerosol optical properties observation were made in MR10-02 to MR16-09 onboard the R/V Mirai, JAMSTEC. The sky radiometer measure the direct and diffuse solar radiance with seven interference filters (0.315, 0.4, 0.5, 0.675, 0.87, 0.94, and 1.02 µm). Observation interval was made every five minutes by once, only in daytime under the clear sky conditions. GPS provides the position with longitude and latitude and heading direction of the vessel, and azimuth and elevation angle of the sun. The aerosol optical properties were computed using the SKYRAD.pack version 4.2. The obtained Aerosol optical properties (Aerosol optical thickness, Ångström exponent, Single scattering albedo, and etc.) and size distribution volume clearly showed spatial and temporal variability over the ocean. Aerosol optical thickness found over the near the coast (Asia and Tropical area) was high and variable. The size distribution volume have peaks at small particles at Asian coast and large particles at Tropical coast area. We provide the information, in this presentation, on the aerosol optical properties measurements with temporal and spatial variability in the Maritime Aerosol. This project is validation satellite of GCOM-C/SGLI, JAXA and other. The GCOM-C satellite scheduled to be launched in 2017 JFY.

  15. Controlling the influence of elastic eigenmodes on nanomagnet dynamics through pattern geometry

    Energy Technology Data Exchange (ETDEWEB)

    Berk, C., E-mail: crberk@soe.ucsc.edu [School of Engineering, University of California Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States); Yahagi, Y. [School of Engineering, University of California Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States); Dhuey, S.; Cabrini, S. [Molecular Foundry, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Schmidt, H. [School of Engineering, University of California Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States)

    2017-03-15

    The effect of the nanoscale array geometry on the interaction between optically generated surface acoustic waves (SAWs) and nanomagnet dynamics is investigated using Time-Resolved Magneto-Optical Kerr Effect Microscopy (TR-MOKE). It is demonstrated that altering the nanomagnet geometry from a periodic to a randomized aperiodic pattern effectively removes the magneto-elastic effect of SAWs on the magnetization dynamics. The efficiency of this method depends on the extent of any residual spatial correlations and is quantified by spatial Fourier analysis of the two structures. Randomization allows observation and extraction of intrinsic magnetic parameters such as spin wave frequencies and damping to be resolvable using all-optical methods, enabling the conclusion that the fabrication process does not affect the damping.

  16. Controlling the influence of elastic eigenmodes on nanomagnet dynamics through pattern geometry

    Science.gov (United States)

    Berk, C.; Yahagi, Y.; Dhuey, S.; Cabrini, S.; Schmidt, H.

    2017-03-01

    The effect of the nanoscale array geometry on the interaction between optically generated surface acoustic waves (SAWs) and nanomagnet dynamics is investigated using Time-Resolved Magneto-Optical Kerr Effect Microscopy (TR-MOKE). It is demonstrated that altering the nanomagnet geometry from a periodic to a randomized aperiodic pattern effectively removes the magneto-elastic effect of SAWs on the magnetization dynamics. The efficiency of this method depends on the extent of any residual spatial correlations and is quantified by spatial Fourier analysis of the two structures. Randomization allows observation and extraction of intrinsic magnetic parameters such as spin wave frequencies and damping to be resolvable using all-optical methods, enabling the conclusion that the fabrication process does not affect the damping.

  17. Advances in hybrid optics physical sensors for extreme environments

    Science.gov (United States)

    Riza, Nabeel A.

    2010-04-01

    Highlighted are novel innovations in hybrid optical design physical sensors for extreme environments. Various hybrid design compositions are proposed that are suited for a particular sensor application. Examples includes combining freespace (wireless) and fiber-optics (wired) for gas turbine sensing and combining single crystal and sintered Silicon Carbide (SiC) materials for robust extreme environment Coefficent of Thermal Expansion (CTE) matched frontend probe design. Sensor signal processing also includes the hybrid theme where for example Black-Body radiation thermometry (pyrometry) is combined with laser interferometry to provide extreme temperature measurements. The hybrid theme also operates on the optical device level where a digital optical device such as a Digital Micromirror Device (DMD) is combined with an analog optical device such as an Electronically Controlled Variable Focal Length Lens (ECVFL) to deliver a smart and compressive Three Dimensional (3-D) imaging sensor for remote scene and object shape capture including both ambient light (passive) mode and active laser targeting and receive processing. Within a device level, the hybrid theme also operates via combined analog and digital control such as within a wavelength-coded variable optical delay line. These powerful hybrid design optical sensors have numerous applications in engineering and science applications from the military to the commercial/industrial sectors.

  18. [The Autocad system for planimetric study of the optic disc in glaucoma: technique and reproducibility study].

    Science.gov (United States)

    Sánchez Pérez, A; Honrubia López, F M; Larrosa Poves, J M; Polo Llorens, V; Melcon Sánchez-Frieras, B

    2001-09-01

    To develop a lens planimetry technique for the optic disc using AutoCAD. To determine variability magnitude of the optic disc morphological measurements. We employed AutoCAD R.14.0 Autodesk: image acquisition, contour delimitation by multiple lines fitting or ellipse adjustment, image sectorialization and measurements quantification (optic disc and excavation, vertical diameters, optic disc area, excavation area, neuroretinal sector area and Beta atrophy area). Intraimage or operator and interimage o total reproducibility was studied by coefficient of variability (CV) (n=10) in normal and myopic optic discs. This technique allows to obtain optic disc measurement in 5 to 10 minutes time. Total or interimage variability of measurements introduced by one observer presents CV range from 1.18-4.42. Operator or intraimage measurement presents CV range from 0.30-4.21. Optic disc contour delimitation by ellipse adjustment achieved better reproducibility results than multiple lines adjustment in all measurements. Computer assisted AutoCAD planimetry is an interactive method to analyse the optic disc, feasible to incorporate to clinical practice. Reproducibility results are comparable to other analyzers in quantification optic disc morphology. Ellipse adjustment improves results in optic disc contours delimitation.

  19. Combined optical/digital security devices

    Science.gov (United States)

    Girnyk, Vladimir I.; Tverdokhleb, Igor V.; Ivanovsky, Andrey A.

    2000-04-01

    Modern holographic security devices used as emblems against counterfeiting are being more difficult as they should oppress criminal world. 2D, 3D, 3D rainbow holograms or simple diffraction structures protecting documents can not be acceptable against illegal copying of important documents, banknotes or valuable products. Recent developments in technology of Optical variable devices permit world leaders to create more advanced security elements: Kinegrams, Exelgrams, Pixelgrams, Kineforms. These products are used for protecting the most confidential documents and banknotes, but now even their security level can not be enough and besides their automatic identification is vulnerable to factors of instability. We elaborate new visual security devices based on the usage of expensive and advanced technology of combined optical/digital security devices. The technology unites digital and analogue methods of synthesis and recording of visual security devices. The analogue methods include techniques of optical holography - different combinations of 2D/3D, 3D, 2D/3D + 3D structures. Basing on them the design with elements of 3D graphics including security elements and hidden machine- readable images are implemented. The digital methods provide synthesis of optical variable devices including special security elements, computer generated holograms and Kineforms. Using them we create determined and quasi-random machine-readable images. Recordings are carried out using the combined optical and electronic submicrometer technology elaborated by Optronics, Ltd. The results obtained show effectiveness of the combined technology permitting to increase the security level essentially that should increase tamper and counterfeit resistance during many years.

  20. Variability of aerosol optical depth and Angstrom wavelength exponent derived from AERONET observations in recent decades

    International Nuclear Information System (INIS)

    Xia Xiangao

    2011-01-01

    Using aerosol loading data from 79 Aerosol Robotic Network (AERONET) stations with observations from more than six years, changes in aerosol optical depth (AOD) and Angstrom wavelength exponent (AWE) were studied. A statistical method was developed to determine whether AOD changes were due to increased background AOD values and/or an increased number of high AOD events. AOD decreased significantly at AERONET sites in northeastern North American and in Western Europe, which was accompanied by decreased AWE. Reduction of AOD there was mainly due to a decreased frequency of high AOD events and an increased frequency of background AOD events. In addition, decreased AOD values for high AOD events also accounted for ∼ 16–32% of the AOD reduction. This is indicative of significant meteorological effects on AOD variability. AOD trends in other regions were marginal and most were not significant; however, AOD increased significantly at one site in the Sahel and another in Saudi Arabia, predominantly due to the increased frequency of high AOD events and their average AOD.

  1. Imaging Variable Stars with HST

    Science.gov (United States)

    Karovska, M.

    2012-06-01

    (Abstract only) The Hubble Space Telescope (HST) observations of astronomical sources, ranging from objects in our solar system to objects in the early Universe, have revolutionized our knowledge of the Universe its origins and contents. I highlight results from HST observations of variable stars obtained during the past twenty or so years. Multiwavelength observations of numerous variable stars and stellar systems were obtained using the superb HST imaging capabilities and its unprecedented angular resolution, especially in the UV and optical. The HST provided the first detailed images probing the structure of variable stars including their atmospheres and circumstellar environments. AAVSO observations and light curves have been critical for scheduling of many of these observations and provided important information and context for understanding of the imaging results of many variable sources. I describe the scientific results from the imaging observations of variable stars including AGBs, Miras, Cepheids, semiregular variables (including supergiants and giants), YSOs and interacting stellar systems with a variable stellar components. These results have led to an unprecedented understanding of the spatial and temporal characteristics of these objects and their place in the stellar evolutionary chains, and in the larger context of the dynamic evolving Universe.

  2. Construction of Database for Pulsating Variable Stars

    Science.gov (United States)

    Chen, B. Q.; Yang, M.; Jiang, B. W.

    2011-07-01

    A database for the pulsating variable stars is constructed for Chinese astronomers to study the variable stars conveniently. The database includes about 230000 variable stars in the Galactic bulge, LMC and SMC observed by the MACHO (MAssive Compact Halo Objects) and OGLE (Optical Gravitational Lensing Experiment) projects at present. The software used for the construction is LAMP, i.e., Linux+Apache+MySQL+PHP. A web page is provided to search the photometric data and the light curve in the database through the right ascension and declination of the object. More data will be incorporated into the database.

  3. Investigation on performance of all optical buffer with large dynamical delay time based on cascaded double loop optical buffers

    International Nuclear Information System (INIS)

    Yong-Jun, Wang; Xiang-Jun, Xin; Xiao-Lei, Zhang; Chong-Qing, Wu; Kuang-Lu, Yu

    2010-01-01

    Optical buffers are critical for optical signal processing in future optical packet-switched networks. In this paper, a theoretical study as well as an experimental demonstration on a new optical buffer with large dynamical delay time is carried out based on cascaded double loop optical buffers (DLOBs). It is found that pulse distortion can be restrained by a negative optical control mode when the optical packet is in the loop. Noise analysis indicates that it is feasible to realise a large variable delay range by cascaded DLOBs. These conclusions are validated by the experiment system with 4-stage cascaded DLOBs. Both the theoretical simulations and the experimental results indicate that a large delay range of 1–9999 times the basic delay unit and a fine granularity of 25 ns can be achieved by the cascaded DLOBs. The performance of the cascaded DLOBs is suitable for the all optical networks. (classical areas of phenomenology)

  4. Coherent feedback control of multipartite quantum entanglement for optical fields

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Zhihui; Jia, Xiaojun; Xie, Changde; Peng, Kunchi [State Key Laboratory of Quantum Optics and Quantum Optics Devices, Institute of Opto-Electronics, Shanxi University, Taiyuan, 030006 (China)

    2011-12-15

    Coherent feedback control (CFC) of multipartite optical entangled states produced by a nondegenerate optical parametric amplifier is theoretically studied. The features of the quantum correlations of amplitude and phase quadratures among more than two entangled optical modes can be controlled by tuning the transmissivity of the optical beam splitter in the CFC loop. The physical conditions to enhance continuous variable multipartite entanglement of optical fields utilizing the CFC loop are obtained. The numeric calculations based on feasible physical parameters of realistic systems provide direct references for the design of experimental devices.

  5. Combined machine-readable and visually authenticated optical devices

    Science.gov (United States)

    Souparis, Hugues

    1996-03-01

    Optical variable devices are now widely used on documents or values. The most recent optical visual features with high definition, animation, brightness, special color tune, provide excellent first and second levels of authentication. Human eye is the only instrument required to check the authenticity. This is a major advantage of OVDs in many circumstances, such as currency exchange, ID street control . . . But, under other circumstances, such as automatic payments with banknotes, volume ID controls at boarders, ID controls in shops . . . an automatic authentication will be necessary or more reliable. When both a visual and automated authentication are required, the combination, on the same security component, of a variable image and a machine readable optical element is a very secure and cost effective solution for the protection of documents. Several techniques are now available an can be selected depending upon the respective roles of the machine readability and visual control.

  6. Exploratory Spectroscopy of Magnetic Cataclysmic Variables Candidates and Other Variable Objects

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, A. S.; Palhares, M. S. [IP and D, Universidade do Vale do Paraíba, 12244-000, São José dos Campos, SP (Brazil); Rodrigues, C. V.; Cieslinski, D.; Jablonski, F. J. [Divisão de Astrofísica, Instituto Nacional de Pesquisas Espaciais, 12227-010, São José dos Campos, SP (Brazil); Silva, K. M. G. [Gemini Observatory, Casilla 603, La Serena (Chile); Almeida, L. A. [Instituto de Astronomia, Geofísica e Ciências Atmosféricas, Universidade de São Paulo, 05508-900, São Paulo, SP (Brazil); Rodríguez-Ardila, A., E-mail: alexandre@univap.br [Laboratório Nacional de Astrofísica LNA/MCTI, 37504-364, Itajubá MG (Brazil)

    2017-04-01

    The increasing number of synoptic surveys made by small robotic telescopes, such as the photometric Catalina Real-Time Transient Survey (CRTS), provides a unique opportunity to discover variable sources and improves the statistical samples of such classes of objects. Our goal is the discovery of magnetic Cataclysmic Variables (mCVs). These are rare objects that probe interesting accretion scenarios controlled by the white-dwarf magnetic field. In particular, improved statistics of mCVs would help to address open questions on their formation and evolution. We performed an optical spectroscopy survey to search for signatures of magnetic accretion in 45 variable objects selected mostly from the CRTS. In this sample, we found 32 CVs, 22 being mCV candidates, 13 of which were previously unreported as such. If the proposed classifications are confirmed, it would represent an increase of 4% in the number of known polars and 12% in the number of known IPs. A fraction of our initial sample was classified as extragalactic sources or other types of variable stars by the inspection of the identification spectra. Despite the inherent complexity in identifying a source as an mCV, variability-based selection, followed by spectroscopic snapshot observations, has proved to be an efficient strategy for their discoveries, being a relatively inexpensive approach in terms of telescope time.

  7. Multifocal visual evoked potentials for quantifying optic nerve dysfunction in patients with optic disc drusen

    DEFF Research Database (Denmark)

    Malmqvist, Lasse; de Santiago, Luis; Boquete, Luciano

    2017-01-01

    and 22 control subjects were examined. Mean amplitude, mean inner ring (IR) amplitude (0.87-5.67° of visual field) and mean outer ring amplitude (5.68-24° of visual field) were calculated using signal-to-noise ratio (SNR) and peak-to-peak analysis. Monocular latency was calculated using second peak......PURPOSE: To explore the applicability of multifocal visual evoked potentials (mfVEPs) for research and clinical diagnosis in patients with optic disc drusen (ODD). This is the first assessment of mfVEP amplitude in patients with ODD. METHODS: MfVEP amplitude and latency from 33 patients with ODD......, full eye and IR. In the control group, SNR intersubject variability was 17.6% and second peak latency intersubject variability was 2.8%. CONCLUSION: Decreased mfVEP amplitude in patients with ODD suggests a direct mechanical compression of the optic nerve axons. Our results suggest that mfVEP amplitude...

  8. Multisoliton solutions in terms of double Wronskian determinant for a generalized variable-coefficient nonlinear Schroedinger equation from plasma physics, arterial mechanics, fluid dynamics and optical communications

    International Nuclear Information System (INIS)

    Lue Xing; Zhu Hongwu; Yao Zhenzhi; Meng Xianghua; Zhang Cheng; Zhang Chunyi; Tian Bo

    2008-01-01

    In this paper, the multisoliton solutions in terms of double Wronskian determinant are presented for a generalized variable-coefficient nonlinear Schroedinger equation, which appears in space and laboratory plasmas, arterial mechanics, fluid dynamics, optical communications and so on. By means of the particularly nice properties of Wronskian determinant, the solutions are testified through direct substitution into the bilinear equations. Furthermore, it can be proved that the bilinear Baecklund transformation transforms between (N - 1)- and N-soliton solutions

  9. New Statistical Model for Variability of Aerosol Optical Thickness: Theory and Application to MODIS Data over Ocean

    Science.gov (United States)

    Alexandrov, Mikhail Dmitrievic; Geogdzhayev, Igor V.; Tsigaridis, Konstantinos; Marshak, Alexander; Levy, Robert; Cairns, Brian

    2016-01-01

    A novel model for the variability in aerosol optical thickness (AOT) is presented. This model is based on the consideration of AOT fields as realizations of a stochastic process, that is the exponent of an underlying Gaussian process with a specific autocorrelation function. In this approach AOT fields have lognormal PDFs and structure functions having the correct asymptotic behavior at large scales. The latter is an advantage compared with fractal (scale-invariant) approaches. The simple analytical form of the structure function in the proposed model facilitates its use for the parameterization of AOT statistics derived from remote sensing data. The new approach is illustrated using a month-long global MODIS AOT dataset (over ocean) with 10 km resolution. It was used to compute AOT statistics for sample cells forming a grid with 5deg spacing. The observed shapes of the structure functions indicated that in a large number of cases the AOT variability is split into two regimes that exhibit different patterns of behavior: small-scale stationary processes and trends reflecting variations at larger scales. The small-scale patterns are suggested to be generated by local aerosols within the marine boundary layer, while the large-scale trends are indicative of elevated aerosols transported from remote continental sources. This assumption is evaluated by comparison of the geographical distributions of these patterns derived from MODIS data with those obtained from the GISS GCM. This study shows considerable potential to enhance comparisons between remote sensing datasets and climate models beyond regional mean AOTs.

  10. Optical properties and light irradiance of monolithic zirconia at variable thicknesses.

    Science.gov (United States)

    Sulaiman, Taiseer A; Abdulmajeed, Aous A; Donovan, Terrence E; Ritter, André V; Vallittu, Pekka K; Närhi, Timo O; Lassila, Lippo V

    2015-10-01

    The aims of this study were to: (1) estimate the effect of polishing on the surface gloss of monolithic zirconia, (2) measure and compare the translucency of monolithic zirconia at variable thicknesses, and (3) determine the effect of zirconia thickness on irradiance and total irradiant energy. Four monolithic partially stabilized zirconia (PSZ) brands; Prettau® (PRT, Zirkonzahn), Bruxzir® (BRX, Glidewell), Zenostar® (ZEN, Wieland), Katana® (KAT, Noritake), and one fully stabilized zirconia (FSZ); Prettau Anterior® (PRTA, Zirkonzahn) were used to fabricate specimens (n=5/subgroup) with different thicknesses (0.5, 0.7, 1.0, 1.2, 1.5, and 2.0mm). Zirconia core material ICE® Zircon (ICE, Zirkonzahn) was used as a control. Surface gloss and translucency were evaluated using a reflection spectrophotometer. Irradiance and total irradiant energy transmitted through each specimen was quantified using MARC® Resin Calibrator. All specimens were then subjected to a standardized polishing method and the surface gloss, translucency, irradiance, and total irradiant energy measurements were repeated. Statistical analysis was performed using two-way ANOVA and post-hoc Tukey's tests (pgloss was significantly affected by polishing (p<0.05), regardless of brand and thickness. Translucency values ranged from 5.65 to 20.40 before polishing and 5.10 to 19.95 after polishing. The ranking from least to highest translucent (after polish) was: BRX=ICE=PRToptical properties of zirconia restorations. FSZ is relatively more polishable and translucent than PSZ. Copyright © 2015 Academy of Dental Materials

  11. How Far Is Quasar UV/Optical Variability from a Damped Random Walk at Low Frequency?

    Energy Technology Data Exchange (ETDEWEB)

    Guo Hengxiao; Wang Junxian; Cai Zhenyi; Sun Mouyuan, E-mail: hengxiaoguo@gmail.com, E-mail: jxw@ustc.edu.cn [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei 230026 (China)

    2017-10-01

    Studies have shown that UV/optical light curves of quasars can be described using the prevalent damped random walk (DRW) model, also known as the Ornstein–Uhlenbeck process. A white noise power spectral density (PSD) is expected at low frequency in this model; however, a direct observational constraint to the low-frequency PSD slope is difficult due to the limited lengths of the light curves available. Meanwhile, quasars show scatter in their DRW parameters that is too large to be attributed to uncertainties in the measurements and dependence on the variation of known physical factors. In this work we present simulations showing that, if the low-frequency PSD deviates from the DRW, the red noise leakage can naturally produce large scatter in the variation parameters measured from simulated light curves. The steeper the low-frequency PSD slope, the larger scatter we expect. Based on observations of SDSS Stripe 82 quasars, we find that the low-frequency PSD slope should be no steeper than −1.3. The actual slope could be flatter, which consequently requires that the quasar variabilities should be influenced by other unknown factors. We speculate that the magnetic field and/or metallicity could be such additional factors.

  12. Analysis of nearly simultaneous x-ray and optical observations of active galactic nuclei

    International Nuclear Information System (INIS)

    Webb, J.R.

    1988-01-01

    Rosemary Hill optical and EINSTEIN X-ray observations of a sample of 36 galactic nuclei (AGN) were reduced and analyzed. Seventy-two x-ray observations of these sources were reduced, nineteen of which yielded spectral information. Of these spectra observations, significant hydrogen column densities above the galactic value were required for nine of the active galactic nuclei. X-ray variability was detected in eight of the eleven sources which were observed more than once by EINSTEIN. Correlations between the x-ray and optical luminosities were investigated using the Jefferys method of least squares. This method allows for errors in both variables. The results indicate a strong correlation between the x-ray and optical luminosities for the entire sample. Division of the sample into groups with similar optical variability characteristics show that the less violently violent variable AGN are more highly correlated than the violently variable blazars. Infrared and radio observations were combined with the x-ray and optical observations of six AGN. These sources were modelled in terms of the synchrotron-self-Compton model. The turnover frequency falls between the infrared and radio data and reliable estimates of this parameter are difficult to estimate. Therefore the results were found as a function of the turnover frequency. Four sources required relativistic bulk motion or beaming. Multifrequency spectra made at different times for one individual source, 0235+164, required different amounts of beaming to satisfy the x-ray observations. Sizes of the emitting regions for the sources modelled ranged from 0.5 parsec to 1.0 parsec

  13. Particle-induced amorphization of complex ceramics. Final report

    International Nuclear Information System (INIS)

    Ewing, R.C.; Wang, L.M.

    1998-01-01

    The crystalline-to-amorphous (c-a) phase transition is of fundamental importance. Particle irradiations provide an important, highly controlled means of investigating this phase transformation and the structure of the amorphous state. The interaction of heavy-particles with ceramics is complex because these materials have a wide range of structure types, complex compositions, and because chemical bonding is variable. Radiation damage and annealing can produce diverse results, but most commonly, single crystals become aperiodic or break down into a polycrystalline aggregate. The authors continued the studies of the transition from the periodic-to-aperiodic state in natural materials that have been damaged by α-recoil nuclei in the uranium and thorium decay series and in synthetic, analogous structures. The transition from the periodic to aperiodic state was followed by detailed x-ray diffraction analysis, in-situ irradiation/transmission electron microscopy, high resolution transmission electron microscopy, extended x-ray absorption fine structure spectroscopy/x-ray absorption near edge spectroscopy and other spectroscopic techniques. These studies were completed in conjunction with bulk irradiations that can be completed at Los Alamos National Laboratory or Sandia National Laboratories. Principal questions addressed in this research program included: (1) What is the process at the atomic level by which a ceramic material is transformed into a disordered or aperiodic state? (2) What are the controlling effects of structural topology, bond-type, dose rate, and irradiation temperature on the final state of the irradiated material? (3) What is the structure of the damaged material? (4) What are the mechanisms and kinetics for the annealing of interstitial and aggregate defects in these irradiated ceramic materials? (5) What general criteria may be applied to the prediction of amorphization in complex ceramics?

  14. Continuous-variable entanglement distillation of non-Gaussian mixed states

    International Nuclear Information System (INIS)

    Dong Ruifang; Lassen, Mikael; Heersink, Joel; Marquardt, Christoph; Leuchs, Gerd; Filip, Radim; Andersen, Ulrik L.

    2010-01-01

    Many different quantum-information communication protocols such as teleportation, dense coding, and entanglement-based quantum key distribution are based on the faithful transmission of entanglement between distant location in an optical network. The distribution of entanglement in such a network is, however, hampered by loss and noise that is inherent in all practical quantum channels. Thus, to enable faithful transmission one must resort to the protocol of entanglement distillation. In this paper we present a detailed theoretical analysis and an experimental realization of continuous variable entanglement distillation in a channel that is inflicted by different kinds of non-Gaussian noise. The continuous variable entangled states are generated by exploiting the third order nonlinearity in optical fibers, and the states are sent through a free-space laboratory channel in which the losses are altered to simulate a free-space atmospheric channel with varying losses. We use linear optical components, homodyne measurements, and classical communication to distill the entanglement, and we find that by using this method the entanglement can be probabilistically increased for some specific non-Gaussian noise channels.

  15. Generating continuous variable optical quantum states and entanglement

    International Nuclear Information System (INIS)

    Lam, P.K.; Bowen, W.P.; Schnabel, R.; Treps, N.; Buchler, B.C.; Bachor, H.-A.; Ralph, T.C.

    2002-01-01

    Full text: Quantum information research has recently been shown to have many applications in the field of communication and information processing. Quantum states and entanglement play a central role to almost all quantum information protocols, and form the basic building blocks for larger quantum information networks. We present an overview of the research activities at the quantum optics group at the ANU relating to this area. In particular, we demonstrate technology to suppress the noise on a coherent laser beam to below that of even vacuum. This quantum state of light is called 'squeezed light'. We show experimentally that by mixing two squeezed beams on a beam splitter, a pair of Einstein-Podolsky-Rosen (EPR) entangled beams can be created. This kind of entanglement exhibits below shot noise correlations between both the phase and amplitude quandratures of two beams. Our experimental results show conclusively that our entangled beams demonstrate the famous EPR paradox

  16. Experimental demonstrations of all-optical networking functions for WDM optical networks

    Science.gov (United States)

    Gurkan, Deniz

    The deployment of optical networks will enable high capacity links between users but will introduce the problems associated with transporting and managing more channels. Many network functions should be implemented in optical domain; main reasons are: to avoid electronic processing bottlenecks, to achieve data-format and data-rate independence, to provide reliable and cost efficient control and management information, to simultaneously process multiple wavelength channel operation for wavelength division multiplexed (WDM) optical networks. The following novel experimental demonstrations of network functions in the optical domain are presented: Variable-bit-rate recognition of the header information in a data packet. The technique is reconfigurable for different header sequences and uses optical correlators as look-up tables. The header is processed and a signal is sent to the switch for a series of incoming data packets at 155 Mb/s, 622 Mb/s, and 2.5 Gb/s in a reconfigurable network. Simultaneous optical time-slot-interchange and wavelength conversion of the bits in a 2.5-Gb/s data stream to achieve a reconfigurable time/wavelength switch. The technique uses difference-frequency-generation (DFG) for wavelength conversion and fiber Bragg gratings (FBG) as wavelength-dependent optical time buffers. The WDM header recognition module simultaneously recognizing two header bits on each of two 2.5-Gbit/s WDM packet streams. The module is tunable to enable reconfigurable look-up tables. Simultaneous and independent label swapping and wavelength conversion of two WDM channels for a multi-protocol label switching (MPLS) network. Demonstration of label swapping of distinct 8-bit-long labels for two WDM data channels is presented. Two-dimensional code conversion module for an optical code-division multiple-access (O-CDMA) local area network (LAN) system. Simultaneous wavelength conversion and time shifting is achieved to enable flexible code conversion and increase code re

  17. Influence of variable tungsten valency on optical transmittance and radiation hardness of lead tungstate (PWO) scintillation crystals

    CERN Document Server

    Burachas, S; Makov, I; Saveliev, Yu; Ippolitov, M S; Man'ko, V; Nikulin, S P; Nyanin, A; Vasilev, A; Apanasenko, A; Tamulaitis, G

    2003-01-01

    A new approach to interpret the radiation hardness of PbWO//4 (PWO) scintillators is developed by revealing importance of the inclusions of tungsten oxides WO//3//-//x with variable valency. It is demonstrated that the influence of the ionizing radiation on PWO is, in many aspects, similar to the effect of the high-temperature annealing in oxygenless ambient. In both cases, a valency change of the tungsten oxides is initiated and results in induced absorption and, consequently, in crystal coloration. In the PWO crystals doped with L//2O//3 (L = Y, La, Gd), the radiation hardness and the optical properties are mainly affected by inclusions of W//1//-//yL//yO//3//- //x (0 less than x less than 0.3) instead of inclusions of WO//3//- //x prevailing in the undoped samples. It is demonstrated that the radiation-induced bleaching and the photochromic effect of PWO are caused by phase transitions in the inclusions of tungsten oxide. Thermodynamic conditions for the phase transitions are discussed and the optimal oxid...

  18. On the K-term and dispersion ratios of semi-regular variables

    International Nuclear Information System (INIS)

    Aslan, Z.

    1981-01-01

    Optical velocities of semi-regular (SR) and irregular (Lb) variables are analysed for a K-term. There is evidence for a dependence upon stellar period. Absorption lines in shorter period non-emission SR variables are blue-shifted relative to the centre-of-mass velocity by about 6 +- 3 km s -1 . Emission-line SR variables give a non-negative absorption K-term and Lb variables give no K-terms other than zero. Comparison is made with the K-terms implied by the OH velocity pattern in long-period variables. Dispersion ratios are also calculated. (author)

  19. Methods for the Quasi-Periodic Variability Analysis in Blazars Y. Liu ...

    Indian Academy of Sciences (India)

    the variability analysis in blazars in optical and radio bands, to search for possible quasi-periodic signals. 2. Power spectral density (PSD). In statistical signal processing and physics, the power spectral density (PSD) is a positive real function of a frequency variable associated with a stationary stochas- tic process. Intuitively ...

  20. Construction of the Database for Pulsating Variable Stars

    Science.gov (United States)

    Chen, Bing-Qiu; Yang, Ming; Jiang, Bi-Wei

    2012-01-01

    A database for pulsating variable stars is constructed to favor the study of variable stars in China. The database includes about 230,000 variable stars in the Galactic bulge, LMC and SMC observed in an about 10 yr period by the MACHO(MAssive Compact Halo Objects) and OGLE(Optical Gravitational Lensing Experiment) projects. The software used for the construction is LAMP, i.e., Linux+Apache+MySQL+PHP. A web page is provided for searching the photometric data and light curves in the database through the right ascension and declination of an object. Because of the flexibility of this database, more up-to-date data of variable stars can be incorporated into the database conveniently.

  1. Encoded diffractive optics for full-spectrum computational imaging

    KAUST Repository

    Heide, Felix; Fu, Qiang; Peng, Yifan; Heidrich, Wolfgang

    2016-01-01

    Diffractive optical elements can be realized as ultra-thin plates that offer significantly reduced footprint and weight compared to refractive elements. However, such elements introduce severe chromatic aberrations and are not variable, unless used in combination with other elements in a larger, reconfigurable optical system. We introduce numerically optimized encoded phase masks in which different optical parameters such as focus or zoom can be accessed through changes in the mechanical alignment of a ultra-thin stack of two or more masks. Our encoded diffractive designs are combined with a new computational approach for self-calibrating imaging (blind deconvolution) that can restore high-quality images several orders of magnitude faster than the state of the art without pre-calibration of the optical system. This co-design of optics and computation enables tunable, full-spectrum imaging using thin diffractive optics.

  2. Encoded diffractive optics for full-spectrum computational imaging

    KAUST Repository

    Heide, Felix

    2016-09-16

    Diffractive optical elements can be realized as ultra-thin plates that offer significantly reduced footprint and weight compared to refractive elements. However, such elements introduce severe chromatic aberrations and are not variable, unless used in combination with other elements in a larger, reconfigurable optical system. We introduce numerically optimized encoded phase masks in which different optical parameters such as focus or zoom can be accessed through changes in the mechanical alignment of a ultra-thin stack of two or more masks. Our encoded diffractive designs are combined with a new computational approach for self-calibrating imaging (blind deconvolution) that can restore high-quality images several orders of magnitude faster than the state of the art without pre-calibration of the optical system. This co-design of optics and computation enables tunable, full-spectrum imaging using thin diffractive optics.

  3. Secchi depth analysis using bio-optical parameters measured in the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Suresh, T.; Naik, P.; Bandishte, M.; Desa, E.; Mascarenhas, A.A.M.Q.; Matondkar, S.G.P.

    spatial and temporal variability of Secchi depth and their dependence on the optical properties beam attenuation and diffuse attenuation the biological parameter of Chlorophyll. The in-situ measured inherent and apparent optical properties have been used...

  4. Integrated Quantum Optics: Experiments towards integrated quantum-light sources and quantum-enhanced sensing

    DEFF Research Database (Denmark)

    Hoff, Ulrich Busk

    The work presented in this thesis is focused on experimental application and generation of continuous variable quantum correlated states of light in integrated dielectric structures. Squeezed states are among the most exploited continuous variable optical states for free-space quantum-enhanced se...... is presented and an optimized device design is proposed. The devices have been fabricated and tested optically and preliminary interrogations of the output quantum noise have been performed....

  5. Experimental demonstration of spectrum-sliced elastic optical path network (SLICE).

    Science.gov (United States)

    Kozicki, Bartłomiej; Takara, Hidehiko; Tsukishima, Yukio; Yoshimatsu, Toshihide; Yonenaga, Kazushige; Jinno, Masahiko

    2010-10-11

    We describe experimental demonstration of spectrum-sliced elastic optical path network (SLICE) architecture. We employ optical orthogonal frequency-division multiplexing (OFDM) modulation format and bandwidth-variable optical cross-connects (OXC) to generate, transmit and receive optical paths with bandwidths of up to 1 Tb/s. We experimentally demonstrate elastic optical path setup and spectrally-efficient transmission of multiple channels with bit rates ranging from 40 to 140 Gb/s between six nodes of a mesh network. We show dynamic bandwidth scalability for optical paths with bit rates of 40 to 440 Gb/s. Moreover, we demonstrate multihop transmission of a 1 Tb/s optical path over 400 km of standard single-mode fiber (SMF). Finally, we investigate the filtering properties and the required guard band width for spectrally-efficient allocation of optical paths in SLICE.

  6. A geometric morphometric assessment of the optic cup in glaucoma.

    Science.gov (United States)

    Sanfilippo, Paul G; Cardini, Andrea; Sigal, Ian A; Ruddle, Jonathan B; Chua, Brian E; Hewitt, Alex W; Mackey, David A

    2010-09-01

    The morphologic appearance of the optic disc is of interest in glaucoma. In contrast to descriptive classification systems that are currently used, a quantitative approach to the analysis of optic disc morphology is required. Our goal was to determine the optimal method for quantifying optic cup shape by comparing traditional (ovality, form-factor and neuroretinal rim (NRR) width ratio) and geometric morphometric approaches. Left optic disc stereophotographs of 160 (80 normal and 80 glaucomatous (stratified by severity)) subjects were examined. The optic cup margins were stereoscopically delineated with a custom tracing system and saved as a series of discrete points. The geometric morphometric methods of elliptic Fourier analysis (EFA) and sliding semi-landmark analysis (SSLA) were used to eliminate variation unrelated to shape (e.g. size) and yield a series of shape variables. Differences in optic cup shape between normal and glaucoma groups were investigated. Discriminant functions were computed and the sensitivity and specificity of each technique determined. Receiver operator characteristic (ROC) curves were calculated for all methods and evaluated in their potential to discriminate between normal and glaucomatous eyes based on the shape variables. All geometric morphometric methods revealed differences between normal and glaucomatous eyes in optic cup shape, in addition to the traditional parameters of ovality, form-factor and NRR width ratio (pgeometric morphometric approach for discriminating between normal and glaucomatous eyes in optic cup shape is superior to that provided by traditional single parameter shape measures. Such analytical techniques could be incorporated into future automated optic disc screening modalities. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  7. Quantum engineering of continuous variable quantum states

    Energy Technology Data Exchange (ETDEWEB)

    Sabuncu, Metin

    2009-10-29

    Quantum information with continuous variables is a field attracting increasing attention recently. In continuous variable quantum information one makes use of the continuous information encoded into the quadrature of a quantized light field instead of binary quantities such as the polarization state of a single photon. This brand new research area is witnessing exciting theoretical and experimental achievements such as teleportation, quantum computation and quantum error correction. The rapid development of the field is mainly due higher optical data rates and the availability of simple and efficient manipulation tools in continuous-variable quantum information processing. We in this thesis extend the work in continuous variable quantum information processing and report on novel experiments on amplification, cloning, minimal disturbance and noise erasure protocols. The promising results we obtain in these pioneering experiments indicate that the future of continuous variable quantum information is bright and many advances can be foreseen. (orig.)

  8. Quantum engineering of continuous variable quantum states

    International Nuclear Information System (INIS)

    Sabuncu, Metin

    2009-01-01

    Quantum information with continuous variables is a field attracting increasing attention recently. In continuous variable quantum information one makes use of the continuous information encoded into the quadrature of a quantized light field instead of binary quantities such as the polarization state of a single photon. This brand new research area is witnessing exciting theoretical and experimental achievements such as teleportation, quantum computation and quantum error correction. The rapid development of the field is mainly due higher optical data rates and the availability of simple and efficient manipulation tools in continuous-variable quantum information processing. We in this thesis extend the work in continuous variable quantum information processing and report on novel experiments on amplification, cloning, minimal disturbance and noise erasure protocols. The promising results we obtain in these pioneering experiments indicate that the future of continuous variable quantum information is bright and many advances can be foreseen. (orig.)

  9. The X-ray cataclysmic variable 1E0643.0-1648

    International Nuclear Information System (INIS)

    Bailey, J.; Hough, J.H.

    1981-01-01

    A new simultaneous IR/optical high-speed photometer on the UK IR telescope has been used to study the recently discovered cataclysmic variable 1 E0643.0-1648. The light curve shows it to be a dwarf nova with a recurrence time scale of 15 days. Photometry obtained during the decline from an outburst showed slow flickering, with the IR and optical curves correlated with no delay. (author)

  10. Assessing the sources and magnitude of diurnal nitrate variability in the San Joaquin River (California) with an in situ optical nitrate sensor and dual nitrate isotopes

    Science.gov (United States)

    Pellerin, Brian A.; Downing, Bryan D.; Kendall, Carol; Dahlgren, Randy A.; Kraus, Tamara E.C.; Saraceno, John Franco; Spencer, Robert G. M.; Bergamaschi, Brian A.

    2009-01-01

    1. We investigated diurnal nitrate (NO3−) concentration variability in the San Joaquin River using an in situ optical NO3− sensor and discrete sampling during a 5‐day summer period characterized by high algal productivity. Dual NO3− isotopes (δ15NNO3 and δ18ONO3) and dissolved oxygen isotopes (δ18ODO) were measured over 2 days to assess NO3− sources and biogeochemical controls over diurnal time‐scales.2. Concerted temporal patterns of dissolved oxygen (DO) concentrations and δ18ODOwere consistent with photosynthesis, respiration and atmospheric O2 exchange, providing evidence of diurnal biological processes independent of river discharge.3. Surface water NO3− concentrations varied by up to 22% over a single diurnal cycle and up to 31% over the 5‐day study, but did not reveal concerted diurnal patterns at a frequency comparable to DO concentrations. The decoupling of δ15NNO3 and δ18ONO3isotopes suggests that algal assimilation and denitrification are not major processes controlling diurnal NO3− variability in the San Joaquin River during the study. The lack of a clear explanation for NO3− variability likely reflects a combination of riverine biological processes and time‐varying physical transport of NO3− from upstream agricultural drains to the mainstem San Joaquin River.4. The application of an in situ optical NO3− sensor along with discrete samples provides a view into the fine temporal structure of hydrochemical data and may allow for greater accuracy in pollution assessment.

  11. Variable quasi-stellar sources with particular emphasis on objects of the BL Lac type

    International Nuclear Information System (INIS)

    Kinman, T.D.

    1975-01-01

    The optically variable quasars tend to have steep optical spectra and to show variable polarization; they tend to be associated with compact radio sources which have flat radio spectra at GHz frequencies. Objects are known which have continuous spectra (like BL Lac and OJ 287), but whose other properties closely parallel those of the variable quasars and N galaxies; in fact no sharp distinction can be drawn between them. The variation in the visibility of emission lines in quasars and N galaxies could be due to variations in the strength and spectral index of the radiation from the non-thermal source and from the differences in the amount and disposition of the material around it; it does not seem likely that a combination of these factors accounts for the observed range in emission line strength. The systematic difference in optical spectral index between continuous-spectrum objects (and OVV variables) on the one hand and those with emission lines on the other will produce a difference in K term between them, which may be expected to affect their distributions with respect to apparent magnitude. (Auth.)

  12. A link between prompt optical and prompt gamma-ray emission in gamma-ray bursts.

    Science.gov (United States)

    Vestrand, W T; Wozniak, P R; Wren, J A; Fenimore, E E; Sakamoto, T; White, R R; Casperson, D; Davis, H; Evans, S; Galassi, M; McGowan, K E; Schier, J A; Asa, J W; Barthelmy, S D; Cummings, J R; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; McLean, K; Palmer, D; Parsons, A; Tueller, J

    2005-05-12

    The prompt optical emission that arrives with the gamma-rays from a cosmic gamma-ray burst (GRB) is a signature of the engine powering the burst, the properties of the ultra-relativistic ejecta of the explosion, and the ejecta's interactions with the surroundings. Until now, only GRB 990123 had been detected at optical wavelengths during the burst phase. Its prompt optical emission was variable and uncorrelated with the prompt gamma-ray emission, suggesting that the optical emission was generated by a reverse shock arising from the ejecta's collision with surrounding material. Here we report prompt optical emission from GRB 041219a. It is variable and correlated with the prompt gamma-rays, indicating a common origin for the optical light and the gamma-rays. Within the context of the standard fireball model of GRBs, we attribute this new optical component to internal shocks driven into the burst ejecta by variations of the inner engine. The correlated optical emission is a direct probe of the jet isolated from the medium. The timing of the uncorrelated optical emission is strongly dependent on the nature of the medium.

  13. The Gigabit Optical Transmitters for the LHCb Calorimeters

    CERN Document Server

    Lax, Ignazio; D’Antone, I; Marconi, U

    2007-01-01

    This report presents the boards developed for the optical data transmission of the calorimeter system of the LHCb experiment and test results. We developed two types of transmission boards: the single-channel and the multi-channel ones. Multi-channel boards can be equipped with a variable number of transmitters, depending on the need, with a maximum allowed of 12 channels. Each optical channel allows transmitting 32 bit data at 40.08 MHz. The boards have been designed and built using radiation hard devices produced at CERN. The optical links have been qualified using the eye diagram and the BERT at 1.6Gbps.

  14. Simple and practical approach for computing the ray Hessian matrix in geometrical optics.

    Science.gov (United States)

    Lin, Psang Dain

    2018-02-01

    A method is proposed for simplifying the computation of the ray Hessian matrix in geometrical optics by replacing the angular variables in the system variable vector with their equivalent cosine and sine functions. The variable vector of a boundary surface is similarly defined in such a way as to exclude any angular variables. It is shown that the proposed formulations reduce the computation time of the Hessian matrix by around 10 times compared to the previous method reported by the current group in Advanced Geometrical Optics (2016). Notably, the method proposed in this study involves only polynomial differentiation, i.e., trigonometric function calls are not required. As a consequence, the computation complexity is significantly reduced. Five illustrative examples are given. The first three examples show that the proposed method is applicable to the determination of the Hessian matrix for any pose matrix, irrespective of the order in which the rotation and translation motions are specified. The last two examples demonstrate the use of the proposed Hessian matrix in determining the axial and lateral chromatic aberrations of a typical optical system.

  15. Optical and Gamma-Ray Variability of the vRL NLSy1 Galaxy, 1H 0323+342

    Directory of Open Access Journals (Sweden)

    Hugh R. Miller

    2017-01-01

    Full Text Available 1H 0323+342 was one of the first vRLNLSy1 galaxies detected at gamma-rays with the Fermi-LAT and is one of the brightest of this class observed at optical wavelengths. We report the results of monitoring the optical flux, polarization and the gamma-ray flux of 1H 0323+342 during the past ~5 years. In some cases, the optical flux has been monitored on timescales as short as ~minutes simultaneously with two telescopes, demonstrating, for the first time, the reality of microvariability events with durations as short as ~15 min for this object.

  16. Variability of cirrus clouds in a convective outflow during the Hibiscus campaign

    Science.gov (United States)

    Fierli, F.; di Donfrancesco, G.; Cairo, F.; Marécal, V.; Zampieri, M.; Orlandi, E.; Durry, G.

    2008-08-01

    Light-weight microlidar and water vapour measurements were taken on-board a stratospheric balloon during the HIBISCUS 2004 campaign, held in Bauru, Brazil (49° W, 22° S). Cirrus clouds were observed throughout the flight between 12 and 15 km height with a high mesoscale variability in optical and microphysical properties. It was found that the cirrus clouds were composed of different layers characterized by marked differences in height, thickness and optical properties. Simultaneous water vapour observations show that the different layers are characterized by different values of the saturation with respect to ice. A mesoscale simulation and a trajectory analysis clearly revealed that the clouds had formed in the outflow of a large and persistent convective region and that the observed variability of the optical properties and of the cloud structure is likely linked to the different residence times of the convectively-processed air in the upper troposphere.

  17. An AO-assisted Variability Study of Four Globular Clusters

    Science.gov (United States)

    Salinas, R.; Contreras Ramos, R.; Strader, J.; Hakala, P.; Catelan, M.; Peacock, M. B.; Simunovic, M.

    2016-09-01

    The image-subtraction technique applied to study variable stars in globular clusters represented a leap in the number of new detections, with the drawback that many of these new light curves could not be transformed to magnitudes due to severe crowding. In this paper, we present observations of four Galactic globular clusters, M 2 (NGC 7089), M 10 (NGC 6254), M 80 (NGC 6093), and NGC 1261, taken with the ground-layer adaptive optics module at the SOAR Telescope, SAM. We show that the higher image quality provided by SAM allows for the calibration of the light curves of the great majority of the variables near the cores of these clusters as well as the detection of new variables, even in clusters where image-subtraction searches were already conducted. We report the discovery of 15 new variables in M 2 (12 RR Lyrae stars and 3 SX Phe stars), 12 new variables in M 10 (11 SX Phe and 1 long-period variable), and 1 new W UMa-type variable in NGC 1261. No new detections are found in M 80, but previous uncertain detections are confirmed and the corresponding light curves are calibrated into magnitudes. Additionally, based on the number of detected variables and new Hubble Space Telescope/UVIS photometry, we revisit a previous suggestion that M 80 may be the globular cluster with the richest population of blue stragglers in our Galaxy. Based on observations obtained at the Southern Astrophysical Research (SOAR) telescope, which is a joint project of the Ministério da Ciência, Tecnologia, e Inovação (MCTI) da República Federativa do Brasil, the U.S. National Optical Astronomy Observatory (NOAO), the University of North Carolina at Chapel Hill (UNC), and Michigan State University (MSU).

  18. Free-space wavelength-multiplexed optical scanner demonstration.

    Science.gov (United States)

    Yaqoob, Zahid; Riza, Nabeel A

    2002-09-10

    Experimental demonstration of a no-moving-parts free-space wavelength-multiplexed optical scanner (W-MOS) is presented. With fast tunable lasers or optical filters and planar wavelength dispersive elements such as diffraction gratings, this microsecond-speed scanner enables large several-centimeter apertures for subdegree angular scans. The proposed W-MOS design incorporates a unique optical amplifier and variable optical attenuator combination that enables the calibration and modulation of the scanner response, leading to any desired scanned laser beam power shaping. The experimental setup uses a tunable laser centered at 1560 nm and a 600-grooves/mm blazed reflection grating to accomplish an angular scan of 12.92 degrees as the source is tuned over an 80-nm bandwidth. The values for calculated maximum optical beam divergance, required wavelength resolution, beam-pointing accuracy, and measured scanner insertion loss are 1.076 mrad, 0.172 nm, 0.06 mrad, and 4.88 dB, respectively.

  19. Generation of three-mode continuous-variable entanglement by cascaded nonlinear interactions in a quasiperiodic superlattice

    International Nuclear Information System (INIS)

    Yu, Y. B.; Xie, Z. D.; Yu, X. Q.; Li, H. X.; Xu, P.; Yao, H. M.; Zhu, S. N.

    2006-01-01

    The generation of three-mode continuous-variable entanglement in a quasiperiodically optical superlattice is studied theoretically in this paper. This work is based on the previous experiment result in which three-color light generated from a quasiperiodically optical superlattice through a stimulated parametric down-conversion cascaded with a sum-frequency process. The degree of quadrature phase amplitude correlations, a nonclassical characteristic, among the three mode was discussed by a sufficient inseparability criterion for continuous-variable entanglement, which was proposed by van Loock and Furusawa

  20. Machine learning search for variable stars

    Science.gov (United States)

    Pashchenko, Ilya N.; Sokolovsky, Kirill V.; Gavras, Panagiotis

    2018-04-01

    Photometric variability detection is often considered as a hypothesis testing problem: an object is variable if the null hypothesis that its brightness is constant can be ruled out given the measurements and their uncertainties. The practical applicability of this approach is limited by uncorrected systematic errors. We propose a new variability detection technique sensitive to a wide range of variability types while being robust to outliers and underestimated measurement uncertainties. We consider variability detection as a classification problem that can be approached with machine learning. Logistic Regression (LR), Support Vector Machines (SVM), k Nearest Neighbours (kNN), Neural Nets (NN), Random Forests (RF), and Stochastic Gradient Boosting classifier (SGB) are applied to 18 features (variability indices) quantifying scatter and/or correlation between points in a light curve. We use a subset of Optical Gravitational Lensing Experiment phase two (OGLE-II) Large Magellanic Cloud (LMC) photometry (30 265 light curves) that was searched for variability using traditional methods (168 known variable objects) as the training set and then apply the NN to a new test set of 31 798 OGLE-II LMC light curves. Among 205 candidates selected in the test set, 178 are real variables, while 13 low-amplitude variables are new discoveries. The machine learning classifiers considered are found to be more efficient (select more variables and fewer false candidates) compared to traditional techniques using individual variability indices or their linear combination. The NN, SGB, SVM, and RF show a higher efficiency compared to LR and kNN.

  1. Very fast optical flaring from a possible new Galactic magnetar.

    Science.gov (United States)

    Stefanescu, A; Kanbach, G; Słowikowska, A; Greiner, J; McBreen, S; Sala, G

    2008-09-25

    Highly luminous rapid flares are characteristic of processes around compact objects like white dwarfs, neutron stars and black holes. In the high-energy regime of X-rays and gamma-rays, outbursts with variabilities on timescales of seconds or less are routinely observed, for example in gamma-ray bursts or soft gamma-ray repeaters. At optical wavelengths, flaring activity on such timescales has not been observed, other than from the prompt phase of one exceptional gamma-ray burst. This is mostly due to the fact that outbursts with strong, fast flaring are usually discovered in the high-energy regime; most optical follow-up observations of such transients use instruments with integration times exceeding tens of seconds, which are therefore unable to resolve fast variability. Here we show the observation of extremely bright and rapid optical flaring in the Galactic transient SWIFT J195509.6+261406. Our optical light curves are phenomenologically similar to high-energy light curves of soft gamma-ray repeaters and anomalous X-ray pulsars, which are thought to be neutron stars with extremely high magnetic fields (magnetars). This suggests that similar processes are in operation, but with strong emission in the optical, unlike in the case of other known magnetars.

  2. Spatial-temporal bio-optical classification of dynamic semi-estuarine waters in western North America

    Science.gov (United States)

    Phillips, Stephen Robert; Costa, Maycira

    2017-12-01

    The use of standard ocean colour reflectance based algorithms to derive surface chlorophyll may have limited applicability for optically dynamic coastal waters due to the pre-defined coefficients based on global datasets. Reflectance based algorithms adjusted to regional optical water characteristics are a promising alternative. A class-based definition of optically diverse coastal waters was investigated as a first step towards the development of temporal and spatial constrained reflectance based algorithms for optically variable coastal waters. A large set of bio-optical data were collected as part of five research cruises and bi-weekly trips aboard a ship of opportunity in the west coast of Canada, to assess the spatial and temporal variability of above-water reflectance in this contrasted coastal environment. To accomplish this, in situ biophysical and optical measurements were collected in conjunction with above-water hyperspectral remote sensing reflectance (Rrs) at 145 stations. The concentrations of measured biophysical data varied considerably; chlorophyll a (Chla) (mean = 1.64, range: 0.10-7.20 μg l-1), total suspended matter (TSM) (3.09, 0.82-20.69 mg l-1), and absorption by chromophoric dissolved organic matter (CDOM) (acdom(443 nm)) (0.525, 0.007-3.072 m-1), thus representing the spatio-temporal variability of the Salish Sea. Optically, a similar large range was also found; particulate scattering (bp(650 nm)) (1.316, 0.250-7.450 m-1), particulate backscattering (bbp(650 nm)) (0.022, 0.005-0.097 m-1), total beam attenuation coefficient (ct(650)) (1.675, 0.371-9.537 m-1) and particulate absorption coefficient (ap(650 nm)) (0.345, 0.048-2.020 m-1). An empirical orthogonal function (EOF) analysis revealed that Rrs variability was highly correlated to bp (r = 0.90), bbp (r = 0.82) and concentration of TSM (r = 0.80), which highlighted the dominant role of water turbidity in this region. Hierarchical clustering analysis was applied to the normalized Rrs

  3. Computing Optical Variable Periods of BL Lac Object S5 0716+714 ...

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... From a large volume of literature, we have collected effective observation of BL Lac object S5 0716+714 in the optical band, and constructed its long-term light curve from 1994 to 2006 AD. The light curve shows that S5 0716+714 is very active and exhibits very complicated non-sinusoidal variations.

  4. Optics/Optical Diagnostics Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Optics/Optical Diagnostics Laboratory supports graduate instruction in optics, optical and laser diagnostics and electro-optics. The optics laboratory provides...

  5. Modeling the South American regional smoke plume: aerosol optical depth variability and surface shortwave flux perturbation

    Directory of Open Access Journals (Sweden)

    N. E. Rosário

    2013-03-01

    Full Text Available Intra-seasonal variability of smoke aerosol optical depth (AOD and downwelling solar irradiance at the surface during the 2002 biomass burning season in South America was modeled using the Coupled Chemistry-Aerosol-Tracers Transport model with the Brazilian developments on the Regional Atmospheric Modeling System (CCATT-BRAMS. Measurements of total and fine mode fraction (FMF AOD from the AErosol RObotic NETwork (AERONET and solar irradiance at the surface from the Solar Radiation Network (SolRad-NET were used to evaluate model results. In general, the major features associated with AOD evolution over the southern part of the Amazon basin and cerrado ecosystem are captured by the model. The main discrepancies were found for high aerosol loading events. In the northeastern portion of the Amazon basin the model systematically underestimated total AOD, as expected, since smoke contribution is not dominant as it is in the southern portion and emissions other than smoke were not considered in the simulation. Better agreement was obtained comparing the model results with observed FMF AOD, which pointed out the relevance of coarse mode aerosol emission in that region. Likewise, major discrepancies over cerrado during high AOD events were found to be associated with coarse mode aerosol omission in our model. The issue of high aerosol loading events in the southern part of the Amazon was related to difficulties in predicting the smoke AOD field, which was discussed in the context of emissions shortcomings. The Cuiabá cerrado site was the only one where the highest quality AERONET data were unavailable for both total and FMF AOD. Thus, lower quality data were used. Root-mean-square error (RMSE between the model and observed FMF AOD decreased from 0.34 to 0.19 when extreme AOD events (FMF AOD550 nm ≥ 1.0 and Cuiabá were excluded from the analysis. Downward surface solar irradiance comparisons also followed similar trends when extreme AOD were excluded

  6. Time-variable gravity potential components for optical clock comparisons and the definition of international time scales

    International Nuclear Information System (INIS)

    Voigt, C.; Denker, H.; Timmen, L.

    2016-01-01

    The latest generation of optical atomic clocks is approaching the level of one part in 10 18 in terms of frequency stability and uncertainty. For clock comparisons and the definition of international time scales, a relativistic redshift effect of the clock frequencies has to be taken into account at a corresponding uncertainty level of about 0.1 m 2 s -2 and 0.01 m in terms of gravity potential and height, respectively. Besides the predominant static part of the gravity potential, temporal variations must be considered in order to avoid systematic frequency shifts. Time-variable gravity potential components induced by tides and non-tidal mass redistributions are investigated with regard to the level of one part in 10 18 . The magnitudes and dominant time periods of the individual gravity potential contributions are investigated globally and for specific laboratory sites together with the related uncertainty estimates. The basics of the computation methods are presented along with the applied models, data sets and software. Solid Earth tides contribute by far the most dominant signal with a global maximum amplitude of 4.2 m 2 s -2 for the potential and a range (maximum-to-minimum) of up to 1.3 and 10.0 m 2 s -2 in terms of potential differences between specific laboratories over continental and intercontinental scales, respectively. Amplitudes of the ocean tidal loading potential can amount up to 1.25 m 2 s -2 , while the range of the potential between specific laboratories is 0.3 and 1.1 m 2 s -2 over continental and intercontinental scales, respectively. These are the only two contributors being relevant at a 10 -17 level. However, several other time-variable potential effects can particularly affect clock comparisons at the 10 -18 level. Besides solid Earth pole tides, these are non-tidal mass redistributions in the atmosphere, the oceans and the continental water storage. (authors)

  7. Confirming LBV Candidates Through Variability: A Photometric and Spectroscopic Monitoring Study

    Science.gov (United States)

    Stringfellow, Guy; Gvaramadze, Vasilii

    2013-02-01

    Luminous Blue Variable (LBV) stars represent an extremely rare class of luminous massive stars with high mass loss rates. The paucity ( 12) of confirmed Galactic LBV precludes determining a solid evolutionary connection between LBV and other intermediate (e.g. Ofpe/WN9, WNL) phases in the life of very massive stars. We've been conducting an optical/near-IR spectral survey of a large subset of central stars residing within newly discovered it Spitzer nebulae and have identified over two dozen new candidate LBVs (cLBVs) based on spectral similarity alone; confirming them as bona fide LBVs requires demonstrating 1-3 mag photometric and spectroscopic variability. This marks a significant advancement in the study of massive stars, far outweighing the return from many studies searching for LBVs and WRs the past several decades. Monitoring from semesters 2011B-2012A already has confirmed one new cLBV as a bona fide LBV. We propose to continue optical-IR photometric monitoring of these cLBVS with the 1.3m. Chiron, replacing the RC spectrograph on the 1.5m, now allows high-resolution optical spectroscopic monitoring of bright cLBVs, 11 of which are proposed herein. Spectra are important for understanding the physics driving photometric variability, properties of the wind, and allow analysis of line profiles.

  8. Fibre optics cabling design for LHC detectors upgrade using variable radiation induced attenuation model

    CERN Document Server

    Shoaie, Mohammad Amin; Machado, Simao; Ricci, Daniel

    2018-01-01

    Foreseen upgrades over the next decades enable LHC to operate at a higher luminosity (HL-LHC). Accordingly, the optical links designed to transmit particle collision data need to be hardened against increased radiation level, allowing for a reliable communication. In this paper we study the fibre cabling design of a link between the transceiver optical front-end and the data control room. The radiation penalty calculation takes temperature drop down to ‒30°C into account. The proposed solution concatenates radiation-resistance and conventional fibres using multi-fibre interconnections. The end-to-end link loss during HL-LHC lifetime is estimated strictly less than 3.5 dB complying with predefined margin.

  9. Continuous Variable Entanglement and Squeezing of Orbital Angular Momentum States

    DEFF Research Database (Denmark)

    Lassen, Mikael Østergaard; Leuchs, Gerd; Andersen, Ulrik Lund

    2009-01-01

    We report the first experimental characterization of the first-order continuous variable orbital angular momentum states. Using a spatially nondegenerate optical parametric oscillator (OPO) we produce quadrature entanglement between the two first-order Laguerre-Gauss modes. The family of orbital...

  10. Modeling and analysis of laser active interference optical path

    Science.gov (United States)

    Shan, Cong-miao; Sun, Hua-yan; Zhao, Yan-zhong; Chen, Jian-biao; Ren, Jian-ying

    2017-10-01

    By using the geometrical optics and physical optics method, the models of wedge plate interference optical path, Michelson interferometer and Mach Zehnder interferometer thus three different active interference pattern are built. The optical path difference (OPD) launched by different interference patterns, fringe spacing and contrast expression have been derived. The results show that far field interference peak intensity of the wedge plate interference is small, so the detection distance is limited, Michelson interferometer with low contrast affects the performance of detection system, Mach Zehnder interferometer has greater advantages in peak intensity, the variable range of interference fringe spacing and contrast ratio. The results of this study are useful for the theoretical research and practical application of laser active interference detection.

  11. Application of the Ultraviolet Scanning Elastic Backscatter LiDAR for the Investigation of Aerosol Variability

    Directory of Open Access Journals (Sweden)

    Fei Gao

    2015-05-01

    Full Text Available In order to investigate the aerosol variability over the southwest region of Slovenia, an ultraviolet scanning elastic backscatter LiDAR was utilized to make the vertical scan for atmospheric probing. With the assumption of horizontal atmospheric homogeneity, aerosol optical variables were retrieved from the horizontal pixel data points of two-dimensional range-height-indicator (RHI diagrams by using a multiangle retrieval method, in which optical depth is defined as the slope of the resulting linear function when height is kept constant. To make the data retrieval feasible and precise, a series of key procedures complemented the data processing, including construction of the RHI diagram, correction of Rayleigh scattering, assessment of horizontal atmospheric homogeneity and retrieval of aerosol optical variables. The measurement example demonstrated the feasibility of the ultraviolet scanning elastic backscatter LiDAR in the applications of the retrieval of aerosol extinction and determination of the atmospheric boundary layer height. Three months’ data combined with the modeling of air flow trajectories using Hybrid Single Particle Lagrangian Integrated Trajectory Model were analyzed to investigate aerosol variability. The average value of aerosol extinction with the presence of land-based air masses from the European continent was found to be two-times larger than that influenced by marine aerosols from the Mediterranean or Adriatic Sea.

  12. ANTI-CORRELATED OPTICAL FLUX AND POLARIZATION VARIABILITY IN BL LAC

    Energy Technology Data Exchange (ETDEWEB)

    Gaur, Haritma [Inter-University Centre for Astronomy and Astrophysics (IUCAA), Ganeshkhind, Pune 411 007 (India); Gupta, Alok C. [Aryabhatta Research Institute of Observational Sciences (ARIES), Manora Peak, Nainital 263 129 (India); Wiita, Paul J. [Department of Physics, The College of New Jersey, P.O. Box 7718, Ewing, NJ 08628-0718 (United States); Uemura, Makoto; Itoh, Ryosuke; Sasada, Mahito, E-mail: haritma@iucaa.ernet.in [Hiroshima Astrophysical Science Center, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan)

    2014-01-20

    We present the results of photometric (V band) and polarimetric observations of the blazar BL Lac during 2008-2010 using TRISPEC attached to the KANATA 1.5 m telescope in Japan. The data reveal a great deal of variability ranging from days to months with detection of strong variations in fractional polarization. The V band flux strongly anticorrelates with the degree of polarization during the first of two observing seasons but not during the second. The direction of the electric vector, however, remained roughly constant during all of our observations. These results are consistent with a model with at least two emission regions being present, with the more variable component having a polarization direction nearly perpendicular to that of the relatively quiescent region so that a rising flux can produce a decline in degree of polarization. We also computed models involving helical jet structures and single transverse shocks in jets and show that they might also be able to agree with the anticorrelations between flux and fractional polarization.

  13. Hermite- Padé projection to thermal radiative and variable ...

    African Journals Online (AJOL)

    The combined effect of variable thermal conductivity and radiative heat transfer on steady flow of a conducting optically thin viscous fluid through a channel with sliding wall and non-uniform wall temperatures under the influence of an externally applied homogeneous magnetic field are analyzed in the present study.

  14. Multi-slit triode ion optical system with ballistic beam focusing

    Energy Technology Data Exchange (ETDEWEB)

    Davydenko, V., E-mail: V.I.Davydenko@inp.nsk.su; Amirov, V.; Gorbovsky, A.; Deichuli, P.; Ivanov, A.; Kolmogorov, A.; Kapitonov, V.; Mishagin, V.; Shikhovtsev, I.; Sorokin, A.; Stupishin, N. [Budker Institute of Nuclear Physics, Novosibirsk 630090 (Russian Federation); Karpushov, A. N. [Ecole Polytechnique Fédérale de Lausanne, Centre de Recherches en Physique des Plasmas (CRPP), CH-1015 Lausanne (Switzerland); Smirnov, A. [Tri Alpha Energy, Inc., Rancho Santa Margarita, California 92688 (United States); Uhlemann, R. [Institute of Energy and Climate Research-Plasma Physics, Research Center Juelich, 52425 Juelich (Germany)

    2016-02-15

    Multi-slit triode ion-optical systems with spherical electrodes are of interest for formation of intense focused neutral beams for plasma heating. At present, two versions of focusing multi-slit triode ion optical system are developed. The first ion optical system forms the proton beam with 15 keV energy, 140 A current, and 30 ms duration. The second ion optical system is intended for heating neutral beam injector of Tokamak Configuration Variable (TCV). The injector produces focused deuterium neutral beam with 35 keV energy, 1 MW power, and 2 s duration. In the later case, the angular beam divergence of the neutral beam is 20-22 mrad in the direction across the slits of the ion optical system and 12 mrad in the direction along the slits.

  15. Two-Decade Monitoring of MWC349 in Optical and Radio: New Results

    Science.gov (United States)

    Thomashow, Eydon; Jorgenson, Regina A.; Strelnitski, Vladimir; Walker, Gary; Maria Mitchell Observatory (MMO) Research Experiences for Undergraduate (REU) Interns, 2017

    2018-01-01

    Maria Mitchell Observatory (MMO) has completed the two-decade long monitoring of MWC 349 in the optical and radio domains. This poster presentation will be primarily devoted to the new results obtained by optical photometry with broad and narrow band filters and observations of the variability in the masing H30 radio line during the observational season of 2017. The H30 emission arises in the circumstellar disk of the MWC 349A component of the visual double star (with 2.4 arcsec separation between the A and B components). Variable optical emission is also believed to be due to star A. By combining our optical observations with earlier MMO observations, we not only confirmed the previously known quasi-period of ~230 days, but confirmed a second period of ~700 days. One of the most interesting results of radio monitoring is the long-term variability of the systemic radial velocity of star A, as determined through averaging the radial velocities of the two masing peaks arising in the circumstellar disk. This may be the first case where a possible hidden close companion of a star (a lower mass star or a massive protoplanet) is detected by monitoring the radial velocity of the star via the spectral line radiation from its disk. E.T. completed this project as a 2017 MMO NSF REU intern and would like to thank the other interns for their help in conducting the optical observations. This project was supported in part by the NSF REU grant AST-1358980 and by the Nantucket Maria Mitchell Association.

  16. Theory-inspired development of organic electro-optic materials

    Energy Technology Data Exchange (ETDEWEB)

    Dalton, Larry R., E-mail: dalton@chem.washington.ed [Department of Chemistry, Bagley Hall 202D, Box 351700, University of Washington, Seattle, Washington 98195-1700 (United States); Department of Electrical Engineering, Bagley Hall 202D, Box 351700, University of Washington, Seattle, Washington 98195-1700 (United States)

    2009-11-30

    Real-time, time-dependent density functional theory (RTTDDFT) and pseudo-atomistic Monte Carlo-molecular dynamics (PAMCMD) calculations have been used in a correlated manner to achieve quantitative definition of structure/function relationships necessary for the optimization of electro-optic activity in organic materials. Utilizing theoretical guidance, electro-optic coefficients (at telecommunication wavelengths) have been increased to 500 pm/V while keeping optical loss to less than 2 dB/cm. RTTDDFT affords the advantage of permitting explicit treatment of time-dependent electric fields, both applied fields and internal fields. This modification has permitted the quantitative simulation of the variation of linear and nonlinear optical properties of chromophores and the electro-optic activity of materials with optical frequency and dielectric permittivity. PAMCMD statistical mechanical calculations have proven an effective means of treating the full range of spatially-anisotropic intermolecular electrostatic interactions that play critical roles in defining the degree of noncentrosymmetric order that is achieved by electric field poling of organic electro-optic materials near their glass transition temperatures. New techniques have been developed for the experimental characterization of poling-induced acentric order including a modification of variable angle polarization absorption spectroscopy (VAPAS) permitting a meaningful correlation of theoretical and experimental data related to poling-induced order for a variety of complex organic electro-optic materials.

  17. Theory-inspired development of organic electro-optic materials

    International Nuclear Information System (INIS)

    Dalton, Larry R.

    2009-01-01

    Real-time, time-dependent density functional theory (RTTDDFT) and pseudo-atomistic Monte Carlo-molecular dynamics (PAMCMD) calculations have been used in a correlated manner to achieve quantitative definition of structure/function relationships necessary for the optimization of electro-optic activity in organic materials. Utilizing theoretical guidance, electro-optic coefficients (at telecommunication wavelengths) have been increased to 500 pm/V while keeping optical loss to less than 2 dB/cm. RTTDDFT affords the advantage of permitting explicit treatment of time-dependent electric fields, both applied fields and internal fields. This modification has permitted the quantitative simulation of the variation of linear and nonlinear optical properties of chromophores and the electro-optic activity of materials with optical frequency and dielectric permittivity. PAMCMD statistical mechanical calculations have proven an effective means of treating the full range of spatially-anisotropic intermolecular electrostatic interactions that play critical roles in defining the degree of noncentrosymmetric order that is achieved by electric field poling of organic electro-optic materials near their glass transition temperatures. New techniques have been developed for the experimental characterization of poling-induced acentric order including a modification of variable angle polarization absorption spectroscopy (VAPAS) permitting a meaningful correlation of theoretical and experimental data related to poling-induced order for a variety of complex organic electro-optic materials.

  18. Line optical and Auger data acquisition

    Energy Technology Data Exchange (ETDEWEB)

    Wall, W E; Stevenson, J R [Georgia Inst. of Tech., Atlanta (USA). School of Physics

    1978-06-01

    A software/hardware package has been developed for use with an 8K DEC PDP-8/L or /I minicomputer, providing real time acquisition and manipulation of optical reflectivity, Auger, and photoemission data. Optical data and Auger or photoemission data may be acquired simultaneously. Provisions have been included for the addition of a scanning rotating ellipsometer. Synchrotron radiation from an electron storage ring has been the primary optical source. Optical reflectivity is measured using single photon counting with a ratio technique that samples a portion of the incident light with one detector and the reflected light with a second detector. Differential Auger or photoemission data is acquired using a cylindrical mirror electron energy analyzer under computer control in a signal averaging mode of operation. Direct electron distribution curves may be displayed using a numerical integration routine. Software was written in assembly language to conserve available memory; however, a modular approach was used to allow easy additions and modifications to experiments. Data arrays may be manipulated and stored as single variables.

  19. Scattering of acoustic waves from a surface in the presence of an anharmonic interface

    DEFF Research Database (Denmark)

    Kulak, A.; Lodziana, Zbigniew; Srokowski, T.

    2002-01-01

    Energy transfer coefficient (analogue of LDOS) and aperiodicity index are defined to characterise the nonlinear response and the surface resonances in a thin layer separated from the underlying bulk crystal by an anharmonic interface. Regions of periodic, aperiodic and intermittent motion of the ...

  20. Design and fabrication of optical thin film layers with variable thickness profile for producing variable reflectivity mirrors

    Directory of Open Access Journals (Sweden)

    Hamid R fallah

    2006-12-01

    Full Text Available   The design method and fabrication of mirrors with variable reflectivity are presented. To fabricate such a mirror a fixed mask with a circular aperture is used. The circular aperture is considered as an extended source with cosx(θas its diffusion distribution function and is the parameter for the distribution function of the particles through the aperture. The thickness profile of deposited layer is a function of this distribution. In this work, the coating system is calibrated for the materials which are used and then the parameter of the diffusion distribution function of the particles through the circular aperture is defined by experiments. Using these results, a graph is presented which connects the parameter of the circular aperture to the parameters of the thickness profile. It is then possible to deposit any type of variable reflectivity mirror using this graph. Finally, the effect of the uncertainty in measuring layer thicknesses on the phase of reflected wave and transmitted wave is investigated.

  1. Extreme Variability in a Broad Absorption Line Quasar

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Daniel; Jun, Hyunsung D. [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Mail Stop 169-221, Pasadena, CA 91109 (United States); Graham, Matthew J.; Djorgovski, S. G.; Donalek, Ciro; Drake, Andrew J.; Mahabal, Ashish A.; Steidel, Charles C. [California Institute of Technology, 1200 E. California Boulevard, Pasadena, CA 91125 (United States); Arav, Nahum; Chamberlain, Carter [Department of Physics, Virginia Tech, Blacksburg, VA 24061 (United States); Barth, Aaron J. [Department of Physics and Astronomy, 4129 Frederick Reines Hall, University of California, Irvine, CA 92697 (United States); Glikman, Eilat, E-mail: daniel.k.stern@jpl.nasa.gov [Department of Physics, Middlebury College, Middlebury, VT 05753 (United States)

    2017-04-20

    CRTS J084133.15+200525.8 is an optically bright quasar at z = 2.345 that has shown extreme spectral variability over the past decade. Photometrically, the source had a visual magnitude of V ∼ 17.3 between 2002 and 2008. Then, over the following five years, the source slowly brightened by approximately one magnitude, to V ∼ 16.2. Only ∼1 in 10,000 quasars show such extreme variability, as quantified by the extreme parameters derived for this quasar assuming a damped random walk model. A combination of archival and newly acquired spectra reveal the source to be an iron low-ionization broad absorption line quasar with extreme changes in its absorption spectrum. Some absorption features completely disappear over the 9 years of optical spectra, while other features remain essentially unchanged. We report the first definitive redshift for this source, based on the detection of broad H α in a Keck/MOSFIRE spectrum. Absorption systems separated by several 1000 km s{sup −1} in velocity show coordinated weakening in the depths of their troughs as the continuum flux increases. We interpret the broad absorption line variability to be due to changes in photoionization, rather than due to motion of material along our line of sight. This source highlights one sort of rare transition object that astronomy will now be finding through dedicated time-domain surveys.

  2. On detecting variables using ROTSE-IIId archival data

    Science.gov (United States)

    Yesilyaprak, C.; Yerli, S. K.; Aksaker, N.; Gucsav, B. B.; Kiziloglu, U.; Dikicioglu, E.; Coker, D.; Aydin, E.; Ozeren, F. F.

    ROTSE (Robotic Optical Transient Search Experiment) telescopes can also be used for variable star detection. As explained in the system description tep{2003PASP..115..132A}, they have a good sky coverage and they allow a fast data acquisition. The optical magnitude range varies between 7^m to 19^m. Thirty percent of the telescope time of north-eastern leg of the network, namely ROTSE-IIId (located at TUBITAK National Observatory, Bakirlitepe, Turkey http://www.tug.tubitak.gov.tr/) is owned by Turkish researchers. Since its first light (May 2004) considerably a large amount of data has been collected (around 2 TB) from the Turkish time and roughly one million objects have been identified from the reduced data. A robust pipeline has been constructed to discover new variables, transients and planetary nebulae from this archival data. In the detection process, different statistical methods were applied to the archive. We have detected thousands of variable stars by applying roughly four different tests to light curve of each star. In this work a summary of the pipeline is presented. It uses a high performance computing (HPC) algorithm which performs inhomogeneous ensemble photometry of the data on a 36 core cluster. This study is supported by TUBITAK (Scientific and Technological Research Council of Turkey) with the grant number TBAG-108T475.

  3. Constraining Aerosol Optical Models Using Ground-Based, Collocated Particle Size and Mass Measurements in Variable Air Mass Regimes During the 7-SEAS/Dongsha Experiment

    Science.gov (United States)

    Bell, Shaun W.; Hansell, Richard A.; Chow, Judith C.; Tsay, Si-Chee; Wang, Sheng-Hsiang; Ji, Qiang; Li, Can; Watson, John G.; Khlystov, Andrey

    2012-01-01

    During the spring of 2010, NASA Goddard's COMMIT ground-based mobile laboratory was stationed on Dongsha Island off the southwest coast of Taiwan, in preparation for the upcoming 2012 7-SEAS field campaign. The measurement period offered a unique opportunity for conducting detailed investigations of the optical properties of aerosols associated with different air mass regimes including background maritime and those contaminated by anthropogenic air pollution and mineral dust. What appears to be the first time for this region, a shortwave optical closure experiment for both scattering and absorption was attempted over a 12-day period during which aerosols exhibited the most change. Constraints to the optical model included combined SMPS and APS number concentration data for a continuum of fine and coarse-mode particle sizes up to PM2.5. We also take advantage of an IMPROVE chemical sampler to help constrain aerosol composition and mass partitioning of key elemental species including sea-salt, particulate organic matter, soil, non sea-salt sulphate, nitrate, and elemental carbon. Our results demonstrate that the observed aerosol scattering and absorption for these diverse air masses are reasonably captured by the model, where peak aerosol events and transitions between key aerosols types are evident. Signatures of heavy polluted aerosol composed mostly of ammonium and non sea-salt sulphate mixed with some dust with transitions to background sea-salt conditions are apparent in the absorption data, which is particularly reassuring owing to the large variability in the imaginary component of the refractive indices. Extinctive features at significantly smaller time scales than the one-day sample period of IMPROVE are more difficult to reproduce, as this requires further knowledge concerning the source apportionment of major chemical components in the model. Consistency between the measured and modeled optical parameters serves as an important link for advancing remote

  4. Application of Spectral Analysis Techniques in the Intercomparison of Aerosol Data: Part III. Using Combined PCA to Compare Spatiotemporal Variability of MODIS, MISR and OMI Aerosol Optical Depth

    Science.gov (United States)

    Li, Jing; Carlson, Barbara E.; Lacis, Andrew A.

    2014-01-01

    Satellite measurements of global aerosol properties are very useful in constraining aerosol parameterization in climate models. The reliability of different data sets in representing global and regional aerosol variability becomes an essential question. In this study, we present the results of a comparison using combined principal component analysis (CPCA), applied to monthly mean, mapped (Level 3) aerosol optical depth (AOD) product from Moderate Resolution Imaging Spectroradiometer (MODIS), Multiangle Imaging Spectroradiometer (MISR), and Ozone Monitoring Instrument (OMI). This technique effectively finds the common space-time variability in the multiple data sets by decomposing the combined AOD field. The results suggest that all of the sensors capture the globally important aerosol regimes, including dust, biomass burning, pollution, and mixed aerosol types. Nonetheless, differences are also noted. Specifically, compared with MISR and OMI, MODIS variability is significantly higher over South America, India, and the Sahel. MODIS deep blue AOD has a lower seasonal variability in North Africa, accompanied by a decreasing trend that is not found in either MISR or OMI AOD data. The narrow swath of MISR results in an underestimation of dust variability over the Taklamakan Desert. The MISR AOD data also exhibit overall lower variability in South America and the Sahel. OMI does not capture the Russian wild fire in 2010 nor the phase shift in biomass burning over East South America compared to Central South America, likely due to cloud contamination and the OMI row anomaly. OMI also indicates a much stronger (boreal) winter peak in South Africa compared with MODIS and MISR.

  5. New organic materials for optics: optical storage and nonlinear optics

    International Nuclear Information System (INIS)

    Gan, F.

    1996-01-01

    New organic materials have received considerable attention recently, due to their easy preparation and different variety. The most application fields in optics are optical storage and nonlinear optics. In optical storage the organic dyes have been used for example, in record able and erasable compact disks (CD-R, CD-E) nonlinear optical effects, such as nonlinear optical absorption, second and third order optical absorption, second and third order optical nonlinearities, can be applied for making optical limiters, optical modulators, as well as laser second and third harmonic generations. Due to high value of optical absorption and optical nonlinearity organic materials are always used as thin films in optical integration. In this paper the new experimental results have been presented, and future development has been also discussed. (author)

  6. Optically coupled cavities for wavelength switching

    Energy Technology Data Exchange (ETDEWEB)

    Costazo-Caso, Pablo A; Granieri, Sergio; Siahmakoun, Azad, E-mail: pcostanzo@ing.unlp.edu.ar, E-mail: granieri@rose-hulman.edu, E-mail: siahmako@rose-hulman.edu [Department of Physics and Optical Engineering, Rose-Hulman Institute of Technology, 5500 Wabash Avenue, Terre Haute, IN 47803 (United States)

    2011-01-01

    An optical bistable device which presents hysteresis behavior is proposed and experimentally demonstrated. The system finds applications in wavelength switching, pulse reshaping and optical bistability. It is based on two optically coupled cavities named master and slave. Each cavity includes a semiconductor optical amplifier (SOA), acting as the gain medium of the laser, and two pair of fiber Bragg gratings (FBG) which define the lasing wavelength (being different in each cavity). Finally, a variable optical coupler (VOC) is employed to couple both cavities. Experimental characterization of the system performance is made analyzing the effects of the coupling coefficient between the two cavities and the driving current in each SOA. The properties of the hysteretic bistable curve and switching can be controlled by adjusting these parameters and the loss in the cavities. By selecting the output wavelength ({lambda}{sub 1} or {lambda}{sub 2}) with an external filter it is possible to choose either the invert or non-invert switched signal. Experiments were developed employing both optical discrete components and a photonic integrated circuit. They show that for 8 m-long cavities the maximum switching frequency is about 500 KHz, and for 4 m-long cavities a minimum rise-time about 21 ns was measured. The switching time can be reduced by shortening the cavity lengths and using photonic integrated circuits.

  7. A high-accuracy optical linear algebra processor for finite element applications

    Science.gov (United States)

    Casasent, D.; Taylor, B. K.

    1984-01-01

    Optical linear processors are computationally efficient computers for solving matrix-matrix and matrix-vector oriented problems. Optical system errors limit their dynamic range to 30-40 dB, which limits their accuray to 9-12 bits. Large problems, such as the finite element problem in structural mechanics (with tens or hundreds of thousands of variables) which can exploit the speed of optical processors, require the 32 bit accuracy obtainable from digital machines. To obtain this required 32 bit accuracy with an optical processor, the data can be digitally encoded, thereby reducing the dynamic range requirements of the optical system (i.e., decreasing the effect of optical errors on the data) while providing increased accuracy. This report describes a new digitally encoded optical linear algebra processor architecture for solving finite element and banded matrix-vector problems. A linear static plate bending case study is described which quantities the processor requirements. Multiplication by digital convolution is explained, and the digitally encoded optical processor architecture is advanced.

  8. Traffic Scheduling in WDM Passive Optical Network with Delay Guarantee

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    WDM passive optical network becomes more favorable as the required bandwidth increases, but currently few media access control algorithms adapted to WDM access network. This paper presented a new scheduling algorithm for bandwidth sharing in WDM passive optical networks, which provides per-flow delay guarantee and supports variable-length packets scheduling. Through theoretical analysis and simulation, the end-to-end delay bound and throughput fairness of the algorithm was demonstrated.

  9. Intra-operative application of optical coherence tomography with an operating microscope.

    Science.gov (United States)

    Just, T; Lankenau, E; Hüttmann, G; Pau, H W

    2009-09-01

    To introduce the use of optical coherence tomography with an operating microscope for intra-operative evaluation of the human larynx. A specially equipped operating microscope with integrated spectral domain optical coherence tomography apparatus was used during microlaryngoscopy. Technical improvements in optical coherence tomography equipment (e.g. pilot beam, variable focal distance, improved image quality and integration into an operating microscope) have enabled greater sensitivity and imaging speed and a non-contact approach. Spectral domain optical coherence tomography now enables a better correlation between optical coherence tomography images and histological findings. With this new technology, the precision of biopsy can be improved during microlaryngoscopy. Use of this new optical coherence tomography technology, integrated into an operating microscope, enables the surgeon to define the biopsy site location and resection plane precisely, while the optical zoom of the operating microscope can be used over the complete range.

  10. Quantum dynamical phenomena of independent electrons in semiconductor superlattices subject to a uniform electric field

    International Nuclear Information System (INIS)

    Bouchard, A.M.

    1994-01-01

    This report discusses the following topics: Bloch oscillations and other dynamical phenomena of electrons in semiconductor superlattices; solvable dynamical model of an electron in a one-dimensional aperiodic lattice subject to a uniform electric field; and quantum dynamical phenomena of electrons in aperiodic semiconductor superlattices

  11. The ASAS-SN Catalog of Variable Stars I: The Serendipitous Survey

    Science.gov (United States)

    Jayasinghe, T.; Kochanek, C. S.; Stanek, K. Z.; Shappee, B. J.; Holoien, T. W.-S.; Thompson, Todd A.; Prieto, J. L.; Dong, Subo; Pawlak, M.; Shields, J. V.; Pojmanski, G.; Otero, S.; Britt, C. A.; Will, D.

    2018-04-01

    The All-Sky Automated Survey for Supernovae (ASAS-SN) is the first optical survey to routinely monitor the whole sky with a cadence of ˜2 - 3 days down to V≲ 17 mag. ASAS-SN has monitored the whole sky since 2014, collecting ˜100 - 500 epochs of observations per field. The V-band light curves for candidate variables identified during the search for supernovae are classified using a random forest classifier and visually verified. We present a catalog of 66,533 bright, new variable stars discovered during our search for supernovae, including 27,753 periodic variables and 38,780 irregular variables. V-band light curves for the ASAS-SN variables are available through the ASAS-SN variable stars database (https://asas-sn.osu.edu/variables). The database will begin to include the light curves of known variable stars in the near future along with the results for a systematic, all-sky variability survey.

  12. Program description of FIBRAM (Fiber Optic Radiation Attenuation Model): a radiation attenuation model for optical fibers

    International Nuclear Information System (INIS)

    Ingram, W.J.

    1987-06-01

    The report describes a fiber-optics system model and its computer implementation. This implementation can calculate the bit error ratio (BER) versus time for optical fibers that have been exposed to gamma radiation. The program is designed so that the user may arbitrarily change any or all of the system input variables and produce separate outputs. The primary output of the program is a table of the BER as a function of time. This table may be stored on magnetic media and later incorporated into computer graphic programs. The program was written in FORTRAN 77 for the IBM PC/AT/XT computers. Flow charts and program listings are included in the report

  13. Herpes Zoster Optic Neuropathy.

    Science.gov (United States)

    Kaufman, Aaron R; Myers, Eileen M; Moster, Mark L; Stanley, Jordan; Kline, Lanning B; Golnik, Karl C

    2018-06-01

    Herpes zoster optic neuropathy (HZON) is a rare manifestation of herpes zoster ophthalmicus (HZO). The aim of our study was to better characterize the clinical features, therapeutic choices, and visual outcomes in HZON. A retrospective chart review was performed at multiple academic eye centers with the inclusion criteria of all eyes presenting with optic neuropathy within 1 month of cutaneous zoster of the ipsilateral trigeminal dermatome. Data were collected regarding presenting features, treatment regimen, and visual acuity outcomes. Six patients meeting the HZON inclusion criteria were identified. Mean follow-up was 2.75 months (range 0.5-4 months). Herpes zoster optic neuropathy developed at a mean of 14.1 days after initial rash (range 6-30 days). Optic neuropathy was anterior in 2 eyes and retrobulbar in 4 eyes. Other manifestations of HZO included keratoconjunctivitis (3 eyes) and iritis (4 eyes). All patients were treated with systemic antiviral therapy in addition to topical and/or systemic corticosteroids. At the last follow-up, visual acuity in 3 eyes had improved relative to presentation, 2 eyes had worsened, and 1 eye remained the same. The 2 eyes that did not receive systemic corticosteroids had the best observed final visual acuity. Herpes zoster optic neuropathy is an unusual but distinctive complication of HZO. Visual recovery after HZON is variable. Identification of an optimal treatment regiment for HZON could not be identified from our patient cohort. Systemic antiviral agents are a component of HZON treatment regimens. Efficacy of systemic corticosteroids for HZON remains unclear and should be considered on a case-by-case basis.

  14. Influence of the relative optical air mass on ultraviolet erythemal irradiance

    Science.gov (United States)

    Antón, M.; Serrano, A.; Cancillo, M. L.; García, J. A.

    2009-12-01

    The main objective of this article is to analyze the relationship between the transmissivity for ultraviolet erythemal irradiance (UVER) and the relative optical air mass at Badajoz (Southwestern Spain). Thus, a power expression between both variables is developed, which analyses in detail how atmospheric transmission is influenced by the total ozone column (TOC) and the atmospheric clearness. The period of analysis extends from 2001 to 2005. The experimental results indicate that clearness conditions play an important role in the relationship between UVER transmissivity and the relative optical air mass, while the effect of TOC is much smaller for this data set. In addition, the results show that UVER transmissivity is more sensitive to changes in atmospheric clearness than to TOC variability. Changes in TOC values higher than 15% cause UVER trasnmissivity to vary between 14% and 22%, while changes between cloud-free and overcast conditions produce variations in UVER transmissivity between 68% and 74% depending on the relative optical air mass.

  15. Multiwavelength Variability Study of the Classical BL Lac Object PKS 0735+178 on Timescales Ranging from Decades to Minutes

    Energy Technology Data Exchange (ETDEWEB)

    Goyal, Arti; Stawarz, Łukasz; Ostrowski, Michał; Soida, Marian [Astronomical Observatory of Jagiellonian University, ul. Orla 171, 30-244 Kraków (Poland); Larionov, Valeri [Astronomical Institute of St. Petersburg State University, Petrodvorets 198504 (Russian Federation); Gopal-Krishna [Centre for Excellence in Basic Sciences (CEBS), University of Mumbai campus (Kalina), Mumbai 400098 (India); Wiita, Paul J. [Department of Physics, The College of New Jersey, 2000 Pennington Road, Ewing, NJ 08628-0718 (United States); Joshi, Santosh [Aryabhatta Research Institute of Observational Sciences (ARIES), Manora Peak, Nainital 263002 (India); Agudo, Iván, E-mail: arti@oa.uj.edu.pl [Instituto de Astrofísica de Andalucía (CSIC), Apartado 3004, E–18080 Granada (Spain)

    2017-03-10

    We present the results of our power spectral analysis for the BL Lac object PKS 0735+178, utilizing the Fermi -LAT survey at high-energy γ -rays, several ground-based optical telescopes, and single-dish radio telescopes operating at GHz frequencies. The novelty of our approach is that, by combining long-term and densely sampled intra-night light curves in the optical regime, we were able to construct for the first time the optical power spectrum of the blazar for a time domain extending from 23 years down to minutes. Our analysis reveals that: (1) the optical variability is consistent with a pure red noise, for which the power spectral density can be well approximated by a single power law throughout the entire time domain probed; (2) the slope of power spectral density at high-energy γ -rays (∼1) is significantly flatter than that found at radio and optical frequencies (∼2) within the corresponding time variability range; (3) for the derived power spectra, we did not detect any low-frequency flattening, nor do we see any evidence for cutoffs at the highest frequencies down to the noise floor levels due to measurement uncertainties. We interpret our findings in terms of a model where the blazar variability is generated by the underlying single stochastic process (at radio and optical frequencies), or a linear superposition of such processes (in the γ -ray regime). Along with the detailed PSD analysis, we also present the results of our extended (1998–2015) intra-night optical monitoring program and newly acquired optical photo-polarimetric data for the source.

  16. A collective variable approach and stabilization for dispersion-managed optical solitons in the quintic complex Ginzburg-Landau equation as perturbations of the nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Fewo, S I; Kenfack-Jiotsa, A; Kofane, T C

    2006-01-01

    With the help of the one-dimensional quintic complex Ginzburg-Landau equation (CGLE) as perturbations of the nonlinear Schroedinger equation (NLSE), we derive the equations of motion of pulse parameters called collective variables (CVs), of a pulse propagating in dispersion-managed (DM) fibre optic links. The equations obtained are investigated numerically in order to view the evolution of pulse parameters along the propagation distance, and also to analyse effects of initial amplitude and width on the propagating pulse. Nonlinear gain is shown to be beneficial in stabilizing DM solitons. A fully numerical simulation of the one-dimensional quintic CGLE as perturbations of NLSE finally tests the results of the CV theory. A good agreement is observed between both methods

  17. Non-linear optical studies of adsorbates: Spectroscopy and dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Xiangdong.

    1989-08-01

    In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs.

  18. Non-linear optical studies of adsorbates: Spectroscopy and dynamics

    International Nuclear Information System (INIS)

    Zhu, Xiangdong.

    1989-08-01

    In the first part of this thesis, we have established a systematic procedure to apply the surface optical second-harmonic generation (SHG) technique to study surface dynamics of adsorbates. In particular, we have developed a novel technique for studies of molecular surface diffusions. In this technique, the laser-induced desorption with two interfering laser beams is used to produce a monolayer grating of adsorbates. The monolayer grating is detected with diffractions of optical SHG. By monitoring the first-order second-harmonic diffraction, we can follow the time evolution of the grating modulation from which we are able to deduce the diffusion constant of the adsorbates on the surface. We have successfully applied this technique to investigate the surface diffusion of CO on Ni(111). The unique advantages of this novel technique will enable us to readily study anisotropy of a surface diffusion with variable grating orientation, and to investigate diffusion processes of a large dynamic range with variable grating spacings. In the second part of this work, we demonstrate that optical infrared-visible sum-frequency generation (SFG) from surfaces can be used as a viable surface vibrational spectroscopic technique. We have successfully recorded the first vibrational spectrum of a monolayer of adsorbates using optical infrared-visible SFG. The qualitative and quantitative correlation of optical SFG with infrared absorption and Raman scattering spectroscopies are examined and experimentally demonstrated. We have further investigated the possibility to use transient infrared-visible SFG to probe vibrational transients and ultrafast relaxations on surfaces. 146 refs

  19. THE NATURE OF OPTICALLY DULL ACTIVE GALACTIC NUCLEI IN COSMOS

    International Nuclear Information System (INIS)

    Trump, Jonathan R.; Impey, Chris D.; Gabor, Jared M.; Taniguchi, Yoshi; Nagao, Tohru; Shioya, Yasuhiro; Brusa, Marcella; Civano, Francesca; Elvis, Martin; Kelly, Brandon C.; Huchra, John P.; Jahnke, Knud; Koekemoer, Anton M.; Salvato, Mara; Capak, Peter; Scoville, Nick Z.; Kartaltepe, Jeyhan S.; Lanzuisi, Giorgio; McCarthy, Patrick J.; Maineri, Vincenzo

    2009-01-01

    We present infrared, optical, and X-ray data of 48 X-ray bright, optically dull active galactic nuclei (AGNs) in the COSMOS field. These objects exhibit the X-ray luminosity of an AGN but lack broad and narrow emission lines in their optical spectrum. We show that despite the lack of optical emission lines, most of these optically dull AGNs are not well described by a typical passive red galaxy spectrum: instead they exhibit weak but significant blue emission like an unobscured AGN. Photometric observations over several years additionally show significant variability in the blue emission of four optically dull AGNs. The nature of the blue and infrared emission suggest that the optically inactive appearance of these AGNs cannot be caused by obscuration intrinsic to the AGNs. Instead, up to ∼70% of optically dull AGNs are diluted by their hosts, with bright or simply edge-on hosts lying preferentially within the spectroscopic aperture. The remaining ∼30% of optically dull AGNs have anomalously high f X /f O ratios and are intrinsically weak, not obscured, in the optical. These optically dull AGNs are best described as a weakly accreting AGN with a truncated accretion disk from a radiatively inefficient accretion flow.

  20. Soft optics in intelligent optical networks

    Science.gov (United States)

    Shue, Chikong; Cao, Yang

    2001-10-01

    In addition to the recent advances in Hard-optics that pushes the optical transmission speed, distance, wave density and optical switching capacity, Soft-optics provides the necessary intelligence and control software that reduces operational costs, increase efficiency, and enhances revenue generating services by automating optimal optical circuit placement and restoration, and enabling value-added new services like Optical VPN. This paper describes the advances in 1) Overall Hard-optics and Soft-optics 2) Layered hierarchy of Soft-optics 3) Component of Soft-optics, including hard-optics drivers, Management Soft-optics, Routing Soft-optics and System Soft-optics 4) Key component of Routing and System Soft-optics, namely optical routing and signaling (including UNI/NNI and GMPLS signaling). In summary, the soft-optics on a new generation of OXC's enables Intelligent Optical Networks to provide just-in-time service delivery and fast restoration, and real-time capacity management that eliminates stranded bandwidth. It reduces operational costs and provides new revenue opportunities.

  1. Feedback Control in Quantum Optics: An Overview of Experimental Breakthroughs and Areas of Application

    OpenAIRE

    Alessio Serafini

    2012-01-01

    We present a broad summary of research involving the application of quantum feedback control techniques to optical set-ups, from the early enhancement of optical amplitude squeezing to the recent stabilisation of photon number states in a microwave cavity, dwelling mostly on the latest experimental advances. Feedback control of quantum optical continuous variables, quantum non-demolition memories, feedback cooling, quantum state control, adaptive quantum measurements and coherent feedback str...

  2. A possible close supermassive black-hole binary in a quasar with optical periodicity.

    Science.gov (United States)

    Graham, Matthew J; Djorgovski, S G; Stern, Daniel; Glikman, Eilat; Drake, Andrew J; Mahabal, Ashish A; Donalek, Ciro; Larson, Steve; Christensen, Eric

    2015-02-05

    Quasars have long been known to be variable sources at all wavelengths. Their optical variability is stochastic and can be due to a variety of physical mechanisms; it is also well-described statistically in terms of a damped random walk model. The recent availability of large collections of astronomical time series of flux measurements (light curves) offers new data sets for a systematic exploration of quasar variability. Here we report the detection of a strong, smooth periodic signal in the optical variability of the quasar PG 1302-102 with a mean observed period of 1,884 ± 88 days. It was identified in a search for periodic variability in a data set of light curves for 247,000 known, spectroscopically confirmed quasars with a temporal baseline of about 9 years. Although the interpretation of this phenomenon is still uncertain, the most plausible mechanisms involve a binary system of two supermassive black holes with a subparsec separation. Such systems are an expected consequence of galaxy mergers and can provide important constraints on models of galaxy formation and evolution.

  3. Spacetime replication of continuous variable quantum information

    International Nuclear Information System (INIS)

    Hayden, Patrick; Nezami, Sepehr; Salton, Grant; Sanders, Barry C

    2016-01-01

    The theory of relativity requires that no information travel faster than light, whereas the unitarity of quantum mechanics ensures that quantum information cannot be cloned. These conditions provide the basic constraints that appear in information replication tasks, which formalize aspects of the behavior of information in relativistic quantum mechanics. In this article, we provide continuous variable (CV) strategies for spacetime quantum information replication that are directly amenable to optical or mechanical implementation. We use a new class of homologically constructed CV quantum error correcting codes to provide efficient solutions for the general case of information replication. As compared to schemes encoding qubits, our CV solution requires half as many shares per encoded system. We also provide an optimized five-mode strategy for replicating quantum information in a particular configuration of four spacetime regions designed not to be reducible to previously performed experiments. For this optimized strategy, we provide detailed encoding and decoding procedures using standard optical apparatus and calculate the recovery fidelity when finite squeezing is used. As such we provide a scheme for experimentally realizing quantum information replication using quantum optics. (paper)

  4. Measuring Repeatability of the Focus-variable Lenses

    Directory of Open Access Journals (Sweden)

    Jan Řezníček

    2014-12-01

    Full Text Available In the field of photogrammetry, the optical system, usually represented by the glass lens, is used for metric purposes. Therefore, the aberration characteristics of such a lens, inducing deviations from projective imaging, has to be well known. However, the most important property of the metric lens is the stability of its glass and mechanical elements, ensuring long-term reliability of the measured parameters. In case of a focus-variable lens, the repeatability of the lens setup is important as well. Lenses with a fixed focal length are usually considered as “fixed” though, in fact, most of them contain one or more movable glass elements, providing the focusing function. In cases where the lens is not equipped with fixing screws, the repeatability of the calibration parameters should be known. This paper derives simple mathematical formulas that can be used for measuring the repeatability of the focus-variable lenses, and gives a demonstrative example of such measuring. The given procedure has the advantage that only demanded parameters are estimated, hence, no unwanted correlations with the additional parameters exist. The test arrangement enables us to measure each demanded magnification of the optical system, which is important in close-range photogrammetry.

  5. Via patterning in the 7-nm node using immersion lithography and graphoepitaxy directed self-assembly

    Science.gov (United States)

    Doise, Jan; Bekaert, Joost; Chan, Boon Teik; Hori, Masafumi; Gronheid, Roel

    2017-04-01

    Insertion of a graphoepitaxy directed self-assembly process as a via patterning technology into integrated circuit fabrication is seriously considered for the 7-nm node and beyond. At these dimensions, a graphoepitaxy process using a cylindrical block copolymer that enables hole multiplication can alleviate costs by extending 193-nm immersion-based lithography and significantly reducing the number of masks that would be required per layer. To be considered for implementation, it needs to be proved that this approach can achieve the required pattern quality in terms of defects and variability using a representative, aperiodic design. The patterning of a via layer from an actual 7-nm node logic layout is demonstrated using immersion lithography and graphoepitaxy directed self-assembly in a fab-like environment. The performance of the process is characterized in detail on a full 300-mm wafer scale. The local variability in an edge placement error of the obtained patterns (4.0 nm 3σ for singlets) is in line with the recent results in the field and significantly less than of the prepattern (4.9 nm 3σ for singlets). In addition, it is expected that pattern quality can be further improved through an improved mask design and optical proximity correction. No major complications for insertion of the graphoepitaxy directed self-assembly into device manufacturing were observed.

  6. Discovery of a New Classical Nova Shell Around a Nova-like Cataclysmic Variable

    Science.gov (United States)

    Guerrero, Martín A.; Sabin, Laurence; Tovmassian, Gagik; Santamaría, Edgar; Michel, Raul; Ramos-Larios, Gerardo; Alarie, Alexandre; Morisset, Christophe; Bermúdez Bustamante, Luis C.; González, Chantal P.; Wright, Nick J.

    2018-04-01

    The morphology and optical spectrum of IPHASX J210204.7+471015, a nebula classified as a possible planetary nebula are, however, strikingly similar to those of AT Cnc, a classical nova shell around a dwarf nova. To investigate its true nature, we have obtained high-resolution narrowband [O III] and [N II] images and deep optical spectra. The nebula shows an arc of [N II]-bright knots notably enriched in nitrogen, while an [O III]-bright bow shock is progressing throughout the ISM. Diagnostic line ratios indicate that shocks are associated with the arc and bow shock. The central star of this nebula has been identified by its photometric variability. Time-resolved photometric and spectroscopic data of this source reveal a period of 4.26 hr, which is attributed to a binary system. The optical spectrum is notably similar to that of RW Sex, a cataclysmic variable star (CV) of the UX UMa nova-like (NL) type. Based on these results, we propose that IPHASX J210204.7 + 471015 is a classical nova shell observed around a CV-NL system in quiescence.

  7. Optical Coronagraphic Spectroscopy of AU Mic: Evidence of Time Variable Colors?

    Science.gov (United States)

    Lomax, Jamie R.; Wisniewski, John P.; Roberge, Aki; Donaldson, Jessica K.; Debes, John H.; Malumuth, Eliot M.; Weinberger, Alycia J.

    2018-02-01

    We present coronagraphic long slit spectra of AU Mic’s debris disk taken with the STIS instrument aboard the Hubble Space Telescope. Our spectra are the first spatially-resolved, scattered light spectra of the system’s disk, which we detect at projected distances between approximately 10 and 45 au. Our spectra cover a wavelength range between 5200 and 10200 Å. We find that the color of AU Mic’s debris disk is bluest at small (12–17 au) projected separations. These results both confirm and quantify the findings qualitatively noted by Krist et al. and are different than IR observations that suggested a uniform blue or gray color as a function of projected separation in this region of the disk. Unlike previous literature, which reported that the color of AU Mic’s disk became increasingly more blue as a function of projected separation beyond ∼30 au, we find the disk’s optical color between 35 and 45 au to be uniformly blue on the southeast side of the disk and decreasingly blue on the northwest side. We note that this apparent change in disk color at larger projected separations coincides with several fast, outward moving “features” that are passing through this region of the southeast side of the disk. We speculate that these phenomenon might be related and that the fast moving features could be changing the localized distribution of sub-micron-sized grains as they pass by, thereby reducing the blue color of the disk in the process. We encourage follow-up optical spectroscopic observations of AU Mic to both confirm this result and search for further modifications of the disk color caused by additional fast moving features propagating through the disk.

  8. Optical imaging of gamma-ray bursts with the LONEOS telescope

    International Nuclear Information System (INIS)

    Wagner, R.M.; Bowell, E.; Koehn, B.W.; Cook, K.H.; Howell, S.B.; Shrader, C.R.; Starrfield, S.G.; Stubbs, C.W.

    1998-01-01

    The optical identification of gamma-ray bursts discovered and localized by BACODINE/LOCBURST using the Lowell Observatory Near-Earth Object Search (LONEOS) 58-cm Schmidt-type telescope and mosaic CCD camera is described. In its final form, LONEOS images 10 square degrees of the sky (3.2 degree x3.2 degree) to ∼22nd mag (2σ) in a 5 minute integration. Identification of optical transients will be based on variability by comparison with subsequent images or previous scans of the region. To date, optical images have been obtained of three BATSE triggers processed by LOCBURST for development and evaluation purposes. copyright 1998 American Institute of Physics

  9. Silicon photonic dynamic optical channel leveler with external feedback loop.

    Science.gov (United States)

    Doylend, J K; Jessop, P E; Knights, A P

    2010-06-21

    We demonstrate a dynamic optical channel leveler composed of a variable optical attenuator (VOA) integrated monolithically with a defect-mediated photodiode in a silicon photonic waveguide device. An external feedback loop mimics an analog circuit such that the photodiode directly controls the VOA to provide blind channel leveling within +/-1 dB across a 7-10 dB dynamic range for wavelengths from 1530 nm to 1570 nm. The device consumes approximately 50 mW electrical power and occupies a 6 mm x 0.1 mm footprint per channel. Dynamic leveling is accomplished without tapping optical power from the output path to the photodiode and thus the loss penalty is minimized.

  10. Quantitative relations between the eyeball, the optic nerve, and the optic canal important for intracranial pressure monitoring.

    Science.gov (United States)

    Vaiman, Michael; Gottlieb, Paul; Bekerman, Inessa

    2014-08-17

    To find correlations between diameters of the optic nerve sheath (ONSD), the eyeball, and the optic canal that might be important for intracranial pressure monitoring. In a prospective cohort study, the CT data of consecutive 400 adults (18+) with healthy eyes and optic nerves and absence of neurological diseases were collected and analyzed. When the CT scans were obtained, the diameters of the optic nerve sheath, the eyeball, and the optic canal were measured and statistically analyzed. The data obtained from the left and from the right eyeballs and optic nerves were compared. The correlation analysis was performed within these variables, with the gender, and the age. In healthy persons, the ONSD varies from 3.65 mm to 5.17 mm in different locations within the intraorbital space with no significant difference between sexes and age groups. There is a strong correlation between the eyeball transverse diameter (ETD) and ONSD that can be presented as ONSD/ETD index. In healthy subjects, the ONSD/ETD index equals 0.19. The calculation of an index when ONSD is divided by the ETD of the eyeball presents precise normative database for ONSD intracranial pressure measurement technique. When the ONSD is measured for intracranial pressure monitoring, the most stable results can be obtained if the diameter is measured 10 mm from the globe. These data might serve as a normative database at emergency departments and in general neurological practice.

  11. Would one rather store squeezing or entanglement in continuous variable quantum memories?

    International Nuclear Information System (INIS)

    Yadsan-Appleby, Hulya; Serafini, Alessio

    2011-01-01

    Given two quantum memories for continuous variables and the possibility to perform passive optical operations on the optical modes before or after the storage, two possible scenarios arise resulting in generally different degrees of final entanglement. Namely, one could either store an entangled state and retrieve it directly from the memory, or rather store two separate single-mode squeezed states and then combine them with a beam-splitter to generate the final entangled state. In this Letter, we analytically determine which of the two options yields more entanglement for several regions of the system's parameters, and quantify the advantage it entails. - Highlights: → We study the optimised storage of continuous variable entanglement. → Analytical conditions to determine optimal storage schemes. → Comprehensive numerical studies complementing the analytics. → Specific discussion concerning QND feedback memories included. → Results applicable to very general Gaussian channel.

  12. Quantum error correction of continuous-variable states against Gaussian noise

    Energy Technology Data Exchange (ETDEWEB)

    Ralph, T. C. [Centre for Quantum Computation and Communication Technology, School of Mathematics and Physics, University of Queensland, St Lucia, Queensland 4072 (Australia)

    2011-08-15

    We describe a continuous-variable error correction protocol that can correct the Gaussian noise induced by linear loss on Gaussian states. The protocol can be implemented using linear optics and photon counting. We explore the theoretical bounds of the protocol as well as the expected performance given current knowledge and technology.

  13. Optical Communication over Plastic Optical Fibers Integrated Optical Receiver Technology

    CERN Document Server

    Atef, Mohamed

    2013-01-01

    This book presents high-performance data transmission over plastic optical fibers (POF) using integrated optical receivers having good properties with multilevel modulation, i.e. a higher sensitivity and higher data rate transmission over a longer plastic optical fiber length. Integrated optical receivers and transmitters with high linearity are introduced for multilevel communication. For binary high-data rate transmission over plastic optical fibers, an innovative receiver containing an equalizer is described leading also to a high performance of a plastic optical fiber link. The cheap standard PMMA SI-POF (step-index plastic optical fiber) has the lowest bandwidth and the highest attenuation among multimode fibers. This small bandwidth limits the maximum data rate which can be transmitted through plastic optical fibers. To overcome the problem of the plastic optical fibers high transmission loss, very sensitive receivers must be used to increase the transmitted length over POF. The plastic optical fiber li...

  14. 18-year variability of ultraviolet radiation penetration in the mid-latitude coastal waters of the western boundary Pacific

    Science.gov (United States)

    Kuwahara, Victor S.; Nozaki, Sena; Nakano, Junji; Toda, Tatsuki; Kikuchi, Tomohiko; Taguchi, Satoru

    2015-07-01

    The 18-year time-series shows in situ ultraviolet radiation (UVR) and photosynthetically active radiation (PAR) diffuse attenuation coefficient Kd(λ) have recurrent seasonal variability of high/low attenuation during summer/winter months, respectively, dependent on variability in water column stratification and concentrations of bio-optical properties. The mid-latitude coastal survey station displayed significant seasonality of the mixed layer depth (MLD) between 12 and 82 m which modified the distribution of chlorophyll a (4.6-24.9 mg m-2) and absorption of colored dissolved organic matter [aCDOM(320 nm) 0.043-1.34 m-1]. The median Kd(320 nm) displayed significant seasonality at 0.19-0.74 m-1 (C.V. = 44.1%) and seasonal variability within the euphotic layer [Z10%(320 nm) = 7-20%]. High attenuation of UVR with relatively moderate attenuation of PAR was consistently observed during the summer months when increased concentrations of terrestrially derived CDOM coupled with a shallow MLD were present. The winter season showed the opposite of low UVR and PAR attenuation due to a relatively deeper MLD coupled with low concentrations of bio-optical properties. Although the long term Kd(λ) did not vary significantly during the time-series, analysis of the interannual variability suggests there are positive and negative phases following the Pacific Decadal Oscillation (PDO) vis-a-vis variability in bio-optical properties (p < 0.001).

  15. Clinical manifestations of optic pit maculopathy as demonstrated by spectral domain optical coherence tomography

    Directory of Open Access Journals (Sweden)

    Tzu JH

    2013-01-01

    Full Text Available Jonathan H Tzu, Harry W Flynn Jr, Audina M Berrocal, William E Smiddy, Timothy G Murray, Yale L FisherDepartment of Ophthalmology, Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Miami, FL, USAPurpose: The purpose of this retrospective study was to evaluate the characteristic features, including spectral-domain optical coherence tomography (SD-OCT, clinical course, and outcome of treatment if given for patients with optic disc pit maculopathy.Methods: We investigated a consecutive series of patients with a diagnosis of optic pit maculopathy treated between 2001 and 2012 at the Bascom Palmer Eye Institute. Patients were divided into two main groups, ie, patients who were observed without surgery and patients who received surgical intervention. The main outcome measures were presenting and final visual acuity, and changes in SD-OCT imaging were recorded. Other data including age, gender, eye, age of onset, length of follow-up, location of optic pit, and location of fluid by OCT were also recorded.Results: On OCT, 67% (12/18 of the eyes showed schisis-like cavities, 22% (4/18 had only subretinal fluid, and 17% (3/18 had only a schisis-like cavity without subretinal fluid. In the patients managed by observation, visual acuity was ≥20/200 in 6/8 eyes initially and 6/8 eyes at last follow-up. Ten of 18 patients received either focal laser, surgery or both. Six of 10 eyes undergoing surgery had initial visual acuity ≥ 20/200, and 8 of 10 eyes undergoing surgery had a visual acuity of ≥20/200 at last follow-up.Conclusion: In this study, many eyes were observed and remained stable during follow-up. In eyes with reduced vision, surgical intervention produced variable outcomes, and persistent intraretinal/subretinal fluid was a common occurrence.Keywords: optic pit maculopathy, spectral-domain optical coherence tomography

  16. Optic axis determination by fibre-based polarization-sensitive swept-source optical coherence tomography

    Energy Technology Data Exchange (ETDEWEB)

    Lu Zenghai; Kasaragod, Deepa K; Matcher, Stephen J, E-mail: z.lu@sheffield.ac.uk, E-mail: s.j.matcher@sheffield.ac.uk [Department of Materials Science and Engineering, Kroto Research Institute, University of Sheffield, North Campus, Broad Lane, Sheffield, S3 7HQ (United Kingdom)

    2011-02-21

    We describe a fibre-based variable-incidence angle (VIA) polarization-sensitive swept-source optical coherence tomography (PS-SS-OCT) system to determine the 3D optical axis of birefringent biological tissues. Single-plane VIA-PS-OCT is also explored which requires measurement of the absolute fast-axis orientation. A state-of-the-art PS-SS-OCT system with some improvements both in hardware and software was used to determine the apparent optical birefringence of equine tendon for a number of different illumination directions. Polar and azimuthal angles of cut equine tendon were produced by the VIA method and compared with the nominal values. A quarter waveplate (QWP) and equine tendon were used as test targets to validate the fast-axis measurements using the system. Polar and azimuthal angles of cut equine tendon broadly agreed with the expected values within about 8% of the nominal values. A theoretical and experimental analysis of the effect of the sample arm fibre on determination of optical axis orientation using a proposed definition based on the orientation of the eigenpolarization ellipse experimentally confirms that this algorithm only works correctly for special settings of the sample arm fibre. A proposed algorithm based on the angle between Stokes vectors on the Poincare sphere is confirmed to work for all settings of the sample arm fibre. A calibration procedure is proposed to remove the sign ambiguity of the measured orientation and was confirmed experimentally by using the QWP.

  17. Optic axis determination by fibre-based polarization-sensitive swept-source optical coherence tomography

    International Nuclear Information System (INIS)

    Lu Zenghai; Kasaragod, Deepa K; Matcher, Stephen J

    2011-01-01

    We describe a fibre-based variable-incidence angle (VIA) polarization-sensitive swept-source optical coherence tomography (PS-SS-OCT) system to determine the 3D optical axis of birefringent biological tissues. Single-plane VIA-PS-OCT is also explored which requires measurement of the absolute fast-axis orientation. A state-of-the-art PS-SS-OCT system with some improvements both in hardware and software was used to determine the apparent optical birefringence of equine tendon for a number of different illumination directions. Polar and azimuthal angles of cut equine tendon were produced by the VIA method and compared with the nominal values. A quarter waveplate (QWP) and equine tendon were used as test targets to validate the fast-axis measurements using the system. Polar and azimuthal angles of cut equine tendon broadly agreed with the expected values within about 8% of the nominal values. A theoretical and experimental analysis of the effect of the sample arm fibre on determination of optical axis orientation using a proposed definition based on the orientation of the eigenpolarization ellipse experimentally confirms that this algorithm only works correctly for special settings of the sample arm fibre. A proposed algorithm based on the angle between Stokes vectors on the Poincare sphere is confirmed to work for all settings of the sample arm fibre. A calibration procedure is proposed to remove the sign ambiguity of the measured orientation and was confirmed experimentally by using the QWP.

  18. The optical counterpart of IGR J00291+5934 in quiescence

    Science.gov (United States)

    D'Avanzo, P.; Campana, S.; Covino, S.; Israel, G. L.; Stella, L.; Andreuzzi, G.

    2007-09-01

    Aims:The recent (December 2004) discovery of the sixth accretion-powered millisecond X-ray pulsar IGR J00291+5934 provides a very good chance to deepen our knowledge of such systems. Although these systems are well studied at high energies, poor informations are available for their optical/NIR counterparts during quiescence. Up to now, only for SAX J1808.4-3658, the first discovered system of this type, we have a secure multiband detection of its optical counterpart in quiescence. Among the seven known system IGR J00291+5934 is the one that resembles SAX J1808.4-3658 more closely. Methods: With the Italian 3.6 m TNG telescope, we have performed deep optical and NIR photometry of the field of IGR J00291+5934 during quiescence in order to look for the presence of a variable counterpart. Results: We present here the first multiband (VRIJH) detection of the optical and NIR counterpart of IGR J00291+5934 in quiescence as well as a deep upper limit in the K-band. We obtain an optical light curve that shows variability consistent with a sinusoidal modulation at the known 2.46 h orbital period and present evidence for a strongly irradiated companion. Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundación Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.

  19. Optical monitoring of Active Galactic Nuclei from ARIES

    Science.gov (United States)

    Gopal-Krishna; Wiita, Paul Joseph

    2018-04-01

    This overview provides a historical perspective highlighting the pioneering role which the fairly modest observational facilities of ARIES have played since the 1990s in systematically characterizing the optical variability on hour-like time scale (intra-night optical variability, or INOV) of several major types of high-luminosity Active Galactic Nuclei (AGN). Such information was previously available only for blazars. Similar studies have since been initiated in at least a dozen countries, giving a boost to AGN variability research. Our work has, in particular, provided strong indication that mild INOV occurs in radio-quiet QSOs (amplitude up to 3 – 5 % and duty cycle 10%) and, moreover, has demonstrated that similarly mild INOV is exhibited even by the vast majority of radio-loud quasars which possess powerful relativistic jets (even including many that are beamed towards us). The solitary outliers are blazars, the tiny strongly polarized subset of powerful AGN, which frequently exhibit a pronounced INOV. Among the blazars, BL Lac objects often show a bluer-when-brighter chromatic behavior, while the flat spectrum radio quasars seem not to. Quantifying any differences of INOV among the major subclasses of non-blazar type AGNs will require dedicated monitoring programs using 2 - 3 metre class telescopes.

  20. Contrasting seasonality in optical-biogeochemical properties of the Baltic Sea.

    Science.gov (United States)

    Simis, Stefan G H; Ylöstalo, Pasi; Kallio, Kari Y; Spilling, Kristian; Kutser, Tiit

    2017-01-01

    Optical-biogeochemical relationships of particulate and dissolved organic matter are presented in support of remote sensing of the Baltic Sea pelagic. This system exhibits strong seasonality in phytoplankton community composition and wide gradients of chromophoric dissolved organic matter (CDOM), properties which are poorly handled by existing remote sensing algorithms. Absorption and scattering properties of particulate matter reflected the seasonality in biological (phytoplankton succession) and physical (thermal stratification) processes. Inherent optical properties showed much wider variability when normalized to the chlorophyll-a concentration compared to normalization to either total suspended matter dry weight or particulate organic carbon. The particle population had the largest optical variability in summer and was dominated by organic matter in both seasons. The geographic variability of CDOM and relationships with dissolved organic carbon (DOC) are also presented. CDOM dominated light absorption at blue wavelengths, contributing 81% (median) of the absorption by all water constituents at 400 nm and 63% at 442 nm. Consequentially, 90% of water-leaving radiance at 412 nm originated from a layer (z90) no deeper than approximately 1.0 m. With water increasingly attenuating light at longer wavelengths, a green peak in light penetration and reflectance is always present in these waters, with z90 up to 3.0-3.5 m depth, whereas z90 only exceeds 5 m at biomass < 5 mg Chla m-3. High absorption combined with a weakly scattering particle population (despite median phytoplankton biomass of 14.1 and 4.3 mg Chla m-3 in spring and summer samples, respectively), characterize this sea as a dark water body for which dedicated or exceptionally robust remote sensing techniques are required. Seasonal and regional optical-biogeochemical models, data distributions, and an extensive set of simulated remote-sensing reflectance spectra for testing of remote sensing algorithms are

  1. Contrasting seasonality in optical-biogeochemical properties of the Baltic Sea.

    Directory of Open Access Journals (Sweden)

    Stefan G H Simis

    Full Text Available Optical-biogeochemical relationships of particulate and dissolved organic matter are presented in support of remote sensing of the Baltic Sea pelagic. This system exhibits strong seasonality in phytoplankton community composition and wide gradients of chromophoric dissolved organic matter (CDOM, properties which are poorly handled by existing remote sensing algorithms. Absorption and scattering properties of particulate matter reflected the seasonality in biological (phytoplankton succession and physical (thermal stratification processes. Inherent optical properties showed much wider variability when normalized to the chlorophyll-a concentration compared to normalization to either total suspended matter dry weight or particulate organic carbon. The particle population had the largest optical variability in summer and was dominated by organic matter in both seasons. The geographic variability of CDOM and relationships with dissolved organic carbon (DOC are also presented. CDOM dominated light absorption at blue wavelengths, contributing 81% (median of the absorption by all water constituents at 400 nm and 63% at 442 nm. Consequentially, 90% of water-leaving radiance at 412 nm originated from a layer (z90 no deeper than approximately 1.0 m. With water increasingly attenuating light at longer wavelengths, a green peak in light penetration and reflectance is always present in these waters, with z90 up to 3.0-3.5 m depth, whereas z90 only exceeds 5 m at biomass < 5 mg Chla m-3. High absorption combined with a weakly scattering particle population (despite median phytoplankton biomass of 14.1 and 4.3 mg Chla m-3 in spring and summer samples, respectively, characterize this sea as a dark water body for which dedicated or exceptionally robust remote sensing techniques are required. Seasonal and regional optical-biogeochemical models, data distributions, and an extensive set of simulated remote-sensing reflectance spectra for testing of remote sensing

  2. Contrasting seasonality in optical-biogeochemical properties of the Baltic Sea

    Science.gov (United States)

    Ylöstalo, Pasi; Kallio, Kari Y.; Spilling, Kristian; Kutser, Tiit

    2017-01-01

    Optical-biogeochemical relationships of particulate and dissolved organic matter are presented in support of remote sensing of the Baltic Sea pelagic. This system exhibits strong seasonality in phytoplankton community composition and wide gradients of chromophoric dissolved organic matter (CDOM), properties which are poorly handled by existing remote sensing algorithms. Absorption and scattering properties of particulate matter reflected the seasonality in biological (phytoplankton succession) and physical (thermal stratification) processes. Inherent optical properties showed much wider variability when normalized to the chlorophyll-a concentration compared to normalization to either total suspended matter dry weight or particulate organic carbon. The particle population had the largest optical variability in summer and was dominated by organic matter in both seasons. The geographic variability of CDOM and relationships with dissolved organic carbon (DOC) are also presented. CDOM dominated light absorption at blue wavelengths, contributing 81% (median) of the absorption by all water constituents at 400 nm and 63% at 442 nm. Consequentially, 90% of water-leaving radiance at 412 nm originated from a layer (z90) no deeper than approximately 1.0 m. With water increasingly attenuating light at longer wavelengths, a green peak in light penetration and reflectance is always present in these waters, with z90 up to 3.0–3.5 m depth, whereas z90 only exceeds 5 m at biomass < 5 mg Chla m-3. High absorption combined with a weakly scattering particle population (despite median phytoplankton biomass of 14.1 and 4.3 mg Chla m-3 in spring and summer samples, respectively), characterize this sea as a dark water body for which dedicated or exceptionally robust remote sensing techniques are required. Seasonal and regional optical-biogeochemical models, data distributions, and an extensive set of simulated remote-sensing reflectance spectra for testing of remote sensing algorithms

  3. Sub-ballistic behavior in the quantum kicked rotor

    Energy Technology Data Exchange (ETDEWEB)

    Romanelli, A. [Instituto de Fisica, Facultad de Ingenieria, Universidad de la Republica, C.C. 30, C.P. 11000, Montevideo (Uruguay)]. E-mail: alejo@fing.edu.uy; Auyuanet, A. [Instituto de Fisica, Facultad de Ingenieria, Universidad de la Republica, C.C. 30, C.P. 11000, Montevideo (Uruguay)]. E-mail: auyuanet@fing.edu.uy; Siri, R. [Instituto de Fisica, Facultad de Ingenieria, Universidad de la Republica, C.C. 30, C.P. 11000, Montevideo (Uruguay)]. E-mail: rsiri@fing.edu.uy; Micenmacher, V. [Instituto de Fisica, Facultad de Ingenieria, Universidad de la Republica, C.C. 30, C.P. 11000, Montevideo (Uruguay)]. E-mail: vmd@fing.edu.uy

    2007-05-28

    We study the resonances of the quantum kicked rotor subjected to an excitation that follows an aperiodic Fibonacci prescription. In such a case the secondary resonances show a sub-ballistic behavior like the quantum walk with the same aperiodic prescription for the coin. The principal resonances maintain the well-known ballistic behavior.

  4. Sub-ballistic behavior in the quantum kicked rotor

    International Nuclear Information System (INIS)

    Romanelli, A.; Auyuanet, A.; Siri, R.; Micenmacher, V.

    2007-01-01

    We study the resonances of the quantum kicked rotor subjected to an excitation that follows an aperiodic Fibonacci prescription. In such a case the secondary resonances show a sub-ballistic behavior like the quantum walk with the same aperiodic prescription for the coin. The principal resonances maintain the well-known ballistic behavior

  5. Multi-sensor control for precise assembly of optical components

    Directory of Open Access Journals (Sweden)

    Ma Li

    2014-06-01

    Full Text Available In order to perform an optical assembly accurately, a multi-sensor control strategy is developed which includes an attitude measurement system, a vision system, a loss measurement system and a force sensor. A 3-DOF attitude measuring method using linear variable differential transformers (LVDT is designed to adjust the relation of position and attitude between the spherical mirror and the resonator. A micro vision feedback system is set up to extract the light beam and the diaphragm, which can achieve the coarse positioning of the spherical mirror in the optical assembly process. A rapid self-correlation method is presented to analyze the spectrum signal for the fine positioning. In order to prevent the damage of the optical components and realize sealing of the resonator, a hybrid force-position control is constructed to control the contact force of the optical components. The experimental results show that the proposed multi-sensor control strategy succeeds in accomplishing the precise assembly of the optical components, which consists of parallel adjustment, macro coarse adjustment, macro approach, micro fine adjustment, micro approach and optical contact. Therefore, the results validate the multi-sensor control strategy.

  6. The Varied Variability of PKS 0736+017

    Science.gov (United States)

    Clements, S. D.; Cubides, L. A.; Greiwe, C. L.; Habermas, K. S.; Jenks, A. K.; Long, A. M.; Patel, J. A.; Torres, Y. V.

    2003-05-01

    The flat spectrum radio quasar PKS 0736+017 has been an exciting observing target, exhibiting diverse optical variability behaviors and even sharing its field one evening with a minor planet. The behavior of PKS 0736+017 has included persistently faint and quiescent periods, episodes of quasi-periodic microvariability, dramatic flaring events, and periods of unusual oscillations. These assorted behaviors are examined, with particular emphasis on the quasi-periodic variations and unusual oscillations that accompanied a dramatic flare.

  7. Multi-gigabit optical interconnects for next-generation on-board digital equipment

    Science.gov (United States)

    Venet, Norbert; Favaro, Henri; Sotom, Michel; Maignan, Michel; Berthon, Jacques

    2017-11-01

    Parallel optical interconnects are experimentally assessed as a technology that may offer the high-throughput data communication capabilities required to the next-generation on-board digital processing units. An optical backplane interconnect was breadboarded, on the basis of a digital transparent processor that provides flexible connectivity and variable bandwidth in telecom missions with multi-beam antenna coverage. The unit selected for the demonstration required that more than tens of Gbit/s be supported by the backplane. The demonstration made use of commercial parallel optical link modules at 850 nm wavelength, with 12 channels running at up to 2.5 Gbit/s. A flexible optical fibre circuit was developed so as to route board-to-board connections. It was plugged to the optical transmitter and receiver modules through 12-fibre MPO connectors. BER below 10-14 and optical link budgets in excess of 12 dB were measured, which would enable to integrate broadcasting. Integration of the optical backplane interconnect was successfully demonstrated by validating the overall digital processor functionality.

  8. Performance analysis of relay-assisted all-optical FSO networks over strong atmospheric turbulence channels with pointing errors

    KAUST Repository

    Yang, Liang; Gao, Xiqi; Alouini, Mohamed-Slim

    2014-01-01

    -optical links. Assuming a variable gain relay with amplify-and-forward protocol, the electrical signal at the source is forwarded to the destination with the help of this relay through all-optical links. More specifically, we first present a cumulative density

  9. Optical signal processing techniques and applications of optical phase modulation in high-speed communication systems

    Science.gov (United States)

    Deng, Ning

    the speed limitation of electronics. Thus, all-optical signal processing techniques are highly desirable to support the necessary optical switching functionalities in future ultrahigh-speed optical packet-switching networks. To cope with the wide use of optical phase-modulated signals, in the thesis, an all-optical logic for DPSK or PSK input signals is developed, for the first time. Based on four-wave mixing in semiconductor optical amplifier, the structure of the logic gate is simple, compact, and capable of supporting ultrafast operation. In addition to the general logic processing, a simple label recognition scheme, as a specific signal processing function, is proposed for phase-modulated label signals. The proposed scheme can recognize any incoming label pattern according to the local pattern, and is potentially capable of handling variable-length label patterns. Optical access network with multicast overlay and centralized light sources. In the arena of optical access networks, wavelength division multiplexing passive optical network (WDM-PON) is a promising technology to deliver high-speed data traffic. However, most of proposed WDM-PONs only support conventional point-to-point service, and cannot meet the requirement of increasing demand on broadcast and multicast service. In this thesis, a simple network upgrade is proposed based on the traditional PON architecture to support both point-to-point and multicast service. In addition, the two service signals are modulated on the same lightwave carrier. The upstream signal is also remodulated on the same carrier at the optical network unit, which can significantly relax the requirement on wavelength management at the network unit.

  10. Regional impacts of ocean color on tropical Pacific variability

    Science.gov (United States)

    Anderson, W.; Gnanadesikan, A.; Wittenberg, A.

    2009-08-01

    The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño) while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.

  11. The Radio-optical Spectra of BL Lacs and Possible Relatives

    Science.gov (United States)

    Dennett-Thorpe, J.

    I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?

  12. Nonimaging compound parabolic concentrator-type reflectors with variable extreme direction.

    Science.gov (United States)

    Gordon, J M; Rabl, A

    1992-12-01

    The properties of nonimaging compound parabolic concentrator (CPC)-type devices are examined in which the extreme direction is not constant but rather is a variable that can change along the reflector. One can then retain the maximal concentration or radiative efficiency of the CPC while the flux map on the absorber or target is modified, depending on whether the device is used for optical concentration or for lighting. Two general classes of reflector are derived, and all the nonimaging devices developed to date are shown to be special cases of the general solution. These two classes are the nonimaging analog of converging and diverging devices of imaging optics.

  13. A Method to Analyze the Potential of Optical Remote Sensing for Benthic Habitat Mapping

    Directory of Open Access Journals (Sweden)

    Rodrigo A. Garcia

    2015-10-01

    Full Text Available Quantifying the number and type of benthic classes that are able to be spectrally identified in shallow water remote sensing is important in understanding its potential for habitat mapping. Factors that impact the effectiveness of shallow water habitat mapping include water column turbidity, depth, sensor and environmental noise, spectral resolution of the sensor and spectral variability of the benthic classes. In this paper, we present a simple hierarchical clustering method coupled with a shallow water forward model to generate water-column specific spectral libraries. This technique requires no prior decision on the number of classes to output: the resultant classes are optically separable above the spectral noise introduced by the sensor, image based radiometric corrections, the benthos’ natural spectral variability and the attenuating properties of a variable water column at depth. The modeling reveals the effect reducing the spectral resolution has on the number and type of classes that are optically distinct. We illustrate the potential of this clustering algorithm in an analysis of the conditions, including clustering accuracy, sensor spectral resolution and water column optical properties and depth that enabled the spectral distinction of the seagrass Amphibolis antartica from benthic algae.

  14. An All-Sky Portable (ASP) Optical Catalogue

    Science.gov (United States)

    Flesch, Eric Wim

    2017-06-01

    This optical catalogue combines the all-sky USNO-B1.0/A1.0 and most-sky APM catalogues, plus overlays of SDSS optical data, into a single all-sky map presented in a sparse binary format that is easily downloaded at 9 Gb zipped. Total count is 1 163 237 190 sources and each has J2000 astrometry, red and blue magnitudes with PSFs and variability indicator, and flags for proper motion, epoch, and source survey and catalogue for each of the photometry and astrometry. The catalogue is available on http://quasars.org/asp.html, and additional data for this paper is available at http://dx.doi.org/10.4225/50/5807fbc12595f.

  15. Optical Precursors to Black Hole X-Ray Binary Outbursts: An Evolving Synchrotron Jet Spectrum in Swift J1357.2–0933

    Science.gov (United States)

    Russell, David M.; Qasim, Ahlam Al; Bernardini, Federico; Plotkin, Richard M.; Lewis, Fraser; Koljonen, Karri I. I.; Yang, Yi-Jung

    2018-01-01

    We present six years of optical monitoring of the black hole (BH) candidate X-ray binary Swift J1357.2–0933, during and since its discovery outburst in 2011. On these long timescales, the quiescent light curve is dominated by high amplitude, short-term (seconds–days) variability spanning ∼2 mag, with an increasing trend of the mean flux from 2012 to 2017 that is steeper than in any other X-ray binary found to date (0.17 mag yr‑1). We detected the initial optical rise of the 2017 outburst of Swift J1357.2–0933, and we report that the outburst began between 2017 April 1 and 6. Such a steep optical flux rise preceding an outburst is expected according to disk instability models, but the high amplitude variability in quiescence is not. Previous studies have shown that the quiescent spectral, polarimetric, and rapid variability properties of Swift J1357.2–0933 are consistent with synchrotron emission from a weak compact jet. We find that a variable optical/infrared spectrum is responsible for the brightening: a steep, red spectrum before and soon after the 2011 outburst evolves to a brighter, flatter spectrum since 2013. The evolving spectrum appears to be due to the jet spectral break shifting from the infrared in 2012 to the optical in 2013, then back to the infrared by 2016–2017 while the optical remains relatively bright. Swift J1357.2–0933 is a valuable source to study BH jet physics at very low accretion rates and is possibly the only quiescent source in which the optical jet properties can be regularly monitored.

  16. Optical Monitoring of Young Stellar Objects

    Science.gov (United States)

    Kar, Aman; Jang-Condell, Hannah; Kasper, David; Findlay, Joseph; Kobulnicky, Henry A.

    2018-06-01

    Observing Young Stellar Objects (YSOs) for variability in different wavelengths enables us to understand the evolution and structure of the protoplanetary disks around stars. The stars observed in this project are known YSOs that show variability in the Infrared. Targets were selected from the Spitzer Space Telescope Young Stellar Object Variability (YSOVAR) Program, which monitored star-forming regions in the mid-infrared. The goal of our project is to investigate any correlation between the variability in the infrared versus the optical. Infrared variability of YSOs is associated with the heating of the protoplanetary disk while accretion signatures are observed in the H-alpha region. We used the University of Wyoming’s Red Buttes Observatory to monitor these stars for signs of accretion using an H-alpha narrowband filter and the Johnson-Cousins filter set, over the Summer of 2017. We perform relative photometry and inspect for an image-to-image variation by observing these targets for a period of four months every two to three nights. The study helps us better understand the link between accretion and H-alpha activity and establish a disk-star connection.

  17. Variable weight Khazani-Syed code using hybrid fixed-dynamic technique for optical code division multiple access system

    Science.gov (United States)

    Anas, Siti Barirah Ahmad; Seyedzadeh, Saleh; Mokhtar, Makhfudzah; Sahbudin, Ratna Kalos Zakiah

    2016-10-01

    Future Internet consists of a wide spectrum of applications with different bit rates and quality of service (QoS) requirements. Prioritizing the services is essential to ensure that the delivery of information is at its best. Existing technologies have demonstrated how service differentiation techniques can be implemented in optical networks using data link and network layer operations. However, a physical layer approach can further improve system performance at a prescribed received signal quality by applying control at the bit level. This paper proposes a coding algorithm to support optical domain service differentiation using spectral amplitude coding techniques within an optical code division multiple access (OCDMA) scenario. A particular user or service has a varying weight applied to obtain the desired signal quality. The properties of the new code are compared with other OCDMA codes proposed for service differentiation. In addition, a mathematical model is developed for performance evaluation of the proposed code using two different detection techniques, namely direct decoding and complementary subtraction.

  18. Variability of Fe II Emission Features in the Seyfert 1 Galaxy NGC 5548

    DEFF Research Database (Denmark)

    Vestergaard, Marianne; Peterson, B. M.

    2005-01-01

    We study the low-contrast Fe II emission blends in the ultraviolet (1250--2200A) and optical (4000--6000A) spectra of the Seyfert 1 galaxy NGC 5548 and show that these features vary in flux and that these variations are correlated with those of the optical continuum. The amplitude of variability ...... are correlated indicates that line fluorescence in a photoionized plasma, rather than collisional excitation, is responsible for the Fe II emission. The iron emission templates are available upon request....

  19. Variable angle spectroscopic ellipsometric characterization of HfO2 thin film

    Science.gov (United States)

    Kumar, M.; Kumari, N.; Karar, V.; Sharma, A. L.

    2018-02-01

    Hafnium Oxide film was deposited on BK7 glass substrate using reactive oxygenated E-Beam deposition technique. The film was deposited using in-situ quartz crystal thickness monitoring to control the film thickness and rate of evaporation. The thin film was grown with a rate of deposition of 0.3 nm/s. The coated substrate was optically characterized using spectrophotometer to determine its transmission spectra. The optical constants as well as film thickness of the hafnia film were extracted by variable angle spectroscopic ellipsometry with Cauchy fitting at incidence angles of 65˚, 70˚ and 75˚.

  20. A design for an internet router with a digital optical data plane

    Science.gov (United States)

    Touch, Joe; Bannister, Joseph; Suryaputra, Stephen; Willner, Alan E.

    2013-12-01

    This paper presents a complete design for an optical Internet router based on decomposing the steps required for IP packet forwarding. Implementations of hopcount decrement and header matching are integrated with a simulation-based approach to variable-length packet merging that avoids recirculation, resulting in an all-optical data plane. A method for IPv4 checksum computation is introduced, and this and previously designed components are extended from binary to higher-density (multiple bits per symbol) encodings. The implications of this design are considered, including the potential for chip-level and system integration, as well as the requirements of basic optical processing components.

  1. A variable suppressed aperture and Faraday cup system

    International Nuclear Information System (INIS)

    Price, H.G.; Charlesworth, T.R.

    1979-02-01

    The injection system of the NSF accelerator within the high voltage enclosure is illustrated. The optics calls for a waist close to the entrance of the 500 kV accelerator tube. This waist will be the initial diagnostic point on the injection path for determining ion source performance and transmission through the later system. This will be made by determining the beam current after a preliminary mass analysis by the 30 0 magnet. To provide this diagnostic and to enable a waist to be formed at this point, a variable aperture and Faraday cup system is required. The Faraday cup will measure the beam transmitted by the aperture. Maximisation of this beam by adjustment of the preceding optical elements will ensure the waist in the beam at that point. (author)

  2. A DESCRIPTION OF QUASAR VARIABILITY MEASURED USING REPEATED SDSS AND POSS IMAGING

    International Nuclear Information System (INIS)

    MacLeod, Chelsea L.; Ivezić, Željko; Becker, Andrew C.; Anderson, Scott F.; Sesar, Branimir; De Vries, Wim; Kochanek, Christopher S.; Kelly, Brandon C.; Lupton, Robert H.; Hall, Patrick B.; Richards, Gordon T.; Schneider, Donald P.

    2012-01-01

    We provide a quantitative description and statistical interpretation of the optical continuum variability of quasars. The Sloan Digital Sky Survey (SDSS) has obtained repeated imaging in five UV-to-IR photometric bands for 33,881 spectroscopically confirmed quasars. About 10,000 quasars have an average of 60 observations in each band obtained over a decade along Stripe 82 (S82), whereas the remaining ∼25,000 have 2-3 observations due to scan overlaps. The observed time lags span the range from a day to almost 10 years, and constrain quasar variability at rest-frame time lags of up to 4 years, and at rest-frame wavelengths from 1000 Å to 6000 Å. We publicly release a user-friendly catalog of quasars from the SDSS Data Release 7 that have been observed at least twice in SDSS or once in both SDSS and the Palomar Observatory Sky Survey, and we use it to analyze the ensemble properties of quasar variability. Based on a damped random walk (DRW) model defined by a characteristic timescale and an asymptotic variability amplitude that scale with the luminosity, black hole mass, and rest wavelength for individual quasars calibrated in S82, we can fully explain the ensemble variability statistics of the non-S82 quasars such as the exponential distribution of large magnitude changes. All available data are consistent with the DRW model as a viable description of the optical continuum variability of quasars on timescales of ∼5-2000 days in the rest frame. We use these models to predict the incidence of quasar contamination in transient surveys such as those from the Palomar Transient Factory and Large Synoptic Survey Telescope.

  3. Generalized approach to modifying optical vortices with suppressed sidelobes using Bessel-like functions.

    Science.gov (United States)

    Chen, J; Yuan, X-C; Zhao, X; Fang, Z L; Zhu, S W

    2009-11-01

    We propose a generalized approach to producing optical vortices with suppressed sidelobes using a variable Bessel-like function added to the conventional spiral phase plate. Experimental verifications are implemented by a phase-only spatial light modulator. It is demonstrated that the method is valid for optical vortex beams with arbitrary topological charges and without changing the primary ring size as a unique property among the existing techniques.

  4. Continuous-variable protocol for oblivious transfer in the noisy-storage model

    DEFF Research Database (Denmark)

    Furrer, Fabian; Gehring, Tobias; Schaffner, Christian

    2018-01-01

    for oblivious transfer for optical continuous-variable systems, and prove its security in the noisy-storage model. This model allows us to establish security by sending more quantum signals than an attacker can reliably store during the protocol. The security proof is based on uncertainty relations which we...... derive for continuous-variable systems, that differ from the ones used in quantum key distribution. We experimentally demonstrate in a proof-of-principle experiment the proposed oblivious transfer protocol for various channel losses by using entangled two-mode squeezed states measured with balanced...

  5. Spectral Data Captures Important Variability Between and Among Species and Functional Types

    Science.gov (United States)

    Townsend, P. A.; Serbin, S. P.; Kingdon, C.; Singh, A.; Couture, J. J.; Gamon, J. A.

    2013-12-01

    Narrowband spectral data in the visible, near and shortwave infrared (400-2500 nm) are being used increasingly in plant ecology to characterize the biochemical, physiological and water status of vegetation, as well as community composition. In particular, spectroscopic data have recently received considerable attention for their capacity to discriminate plants according to functional properties or 'optical types.' Such measurements can be acquired from airborne/satellite remote sensing imagery or field spectrometers and are commonly used to directly estimate or infer properties important to photosynthesis, carbon and water fluxes, nutrient dynamics, phenology, and disturbance. Spectral data therefore represent proxies for measurements that are otherwise time consuming or expensive to make, and - more importantly - provide the opportunity to characterize the spatial and temporal variability of taxonomic or functional groups. We have found that spectral variation within species and functional types can in fact exceed the variation between types. As such, we recommend that the traditional quantification of characteristics defining species and/or functional types must be modified to include the range of variability in those properties. We provide four examples of the importance of spectral data for describing within-species/functional type variation. First, within temperate forests, the spectral properties of foliage vary considerably with canopy position. This variability is strongly related to differences in specific leaf area between shade- and sun-lit leaves, and the resulting differences among leaves in strategies for light harvesting, photosynthesis, and leaf longevity. These results point to the need to better characterize leaf optical properties throughout a canopy, rather than basing the characterization of ecosystem functioning on only the sunlit portion of the canopy crown. Second, we show considerable differences in optical properties of foliage from

  6. ROTSE All-Sky Surveys for Variable Stars. I. Test Fields

    International Nuclear Information System (INIS)

    Akerlof, C.; Amrose, S.; Balsano, R.; Bloch, J.; Casperson, D.; Fletcher, S.; Gisler, G.; Hills, J.; Kehoe, R.; Lee, B.

    2000-01-01

    The Robotic Optical Transient Search Experiment I (ROTSE-I) experiment has generated CCD photometry for the entire northern sky in two epochs nightly since 1998 March. These sky patrol data are a powerful resource for studies of astrophysical transients. As a demonstration project, we present first results of a search for periodic variable stars derived from ROTSE-I observations. Variable identification, period determination, and type classification are conducted via automatic algorithms. In a set of nine ROTSE-I sky patrol fields covering roughly 2000 deg2, we identify 1781 periodic variable stars with mean magnitudes between m v = 10.0 and m v = 15.5. About 90% of these objects are newly identified as variable. Examples of many familiar types are presented. All classifications for this study have been manually confirmed. The selection criteria for this analysis have been conservatively defined and are known to be biased against some variable classes. This preliminary study includes only 5.6% of the total ROTSE-I sky coverage, suggesting that the full ROTSE-I variable catalog will include more than 32,000 periodic variable stars. (c) (c) 2000. The American Astronomical Society

  7. Photobiology of Symbiodinium revisited: bio-physical and bio-optical signatures

    Science.gov (United States)

    Hennige, S. J.; Suggett, D. J.; Warner, M. E.; McDougall, K. E.; Smith, D. J.

    2009-03-01

    Light is often the most abundant resource within the nutrient-poor waters surrounding coral reefs. Consequently, zooxanthellae ( Symbiodinium spp.) must continually photoacclimate to optimise productivity and ensure coral success. In situ coral photobiology is becoming dominated by routine assessments using state-of-the-art non-invasive bio-optical or chlorophyll a fluorescence (bio-physical) techniques. Multiple genetic types of Symbiodinium are now known to exist; however, little focus has been given as to how these types differ in terms of characteristics that are observable using these techniques. Therefore, this investigation aimed to revisit and expand upon a pivotal study by Iglesias-Prieto and Trench (1994) by comparing the photoacclimation characteristics of different Symbiodinium types based on their bio-physical (chlorophyll a fluorescence, reaction centre counts) and bio-optical (optical absorption, pigment concentrations) ‘signatures’. Signatures described here are unique to Symbiodinium type and describe phenotypic responses to set conditions, and hence are not suitable to describe taxonomic structure of in hospite Symbiodinium communities. In this study, eight Symbiodinium types from clades and sub-clades (A-B, F) were grown under two PFDs (Photon Flux Density) and examined. The photoacclimation response by Symbiodinium was highly variable between algal types for all bio-physical and for many bio-optical measurements; however, a general preference to modifying reaction centre content over effective antennae-absorption was observed. Certain bio-optically derived patterns, such as light absorption, were independent of algal type and, when considered per photosystem, were matched by reaction centre stoichiometry. Only by better understanding genotypic and phenotypic variability between Symbiodinium types can future studies account for the relative taxonomic and physiological contribution by Symbiodinium to coral acclimation.

  8. Energy-efficient routing, modulation and spectrum allocation in elastic optical networks

    Science.gov (United States)

    Tan, Yanxia; Gu, Rentao; Ji, Yuefeng

    2017-07-01

    With tremendous growth in bandwidth demand, energy consumption problem in elastic optical networks (EONs) becomes a hot topic with wide concern. The sliceable bandwidth-variable transponder in EON, which can transmit/receive multiple optical flows, was recently proposed to improve a transponder's flexibility and save energy. In this paper, energy-efficient routing, modulation and spectrum allocation (EE-RMSA) in EONs with sliceable bandwidth-variable transponder is studied. To decrease the energy consumption, we develop a Mixed Integer Linear Programming (MILP) model with corresponding EE-RMSA algorithm for EONs. The MILP model jointly considers the modulation format and optical grooming in the process of routing and spectrum allocation with the objective of minimizing the energy consumption. With the help of genetic operators, the EE-RMSA algorithm iteratively optimizes the feasible routing path, modulation format and spectrum resources solutions by explore the whole search space. In order to save energy, the optical-layer grooming strategy is designed to transmit the lightpath requests. Finally, simulation results verify that the proposed scheme is able to reduce the energy consumption of the network while maintaining the blocking probability (BP) performance compare with the existing First-Fit-KSP algorithm, Iterative Flipping algorithm and EAMGSP algorithm especially in large network topology. Our results also demonstrate that the proposed EE-RMSA algorithm achieves almost the same performance as MILP on an 8-node network.

  9. Bio-optical properties of coastal waters in the Eastern English Channel

    Science.gov (United States)

    Vantrepotte, Vincent; Brunet, Christophe; Mériaux, Xavier; Lécuyer, Eric; Vellucci, Vincenzo; Santer, Richard

    2007-03-01

    Strong tidal currents, shallow water and numerous freshwater inputs characterize the coastal waters of the eastern English Channel. These case 2 waters were investigated through an intensive sampling effort in 2000 aiming to study the distribution and variability of the Chromophoric Dissolved Organic Matter (CDOM), Non-Algal Particles (NAP) and phytoplankton absorption at the mesoscale. Four cruises were carried out in February, March, May and July and more than 80 stations each cruise were sampled for hydrographical, chemical and bio-optical analyses. Results showed two distinct situations, the winter period characterized by the strong dominance of CDOM absorption over the particulate matter, and the spring-summer period when phytoplankton and CDOM represented the same contribution. Meteorology was the main factor driving the bio-optical properties of the water column in winter whereas in spring-summer the biological activity seemed to be the more active driving force. The algal community composition in term of dominant cell size and, therefore pigment packaging, is the main factor driving the phytoplankton specific absorption in the water column. Photoprotective pigments did not significantly influence algal absorption, due to turbid and highly mixed water masses. This feature also explained the bio-optical homogeneity found along the water column. On the mesoscale, distinct bio-optical provinces were defined in relation with the observed bio-hydrographical variability.

  10. Challenges in constraining anthropogenic aerosol effects on cloud radiative forcing using present-day spatiotemporal variability.

    Science.gov (United States)

    Ghan, Steven; Wang, Minghuai; Zhang, Shipeng; Ferrachat, Sylvaine; Gettelman, Andrew; Griesfeller, Jan; Kipling, Zak; Lohmann, Ulrike; Morrison, Hugh; Neubauer, David; Partridge, Daniel G; Stier, Philip; Takemura, Toshihiko; Wang, Hailong; Zhang, Kai

    2016-05-24

    A large number of processes are involved in the chain from emissions of aerosol precursor gases and primary particles to impacts on cloud radiative forcing. Those processes are manifest in a number of relationships that can be expressed as factors dlnX/dlnY driving aerosol effects on cloud radiative forcing. These factors include the relationships between cloud condensation nuclei (CCN) concentration and emissions, droplet number and CCN concentration, cloud fraction and droplet number, cloud optical depth and droplet number, and cloud radiative forcing and cloud optical depth. The relationship between cloud optical depth and droplet number can be further decomposed into the sum of two terms involving the relationship of droplet effective radius and cloud liquid water path with droplet number. These relationships can be constrained using observations of recent spatial and temporal variability of these quantities. However, we are most interested in the radiative forcing since the preindustrial era. Because few relevant measurements are available from that era, relationships from recent variability have been assumed to be applicable to the preindustrial to present-day change. Our analysis of Aerosol Comparisons between Observations and Models (AeroCom) model simulations suggests that estimates of relationships from recent variability are poor constraints on relationships from anthropogenic change for some terms, with even the sign of some relationships differing in many regions. Proxies connecting recent spatial/temporal variability to anthropogenic change, or sustained measurements in regions where emissions have changed, are needed to constrain estimates of anthropogenic aerosol impacts on cloud radiative forcing.

  11. Optical Proxies for Terrestrial Dissolved Organic Matter in Estuaries and Coastal Waters

    Directory of Open Access Journals (Sweden)

    Christopher L. Osburn

    2016-01-01

    Full Text Available Optical proxies, especially DOM fluorescence, were used to track terrestrial DOM fluxes through estuaries and coastal waters by comparing models developed for several coastal ecosystems. Key to using optical properties is validating and calibrating them with chemical measurements, such as lignin-derived phenols - a proxy to quantify terrestrial DOM. Utilizing parallel factor analysis (PARAFAC, and comparing models statistically using the OpenFluor database (http://www.openfluor.org we have found common, ubiquitous fluorescing components which correlate most strongly with lignin phenol concentrations in several estuarine and coastal environments. Optical proxies for lignin were computed for the following regions: Mackenzie River Estuary, Atchafalaya River Estuary, Charleston Harbor, Chesapeake Bay, and Neuse River Estuary. The slope of linear regression models relating CDOM absorption at 350 nm (a350 to DOC and to lignin, varied 5 to 10 fold among systems. Where seasonal observations were available from a region, there were distinct seasonal differences in equation parameters for these optical proxies. Despite variability, overall models using single linear regression were developed that related dissolved organic carbon (DOC concentration to CDOM (DOC = 40×a350+138; R2 = 0.77; N = 130 and lignin (Σ8 to CDOM (Σ8 = 2.03×a350-0.5; R2 = 0.87; N = 130. This wide variability suggested that local or regional optical models should be developed for predicting terrestrial DOM flux into coastal oceans and taken into account when upscaling to remote sensing observations and calibrations.

  12. Entangling optical and microwave cavity modes by means of a nanomechanical resonator

    Energy Technology Data Exchange (ETDEWEB)

    Barzanjeh, Sh. [Department of Physics, Faculty of Science, University of Isfahan, Hezar Jerib, 81746-73441 Isfahan (Iran, Islamic Republic of); School of Science and Technology, Physics Division, Universita di Camerino, I-62032 Camerino, Macerata (Italy); Vitali, D.; Tombesi, P. [School of Science and Technology, Physics Division, Universita di Camerino, I-62032 Camerino, Macerata (Italy); Milburn, G. J. [Centre for Engineered Quantum Systems, School of Physical Sciences, University of Queensland, Saint Lucia, Queensland 4072 (Australia)

    2011-10-15

    We propose a scheme that is able to generate stationary continuous-variable entanglement between an optical and a microwave cavity mode by means of their common interaction with a nanomechanical resonator. We show that when both cavities are intensely driven, one can generate bipartite entanglement between any pair of the tripartite system, and that, due to entanglement sharing, optical-microwave entanglement is efficiently generated at the expense of microwave-mechanical and optomechanical entanglement.

  13. Entangling optical and microwave cavity modes by means of a nanomechanical resonator

    International Nuclear Information System (INIS)

    Barzanjeh, Sh.; Vitali, D.; Tombesi, P.; Milburn, G. J.

    2011-01-01

    We propose a scheme that is able to generate stationary continuous-variable entanglement between an optical and a microwave cavity mode by means of their common interaction with a nanomechanical resonator. We show that when both cavities are intensely driven, one can generate bipartite entanglement between any pair of the tripartite system, and that, due to entanglement sharing, optical-microwave entanglement is efficiently generated at the expense of microwave-mechanical and optomechanical entanglement.

  14. Development and applications of diffractive optical security devices for banknotes and high value documents

    Science.gov (United States)

    Drinkwater, John K.; Holmes, Brian W.; Jones, Keith A.

    2000-04-01

    Embossed holograms and othe rdiffractive optically variable devices are increasingly familiar security items on plastic cards, banknotes, securyt documetns and on branded gods and media to protect against counterfeit, protect copyright and to evidence tamper. This paper outlines some of the diffractive optical seuryt and printed security develoepd for this rapidly growing field and provides examles of some current security applications.

  15. Uncertainty in stratiform cloud optical thickness inferred from pyranometer measurements at the sea surface

    Directory of Open Access Journals (Sweden)

    Anna Rozwadowska

    2004-06-01

    Full Text Available The relative "plane-parallel" error in a mean cloud optical thickness retrieved from ground-based pyranometer measurements is estimated. The plane-parallel error is defined as the bias introduced by the assumption in the radiative transfer model used in cloud optical thickness retrievals that the atmosphere, including clouds, is horizontally homogeneous on the scale of an individual retrieval. The error is estimated for the optical thickness averaged over the whole domain, which simulates the mean cloud optical thickness obtained from a time series of irradiance measurements. The study is based on 3D Monte Carlo radiative transfer simulations for non-absorbing, all-liquid, layer clouds. Liquid water path distributions in the clouds are simulated by a bounded cascade fractal model. The sensitivity of the error is studied with respect to the following factors: averaging time of irradiance used in an individual retrieval, mean cloud optical thickness, cloud variability, cloud base height and solar zenith angle. In the simulations presented in this paper, the relative bias in the domain averaged cloud optical thickness retrieved from pyranometer measurements varies from +1% for optically thin clouds to nearly -20%. The highest absolute value of the relative bias is expected for thick and variable clouds with high bases (e.g. 1 km and retrievals based on long-term mean irradiances (averaging time of the order of several tens of minutes or hours. The bias can be diminished by using short-term irradiance averages, e.g. of one minute, and by limiting retrievals to low-level clouds.

  16. THE CHANDRA VARIABLE GUIDE STAR CATALOG

    International Nuclear Information System (INIS)

    Nichols, Joy S.; Lauer, Jennifer L.; Morgan, Douglas L.; Sundheim, Beth A.; Henden, Arne A.; Huenemoerder, David P.; Martin, Eric

    2010-01-01

    Variable stars have been identified among the optical-wavelength light curves of guide stars used for pointing control of the Chandra X-ray Observatory. We present a catalog of these variable stars along with their light curves and ancillary data. Variability was detected to a lower limit of 0.02 mag amplitude in the 4000-10000 A range using the photometrically stable Aspect Camera on board the Chandra spacecraft. The Chandra Variable Guide Star Catalog (VGUIDE) contains 827 stars, of which 586 are classified as definitely variable and 241 are identified as possibly variable. Of the 586 definite variable stars, we believe 319 are new variable star identifications. Types of variables in the catalog include eclipsing binaries, pulsating stars, and rotating stars. The variability was detected during the course of normal verification of each Chandra pointing and results from analysis of over 75,000 guide star light curves from the Chandra mission. The VGUIDE catalog represents data from only about 9 years of the Chandra mission. Future releases of VGUIDE will include newly identified variable guide stars as the mission proceeds. An important advantage of the use of space data to identify and analyze variable stars is the relatively long observations that are available. The Chandra orbit allows for observations up to 2 days in length. Also, guide stars were often used multiple times for Chandra observations, so many of the stars in the VGUIDE catalog have multiple light curves available from various times in the mission. The catalog is presented as both online data associated with this paper and as a public Web interface. Light curves with data at the instrumental time resolution of about 2 s, overplotted with the data binned at 1 ks, can be viewed on the public Web interface and downloaded for further analysis. VGUIDE is a unique project using data collected during the mission that would otherwise be ignored. The stars available for use as Chandra guide stars are

  17. Integration and application of optical chemical sensors in microbioreactors.

    Science.gov (United States)

    Gruber, Pia; Marques, Marco P C; Szita, Nicolas; Mayr, Torsten

    2017-08-08

    The quantification of key variables such as oxygen, pH, carbon dioxide, glucose, and temperature provides essential information for biological and biotechnological applications and their development. Microfluidic devices offer an opportunity to accelerate research and development in these areas due to their small scale, and the fine control over the microenvironment, provided that these key variables can be measured. Optical sensors are well-suited for this task. They offer non-invasive and non-destructive monitoring of the mentioned variables, and the establishment of time-course profiles without the need for sampling from the microfluidic devices. They can also be implemented in larger systems, facilitating cross-scale comparison of analytical data. This tutorial review presents an overview of the optical sensors and their technology, with a view to support current and potential new users in microfluidics and biotechnology in the implementation of such sensors. It introduces the benefits and challenges of sensor integration, including, their application for microbioreactors. Sensor formats, integration methods, device bonding options, and monitoring options are explained. Luminescent sensors for oxygen, pH, carbon dioxide, glucose and temperature are showcased. Areas where further development is needed are highlighted with the intent to guide future development efforts towards analytes for which reliable, stable, or easily integrated detection methods are not yet available.

  18. Line Shape Variability in a Sample of AGN with Broad Lines

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... We give here a comparative review of the line shape variability in a sample of five type 1 AGNs, those with broad emission lines in their spectra, of the data obtained from the international long-term optical monitoring campaign coordinated by the Special Astrophysical Observatory of the Russian Academy ...

  19. Applied optics and optical design

    CERN Document Server

    Conrady, Alexander Eugen

    1957-01-01

    ""For the optical engineer it is an indispensable work."" - Journal, Optical Society of America""As a practical guide this book has no rival."" - Transactions, Optical Society""A noteworthy contribution,"" - Nature (London)Part I covers all ordinary ray-tracing methods, together with the complete theory of primary aberrations and as much of higher aberration as is needed for the design of telescopes, low-power microscopes and simple optical systems. Chapters: Fundamental Equations, Spherical Aberration, Physical Aspect of Optical Images, Chromatic Aberration, Design of Achromatic Object-Glass

  20. The GRB variability/peak luminosity correlation: new results

    International Nuclear Information System (INIS)

    Guidorzi, C.; Rossi, F.; Hurley, K.; Mundell, C.G.

    2005-01-01

    We test the correlation between time variability and isotropic-equivalent peak luminosity found by Reichart et al. (ApJ, 552 (2001) 57) using a set of 26 Gamma-Ray Bursts (GRBs) with known redshift. We confirm the correlation, thought with a larger spread around the best-fit power-law obtained by Reichart et al. which in turn does not provide an acceptable description any longer. In addiction, we find no evidence for correlation between variability and beaming-corrected peak luminosity for a subset of 14 GRBs whose beaming angles have been taken from Ghirlanda et al. (ApJ, 616 (2004) 331). Finally, we investigate the possible connection for some GRBs between the location in the variability/peak luminosity space and some afterglow properties, such as the detectability in the optical band, by adding some GRBs whose redshifts, unknown from direct measurements, have been derived assuming the Amati at al. (AeA, 390 (2002) 81) relationship

  1. 3D flow visualizations by means of laser beam sweeps

    International Nuclear Information System (INIS)

    Prenel, J.P.; Porcar, R.; Diemunsch, G.

    1987-01-01

    A method in which two-dimensional aperiodic or periodic sweeps are used to produce three-dimensional light sweeps makes possible the quasi-simultaneous recording of different specific planes of a flow, or the characterization of a fluid without revolution symmetry. The optical device consists of two scanners (whose axes are orthogonal) set into a telescope, allowing fine focusing of the light sheets in the study zone. The method also allows visualizations on skewed surfaces, particularly those of flows without a cylindrical geometry; it is applicable from low velocity, as in heat convection, to supersonic velocity, as in the analysis of a nonaxisymmetric ejector. 8 references

  2. Aerosol climatology using a tunable spectral variability cloud screening of AERONET data

    Science.gov (United States)

    Kaufman, Yoram J.; Gobbi, Gian Paolo; Koren, Ilan

    2005-01-01

    Can cloud screening of an aerosol data set, affect the aerosol optical thickness (AOT) climatology? Aerosols, humidity and clouds are correlated. Therefore, rigorous cloud screening can systematically bias towards less cloudy conditions, underestimating the average AOT. Here, using AERONET data we show that systematic rejection of variable atmospheric optical conditions can generate such bias in the average AOT. Therefore we recommend (1) to introduce more powerful spectral variability cloud screening and (2) to change the philosophy behind present aerosol climatologies: Instead of systematically rejecting all cloud contaminations, we suggest to intentionally allow the presence of cloud contamination, estimate the statistical impact of the contamination and correct for it. The analysis, applied to 10 AERONET stations with approx. 4 years of data, shows almost no change for Rome (Italy), but up to a change in AOT of 0.12 in Beijing (PRC). Similar technique may be explored for satellite analysis, e.g. MODIS.

  3. Simulation studies on the effect of positioning tolerances on optical coupling efficiency

    Science.gov (United States)

    Pamidighantam, Ramana V.; Yeo, Yongkee; Sudharsanam, Krishnamachari; Lee, Sik Pong; Iyer, Mahadevan K.

    2002-08-01

    The development of Optoelectronic components for communications is converging towards access networks where device cost makes a significant impact on the market acceptance. Thus, the device design engineer needs to input assembly, fabrication and process constraints into the design at an early stage. The present study is part of a Project on Packaging of Optical Components that IME, Singapore has initiated as part of an ongoing Electronics Packaging Research Consortium with industry partnership. In the present study, the coupling of optical radiation from a laser diode to optical fiber is simulated for a fiber optic transmitter component development project. Different optical configurations based on direct coupling, spherical ball lenses, integral lensed fibers and thermally expanded fibers are created within the commercially available transmitter package space. The effect of optical element variables on the placement tolerance is analyzed and will be reported. The effect of alignment tolerances on the optical coupling is analyzed. Simulation results are presented recommending realizable alignment and placement tolerances to develop a low cost short range link distance transmitter.

  4. Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates

    Science.gov (United States)

    Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.

    2017-10-01

    For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.

  5. The possibilities of CCD photometry of optical afterglows of GRBs

    Czech Academy of Sciences Publication Activity Database

    Šimon, Vojtěch; Polášek, Cyril; Jelínek, M.; Hudec, René; Štrobl, Jan

    -, č. 125 (2010), s. 24-28 ISSN 1801-5964. [Conference on Variable Stars Research /41./. Prague, 27.11.2009-29.11.2009] Institutional research plan: CEZ:AV0Z10030501 Keywords : gamma-ray bursts * optical afterglows * CCD photometry Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  6. Charactering lidar optical subsystem using four quadrants method

    Science.gov (United States)

    Tian, Xiaomin; Liu, Dong; Xu, Jiwei; Wang, Zhenzhu; Wang, Bangxin; Wu, Decheng; Zhong, Zhiqing; Xie, Chenbo; Wang, Yingjian

    2018-02-01

    Lidar is a kind of active optical remote sensing instruments , can be applied to sound atmosphere with a high spatial and temporal resolution. Many parameter of atmosphere can be get by using different inverse algorithm with lidar backscatter signal. The basic setup of a lidar consist of a transmitter and a receiver. To make sure the quality of lidar signal data, the lidar must be calibrated before being used to measure the atmospheric variables. It is really significant to character and analyze lidar optical subsystem because a well equiped lidar optical subsystem contributes to high quality lidar signal data. we pay close attention to telecover test to character and analyze lidar optical subsystem.The telecover test is called four quadrants method consisting in dividing the telescope aperture in four quarants. when a lidar is well configured with lidar optical subsystem, the normalized signal from four qudrants will agree with each other on some level. Testing our WARL-II lidar by four quadrants method ,we find the signals of the four basically consistent with each other both in near range and in far range. But in detail, the signals in near range have some slight distinctions resulting from overlap function, some signals distinctions are induced by atmospheric instability.

  7. Absorptive and dispersive optical profiles in fluctuating environments: A stochastic model

    International Nuclear Information System (INIS)

    Paz, J.L.; Mendoza-Garcia, A.; Mastrodomenico, A.

    2011-01-01

    In this study, we determined the absorptive and dispersive optical profiles of a molecular system coupled with a thermal bath. Solvent effects were explicitly considered by modelling the non-radiative interaction with the solute as a random variable. The optical stochastical Bloch equations (OSBE) were solved using a time-ordered cumulant expansion with white noise as a correlation function. We found a solution for the Fourier component of coherence at the third order of perturbation for the nonlinear Four-wave mixing signal and produced analytical expressions for the optical responses of the system. Finally, we examined the behaviour of these properties with respect to the noise parameter, frequency detuning of the dynamic perturbation, and relaxation times.

  8. Exploring the Variable Sky with the Sloan Digital Sky Survey

    Energy Technology Data Exchange (ETDEWEB)

    Sesar, Branimir; Ivezic, Zeljko; Lupton, Robert; Juric, Mario; Gunn, James; Knapp, Gillian; De Lee, Nathan; Smith, J. Allyn; Miknaitis,Gajus; Lin, Huan; Tucker, Douglas; Doi, Mamoru; Tanaka, Masayuki; Fukugita, Masataka; Holtzman, Jon; Kent, Steve; Yanny, Brian; Schlegel,David; Finkbeiner, Douglas; Padmanabhan, Nikhil; Rockosi, Constance; Bond, Nicholas; Lee, Brian; Stoughton, Chris; Jester, Sebastian; Harris,Hugh; Harding, Paul; Brinkmann, Jon; Schneider, Donald; York, Donald; Richmond, Michael; Vanden Berk, Daniel

    2007-04-01

    We quantify the variability of faint unresolved optical sources using a catalog based on multiple SDSS imaging observations. The catalog covers SDSS Stripe 82, which lies along the celestial equator in the Southern Galactic Hemisphere (22h 24m < {alpha}{sub J2000} < 04h 08m, -1.27{sup o} < {delta}{sub J2000} < +1.27{sup o}, {approx} 290 deg{sup 2}), and contains 58 million photometric observations in the SDSS ugriz system for 1.4 million unresolved sources that were observed at least 4 times in each of the gri bands (with a median of 10 observations obtained over {approx}5 years). In each photometric bandpass we compute various low-order lightcurve statistics such as root-mean-square scatter (rms), {chi}{sup 2} per degree of freedom, skewness, minimum and maximum magnitude, and use them to select and study variable sources. We find that 2% of unresolved optical sources brighter than g = 20.5 appear variable at the 0.05 mag level (rms) simultaneously in the g and r bands. The majority (2/3) of these variable sources are low-redshift (< 2) quasars, although they represent only 2% of all sources in the adopted flux-limited sample. We find that at least 90% of quasars are variable at the 0.03 mag level (rms) and confirm that variability is as good a method for finding low-redshift quasars as is the UV excess color selection (at high Galactic latitudes). We analyze the distribution of lightcurve skewness for quasars and find that is centered on zero. We find that about 1/4 of the variable stars are RR Lyrae stars, and that only 0.5% of stars from the main stellar locus are variable at the 0.05 mag level. The distribution of lightcurve skewness in the g-r vs. u-g color-color diagram on the main stellar locus is found to be bimodal (with one mode consistent with Algol-like behavior). Using over six hundred RR Lyrae stars, we demonstrate rich halo substructure out to distances of 100 kpc. We extrapolate these results to expected performance by the Large Synoptic Survey

  9. Optical image reconstruction using DC data: simulations and experiments

    International Nuclear Information System (INIS)

    Huabei Jiang; Paulsen, K.D.; Oesterberg, U.L.

    1996-01-01

    In this paper, we explore optical image formation using a diffusion approximation of light propagation in tissue which is modelled with a finite-element method for optically heterogeneous media. We demonstrate successful image reconstruction based on absolute experimental DC data obtained with a continuous wave 633 nm He-Ne laser system and a 751 nm diode laser system in laboratory phantoms having two optically distinct regions. The experimental systems used exploit a tomographic type of data collection scheme that provides information from which a spatially variable optical property map is deduced. Reconstruction of scattering coefficient only and simultaneous reconstruction of both scattering and absorption profiles in tissue-like phantoms are obtained from measured and simulated data. Images with different contrast levels between the heterogeneity and the background are also reported and the results show that although it is possible to obtain qualitative visual information on the location and size of a heterogeneity, it may not be possible to quantitatively resolve contrast levels or optical properties using reconstructions from DC data only. Sensitivity of image reconstruction to noise in the measurement data is investigated through simulations. The application of boundary constraints has also been addressed. (author)

  10. TIME VARIABILITY OF EMISSION LINES FOR FOUR ACTIVE T TAURI STARS. I. OCTOBER-DECEMBER IN 2010

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Mei-Yin; Takami, Michihiro; Karr, Jennifer L.; Shang Hsien; Liu, Hauyu Baobab [Institute of Astronomy and Astrophysics, Academia Sinica, P.O. Box 23-141, Taipei 10617, Taiwan (China); Manset, Nadine [Canada-France-Hawaii Telescope, 65-1238 Mamalahoa Hwy, Kamuela, HI 96743 (United States); Beck, Tracy [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Pyo, Tae-Soo [Subaru Telescope, 650 North Aohoku Place, Hilo, HI 96720 (United States); Chen, Wen-Ping; Panwar, Neelam [Institute of Astronomy, National Central University, Taoyuan County 32001, Taiwan (China)

    2013-04-15

    We present optical spectrophotometric monitoring of four active T Tauri stars (DG Tau, RY Tau, XZ Tau, RW Aur A) at high spectral resolution (R {approx}> 1 Multiplication-Sign 10{sup 4}), to investigate the correlation between time variable mass ejection seen in the jet/wind structure of the driving source and time variable mass accretion probed by optical emission lines. This may allow us to constrain the understanding of the jet/wind launching mechanism, the location of the launching region, and the physical link with magnetospheric mass accretion. In 2010, observations were made at six different epochs to investigate how daily and monthly variability might affect such a study. We perform comparisons between the line profiles we observed and those in the literature over a period of decades and confirm the presence of time variability separate from the daily and monthly variability during our observations. This is so far consistent with the idea that these line profiles have a long-term variability (3-20 yr) related to episodic mass ejection suggested by the structures in the extended flow components. We also investigate the correlations between equivalent widths and between luminosities for different lines. We find that these correlations are consistent with the present paradigm of steady magnetospheric mass accretion and emission line regions that are close to the star.

  11. TIME VARIABILITY OF EMISSION LINES FOR FOUR ACTIVE T TAURI STARS. I. OCTOBER–DECEMBER IN 2010

    International Nuclear Information System (INIS)

    Chou, Mei-Yin; Takami, Michihiro; Karr, Jennifer L.; Shang Hsien; Liu, Hauyu Baobab; Manset, Nadine; Beck, Tracy; Pyo, Tae-Soo; Chen, Wen-Ping; Panwar, Neelam

    2013-01-01

    We present optical spectrophotometric monitoring of four active T Tauri stars (DG Tau, RY Tau, XZ Tau, RW Aur A) at high spectral resolution (R ∼> 1 × 10 4 ), to investigate the correlation between time variable mass ejection seen in the jet/wind structure of the driving source and time variable mass accretion probed by optical emission lines. This may allow us to constrain the understanding of the jet/wind launching mechanism, the location of the launching region, and the physical link with magnetospheric mass accretion. In 2010, observations were made at six different epochs to investigate how daily and monthly variability might affect such a study. We perform comparisons between the line profiles we observed and those in the literature over a period of decades and confirm the presence of time variability separate from the daily and monthly variability during our observations. This is so far consistent with the idea that these line profiles have a long-term variability (3-20 yr) related to episodic mass ejection suggested by the structures in the extended flow components. We also investigate the correlations between equivalent widths and between luminosities for different lines. We find that these correlations are consistent with the present paradigm of steady magnetospheric mass accretion and emission line regions that are close to the star.

  12. Mid-infrared Variability of Changing-look AGNs

    International Nuclear Information System (INIS)

    Sheng, Zhenfeng; Wang, Tinggui; Jiang, Ning; Yang, Chenwei; Peng, Bo; Yan, Lin; Dou, Liming

    2017-01-01

    It is known that some active galactic nuclei (AGNs) transit from Type 1 to Type 2 or vice versa. There are two explanations for the so-called changing-look AGNs: one is the dramatic change of the obscuration along the line of sight, and the other is the variation of accretion rate. In this Letter, we report the detection of large amplitude variations in the mid-infrared luminosity during the transitions in 10 changing-look AGNs using the Wide-field Infrared Survey Explorer ( WISE ) and newly released Near-Earth Object WISE Reactivation data. The mid-infrared light curves of 10 objects echo the variability in the optical band with a time lag expected for dust reprocessing. The large variability amplitude is inconsistent with the scenario of varying obscuration, rather it supports the scheme of dramatic change in the accretion rate.

  13. Mid-infrared Variability of Changing-look AGNs

    Energy Technology Data Exchange (ETDEWEB)

    Sheng, Zhenfeng; Wang, Tinggui; Jiang, Ning; Yang, Chenwei; Peng, Bo [CAS Key Laboratory for Researches in Galaxies and Cosmology, University of Sciences and Technology of China, Hefei, Anhui 230026 (China); Yan, Lin [Caltech Optical Observatories, Cahill Center for Astronomy and Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Dou, Liming, E-mail: shengzf@mail.ustc.edu.cn, E-mail: twang@ustc.edu.cn [Center for Astrophysics, Guangzhou University, Guangzhou 510006 (China)

    2017-09-01

    It is known that some active galactic nuclei (AGNs) transit from Type 1 to Type 2 or vice versa. There are two explanations for the so-called changing-look AGNs: one is the dramatic change of the obscuration along the line of sight, and the other is the variation of accretion rate. In this Letter, we report the detection of large amplitude variations in the mid-infrared luminosity during the transitions in 10 changing-look AGNs using the Wide-field Infrared Survey Explorer ( WISE ) and newly released Near-Earth Object WISE Reactivation data. The mid-infrared light curves of 10 objects echo the variability in the optical band with a time lag expected for dust reprocessing. The large variability amplitude is inconsistent with the scenario of varying obscuration, rather it supports the scheme of dramatic change in the accretion rate.

  14. Asynchronous sampled-data approach for event-triggered systems

    Science.gov (United States)

    Mahmoud, Magdi S.; Memon, Azhar M.

    2017-11-01

    While aperiodically triggered network control systems save a considerable amount of communication bandwidth, they also pose challenges such as coupling between control and event-condition design, optimisation of the available resources such as control, communication and computation power, and time-delays due to computation and communication network. With this motivation, the paper presents separate designs of control and event-triggering mechanism, thus simplifying the overall analysis, asynchronous linear quadratic Gaussian controller which tackles delays and aperiodic nature of transmissions, and a novel event mechanism which compares the cost of the aperiodic system against a reference periodic implementation. The proposed scheme is simulated on a linearised wind turbine model for pitch angle control and the results show significant improvement against the periodic counterpart.

  15. Dispersion properties of Kolakoski-cladding hollow-core nanophotonic Bragg waveguide

    Directory of Open Access Journals (Sweden)

    Fesenko Volodymyr I.

    2016-09-01

    Full Text Available A comprehensive analysis of guided modes of a novel type of a planar Bragg reflection waveguide that consists of a low refractive index guiding layer sandwiched between two finite aperiodic mirrors is presented. The layers in the mirrors are aperiodically arranged according to the Kolakoski substitution rule. In such a waveguide, light is confined inside the core by Bragg reflection, while dispersion characteristics of guided modes strongly depend on aperiodicity of the cladding. Using the transfer matrix formalism bandgap conditions, dispersion characteristics and mode profiles of the guided modes of such a waveguide are studied on the GaAs/AlAs and Si/SiO2 epitaxial platforms, which are compatible with hybrid and heteroepitaxial frameworks of silicon photonics.

  16. Effect of nanoclay on optical properties of PLA/clay composite films

    CSIR Research Space (South Africa)

    Cele, HM

    2014-06-01

    Full Text Available function of the clay loading. The optical properties of the PLA/OMMT composites were studied using variable angle spectroscopic ellipsometry (VASE) and ultra-violet (UV-Vis) spectroscopy. VASE revealed that the refractive index and extinction coefficient (n...

  17. Retinal Nerve Fiber Layer Protrusion Associated with Tilted Optic Discs.

    Science.gov (United States)

    Chiang, Jaclyn; Yapp, Michael; Ly, Angelica; Hennessy, Michael P; Kalloniatis, Michael; Zangerl, Barbara

    2018-03-01

    This study resulted in the identification of an optic nerve head (ONH) feature associated with tilted optic discs, which might potentially contribute to ONH pathologies. Knowledge of such findings will enhance clinical insights and drive future opportunities to understand disease processes related to tilted optic discs. The aim of this study was to identify novel retinal nerve fiber layer (RNFL) anomalies by evaluating tilted optic discs using optical coherence tomography. An observed retinal nerve fiber protrusion was further investigated for association with other morphological or functional parameters. A retrospective review of 400 randomly selected adult patients with ONH examinations was conducted in a referral-only, diagnostic imaging center. After excluding other ONH pathologies, 215 patients were enrolled and evaluated for optic disc tilt and/or torsion. Gross anatomical ONH features, including size and rim or parapapillary region elevation, were assessed with stereoscopic fundus photography. Optical coherence tomography provided detailed morphological information of individual retinal layers. Statistical analysis was applied to identify significant changes between individual patient cohorts. A dome-shaped hyperreflective RNFL bulge, protruding into the neurosensory retina at the optic disc margins, was identified in 17 eyes with tilted optic discs. Available follow-up data were inconclusive regarding natural changes with this ONH feature. This RNFL herniation was significantly correlated with smaller than average optic disc size (P = .005), congenital disc tilt (P optic discs, which has not previously been assessed as an independent ONH structure. The feature is predominantly related to congenital crowded, small optic discs and variable between patients. This study is an important first step to elucidate diagnostic capabilities of tilted disc morphological changes and understanding associated functional deficits.

  18. Regional impacts of ocean color on tropical Pacific variability

    Directory of Open Access Journals (Sweden)

    W. Anderson

    2009-08-01

    Full Text Available The role of the penetration length scale of shortwave radiation into the surface ocean and its impact on tropical Pacific variability is investigated with a fully coupled ocean, atmosphere, land and ice model. Previous work has shown that removal of all ocean color results in a system that tends strongly towards an El Niño state. Results from a suite of surface chlorophyll perturbation experiments show that the mean state and variability of the tropical Pacific is highly sensitive to the concentration and distribution of ocean chlorophyll. Setting the near-oligotrophic regions to contain optically pure water warms the mean state and suppresses variability in the western tropical Pacific. Doing the same above the shadow zones of the tropical Pacific also warms the mean state but enhances the variability. It is shown that increasing penetration can both deepen the pycnocline (which tends to damp El Niño while shifting the mean circulation so that the wind response to temperature changes is altered. Depending on what region is involved this change in the wind stress can either strengthen or weaken ENSO variability.

  19. Optical Array Processor: Laboratory Results

    Science.gov (United States)

    Casasent, David; Jackson, James; Vaerewyck, Gerard

    1987-01-01

    A Space Integrating (SI) Optical Linear Algebra Processor (OLAP) is described and laboratory results on its performance in several practical engineering problems are presented. The applications include its use in the solution of a nonlinear matrix equation for optimal control and a parabolic Partial Differential Equation (PDE), the transient diffusion equation with two spatial variables. Frequency-multiplexed, analog and high accuracy non-base-two data encoding are used and discussed. A multi-processor OLAP architecture is described and partitioning and data flow issues are addressed.

  20. Acquisition and tracking for underwater optical communications

    Science.gov (United States)

    Williams, Andrew J.; Laycock, Leslie L.; Griffith, Michael S.; McCarthy, Andrew G.; Rowe, Duncan P.

    2017-10-01

    There is a growing requirement to transfer large volumes of data between underwater platforms. As seawater is transmissive in the visible band, underwater optical communications is an active area of interest since it offers the potential for power efficient, covert and high bandwidth datalinks at short to medium ranges. Short range systems have been successfully demonstrated using sources with low directionality. To realise higher data rates and/or longer ranges, the use of more efficient directional beams is required; by necessity, these must be sufficiently aligned to achieve the required link margin. For mobile platforms, the acquisition and tracking of each node is therefore critical in order to establish and maintain an optical datalink. This paper describes work undertaken to demonstrate acquisition and tracking in a 3D underwater environment. A range of optical sources, beam steering technologies, and tracking sensors have been assessed for suitability. A novel scanning strategy exploiting variable beam divergence was developed to provide robust acquisition whilst minimising acquisition time. A prototype system was assembled and demonstrated in a large water tank. This utilised custom quadrant detectors based on Silicon PhotoMultiplier (SiPM) arrays for fine tracking, and a Wide Field of View (WFoV) sCMOS camera for link acquisition. Fluidic lenses provided dynamic control of beam divergence, and AC modulation/filtering enabled background rejection. The system successfully demonstrated robust optical acquisition and tracking between two nodes with only nanowatt received optical powers. The acquisition time was shown to be dependent on the initial conditions and the transmitted optical power.

  1. Revisiting Bragg's X-ray microscope: scatter based optical transient grating detection of pulsed ionising radiation.

    Science.gov (United States)

    Fullagar, Wilfred K; Paganin, David M; Hall, Chris J

    2011-06-01

    Transient optical gratings for detecting ultrafast signals are routine for temporally resolved photochemical investigations. Many processes can contribute to the formation of such gratings; we indicate use of optically scattering centres that can be formed with highly variable latencies in different materials and devices using ionising radiation. Coherent light scattered by these centres can form the short-wavelength-to-optical-wavelength, incoherent-to-coherent basis of a Bragg X-ray microscope, with inherent scope for optical phasing. Depending on the dynamics of the medium chosen, the way is open to both ultrafast pulsed and integrating measurements. For experiments employing brief pulses, we discuss high-dynamic-range short-wavelength diffraction measurements with real-time optical reconstructions. Applications to optical real-time X-ray phase-retrieval are considered. Copyright © 2010 Elsevier B.V. All rights reserved.

  2. Optical properties of cells with melanin

    Science.gov (United States)

    Rohde, Barukh; Coats, Israel; Krueger, James; Gareau, Dan

    2014-02-01

    The optical properties of pigmented lesions have been studied using diffuse reflectance spectroscopy in a noninvasive configuration on optically thick samples such as skin in vivo. However, it is difficult to un-mix the effects of absorption and scattering with diffuse reflectance spectroscopy techniques due to the complex anatomical distributions of absorbing and scattering biomolecules. We present a device and technique that enables absorption and scattering measurements of tissue volumes much smaller than the optical mean-free path. Because these measurements are taken on fresh-frozen sections, they are direct measurements of the optical properties of tissue, albeit in a different hydration state than in vivo tissue. Our results on lesions from 20 patients including melanomas and nevi show the absorption spectrum of melanin in melanocytes and basal keratinocytes. Our samples consisted of fresh frozen sections that were unstained. Fitting the spectrum as an exponential decay between 500 and 1100 nm [mua = A*exp(-B*(lambda-C)) + D], we report on the fit parameters of and their variation due to biological heterogeneity as A = 4.20e4 +/- 1.57e5 [1/cm], B = 4.57e-3 +/- 1.62e-3 [1/nm], C = 210 +/- 510 [nm] , D = 613 +/- 534 [1/cm]. The variability in these results is likely due to highly heterogeneous distributions of eumelanin and pheomelanin.

  3. Clinical manifestations of optic pit maculopathy as demonstrated by spectral domain optical coherence tomography.

    Science.gov (United States)

    Tzu, Jonathan H; Flynn, Harry W; Berrocal, Audina M; Smiddy, William E; Murray, Timothy G; Fisher, Yale L

    2013-01-01

    The purpose of this retrospective study was to evaluate the characteristic features, including spectral-domain optical coherence tomography (SD-OCT), clinical course, and outcome of treatment if given for patients with optic disc pit maculopathy. We investigated a consecutive series of patients with a diagnosis of optic pit maculopathy treated between 2001 and 2012 at the Bascom Palmer Eye Institute. Patients were divided into two main groups, ie, patients who were observed without surgery and patients who received surgical intervention. The main outcome measures were presenting and final visual acuity, and changes in SD-OCT imaging were recorded. Other data including age, gender, eye, age of onset, length of follow-up, location of optic pit, and location of fluid by OCT were also recorded. On OCT, 67% (12/18) of the eyes showed schisis-like cavities, 22% (4/18) had only subretinal fluid, and 17% (3/18) had only a schisis-like cavity without subretinal fluid. In the patients managed by observation, visual acuity was ≥20/200 in 6/8 eyes initially and 6/8 eyes at last follow-up. Ten of 18 patients received either focal laser, surgery or both. Six of 10 eyes undergoing surgery had initial visual acuity ≥ 20/200, and 8 of 10 eyes undergoing surgery had a visual acuity of ≥20/200 at last follow-up. In this study, many eyes were observed and remained stable during follow-up. In eyes with reduced vision, surgical intervention produced variable outcomes, and persistent intraretinal/subretinal fluid was a common occurrence.

  4. Optical MEMS: boom, bust and beyond

    Science.gov (United States)

    Ramani, Chandra Mouli

    2005-10-01

    Optical Telecommunications bandwidth, spurred by the growth of the internet, experienced unprecedented growth in the late 1990's. The creation of new enterprises was vast and the expansion of established component, system and services companies was also breathtaking. This period of speculative growth was followed in 2001-2004 by one of the most significant market crashes in history. While $20B of venture capital was invested in optical telecom in the last 10 years, the vast majority of that has been written off in the last four. Countless start-ups inaugurated with great fanfare at the end of the 20th century were unceremoniously shut down at the start of the 21st. (1) As in all speculative bubbles, innovative technologies were born and buried. Nonetheless, new capabilities emerge from the chaos and disruption; one such example is the advent of Optical MEMS (MOEMS). Its development was vigorously pursued in both academic and corporate laboratories during the boom and, in the author's view; MOEMS constitutes a powerful and versatile tool set that is an invaluable residual of the last few years. In Telecommunications, MOEMS has proven to be the technology of choice for many optical switching and wavelength management applications. (2) Variable Optical Attenuators (VOA), Wavelength Blockers (WB), Dynamic Gain Equalizers (DGE), and most recently Wavelength Selective Switches (WSS) are being used in the numerous recent network deployments. Moreover, agile networks of the future will have MOEMS at every node. This presentation will provide an overview of the history of MOEMS in Telecommunications, discuss its byproducts and project the future of the technology.

  5. OPTICAL PROPERTIES OF THE ULTRALUMINOUS X-RAY SOURCE HOLMBERG IX X-1 AND ITS STELLAR ENVIRONMENT

    International Nuclear Information System (INIS)

    Grise, F.; Kaaret, P.; Pakull, M. W.; Motch, C.

    2011-01-01

    Holmberg IX X-1 is an archetypal ultraluminous X-ray source (ULX). Here we study the properties of the optical counterpart and of its stellar environment using optical data from SUBARU/Faint Object Camera and Spectrograph, GEMINI/GMOS-N and Hubble Space Telescope (HST)/Advanced Camera for Surveys, as well as simultaneous Chandra X-ray data. The V ∼ 22.6 spectroscopically identified optical counterpart is part of a loose cluster with an age ∼ sun . The counterpart is more luminous than the other stars of the association, suggesting a non-negligible optical contribution from the accretion disk. An observed UV excess also points to non-stellar light similar to X-ray active low-mass X-ray binaries. A broad He II λ4686 emission line identified in the optical spectrum of the ULX further suggests optical light from X-ray reprocessing in the accretion disk. Using stellar evolutionary tracks, we have constrained the mass of the counterpart to be ∼> 10 M sun , even if the accretion disk contributes significantly to the optical luminosity. Comparison of the photometric properties of the counterpart with binary models show that the donor may be more massive, ∼> 25 M sun , with the ULX system likely undergoing case AB mass transfer. Finally, the counterpart exhibits photometric variability of 0.14 mag between two HST observations separated by 50 days which could be due to ellipsoidal variations and/or disk reprocessing of variable X-ray emission.

  6. Bio-optical properties of Porsnagerfjorden (Norway) waters based on data collected in 2014 and 2015

    Science.gov (United States)

    Białogrodzka, Jagoda; Stramska, Małgorzata; Burska, Dorota; Ficek, Dariusz; Stoń-Egiert, Joanna; Winogradow, Aleksandra

    2016-04-01

    Oceanographic data collected in the Arctic are valuable in view of the role of this region in the studies on global climate change and the fact that historically the number of in situ measurements is relatively low. Porsangerfjorden, Norway, is an example of oceanic basin with case 2 water according to the optical classification. Optical data from coastal seas are difficult in interpretation because the concentrations of optically important components can be high, variable, and not covarying with each other. Porsanger Fjord can be divided into three basins: inner, middle and outer, where physical and bio-optical properties of water masses differ. We collected optical data and water samples for phytoplankton pigments, dissolved organic matter, particulate (POC) and dissolved (DOC) organic carbon, and particulate inorganic carbon (PIC) during our two summer expeditions in 2014 and 2015. In this presentation we focus on data collected with WETLabs' ac-9 and ac-s spectrophotometers and ECO-Triplet and ECO-Triplet-w fluorometers. Concurrently with in situ optical measurements water samples were collected in situ and soon afterwards they were filtered in the laboratory at the station, stored and transported for further processing in Poland. Our analysis includes 146 of in situ measurements and discrete water samples: 62 of POC, 52 of PIC, 33 of DOC, 68 of dissolved organic matter and 89 of phytoplankton pigments. During our analysis we compare chlorophyll (Chl_a), dissolved organic matter (CDOM) and carbon concentrations with in situ collected inherent optical properties of sea water to find empirical proxies allowing to estimate various water component concentrations from optical data. Application of these proxies to available bio-optical data allowed us to derive spatial distribution of these water constituents and their variability. This work was funded by the Norway Grants (NCBR contract No. 201985, project NORDFLUX).

  7. Optical hybrid quantum teleportation and its applications

    Science.gov (United States)

    Takeda, Shuntaro; Okada, Masanori; Furusawa, Akira

    2017-08-01

    Quantum teleportation, a transfer protocol of quantum states, is the essence of many sophisticated quantum information protocols. There have been two complementary approaches to optical quantum teleportation: discrete variables (DVs) and continuous variables (CVs). However, both approaches have pros and cons. Here we take a "hybrid" approach to overcome the current limitations: CV quantum teleportation of DVs. This approach enabled the first realization of deterministic quantum teleportation of photonic qubits without post-selection. We also applied the hybrid scheme to several experiments, including entanglement swapping between DVs and CVs, conditional CV teleportation of single photons, and CV teleportation of qutrits. We are now aiming at universal, scalable, and fault-tolerant quantum computing based on these hybrid technologies.

  8. Data reduction and analysis of the multiband optical images of the blazar Mrk180

    Directory of Open Access Journals (Sweden)

    M Sabzi Sarvestani

    2012-09-01

    Full Text Available  Nearly simultaneous multiband monitoring of blazars is very limited and most studies reported in literature are conflicting, too. Although optical variability on intra-night timescales is now a well established phenomenon for blazars, its relationship to long-term variability remains unclear. Possible clues could come from monitoring the optical spectrum for correlation with brightness. The presence or absence of bluer color in blazar color index, when its luminosity is increased on intra-night and inter-night timescales, can provide interesting clues to the origin of blazar variability from hourly to much longer timescales. Luminosity of blazars varies at all wavelengths over a variety of timescales. Various models have been proposed to explain blazar variability. However, the mechanism responsible for variability is not conclusively understood. One factor which can discriminate the various variability models is that of color (spectral index variations of blazars. This factor may help to better understand the mechanism of blazar variability. Therefore, it was initially proposed, by the second author of this paper to the OHP observatory, to carry out quasi-simultaneous multiband monitoring of one of the brightest blazer, Mrk180. Fortunately, it was accepted by the scientific team of the observatory and the 1.20m telescope time was allocated to the project from 23 to 28 April 2009. Because of the weather conditions, we could only monitor this blazar for three nights. Raw data processing and data reduction were performed using the standard system of Europe Southerner Observatory, ESO-MIDAS. We considered two reference stars and measured the magnitudes of the reference stars and the blazar Mrk 180 and then plotted the light curves and the color index diagrams. The light curves showed the optical variations of the blazar. The maximum amplitude value of its variations was 0.185 mag for the V filter. Investigating the blazar color index shows its

  9. Interstellar scintillation as the origin of the rapid radio variability of the quasar J1819+3845.

    Science.gov (United States)

    Dennett-Thorpe, J; de Bruyn, A G

    2002-01-03

    The liberation of gravitational energy as matter falls onto a supermassive black hole at the centre of a galaxy is believed to explain the high luminosity of quasars. The variability of this emission from quasars and other types of active galactic nuclei can provide information on the size of the emitting regions and the physical process of fuelling the black hole. Some active galactic nuclei are variable at optical (and shorter) wavelengths, and display radio outbursts over years and decades. These active galactic nuclei often also show faster intraday variability at radio wavelengths. The origin of this rapid variability has been extensively debated, but a correlation between optical and radio variations in some sources suggests that both are intrinsic. This would, however, require radiation brightness temperatures that seem physically implausible, leading to the suggestion that the rapid variations are caused by scattering of the emission by the interstellar medium inside our Galaxy. Here we show that the rapid variations in the extreme case of quasar J1819+3845 (ref. 10) indeed arise from interstellar scintillation. The transverse velocity of the scattering material reveals the presence of plasma with a surprisingly high velocity close to the Solar System.

  10. Optical tomographic imaging for breast cancer detection

    Science.gov (United States)

    Cong, Wenxiang; Intes, Xavier; Wang, Ge

    2017-09-01

    Diffuse optical breast imaging utilizes near-infrared (NIR) light propagation through tissues to assess the optical properties of tissues for the identification of abnormal tissue. This optical imaging approach is sensitive, cost-effective, and does not involve any ionizing radiation. However, the image reconstruction of diffuse optical tomography (DOT) is a nonlinear inverse problem and suffers from severe illposedness due to data noise, NIR light scattering, and measurement incompleteness. An image reconstruction method is proposed for the detection of breast cancer. This method splits the image reconstruction problem into the localization of abnormal tissues and quantification of absorption variations. The localization of abnormal tissues is performed based on a well-posed optimization model, which can be solved via a differential evolution optimization method to achieve a stable reconstruction. The quantification of abnormal absorption is then determined in localized regions of relatively small extents, in which a potential tumor might be. Consequently, the number of unknown absorption variables can be greatly reduced to overcome the underdetermined nature of DOT. Numerical simulation experiments are performed to verify merits of the proposed method, and the results show that the image reconstruction method is stable and accurate for the identification of abnormal tissues, and robust against the measurement noise of data.

  11. AEROSOL VARIABILITY OBSERVED WITH RPAS

    Directory of Open Access Journals (Sweden)

    B. Altstädter

    2013-08-01

    Full Text Available To observe the origin, vertical and horizontal distribution and variability of aerosol particles, and especially ultrafine particles recently formed, we plan to employ the remotely piloted aircraft system (RPAS Carolo-P360 "ALADINA" of TU Braunschweig. The goal of the presented project is to investigate the vertical and horizontal distribution, transport and small-scale variability of aerosol particles in the atmospheric boundary layer using RPAS. Two additional RPAS of type MASC of Tübingen University equipped with turbulence instrumentation add the opportunity to study the interaction of the aerosol concentration with turbulent transport and exchange processes of the surface and the atmosphere. The combination of different flight patterns of the three RPAS allows new insights in atmospheric boundary layer processes. Currently, the different aerosol sensors are miniaturized at the Leibniz Institute for Tropospheric Research, Leipzig and together with the TU Braunschweig adapted to fit into the RPAS. Moreover, an additional meteorological payload for measuring temperature, humidity and turbulence properties is constructed by Tübingen University. Two condensation particle counters determine the total aerosol number with a different lower detection threshold in order to investigate the horizontal and vertical aerosol variability and new particle formation (aerosol particles of some nm diameter. Further the aerosol size distribution in the range from about 0.300 to ~5 μm is given by an optical particle counter.

  12. Revisiting Bragg's X-ray microscope: Scatter based optical transient grating detection of pulsed ionising radiation

    International Nuclear Information System (INIS)

    Fullagar, Wilfred K.; Paganin, David M.; Hall, Chris J.

    2011-01-01

    Transient optical gratings for detecting ultrafast signals are routine for temporally resolved photochemical investigations. Many processes can contribute to the formation of such gratings; we indicate use of optically scattering centres that can be formed with highly variable latencies in different materials and devices using ionising radiation. Coherent light scattered by these centres can form the short-wavelength-to-optical-wavelength, incoherent-to-coherent basis of a Bragg X-ray microscope, with inherent scope for optical phasing. Depending on the dynamics of the medium chosen, the way is open to both ultrafast pulsed and integrating measurements. For experiments employing brief pulses, we discuss high-dynamic-range short-wavelength diffraction measurements with real-time optical reconstructions. Applications to optical real-time X-ray phase-retrieval are considered. -- Research highlights: → It is timely that the concept of Bragg's X-ray microscope be revisited. → Transient gratings can be used for X-ray all-optical information processing. → Applications to optical real-time X-ray phase-retrieval are considered.

  13. Optical sensor for real-time weld defect detection

    Science.gov (United States)

    Ancona, Antonio; Maggipinto, Tommaso; Spagnolo, Vincenzo; Ferrara, Michele; Lugara, Pietro M.

    2002-04-01

    In this work we present an innovative optical sensor for on- line and non-intrusive welding process monitoring. It is based on the spectroscopic analysis of the optical VIS emission of the welding plasma plume generated in the laser- metal interaction zone. Plasma electron temperature has been measured for different chemical species composing the plume. Temperature signal evolution has been recorded and analyzed during several CO2-laser welding processes, under variable operating conditions. We have developed a suitable software able to real time detect a wide range of weld defects like crater formation, lack of fusion, excessive penetration, seam oxidation. The same spectroscopic approach has been applied for electric arc welding process monitoring. We assembled our optical sensor in a torch for manual Gas Tungsten Arc Welding procedures and tested the prototype in a manufacturing industry production line. Even in this case we found a clear correlation between the signal behavior and the welded joint quality.

  14. ARE THE VARIATIONS IN QUASAR OPTICAL FLUX DRIVEN BY THERMAL FLUCTUATIONS?

    International Nuclear Information System (INIS)

    Kelly, Brandon C.; Siemiginowska, Aneta; Bechtold, Jill

    2009-01-01

    We analyze a sample of optical light curves for 100 quasars, 70 of which have black hole mass estimates. Our sample is the largest and broadest used yet for modeling quasar variability. The sources in our sample have z 42 ∼ λ (5100 A) ∼ 46 , and 10 6 ∼ BH /M sun ∼ 10 . We model the light curves as a continuous time stochastic process, providing a natural means of estimating the characteristic timescale and amplitude of quasar variations. We employ a Bayesian approach to estimate the characteristic timescale and amplitude of flux variations; our approach is not affected by biases introduced from discrete sampling effects. We find that the characteristic timescales strongly correlate with black hole mass and luminosity, and are consistent with disk orbital or thermal timescales. In addition, the amplitude of short-timescale variations is significantly anticorrelated with black hole mass and luminosity. We interpret the optical flux fluctuations as resulting from thermal fluctuations that are driven by an underlying stochastic process, such as a turbulent magnetic field. In addition, the intranight variations in optical flux implied by our empirical model are ∼<0.02 mag, consistent with current microvariability observations of radio-quiet quasars. Our stochastic model is therefore able to unify both long- and short-timescale optical variations in radio-quiet quasars as resulting from the same underlying process, while radio-loud quasars have an additional variability component that operates on timescales ∼<1 day.

  15. Spatiotemporal optical pulse transformation by a resonant diffraction grating

    Energy Technology Data Exchange (ETDEWEB)

    Golovastikov, N. V.; Bykov, D. A., E-mail: bykovd@gmail.com; Doskolovich, L. L., E-mail: leonid@smr.ru; Soifer, V. A. [Russian Academy of Sciences, Image Processing Systems Institute (Russian Federation)

    2015-11-15

    The diffraction of a spatiotemporal optical pulse by a resonant diffraction grating is considered. The pulse diffraction is described in terms of the signal (the spatiotemporal incident pulse envelope) passage through a linear system. An analytic approximation in the form of a rational function of two variables corresponding to the angular and spatial frequencies has been obtained for the transfer function of the system. A hyperbolic partial differential equation describing the general form of the incident pulse envelope transformation upon diffraction by a resonant diffraction grating has been derived from the transfer function. A solution of this equation has been obtained for the case of normal incidence of a pulse with a central frequency lying near the guided-mode resonance of a diffraction structure. The presented results of numerical simulations of pulse diffraction by a resonant grating show profound changes in the pulse envelope shape that closely correspond to the proposed theoretical description. The results of the paper can be applied in creating new devices for optical pulse shape transformation, in optical information processing problems, and analog optical computations.

  16. Spin and diamagnetism in linear and nonlinear optics

    International Nuclear Information System (INIS)

    Andersen, Torsten; Keller, Ole; Huebner, Wolfgang; Johansson, Boerje

    2004-01-01

    We present a local-field theory for spin and diamagnetism in linear and nonlinear optics. We examine all the processes contained in the Pauli Hamiltonian and its corresponding microscopic current density, including the terms depending on the electron spin. The resulting general real-space conductivities are presented and discussed. To quantify the implications of including the spin, we study the linear and nonlinear optical properties of free-electron metals, represented by the screened homogeneous electron gas. The real-space formalism is transformed into Fourier space, and the symmetries of the linear and nonlinear optical conductivities in a homogeneous electron gas are discussed. Numerical results are presented for the homogeneous electron gas, in which we treat ω and q as independent variables, thereby opening the theory to near-field optics and the study of evanescent waves. We show that in regions of the ω-q spectrum, the presence of diamagnetism and spin dynamics significantly alters the response in comparison to considering only the paramagnetic response. Additionally, we discuss the effects of screening, and we finish our treatment by a discussion of how to connect the present theory to existing methods in ab initio solid-state physics

  17. Experimental demonstration of continuous variable cloning with phase-conjugate inputs

    DEFF Research Database (Denmark)

    Sabuncu, Metin; Andersen, Ulrik Lund; Leuchs, G.

    2007-01-01

    We report the first experimental demonstration of continuous variable cloning of phase-conjugate coherent states as proposed by Cerf and Iblisdir [Phys. Rev. Lett. 87, 247903 (2001)]. In contrast to this proposal, the cloning transformation is accomplished using only linear optical components......, homodyne detection, and feedforward. As a result of combining phase conjugation with a joint measurement strategy, superior cloning is demonstrated with cloning fidelities reaching 89%....

  18. Quantum communication network utilizing quadripartite entangled states of optical field

    International Nuclear Information System (INIS)

    Shen Heng; Su Xiaolong; Jia Xiaojun; Xie Changde

    2009-01-01

    We propose two types of quantum dense coding communication networks with optical continuous variables, in which a quadripartite entangled state of the optical field with totally three-party correlations of quadrature amplitudes is utilized. In the networks, the exchange of information between any two participants can be manipulated by one or two of the remaining participants. The channel capacities for a variety of communication protocols are numerically calculated. Due to the fact that the quadripartite entangled states applied in the communication systems have been successfully prepared already in the laboratory, the proposed schemes are experimentally accessible at present.

  19. Program description of FIBRAM: a radiation attenuation model for optical fibers

    International Nuclear Information System (INIS)

    Ingram, W.J.

    1987-06-01

    The report describes a fiber optics system model and its computer implementation. This implementation can calculate the bit error ratio (BER) versus time for optical fibers that have been exposed to gamma radiation. The program is designed so that the user may arbitrarily change any or all of the system input variables and produce separate output calculations. The primary output of the program is a table of the BER as a function of time. This table may be stored on magnetic media and later incorporated into computer graphics programs

  20. MULTIWAVELENGTH VARIABILITY OF THE BROAD LINE RADIO GALAXY 3C 120

    International Nuclear Information System (INIS)

    Marshall, Kevin; Ryle, Wesley T.; Miller, H. Richard; Marscher, Alan P.; Jorstad, Svetlana G.; Chicka, Benjamin; McHardy, Ian M.

    2009-01-01

    We present results from a multiyear monitoring campaign of the broad-line radio galaxy 3C 120, using the Rossi X-ray Timing Explorer for nearly five years of observations. Additionally, we present coincident optical monitoring using data from several ground-based observatories. Both the X-ray and optical emission are highly variable and appear to be strongly correlated, with the X-ray emission leading the optical by 28 days. The X-ray power density spectrum is best fit by a broken power law, with a low-frequency slope of -1.2, breaking to a high-frequency slope of -2.1, and a break frequency of log ν b = -5.75 Hz, or 6.5 days. This value agrees well with the value expected based on 3C 120's mass and accretion rate. We find no evidence for a second break in the power spectrum. Combined with a moderately soft X-ray spectrum (Γ = 1.8) and a moderately high accretion rate, this indicates that 3C 120 fits in well with the high/soft variability state found in most other active galactic nuclei. Previous studies have shown that the spectrum has a strong Fe Kα line, which may be relativistically broadened. The presence of this line, combined with a power spectrum similar to that seen in Seyfert galaxies, suggests that the majority of the X-ray emission in this object arises in or near the disk, and not in the jet.

  1. Influence of optical feedback on laser frequency spectrum and threshold conditions

    DEFF Research Database (Denmark)

    Osmundsen, Jens Henrik; Gade, Niels

    1983-01-01

    The steady state behavior of the external cavity operated laser has been analyzed, taking into account multiple reflections. The effect of optical feedback is included in the phase- and gain-conditions by a factor which is shown to have a simple geometrical representation. From this representation...... it is easily seen how the laser frequency spectrum and the threshold gain depend on external parameters such as distance to the reflection point and the amount of optical feedback. Furthermore, by inserting a variable attenuator in the external cavity and measuring the threshold current versus transmittance we...... have simultaneously determined the photon lifetime and the absolute amount of optical feedback. For the laser considered we found the photon lifetimetau_{p} = 1.55ps....

  2. A hybrid active optical system for wave front preservation and variable focal distance

    Energy Technology Data Exchange (ETDEWEB)

    Cocco, Daniele, E-mail: daniele.cocco@elettra.trieste.i [Sincrotrone Trieste ScpA, 34012 Trieste (Italy); Bortoletto, Gianluca; Sergo, Rudi; Sostero, Giovanni; Cudin, Ivan [Sincrotrone Trieste ScpA, 34012 Trieste (Italy)

    2010-05-01

    A new Free Electron Laser (FEL) user facility, named FERMI-Elettra, is under construction at Sincrotrone Trieste (Italy). It is based on a seeded scheme to provide an almost perfect transform limited beam with fully spatial coherence. The wavelength range will be 100-3 nm with fundamental and will go down to 1 nm by using higher harmonics. It will be operative by autumn 2010. The exceptional characteristics of the source must be preserved until the experimental chamber, where a large set of different experiments will be performed. This condition poses very tight requirements to the design of the beamlines and, in particular, to the focusing optics. Here we will present the active optics system developed for Fermi but intended to be used also on the Elettra beamlines. It is based on the adoption of a hybrid active system composed by UHV compatible stepping motors and piezo ceramic actuators. These mirrors are supposed to provide focal distances from 0.8 m to infinity with an angle of incidence up to a few degrees and residual shape errors below 10 or 5 nm (depending on the wavelength). In this way it is possible to work with an almost perfect focused coherent beam as well as with a uniform defocused or unfocused image. The metrology results on the first 400 mm long mirror will be shown and the actuator system described. A strain gauge assembly, calibrated in Elettra by means of a long trace profiler, and controlled by a custom made electronic system developed by us, is used as a direct in situ encoder.

  3. Optics

    CERN Document Server

    Mathieu, Jean Paul

    1975-01-01

    Optics, Parts 1 and 2 covers electromagnetic optics and quantum optics. The first part of the book examines the various of the important properties common to all electromagnetic radiation. This part also studies electromagnetic waves; electromagnetic optics of transparent isotropic and anisotropic media; diffraction; and two-wave and multi-wave interference. The polarization states of light, the velocity of light, and the special theory of relativity are also examined in this part. The second part is devoted to quantum optics, specifically discussing the classical molecular theory of optical p

  4. Dominant optic atrophy

    Directory of Open Access Journals (Sweden)

    Lenaers Guy

    2012-07-01

    Full Text Available Abstract Definition of the disease Dominant Optic Atrophy (DOA is a neuro-ophthalmic condition characterized by a bilateral degeneration of the optic nerves, causing insidious visual loss, typically starting during the first decade of life. The disease affects primary the retinal ganglion cells (RGC and their axons forming the optic nerve, which transfer the visual information from the photoreceptors to the lateral geniculus in the brain. Epidemiology The prevalence of the disease varies from 1/10000 in Denmark due to a founder effect, to 1/30000 in the rest of the world. Clinical description DOA patients usually suffer of moderate visual loss, associated with central or paracentral visual field deficits and color vision defects. The severity of the disease is highly variable, the visual acuity ranging from normal to legal blindness. The ophthalmic examination discloses on fundoscopy isolated optic disc pallor or atrophy, related to the RGC death. About 20% of DOA patients harbour extraocular multi-systemic features, including neurosensory hearing loss, or less commonly chronic progressive external ophthalmoplegia, myopathy, peripheral neuropathy, multiple sclerosis-like illness, spastic paraplegia or cataracts. Aetiology Two genes (OPA1, OPA3 encoding inner mitochondrial membrane proteins and three loci (OPA4, OPA5, OPA8 are currently known for DOA. Additional loci and genes (OPA2, OPA6 and OPA7 are responsible for X-linked or recessive optic atrophy. All OPA genes yet identified encode mitochondrial proteins embedded in the inner membrane and ubiquitously expressed, as are the proteins mutated in the Leber Hereditary Optic Neuropathy. OPA1 mutations affect mitochondrial fusion, energy metabolism, control of apoptosis, calcium clearance and maintenance of mitochondrial genome integrity. OPA3 mutations only affect the energy metabolism and the control of apoptosis. Diagnosis Patients are usually diagnosed during their early childhood, because of

  5. A Design for an Internet Router with a Digital Optical Data Plane

    Directory of Open Access Journals (Sweden)

    Joe Touch

    2017-02-01

    Full Text Available This paper presents a complete design for an optical Internet router based on the component steps required for Internet protocol (IP packet forwarding. Implementations of hop count decrement and header matching are integrated with a simulation-based approach to variable-length packet traffic merging that avoids recirculation, demonstrating an approach for an all-optical data plane. A method for IPv4 checksum computation is introduced, and this and previously designed components are extended from binary to higher-density (multiple bits per symbol encodings. The implications of this design are considered, including the potential for chip-level and system integration, as well as the requirements of basic optical processing components.

  6. Seven-Year Multi-Colour Optical Monitoring of BL Lacertae Object ...

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... We monitored the BL Lac object S5 0716+714 in five intermediate optical passbands from 2004 September to 2011 April. The object was active most of the time and intra-day variability was frequently observed. The total variation amplitude tended to decrease with decreasing frequency. Strong ...

  7. Two-color photographic photometry of variables in the globular cluster M28

    International Nuclear Information System (INIS)

    Wehlau, A.; Butterworth, S.

    1990-01-01

    Visual magnitudes have been measured for 20 variables on 32 plates of M28. These have been combined with previously published as well as newly determined blue magnitudes in order to obtain colors for the variables. Blue and visual light curves are presented for 15 of the the variables, including one W Virginis star V4, one RV Tauri star V17, one field Mira variable V7, nine cluster RR Lyrae stars, and three field RR Lyrae stars. It is shown that V14, previously thought to be a c type RR Lyrae star, is to the red of the instability strip. The visual light curve of V9 suggests that the star may be a member of a binary or a very close optical double. Possible evidence for differential reddening in the vicinity of M28 is presented. The bimodal distribution of the periods of the RR Lyrae stars in M28 may indicate a spread in metallicity among the RR Lyrae variables. 16 refs

  8. Instabilities of line-driven stellar winds. V. Effect of an optically thick continuum

    International Nuclear Information System (INIS)

    Owocki, S.P.; Rybicki, G.B.

    1991-01-01

    Earlier analyses of the linear instability of line-driven stellar winds are extended to the case, relevant to Wolf-Rayet stars, in which the continuum remains optically thick well above the sonic point. It is found that an optically thick flow driven by pure scattering lines is stabilized by the drag effect of the diffuse, scattered radiation. However, even a relatively small photon destruction probability can cause a flow with continuum optical thickness much greater than 1 to remain unstable, with a given growth rate. The implications of these results for the variability characteristics of winds from Wolf-Rayet stars are briefly discussed. 16 refs

  9. Phase-dependent Photometric and Spectroscopic Characterization of the MASTER-Net Optical Transient J212444.87+321738.3: An Oxygen-rich Mira

    Science.gov (United States)

    Ghosh, Supriyo; Mondal, Soumen; Das, Ramkrishna; Banerjee, D. P. K.; Ashok, N. M.; Hambsch, Franz-Josef; Dutta, Somnath

    2018-05-01

    We describe the time-dependent properties of a new spectroscopically confirmed Mira variable, which was discovered in 2013 as MASTER-Net Optical Transient J212444.87+321738.3 toward the Cygnus constellation. We have performed long-term optical/near-infrared (NIR) photometric and spectroscopic observations to characterize the object. From the optical/NIR light curves, we estimate a variability period of 465 ± 30 days. The wavelength-dependent amplitudes of the observed light curves range from ΔI ∼ 4 mag to ΔK ∼ 1.5 mag. The (J ‑ K) color index varies from 1.78 to 2.62 mag over phases. Interestingly, a phase lag of ∼60 days between optical and NIR light curves is also seen, as in other Miras. Our optical/NIR spectra show molecular features of TiO, VO, CO, and strong water bands that are a typical signature of oxygen-rich Mira. We rule out S- or C-type as ZrO bands at 1.03 and 1.06 μm and C2 band at 1.77 μm are absent. We estimate the effective temperature of the object from the Spectral Energy Distribution, and distance and luminosity from standard Period–Luminosity relations. The optical/NIR spectra display time-dependent atomic and molecular features (e.g., TiO, Na I, Ca I, H2O, CO), as commonly observed in Miras. Such spectroscopic observations are useful for studying pulsation variability in Miras.

  10. Light Optics for Optical Stochastic Cooling

    Energy Technology Data Exchange (ETDEWEB)

    Andorf, Matthew [NICADD, DeKalb; Lebedev, Valeri [Fermilab; Piot, Philippe [NICADD, DeKalb; Ruan, Jinhao [Fermilab

    2016-06-01

    In Optical Stochastic Cooling (OSC) radiation generated by a particle in a "pickup" undulator is amplified and transported to a downstream "kicker" undulator where it interacts with the same particle which radiated it. Fermilab plans to carry out both passive (no optical amplifier) and active (optical amplifier) tests of OSC at the Integrable Optics Test Accelerator (IOTA) currently in construction*. The performace of the optical system is analyzed with simulations in Synchrotron Radiation Workshop (SRW) accounting for the specific temporal and spectral properties of undulator radiation and being augmented to include dispersion of lens material.

  11. POF based smart sensor for studying the setting dynamics of cement paste

    International Nuclear Information System (INIS)

    Rajesh, M; Sheeba, M; Nampoori, V P N

    2007-01-01

    Fiber optic smart sensors are used to monitor the civil structures. One of the important parameters in civil engineering is the setting characteristics of concrete made of cement. The paper discusses how a simple polymer optical fiber can be used to characterise the setting dynamics of various grades of cement. The results explain the comparative performance of polymer fiber over silica fiber. The basic principle underlying the sensor is that as the cement sets, it exerts a stress on the sensing fiber, which is laid within the cement paste. This stress induces strain on the optical fiber, which can be thought of as a series of aperiodic microbends on the surface of the fiber. This in turn changes the characteristics of the light signal transmitted through the fiber and can be viewed as stress induced modulation of light in the fiber. By monitoring the intensity variation of transmitted light signal with time we can determine the cement setting rate. This can be used as an effective tool for quality testing of commercially available cements of different grades

  12. Numerical algorithm for laser treatment of powder layer with variable thickness

    Science.gov (United States)

    Soboleva, Polina; Knyazeva, Anna

    2017-12-01

    Two-dimensional model of laser treatment of powder layer on the substrate is proposed in this paper. The model takes into account the shrinkage of powder layer due to the laser treatment. Three simplified variants of the model were studied. Firstly, the influence of optical properties of powder layer on the maximal temperature was researched. Secondly, two-dimensional model for given thickness of powder layer was studied where practically uniform temperature distribution across thin powder layer was demonstrated. Then, the numerical algorithm was developed to calculate the temperature field for the area of variable size. The impact of the optical properties of powder material on the character of the temperature distribution was researched numerically.

  13. Optimization of a particle optical system in a mutilprocessor environment

    International Nuclear Information System (INIS)

    Wei Lei; Yin Hanchun; Wang Baoping; Tong Linsu

    2002-01-01

    In the design of a charged particle optical system, many geometrical and electric parameters have to be optimized to improve the performance characteristics. In every optimization cycle, the electromagnetic field and particle trajectories have to be calculated. Therefore, the optimization of a charged particle optical system is limited by the computer resources seriously. Apart from this, numerical errors of calculation may also influence the convergence of merit function. This article studies how to improve the optimization of charged particle optical systems. A new method is used to determine the gradient matrix. With this method, the accuracy of the Jacobian matrix can be improved. In this paper, the charged particle optical system is optimized with a Message Passing Interface (MPI). The electromagnetic field, particle trajectories and gradients of optimization variables are calculated on networks of workstations. Therefore, the speed of optimization has been increased largely. It is possible to design a complicated charged particle optical system with optimum quality on a MPI environment. Finally, an electron gun for a cathode ray tube has been optimized on a MPI environment to verify the method proposed in this paper

  14. Classical Optical Transforms Studied in the Context of Quantum Optics via the Route of Developing Dirac's Symbolic Method

    Science.gov (United States)

    Fan, Hong-Yi; Lu, Hai-Liang

    Via the route of developing Dirac's symbolic method and following Dirac's assertion: "⋯ for a quantum dynamic system that has a classical analogue, unitary transformation in the quantum theory is the analogue of contact transformation in the classical theory", we find the generalized Fresnel operator (GFO) corresponding to the generalized Fresnel transform (GFT) in classical optics. We derive GFO's normal product form and its canonical coherent state representation and find that GFO is the loyal representation of symplectic group multiplication rule. We show that GFT is just the transformation matrix element of GFO in the coordinate representation such that two successive GFTs is still a GFT. The ABCD rule of the Gaussian beam propagation is directly demonstrated in quantum optics. With the aid of entangled state representation the entangled Fresnel transform is proposed; new eigenfunctions of the complex fractional Fourier transform and fractional Hankel transform are obtained; the two-variable Hermite eigenmodes of light propagation are used in studying the Talbot effect in quadratic-index media; the complex wavelet transform and the condition of mother wavelet are studied in the context of quantum optics too. Moreover, quantum optical version of classical z-transforms is obtained on the basis of the eigenvector of creation operator. Throughout our discussions, the coherent state, squeezing operators and the technique of integration within an ordered product (IWOP) of operators are fully used.

  15. Optical materials

    International Nuclear Information System (INIS)

    Poker, D.B.; Ortiz, C.

    1989-01-01

    This book reports on: Diamond films, Synthesis of optical materials, Structure related optical properties, Radiation effects in optical materials, Characterization of optical materials, Deposition of optical thin films, and Optical fibers and waveguides

  16. Spectral and photometric observations of fast irregular variables. 3. VX Cas, UX Ori, BN Ori and WW Vul - results of U,B,V,J,H,K,L photometry

    International Nuclear Information System (INIS)

    Kolotilov, E.A.; Zajtseva, G.V.; Chenavrin, V.I.

    1977-01-01

    In the 1975-76 period photometric observations of the variable stars VX Cas, BN Ori and WW Vul in the optical (U,B,V) and infrared (J,H,K,L) spectral ranges have been conducted on the 60-cm and 125-cm reflector at the GAISh station in the Crimea. In most cases the optical and infrared measurements were carried out concurrently for each star. The photometric behavior of the variables during the observation period is described and, where possible, radiation variabilities in the different spectra ranges are compared

  17. Optical MEMS for earth observation payloads

    Science.gov (United States)

    Rodrigues, B.; Lobb, D. R.; Freire, M.

    2017-11-01

    An ESA study has been taken by Lusospace Ltd and Surrey Satellite Techonoly Ltd (SSTL) into the use of optical Micro Eletro-Mechanical Systems (MEMS) for earth Observation. A review and analysis was undertaken of the Micro-Optical Electro-Mechanical Systems (MOEMS) available in the market with potential application in systems for Earth Observation. A summary of this review will be presented. Following the review two space-instrument design concepts were selected for more detailed analysis. The first was the use of a MEMS device to remove cloud from Earth images. The concept is potentially of interest for any mission using imaging spectrometers. A spectrometer concept was selected and detailed design aspects and benefits evaluated. The second concept developed uses MEMS devices to control the width of entrance slits of spectrometers, to provide variable spectral resolution. This paper will present a summary of the results of the study.

  18. Optical eclipses and precessional effects in the X-ray binary system HD 77581=4U 0900-40

    International Nuclear Information System (INIS)

    Khruzina, T.S.; Cherepashchuk, A.M.

    1982-01-01

    The longperiod (P=93.3sup(d)) variability of the amplitude and shape of the optical light curves of the X-ray binary HD 77581 has been discovered from the analysis of all published photometric data. The 93.3-day period is presumably the period of the forced precession of the rotational axis of the optical star. It is shown that the system HD 77581 appears to be an eclipsing binary in the optical range with the amplitude of the ellipsoidal variability approximately 0sup(m).04 and the depth of the eclipse reaching approximately 0sup(m).04. The eclipses are caused by the gaseous streams and the accreting structure, the orientation of which in the binary system is varying with the precession period of the optical star. The estimates of the parameters of the system are obtained. It is shown that the parameter of the Roche Lobe filling for the optical star is μ < 1. The mass of the neutron star is Msub(x)=(1.6+-0.3) Msub(Sun), where Msub(Sun) is the solar mass. The forced precession of the optical star is connected with the non-perpendicularity of its rotational axis to the orbit plane of the binary system. This non-perpendicularity may be a result