WorldWideScience

Sample records for antibody fab fragment

  1. Generation and characterization of the human neutralizing antibody fragment Fab091 against rabies virus

    Institute of Scientific and Technical Information of China (English)

    Chen LI; Feng ZHANG; Hong LIN; Zhong-can WANG; Xin-jian LIU; Zhen-qing FENG; Jin ZHU; Xiao-hong GUAN

    2011-01-01

    Aim: To transform the human anti-rabies virus glycoprotein (anti-RABVG) single-chain variable fragment (scFv) into a Fab fragment and to analyze its immunological activity.Methods: The Fab gene was amplified using overlap PCR and inserted into the vector pComb3XSS. The recombinant vector was then transformed into E coli Top10F' for expression and purification. The purified Fab was characterized using SDS-PAGE, Western blotting,indirect ELISA, competitive ELISA, and the fluorescent antibody virus neutralization test (FAVN), respectively, and examined in a Kunming mouse challenge model in vivo.Results: A recombinant vector was constructed. The Fab was expressed in soluble form In E coll Top10F'. Specific binding of the Fab to rabies virus was confirmed by indirect ELISA and immunoprecipitation (IP). The neutralizing antibody titer of Fab was 10.26 IU/mL.The mouse group treated with both vaccine and human rabies immunoglobulin (HRIG)/Fab091 (32 IU/kg) showed protection against rabies, compared with the control group (P<0.05, Logrank test).Conclusion: The antibody fragment Fab was shown to be a neutralizing antibody against RABVG. It can be used together with other monoclonal antibodies for post-exposure prophylaxis of rabies virus in future studies.

  2. Generation and characterization of the human neutralizing antibody fragment Fab091 against rabies virus

    OpenAIRE

    Li, Chen; Zhang, Feng; Lin, Hong; Wang, Zhong-can; Liu, Xin-jian; Feng, Zhen-qing; Zhu, Jin; Guan, Xiao-hong

    2011-01-01

    Aim: To transform the human anti-rabies virus glycoprotein (anti-RABVG) single-chain variable fragment (scFv) into a Fab fragment and to analyze its immunological activity. Methods: The Fab gene was amplified using overlap PCR and inserted into the vector pComb3XSS. The recombinant vector was then transformed into E coli Top10F' for expression and purification. The purified Fab was characterized using SDS-PAGE, Western blotting, indirect ELISA, competitive ELISA, and the fluorescent antibody ...

  3. Crystallization of BMP receptor type IA bound to the antibody Fab fragment AbD1556

    International Nuclear Information System (INIS)

    The crystallization of BMP receptor type IA bound to the neutralizing antibody Fab fragment AbD1556 obtained by phage-display selection is reported. An antibody Fab fragment, AbD1556, was selected against the extracellular domain of BMP receptor type IA, which blocks the binding of BMP-2 to BMPR-IA and thereby neutralizes BMP-2 activity. To study the mechanism by which BMPR-IA is recognized and bound by the Fab fragment, the complex of AbD1556 bound to BMPR-IA was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group P21, with unit-cell parameters a = 89.32, b = 129.25, c = 100.24 Å, β = 92.27°

  4. Increased streptavidin uptake in tumors pretargeted with biotinylated antibody using a conjugate of streptavidin-Fab fragment

    International Nuclear Information System (INIS)

    Radiolabeled streptavidin accumulated in tumors pretargeted with biotinylated antibody. However, the absolute delivery of radioactivity was limited. To increase the tumor uptake of radioactivity further, we conjugated streptavidin with a mouse monoclonal antibody (MAb) fragment, OST6Fab, which recognizes antigen on human osteosarcoma. Another mouse MAb, OST7, which also reacts with the same tumor but recognizes an epitope different from the OST6 epitope, was biotinylated. The radioiodinated streptavidin-OST6Fab conjugate was administered to tumor-bearing mice after the biotinylated OST7 pretargeting. The uptake of the conjugate in tumors pretargeted with the biotinylated antibody was significantly higher than that of streptavidin and that of the conjugate of streptavidin and irrelevant Fab fragment. Renal uptake of radioactivity was decreased markedly, and the blood clearance was retarded by the conjugation with Fab fragment. In conclusion, the conjugate of streptavidin with specific Fab fragment increased the accumulation of radioactivity in tumors pretargeted with biotinylated antibody

  5. PET imaging of osteosarcoma in dogs using a fluorine-18-labeled monoclonal antibody fab fragment

    International Nuclear Information System (INIS)

    Four dogs with histologically confirmed osteogenic sarcoma were studied with PET following intravenous injection of the 18F-labeled Fab fragment of TP-3, a monoclonal antibody specific for human and canine osteosarcomas. The antibody fragment was labeled using the N-succinimidyl (8-(4'-(18F)fluorobenzyl)amino)suberate acylation agent. Blood clearance of activity was biphasic in all dogs but half-times were variable (T1/2β = 2-13 hr). Catabolism of labeled Fab was reflected by the decrease in protein-associated activity in serum from more than 90% at 1 min to 60%-80% at 4 hr. PET images demonstrated increased accumulation of 18F at the primary tumor site relative to normal contralateral bone in one dog as early as 15 min after injection. Biopsies obtained after euthanasia indicated higher uptake at the edges of the tumor as observed on the PET scans. Tumor uptake was 1-3 x 10-3% injected dose/g, a level similar to that reported for other Fab fragments in human tumors. In the three dogs with metastatic disease, early PET images reflected activity in the blood pool but later uptake was observed in suspected metastatic sites. These results, although preliminary, suggest that PET imaging of 18F-labeled antibody fragments is feasible and that dogs with spontaneous tumors could be a valuable model for preclinical research with radioimmunoconjugates. 34 refs., 6 figs., 2 tabs

  6. Nebulized Anti-IL-13 Monoclonal Antibody Fab' Fragment Reduces Allergen-Induced Asthma

    OpenAIRE

    Hacha, Jonathan; Tomlinson, K; Maertens, Ludovic; Paulissen, Geneviève; Rocks, Natacha; Foidart, Jean-Michel; Noël, Agnès; Palframan, R; Guéders, Maud; Cataldo, Didier

    2012-01-01

    Rationale: Interleukin-13 (IL-13) is a prototypic Th2 cytokine and a central mediator of the complex cascade of events leading to asthmatic phenotype. Indeed, IL-13 plays key roles in IgE synthesis, bronchial hyperresponsiveness, mucus hypersecretion, subepithelial fibrosis and eosinophil infiltration. Objectives: We assessed the potential efficacy of inhaled anti-IL-13 monoclonal antibody Fab' fragment on allergen-induced airway inflammation, hyperresponsiveness and remodeling in an experime...

  7. Crystal Structure of the Fab Fragment of an Anti-factor IX Antibody 10C12

    Institute of Scientific and Technical Information of China (English)

    SHI Xiao-Li; ZENG Tu; HUANG Ming-Dong

    2008-01-01

    10C12 is an anticoagulant antibody identified from a phage display single-chain Fv human antibody library. It can be directed at the calcium-stabilized Gla domain of Factor-IX, an important coagulation factor in intrinsic pathway of blood coagulation cascade, and interfere with membrane anchoring of Factor IX, thus inhibiting blood coagulation function. 10C12 has been demonstrated as an effective anti-coagulant in attenuating thrombosis in several different animal models. Here, we report the crystal structure of the Fab fragment of 10C12. The crystal contains two Fab molecules in the asymmetric unit with identical conformation, forming a lattice with large cavities. In addition, comparison of this free Fab with the antigen-bound structure of 10C12 shows no change in CDR conformations and the relative disposition of the variable subunits of H and L chains, suggesting the rigid conformation of this 10C12 Fab and a lock-and-key mechanism of antibody-antigen recognition for 10C 12.

  8. High contrast tumor imaging with radio-labeled antibody Fab fragments tailored for optimized pharmacokinetics via PASylation

    OpenAIRE

    Mendler, Claudia T; Friedrich, Lars; Laitinen, Iina; Schlapschy, Martin; Schwaiger, Markus; Wester, Hans-Jürgen; Skerra, Arne

    2014-01-01

    Although antigen-binding fragments (Fabs) of antibodies constitute established tracers for in vivo radiodiagnostics, their functionality is hampered by a very short circulation half-life. PASylation, the genetic fusion with a long, conformationally disordered amino acid chain comprising Pro, Ala and Ser, provides a convenient way to expand protein size and, consequently, retard renal filtration. Humanized αHER2 and αCD20 Fabs were systematically fused with 100 to 600 PAS residues and produced...

  9. High contrast tumor imaging with radio-labeled antibody Fab fragments tailored for optimized pharmacokinetics via PASylation

    Science.gov (United States)

    Mendler, Claudia T; Friedrich, Lars; Laitinen, Iina; Schlapschy, Martin; Schwaiger, Markus; Wester, Hans-Jürgen; Skerra, Arne

    2015-01-01

    Although antigen-binding fragments (Fabs) of antibodies constitute established tracers for in vivo radiodiagnostics, their functionality is hampered by a very short circulation half-life. PASylation, the genetic fusion with a long, conformationally disordered amino acid chain comprising Pro, Ala and Ser, provides a convenient way to expand protein size and, consequently, retard renal filtration. Humanized αHER2 and αCD20 Fabs were systematically fused with 100 to 600 PAS residues and produced in E. coli. Cytofluorimetric titration analysis on tumor cell lines confirmed that antigen-binding activities of the parental antibodies were retained. The radio-iodinated PASylated Fabs were studied by positron emission tomography (PET) imaging and biodistribution analysis in mouse tumor xenograft models. While the unmodified αHER2 and αCD20 Fabs showed weak tumor uptake (0.8% and 0.2% ID/g, respectively; 24 h p.i.) tumor-associated radioactivity was boosted with increasing PAS length (up to 9 and 26-fold, respectively), approaching an optimum for Fab-PAS400. Remarkably, 6- and 5-fold higher tumor-to-blood ratios compared with the unmodified Fabs were measured in the biodistribution analysis (48 h p.i.) for αHER2 Fab-PAS100 and Fab-PAS200, respectively. These findings were confirmed by PET studies, showing high imaging contrast in line with tumor-to-blood ratios of 12.2 and 5.7 (24 h p.i.) for αHER2 Fab-PAS100 and Fab-PAS200. Even stronger tumor signals were obtained with the corresponding αCD20 Fabs, both in PET imaging and biodistribution analysis, with an uptake of 2.8% ID/g for Fab-PAS100 vs. 0.24% ID/g for the unmodified Fab. Hence, by engineering Fabs via PASylation, plasma half-life can be tailored to significantly improve tracer uptake and tumor contrast, thus optimally matching reagent/target interactions. PMID:25484039

  10. Rigidity Emerges during Antibody Evolution in Three Distinct Antibody Systems: Evidence from QSFR Analysis of Fab Fragments.

    Directory of Open Access Journals (Sweden)

    Tong Li

    2015-07-01

    Full Text Available The effects of somatic mutations that transform polyspecific germline (GL antibodies to affinity mature (AM antibodies with monospecificity are compared among three GL-AM Fab pairs. In particular, changes in conformational flexibility are assessed using a Distance Constraint Model (DCM. We have previously established that the DCM can be robustly applied across a series of antibody fragments (VL to Fab, and subsequently, the DCM was combined with molecular dynamics (MD simulations to similarly characterize five thermostabilizing scFv mutants. The DCM is an ensemble based statistical mechanical approach that accounts for enthalpy/entropy compensation due to network rigidity, which has been quite successful in elucidating conformational flexibility and Quantitative Stability/Flexibility Relationships (QSFR in proteins. Applied to three disparate antibody systems changes in QSFR quantities indicate that the VH domain is typically rigidified, whereas the VL domain and CDR L2 loop become more flexible during affinity maturation. The increase in CDR H3 loop rigidity is consistent with other studies in the literature. The redistribution of conformational flexibility is largely controlled by nonspecific changes in the H-bond network, although certain Arg to Asp salt bridges create highly localized rigidity increases. Taken together, these results reveal an intricate flexibility/rigidity response that accompanies affinity maturation.

  11. Intracellular interactome of secreted antibody Fab fragment in Pichia pastoris reveals its routes of secretion and degradation.

    Science.gov (United States)

    Pfeffer, Martin; Maurer, Michael; Stadlmann, Johannes; Grass, Josephine; Delic, Marizela; Altmann, Friedrich; Mattanovich, Diethard

    2012-03-01

    Protein translation, translocation, folding, processing, and secretion in eukaryotic cells are complex and not always straightforward processes, e.g., different routes of secretion and degradation exist. Formation of malfolded proteins in the endoplasmic reticulum (ER) can be one of the major bottlenecks for recombinant protein production. In this regard, an in-depth analysis of the interactions of a secreted protein during its pathway through the cell may be beneficial, as realized in this study for the methylotrophic yeast Pichia pastoris. The antibody fragment Fab3H6 used here is the anti-idiotype to the HIV neutralizing antibody 2F5 and is known to be intracellularly degraded in significant amounts when expressed in P. pastoris. The interactome of Fab3H6 was analyzed by using a pull-down mass spectrometry approach, and 23 proteins were found to bind specifically to the antibody fragment. Those allowed concluding that Fab3H6 is post-translationally translocated into the ER and degraded via the proteasome as well as the vacuole. In line with this, the expression of Fab3H6 increased the proteasomal activities by over 20%. Partial inhibition of the proteasome resulted in a significant increase of extracellular Fab3H6. Thus, it seems that ER quality control overshoots its requirements for the recombinant protein expressed and that more than just terminally malfolded protein is degraded by ER-associated degradation. This work will further facilitate our understanding how recombinant proteins behave in the secretory pathway. PMID:22350260

  12. PET Imaging of CD105/Endoglin Expression with a 61/64Cu-Labeled Fab Antibody Fragment

    Science.gov (United States)

    Zhang, Yin; Hong, Hao; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo

    2013-01-01

    Purpose The goal of this study was to generate and characterize the Fab fragment of TRC105, a monoclonal antibody that binds with high affinity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis in a small animal model after 61/64Cu-labeling. Methods TRC105-Fab was generated by enzymatic papain digestion. The integrity and CD105 binding affinity of TRC105-Fab was evaluated before NOTA (i.e., 1,4,7-triazacyclononane-1,4,7-triacetic acid) conjugation and 61/64Cu-labeling. Serial PET imaging and biodistribution studies were carried out in the syngeneic 4T1 murine breast cancer model to quantify tumor targeting efficacy and normal organ distribution of 61/64Cu-NOTA-TRC105-Fab. Blocking studies with unlabeled TRC105 were performed to confirm CD105 specificity of the tracer in vivo. Immunofluorescence staining was also conducted to correlate tracer uptake in the tumor and normal tissues with CD105 expression. Results TRC105-Fab was produced with high purity through papain digestion of TRC105, as confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. 61/64Cu-labeling of NOTA-TRC105-Fab was achieved with ~50% yield (specific activity: ~44 GBq/µmol). PET imaging revealed rapid uptake of 64Cu-NOTA-TRC105-Fab in the 4T1 tumor (3.6 ± 0.4, 4.2 ± 0.5, 4.9 ± 0.3, 4.4 ± 0.7, and 4.6 ± 0.8 %ID/g at 0.5, 2, 5, 16, and 24 h post-injection respectively; n = 4). Since tumor uptake peaked soon after tracer injection, 61Cu-labeled TRC105-Fab was also able to provide tumor contrast at 3 and 8 h post-injection. CD105 specificity of the tracer was confirmed with blocking studies and histological examination. Conclusion Herein we report PET imaging of CD105 expression with 61/64Cu-NOTA-TRC105-Fab, which exhibited prominent and target specific uptake in the 4T1 tumor. The use of a Fab fragment led to much faster tumor uptake (which peaked at a few hours after tracer injection) compared to

  13. Potent neutralization of VEGF biological activities with a fully human antibody Fab fragment directed against VEGF receptor 2

    International Nuclear Information System (INIS)

    Compelling evidence suggest that vascular endothelial growth factor (VEGF) and its receptors, especially receptor 2 (VEGFR2, or kinase insert domain-containing receptor, KDR), play a critical role in angiogenesis under both physiological and pathological conditions, including cancer and angiogenic retinopathies such as age-related macular degeneration (AMD). To this end, inhibition of angiogenesis with antagonists to either VEGF or KDR has yielded significant therapeutic efficacy both in preclinical studies in animal models and in clinical trials in patients with cancer and AMD. We previously reported the identification of a high affinity, fully human anti-KDR antibody fragment, 1121B Fab, through a highly stringent affinity maturation process with a Fab originally isolated from a naive human antibody phage display library. In this study, we demonstrate that 1121B Fab is able to strongly block KDR/VEGF interaction, resulting in potent inhibition of an array of biological activities of VEGF, including activation of the receptor and its signaling pathway, intracellular calcium mobilization, and migration and proliferation of endothelial cells. Taken together, our data lend strong support to the further development of 1121B Fab fragment as an anti-angiogenesis agent in both cancer and angiogenic retinopathies

  14. Localization of tumors in vivo by scintigraphic identification of Clostridium butyricum using 131I-labelled antibodies and F(ab')2-antibody fragments

    International Nuclear Information System (INIS)

    Tumor-bearing mice injected with clostridial spores show enrichment and germination of the spores within the tumor. 131I-labelled anti-Clostridium-antibodies and anti-Clostridium-F(ab')2-fragments were used for a possible localization of tumors in vivo by scintiscanning. The application of the antibody revealed increased radioactivity in the tumors of mice pretreated with spores as well as in animals without pretreatment. In using F(ab')2-fragments instead of total antibody neither the apparently unspecific increase of radioactivity in not pretreated mice nor the specific fixation of labelled F(ab')2-fragments to clostridial rods in the tumors of pretreated animals could be demonstrated. The results are discussed with respect to further investigation

  15. Recombinant human antibodies: linkage of an Fab fragment from a combinatorial library to an Fc fragment for expression in mammalian cell culture.

    Science.gov (United States)

    Bender, E; Woof, J M; Atkin, J D; Barker, M D; Bebbington, C R; Burton, D R

    1993-04-01

    The combinatorial phage library approach to immunoglobulin repertoire cloning recently made it possible to isolate gene fragments encoding human immunoglobulin G1 Fabs binding with high affinity to specific antigens. Here we describe the construction of genes encoding whole human anti-tetanus toxoid antibodies based on one of these gene fragments and the efficient expression of these constructs by co-transfection of separate heavy and light chain vectors into a Chinese hamster ovary cell line constitutively expressing a viral transactivator protein. This system will be generally useful for the rapid analysis of recombinant antibodies derived from combinatorial libraries. PMID:8518367

  16. Crystallization and preliminary diffraction studies of prostaglandin E2-specific monoclonal antibody Fab fragment in the ligand complex

    International Nuclear Information System (INIS)

    The Fab fragment of a monoclonal anti-prostaglandin E2 antibody was prepared and its complex with prostaglandin E2 was crystallized. Prostaglandin E2 is a major lipid mediator that regulates diverse biological processes. To elucidate how prostaglandin E2 is recognized specifically by its antibody, the Fab fragment of a monoclonal anti-prostaglandin E2 antibody was prepared and its complex with prostaglandin E2 was crystallized. The stable Fab–prostaglandin E2 complex was prepared by gel-filtration chromatography. Crystals were obtained by the microbatch method at 277 K using polyethylene glycol 4000 as a precipitant. A diffraction data set was collected to 2.2 Å resolution. The crystals belonged to space group P212121, with unit-cell parameters a = 70.3, b = 81.8, c = 82.2 Å. The asymmetric unit was suggested to contain one molecule of the Fab–prostaglandin E2 complex, with a corresponding crystal volume per protein weight of 2.75 Å3 Da−1

  17. Specific Conjugation of the Hinge Region for Homogeneous Preparation of Antibody Fragment-Drug Conjugate: A Case Study for Doxorubicin-PEG-anti-CD20 Fab' Synthesis.

    Science.gov (United States)

    Zhou, Zhan; Zhang, Jing; Zhang, Yan; Ma, Guanghui; Su, Zhiguo

    2016-01-20

    Conventional preparation strategies for antibody-drug conjugates (ADCs) result in heterogeneous products with various molecular sizes and species. In this study, we developed a homogeneous preparation strategy by site-specific conjugation of the anticancer drug with an antibody fragment. The model drug doxorubicin (DOX) was coupled to the Fab' fragment of anti-CD20 IgG at its permissive sites through a heterotelechelic PEG linker, generating an antibody fragment-drug conjugate (AFDC). Anti-CD20 IgG was digested and reduced specifically with β-mercaptoethylamine to generate the Fab' fragment with two free mercapto groups in its hinge region. Meanwhile, DOX was conjugated with α-succinimidylsuccinate ω-maleimide polyethylene glycol (NHS-PEG-MAL) to form MAL-PEG-DOX, which was subsequently linked to the free mercapto containing Fab' fragment to form a Fab'-PEG-DOX conjugate. The dual site-specific bioconjugation was achieved through the combination of highly selective reduction of IgG and introduction of heterotelechelic PEG linker. The resulting AFDC provides an utterly homogeneous product, with a definite ratio of one fragment to two drugs. Laser confocal microscopy and cell ELISA revealed that the AFDC could accumulate in the antigen-positive Daudi tumor cell. In addition, the Fab'-PEG-DOX retained appreciable targeting ability and improved antitumor activity, demonstrating an excellent therapeutic effect on the lymphoma mice model for better cure rate and significantly reduced side effects. PMID:26700095

  18. Aptamers, antibody scFv, and antibody Fab' fragments: An overview and comparison of three of the most versatile biosensor biorecognition elements.

    Science.gov (United States)

    Crivianu-Gaita, Victor; Thompson, Michael

    2016-11-15

    The choice of biosensing elements is crucial for the development of the optimal biosensor. Three of the most versatile biosensing elements are antibody single-chain Fv fragments (scFv), antibody fragment-antigen binding (Fab') units, and aptamers. This article provides an overview of these three biorecognition elements with respects to their synthesis/engineering, various immobilization techniques, and examples of their use in biosensors. Furthermore, the final section of the review compares and contrasts their characteristics (time/cost of development, ease and variability of immobilization, affinity, stability) illustrating their advantages and disadvantages. Overall, scFv fragments are found to display the highest customizability (i.e. addition of functional groups, immobilizing peptides, etc.) due to recombinant synthesis techniques. If time and cost are an issue in the development of the biosensor, Fab' fragments should be chosen as they are relatively cheap and can be developed quickly from whole antibodies (several days). However, if there are sufficient funds and time is not a factor, aptamers should be utilized as they display the greatest affinity towards their target analytes and are extremely stable (excellent biosensor regenerability). PMID:27155114

  19. Characterization of a Human Antibody Fragment Fab and Its Calcium Phosphate Nanoparticles that Inhibit Rabies Virus Infection with Vaccine

    OpenAIRE

    Liu, Xinjian; Lin, Hong; Tang, Qi; Li, Chen; Yang, Songtao; Wang, Zhongcan; Wang, Changjun; He, Qing; Cao, Brian; Feng, Zhenqing; Guan, Xiaohong; Zhu, Jin

    2011-01-01

    Recombinant antibody phage display technology has been used to mimic many aspects of the processes that govern the generation and selection of high-affinity natural human antibodies in the human immune system, especially for infectious disease prophylaxis. An anti-rabies virus immunized phage-display Fab library was constructed from peripheral blood lymphocytes from vaccinated volunteers. The immunized antibody library, with a diversity of 6.7×108, was used to select and produce antibodies th...

  20. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment

    OpenAIRE

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo

    2013-01-01

    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spe...

  1. Crystallization and preliminary X-ray diffraction analysis of prion protein bound to the Fab fragment of the POM1 antibody

    International Nuclear Information System (INIS)

    The complex of MoPrP(120–232) and Fab POM1 has been crystallized (space group C2, unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°). Diffraction data to 2.30 Å resolution have been collected using synchrotron radiation. Prion diseases are neurodegenerative diseases that are characterized by the conversion of the cellular prion protein PrPc to the pathogenic isoform PrPsc. Several antibodies are known to interact with the cellular prion protein and to inhibit this transition. An antibody Fab fragment, Fab POM1, was produced that recognizes a structural motif of the C-terminal domain of mouse prion protein. To study the mechanism by which Fab POM1 recognizes and binds the prion molecule, the complex between Fab POM1 and the C-terminal domain of mouse prion (residues 120–232) was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group C2, with unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°

  2. Detection of pulmonary embolism with 99mTc-Labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody in dogs

    International Nuclear Information System (INIS)

    Pulmonary embolism is a common and potentially life-threatening condition, and its correct diagnosis is highly desirable before anticoagulant therapy is initiated. However, the safe and accurate diagnosis of acute pulmonary embolism remains a challenge. Single photon emission computed tomography (SPECT) is a highly sensitive scintigraphic imaging technique. Pulmonary embolism can be detected by SPECT with 99mTc-labeled imaging agents that bind to components present predominantly on thromboemboli. P-selectin is an adhesion glycoprotein that is expressed in platelets and endothelial cells. P-selectin on activated platelets is a suitable biomarker of the active thrombus process. The objective of this study was to evaluate 99mTc-labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody SZ51, 99mTc-SZ51-F(ab)2, for imaging pulmonary embolism in beagle canines. SZ51 was digested to F(ab)2 fragment, named SZ51-F(ab)2, and its specific binding to P-selectin on either human or canine platelets was verified by flow cytometry assay. In each dog, an 18-gauge catheter was inserted into left or right pulmonary artery, and a two-stranded spiral stainless-steel coil (20 mm) was inserted through catheter. At 30 min after coil placement, X-ray angiography was performed to document the pulmonary embolism and the locations of the coil. After intravenous injection of 99mTc-SZ51-F(ab)2, experimental thrombi in dogs could be consistently visualized for 2-3 hours by SPECT. Pulmonary embolism showed higher uptake of 99mTc-SZ51-F(ab)2. The present study suggests that 99mTc-SZ51-F(ab)2 may be a promising agent for detecting pulmonary embolism. (author)

  3. Crystallization and preliminary X-ray diffraction analysis of the Fab fragment of WO2, an antibody specific for the Aβ peptides associated with Alzheimer’s disease

    International Nuclear Information System (INIS)

    Crystallization and X-ray diffraction data collection of the Fab fragment of the monoclonal antibody WO2 in the absence or presence of amyloid β peptides associated with Alzheimer’s disease are reported. The murine monoclonal antibody WO2 specifically binds the N-terminal region of the amyloid β peptide (Aβ) associated with Alzheimer’s disease. This region of Aβ has been shown to be the immunodominant B-cell epitope of the peptide and hence is considered to be a basis for the development of immunotherapeutic strategies against this prevalent cause of dementia. Structural studies have been undertaken in order to characterize the molecular basis for antibody recognition of this important epitope. Here, details of the crystallization and X-ray analysis of the Fab fragment of the unliganded WO2 antibody in two crystal forms and of the complexes that it forms with the truncated Aβ peptides Aβ1–16 and Aβ1–28 are presented. These crystals were all obtained using the hanging-drop vapour-diffusion method at 295 K. Crystals of WO2 Fab were grown in polyethylene glycol solutions containing ZnSO4; they belonged to the orthorhombic space group P212121 and diffracted to 1.6 Å resolution. The complexes of WO2 Fab with either Aβ1–@@16 or Aβ1–28 were cocrystallized from polyethylene glycol solutions. These two complex crystals grew in the same space group, P212121, and diffracted to 1.6 Å resolution. A second crystal form of WO2 Fab was grown in the presence of the sparingly soluble Aβ1–42 in PEG 550 MME. This second form belonged to space group P21 and diffracted to 1.9 Å resolution

  4. Crystallization and preliminary X-ray diffraction analysis of the Fab fragment of WO2, an antibody specific for the Aβ peptides associated with Alzheimer’s disease

    Energy Technology Data Exchange (ETDEWEB)

    Wun, Kwok S. [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Miles, Luke A. [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, 30 Flemington Road, Parkville, Victoria 3010 (Australia); Crespi, Gabriela A. N. [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Wycherley, Kaye [WEHI Biotechnology Centre, La Trobe R& D Park, Bundoora, Victoria 3086 (Australia); Ascher, David B. [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Barnham, Kevin J.; Cappai, Roberto [Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, 30 Flemington Road, Parkville, Victoria 3010 (Australia); Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); The Mental Health Research Institute of Victoria, Parkville, Victoria 3052 (Australia); Beyreuther, Konrad [ZMBH, University of Heidelberg, Heidelberg (Germany); Masters, Colin L. [Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); The Mental Health Research Institute of Victoria, Parkville, Victoria 3052 (Australia); Parker, Michael W. [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, 30 Flemington Road, Parkville, Victoria 3010 (Australia); McKinstry, William J., E-mail: wjmckinstry@hotmail.com [Biota Structural Biology Laboratory and Centre for Structural Neurobiology, St Vincent’s Institute of Medical Research, 41 Victoria Parade, Fitzroy, Victoria 3065 (Australia); Department of Medicine (St Vincent’s Hospital), The University of Melbourne, 41 Victoria Parade, Fitzroy 3065 (Australia)

    2008-05-01

    Crystallization and X-ray diffraction data collection of the Fab fragment of the monoclonal antibody WO2 in the absence or presence of amyloid β peptides associated with Alzheimer’s disease are reported. The murine monoclonal antibody WO2 specifically binds the N-terminal region of the amyloid β peptide (Aβ) associated with Alzheimer’s disease. This region of Aβ has been shown to be the immunodominant B-cell epitope of the peptide and hence is considered to be a basis for the development of immunotherapeutic strategies against this prevalent cause of dementia. Structural studies have been undertaken in order to characterize the molecular basis for antibody recognition of this important epitope. Here, details of the crystallization and X-ray analysis of the Fab fragment of the unliganded WO2 antibody in two crystal forms and of the complexes that it forms with the truncated Aβ peptides Aβ{sub 1–16} and Aβ{sub 1–28} are presented. These crystals were all obtained using the hanging-drop vapour-diffusion method at 295 K. Crystals of WO2 Fab were grown in polyethylene glycol solutions containing ZnSO{sub 4}; they belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.6 Å resolution. The complexes of WO2 Fab with either Aβ{sub 1–@}@{sub 16} or Aβ{sub 1–28} were cocrystallized from polyethylene glycol solutions. These two complex crystals grew in the same space group, P2{sub 1}2{sub 1}2{sub 1}, and diffracted to 1.6 Å resolution. A second crystal form of WO2 Fab was grown in the presence of the sparingly soluble Aβ{sub 1–42} in PEG 550 MME. This second form belonged to space group P2{sub 1} and diffracted to 1.9 Å resolution.

  5. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment

    Science.gov (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo

    2013-01-01

    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. 61/64Cu-labeling of NOTA-TRC105-F(ab')2 (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of > 75% (specific activity: ~115 GBq/μmol). PET imaging revealed rapid tumor uptake of 64Cu-NOTA TRC105-F(ab')2 in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7 %ID/g at 0.5, 3, 16, 24, and 48 h post-injection respectively; n = 4). Since tumor uptake peaked at 3 h post-injection, 61Cu-NOTA-TRC105-F(ab')2 also gave good tumor contrast at 3 and 8 h post-injection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')2 fragment led to more rapid tumor uptake (which peaked at 3 h post-injection) than radiolabeled intact antibody (which often peaked after 24 h post-injection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  6. Positron emission tomography imaging of tumor angiogenesis with a (61/64)Cu-labeled F(ab')(2) antibody fragment.

    Science.gov (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F; Nayak, Tapas R; Bean, Jero; Theuer, Charles P; Barnhart, Todd E; Cai, Weibo

    2013-02-01

    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')(2) fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e., endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after (61/64)Cu-labeling. TRC105-F(ab')(2) of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. (61/64)Cu-labeling of NOTA-TRC105-F(ab')(2) (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of >75% (specific activity: ∼115 GBq/μmol). PET imaging revealed rapid tumor uptake of (64)Cu-NOTA-TRC105-F(ab')(2) in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7% ID/g at 0.5, 3, 16, 24, and 48 h postinjection respectively; n = 4). Since tumor uptake peaked at 3 h postinjection, (61)Cu-NOTA-TRC105-F(ab')(2) also gave good tumor contrast at 3 and 8 h postinjection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')(2) fragment led to more rapid tumor uptake (which peaked at 3 h postinjection) than radiolabeled intact antibody (which often peaked after 24 h postinjection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  7. ImmunoPET of tissue factor expression in triple-negative breast cancer with a radiolabeled antibody Fab fragment

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Sixiang [University of Wisconsin, Materials Science Program, Madison, WI (United States); Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D. [University of Wisconsin, Department of Radiology, Madison, WI (United States); Graves, Stephen A.; Nickles, Robert J. [University of Wisconsin, Department of Medical Physics, Madison, WI (United States); Liu, Bai; Wong, Hing C. [Altor BioScience, Miramar, FL (United States); Cai, Weibo [University of Wisconsin, Materials Science Program, Madison, WI (United States); University of Wisconsin, Department of Radiology, Madison, WI (United States); University of Wisconsin, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States); University of Wisconsin, Departments of Radiology and Medical Physics, Madison, WI (United States)

    2015-07-15

    To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and {sup 64}Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of {sup 64}Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of {sup 64}Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. {sup 64}Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)

  8. Bacterial expression and purification of recombinant bovine Fab fragments.

    Science.gov (United States)

    O'Brien, Philippa M; Maxwell, Gavin; Campo, M Saveria

    2002-02-01

    We have previously described a recombinant phagemid expression vector, pComBov, designed for the production of native sequence bovine monoclonal antibodies (mAb) generated by antibody phage display. Bovine mAb Fab fragments isolated from libraries constructed using pComBov in Escherichia coli strain XL1-Blue, which is routinely used for antibodies expressed on the surface of phage, were expressed at very low yields. Therefore, a study was undertaken to determine optimal growth conditions for maximal expression of bovine Fab fragments in E. coli. By varying the E. coli strain, and the temperature and length of the culture growth, we were able to substantially increase the yield of soluble Fab fragments. A high yield of Fab fragments was found in the culture growth medium, which enabled us to devise a rapid and simple single-step method for the purification of native (nondenatured) Fabs based on immobilized metal affinity chromatography against a six-histidine amino acid carboxyl-terminal extension of the heavy-chain constant region. Using these methods we were able to express and purify antigen-specific bovine Fab fragments from E. coli. PMID:11812221

  9. The Fab fragment of a directly activating monoclonal antibody that precipitates a disulfide-linked heterodimer from a helper T cell clone blocks activation by either allogeneic Ia or antigen and self-Ia

    OpenAIRE

    1984-01-01

    We characterize a monoclonal antibody directed against the antigen/Ia receptor of a cloned helper T cell line that induced T cell clone proliferation and T cell clone-dependent B cell proliferation at antibody concentrations as low as 10(-11) M. A Fab fragment of this antibody was not stimulatory, implicating cross-linking of antigen receptors as the primary signal for T cell activation. The Fab fragment inhibited activation of this clone by both allogeneic Ia and antigen plus self-Ia, but no...

  10. Biodistribution in normal mice of an 111In-labelled prostatic acid phosphatase-specific antibody and its F(ab')2 fragments derivatized site-specifically or via bicyclic diethylenetriaminepentaacetic acid anhydride

    International Nuclear Information System (INIS)

    We examined the optimization of derivatization of monoclonal antibodies and their fragments intended for use as radiopharmaceutical in radioimaging and/or radioimmunotherapy of prostatic cancer. Two different principles were used to conjugate (DTPA) to a monoclonal antibody (Mab, subclass IgG1) raised against human prostatic acid phosphatase (PAP). In addition, the F(ab')2 fragments of this Mab were also derivatized. The biodistribution of the 111In-labelled derivatives was investigated in normal mice. All the derivatives of IgG1 demonstrated a slower blood clearance than the corresponding derivatives of the F(ab')2 fragments. This property was particularly pronounced in the site-specifically conjugated derivatives of IgG1. All the derivatives studied accumulated in the liver, kidney, and spleen. The CA-DTPA derivatives of F(ab')2 fragments showed the highest kidney-to-blood ratios of radioactivity. The derivatives of IgG1 showed a higher percentage of the injected dose in liver and spleen tissues than the derivatives of the F(ab')2 fragments. The F(ab')2 fragments studied also gave rise to site-specific derivatives, which demonstrated that carbohydrates were also present in this part of the molecule. They behaved similarly to the CA-DTPA F(ab')2 derivative in other respects, but the kidney accumulation was lower at 72 and 120 h. The F(ab')2 fragments studied would be better suited for radioimaging than the derivatives of the IgG1 studied. In contrast, the derivatives of IgG1, especially the p-NH2-Bz-DTPA conjugate, might be more suitable candidates for the development of therapeutic agents. (orig.)

  11. Crystallization and preliminary X-ray diffraction analysis of two peptides from Alzheimer PHF in complex with the MN423 antibody Fab fragment

    International Nuclear Information System (INIS)

    Crystals of the paired helical filaments (PHF) specific monoclonal antibody MN423 grown in the presence of two synthetic peptides derived from the PHF tau protein were analysed by X-ray techniques and the structure was solved by molecular replacement. The major constituent of the Alzheimer’s disease paired helical filaments (PHF) core is the intrinsically disordered protein (IDP) tau. Globular binding partners, e.g. monoclonal antibodies, can stabilize the fold of disordered tau in complexes. A previously published structure of a proteolytically generated tau fragment in a complex with the PHF-specific monoclonal antibody MN423 revealed a turn-like structure of the PHF core C-terminus [Sevcik et al. (2007 ▶). FEBS Lett.581, 5872–5878]. To examine the structures of longer better-defined PHF segments, crystals of the MN423 Fab fragment were grown in the presence of two synthetic peptides derived from the PHF core C-terminus. For each, X-ray diffraction data were collected at 100 K at a synchrotron source and initial phases were obtained by molecular replacement

  12. Antibody fragments: Hope and hype

    OpenAIRE

    Nelson, Aaron L

    2010-01-01

    The antibody molecule is modular and separate domains can be extracted through biochemical or genetic means. It is clear from review of the literature that a wave of novel, antigen-specific molecular forms may soon enter clinical evaluation. This report examines the developmental histories of therapeutics derived from antigen-specific fragments of antibodies produced by recombinant processes. Three general types of fragments were observed, antigen-binding fragments (Fab), single chain variabl...

  13. Crystal structure of a Staphylococcus aureus protein A domain complexed with the Fab fragment of a human IgM antibody: Structural basis for recognition of B-cell receptors and superantigen activity

    OpenAIRE

    Graille, Marc; Stura, Enrico A; Corper, Adam L.; Sutton, Brian J.; Michael J. Taussig; Charbonnier, Jean-Baptiste; Silverman, Gregg J.

    2000-01-01

    Staphylococcus aureus produces a virulence factor, protein A (SpA), that contains five homologous Ig-binding domains. The interactions of SpA with the Fab region of membrane-anchored Igs can stimulate a large fraction of B cells, contributing to lymphocyte clonal selection. To understand the molecular basis for this activity, we have solved the crystal structure of the complex between domain D of SpA and the Fab fragment of a human IgM antibody to 2.7-Å resolution. In the complex, helices II ...

  14. Topical skin treatment with Fab fragments of an allergen-specific IgG1 monoclonal antibody suppresses allergen-induced atopic dermatitis-like skin lesions in mice.

    Science.gov (United States)

    Sae-Wong, Chutha; Mizutani, Nobuaki; Kangsanant, Sureeporn; Yoshino, Shin

    2016-05-15

    Fab fragments (Fabs), which lack effector functions due to the absence of the Fc portion, maintain the ability to bind to specific allergens. In the present study, we examined whether Fabs of an allergen-specific IgG1 monoclonal antibody (mAb) were able to regulate allergen-induced atopic dermatitis-like skin lesions in mice. BALB/c mice passively sensitized with ovalbumin (OVA)-specific IgE mAb were repeatedly challenged with OVA applied to the skin after sodium dodecyl sulfate treatment. Fabs prepared by the digestion of anti-OVA IgG1 mAb (O1-10) with papain were applied to the skin 30min before the OVA challenges followed by measurement of clinical symptoms including erythema/hemorrhage, edema, scarring/dryness, and excoriation/erosion of the skin. Treatment with O1-10 Fabs, but not intact O1-10, showed inhibition of clinical symptoms (Pskin of mice is effective in suppressing allergen-induced atopic dermatitis-like skin lesions, suggesting that allergen-specific mAb Fabs could be used as a tool to regulate allergen-induced atopic dermatitis. PMID:26970183

  15. Modification of fibrin network ultrastructure by Fab fragments specific for different domain of fibrinogen.

    Science.gov (United States)

    Cierniewski, C S; Janiak, A; Wyroba, E

    1986-01-01

    Kinetics of inhibition of fibrin monomer polymerization produced by Fab fragments prepared from immunochemically purified monospecific antibodies to the surface epitopes of different domains of fibrinogen molecule has been correlated with electron microscopic observations of resulting specimens. Fab fragments prepared from anti FgD antisera were the most efficient inhibitors of thrombin-catalysed conversion of fibrinogen to fibrin; polymerization of fibrin monomers as detected spectrophotometrically was abolished at 2:1 molar ratio of anti FgD Fab fragments to fibra monomer. These Fab fragments acting as a steric hindrance of polymerization sites inhibited the first stage of fibrin monomer aggregation. Interaction of Fab fragments derived from antibodies specific for alpha 239-476 with corresponding segment of fibrinogen molecule resulted in a weak inhibition of fibrin monomer polymerization. However, fibrin obtained in the presence of these Fab fragments was significantly modified and showed no periodicity. This observation may suggest that anti alpha 239-476 Fab impaired the course of the second stage of fibrin monomer polymerization, i.e. lateral association of fibrin fibrils. PMID:2433859

  16. Improved immunoscintigraphy by subcutaneous injection of sup(99m)Tc or 111In labelled F(ab')2 fragments of an anti-melanoma monoclonal antibody

    International Nuclear Information System (INIS)

    Technetium-99m and/or 111In labelled F(ab')2 fragments of a melanoma associated MoAb 225.28S were injected i.v. in 80 patients affected by stage I to IV malignant melanoma. 75% of metastatic lesions already documented by other methods were detected by immunoscintigraphy, which was also capable of detecting a certain number of unknown metastases. The authors observed a lower percentage of positive scans in liver, lung and skin because of the poor tumour to background ratio. In some patients, subcutaneous (s.c.) injection allowed visualization documented metastases undetected by i.v. administration. An equal amount on non-specific F(ab')2 fragments (MoAb 4C4) injected s.c. as a negative control showed no positive scans. Clinical studies and chromatographic patterns of patient serum samples suggest that the s.c. route of administration offers, with respect to the the i.v. route, the advantage of reducing vascular background and aspecific accumulation in liver, probably because of retention of possible contaminants by the lymphatic system. (author)

  17. Crystallization and diffraction properties of the Fab fragment of 3B5H10, an antibody specific for disease-causing polyglutamine stretches

    International Nuclear Information System (INIS)

    Optimization of crystallization conditions and cryoprotectants decreased the anisotropy of the diffraction obtained from 3B5H10 Fab crystals. Dehydration improved the resolution of cryoprotected 3B5H10 crystals from 2.6 to 1.9 Å, but changed the space group of the crystals from P21212 to P21. Because it binds soluble forms of proteins with disease-associated polyglutamine expansions, the antibody 3B5H10 is a powerful tool for studying polyglutamine-related diseases. Crystals of the 3B5H10 Fab (47 kDa) were obtained by vapor diffusion at room temperature from PEG 3350. However, the initial crystals gave highly anisotropic diffraction patterns. After optimization of the crystallization conditions and cryoprotectants, a nearly isotropic diffraction pattern at 2.6 Å resolution was achieved for crystals with unit-cell parameters a = 133.26, b = 79.52, c = 41.49 Å and space group P21212. Dehydrated crystals diffracted isotropically to 1.9 Å with unit-cell parameters a = 123.65, b = 78.25, c = 42.26 Å, β = 90.3° and space group P21

  18. Anti-fouling properties of Fab' fragments immobilized on silane-based adlayers

    Science.gov (United States)

    Crivianu-Gaita, Victor; Romaschin, Alexander; Thompson, Michael

    2015-12-01

    Biosensors require surfaces that are highly specific towards the target analyte and that are minimally fouling. However, surface tuning to minimize fouling is a difficult task. The last decade has seen an increase in the use of immobilized antigen-binding antibody fragments (Fab') in biosensors. One Fab' linker compound S-(11-trichlorosilyl-undecanyl)-benzothiosulfonate (TUBTS) and three spacers were used to create the silane-based adlayers. The ultra-high frequency electromagnetic piezoelectric acoustic sensor (EMPAS) was used to gauge the fouling properties of the various surfaces using bovine serum albumin (BSA), goat IgG, and mouse serum. X-ray photoelectron spectroscopy (XPS), contact angle, and atomic force microscopy (AFM) were employed to characterize the surfaces. It was discovered that immobilized oriented Fab' fragments reduced the fouling levels of surfaces up to 80% compared to the surfaces without fragments. An explanation for this phenomenon is that the antibody fragments increase the hydration of the surfaces and aid in the formation of an anti-fouling water barrier. The anti-fouling effect of the Fab' fragments is at its maximum when there is an even distribution of fragments across the surfaces. Finally, using Fab'-covered surfaces, a cancer biomarker was detected from serum, showing the applicability of this work to the field of biodetection.

  19. Effects of tumour mass and circulating antigen on the biodistribution of 111In-labelled F(ab')2 fragments of human prostatic acid phosphatase monoclonal antibody in nude mice bearing PC-82 human prostatic tumor xenografts

    International Nuclear Information System (INIS)

    We have evaluated the effects of tumour mass and circulating antigen (prostatic acid phosphatase, PAP) on the biodistribution and the incorporation of 111In-labelled F(ab')2 monoclonal antibody (MoAb) fragments directed against human PAP into human prostatic tumours (PC-82; 0.1-8.9 g) growing in nude mice. The radioactivities in the blood, liver, spleen, kidney and tumour were compared at 1, 3, 4 and 6 days after the intravenous administration of the antibody fragments. There was a significant correlation between the tumour size and the serum PAP concentration in the model employed. Even tissue of a small tumour (111In-labelled F(ab')2 fragments. This relationship had levelled off by 72 h and most likely reflected a better vascularisation of the smaller tumours. Our results show that the increase in tumour size and in the concentration of circulating antigen in the blood led to decreased tumour-to-blood ratios, since there was a tendency for higher blood activities in mice with larger tumours and higher serum PAP concentrations. There was no correlation between tumour size and label uptake by the liver during the follow-up over 144 h, although serum PAP concentrations ranged from 3.1 μg/l to 352 μg/l. On the other hand, when compared with our previous data obtained with non-tumour-bearing mice, there was a significant increase in the uptake by the liver and spleen. These results indicate that even a small concentration of circulating antigen was able to trigger an abnormal change in the biodistribution of MoAbs. (orig.)

  20. Radioimmunodetection of lymph node invasion in prostatic cancer. The use of iodine-123 (123I)-labeled monoclonal anti-prostatic acid phosphatase (PAP) 227 A F(ab')2 antibody fragments in vivo

    International Nuclear Information System (INIS)

    The therapeutic indications in prostatic cancer depend on the regional and distant extension of the cancer and are difficult to assess before lymphadenectomy. Radioimmunodetection of lymph node involvement with monoclonal anti-prostatic acid phosphatase (PAP) antibodies can be proposed as a noninvasive alternative to lymphadenectomy. Fifteen patients with various stages of histologically proven prostatic cancer were examined by immunolymphoscintigraphy (ILS) before treatment to detect lymph node metastases. These patients had Stage A (n = 7), Stage B (n = 3), Stage C (n = 2), and Stage D (n = 3) tumors. They received between 100 and 400 micrograms of monoclonal antibody 227 A in the form of F(ab')2 fragments labeled with iodine-123 (123I). The antibody was injected directly into the periprostatic area. ILS images were obtained after 1, 3, 6, and 24 hours. Three days later, each patient underwent a lymphadenectomy for histologic examination. The results of the histologic examination and ILS were compared. In ten patients, the examination did not show any images capable of being interpreted as lymphadenopathy and histologic examination confirmed the integrity of the nodes examined. In five cases, scintigraphy suggested the presence of lymph node invasion by prostatic cancer and this was confirmed by histologic examination in three of the five cases. Overall, in terms of lymphadenopathy, this examination had a sensitivity of 100% and a specificity of 83%. Therefore, ILS appears to be capable of detecting lymph node metastases in prostatic cancer

  1. Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

    Science.gov (United States)

    Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

    2015-11-01

    Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. PMID:26271437

  2. Characterization of Human Colorectal Cancer MDR1/P-gp Fab Antibody

    OpenAIRE

    Xuemei Zhang; Gary Guishan Xiao; Ying Gao

    2013-01-01

    In this study, the peptide sized 21 kDa covering P-gp transmembrane region was first prepared for generating a novel mouse monoclonal antibody Fab fragment with biological activity against multiple drug resistance protein P-gp21 by phage display technology. Phage-displayed antibody library prepared from mice spleen tissues was selected against the recombinant protein P-gp21 with five rounds of panning. A number of clones expressing Fab bound to P-gp21, showing neutralized activity in vitro, w...

  3. 21 CFR 866.5520 - Immunoglobulin G (Fab fragment specific) immunological test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fab fragment specific... Test Systems § 866.5520 Immunoglobulin G (Fab fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fab fragment specific) immunological test system is a device that...

  4. Construction and selection of the natural immune Fab antibody phage display library from patients with colorectal cancer

    Institute of Scientific and Technical Information of China (English)

    Bao-Ping Wu; Bing Xiao; Tian-Mo Wan; Ya-Li Zhang; Zhen-Shu Zhang; Dian-Yuan Zhou; Zhuo-Sheng Lai; Chun-Fang Gao

    2001-01-01

    AIM: To construct the natural immune Fab antibody phage display libraries of colorectal cancer and to select antibodies related with colorectal cancer. METHODS: Extract total RNA from tissue of local cancer metastasis lymph nodes of patients with colorectal cancer.RT-PCR was used to amplify the heavy chain Fd and light chain к and the amplification products were inserted successively into the vector pComb3 to construct the human libraries of Fab antibodies. They were then panned by phage display technology. By means of Dot immunoblotting and ELISA, the libraries were identified and the Fab phage antibodies binding with antigens of colorectal cancer were selected. RESULTS: The amplified fragments of Fd and к gained by RT-PCR were about 650bp. Fd and к PCR products were subsequently inserted into the vector pComb3, resulting in a recombination rate of 40% and the volume of Fab phage display library reached 1.48 x 106. The libraries were enriched about 120-fold by 3 cycles of adsorption-elution- multiplication (panning). Dot immunoblotting showed Fab expressions on the phage libraries and ELISA showed 5clones of Fab phage antibodies which had binding activities with antigens of colorectal cancer. CONCLUSION: The natural immune Fab antibody phage display libraries of colorectal cancer were constructed. They could be used to select the relative antibodies of colorectal cancer.

  5. RECOMBINANT PRODUCTION OF HORSERADISH PEROXIDASE CONJUGATES WITH FAB ANTIBODIES IN PICHIA PASTORIS FOR ANALYTICAL APPLICATIONS

    OpenAIRE

    Koliasnikov, O.; Grigorenko, V.; Egorov, A.; S. Lange(Justus Liebig-Universität Gie\\ssen II Physikalisches Institut, Germany); Schmid, R

    2011-01-01

    Recombinant immunoconjugates of marker enzymes with antigens or antibodies present considerably more advantages than those obtained by conventional methods of chemical synthesis; i.e. they are homogeneous, have a strictly determined stoichiometry, and retain the functional activity of both a marker protein and an antigen/antibody. Based on the pPICZαB shuttle vector, we first managed to obtain a recombinant conjugate of key marker enzyme horseradish peroxidase (HRP) with Fab fragments of anti...

  6. Detection of irradiation-induced, membrane heat shock protein 70 (Hsp70) in mouse tumors using Hsp70 Fab fragment

    International Nuclear Information System (INIS)

    Background and purpose: The major stress-inducible heat shock protein 70 (Hsp70) is frequently overexpressed in highly aggressive tumors, and elevated intracellular Hsp70 levels mediate protection against apoptosis. Following therapeutic intervention, such as ionizing irradiation, translocation of cytosolic Hsp70 to the plasma membrane is selectively increased in tumor cells and therefore, membrane Hsp70 might serve as a therapy-inducible, tumor-specific target structure. Materials and methods: Based on the IgG1 mouse monoclonal antibody (mAb) cmHsp70.1, we produced the Hsp70-specific recombinant Fab fragment (Hsp70 Fab), as an imaging tool for the detection of membrane Hsp70 positive tumor cells in vitro and in vivo. Results: The binding characteristics of Hsp70 Fab towards mouse colon (CT26) and pancreatic (1048) carcinoma cells at 4 deg. C were comparable to that of cmHsp70.1 mAb, as determined by flow cytometry. Following a temperature shift to 37 deg. C, Hsp70 Fab rapidly translocates into subcellular vesicles of mouse tumor cells. Furthermore, in tumor-bearing mice Cy5.5-conjugated Hsp70 Fab, but not unrelated IN-1 control Fab fragment (IN-1 ctrl Fab), gradually accumulates in CT26 tumors between 12 and 55 h after i.v. injection. Conclusions: In summary, the Hsp70 Fab provides an innovative, low immunogenic tool for imaging of membrane Hsp70 positive tumors, in vivo.

  7. In Vitro Selection of Fab Fragments by mRNA Display and Gene-Linking Emulsion PCR

    Directory of Open Access Journals (Sweden)

    Takeshi Sumida

    2012-01-01

    Full Text Available In vitro selection by display methods has been an effective tool for engineering recombinant antibodies. mRNA display based on a cell-free translation system has the advantages of larger library sizes and quicker selection procedures compared with cell-based display methods such as phage display. However, mRNA display has been limited to select single-chain polypeptides such as scFvs due to its characteristic of linking a nascent polypeptide with its encoding mRNA on the ribosome. Here we demonstrated a new way of selecting heterodimeric Fab fragments by using mRNA display combined with emulsion PCR. We designed a pair of complementary 5′ UTR sequences that can link the Fab heavy and light chain genes together by overlap-extension PCR in water-in-oil emulsions. We confirmed that two mRNA-displayed polypeptides for heavy and light chain of a model Fab fragment were associated into the active form and that a specific Fab fragment gene was enriched over 100-fold per round of a model affinity selection followed by the gene-linking emulsion PCR. We further performed directed evolution of Fab fragments with higher binding activity from a randomized Fab fragment library.

  8. The crystal structure of sphingosine-1-phosphate in complex with a Fab fragment reveals metal bridging of an antibody and its antigen

    OpenAIRE

    Wojciak, Jonathan M.; Zhu, Norman; Schuerenberg, Karen T.; Moreno, Kelli; Shestowsky, William S.; Hiraiwa, Masao; Sabbadini, Roger; Huxford, Tom

    2009-01-01

    The pleiotropic signaling lipid sphingosine-1-phosphate (S1P) plays significant roles in angiogenesis, heart disease, and cancer. LT1009 (also known as sonepcizumab) is a humanized monoclonal antibody that binds S1P with high affinity and specificity. Because the antibody is currently in clinical trials, it is important to confirm by structural and biochemical analyses that it binds its target in a predictable manner. Therefore, we determined the structure of a complex between the LT1009 anti...

  9. Imaging of soft-tissue sarcomas with indium-111-labeled monoclonal antimyosin Fab fragments

    Energy Technology Data Exchange (ETDEWEB)

    Kairemo, K.J.; Wiklund, T.A.; Liewendahl, K.; Miettinen, M.; Heikkonen, J.J.; Virkkunen, P.J.; Aronen, H.J.; Blomqvist, C.P. (Helsinki Univ. Central Hospital (Finland))

    1990-01-01

    Some soft-tissue sarcomas contain intracellular myosin. We therefore studied the possibility of localizing various soft-tissue sarcomas with {sup 111}In-labeled monoclonal antibody Fab fragments binding specifically to myosin, assuming that damage to the cell membrane could expose intracellular myosin. Nineteen patients with different types of soft-tissue sarcomas were studied. Eighteen patients were found to have abnormal antibody uptakes. Antibody uptake was not observed in an additional patient operated for a benign tumor (gastric leiomyoma). The immunoscintigraphy results were generally in good agreement with those of other radiologic findings (computed tomography, ultrasound, magnetic resonance imaging). Surprisingly, the immunohistochemistry results showed that tumors not stainable for myosin can also be imaged with antimyosin. Thus, the mechanism of antibody uptake does not seem to be related entirely to specific antigen recognition. Irrespective of the exact mechanism for the uptake of labeled antibody this method appears to be useful for localizing soft-tissue sarcomas.

  10. Use of amiodarone and digoxin specific Fab antibodies in digoxin overdosage.

    OpenAIRE

    Nicholls, D P; Murtagh, J. G.; Holt, D W

    1985-01-01

    A 61 year old man with mild aortic stenosis and chronic depression took 12.5 mg digoxin in a suicide attempt. Ventricular tachycardia and fibrillation were resistant to lignocaine and to phenytoin but responded to intravenous amiodarone, with restoration of pacing. Because of persistent hyperkalaemia he was also treated with Fab fragments of digoxin specific antibody, which bound most of the ingested digoxin. It is suggested that the treatment of choice in severe digoxin poisoning is amiodaro...

  11. Characterization and crystallization of a recombinant IgE Fab fragment in complex with the bovine β-lactoglobulin allergen

    International Nuclear Information System (INIS)

    The high-resolution mass-spectrometric characterization, crystallization and X-ray diffraction studies of a recombinant IgE Fab fragment in complex with bovine β-lactoglobulin are reported. A D1 Fab fragment containing the allergen-binding variable domains of the IgE antibody was characterized by ESI FT–ICR mass spectrometry and crystallized with bovine β-lactoglobulin (BLG) using the hanging-drop vapour-diffusion method at 293 K. X-ray data suitable for structure determination were collected to 2.8 Å resolution using synchrotron radiation. The crystal belonged to the orthorhombic space group P212121, with unit-cell parameters a = 67.0, b = 100.6, c = 168.1 Å. The three-dimensional structure of the D1 Fab fragment–BLG complex will provide the first insight into IgE antibody–allergen interactions at the molecular level

  12. A single-domain antibody-linked Fab bispecific antibody Her2-S-Fab has potent cytotoxicity against Her2-expressing tumor cells.

    Science.gov (United States)

    Li, Aifen; Xing, Jieyu; Li, Li; Zhou, Changhua; Dong, Bin; He, Ping; Li, Qing; Wang, Zhong

    2016-12-01

    Her2, which is frequently overexpressed in breast cancer, is one of the most studied tumor-associated antigens for cancer therapy. Anti-HER2 monoclonal antibody, trastuzumab, has achieved significant clinical benefits in metastatic breast cancer. In this study, we describe a novel bispecific antibody Her2-S-Fab targeting Her2 by linking a single domain anti-CD16 VHH to the trastuzumab Fab. The Her2-S-Fab antibody can be efficiently expressed and purified from Escherichia coli, and drive potent cancer cell killing in HER2-overexpressing cancer cells. In xenograft model, the Her2-S-Fab suppresses tumor growth in the presence of human immune cells. Our results suggest that the bispecific Her2-S-Fab may provide a valid alternative to Her2 positive cancer therapy. PMID:27112931

  13. Purification and characterization of Fab fragments with rapid reaction kinetics against myoglobin.

    Science.gov (United States)

    Song, Hyung-Nam; Kim, Dong-Hyung; Park, Sung-Goo; Lee, Myung Kyu; Paek, Se-Hwan; Woo, Eui-Jeon

    2015-01-01

    Myoglobin is an early biomarker for acute myocardial infarction. Recently, we isolated the antibody IgG-Myo2-7ds, which exhibits unique rapid reaction kinetics toward human myoglobin antigen. Antibodies with rapid dissociation kinetics are thought to be premature IgG forms that are produced during the early stage of in vivo immunization. In the present study, we identified the epitope region of the IgG-Myo2-7ds antibody to be the C-terminal region of myoglobin, which corresponds to 144-154 aa. The Fab fragment was directly purified by papain cleavage and protein G affinity chromatography and demonstrated kinetics of an association constant of 4.02 × 10(4) M(-1) s(-1) and a dissociation constant of 2.28 × 10(-2) s(-1), which retained the unique reaction kinetics of intact IgG-Myo2-7ds antibodies. Because a rapid dissociation antibody can be utilized for antibody recycling, the results from this study would provide a platform for the development of antibody engineering in potential diagnostic areas such as a continuous monitoring system for heart disease. PMID:25561012

  14. In vivo evaluation of an anti-melanoma antibody, F(ab')2, labelled with Tc-99m

    International Nuclear Information System (INIS)

    On the basis of the high specificity of the antigen-antibody reaction, tumor antigens can be recognized in vivo by specific antibodies, labelled with gamma emitting radionuclides (I-131, I-123, In-111, Tc-99m). Immunoscintigraphic detection of different human tumours has been obtained. A further improvement in the technique has been produced by the use of labelled purified FAb fragments, i.e. without Fc, the main cause of aspecific bonds. Divalent fragments, F(ab')2, have a better target/background ratio and show a faster clearance rate from the blood pool. Here we present our experience using Tc-99m-F(ab')2 of the 225.28S monoclonal antibody that recognizes high molecular weight melanoma associated antigens (HMW-MAA). (Auth.)

  15. Comparative study of intact A7 MoAc and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab)2 fragments were studied in human colon cancer (LS-174T)-bearing nude mice. The authors examined the yield and the immunoreactivity of F(ab)2 fragments after treatment with ficin as a function of time. The yield of F(ab)2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab)2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. The tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  16. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  17. Refolding Technologies for Antibody Fragments

    OpenAIRE

    Tsutomu Arakawa; Daisuke Ejima

    2014-01-01

    Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppresso...

  18. Distribution and dosimetry of indium-111 labeled F(ab')2 fragments in humans

    International Nuclear Information System (INIS)

    The purpose of this study was to obtain quantitative biodistribution data in patients injected with the indium-111 labeled F(ab')2 fragments of mouse monoclonal antibody. From this data dosimetric calculations were made for the individual organs. The authors also evaluated the quantitative properties of SPECT in this application and compared it with the more conventional two view planar technique in both phantom and patient studies. For one antibody (19-9) the mean dose in rads/mCi for the organs of highest accumulation, namely, the liver and kidneys was 3.2 and 2.6 respectively. Preliminary data from another antibody (OC 125) showed much higher blood levels and a significantly lower liver dose of 2.3 indicating that antibody type is another significant determinant in dosimetry. The SPECT approach particularly in the presence of background activity, was more accurate in the phantom studies and resulted in larger estimated doses in the patient studies. Also, SPECT has the added advantage of providing an index of organ volume, which has to be balanced with the fact the planar is more rapid, and does not require special hardware. 24 references, 5 figures, 1 table

  19. A polar ring endows improved specificity to an antibody fragment.

    Science.gov (United States)

    Schaefer, Zachary P; Bailey, Lucas J; Kossiakoff, Anthony A

    2016-07-01

    Engineering monovalent Fab fragments into bivalent formats like IgGs or F(ab')2 can lead to aggregation presumably because of nonspecific off-target interactions that induce aggregation. In an effort to further understand the molecular determinants of nonspecific interactions for engineered antibodies and natively folded proteins in general, we focused on a synthetic Fab with low nanomolar affinity to histone chaperone Anti-silencing factor 1 (Asf1) that demonstrates off-target binding through low solubility (∼5 mg/mL) in the multivalent F(ab') 2 state. Here, we generated phage display-based shotgun scanning libraries to introduce aspartate as a negative design element into the antibody paratope. The antibody-combining site was amenable to aspartate substitution at numerous positions within the antigen binding loops and one variant, Tyr(L93) Asp/His(L94) Asp/Thr(H100b) Asp, possessed high solubility (>100 mg/ml). Furthermore, the mutations decreased nonspecific interactions measured by column interaction chromatography and ELISA in the multivalent antibody format while maintaining high affinity to the antigen. Structural determination of the antibody-antigen complex revealed that the aspartate-permissive residues formed a polar ring around the structural and functional paratope, recapitulating the canonical feature of naturally occurring protein-protein interactions. This observation may inform future strategies for the design and engineering of molecular recognition. PMID:27334407

  20. A triglycine linker improves tumor uptake and biodistributions of 67-Cu-Labeled anti-neuroblastoma MAb chCE7 F(ab')2 fragments

    International Nuclear Information System (INIS)

    The peptide-linked copper chelators CPTA-triglycyl-L-p-isothiocyanato-phenylalanine (CPTA-R1-NCS) as well as DOTA-triglycyl-L-p-isocyanato-phenylalanine (DOTA-R1-NCS) were synthesized and coupled to F(ab')2 fragments of the anti-neuroblastoma monoclonal antibody (MAb) chCE7. 67Cu-labeled conjugates were compared with the original CPTA- and DO3A-F(ab')2 in vitro and in vivo in mice bearing neuroblastoma xenografts. With the CPTA-R1-F(ab')2, biodistributions were improved, because radioactivity present in the kidney was reduced. With the DOTA-R1-F(ab')2, clearance from the blood was slower and tumor uptake was higher compared with the other conjugates. DOTA-R1-F(ab')2 achieved the best tumor/tissue ratios

  1. Production, purification, crystallization and preliminary X-ray diffraction analysis of the HIV-2-neutralizing V3 loop-specific Fab fragment 7C8

    International Nuclear Information System (INIS)

    Neutralizing Fab fragments of the HIV-2-binding murine antibody 7C8 were generated after purification from hybridoma cell-culture supernatant. Crystallization conditions were determined and diffraction data were collected to 2.7 Å resolution. 7C8 is a mouse monoclonal antibody that is specific for the third hypervariable loop (V3 loop) of the human immunodeficiency virus type 2 (HIV-2) associated protein gp125. Fab fragments of 7C8 effectively neutralize HIV-2. 7C8 was expressed and purified from a hybridoma cell line in order to establish the molecular basis underlying the specificity of the 7C8 antibody for the V3 loop as well as the specific role of the elongated third complementarity-determining region of the heavy chain (CDRH3). The antibody was digested with papain and Fab fragments were purified using size-exclusion chromatography. Hanging-drop vapour-diffusion crystallization techniques were employed and the protein was crystallized in 50 mM ammonium sulfate, 100 mM Tris–HCl pH 8.5, 25%(w/v) PEG 8000 and 2.5%(w/v) PEG 400 at 275 K. The analysed crystals belonged to the rhombohedral space group P3221, with unit-cell parameters a = b = 100.1, c = 196.8 Å, and diffracted to 2.7 Å resolution

  2. Insights into the potential aggregation liabilities of the b12 Fab fragment via elevated temperature molecular dynamics.

    Science.gov (United States)

    Buck, Patrick M; Kumar, Sandeep; Singh, Satish K

    2013-03-01

    Aggregation is a common hurdle faced during the development of antibody therapeutics. In this study, we explore the potential aggregation liabilities of the Fab (fragment antigen-binding) from a human IgG1κ antibody via multiple elevated temperature molecular dynamic simulations, analogous to accelerated stability studies performed during formulation development. Deformation and solvent exposure changes in response to thermal stress were monitored for individual structural domains (V(H), V(L), C(H)1 and C(L)), their interfaces (V(H):V(L) and C(H)1:C(L)), edge beta-strands and sequence-predicted aggregation-prone regions (APRs). During simulations, domain interfaces deformed prior to the unfolding of individual domains. However, interfacial beta-strands retained their secondary structure and remained solvent protected longer than all other strands or loops. Thus, APRs located in interfacial beta-strands are effectively blocked from self-association. Structural deformations were also observed in complementarity-determining regions, edge beta-strands and adjoining framework beta-strands, which increased their solvent-accessible surface area and exposed APRs in these regions. From the analysis of these structural changes, two potential aggregation liabilities were identified in the V(H) domain of this Fab. Insights gained from this investigation should be useful in devising a rational structure-based strategy for the design and selection of antibody candidates with high potency and improved developability. PMID:23188804

  3. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.; Kemp, G.J.L.; Secombes, C.J.; Cunningham, C.

    single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using the......We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...

  4. Data of rational process optimization for the production of a full IgG and its Fab fragment from hybridoma cells.

    Science.gov (United States)

    Röhm, Martina; Handl, Alina; König, Maria; Mavoungou, Chrystelle; Handrick, René; Schindowski, Katharina

    2016-09-01

    This data article focuses on the production of monoclonal antibodies (mAb) and their fragments Fab and F(ab')2. Here, we present the data of an optimization protocol to improve the product yield of a hybridoma cell process using a Design of Experiment (DoE) strategy. Furthermore, the data of the evaluated conditions were used to test feeding strategies in shake flasks. They were verified in controlled 2 L fed-batch bioreactor processes. Supplementing the culture medium with human insulin-like growth factor-I (IGF-I) and Pluronic F-68, as well as a nutrient rich additive for fed-batch, resulted in improved cell growth correlating with a 7 day elongated process time and a 4.5 fold higher product titer. Finally, a rapid Fab generation protocol and the respective data are presented using different papain digestion and a camelid anti-kappa light chain VHH affinity ligand. PMID:27366780

  5. A kit to prepare {sup 111}In-DTPA-trastuzumab (Herceptin) Fab fragments injection under GMP conditions for imaging or radioimmunoguided surgery of HER2-positive breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Scollard, Deborah A.; Chan, Conrad [Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada); Holloway, Claire M.B. [Department of Surgery, Sunnybrook Health Sciences Centre, Toronto, ON, M4N 1H1 (Canada); Reilly, Raymond M., E-mail: raymond.reilly@utoronto.c [Department of Pharmaceutical Sciences, University of Toronto, Toronto, ON, M5S 3M2 (Canada); Department of Medical Imaging, University of Toronto, Toronto, ON, M5S 3E2 (Canada); Toronto General Research Institute, University Health Network, Toronto, ON, M5G 2M9 (Canada)

    2011-01-15

    Introduction: The human epidermal growth factor receptor-2 (HER2) gene is amplified in 25% of invasive breast cancers, and receptor overexpression has been noted in up to 60% of early stages of the disease [ductal carcinoma in situ (DCIS)]. Preclinical studies have revealed high tumor/blood ratios (>27:1) for {sup 111}In-labeled Fab fragments of the HER2 monoclonal antibody, trastuzumab (Herceptin) ({sup 111}In-DTPA-trastuzumab Fab) at 72 h pi in athymic mice bearing subcutaneous human breast cancer xenografts. Our aim in this study was to formulate a kit for preparation of {sup 111}In-DTPA-trastuzumab Fab injection under good manufacturing practice (GMP) conditions suitable for human administration in a Phase I clinical trial of imaging and radioimmunoguided surgery (RIGS) of HER2-positive breast cancer. Methods: Fab fragments were produced by digestion of trastuzumab IgG (Herceptin) with immobilized papain for 20 h at 37{sup o}C. Fab fragments were purified by ultrafiltration, then reacted with a 10-fold molar excess of diethylenetriaminepentaacetic acid (DTPA) dianhydride. DTPA-Fab fragments were purified, then sterilized by filtration into unit dose glass vials (kits). Kits were tested against specifications for volume (0.9-1.1 ml), protein concentration (0.45-0.55 mg/ml), pH (5.5-6.5), DTPA substitution (0.5-4.0 mol DTPA/mol Fab), appearance (clear, colorless and particle free), labeling efficiency ({>=}85%), and sterility and apyrogenicity (USP XXXII). Immunoreactivity of {sup 111}In-DTPA-trastuzumab Fab towards HER2 was measured by saturation radioligand binding assays using SKBR-3 human breast cancer cells (specifications: K{sub a}=0.6-9.6x10{sup 7} L/mol; B{sub max}=0.6-10.4x10{sup 6} sites/cell). {sup 111}In-DTPA-trastuzumab Fab injection was prepared by adding 80-100 MBq of {sup 111}InCl{sub 3} to a single kit vial and incubating for 30 min at room temperature. {sup 111}In-DTPA-trastuzumab Fab was assayed for the amount of radioactivity and tested for p

  6. A kit to prepare 111In-DTPA-trastuzumab (Herceptin) Fab fragments injection under GMP conditions for imaging or radioimmunoguided surgery of HER2-positive breast cancer

    International Nuclear Information System (INIS)

    Introduction: The human epidermal growth factor receptor-2 (HER2) gene is amplified in 25% of invasive breast cancers, and receptor overexpression has been noted in up to 60% of early stages of the disease [ductal carcinoma in situ (DCIS)]. Preclinical studies have revealed high tumor/blood ratios (>27:1) for 111In-labeled Fab fragments of the HER2 monoclonal antibody, trastuzumab (Herceptin) (111In-DTPA-trastuzumab Fab) at 72 h pi in athymic mice bearing subcutaneous human breast cancer xenografts. Our aim in this study was to formulate a kit for preparation of 111In-DTPA-trastuzumab Fab injection under good manufacturing practice (GMP) conditions suitable for human administration in a Phase I clinical trial of imaging and radioimmunoguided surgery (RIGS) of HER2-positive breast cancer. Methods: Fab fragments were produced by digestion of trastuzumab IgG (Herceptin) with immobilized papain for 20 h at 37oC. Fab fragments were purified by ultrafiltration, then reacted with a 10-fold molar excess of diethylenetriaminepentaacetic acid (DTPA) dianhydride. DTPA-Fab fragments were purified, then sterilized by filtration into unit dose glass vials (kits). Kits were tested against specifications for volume (0.9-1.1 ml), protein concentration (0.45-0.55 mg/ml), pH (5.5-6.5), DTPA substitution (0.5-4.0 mol DTPA/mol Fab), appearance (clear, colorless and particle free), labeling efficiency (≥85%), and sterility and apyrogenicity (USP XXXII). Immunoreactivity of 111In-DTPA-trastuzumab Fab towards HER2 was measured by saturation radioligand binding assays using SKBR-3 human breast cancer cells (specifications: Ka=0.6-9.6x107 L/mol; Bmax=0.6-10.4x106 sites/cell). 111In-DTPA-trastuzumab Fab injection was prepared by adding 80-100 MBq of 111InCl3 to a single kit vial and incubating for 30 min at room temperature. 111In-DTPA-trastuzumab Fab was assayed for the amount of radioactivity and tested for pH, radiochemical purity (RCP), appearance and sterility. Results: Pure and

  7. A collagen-binding EGFR antibody fragment targeting tumors with a collagen-rich extracellular matrix

    OpenAIRE

    Hui Liang; Xiaoran Li; Bin Wang; Bing Chen; Yannan Zhao; Jie Sun; Yan Zhuang; Jiajia Shi; He Shen; Zhijun Zhang; Jianwu Dai

    2016-01-01

    Many tumors over-express collagen, which constitutes the physical scaffold of tumor microenvironment. Collagen has been considered to be a target for cancer therapy. The collagen-binding domain (CBD) is a short peptide, which could bind to collagen and achieve the sustained release of CBD-fused proteins in collagen scaffold. Here, a collagen-binding EGFR antibody fragment was designed and expressed for targeting the collagen-rich extracellular matrix in tumors. The antibody fragment (Fab) of ...

  8. Structural and energetic hot-spots for the interaction between a ladder-like polycyclic ether and the anti-ciguatoxin antibody 10C9Fab.

    Science.gov (United States)

    Ui, Mihoko; Tanaka, Yoshikazu; Tsumuraya, Takeshi; Fujii, Ikuo; Inoue, Masayuki; Hirama, Masahiro; Tsumoto, Kouhei

    2011-03-01

    The mechanism by which anti-ciguatoxin antibody 10C9Fab recognizes a fragment of ciguatoxin CTX3C (CTX3C-ABCDE) was investigated by mutational analysis based on structural data. 10C9Fab has an extraordinarily large and deep antigen-binding pocket at the center of its variable region. We mutated several residues located at the antigen-binding pocket to Ala, and kinetic analysis of the interactions between the mutant proteins and the antigen fragment was performed. The results indicate that some residues associated with the rigid antigen-binding pocket are structural hot-spots and that L-N94 is an energetic hot-spot for association of the antibody with the antigen fragment CTX3C-ABCDE, suggesting the importance of structural complementarity and energetic hot-spot interactions for specific recognition of polycyclic ethers. PMID:21161086

  9. Radioimmunotherapy with engineered antibody fragments

    International Nuclear Information System (INIS)

    Authors have developed and begun evaluating radiometal-chelated (213Bi) engineered antibody fragments as radioimmunotherapy agents that target the HER2/neu (c-erbB-2) antigen. The diabody format was found to have 40-fold greater affinity for HER2/neu and to be associated with significantly greater tumor localization than is achieved with scFv molecule. It is shown that short-lived isotopes like 213Bi would be most effective when used in conjunction with antibodies that targeted diffuse malignancies (leukemia or lymphoma) or when used for very rapid pretargeted radioimmunotherapy application in which the radioisotope is conjugated to a very small ligand

  10. Characterization of crystals of an antibody-recognition fragment of the cancer differentiation antigen mesothelin in complex with the therapeutic antibody MORAb-009

    OpenAIRE

    Ma, Jichun; Tang, Wai Kwan; Esser, Lothar; Pastan, Ira; Xia, Di

    2012-01-01

    The therapeutic antibody MORAb-009 disrupts the interaction of mesothelin and the ovarian cancer antigen CA-125. Crystals have been grown of the Fab fragment derived from MORAb-009 and of its complex with an N-terminal fragment of mesothelin.

  11. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.; Kemp, G.J.L.; Secombes, C.J.; Cunningham, C.

    We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... BIAcore analysis and found to correlate with the capacity of each molecule to neutralise DK-F1. These investigations, together with computer assisted molecular analysis of the theoretical influence of each mutation on antigen binding, led to the identification of a single mutation at position 35a in the...

  12. Prokaryotic expression and renaturation of engineering chimeric Fab antibody against human hepatoma

    Institute of Scientific and Technical Information of China (English)

    Jin-Liang Xing; Xiang-Min Yang; Xi-Ying Yao; Fei Song; Zhi-Nan Chen

    2004-01-01

    AIM: To express chimeric Fd (cFd) and chimeric light chain (cL) in E.coli respectively and refold them into chimeric Fab (cFab) antibody.METHODS: cFd and cL genes were respectively inserted into the prokaryotic expression vector pET32a to construct recombinant vectors pET32a/cFd and pET32a/cL. Then,the competent E. colicells were transformed by the recombinant vectors and induced by IPTG. Moreover, a large quantity of cFd and cL expression products were prepared and mixed with equal molar to refold into cFab by gradient dialysis. The refolded products were identified and analyzed by sodium SDS-PAGE, Western blotting,ELISA and HPLC.RESULTS: High efficient prokaryotic expressions of both cFd and cL in the form of non-fusion protein were obtained with the expression levels of 28.3% and 32.3% of total bacteria proteins, respectively. Their relative molecular masses were all 24 ku or so, and both of them mainly existed in the form of inclusion bodies. In addition, cFd and cL were successfully refolded into cFab by gradient dialysis, with about 59.45% of recovery when the starting total protein concentration was 100 μg/mL. The renatured cFab could specifically bind to related antigen with high affinity.CONCLUSION: The cFab antibody against human hepatoma was highly and efficiently expressed and refolded, which laid a solid foundation for studying its application in the treatment of hepatoma.

  13. Fab crystallization and preliminary X-ray analysis of NC-1, an anti-HIV-1 antibody that recognizes the six-helix bundle core of gp41

    International Nuclear Information System (INIS)

    The Fab fragment of NC-1, a murine antibody that specifically recognizes the six-helix bundle core of HIV-1 gp41, has been crystallized in space group P3221. An X-ray diffraction data set was collected at 3.2 Å resolution and a clear molecular-replacement solution was obtained for solution of the structure. NC-1 is a murine monoclonal antibody that specifically recognizes the six-helix bundle core of the human immunodeficiency virus type 1 (HIV-1) gp41. As such, it is a useful tool for probing gp41 conformations in HIV-1 membrane fusion. To establish the structural basis underlying the NC-1 specificity, X-ray crystallography was employed to solve its three-dimensional structure. To accomplish this, hybridoma-produced NC-1 antibody was first purified and digested with papain. Its Fab fragment was then purified using size-exclusion chromatography following Fc depletion using a Protein A affinity column. Finally, crystallization of NC-1 Fab was performed by the hanging-drop vapour-diffusion method and the protein was crystallized at pH 8.0 using PEG 6000 as precipitant. The results showed that the NC-1 Fab crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 118.7, c = 106.0 Å. There is one Fab molecule in the asymmetric unit, with 67.5% solvent content. An X-ray diffraction data set was collected at 3.2 Å resolution and a clear molecular-replacement solution was obtained for solution of the structure

  14. Recognition by recombinant autoimmune thyroid disease-derived Fab fragments of a dominant conformational epitope on human thyroid peroxidase.

    OpenAIRE

    Portolano, S; Chazenbalk, G D; Seto, P; Hutchison, J S; Rapoport, B.; McLachlan, S M

    1992-01-01

    To characterize the nature of thyroid peroxidase (TPO) autoantibodies present in the sera of patients with autoimmune thyroid disease, we cloned three IgG1/kappa Fab fragments which bind 125I-TPO. This was accomplished by the molecular cloning and expression in bacteria of IgG gene fragments from B cells infiltrating the thyroid of a patient with Graves' disease. The three Fab fragments (SP2, SP4, and SP5) are coded for by a common heavy chain (VH1, D, JH3) and three related, but different, l...

  15. Radioimmunoscintigraphy using 99mTc-anti-CEA F(ab's)2 fragment in rectal cancer and a pilot study for radioimmunoguided surgery

    International Nuclear Information System (INIS)

    This prospective study was performed to evaluate the usefulness of preoperative radioimmunoscintigraphy and intraoperative scintimetric examination (radioimmunoguided surger: RIGS) using99mTc-anti-CEA F(ab')2 fragment. Nineteen patients with rectal cancer underwent preoperative whole body planar scintigraphy at 4 hours after injection of 99mTc-anti-CEA F(ab')2 fragment and SPECT imaging at 18 hours. Surgical operation was performed at 24 hours after injection. During laparotomy, radioactivities from intraabdominal viscera were measured by gamma probe. The radioactivities from excised tumor and lymph nodes were also measured and compared with pathology. All nineteen patients were confirmed to have adenocarcinomas in the rectum. Twenty-seven of 97 excised lymph node groups had metastasis and 2 patients had liver metastasis in pathology. Preoperative radioimmunoscintigraphy detected primary tumors in 11 patients (sensitivity 55%) and it could not detect any lymph nodes or liver metastasis. All patients showed high radioactivity in the kidneys, liver, spleen, and major vessels in intraoperative measurement by gamma probe, and tumor activity was not discriminated from background activity. However, radioactivity from excised tumor was higher than normal rectum (T/B ratio; 3,47±2.25). When excised lymph node activity/background activity ratio >1.5 was considered as positive criteria of metastasis, sensitivity, specificity, positive and negative predictive values were 78.6%, 73.9%, 55.0% and 89.5%, respectively. Radioimmunoscintigraphy using 99mTc-anti-CEA F(ab')2 has no additional value for preoperative staging and use of early RIGS using 99mTc-anti-CEA F(ab')2 is inappropriate. For early RIGS using 99mTc labeled antibodies in rectal cancer patients, further development of more specific antibodies and methods to reduce background activity are needed.=20

  16. Construction of phage antibody library and screening of anti-FasFab antibody%噬菌体呈现抗体库的构建及抗 Fas-Fab抗体的研究

    Institute of Scientific and Technical Information of China (English)

    王希良; 黄云辉; 陈克敏; 朱锡华

    2001-01-01

    目的构建噬菌体抗体库,获得具有功能的抗Fas-Fab噬菌体抗体。方法以Fas重组蛋白为抗原免疫Balb/c小鼠。取其脾细胞提取mRNA,采用RT-PCR方法扩增抗体基因,构建重链和κ链基因库,用重组Fas抗原对所构建的抗体库进行4轮筛选,并以ELISA法鉴定其功能。结果获得抗体重链Fd基因和κ链基因长度约700bp。构建的重链Fd基因为3.5×106的抗体重链基因库。构建的重链和κ链基因库的容量均为3.1×106。经VCSM13感染得到噬菌体的滴度为8.9×1016cFu/L的噬菌体抗体库,含有抗体重链和κ链基因的噬菌体占27%。用重组人Fas抗原进行4轮筛选,得到100%的富集,说明Fas重组抗原富集了抗Fas-Fab噬菌体抗体,经ELISA检测均有抗Fas抗体的特异性。结论制备的可溶性抗Fas-Fab抗体具有抗Fas抗体的特异性,为进一步的研究奠定了基础。%Aim The phage display antibody library was constructed to obtainfunctional anti-Fas Fab. Methods Balb/c mice were immunized with recombinant Fas protein. mRNA was isolated from splenocytes and antibody heavy chain genes Fd and κ chain genes were amplified by RT-PCR, and combinatorial Fab antibody library. This iuelicated that the screening of antibody library was done with recombinont Fas antigen and the immunifacient function of the antibody was determined by ELISA. Results The amplified products were the desired fragments and contained 700 bp. The amplified antibody heavy chain Fd genes were cloned into pcomb3 vector at first, and transformed into E.coli XL1-blue to construct an antibody heavy chain library with a size of 3.5× 106 members. The κ chain genes were then randomly combined with heavy chain genes to generate a combinatorial vector encoding both chains and capable of generating Fab fragments. These combinatorial vectors were transformed to E.coli XL1-Blue,and the combinatorial Fab antibody library was 3.7× 106. The phage antibody library was

  17. Characterization of crystals of an antibody-recognition fragment of the cancer differentiation antigen mesothelin in complex with the therapeutic antibody MORAb-009

    International Nuclear Information System (INIS)

    The therapeutic antibody MORAb-009 disrupts the interaction of mesothelin and the ovarian cancer antigen CA-125. Crystals have been grown of the Fab fragment derived from MORAb-009 and of its complex with an N-terminal fragment of mesothelin. The mesothelin-specific monoclonal antibody MORAb-009 is capable of blocking the binding of mesothelin to CA-125 and displays promising anticancer potential. It is currently undergoing clinical trials. In order to understand the basis of the interaction between MORAb-009 and mesothelin at atomic resolution, both the Fab fragment of MORAb-009 and the complex between the Fab and an N-terminal fragment of mesothelin (residues 7–64) were crystallized. The crystals of the Fab diffracted X-rays to 1.75 Å resolution and had the symmetry of space group P41212, with unit-cell parameters a = b = 140.6, c = 282.0 Å. The crystals of the mesothelin–Fab complex diffracted to 2.6 Å resolution and belonged to the hexagonal space group P64, with unit-cell parameters a = b = 146.2, c = 80.9 Å. Structural analyses of these molecules are in progress

  18. COMPARISON OF FOUR METHODS TO GENERATE IMMUNOREACTIVE FRAGMENTS OF A MURINE MONOCLONAL ANTIBODY OC859 AGAINST HUMAN OVARIAN EPITHELIAL CANCER ANTIGEN

    Institute of Scientific and Technical Information of China (English)

    邹颖; 卞美璐; 杨子义; 连利娟; 刘文淑; 许秀英

    1995-01-01

    In the present study,four different proteases (pepsin,papain,bromelain and ficin) were screened with a murine monoclonal antibody OC859,in order to verify whether different digestion procedures could improve yield and stability of the F(ab')2 or Fab fragments.The yields of F(ab')2 or Fab fragments from digestion with pepsin,papain,bromelain and ficin were respectively 20.3+/-2.0%,50.5%+/-5.0%,74.4+/-2.7% and 82.8+/-10.2% of the theoretical maximum.Immunoreactivity in a noncompetitive solid-phase radioimmunoassay (SPRIA) of the fragments generated by the four proteases were respectively 10+/-5%,36+/-5%,60+/-6% and 75+/-6% of the intact OC859 IgG.These results suggested that the fragmentation of OC859 with ficin gave a higher yield of superior immunoreactive fragments.

  19. Generation of a haptoglobin-hemoglobin complex-specific Fab antibody blocking the binding of the complex to CD163

    DEFF Research Database (Denmark)

    Horn, Ivo R; Nielsen, Marianne Jensby; Madsen, Mette; Jacobsen, Christian; Graversen, Jonas Heilskov; Moestrup, Søren K

    2003-01-01

    During intravascular hemolysis hemoglobin (Hb) binds to haptoglobin (Hp) leading to endocytosis of the complex by the macrophage receptor, CD163. In the present study, we used a phage-display Fab antibody strategy to explore if the complex formation between Hp and Hb leads to exposure of antigenic...... measured for non-complexed Hp or Hb. The Fab antibody completely inhibited the binding of 125I-labeled Hp-Hb complexes to CD163 and blocked their uptake in CD163-transfected cells. In conclusion, we have raised a receptor-blocking antibody specifically recognizing the Hp-Hb complex. In addition to provide...

  20. Pharmacokinetics of the monoclonal antibody B72.3 and its fragments labeled with either 125I or 111In

    International Nuclear Information System (INIS)

    A comparison of the pharmacokinetics of intact B72.3 (a murine monoclonal antibody specific for human breast and colon carcinoma) with F(ab')2 and Fab fragments labeled with 111In and 125I was done in athymic mice bearing target (LS174T) and non-target (HCT-15) tumors. IgG B72.3 labeled with either isotype imaged LS174T. Biodistributions of both labels were similar in all organs except liver. F(ab')2 also imaged the LS174T tumor, while Fab bearing either isotype did not. The blood clearance was Fab greater than F(ab')2 greater than immunoglobulin G B72.3 for both isotopes. 111In-labeled fragments yielded large accumulations in the kidneys which persisted for 2 days. The different patterns of biodistribution for the various forms of B72.3 labeled with the two isotopes suggest that the most desirable combination of fragment and isotope will depend on the intended use

  1. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    International Nuclear Information System (INIS)

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  2. The Fab and Fc fragments of IgA1 exhibit a different arrangement from that in IgG: a study by X-ray and neutron solution scattering and homology modelling.

    Science.gov (United States)

    Boehm, M K; Woof, J M; Kerr, M A; Perkins, S J

    1999-03-12

    Human immunoglobulin A (IgA) is an abundant antibody that mediates immune protection at mucosal surfaces as well as in plasma. The IgA1 isotype contains two four-domain Fab fragments and a four-domain Fc fragment analogous to that in immunoglobulin G (IgG), linked by a glycosylated hinge region made up of 23 amino acid residues from each of the heavy chains. IgA1 also has two 18 residue tailpieces at the C terminus of each heavy chain in the Fc fragment. X-ray scattering using H2O buffers and neutron scattering using 100 % 2H2O buffers were performed on monomeric IgA1 and a recombinant IgA1 that lacks the tailpiece (PTerm455). The radii of gyration RG from Guinier analyses were similar at 6.11-6.20 nm for IgA1 and 5.84-6.16 nm for PTerm455, and their cross-sectional radii of gyration RXS were also similar. The similarity of the RG and RXS values suggests that the tailpiece of IgA1 is not extended outwards in solution. The IgA1 RG values are higher than those for IgG, and the distance distribution function P(r) showed two distinct peaks, whereas a single peak was observed for IgG. Both results show that the hinge of IgA1 results in an extended Fab and Fc arrangement that is different from that in IgG. Automated curve-fit searches constrained by homology models for the Fab and Fc fragments were used to model the experimental IgA1 scattering curves. A translational search to optimise the relative arrangement of the Fab and Fc fragments held in a fixed orientation resembling that in IgG was not successful in fitting the scattering data. A new molecular dynamics curve-fit search method generated IgA1 hinge structures to which the Fab and Fc fragments could be connected in any orientation. A search based on these identified a limited family of IgA1 structures that gave good curve fits to the experimental data. These contained extended hinges of length about 7 nm that positioned the Fab-to-Fab centre-to-centre separation 17 nm apart while keeping the corresponding Fab

  3. An efficient process of generating bispecific antibodies via controlled Fab-arm exchange using culture supernatants.

    Science.gov (United States)

    Paul, Suparna; Connor, Judy; Nesspor, Tom; Haytko, Peter; Boakye, Ken; Chiu, Mark L; Jiang, Haiyan

    2016-05-01

    Bispecific antibody generation is actively pursued for therapeutic and research antibody development. Although there are multiple strategies for generating bispecific antibodies (bsAbs); the common challenge is to develop a scalable method to prepare bsAbs with high purity and yield. The controlled Fab-arm exchange (cFAE) method combines two parental monoclonal antibodies (mAbs), each with a matched point mutation, F405L and K409R in the respective CH3 domains. The conventional process employs two steps: the purification of two parental mAbs from culture supernatants followed by cFAE. Following a reduction/oxidation reaction, the bispecific mAb is formed with greater than 95% heterodimerization efficiency. In this study, cFAE was initiated in culture supernatants expressing the two parental mAbs, thereby eliminating the need to first purify the parental mAbs. The bsAbs formed in culture supernatant was then purified using a Protein A affinity chromatography. The BsAbs generated in this manner had efficiency comparable to the conventional method using purified parental mAbs. BsAbs prepared by two different routes showed indistinguishable characteristics by SDS capillary electrophoresis, analytical size exclusion, and cation exchange chromatography. This alternative method significantly shortened timelines and reduced resources required for bsAb generation, providing an improved process with potential benefits in large-scale bsAb preparation, as well as for HTP small-scale bsAb matrix selection. PMID:26826313

  4. Imaging of deep venous thrombosis in patients using a radiolabelled anti-D-dimer Fab' fragment ({sup 99m}Tc-DI-DD3B6/22-80B3): results of a phase I trial

    Energy Technology Data Exchange (ETDEWEB)

    Macfarlane, David [University of Queensland, School of Medicine, Brisbane (Australia); Socrates, Angelides; Larcos, George [University of Sydney, Department of Medicine, Sydney (Australia)]|[Westmead Hospital, Department of Nuclear Medicine and Ultrasound, Westmead (Australia)]|[Westmead Hospital, Centre for Biomedical Imaging and Research, Westmead (Australia); Eisenberg, Paul [Amgen Inc, Thousand Oaks, CA (United States); Roach, Paul [University of Sydney, Department of Medicine, Sydney (Australia)]|[Royal North Shore Hospital, Nuclear Medicine, St. Leonards (Australia); Gerometta, Michael [Agen Biomedical Pty Ltd, Brisbane (Australia); Smart, Richard; Tsui, Wendy [St. George Hospital, Nuclear Medicine Department, Sydney (Australia)]|[University of New South Wales, Department of Medicine, Sydney (Australia); Scott, Andrew M. [Austin Hospital, Centre for PET, Melbourne (Australia)]|[Ludwig Institute, Melbourne (Australia)

    2009-02-15

    {sup 99m}Tc-DI-DD3B6/22-80B3 (ThromboView registered, hereafter abbreviated to {sup 99m}Tc-DI-80B3 Fab') is a radiolabelled humanised monoclonal Fab' fragment with affinity and specificity for D-dimer domains of cross-linked fibrin. Detection of thromboembolic events has been demonstrated in canine models. The study objectives were evaluation of safety and characterisation of biodistribution, immunogenicity and pharmacokinetic profile of increasing doses of {sup 99m}Tc-DI-80B3 Fab' in subjects with acute lower-limb DVT. Twenty-six patients with acute lower limb DVT were enrolled. Of these, 21 received a single intravenous dose of 0.5 mg (n = 6), 1.0 mg (n = 9) or 2 mg (n = 6) {sup 99m}Tc-DI-80B3 Fab'. Blood and urine samples and gamma camera images were collected to 24 h after administration for pharmacokinetic and dosimetry analysis. Vital signs, electrocardiography, hematological and biochemical data and human anti-human antibody (HAHA) levels were monitored for up to 30 days following administration. Patients were assigned to either planar or single photon emission computed tomographic (SPECT) imaging of the thorax at 4 h following injection. Thirty-five adverse events were reported in 15 of the 21 subjects. Those deemed possibly related to administration of {sup 99m}Tc-DI-80B3 Fab' included mild hypertension, mild elevation of LD (lactate dehydrogenase) and moderate elevation of ALT (alanine transaminase). HAHA assays remained negative. Pharmacokinetics and organ dosimetry were comparable to prior normal volunteer data. Localisation of Thromboview registered to sites of known thrombus was evident as early as 30 min post-injection. In subjects with acute DVT, {sup 99m}Tc-DI-80B3 Fab' was well tolerated with favourable characteristics for the detection of acute venous thrombosis. (orig.)

  5. Imaging of deep venous thrombosis in patients using a radiolabelled anti-D-dimer Fab' fragment (99mTc-DI-DD3B6/22-80B3): results of a phase I trial

    International Nuclear Information System (INIS)

    99mTc-DI-DD3B6/22-80B3 (ThromboView registered, hereafter abbreviated to 99mTc-DI-80B3 Fab') is a radiolabelled humanised monoclonal Fab' fragment with affinity and specificity for D-dimer domains of cross-linked fibrin. Detection of thromboembolic events has been demonstrated in canine models. The study objectives were evaluation of safety and characterisation of biodistribution, immunogenicity and pharmacokinetic profile of increasing doses of 99mTc-DI-80B3 Fab' in subjects with acute lower-limb DVT. Twenty-six patients with acute lower limb DVT were enrolled. Of these, 21 received a single intravenous dose of 0.5 mg (n = 6), 1.0 mg (n = 9) or 2 mg (n = 6) 99mTc-DI-80B3 Fab'. Blood and urine samples and gamma camera images were collected to 24 h after administration for pharmacokinetic and dosimetry analysis. Vital signs, electrocardiography, hematological and biochemical data and human anti-human antibody (HAHA) levels were monitored for up to 30 days following administration. Patients were assigned to either planar or single photon emission computed tomographic (SPECT) imaging of the thorax at 4 h following injection. Thirty-five adverse events were reported in 15 of the 21 subjects. Those deemed possibly related to administration of 99mTc-DI-80B3 Fab' included mild hypertension, mild elevation of LD (lactate dehydrogenase) and moderate elevation of ALT (alanine transaminase). HAHA assays remained negative. Pharmacokinetics and organ dosimetry were comparable to prior normal volunteer data. Localisation of Thromboview registered to sites of known thrombus was evident as early as 30 min post-injection. In subjects with acute DVT, 99mTc-DI-80B3 Fab' was well tolerated with favourable characteristics for the detection of acute venous thrombosis. (orig.)

  6. Noninvasive brain cancer imaging with a bispecific antibody fragment, generated via click chemistry.

    Science.gov (United States)

    Luo, Haiming; Hernandez, Reinier; Hong, Hao; Graves, Stephen A; Yang, Yunan; England, Christopher G; Theuer, Charles P; Nickles, Robert J; Cai, Weibo

    2015-10-13

    Early diagnosis remains a task of upmost importance for reducing cancer morbidity and mortality. Successful development of highly specific companion diagnostics targeting aberrant molecular pathways of cancer is needed for sensitive detection, accurate diagnosis, and opportune therapeutic intervention. Herein, we generated a bispecific immunoconjugate [denoted as Bs-F(ab)2] by linking two antibody Fab fragments, an anti-epidermal growth factor receptor (EGFR) Fab and an anti-CD105 Fab, via bioorthogonal "click" ligation of trans-cyclooctene and tetrazine. PET imaging of mice bearing U87MG (EGFR/CD105(+/+)) tumors with (64)Cu-labeled Bs-F(ab)2 revealed a significantly enhanced tumor uptake [42.9 ± 9.5 percentage injected dose per gram (%ID/g); n = 4] and tumor-to-background ratio (tumor/muscle ratio of 120.2 ± 44.4 at 36 h postinjection; n = 4) compared with each monospecific Fab tracer. Thus, we demonstrated that dual targeting of EGFR and CD105 provides a synergistic improvement on both affinity and specificity of (64)Cu-NOTA-Bs-F(ab)2. (64)Cu-NOTA-Bs-F(ab)2 was able to visualize small U87MG tumor nodules (<5 mm in diameter), owing to high tumor uptake (31.4 ± 10.8%ID/g at 36 h postinjection) and a tumor/muscle ratio of 76.4 ± 52.3, which provided excellent sensitivity for early detection. Finally, we successfully confirmed the feasibility of a ZW800-1-labeled Bs-F(ab)2 for near-infrared fluorescence imaging and image-guided surgical resection of U87MG tumors. More importantly, our rationale can be used in the construction of other disease-targeting bispecific antibody fragments for early detection and diagnosis of small malignant lesions. PMID:26417085

  7. Conjugation of R-Phycoerythrin to a Polyclonal Antibody and F (ab')2 Fragment of a Polyclonal Antibody by Two Different Methods.

    Science.gov (United States)

    Mahmoudian, Jafar; Jeddi-Tehrani, Mahmood; Rabbani, Hodjattallah; Mahmoudi, Ahmad Reza; Akhondi, Mohammad Mehdi; Zarnani, Amir Hassan; Goli, Leila Balaei; Babaei, Mahdokht; Ghods, Roya

    2010-04-01

    R-Phycoerythrin (R-PE), a fluorescent protein from phycobiliprotein family, is isolated from red algae. Conjugation of antibodies to R-PE facilitates multiple fluorescent staining methods. In the present study polyclonal antibodies and polyclonal F(ab')2 fragment antibodies were conjugated to R-PE by two different methods. The efficiency of the methods was evaluated using Immunocytochemistry (ICC) and Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE). In the first conjugation method, PE was attached to SMCC linker followed by conjugation of antibody to PE-SMCC. In the second method, SH groups were added onto R-PE molecule, while the antibody was attached to SPDP linker. Then, the antibody-SPDP molecule was conjugated to R-PE. Our results showed that the two conjugation methods did not have any abrogative effects on the antibody binding activity. PMID:23407609

  8. A Nanoparticle Platform To Evaluate Bioconjugation and Receptor-Mediated Cell Uptake Using Cross-Linked Polyion Complex Micelles Bearing Antibody Fragments.

    Science.gov (United States)

    Florinas, Stelios; Liu, Marc; Fleming, Ryan; Van Vlerken-Ysla, Lilian; Ayriss, Joanne; Gilbreth, Ryan; Dimasi, Nazzareno; Gao, Changshou; Wu, Herren; Xu, Ze-Qi; Chen, Shaoyi; Dirisala, Anjaneyulu; Kataoka, Kazunori; Cabral, Horacio; Christie, R James

    2016-05-01

    Targeted nanomedicines are a promising technology for treatment of disease; however, preparation and characterization of well-defined protein-nanoparticle systems remain challenging. Here, we describe a platform technology to prepare antibody binding fragment (Fab)-bearing nanoparticles and an accompanying real-time cell-based assay to determine their cellular uptake compared to monoclonal antibodies (mAbs) and Fabs. The nanoparticle platform was composed of core-cross-linked polyion complex (PIC) micelles prepared from azide-functionalized PEG-b-poly(amino acids), that is, azido-PEG-b-poly(l-lysine) [N3-PEG-b-PLL] and azido-PEG-b-poly(aspartic acid) [N3-PEG-b-PAsp]. These PIC micelles were 30 nm in size and contained approximately 10 polymers per construct. Fabs were derived from an antibody binding the EphA2 receptor expressed on cancer cells and further engineered to contain a reactive cysteine for site-specific attachment and a cleavable His tag for purification from cell culture expression systems. Azide-functionalized micelles and thiol-containing Fab were linked using a heterobifunctional cross-linker (FPM-PEG4-DBCO) that contained a fluorophenyl-maleimide for stable conjugation to Fabs thiols and a strained alkyne (DBCO) group for coupling to micelle azide groups. Analysis of Fab-PIC micelle conjugates by fluorescence correlation spectroscopy, size exclusion chromatography, and UV-vis absorbance determined that each nanoparticle contained 2-3 Fabs. Evaluation of cellular uptake in receptor positive cancer cells by real-time fluorescence microscopy revealed that targeted Fab-PIC micelles achieved higher cell uptake than mAbs and Fabs, demonstrating the utility of this approach to identify targeted nanoparticle constructs with unique cellular internalization properties. PMID:27007881

  9. Neutralizing human monoclonal antibody against H5N1 influenza HA selected from a Fab-phage display library

    Directory of Open Access Journals (Sweden)

    Ooi Eng

    2008-10-01

    Full Text Available Abstract Identification of neutralizing antibodies with specificity away from the traditional mutation prone antigenic regions, against the conserved regions of hemagglutinin from H5N1 influenza virus has the potential to provide a therapeutic option which can be developed ahead of time in preparation for a possible pandemic due to H5N1 viruses. In this study, we used a combination of panning strategies against the hemagglutinin (HA of several antigenic distinct H5N1 isolates to bias selection of Fab-phage from a naïve human library away from the antigenic regions of HA, toward the more conserved portions of the protein. All of the identified Fab clones which showed binding to multiple antigenically distinct HA were converted to fully human IgG, and tested for their ability to neutralize the uptake of H5N1-virus like particles (VLP into MDCK cells. Five of the antibodies which showed binding to the relatively conserved HA2 subunit of HA, exhibited neutralization of H5N1-VLP uptake in a dose dependant manner. The inhibitory effects of these five antibodies were similar to those observed with a previously described neutralizing antibody specific for the 140s antigenic loop present within HA1 and highlight the exciting possibility that these antibodies may be efficacious against multiple H5N1 strains.

  10. Reducing the renal uptake of radiolabeled antibody fragments and peptides for diagnosis and therapy: present status, future prospects and limitations

    International Nuclear Information System (INIS)

    Over recent years, one of the focuses of research has been to develop suitable methods to reduce renal uptake, and to evaluate whether the resulting methodology will benefit therapy with antibody fragments and peptides. In these studies it has been shown that the kidney uptake of antibody fragments in animals can be reduced in a dose-dependent manner by almost one order of magnitude by the systemic administration of cationic amino acids and their derivatives, whereas the uptake in all other organs, as well as the tumor, remains unaffected. A similar reduction in renal retention is achieved for all intracellularly retained radionuclides (e.g., radiometals) or radioiodinated immunoconjugates, as well as for smaller peptides. Lysine is usually the preferred agent, and its d- and l-isomers are equally effective whether given intraperitoneally or orally. Amino sugars are effective, but their N-acetyl derivatives, lacking the positive charge, are not. Basic polypeptides are also effective, and their potency increases with increasing molecular weight. Urine analysis of treated individuals shows the excretion of unmetabolized, intact fragments or peptides, in contrast to mostly low-molecular-weight metabolites in untreated controls. In therapy studies using radiometal-conjugated Fab fragments, the kidney is the first dose-limiting organ. Administration of cationic amino acids results in a substantial increase in the maximum tolerated dose of such Fab fragments. As was the case in animal studies, in pilot clinical trials the renal uptake in patients injected with Fab' fragments and given amino acids could be decreased significantly, whereas the uptake by all other organs remained unaffected. Thus, radiation nephrotoxicity of antibody fragments and peptides can be overcome successfully. (orig./MG) (orig.)

  11. Label-free Fab and Fc affinity/avidity profiling of the antibody complex half-life for polyclonal and monoclonal efficacy screening.

    Science.gov (United States)

    Read, Thomas; Olkhov, Rouslan V; Williamson, E Diane; Shaw, Andrew M

    2015-09-01

    A unified approach to affinity screening for Fab and Fc interactions of an antibody for its antigen and FcγR receptor has been developed. An antigen array is used for the Fab affinity and cross-reactivity screening and protein A/G proxy is the FcγR receptor. The affinities are derived using a simple 1:1 binding model with a consistent error analysis. The association and dissociation kinetics are measured over optimised times for accurate determination. The Fab/Fc affinities are derived for ten antibodies: mAb-actin (mouse), pAb-BSA (sheep), pAb-collagen V (rabbit), pAb-CRP (goat), mAb-F1 (mouse), mAbs (mouse) 7.3, 12.3, 29.3, 36.3 and 46.3 raised against LcrV in Yersinia pestis. The rate of the dissociation of antigen-antibody complexes relates directly to their immunological function as does the Fc-FcγR complex and a new half-life plot has been defined with a Fab/Fc half-life range of 17-470 min. The upper half-life value points to surface avidity. Two antibodies that are protective as an immunotherapy define a Fab half-life >250 min and an Fc half-life >50 min as characteristics of ideal interactions which can form the basis of an antibody screen for immunotherapy. PMID:26187320

  12. Study of the viability of technetium-99m labeling of whole antimyosin antibody and its fragment: development of radiopharmaceutical for cardiac survey

    International Nuclear Information System (INIS)

    In the acute myocardium infarction, the myocytes cell membrane loses its integrity, allowing the influx of extracellular macromolecules such as circulating antibody into the damaged cell. The use of the specific antibodies against cardiac myosin labeled with 99mTc allows to determine the localization and extension of myocardial infarction. The purpose of this work was to study the viability of labeling of the antimyosin monoclonal antibody and its fragment F(ab')2 with 99mTc. Because of the high cost of antimyosin antibody, others antibodies were used to optimize the methodology and the best condition was used for antimyosin antibody. The intact antibody was cleaved by pepsin to produce F(ab')2 fragment. The F(ab')2 and the intact antibody were reduced by treatment with Dithiothreitol (DTT) and 2-Mercaptoethanol (2-ME) and labeled with 99mTc by direct method. Different concentrations of reductant, mixing conditions and incubation times were studied. In the standard condition, incubation at molar ratio 1:1000 (antibody:reducing agent) at room temperature for 30 minutes with continuous rotation (850 rpm), 13.28 - SH groups were formed per molecule. It was studied the influence of p H, of the concentration of stannous chloride (Sn2+) and incubation time in the labeling condition. The better radiochemical yield (90.06 +- 1.53%) was obtained using 2.5 μg of Sn2+ in p H 4.5 for 60 minutes. The labeling of the fragment F(ab')2 did not present satisfactory results because of the low yield of the digestion. After purification by PD-10, the biodistribution study was performed and showed that the intact antimyosin antibody labeled with 99mTc presented fast kinetic compatible with the biodistribution of an intact antibody labeled with 99mTc. Scintigraphy image of the animal with myocardial infarction was obtained and compared with the image of a normal animal. The studies allow to conclude that the use of fragment F(ab')2 are not viable, but the use of the labeled antimyosin

  13. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents. PMID:15518242

  14. [One amino acid mutation in an anti-CD20 antibody fragment that affects the yield bacterial secretion and the affinity].

    Science.gov (United States)

    Liu, Yin-Xing; Xiong, Dong-Sheng; Fan, Dong-Mei; Shao, Xiao-Feng; Xu, Yuan-Fu; Zhu, Zhen-Ping; Yang, Chun-Zheng

    2003-05-01

    Monoclonal antibodies (mAb) directed against CD20, either unmodified or in radiolabeled forms, have been successfully exploited in clinic as effective therapeutic agents in the management of non-Hodgkin's B-cell lymphoma. The antibody fragment is a potential agent in image and therapy of tumor. To further improve the soluble expression of anti-CD20 antibody Fab' fragment, PCR was used to mutate the anti-CD20 VL and VH genes and its biological activity was identified. The expression vector of chimeric antibody Fab' was constructed and expressed in E. coli. The data of mutant clone DNA sequence showed that the amino acid of light chain gene of the parent anti-CD20 antibody (H47) was successful mutated as Ser (GAG)-Asn (CAG). The soluble expression of mutated anti-CD20 Fab' (CD20-7) was 3.8 mg/g dry cell weight, while the parent (CD20-2) was 1.3 mg/g dry cell weight. The affinity constant Ka of CD20-7 was 2.2 x 10(9) L/mol. The primary results of competitive assays by FACS showed that CD20-7 could partially block the sites through which parent antibody (HI47) bind to Raji cells. There was difference in the Raji cells (CD20+)-binding activity between the mutant CD20-7 and parent CD20-2. The site mutation of anti-CD20 Fab' gene make it possible that the anti-CD20 antibody fragment was succeeded to obtain higher expression. In this thesis, we succeeded in completing mutation and expression of anti-CD20 Fab' genes, distinguishing its biological activity, and obtaining its highly expression. These period results will lay a foundation for development of other kind of anti-CD20 engineering antibody (for instance: Fab' Diabody and miniantibody), and make it possible for anti-CD20 antibody to be applied to tumor therapy in civil in the future. PMID:15969005

  15. An efficient method for isolating antibody fragments against small peptides by antibody phage display

    DEFF Research Database (Denmark)

    Duan, Zhi; Siegumfeldt, Henrik

    2010-01-01

    We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do not...... scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

  16. A sensitive TSH assay in spot-coated microwells utilizing recombinant antibody fragments.

    Science.gov (United States)

    Ylikotila, J; Välimaa, L; Vehniäinen, M; Takalo, H; Lövgren, T; Pettersson, K

    2005-11-30

    We have developed a novel TSH immunoassay based on a simplified test protocol suitable for point-of-care testing yet providing 3rd generation TSH assay sensitivity. The antibody density and the functional solid phase capacity were improved up to six-fold by capturing the site-specifically biotinylated recombinant Fab fragment or single chain antibody fragment onto the surface of immobilized streptavidin. An important mechanism for obtaining a low limit of detection (0.003 mIU/l) was the reduction of the coated area to a size ("spot") more closely coinciding with the excitation beam. The reporter technology was based on time-resolved fluorometric detection of inherently fluorescent europium chelates of high quantum yield. The ready-to-use assay concept employed the all-in-one (Aio!) principle--holding all assay components in a dry form in the microtitration well--to provide a simple assay protocol. Direct signal measurement from the surface was done after the washing step without a separate development step. It is concluded that size reduction and site-specific labeling of the antibodies to create a surface with high functional capacity provides a rapid, highly sensitive immunoassay. PMID:16154584

  17. Effect of chloramine-T labeling conditions on the stability of monoclonal antibodies and their fragments

    International Nuclear Information System (INIS)

    Rapid in vivo degradation of radioiodinated monoclonal antibodies (MAb) has been reported. Conditions for radioiodination have varied. The purposes of this study were to compare the stability of MAb and their fragments when iodinated with chloramine-T (CT) under different conditions, and to compare methods for quality assessment of the radioiodinated molecules. A B-cell lymphoma MAb (Lym-1, IgG2a) and its FAb fragment, and a mammary cancer MAb(B6.01, IgG1) and its F(Ab')/sub 2/ fragment were iodinated with I-125 at CT:AB and I:Ab ratios of 1:1 and 1:10. Molecular sieving (TSK-3000) high performance liquid chromatography (HPLC), cellulose acetate electrophoresis (CAE) at 11 and 45 minutes and solid phase immunoreactivity (IRA) were used to observe stability of the molecules when stored at 40C. Radiochemical yield was greater than 95% in all instances. Iodination at CT:Ab and I:Ab ratios of 1:1 induced progressive degradation in all species which was most marked for the fragments. Iodination at CT:Ab and I:Ab ratios of 1:10 resulted in no observable degradation over 21 days. There was no significant difference in degradation between the IgG2a and IgG1 antibody when iodinated under identical circumstances. HPLC, CAE for 11 minutes and IRA, but not CAE for 45 minutes, revealed comparable changes. The authors conclude that lesser amounts of chloramine-T can be used to iodinate MAb and their fragments without loss of radiochemical efficiency and with improved stability of the species. MAb fragments are more vulnerable to chloramine-T. These observations may explain, at least in part, rapid in vivo degradation of radioiodinated MAb

  18. Choice of labeling and cell line influences interactions between the Fab fragment AbD15179 and its target antigen CD44v6

    International Nuclear Information System (INIS)

    Medical imaging by use of immunotargeting generally relies on a labeled molecule binding to a specific target on the cell surface. It is important to utilize both cell-based and time-resolved binding assays in order to understand the properties of such molecular interactions in a relevant setting. In this report we describe the detailed characterization of the interaction properties for AbD15179, a promising CD44v6-targeting antibody fragment for radio-immunotargeting. Influence of labeling and cell-line model on the protein interaction kinetics was assessed using three different labeling approaches (111In, 125I and FITC) on three different squamous carcinoma cell lines. Interactions were measured using time-resolved assays on living cells, and further analyzed with Interaction Map®. Results demonstrated a general biphasic appearance of a high- and a low-affinity binding event in all cases. The relative contribution from these two interactions differed between conjugates. For 125I-Fab, the population of low-affinity binders could be significantly increased by extending the chloramine T exposure during labeling, whereas the 111In-labeling predominantly resulted in a high-affinity interaction. Interactions were also shown to be cell line dependent, with e.g. SCC-25 cells generally mediating a faster dissociation of conjugates compared to the other cell lines. In conclusion, we report both cell line dependent and labeling associated variations in interaction kinetics for AbD15179 binding to CD44v6. This has implications for cell-based kinetic assays and applications based on labeled conjugates in general, as well as in a clinical setting, where each individual tumor may create different kinetic profiles for the same conjugate

  19. Effects of a superantigen-antibody recombinant fusion protein (r-C242 Fab-SEA) on toxicological responses in the anaesthetised rabbit

    International Nuclear Information System (INIS)

    The objective was to study toxin-induced effects on physiological parameters in the rabbit and whether these parameters show dose-response and co-variation after administration of a recombinant fusion protein between staphylococcal enterotoxin (SE) and the Fab fragment of an antibody. Rabbits are very sensitive to SE toxins and the cardiovascular and immune effects are similar to those observed in septic shock in man. The test compound, r-C242 Fab-SEA, was administered intravenously to anaesthetised New Zealand white rabbits at doses in the range of 0.00005-50 μg/kg. All rabbits were checked for titres of anti-SEA antibodies before entering the experiment, since they could neutralise the effect of the test compound. Heart rate, blood pressure and body temperature were continuously monitored before and during 6 h after dosing. Immediately before the start of administration and 3 and 6 h during the experiment, blood gases (pO2 and pCO2), pH, haematology, clinical chemistry, cytokine response (TNF-α) and trace elements (Mn, Cu, Zn, Se, Ag, Cd, Hg and Pb) were measured. No mortality occurred, but at 50 μg/kg severe adverse clinical signs developed. The decrease in blood pressure was weakly dose-related. Heart rate, ECG, body temperature, pCO2 and pH were not affected by the treatment. pO2 tended to increase as a function of time, but not in relation to dose. WBC and PLT decreased dose dependently. TNF-α was not affected by the treatment. The major effects on clinical chemistry were a dose-dependent increase in AST and creatinine. Potassium and urea showed dose dependent increases, mainly at higher doses, though these changes were of less value for drug selection purposes. Trace element changes were observed, including an increase in Mn and a decrease of Zn at all doses. The Cu/Zn ratio decreased below normal at low doses, whereas at high doses in which adverse effects developed, it increased above normal. Post mortem examination revealed minimal to moderate dose

  20. Pulmonary uptake in indium-111-antimyosin fab fragment imaging following human cardia transplantation

    International Nuclear Information System (INIS)

    Recent studies suggest that cardiac uptake of 111In-labeled antimyosin monoclonal antibody may be estimated semiquantitatively by calculating a heart-to-lung activity ratio, with pulmonary uptake serving as a reference region. The authors obtained 96 111In-antimyosin scintigraphs to monitor rejection occurrence after heart transplantation in 26 patients. On five scintigraphs, the count rate density in ROIs over the lungs was markedly higher (mean 53% higher) than that in the immediately preceding and following scintigraphs, whereas the activity in the heart was essentially unchanged. Four of these scintigraphs coincided with ongoing pulmonary infection and the fifth with an occurrence of a high anti-CMV titer. The mechanism of apparent nonspecific antimyosin accumulation in the lungs is uncertain, although increased capillary permeability may be one possibility. Attention should be given to activity in the lungs if this activity is used as a reference in studies of 111In-antimyosin uptake in the heart. 15 refs., 3 figs., 1 tab

  1. Isolation of Balamuthia mandrillaris-specific antibody fragments from a bacteriophage antibody display library.

    Science.gov (United States)

    Siddiqui, Ruqaiyyah; Kulsoom, Huma; Lalani, Salima; Khan, Naveed Ahmed

    2016-07-01

    Balamuthia mandrillaris is a protist pathogen that can cause encephalitis with a mortality rate of more than 95%. Early diagnosis followed by aggressive treatment is a pre-requisite for successful prognosis. Current methods for identifying this organism rely on culture and microscopy, antibody-based methods using animals, or involve the use of molecular tools that are expensive. Here, we describe the isolation of antibody fragments that can be used for the unequivocal identification of B. mandrillaris. B. mandrillaris-specific antibody fragments were isolated from a bacteriophage antibody display library. Individual clones were studied by enzyme-linked immunosorbent assay, and immunofluorescence. Four antibody clones showed specific binding to B. mandrillaris. The usefulness of phage antibody display technology as a diagnostic tool for isolating antibody fragments against B. mandrillaris antigens and studying their biological role(s) is discussed further. PMID:27055361

  2. Generation and selection of immunized Fab phage display library against human B cell lymphoma

    Institute of Scientific and Technical Information of China (English)

    Yongmei Shen; Xiaochun Yang; Ningzheng Dong; Xiaofang Xie; Xia Bai; Yizhen Shi

    2007-01-01

    The approval of using monoclonal antibodies as a targeted therapy in the management of patients with B cell lymphoma has led to new treatment options for this group of patients. Production of monoclonal antibodies by the traditional hybridoma technology is costly, and the resulting murine antibodies often have the disadvantage of triggering human anti-mouse antibody (HAMA) response. Therefore recombinant Fab antibodies generated by the phage display technology can be a suitable alternative in managing B cell lymphoma. In this study, we extracted total RNA from spleen cells of BALB/c mice immunized with human B lymphoma cells, and used RT-PCR to amplify cDNAs coding for the K light chains and Fd fragments of heavy chains. After appropriate restriction digests, these cDNA fragments were successively inserted into the phagemid vector pComb3H-SS to construct an immunized Fab phage display library. The diversity of the constructed library was approximately 1.94×107. Following five rounds of biopanning, soluble Fab antibodies were produced from positive clones identified by ELISA. From eight positive clones, FabC06, FabC21, FabC43 and FabC59 were selected for sequence analysis. At the level of amino acid sequences, the variable heavy domains (VH) and variable light domains (VL) were found to share 88-92% and 89-94% homology with sequences coded by the corresponding murine germline genes respectively. Furthermore, reactivity with membrane proteins of the B cell lymphoma was demonstrated by immunohistochemistry and western blotting. These immunized Fab antibodies may provide a valuable tool for further study of B cell lymphoma and could also contribute to the improvement of disease therapy.

  3. Indium-111 antimyosin monoclonal antibody Fab imaging in patients with cardiomyopathy

    International Nuclear Information System (INIS)

    Six patients with cardiomyopathy were imaged following intravenous injection of an indium-111 labeled monoclonal antibody directed against the heavy chain of cardiac myosin. Two patients had hypertrophic non-obstructive cardiomyopathy (HNCM), two patients had dilated cardiomyopathy (DCM), and two patients had specific heart muscle disease. One of 2 patients with HNCM and one of 2 patients with DCM had a positive antimyosin scan. The 2 patients with specific heart muscle disease manifested persistent blood pool activity of the antibody, thereby precluding interpretation of the images. The present report demonstrates that antimyosin antibody imaging may provide evidence of myocardial injury, or necrosis in some patients with cardiomyopathy. (author)

  4. A comparison of 111In- or 64Cu-DOTA-trastuzumab Fab fragments for imaging subcutaneous HER2-positive tumor xenografts in athymic mice using microSPECT/CT or microPET/CT

    OpenAIRE

    Chan, Conrad; Scollard, Deborah A; McLarty, Kristin; Smith, Serena; Reilly, Raymond M

    2011-01-01

    Background Our objective was to compare 111In- or 64Cu-DOTA-trastuzumab Fab fragments for imaging small or large s.c. tumor xenografts in athymic mice that display a wide range of human epidermal growth factor receptor-2 (HER2) expression using microSPECT/CT or microPET/CT. Methods Trastuzumab Fab were labeled with 111In or 64Cu by conjugation to 1,4,7,10-tetraazacyclododecane N, N', N'', N'''-tetraacetic acid (DOTA). The purity of 111In- and 64Cu-DOTA-trastuzumab Fab was measured by SDS-PAGE...

  5. An investigation into the mechanism of protection by local passive immunization with monoclonal antibodies against Streptococcus mutans.

    OpenAIRE

    Ma, J K; Hunjan, M; Smith, R; Kelly, C; Lehner, T.

    1990-01-01

    Local oral passive immunization with Streptococcus mutans-specific monoclonal antibody (MAb) (Guy's 13) prevented recolonization by indigenous S. mutans in human volunteers who had first been treated with a conventional antibacterial agent (chlorhexidine). The F(ab')2 fragment of the MAb was as protective as the intact immunoglobulin G, but the Fab fragment of the molecule failed to prevent recolonization of S. mutans. In subjects receiving the MAb Fab fragment, S. mutans levels in dental pla...

  6. Intraspinal distribution and reaction in the grey matter with tetanus toxin of intracisternally injected anti-tetanus toxoid F(ab')2 fragments

    International Nuclear Information System (INIS)

    Anti-tetanus toxoid F(ab')2 fragments were purified using immune-affinity chromatography on tetanus toxoid-Sepharose. Fragments were labeled with 125I. Labeled or non-labeled fragments were injected into the intrathecal space of rats. The labeled fragments were found in the spinal cord outside but not inside neurons. Tetanus toxin was injected into a muscle and 36 h later labeled fragments were injected intracisternally. After another 24 h the label was elevated in the spinal cord half segments giving neural supply to the injected muscle and in these half-segments the label was concentrated around some α-motoneurons. [125I]Tetanus toxin was injected into a muscle and at different times thereafter non-labeled fragments were injected intracisternally. The development of hindlimb rigidity but not the accumulation of [125I]tetanus toxin in α-motoneurons was prevented by early intracisternal injection of fragments. Injection of fragments after the appearance of hindlimb rigidity did not revert the rigidity but prevented the further development of symptoms. (Auth.)

  7. Monoclonal antibodies and Fc fragments for treating solid tumors

    Directory of Open Access Journals (Sweden)

    Eisenbeis AM

    2012-01-01

    Full Text Available Andrea M Eisenbeis, Stefan J GrauDepartment of Neurosurgery, University Hospital of Cologne, Cologne, GermanyAbstract: Advances in biotechnology, better understanding of pathophysiological processes, as well as the identification of an increasing number of molecular markers have facilitated the use of monoclonal antibodies and Fc fragments in various fields in medicine. In this context, a rapidly growing number of these substances have also emerged in the field of oncology. This review will summarize the currently approved monoclonal antibodies used for the treatment of solid tumors with a focus on their clinical application, biological background, and currently ongoing trials.Keywords: targeted therapy, monoclonal antibodies, cancer, biological therapy

  8. Structure of Rotavirus Outer-Layer Protein VP7 Bound with a Neutralizing Fab

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, Scott T.; Settembre, Ethan C.; Trask, Shane D.; Greenberg, Harry B.; Harrison, Stephen C.; Dormitzer, Philip R.; (Stanford-MED); (CH-Boston)

    2009-06-17

    Rotavirus outer-layer protein VP7 is a principal target of protective antibodies. Removal of free calcium ions (Ca{sup 2+}) dissociates VP7 trimers into monomers, releasing VP7 from the virion, and initiates penetration-inducing conformational changes in the other outer-layer protein, VP4. We report the crystal structure at 3.4 angstrom resolution of VP7 bound with the Fab fragment of a neutralizing monoclonal antibody. The Fab binds across the outer surface of the intersubunit contact, which contains two Ca{sup 2+} sites. Mutations that escape neutralization by other antibodies suggest that the same region bears the epitopes of most neutralizing antibodies. The monovalent Fab is sufficient to neutralize infectivity. We propose that neutralizing antibodies against VP7 act by stabilizing the trimer, thereby inhibiting the uncoating trigger for VP4 rearrangement. A disulfide-linked trimer is a potential subunit immunogen.

  9. High affinity mouse-human chimeric Fab against Hepatitis B surface antigen

    Institute of Scientific and Technical Information of China (English)

    Biplab Bose; Navin Khanna; Subrat K Acharya; Subrata Sinha

    2005-01-01

    AIM: Passive immunotherapy using antibody against hepatitis B surface antigen (HBsAg) has been advocated in certain cases of Hepatitis B infection. We had earlier reported on the cloning and expression of a high affinity scFv derived from a mouse monoclonal (5S) against HBsAg. However this mouse antibody cannot be used for therapeutic purposes as it may elicit anti-mouse immune responses. Chimerization by replacing mouse constant domains with human ones can reduce the immunogenicity of this antibody.METHODS: We cloned the VH and VL genes of this mouse antibody; and fused them with CH1 domain of human IgG1 and CL domain of human kappa chain respectively. These chimeric genes were cloned into a phagemid vector. After initial screening using the phage display system, the chimeric Fab was expressed in soluble form in E. Coli.RESULTS: The chimeric Fab was purified from the bacterial periplasmic extract. We characterized the chimeric Fab using several in vitro techniques and it was observed that the chimeric molecule retained the high affinity and specificity of the original mouse monoclonal.This chimeric antibody fragment was further expressed in different strains of E> coli to increase the yield.CONCLUSION: We have generated a mouse-human chimeric Fab against HBsAg without any significant loss in binding and epitope specificity. This chimeric Fab fragment can be further modified to generate a fulllength chimeric antibody for therapeutic uses.

  10. Phage display used for gene cloning of human recombinant antibody against the erythrocyte surface antigen, rhesus D

    DEFF Research Database (Denmark)

    Dziegiel, M; Nielsen, L K; Andersen, P S;

    1995-01-01

    A novel phage display system has been developed for PCR amplification and cloning of the Fab fragments of human immunoglobulin genes. Using this system, we have cloned an antibody from a mouse-human hybridoma cell line directed against the erythrocyte antigen rhesus D. Intact erythrocytes were used...... for absorption of the Fab phages. Soluble Fab fragments produced from the cloned material showed identical performance to the parental antibody in agglutination assays. Gel filtration confirmed that the Fab fragment consists of a kappa-Fd heterodimer. The successful use of intact cells for selection...

  11. ANTITUMOR EFFECTS OF MONOCLONAL ANTIBODY FAB′ FRAGMENT CONTAINING IMMUNOCONJUGATES

    Institute of Scientific and Technical Information of China (English)

    刘小云; 甄永苏

    2002-01-01

    Objective.Using monoclonal antibody (mAb) Fab′ fragment to develop mAb immunoconjugates for cancer. Methods.Fab′ fragment of mAb 3A5 was prepared by digestion of the antibody with pepsin and then reduced by dithiothreitol (DTT),while Fab′ fragment of mAb 3D6 was obtained by digestion of the antibody with ficin and subsequently reduced by β mercaptoethanol.The conjugation between Fab′ fragment and pingyangmycin (PYM),an antitumor antibiotic,was mediated by dextran T 40.Immunoreactivity of Fab′ PYM conjugates with cancer cells was determined by ELISA,and the cytotoxicity of those conjugates to cancer cells was determined by clonogenic assay.Antitumor effects of the Fab′ PYM conjugates were evaluated by subcutaneously transplanted tumors in mice. Results.The molecular weight of Fab′ fragment was approximately 53 kD,while the average molecular weight of Fab′ PYM conjugate was 170 kD.The Fab′ PYM conjugates showed immunoreactivity with antigen relevant cancer cells and selective cytotoxicity against target cells.Administered intravenously,Fab′ PYM conjugates were more effective against the growth of tumors in mice than free PYM and PYM conjugated with intact mAb. Conclusion.Fab′ PYM conjugate may be capable of targeting cancer cells and effectively inhibiting tumor growth,suggesting its therapeutic potential in cancer treatment.

  12. Production of recombinant antibodies using bacteriophages

    OpenAIRE

    Shukra, A. M.; Sridevi, N. V.; Dev Chandran,; Kapil Maithal,

    2014-01-01

    Recombinant antibody fragments such as Fab, scFv, diabodies, triabodies, single domain antibodies and minibodies have recently emerged as potential alternatives to monoclonal antibodies, which can be engineered using phage display technology. These antibodies match the strengths of conventionally produced monoclonal antibodies and offer advantages for the development of immunodiagnostic kits and assays. These fragments not only retain the specificity of the whole monoclonal ...

  13. Fast antibody fragment motion: flexible linkers act as entropic spring.

    Science.gov (United States)

    Stingaciu, Laura R; Ivanova, Oxana; Ohl, Michael; Biehl, Ralf; Richter, Dieter

    2016-01-01

    A flexible linker region between three fragments allows antibodies to adjust their binding sites to an antigen or receptor. Using Neutron Spin Echo Spectroscopy we observed fragment motion on a timescale of 7 ns with motional amplitudes of about 1 nm relative to each other. The mechanistic complexity of the linker region can be described by a spring model with Brownian motion of the fragments in a harmonic potential. Displacements, timescale, friction and force constant of the underlying dynamics are accessed. The force constant exhibits a similar strength to an entropic spring, with friction of the fragment matching the unbound state. The observed fast motions are fluctuations in pre-existing equilibrium configurations. The Brownian motion of domains in a harmonic potential is the appropriate model to examine functional hinge motions dependent on the structural topology and highlights the role of internal forces and friction to function. PMID:27020739

  14. Structural Comparison of Different Antibodies Interacting with Parvovirus Capsids

    Energy Technology Data Exchange (ETDEWEB)

    Hafenstein, Susan; Bowman, Valorie D.; Sun, Tao; Nelson, Christian D.S.; Palermo, Laura M.; Chipman, Paul R.; Battisti, Anthony J.; Parrish, Colin R.; Rossmann, Michael G.; Cornell; Purdue

    2009-05-13

    The structures of canine parvovirus (CPV) and feline parvovirus (FPV) complexed with antibody fragments from eight different neutralizing monoclonal antibodies were determined by cryo-electron microscopy (cryoEM) reconstruction to resolutions varying from 8.5 to 18 {angstrom}. The crystal structure of one of the Fab molecules and the sequence of the variable domain for each of the Fab molecules have been determined. The structures of Fab fragments not determined crystallographically were predicted by homology modeling according to the amino acid sequence. Fitting of the Fab and virus structures into the cryoEM densities identified the footprints of each antibody on the viral surface. As anticipated from earlier analyses, the Fab binding sites are directed to two epitopes, A and B. The A site is on an exposed part of the surface near an icosahedral threefold axis, whereas the B site is about equidistant from the surrounding five-, three-, and twofold axes. One antibody directed to the A site binds CPV but not FPV. Two of the antibodies directed to the B site neutralize the virus as Fab fragments. The differences in antibody properties have been linked to the amino acids within the antibody footprints, the position of the binding site relative to the icosahedral symmetry elements, and the orientation of the Fab structure relative to the surface of the virus. Most of the exposed surface area was antigenic, although each of the antibodies had a common area of overlap that coincided with the positions of the previously mapped escape mutations.

  15. Crystallization and preliminary X-ray diffraction analysis of the complex between a human anti-alpha toxin antibody fragment and alpha toxin

    International Nuclear Information System (INIS)

    Crystals of the complex between the Fab fragment of a human anti-alpha toxin antibody and alpha toxin have been obtained. Diffraction data sets were collected to 2.56 Å resolution. Staphylococcus aureus alpha toxin (AT) has been crystallized in complex with the Fab fragment of a human antibody (MEDI4893). This constitutes the first reported crystals of AT bound to an antibody. The monoclinic crystals belonged to space group P21, with unit-cell parameters a = 85.52, b = 148.50, c = 93.82 Å, β = 99.82°. The diffraction of the crystals extended to 2.56 Å resolution. The asymmetric unit contained two MEDI4893 Fab–AT complexes. This corresponds to a crystal volume per protein weight (VM) of 2.3 Å3 Da−1 and a solvent content of 47%. The three-dimensional structure of this complex will contribute to an understanding of the molecular basis of the interaction of MEDI4893 with AT. It will also shed light on the mechanism of action of this antibody, the current evaluation of which in the field of S. aureus-mediated diseases makes it a particularly interesting case study. Finally, this study will provide the three-dimensional structure of AT in a monomeric state for the first time

  16. Recombinant fragment of an antibody tailored for direct radioiodination

    Czech Academy of Sciences Publication Activity Database

    Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína

    2012-01-01

    Roč. 55, č. 1 (2012), s. 52-56. ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012

  17. The study on the use of fragmented antibody for the development of therapeutic radiopharmaceutical

    International Nuclear Information System (INIS)

    This project was designed to develop the therapeutic radiopharmaceuticals for therapy and diagnosis of cancer using fragmented antibodies. The major activities to be carried out are as follows: - exploration of the key angiogenic factors involved in cancer, - development of radiolabeled-compounds using antibody fragments for minimal toxicity - In vitro/vivo investigation on the targeting ability of RI labeled antibody fragment

  18. Fluorescent labeling of antibody fragments using split GFP.

    Directory of Open Access Journals (Sweden)

    Fortunato Ferrara

    Full Text Available Antibody fragments are easily isolated from in vitro selection systems, such as phage and yeast display. Lacking the Fc portion of the antibody, they are usually labeled using small peptide tags recognized by antibodies. In this paper we present an efficient method to fluorescently label single chain Fvs (scFvs using the split green fluorescent protein (GFP system. A 13 amino acid tag, derived from the last beta strand of GFP (termed GFP11, is fused to the C terminus of the scFv. This tag has been engineered to be non-perturbing, and we were able to show that it exerted no effect on scFv expression or functionality when compared to a scFv without the GFP11 tag. Effective functional fluorescent labeling is demonstrated in a number of different assays, including fluorescence linked immunosorbant assays, flow cytometry and yeast display. Furthermore, we were able to show that this split GFP system can be used to determine the concentration of scFv in crude samples, as well an estimate of antibody affinity, without the need for antibody purification. We anticipate this system will be of widespread interest in antibody engineering and in vitro display systems.

  19. Localization of melanoma with radiolabelled monoclonal antibody fragments and iodoamphetamine

    Energy Technology Data Exchange (ETDEWEB)

    Liewendahl, K.; Kairento, A.L.; Lindroth, L.; Pyroenen, S.; Franssila, K.; Virkkunen, P.; Asko-Seljavaara, S.; Launes, J.

    1986-10-01

    In two melanoma patients, metastases accumulated both /sup 99m/Tc-labelled monoclonal anti-tumor F(ab')/sub 2/ fragments and N-isopropyl-p-(/sup 123/I)-iodoamphetamine. Small metastatic deposits were localized only by labelled antibody, for which a higher target-to-nontarget ratio was observed than for radioiodoamphetamine, indicating that immunoscintigraphy may be the more sensitive method. In these two patients positive immunohistochemical staining for the antibody used was observed, whereas in a third patient, with no concentration of labelled antibody, the staining result was negative showing the specificity of the immunoscintigraphy findings. It is possible that the accumulation of radio-iodoamphetamine is due to binding to melanin but this is not certain as tissue samples from one of the two patients with positive scintigrams did not contain stainable melanin.

  20. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-CH3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  1. Crystallization and preliminary X-ray diffraction analysis of the complex between a human anti-interferon antibody fragment and human interferon α-2A

    International Nuclear Information System (INIS)

    Crystals of the complex between the Fab fragment of a human anti-interferon α therapeutic antibody and human interferon α-2A have been obtained and diffracted to 3.0 Å resolution. Recombinant human interferon α-2A (rhIFN-α-2A) has been crystallized in complex with the recombinantly produced Fab fragment of a therapeutic monoclonal antibody (MEDI545; IgG1/κ) which targets several human interferon α subtypes. This constitutes the first reported crystals of a human type I interferon bound to an antibody. The orthorhombic crystals belonged to either space group I222 or I212121, with unit-cell parameters a = 134.82, b = 153.26, c = 163.49 Å. The diffraction of the crystals extended to 3.0 Å resolution. The asymmetric unit contained two Fab–rhIFN-α-2A complexes. This corresponded to a crystal volume per protein weight (VM) of 3.02 Å3 Da−1 and a solvent content of 59.3%. The corresponding three-dimensional structure is expected to shed light on the mechanism of action of MEDI545 and the molecular basis of its specificity

  2. Cell-Free Synthesis Meets Antibody Production: A Review

    OpenAIRE

    Marlitt Stech; Stefan Kubick

    2015-01-01

    Engineered antibodies are key players in therapy, diagnostics and research. In addition to full size immunoglobulin gamma (IgG) molecules, smaller formats of recombinant antibodies, such as single-chain variable fragments (scFv) and antigen binding fragments (Fab), have emerged as promising alternatives since they possess different advantageous properties. Cell-based production technologies of antibodies and antibody fragments are well-established, allowing researchers to design and manufactu...

  3. High affinity human antibody fragments to dengue virus non-structural protein 3.

    Directory of Open Access Journals (Sweden)

    Nicole J Moreland

    Full Text Available BACKGROUND: The enzyme activities catalysed by flavivirus non-structural protein 3 (NS3 are essential for virus replication. They are distributed between the N-terminal protease domain in the first one-third and the C-terminal ATPase/helicase and nucleoside 5' triphosphatase domain which forms the remainder of the 618-aa long protein. METHODOLOGY/PRINCIPAL FINDINGS: In this study, dengue full-length NS3 protein with residues 49 to 66 of NS2B covalently attached via a flexible linker, was used as bait in biopanning with a naïve human Fab phage-display library. Using a range of truncated constructs spanning the NS2B cofactor region and the full-length NS3, 10 unique Fab were identified and characterized. Of these, monoclonal Fab 3F8 was shown to bind α3″ (residues 526 through 531 within subdomain III of the helicase domain. The antibody inhibits the ATPase and helicase activites of NS3 in biochemical assays and reduces DENV replication in HEK293 cells that were previously transfected with Fab 3F8 compared with mock transfected cells. CONCLUSIONS/SIGNIFICANCE: Antibodies such as 3F8 are valuable tools for studying the molecular mechanisms of flaviviral replication and for the monospecific detection of replicating dengue virus in vivo.

  4. In vitro studies with an anti-platelet monoclonal antibody; P256

    International Nuclear Information System (INIS)

    P256 is a platelet-specific monoclonal antibody. It has potential as a diagnostic agent for use in thrombus detection by radioimmunoscintigraphy. However, the whole antibody has been reported to cause platelet aggregation. The object of the present study was to determine the effects of the F(ab')2 and Fab' fragments of P256 on human platelets in vitro. Gel-filtered platelets were prepared from citrated venous blood, and aggregation was studied at 370C using the method of Born. The whole antibody caused aggregation over the concentration range 10-9-10-7 M, with a maximum of 70% aggregation. The F(ab')2 fragment was less potent with a maximum response of only 45%. The monovalent Fab' fragment caused no aggregation at concentrations up to 10-7 M. However, binding studies with 111In-labelled monovalent Fab' fragment demonstrated saturable displaceable binding. Aggregation induced by the divalent forms of the antibody was partially dependent upon added fibrinogen. It is concluded that the monovalent Fab' fragment of P256 may be used in platelet-labelling studies without risk of inducing aggregation irrespective of concentration. The whole antibody, or its divalent F(ab')2 fragment, may also be used provided their concentrations are kept below 10-9 M. (author)

  5. Development of radioinmunoconjugate 90Y-DOTA-nimotuzumab-Fab for therapy of EGFR over expressing tumors

    International Nuclear Information System (INIS)

    Many monoclonal antibodies conjugated with 1,4,7,10-tetraaza cyclododecane-N, N', N'', N'''-tetraacetic acid (DOTA) and radiolabeled with 90Y, have been used for radioimmunotherapy. As know IgG molecules are heavy proteins with a molecular weight of approximately 150 kDa. Accordingly, intact IgG antibodies may have significant slow kinetics biodistribution and severely limited properties of tissue penetration. Antibody fragments labeled with radio metals could be promising radiopharmaceuticals for imaging and non-invasive therapy due to its high affinity to the tumor, the lack of effector function and rapid pharmacokinetic. In this work, the nimotuzumab Fab fragment was obtained by cleavage with papain in molar excess. After separating the reaction mixture in three steps using affinity, size exclusion and ion exchange chromatography; the Fab fragment showed high values of purity, integrity and identity. The Fab fragment was derivatized with DOTA and labeled with 90Y. The radioimmunoconjugate with high radiochemical yield was assessed by in vitro stability with an excess of 50mM DTPA. The development of 90Y-DOTA-Nimotuzumab-Fab radioimmunoconjugate allows to count on as a potential agent for radioimmunotherapy. (Author)

  6. Isolation of llama antibody fragments for prevention of dandruff by phage display in shampoo

    OpenAIRE

    Dolk, E.; van der Vaart, M.; Lutje Hulsik, D; Vriend, G.; de Haard, H; Spinelli, S.; Cambillau, C.; Frenken, L.; Verrips, T.

    2005-01-01

    As part of research exploring the feasibility of using antibody fragments to inhibit the growth of organisms implicated in dandruff, we isolated antibody fragments that bind to a cell surface protein of Malassezia furfur in the presence of shampoo. We found that phage display of llama single-domain antibody fragments (VHHs) can be extended to very harsh conditions, such as the presence of shampoo containing nonionic and anionic surfactants. We selected several VHHs that bind to the cell wall ...

  7. Isolation of Llama Antibody Fragments for Prevention of Dandruff by Phage Display in Shampoo

    OpenAIRE

    2005-01-01

    As part of research exploring the feasibility of using antibody fragments to inhibit the growth of organisms implicated in dandruff, we isolated antibody fragments that bind to a cell surface protein of Malassezia furfur in the presence of shampoo. We found that phage display of llama single-domain antibody fragments (VHHs) can be extended to very harsh conditions, such as the presence of shampoo containing nonionic and anionic surfactants. We selected several VHHs that bind to the cell wall ...

  8. New Genetic Constructs for Generation of Stable Therapeutic Antibodies to Organophosphorus Toxins in Methylotrophic Yeasts Pichia Pastoris.

    Science.gov (United States)

    Mokrushina, Yu A; Stepanova, A V; Bobik, T V; Smirnov, I V; Gabibov, A G

    2016-05-01

    We propose a new method of obtaining of stable Fab-fragments of antibodies in Pichia pastoris expression system. Recently, we obtained Fab-fragments of antibodies neutralizing organophosphorus toxins. However, high yield of the target products was not attained because of high level of proteolytic degradation. In the present study, we identified sites of proteolytic degradation in Fab-fragments and endogenous proteases performing degradation, which allowed obtaining optimized genetic constructs for expression of antibody heavy chains (IgGγ1) and kappa and lambda isotypes of light chains. Co-transformation of these vectors allowed obtaining Fab-fragments of antibodies to organophosphorus toxins without proteolytic degradation of the product. PMID:27270933

  9. IMMUNOMODULATORY EFFECTS OF INTRAVENOUS BIS-1 F(AB')(2) ADMINISTRATION IN RENAL-CELL CANCER-PATIENTS

    NARCIS (Netherlands)

    JANSSEN, RAJ; KROESEN, BJ; MESANDER, G; SLEIJFER, DT; THE, TH; MULDER, NH; DELEIJ, L

    1995-01-01

    We report the immunomodulatory effects of an intravenous treatment with F(ab')(2) fragments of the bispecific monoclonal antibody BIS-1 during subcutaneous recombinant interleukin 2 (rIL-2) therapy of renal cell cancer (RCC) patients. BIS-1 is directed against both the CD3 antigen on T cells and the

  10. Crystallization and preliminary X-ray diffraction analysis of the complex of a human anti-ephrin type-A receptor 2 antibody fragment and its cognate antigen

    International Nuclear Information System (INIS)

    Crystals of the complex between the Fab fragment of a human anti-EphA2 antibody and the N-terminal domain of human EphA2 have been obtained. Diffraction data were collected to 2.55 Å resolution. The recombinant N-terminal domain of human ephrin type-A receptor 2 (rEphA2) has been crystallized in complex with the recombinantly produced Fab fragment of a fully human antibody (1C1; IgG1/κ). These are the first reported crystals of an ephrin receptor bound to an antibody. The orthorhombic crystals belonged to space group C2221 (the 00l reflections obey the l = 2n rule), with unit-cell parameters a = 78.93, b = 120.79, c = 286.20 Å. The diffraction of the crystals extended to 2.0 Å resolution. However, only data to 2.55 Å resolution were considered to be useful owing to spot overlap caused by the long unit-cell parameter. The asymmetric unit is most likely to contain two 1C1 Fab–rEphA2 complexes. This corresponds to a crystal volume per protein weight (VM) of 2.4 Å3 Da−1 and a solvent content of 49.5%. The three-dimensional structure of this complex will shed light on the molecular basis of 1C1 specificity. This will also contribute to a better understanding of the mechanism of action of this antibody, the current evaluation of which as an antibody–drug conjugate in cancer therapy makes it a particularly interesting case study

  11. Fab-mediated binding of drug-dependent antibodies to platelets in quinidine- and quinine-induced thrombocytopenia.

    OpenAIRE

    Christie, D J; Mullen, P C; Aster, R H

    1985-01-01

    Platelets coated with quinine- or quinidine-induced antibodies form rosettes around protein A-Sepharose beads and normal platelets form rosettes about protein A-Sepharose beads coated with these antibodies. These reactions occurred only in the presence of sensitizing drug. Platelets also formed rosettes about protein A-Sepharose beads coated with an anti-PIA1 antibody, but drug was not required. Formation of rosettes between antibody-coated platelets and protein A-Sepharose was inhibited by F...

  12. Characterization of Tumor-Avid Antibody Fragments Genetically Engineered for Mono-Specific Radionuclide Chelation

    International Nuclear Information System (INIS)

    The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with 99mTc and 188Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic nuclear

  13. Characterization of Tumor-Avid Antibody Fragments Genetically Engineered for Mono-Specific Radionuclide Chelation

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, T.P.

    2003-12-31

    The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with {sup 99m}Tc and {sup 188}Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic

  14. The production of recombinant single chain antibody fragments for the detection of illicit drug residues

    OpenAIRE

    Brennan, Joanne

    2005-01-01

    Recombinant antibodies represent a more sensitive and specific detection tool for immunoanalysis. The research carried out for this thesis describes the production of genetically-derived single chain antibody fragments to detect illicit drugs. A variety of novel recombinant antibody fragments against morphine-3-glucuronide, a metabolite of heroin has been produced. A monomeric, dimeric and enzyme-labelled scFv were characterised with respect to their binding abilities and cross reactiviti...

  15. Expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori

    NARCIS (Netherlands)

    Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.

    2005-01-01

    We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA level

  16. Noninvasive detection of human cardiac transplant rejection with indium-111 antimyosin (Fab) imaging

    International Nuclear Information System (INIS)

    Diagnosis of rejection after cardiac transplantation is currently made by right ventricular endomyocardial biopsy. To evaluate antimyosin imaging as a noninvasive means of detecting human cardiac rejection, the Fab fragment of murine monoclonal antimyosin antibodies was labeled with indium-111 and given intravenously to 18 patients (age 45 +/- 12 years) in 20 studies 7 days to 9 years after transplantation. Endomyocardial biopsy specimens were obtained at the time of each imaging study. Eight patients had positive scans confirmed by biopsy as rejection, and eight patients had negative scans and no evidence of rejection on biopsy. Discordance was observed in four studies, two with positive scans and no rejection on biopsy and two with negative scans and positive biopsy. The sensitivity, specificity, and overall accuracy of the technique were each 80%. Imaging with radiolabeled antimyosin antibody Fab fragments may be of value in the noninvasive identification of rejection in the cardiac transplant recipient

  17. Noninvasive detection of human cardiac transplant rejection with indium-111 antimyosin (Fab) imaging

    Energy Technology Data Exchange (ETDEWEB)

    Frist, W.; Yasuda, T.; Segall, G.; Khaw, B.A.; Strauss, H.W.; Gold, H.; Stinson, E.; Oyer, P.; Baldwin, J.; Billingham, M.

    1987-11-01

    Diagnosis of rejection after cardiac transplantation is currently made by right ventricular endomyocardial biopsy. To evaluate antimyosin imaging as a noninvasive means of detecting human cardiac rejection, the Fab fragment of murine monoclonal antimyosin antibodies was labeled with indium-111 and given intravenously to 18 patients (age 45 +/- 12 years) in 20 studies 7 days to 9 years after transplantation. Endomyocardial biopsy specimens were obtained at the time of each imaging study. Eight patients had positive scans confirmed by biopsy as rejection, and eight patients had negative scans and no evidence of rejection on biopsy. Discordance was observed in four studies, two with positive scans and no rejection on biopsy and two with negative scans and positive biopsy. The sensitivity, specificity, and overall accuracy of the technique were each 80%. Imaging with radiolabeled antimyosin antibody Fab fragments may be of value in the noninvasive identification of rejection in the cardiac transplant recipient.

  18. Structure of the receptor-binding domain of human thrombopoietin determined by complexation with a neutralizing antibody fragment

    OpenAIRE

    Feese, Michael D; Tamada, Taro; Kato, Yoichi; Maeda, Yoshitake; Hirose, Masako; Matsukura, Yasuko; Shigematsu, Hideki; Muto, Takanori; Matsumoto, Atsushi; Watarai, Hiroshi; Ogami, Kinya; Tahara, Tomoyuki; Kato, Takashi; Miyazaki, Hiroshi; Kuroki, Ryota

    2004-01-01

    The cytokine thrombopoietin (TPO), the ligand for the hematopoietic receptor c-Mpl, acts as a primary regulator of megakaryocytopoiesis and platelet production. We have determined the crystal structure of the receptor-binding domain of human TPO (hTPO163) to a 2.5-Å resolution by complexation with a neutralizing Fab fragment. The backbone structure of hTPO163 has an antiparallel four-helix bundle fold. The neutralizing Fab mainly recognizes the C–D crossover loop containing the species invari...

  19. Imaging of HER2/neu-positive BT-474 human breast cancer xenografts in athymic mice using {sup 111}In-trastuzumab (Herceptin) Fab fragments

    Energy Technology Data Exchange (ETDEWEB)

    Tang Ying [Division of Nuclear Medicine, University Health Network, Toronto, Ontario, M5G 2C4 (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario, M5S 2S2 (Canada); Wang, Judy [Division of Nuclear Medicine, University Health Network, Toronto, Ontario, M5G 2C4 (Canada); Scollard, Deborah A. [Division of Nuclear Medicine, University Health Network, Toronto, Ontario, M5G 2C4 (Canada); Mondal, Hridya [Division of Nuclear Medicine, University Health Network, Toronto, Ontario, M5G 2C4 (Canada); Holloway, Claire [Sunnybrook and Women' s College Health Sciences Center, Toronto, Ontario, M4N 3M5 (Canada); Kahn, Harriette J. [Sunnybrook and Women' s College Health Sciences Center, Toronto, Ontario, M4N 3M5 (Canada); Reilly, Raymond M. [Division of Nuclear Medicine, University Health Network, Toronto, Ontario, M5G 2C4 (Canada) and Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario, M5S 2S2 (Canada) and Department of Medical Imaging, University of Toronto, Toronto, Ontario, M5S 3E2 (Canada)]. E-mail: raymond.reilly@utoronto.ca

    2005-01-01

    Trastuzumab (Herceptin) Fab were prepared by digestion of intact IgG with immobilized papain, derivatized with diethylenetriaminepentaacetic acid (DTPA) and radiolabeled with {sup 111}In. The dissociation constant (K{sub d}) for binding of Fab to HER2/neu-positive SK-BR-3 human breast cancer cells was two- to threefold higher than for intact IgG (14-36 vs. 8-14 nM). The binding affinity was not significantly decreased after DTPA derivatization (K{sub d}=47 nM). {sup 111}In-trastuzumab Fab localized specifically in HER2/neu-positive BT-474 human breast cancer xenografts in athymic mice with tumor uptake of 7.8{+-}0.7% injected dose (ID)/g and tumor/blood ratio of 25.2{+-}1.6 at 72 h postinjection compared with 2.7{+-}0.7% ID/g and 7.0{+-}0.9 for {sup 111}In-HuM195 anti-CD33 Fab (significantly different, P<.001). Small (3-5 mm in diameter) BT-474 tumors were imaged with {sup 111}In-trastuzumab Fab as early as 24 h postinjection.

  20. Biodistribution of charged F(ab')2 photoimmunoconjugates in a xenograft model of ovarian cancer.

    OpenAIRE

    Duska, L. R.; Hamblin, M R; Bamberg, M. P.; Hasan, T.

    1997-01-01

    The effect of charge modification of photoimmunoconjugates (PICs) on their biodistribution in a xenograft model of ovarian cancer was investigated. Chlorin(e6)c(e6) was attached site specifically to the F(ab')2 fragment of the murine monoclonal antibody OC125, directed against human ovarian cancer cells, via poly-1-lysine linkers carrying cationic or anionic charges. Preservation of immunoreactivity was checked by enzyme-linked immunosorbent assay (ELISA). PICs were radiolabelled with 125I an...

  1. Kinetics and dosimetry of iodine-131-labelled antibody fragments after local administration in patients with rectal cancer

    International Nuclear Information System (INIS)

    In 11 patients with rectal cancer, a mixture of F(ab')2 fragments of anti-carcinomembryonic antigen and anti-CA 19.9 labelled with a diagnostic dose of iodine-131 (3-10 MBq) was administered submucosally around the tumour. In this study, the local kinetics in and the dose to the rectal wall, the whole body kinetics and the effective dose equivalent are presented. Initially, about 50% of the plasma activity was due to free 131I. After 4 h, the plasma activity was almost completely protein bound (86%). Maximum plasma activity was observed after the 2nd day. In the first 24 h, 14% of the injected dose was excreted in the urine and within 4 days about half of the administered activity. The absorbed radiation dose to the rectal wall was estimated to be 0.2 Gy/MBq. The dose to the bone marrow was 0.2 mGy/MBq or 0.4 mGy/MBq, assuming a homogeneous tracer distribution or equal blood and bone marrow activity concentrations, respectively. The effective dose equivalent is 1.9 mSv/MBq. We conclude that the theoretical advantages of the local administration of 131I-labelled antibodies for diagnostic purposes in patients with rectal cancer are not limited by our dosimetric data. Nevertheless, we advocate the use of other radiolabels with more appropriate imaging qualities and probably a lower radiation burden. (orig./MG)

  2. Stability of llama heavy chain antibody fragments under extreme conditions

    OpenAIRE

    Dolk, E.

    2004-01-01

    Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The applications in which these VHHs are to be used, require functionality in non-physiological environments. High temperature, anionic and non-ionic surfactants in shampoo, and the low pH and digestive ...

  3. An ultra scale-down approach to study the interaction of fermentation, homogenization, and centrifugation for antibody fragment recovery from rec E. coli.

    Science.gov (United States)

    Li, Qiang; Mannall, Gareth J; Ali, Shaukat; Hoare, Mike

    2013-08-01

    Escherichia coli is frequently used as a microbial host to express recombinant proteins but it lacks the ability to secrete proteins into medium. One option for protein release is to use high-pressure homogenization followed by a centrifugation step to remove cell debris. While this does not give selective release of proteins in the periplasmic space, it does provide a robust process. An ultra scale-down (USD) approach based on focused acoustics is described to study rec E. coli cell disruption by high-pressure homogenization for recovery of an antibody fragment (Fab') and the impact of fermentation harvest time. This approach is followed by microwell-based USD centrifugation to study the removal of the resultant cell debris. Successful verification of this USD approach is achieved using pilot scale high-pressure homogenization and pilot scale, continuous flow, disc stack centrifugation comparing performance parameters such as the fraction of Fab' release, cell debris size distribution and the carryover of cell debris fine particles in the supernatant. The integration of fermentation and primary recovery stages is examined using USD monitoring of different phases of cell growth. Increasing susceptibility of the cells to disruption is observed with time following induction. For a given recovery process this results in a higher fraction of product release and a greater proportion of fine cell debris particles that are difficult to remove by centrifugation. Such observations are confirmed at pilot scale. PMID:23475508

  4. Production of recombinant antibody fragments in Bacillus megaterium

    OpenAIRE

    Jahn Dieter; Schirrmann Thomas; Biedendieck Rebekka; Roth Andreas; Hust Michael; Jordan Eva; Dübel Stefan

    2007-01-01

    Abstract Background Recombinant antibodies are essential reagents for research, diagnostics and therapy. The well established production host Escherichia coli relies on the secretion into the periplasmic space for antibody synthesis. Due to the outer membrane of Gram-negative bacteria, only a fraction of this material reaches the medium. Recently, the Gram-positive bacterium Bacillus megaterium was shown to efficiently secrete recombinant proteins into the growth medium. Here we evaluated B. ...

  5. SINGLE CHAIN VARIABLE FRAGMENTS OF ANTIBODIES AGAINST DIPHTHERIA TOXIN B-SUBUNIT ISOLATED FROM PHAGE DISPLAY HUMAN ANTIBODY LIBRARY

    Directory of Open Access Journals (Sweden)

    Oliinyk O. S.

    2014-02-01

    Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.

  6. Characterization of monoclonal antibodies against MHC class II-associated p41 invariant chain fragment

    International Nuclear Information System (INIS)

    Mouse monoclonal antibodies directed against human MHC class II-associated p41 invariant chain fragment have been generated. Mice were immunized with human recombinant Ii-isoform p26. For hybridoma production mouse splenocytes and myeloma cells were fused. Hybridoma cells were screened using ELISA and immunoblotting. Three cell lines (42B10, 42G11 and 43C8) were used for production of specific antibodies, which reacted with p41 fragment and did not bind to cathepsins L or S or their proenyzmes. As primary antibody for immunofluorescence staining of lymph node tissue sections clone 2C12 MAb was selected. Specific localization of p41 fragment in certain cells in lymph nodes was observed. (author)

  7. An integrated top-down and bottom-up proteomic approach to characterize the antigen binding fragment of antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Dekker, Leendert J.; Wu, Si; vanDuijn, Martijn M.; Tolic, Nikola; Stingl, Christoph; Zhao, Rui; Luider, Theo N.; Pasa-Tolic, Ljiljana

    2014-05-31

    We have previously shown that different individuals exposed to the same antigen produce antibodies with identical mutations in their complementarity determining regions (CDR), suggesting that CDR tryptic peptides can serve as biomarkers for disease diagnosis and prognosis. Complete Fabs derived from disease specific antibodies have even higher potential; they could potentially be used for disease treatment and are required to identify the antigens towards which the antibodies are directed. However, complete Fab sequence characterization via LC-MS analysis of tryptic peptides (i.e. bottom-up) has proven to be impractical for mixtures of antibodies. To tackle this challenge, we have developed an integrated bottom-up and top-down MS approach, employing 2D chromatography coupled with Fourier transform mass spectrometry (FTMS), and applied this approach for full characterization of the variable parts of two pharmaceutical monoclonal antibodies with sensitivity comparable to the bottom-up standard. These efforts represent an essential step towards the identification of disease specific antibodies in patient samples with potentially significant clinical impact.

  8. A structural basis for the activity of retro-Diels–Alder catalytic antibodies: Evidence for a catalytic aromatic residue

    OpenAIRE

    Hugot, Marina; Bensel, Nicolas; Vogel, Monique; Reymond, Martine T.; Stadler, Beda; Reymond, Jean-Louis; Baumann, Ulrich

    2002-01-01

    The nitroxyl synthase catalytic antibodies 10F11, 9D9, and 27C5 catalyze the release of nitroxyl from a bicyclic pro-drug by accelerating a retro-Diels–Alder reaction. The Fabs (antigen-binding fragments) of these three catalytic antibodies were cloned and sequenced. Fab 9D9 was crystallized in the apo-form and in complex with one transition state analogue of the reaction. Crystal structures of Fab 10F11 in complex with ligands mimicking substrate, transition state, and product have been dete...

  9. Functional improvement of antibody fragments using a novel phage coat protein III fusion system

    DEFF Research Database (Denmark)

    Jensen, Kim Bak; Larsen, Martin; Pedersen, Jesper Søndergaard; Christensen, Peter Astrup; Álvarez-Vallina, Luis; Goletz, Steffen; Clark, Brian F.C.; Kristensen, Peter

    2002-01-01

    constitute an easy and inexpensive method compared to hybridoma cultures. Such approaches have, however, often suffered from low yields and poor functionality. A general method is described here which enables expressions of functional antibody fragments when fused to the amino-terminal domain(s) of the...... heterologous expression systems will benefit present-day quests in structural and functional genomics where high amounts of active protein are required. One example, which has been the subject of considerable interest, is recombinant antibodies or fragments thereof as expressions of these in bacteria...

  10. A Potent and Broad Neutralizing Antibody Recognizes and Penetrates the HIV Glycan Shield

    NARCIS (Netherlands)

    R. Pejchal; K.J. Doores; L.M. Walker; R. Khayat; P.S. Huang; S.K. Wang; R.L. Stanfield; J.P. Julien; A. Ramos; M. Crispin; R. Depetris; U. Katpally; A. Marozsan; A. Cupo; S. Maloveste; Y. Liu; R. McBride; Y. Ito; R.W. Sanders; C. Ogohara; J.C. Paulson; T. Feizi; C.N. Scanlan; C.H. Wong; J.P. Moore; W.C. Olson; A.B. Ward; P. Poignard; W.R. Schief; D.R. Burton; I.A. Wilson

    2011-01-01

    The HIV envelope (Env) protein gp120 is protected from antibody recognition by a dense glycan shield. However, several of the recently identified PGT broadly neutralizing antibodies appear to interact directly with the HIV glycan coat. Crystal structures of antigen-binding fragments (Fabs) PGT 127 a

  11. Magnetosome Expression of Functional Camelid Antibody Fragments (Nanobodies) in Magnetospirillum gryphiswaldense▿†

    OpenAIRE

    Pollithy, Anna; Romer, Tina; Lang, Claus; Müller, Frank D.; Helma, Jonas; Leonhardt, Heinrich; Rothbauer, Ulrich; Schüler, Dirk

    2011-01-01

    Numerous applications of conventional and biogenic magnetic nanoparticles (MNPs), such as in diagnostics, immunomagnetic separations, and magnetic cell labeling, require the immobilization of antibodies. This is usually accomplished by chemical conjugation, which, however, has several disadvantages, such as poor efficiency and the need for coupling chemistry. Here, we describe a novel strategy to display a functional camelid antibody fragment (nanobody) from an alpaca (Lama pacos) on the surf...

  12. Shark Variable New Antigen Receptor (VNAR) Single Domain Antibody Fragments: Stability and Diagnostic Applications

    OpenAIRE

    Stewart Nuttall; Perugini, Matthew A.; Iveth González; Casey, Joanne L.; Abdulmonem Sanalla; Miles Barraclough; Con Dogovski; Julie Angerosa; Kathy Parisi; Olan Dolezal; Katherine Griffiths; Michael Foley

    2013-01-01

    The single variable new antigen receptor domain antibody fragments (VNARs) derived from shark immunoglobulin new antigen receptor antibodies (IgNARs) represent some of the smallest known immunoglobulin-based protein scaffolds. As single domains, they demonstrate favorable size and cryptic epitope recognition properties, making them attractive in diagnosis and therapy of numerous disease states. Here, we examine the stability of VNAR domains with a focus on a family of VNARs specific for apica...

  13. Engineering Venom’s Toxin-Neutralizing Antibody Fragments and Its Therapeutic Potential

    Directory of Open Access Journals (Sweden)

    Larissa M. Alvarenga

    2014-08-01

    Full Text Available Serum therapy remains the only specific treatment against envenoming, but anti-venoms are still prepared by fragmentation of polyclonal antibodies isolated from hyper-immunized horse serum. Most of these anti-venoms are considered to be efficient, but their production is tedious, and their use may be associated with adverse effects. Recombinant antibodies and smaller functional units are now emerging as credible alternatives and constitute a source of still unexploited biomolecules capable of neutralizing venoms. This review will be a walk through the technologies that have recently been applied leading to novel antibody formats with better properties in terms of homogeneity, specific activity and possible safety.

  14. Imaging of low-grade bone infection with a technetium-99m labelled monoclonal anti-NCA-90 Fab' fragment in patients with previous joint surgery

    International Nuclear Information System (INIS)

    We analysed 38 scans in 30 consecutive patients (age range, 30-85 years; median age, 62 years) referred for suspected low-grade bone infection. There were 17 patients (21 scans) with total hip arthroplasty (THA), six with total knee arthroplasty (TKA), three who had undergone hip or knee surgery for trauma and five (seven scans) with resected hips and no endoprostheses (Girdlestone situations); There were no patients with rheumatoid arthritis as the underlying disease. Results were verified by means of bacteriological cultures, histopathological findings and/or follow-up and compared with the respective Zimmerli scores, which were used for clinical assessment of inflammatory activity. In one patient, the final diagnosis could not be established. One, 5 and 24 h after intravenous injection of up to 1.1 GBq of MN3 Fab', whole-body and planar scans were performed using a dual-head gamma camera. Scans were analysed visually and semiquantitatively adopting an arbitrary score ranging from 0 to 3. There were 13 true positive, 14 true negative and 10 false positive outcomes, yielding an overall sensitivity of 100%, an overall specificity of 58%, an accuracy of 73% and positive and negative predictive values of 57% and 100%, respectively. In patients with THA or TKA, accuracy was 81% and 80%, respectively, while it dropped to 43% in patients with Girdlestone situations owing to a high proportion of false positive findings (4/7) in this subgroup. Scintigraphic score was 1 in all of the false positive and in 11/13 true positive findings. The two remaining true positive findings displayed scintigraphic scores of 2 and 3, respectively. Scintigraphic and Zimmerli scores were loosely correlated (Spearman ρ=0.38, P<0.05). Infection was excluded in 22/24 investigations with Zimmerli scores of <6. In this group, there were 13 scintigraphically true negative, nine false positive outcomes, and just two true positive outcomes. In 11/12 investigations with Zimmerli scores of 6 or 7

  15. Sortase-catalyzed in vitro functionalization of a HER2-specific recombinant Fab for tumor targeting of the plant cytotoxin gelonin

    OpenAIRE

    Kornberger, Petra; Skerra, Arne

    2013-01-01

    We report on the preparation of a new type of immunotoxin via in vitro ligation of the αHer2 antigen binding fragment (Fab) of the clinically-validated antibody trastuzumab to the plant toxin gelonin, employing catalysis by the bacterial enzyme sortase A (SrtA). The αHer2 Fab was fused with the extended SrtA recognition motif LPET↓GLEH6 at the C-terminus of its heavy chain, thereby preventing interference with antigen binding, while the toxin was equipped with a Gly2 sequence at its N-terminu...

  16. A bacterial signal peptidase enhances processing of a recombinant single chain antibody fragment in insect cells

    NARCIS (Netherlands)

    Ailor, E; Pathmanathan, J; Jongbloed, JDH; Betenbaugh, MJ

    1999-01-01

    The production of an antibody single chain fragment (scFv) in insect cells was accompanied by the formation of an insoluble intracellular precursor even with the inclusion of the bee melittin signal peptide. The presence of the precursor polypeptide suggests a limitation in the processing of the sig

  17. Optimization of the crystallizability of a single-chain antibody fragment

    Czech Academy of Sciences Publication Activity Database

    Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína

    2014-01-01

    Roč. 70, č. 12 (2014), s. 1701-1706. ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014

  18. Association of selenocysteine transfer RNA fragments with serum antibody response to Mycoplasma spp. in beef cattle

    Science.gov (United States)

    The objective was to identify transfer RNA fragments (tRFs) associated with a serum antibody response to Mycoplasma spp. in beef cattle. Serum from sixteen beef calves was collected at three points: in summer after calves were born, in fall at weaning, and in the following spring. All sera collected...

  19. Biodistribution of charged F(ab')2 photoimmunoconjugates in a xenograft model of ovarian cancer.

    Science.gov (United States)

    Duska, L R; Hamblin, M R; Bamberg, M P; Hasan, T

    1997-01-01

    The effect of charge modification of photoimmunoconjugates (PICs) on their biodistribution in a xenograft model of ovarian cancer was investigated. Chlorin(e6)c(e6) was attached site specifically to the F(ab')2 fragment of the murine monoclonal antibody OC125, directed against human ovarian cancer cells, via poly-1-lysine linkers carrying cationic or anionic charges. Preservation of immunoreactivity was checked by enzyme-linked immunosorbent assay (ELISA). PICs were radiolabelled with 125I and compared with non-specific rabbit IgG PICs after intraperitoneal (i.p.) injection into nude mice. Samples were taken from normal organs and tumour at 3 h and 24 h. Tumour to normal 125I ratios showed that the cationic OC125F(ab')2 PIC had the highest tumour selectivity. Ratios for c(e6) were uniformly higher than for 125I, indicating that c(e6) became separated from 125I. OC125F(ab')2 gave highest tissue values of 125I, followed by cationic OC125F(ab')2 PIC; other species were much lower. The amounts of c(e6) delivered per gram of tumour were much higher for cationic OC125F(ab')2 PIC than for other species. The results indicate that cationic charge stimulates the endocytosis and lysosomal degradation of the OC125F(ab')2-pl-c(e6) that has bound to the i.p. tumour. Positively charged PICs may have applications in the i.p. photoimmunotherapy of minimal residual ovarian cancer. PMID:9062404

  20. Monoclonal antibodies to cell surface antigens of human melanoma

    International Nuclear Information System (INIS)

    The authors have worked with three human melanoma antigens which have been defined by monoclonal mouse antibodies: p97, a glycoprotein that is structurally related to transferrin, a proteoglycan, and a GD3 ganglioside that is slightly different from the GD3 of normal brain. All three antigens can be detected in frozen sections of melanoma, using immunohistological techniques. Antibodies and Fab fragments, specific for either p97 or the proteoglycan antigen, have been radiolabelled with 131I and successfully used for tumor imaging, and Phase I therapeutic trails are underway, using 131I-labelled Fab fragments, specific for p97 or the proteoglycan antigen, to localize a potentially therapeutic dose of radiation into tumors. It may be feasible to use the same monoclonal antibodies, or antibody fragments, as carriers of neutron capturers, such as boron, for possible use in tumor therapy. The initial experiments on this are best carried out by using nude mice (or rats) carrying human melanoma xenografts

  1. Dimerisation strategies for shark IgNAR single domain antibody fragments.

    Science.gov (United States)

    Simmons, David P; Abregu, Fiona A; Krishnan, Usha V; Proll, David F; Streltsov, Victor A; Doughty, Larissa; Hattarki, Meghan K; Nuttall, Stewart D

    2006-08-31

    Immunoglobulin new antigen receptors (IgNARs) are unique single domain antibodies found in the serum of sharks. The individual variable (VNAR) domains bind antigen independently and are candidates for the smallest antibody-based immune recognition units (approximately 13 kDa). Here, we first isolated and sequenced the cDNA of a mature IgNAR antibody from the spotted wobbegong shark (Orectolobus maculatus) and confirmed the independent nature of the VNAR domains by dynamic light scattering. Second, we asked which of the reported antibody fragment dimerisation strategies could be applied to VNAR domains to produce small bivalent proteins with high functional affinity (avidity). In contrast to single chain Fv (scFv) fragments, separate IgNARs could not be linked into a tandem single chain format, with the resulting proteins exhibited only monovalent binding due solely to interaction of the N-terminal domain with antigen. Similarly, incorporation of C-terminal helix-turn-helix (dhlx) motifs, while resulting in efficiently dimerised protein, resulted in only a modest enhancement of affinity, probably due to an insufficiently long hinge region linking the antibody to the dhlx motif. Finally, generation of mutants containing half-cystine residues at the VNAR C-terminus produced dimeric recombinant proteins exhibiting high functional affinity for the target antigens, but at the cost of 50-fold decreased protein expression levels. This study demonstrates the potential for construction of bivalent or bispecific IgNAR-based binding reagents of relatively small size (approximately 26 kDa), equivalent to a monovalent antibody Fv fragment, for formulation into future diagnostic and therapeutic formats. PMID:16962608

  2. Structure of anti-FLAG M2 Fab domain and its use in the stabilization of engineered membrane proteins

    International Nuclear Information System (INIS)

    The X-ray crystallographic analysis of anti-FLAG M2 Fab is reported and the implications of the structure on FLAG epitope binding are described as a first step in the development of a tool for the structural and biophysical study of membrane proteins. The inherent difficulties of stabilizing detergent-solubilized integral membrane proteins for biophysical or structural analysis demand the development of new methodologies to improve success rates. One proven strategy is the use of antibody fragments to increase the ‘soluble’ portion of any membrane protein, but this approach is limited by the difficulties and expense associated with producing monoclonal antibodies to an appropriate exposed epitope on the target protein. Here, the stabilization of a detergent-solubilized K+ channel protein, KvPae, by engineering a FLAG-binding epitope into a known loop region of the protein and creating a complex with Fab fragments from commercially available anti-FLAG M2 monoclonal antibodies is reported. Although well diffracting crystals of the complex have not yet been obtained, during the course of crystallization trials the structure of the anti-FLAG M2 Fab domain was solved to 1.86 Å resolution. This structure, which should aid future structure-determination efforts using this approach by facilitating molecular-replacement phasing, reveals that the binding pocket appears to be specific only for the first four amino acids of the traditional FLAG epitope, namely DYKD. Thus, the use of antibody fragments for improving the stability of target proteins can be rapidly applied to the study of membrane-protein structure by placing the short DKYD motif within a predicted peripheral loop of that protein and utilizing commercially available anti-FLAG M2 antibody fragments

  3. Isolation of active site and antibody-binding fragments of human erythrocyte transglutaminase

    International Nuclear Information System (INIS)

    Catalytically active human erythrocyte transglutaminase (TGase) was purified using an immunoaffinity column prepared from a monoclonal antibody to guinea pig liver TGase. The enzyme activity was completely inhibited by incorporation of iodo[14C]acetamide to the level of 1 mole per 1 mole of TGase. The 14C-labeled TGase was digested with cyanogen bromide, subjected to HPLC, and four pure peptides were isolated with molecular weights ranging from 3-22 KDa. Only one of the peptides was radiolabeled and characterized as an active site peptide of 10 KDa. Another peptide of 18 KDa was identified as a monoclonal antibody-binding domain of TGase. Although the active site and the antibody-binding domain were present on different cyanogen bromide fragments, the mouse anti-TGase inhibited 100% of TGase activity. The results suggest that the antibody-binding site is not located on the enzyme active site sequence, but that the three dimensional space configuration of the antigen-antibody complex hinders substrate binding to the active site. The radiolabeled active site cysteine residue was not found in the N-terminal 21 amino acids of the 10 KDa peptide. Additional fragments of the active site peptide are currently being analyzed

  4. Positron Emission Tomography Imaging of Endometrial Cancer Using Engineered Anti-EMP2 Antibody Fragments

    OpenAIRE

    Fu, Maoyong; Brewer, Sarah; Olafsen, Tove; Wu, Anna M.; Gordon, Lynn K.; Said, Jonathan; Braun, Jonathan; Wadehra, Madhuri

    2012-01-01

    Purpose As imaging of the cell surface tetraspan protein epithelial membrane protein-2 (EMP2) expression in malignant tumors may provide important prognostic and predictive diagnostic information, the goal of this study is to determine if antibody fragments to EMP2 may be useful for imaging EMP2 positive tumors. Procedures The normal tissue distribution of EMP2 protein expression was evaluated by immunohistochemistry and found to be discretely expressed in both mouse and human tissues. To det...

  5. Pharmacological selection of antibodies for immunoscintigraphy

    International Nuclear Information System (INIS)

    The recent development of hybridoma technology has resulted in the production of monoclonal antibodies that recognize a variety of tumor antigens. Many antibodies have been developed and some of them are used with different success in clinical practice. A list of criteria is proposed for the selection of antibodies suitable for imaging studies illustrated with the example of two monoclonal antibodies anti-CEA and 19.9 used in colorectal carcinoma imaging. Monoclonal antibodies obtained today are not truly tumor-specific, they are tumor-associated; this suggests that some cross-reactions with normal tissues exist. For immunoscintigraphical use it is important to select antibodies which procedure high tumor cell staining with limited reactivity against normal tissues. Antibodies can be separated into F(ab')2 and Fab fragments which diffuse more easily into the tumor with a rapid clearance from the circulation giving higher tumor to normal tissues ratio at an early time. Antibodies with both high affinity and avidity towards tumor cell receptors produce better imaging results. Antibodies can be labelled directly with iodine or technetium and with indium using chelating agents. In vivo kinetics of radiolabelled antibodies are very different considering the nuclide and the labelling method used. Pharmacokinetics on nude mice grated with human tumors are very useful for selecting the most appropriate nuclide antibody fragment and the most efficient labelling technique for a given application. (author)

  6. Conjugation of 10 kDa Linear PEG onto Trastuzumab Fab' Is Sufficient to Significantly Enhance Lymphatic Exposure while Preserving in Vitro Biological Activity.

    Science.gov (United States)

    Chan, Linda J; Ascher, David B; Yadav, Rajbharan; Bulitta, Jürgen B; Williams, Charlotte C; Porter, Christopher J H; Landersdorfer, Cornelia B; Kaminskas, Lisa M

    2016-04-01

    The lymphatic system is a major conduit by which many diseases spread and proliferate. There is therefore increasing interest in promoting better lymphatic drug targeting. Further, antibody fragments such as Fabs have several advantages over full length monoclonal antibodies but are subject to rapid plasma clearance, which can limit the lymphatic exposure and activity of Fabs against lymph-resident diseases. This study therefore explored ideal PEGylation strategies to maximize biological activity and lymphatic exposure using trastuzumab Fab' as a model. Specifically, the Fab' was conjugated with single linear 10 or 40 kDa PEG chains at the hinge region. PEGylation led to a 3-4-fold reduction in binding affinity to HER2, but antiproliferative activity against HER2-expressing BT474 cells was preserved. Lymphatic pharmacokinetics were then examined in thoracic lymph duct cannulated rats after intravenous and subcutaneous dosing at 2 mg/kg, and the data were evaluated via population pharmacokinetic modeling. The Fab' displayed limited lymphatic exposure, but conjugation of 10 kDa PEG improved exposure by approximately 11- and 5-fold after intravenous (15% dose collected in thoracic lymph over 30 h) and subcutaneous (9%) administration, respectively. Increasing the molecular weight of the PEG to 40 kDa, however, had no significant impact on lymphatic exposure after intravenous (14%) administration and only doubled lymphatic exposure after subcutaneous administration (18%) when compared to 10 kDa PEG-Fab'. The data therefore suggests that minimal PEGylation has the potential to enhance the exposure and activity of Fab's against lymph-resident diseases, while no significant benefit is achieved with very large PEGs. PMID:26871003

  7. Refolded scFv Antibody Fragment against Myoglobin Shows Rapid Reaction Kinetics

    Directory of Open Access Journals (Sweden)

    Hyung-Nam Song

    2014-12-01

    Full Text Available Myoglobin is one of the early biomarkers for acute myocardial infarction. Recently, we have screened an antibody with unique rapid reaction kinetics toward human myoglobin antigen. Antibodies with rapid reaction kinetics are thought to be an early IgG form produced during early stage of in vivo immunization. We produced a recombinant scFv fragment for the premature antibody from Escherichia coli using refolding technology. The scFv gene was constructed by connection of the VH–VL sequence with a (Gly4Ser3 linker. The scFv fragment without the pelB leader sequence was expressed at a high level, but the solubility was extremely low. A high concentration of 8 M urea was used for denaturation. The dilution refolding process in the presence of arginine and the redox reagents GSH and GSSH successfully produced a soluble scFv protein. The resultant refolded scFv protein showed association and dissociation values of 9.32 × 10−4 M−1·s−1 and 6.29 × 10−3 s−1, respectively, with an affinity value exceeding 107 M−1 (kon/koff, maintaining the original rapid reaction kinetics of the premature antibody. The refolded scFv could provide a platform for protein engineering for the clinical application for diagnosis of heart disease and the development of a continuous biosensor.

  8. Refolded scFv antibody fragment against myoglobin shows rapid reaction kinetics.

    Science.gov (United States)

    Song, Hyung-Nam; Jang, Jun-Hyuck; Kim, Young-Wan; Kim, Dong-Hyung; Park, Sung-Goo; Lee, Myung Kyu; Paek, Se-Hwan; Woo, Eui-Jeon

    2014-01-01

    Myoglobin is one of the early biomarkers for acute myocardial infarction. Recently, we have screened an antibody with unique rapid reaction kinetics toward human myoglobin antigen. Antibodies with rapid reaction kinetics are thought to be an early IgG form produced during early stage of in vivo immunization. We produced a recombinant scFv fragment for the premature antibody from Escherichia coli using refolding technology. The scFv gene was constructed by connection of the V(H)-V(L) sequence with a (Gly4Ser)3 linker. The scFv fragment without the pelB leader sequence was expressed at a high level, but the solubility was extremely low. A high concentration of 8 M urea was used for denaturation. The dilution refolding process in the presence of arginine and the redox reagents GSH and GSSH successfully produced a soluble scFv protein. The resultant refolded scFv protein showed association and dissociation values of 9.32 × 10⁻⁴ M⁻¹·s⁻¹ and 6.29 × 10⁻³ s⁻¹, respectively, with an affinity value exceeding 10⁷ M⁻¹ (k(on)/k(off)), maintaining the original rapid reaction kinetics of the premature antibody. The refolded scFv could provide a platform for protein engineering for the clinical application for diagnosis of heart disease and the development of a continuous biosensor. PMID:25530617

  9. Characterization of neutralizing monoclonal antibodies directed against tetanus toxin fragment C.

    Science.gov (United States)

    Yousefi, Mehdi; Tahmasebi, Fathollah; Younesi, Vahid; Razavi, Alireza; Khoshnoodi, Jalal; Bayat, Ali Ahmad; Abbasi, Ebrahim; Rabbani, Hodjatallah; Jeddi-Tehrani, Mahmood; Shokri, Fazel

    2014-01-01

    Clostridium tetani causes a life-threatening infectious disease by production of tetanus neurotoxin (TeNT), a 150 kDa molecule composed of light (LC) and heavy chain (HC) polypeptides. The TeNT HC contains an N-terminal domain critical for LC translocation and a C-terminal toxin receptor-binding domain known as fragment C. Despite extensive investigations on epitope specificity of anti-TeNT antibodies, the immunodominant neutralizing epitopes of the toxin are poorly defined. This study describes the generation and characterization of four monoclonal antibodies (MAb) specific for TeNT. The characteristics of each MAb were explored in terms of isotype, specificity, affinity, and immuno-globulin heavy chain variable region (IGHV) gene usage using ELISA, Western blotting, and sequencing techniques. The toxin neutralizing activity of the MAbs was also investigated using the in vitro GT1b neutralizing assay. The data demonstrated that all MAbs bind to tetanus toxin and toxoid. Sub-fragments binding analysis showed that two MAbs react with fragment C, one with both fragment C and LC, and one with LC. Only the two fragment C-specific MAbs were able to neutralize the toxin. Sequencing of the expressed VH and VL genes revealed rearrangements of various VH and VL gene segments in all hybridoma clones. Clonality of the hybridomas was also confirmed by a competition assay that showed recognition of distinct epitopes by these MAbs. The results suggest the importance of TeNT fragment C in terms of immunogenicity and toxin neutralization activity. PMID:23369087

  10. Immunoscintigraphy of CEA-expressing cancers with complete and fragmented monoclonal antibodies: indications, chances and limits

    International Nuclear Information System (INIS)

    CEA-expressing cancers belong to the most frequent malignant diseases of the western world. The early recognition of tumor recurrence or metastasis, respectively, is probably the key to an improvement of the patient's prognosis. Conventional radiological procedures are characterized by their limited sensitivity and specificity; therefore, complementary methods, such as immunoscintigraphy, are warranted. In Europe, essentially three monoclonal anti-CEA antibodies, which can be directly labeled with technetium (complete IgG of the clone BW431/26, as well as the fragments F023C5 and IMMU-4), are in clinical use. Complete IgG is burdened by slow tumor targeting kinetics and a slow background clearance. This makes its diagnostic use with short-lived isotopes difficult. Fragments are able to targert more quickly but express some metabolic instability, as well as a high renal accretion. Fragments have shown higher sensitivities in the detection of liver metastases and local recurrences, two of the most important sites of tumor relapse. In contrast to IgG, diagnosis is usually possible as early as after 4-6 h p.i. Thus, different indications for the use of IgG or fragments result, and, in the individual case, also complementary studies with both may be indicated. Whereas 30% of patients develop HAMA after a single administration of IgG, the HAMA incidence of fragments is, with less than 1%, dramatically lower, even in the case of repeated administrations. Future studies with humanized antibodies, smaller 'molecular recognition units', or the development of stable bivalent fragment with technetium label will show whether further improvements of the diagnostic accuracy are possible. (orig.)

  11. Radioiodination and biodistribution of the monoclonal antibody TU-20 and its scFv fragment

    International Nuclear Information System (INIS)

    The ability of the monoclonal antibody TU-20 and its scFv fragment to bind specifically to the C-end of the class III β-tubulin makes these substances useful as potential diagnostics for neurodegenerative diseases-especially peripheral neuropathies. TU-20 and its scFv were labeled with 125I and 123I by chloramine-T (with radiochemical yield 75 and 50%, respectively). Radiochemical purity and stability was revealed by gel filtration (decrease to 80 and 50% in 2 months, respectively). Immunoreactivity of the labeled TU-20 was determined by ELISA - the range of the preserved immunoreactivity varies from 60 to 95% in accordance to the used radiolabeling process. RIA and affinity coupling analytic methods were specifically designed with focusing on specifics of the antibody and its fragment. The results of RIA differ in dependence on the type of the reaction vessel (glass or polystyrene) and the affinity coupling results depend on the experimental arrangement - in the batch or on the column. Fragmentation of the labeled antibody and its fragment was estimated by bis-tris gel electrophoresis followed by silver staining and autoradiography (over 95% of radioactivity bound in the substances). The antibody binding in tissue slices was studied in vitro by immunohistochemistry. The Purkinje cells were observed conjugated with the radiolabeled substances, either TU-20 or its ScFv fragment in the area of the cerebellum. In vivo biodistribution of 125I-TU-20, 125I-scFv TU-20, 123I-scFv TU-20 and Na125I was proceeded in normal mice (wild type C57B/6/J). Both biomolecules labeled by 123I were also proved in an imaging biodistribution study with use of the SPECT camera. Finally, a transgene population G93A1 Gur was used for comparative study to show the different behaviour of the substances in a normal mouse and in the modified organism with amyotrophic lateral sclerosis. The most part of differences is observed in the area of the muscles, rostal and caudal spinal cord. In summary

  12. Immunogenicity of anti-tumor necrosis factor antibodies-toward improved methods of anti-antibody measurement.

    Science.gov (United States)

    Aarden, Lucien; Ruuls, Sigrid R; Wolbink, Gertjan

    2008-08-01

    To date, millions of people have been treated with therapeutic monoclonal antibodies (TmAbs) for various indications. It is becoming increasingly clear that TmAbs can be immunogenic, which may reduce efficacy or induce adverse effects. Over the years, the importance of antibody formation has been questioned and sometimes minimized, as few antibody responses to TmAbs (HACA or HAHA) were reported. However, the methods to detect and quantify such antibodies used in the past have been problematic. Only recently, methods have been developed that have adequate sensitivity and are not seriously disturbed by false-positive reactions caused by rheumatoid factors, natural antibodies to Fab or F(ab')2 fragments, or Fc interactions of IgG4. The large number of treated patients, in combination with these new assays, presents a unique opportunity to study the anti-antibody immune response in man, possibly allowing us to manipulate immunogenicity in the future. PMID:18619538

  13. Sortase-catalyzed in vitro functionalization of a HER2-specific recombinant Fab for tumor targeting of the plant cytotoxin gelonin

    Science.gov (United States)

    Kornberger, Petra; Skerra, Arne

    2014-01-01

    We report on the preparation of a new type of immunotoxin via in vitro ligation of the αHer2 antigen binding fragment (Fab) of the clinically-validated antibody trastuzumab to the plant toxin gelonin, employing catalysis by the bacterial enzyme sortase A (SrtA). The αHer2 Fab was fused with the extended SrtA recognition motif LPET↓GLEH6 at the C-terminus of its heavy chain, thereby preventing interference with antigen binding, while the toxin was equipped with a Gly2 sequence at its N-terminus, distant to the catalytically active site in the C-terminal region. Site-specific in vitro transpeptidation led to a novel antibody-toxin conjugate wherein gelonin had effectively replaced the Fc region of a conventional (monomerized) immunoglobulin. After optimization of reaction conditions and incubation time, the resulting Fab-Gelonin ligation product was purified to homogeneity in a two-step procedure by means of Strep-Tactin affinity chromatography—utilizing the Strep-tag II appended to gelonin—and size exclusion chromatography. Binding activity of the immunotoxin for the Her2 ectodomain was indistinguishable from the unligated Fab as measured by real-time surface plasmon resonance spectroscopy. Specific cytotoxic potency of Fab-Gelonin was demonstrated against two Her2-positive cell lines, resulting in EC50 values of ~1 nM or lower, indicating a 1000-fold enhanced cell-killing activity compared with gelonin itself. Thus, our strategy provides a convenient route to the modular construction of functional immunotoxins from Fabs of established tumor-specific antibodies with gelonin or related proteotoxins, also avoiding the elevated biosafety levels that would be mandatory for the direct biotechnological preparation of corresponding fusion proteins. PMID:24492291

  14. Proteomic differences in recombinant CHO cells producing two similar antibody fragments.

    Science.gov (United States)

    Sommeregger, Wolfgang; Mayrhofer, Patrick; Steinfellner, Willibald; Reinhart, David; Henry, Michael; Clynes, Martin; Meleady, Paula; Kunert, Renate

    2016-09-01

    Chinese hamster ovary (CHO) cells are the most commonly used mammalian hosts for the production of biopharmaceuticals. To overcome unfavorable features of CHO cells, a lot of effort is put into cell engineering to improve phenotype. "Omics" studies investigating elevated growth rate and specific productivities as well as extracellular stimulus have already revealed many interesting engineering targets. However, it remains largely unknown how physicochemical properties of the recombinant product itself influence the host cell. In this study, we used quantitative label-free LC-MS proteomic analyses to investigate product-specific proteome differences in CHO cells producing two similar antibody fragments. We established recombinant CHO cells producing the two antibodies, 3D6 and 2F5, both as single-chain Fv-Fc homodimeric antibody fragments (scFv-Fc). We applied three different vector strategies for transgene delivery (i.e., plasmid, bacterial artificial chromosome, recombinase-mediated cassette exchange), selected two best performing clones from transgene variants and transgene delivery methods and investigated three consecutively passaged cell samples by label-free proteomic analysis. LC-MS-MS profiles were compared in several sample combinations to gain insights into different aspects of proteomic changes caused by overexpression of two different heterologous proteins. This study suggests that not only the levels of specific product secretion but the product itself has a large impact on the proteome of the cell. Biotechnol. Bioeng. 2016;113: 1902-1912. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26913574

  15. Mutations in Antibody Fragments Modulate Allosteric Response Via Hydrogen-Bond Network Fluctuations.

    Science.gov (United States)

    Srivastava, Amit; Tracka, Malgorzata B; Uddin, Shahid; Casas-Finet, Jose; Livesay, Dennis R; Jacobs, Donald J

    2016-05-10

    A mechanical perturbation method that locally restricts conformational entropy along the protein backbone is used to identify putative allosteric sites in a series of antibody fragments. The method is based on a distance constraint model that integrates mechanical and thermodynamic viewpoints of protein structure wherein mechanical clamps that mimic substrate or cosolute binding are introduced. Across a set of six single chain-Fv fragments of the anti-lymphotoxin-β receptor antibody, statistically significant responses are obtained by averaging over 10 representative structures sampled from a molecular dynamics simulation. As expected, the introduced clamps locally rigidify the protein, but long-ranged increases in both rigidity and flexibility are also frequently observed. Expanding our analysis to every molecular dynamics frame demonstrates that the allosteric responses are modulated by fluctuations within the hydrogen-bond network where the native ensemble is comprised of conformations that both are, and are not, affected by the perturbation in question. Population shifts induced by the mutations alter the allosteric response by adjusting which hydrogen-bond networks are the most probable. These effects are compared using response maps that track changes across each single chain-Fv fragment, thus providing valuable insight into how sensitive allosteric mechanisms are to mutations. PMID:27166802

  16. Experimental radioimmunotherapy of a xenografted human glioma using 131I-labeled monoclonal antibody to epidermal growth factor receptor

    International Nuclear Information System (INIS)

    131I-labeled F (ab')2 fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 μCi 131I-labeled 425 F(ab')2 achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')2 was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')2. These studies suggest that 131I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author)

  17. Kinetic analysis of the interaction between the monoclonal antibody A33 and its colonic epithelial antigen by the use of an optical biosensor. A comparison of immobilisation strategies.

    Science.gov (United States)

    Catimel, B; Nerrie, M; Lee, F T; Scott, A M; Ritter, G; Welt, S; Old, L J; Burgess, A W; Nice, E C

    1997-07-25

    The interaction between the humanised A33 monoclonal antibody and the corresponding F(ab)'2 or Fab' fragments with the colonic epithelial A33 antigen, purified by micropreparative HPLC from membrane extracts of the colonic carcinoma cell line LIM 1215, has been studied with the BIAcore 2000 biosensor using surface plasmon resonance detection. The surface orientation of immobilised antibody and the Fab' fragment onto the biosensor surface was controlled using alternative immobilisation chemistries. This resulted in significantly higher molar binding activities compared with the conventional N-hydroxysuccinimide (NHS)/N-ethyl-N'-dimethylaminopropylcarbodiimide (EDC) chemistry. This increase in signal resulted in a concomitant increase in sensitivity of detection, which facilitates analysis of low levels of A33 antigen. The apparent association rate (ka) and dissociation rate (kd) constants obtained with the different immobilisation chemistries were determined. These analyses showed that the kinetic constants obtained for the IgG were not significantly affected by the method of immobilisation. F(ab)'2 and Fab' fragments immobilised using NHS/EDC chemistry showed significantly lower apparent affinity. By contrast the use of the thiol coupling chemistry with the Fab' fragment gave a five fold increase in observed KA, resulting in a similar affinity to that observed with the intact IgG molecule. PMID:9286074

  18. Tumor targeting of humanized fragment antibody secreted from transgenic rice cell suspension culture

    DEFF Research Database (Denmark)

    Hong, Shin-Young; Lee, Tae-Sup; Kim, Ju; Jung, Jae-Ho; Choi, Chang-Woon; Kim, Tae-Geum; Kwon, Tae-Ho; Jang, Yong-Suk; Yang, Moon-Sik

    The tumor-associated glycoprotein 72 (TAG 72) has been shown to be expressed in the majority of human adenocarcinomas. In an effort to develop a technique for the safe and inexpensive production of large quantities of anti-TAG 72 humanized antibody fragments (hzAb) as a future source of clinical......-grade proteins, we developed a transgenic rice cell suspension culture system. The in vivo assembly and secretion of hzAb were achieved in a transgenic rice cell culture under the control of the rice alpha amylase 3D (RAmy 3D) expression system, and the biological activities of plant-derived hzAb were determined...

  19. Human oxidation-specific antibodies reduce foam cell formation and atherosclerosis progression

    DEFF Research Database (Denmark)

    Tsimikas, Sotirios; Miyanohara, Atsushi; Hartvigsen, Karsten; Merki, Esther; Shaw, Peter X; Chou, Meng-Yun; Pattison, Jennifer; Torzewski, Michael; Sollors, Janina; Friedmann, Theodore; Lai, N Chin; Hammond, H Kirk; Getz, Godfrey S; Reardon, Catherine A; Li, Andrew C; Banka, Carole L; Witztum, Joseph L

    2011-01-01

    We sought to assess the in vivo importance of scavenger receptor (SR)-mediated uptake of oxidized low-density lipoprotein (OxLDL) in atherogenesis and to test the efficacy of human antibody IK17-Fab or IK17 single-chain Fv fragment (IK17-scFv), which lacks immunologic properties of intact...

  20. Structural analysis and molecular modeling of two antitrichosanthin IgE clones from phage antibody library

    Institute of Scientific and Technical Information of China (English)

    LIZONGDONG; YURENYUAN; 等

    1997-01-01

    Recently we constructed a murine IgE phage surface display library and screened out two IgE (Fab) clones with specific binding activity to Trichosanthin (TCS).In this work,the Vε and Vκ genes of the two clones were sequenced and their putative germline gene usages were studied.On the basis of the known 3D structure of Trichosanthin and antibody,molecular modeling was carried out to study the antigen-antibody interaction.The possible antigenic determinant sites on the surface of TCS recognized by both the clones were analyzed,and the reaction forces between TCS and two Fab fragments were also analyzed respectively.

  1. Ley specific antibody with potent anti-tumor activity is internalized and degraded in lysosomes.

    OpenAIRE

    Garrigues, J; Garrigues, U.; Hellström, I; Hellström, K. E.

    1993-01-01

    BR96 is a monoclonal antibody (MAb) that recognizes many human carcinomas and can kill antigen-positive tumor cells in vitro. Using both gold and radiolabeled MAb, the distribution and cellular processing of BR96 during cytolysis has been determined. After a brief (< 3 minutes) MAb treatment, cells in suspension are stained by the nuclear viability dye propidium iodide. Whole MAb and F(ab')2 fragments are equally cytotoxic; monovalent F(ab) fragments, however, have no effect on dye uptake unl...

  2. Shark Variable New Antigen Receptor (VNAR Single Domain Antibody Fragments: Stability and Diagnostic Applications

    Directory of Open Access Journals (Sweden)

    Stewart Nuttall

    2013-01-01

    Full Text Available The single variable new antigen receptor domain antibody fragments (VNARs derived from shark immunoglobulin new antigen receptor antibodies (IgNARs represent some of the smallest known immunoglobulin-based protein scaffolds. As single domains, they demonstrate favorable size and cryptic epitope recognition properties, making them attractive in diagnosis and therapy of numerous disease states. Here, we examine the stability of VNAR domains with a focus on a family of VNARs specific for apical membrane antigen 1 (AMA-1 from Plasmodium falciparum. The VNARs are compared to traditional monoclonal antibodies (mAbs in liquid, lyophilized and immobilized nitrocellulose formats. When maintained in various formats at 45 °C, VNARs have improved stability compared to mAbs for periods of up to four weeks. Using circular dichroism spectroscopy we demonstrate that VNAR domains are able to refold following heating to 80 °C. We also demonstrate that VNAR domains are stable during incubation under potential in vivo conditions such as stomach acid, but not to the protease rich environment of murine stomach scrapings. Taken together, our results demonstrate the suitability of shark VNAR domains for various diagnostic platforms and related applications.

  3. FabIO

    DEFF Research Database (Denmark)

    Bergbäck Knudsen, Erik; Sørensen, Henning O.; Wright, Jonathan P.; Goret, Gaël; Kieffer, Jérôme

    2013-01-01

    FabIO is a Python module written for easy and transparent reading of raw two-dimensional data from various X-ray detectors. The module provides a function for reading any image and returning a fabioimage object which contains both metadata (header information) and the raw data. All fabioimage...

  4. Tumor penetration with intact MAb and fragments demonstrated in vitro on tumor spheroids and in vivo in the nude mouse model

    International Nuclear Information System (INIS)

    Tumor spheroids grown in culture represent a good in vitro model for the study of tumor penetration phenomena of potential radiotherapeutics. Using this system, it was found that Fab-fragments penetrate tumors more quickly and deeply than complete antibodies. These results were confirmed in tumor bearing nephrectomized nude mice

  5. Preparation and identification of the fragment of rabbit's polyclonal antibodies against human ouabain%抗哇巴因多克隆抗体F(ab)2 片段的研制及鉴定

    Institute of Scientific and Technical Information of China (English)

    张明娟; 吕卓人; 袁育康; 贺浪冲; 王颢

    2000-01-01

    Objective Anti-ouabain polyclonal antibody was digested with pepsin to prepare F fragment in order to find the base of reshaped antibody. Methods Anti-ouabain polyclonal antibody was prepared by immunizing rabbits. Then anti-ouabain polyclonal antibody was digested under different conditions. The reactants were analyzed and purified by High Performance Size Ex-clude Chromatography (HPSEC). The immune activities were detected and identified by Enzyme Linked Immunosorbent Assay (ELISA). Results The proper reactive conditions for preparation of anti-ouabain polyclonal antibody F(ab)2 fragment with pepsin were established. The eligible dose of pepsin, by which 100mg anti-onabain polyclonal antibody was digested better, was 2mg. The eligible digesuve time was 18h. The value of pH of reactive system was 3.0. Conclusion The active F fragment of anti-ouabain polyclonal antibody can be obtained with pepsin. The method is simple and feasible.%目的用胃蛋白酶酶解抗哇巴因多克隆抗体,制备出片段,为改型抗体的研究提 供依据。方法免疫家兔制备出抗哇巴因多克隆抗体,并用胃蛋白酶分别在不同的酶解条件下消化抗体,继之用高效液相排阻色谱法(HPSEC)对其进行分析、纯化,采用酶联免疫吸附法(ELISA)检测、鉴定其活性。结果用胃蛋白酶2mg/100mg抗哇巴因多克隆抗体,消化18h,反应体系的pH3.0时,可获得片段。结论用胃蛋白酶酶解抗哇巴因多克隆抗体是研制出有活性的片段的有效方法。

  6. Phage display used for gene cloning of human recombinant antibody against the erythrocyte surface antigen, rhesus D

    DEFF Research Database (Denmark)

    Dziegiel, Morten Hanefeld; Nielsen, L K; Andersen, P S; Blancher, A; Dickmeiss, E; Engberg, J

    1995-01-01

    A novel phage display system has been developed for PCR amplification and cloning of the Fab fragments of human immunoglobulin genes. Using this system, we have cloned an antibody from a mouse-human hybridoma cell line directed against the erythrocyte antigen rhesus D. Intact erythrocytes were used...

  7. Study of the association of an O-specific polysaccharide from Pseudomonas fluorescens with antibodies

    International Nuclear Information System (INIS)

    The O-specific polysaccharide has been isolated from the lipopolysaccharide-protein complex of Pseudomonas fluorescens by mild acid hydrolysis followed by gel chromatography of the carbohydrate fraction of Sephadex G-50. According to 13C NMR spectroscopy, the polysaccharide is constructed of regularly repeating trisaccharide units including three 6-deoxyhexose residues two of which are amino sugars. An investigation has been performed of the interaction of the polysaccharide with specific antibodies and univalent Fab fragments of the antibodies. For the isolation of the antibodies and Fab fragments and their fractionation with respect to affinity we used an immunosorbent based on the polysaccharide bound to Sepharose 4B. It was established that antibodies to the polysaccharide were heterogeneous to some extent in relation to their affinity, and their interaction with polysaccharide had a cooperative nature

  8. Study of the association of an O-specific polysaccharide from Pseudomonas fluorescens with antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Solov' eva, T.F.; Naberezhnykh, G.A.; Mazur, A.K.; Khomenko, V.A.; Ovodoy, Yu.S.

    1986-12-01

    The O-specific polysaccharide has been isolated from the lipopolysaccharide-protein complex of Pseudomonas fluorescens by mild acid hydrolysis followed by gel chromatography of the carbohydrate fraction of Sephadex G-50. According to /sup 13/C NMR spectroscopy, the polysaccharide is constructed of regularly repeating trisaccharide units including three 6-deoxyhexose residues two of which are amino sugars. An investigation has been performed of the interaction of the polysaccharide with specific antibodies and univalent Fab fragments of the antibodies. For the isolation of the antibodies and Fab fragments and their fractionation with respect to affinity we used an immunosorbent based on the polysaccharide bound to Sepharose 4B. It was established that antibodies to the polysaccharide were heterogeneous to some extent in relation to their affinity, and their interaction with polysaccharide had a cooperative nature.

  9. Diffusion and binding of monoclonal antibody TNT-1 in multicellular tumor spheroids

    International Nuclear Information System (INIS)

    Tumor spheroids of HT-29 human colon adenocarcinoma and A375 melanoma were established to investigate the uptake and clearance kinetics of TNT-1, a monoclonal antibody that targets necrotic cells of tumors. Our data reveal that there was rapid uptake of TNT-1 and its F(ab')2 fragment in both spheroid models, whereas an antibody of irrelevant specificity, Lym-1, and its F(ab')2 fragment bound poorly to the spheroids. Unlike previously reported monoclonal antibodies to tumor cell-surface antigens, TNT-1 showed (1) a linear uptake that increased over time without saturation in tumor spheroids and (2) an unexpected uptake by a subpopulation of cells in the viable outer rim of the spheroids. These preclinical studies provide important information concerning the therapeutic potential of TNT monoclonal antibodies for the treatment of cancer and micrometastases

  10. In Vitro Neutralisation of Rotavirus Infection by Two Broadly Specific Recombinant Monovalent Llama-Derived Antibody Fragments

    OpenAIRE

    Farah Aladin; Einerhand, Alexandra W. C.; Janneke Bouma; Sandra Bezemer; Pim Hermans; Danielle Wolvers; Kate Bellamy; Frenken, Leon G J; Jim Gray; Miren Iturriza-Gómara

    2012-01-01

    textabstractRotavirus is the main cause of viral gastroenteritis in young children. Therefore, the development of inexpensive antiviral products for the prevention and/or treatment of rotavirus disease remains a priority. Previously we have shown that a recombinant monovalent antibody fragment (referred to as Anti-Rotavirus Proteins or ARP1) derived from a heavy chain antibody of a llama immunised with rotavirus was able to neutralise rotavirus infection in a mouse model system. In the presen...

  11. Expression of secreted human single-chain fragment variable antibody against human amyloid beta peptide in Pichia pastoris

    Institute of Scientific and Technical Information of China (English)

    Jiong Cai; Fang Li; Shizhen Wang

    2008-01-01

    BACKGROUND: Studies have shown that monoclonal or polyclonal antibody injections ofamyloid β peptide arc effective in removing amyloid β peptide overload in the brain.OBJECTIVE: Based on successful screening of a human single-chain fragment variable antibody specific to amyloid β peptide, this paper aimed to express recombinant human single-chain variable antibody against amyloid β peptide.DESIGN, TIME AND SETTING: A single sample experiment was performed at the Department of Nuclear Medicine, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Hospital (Beijing, China) from January to July 2006.MATERIALS: Human single-chain fragment variable antibody gene against amyloid β peptide was screened from a human phage-display antibody library.METHODS: Human single-chain fragment variable antibody gene was mutated to eliminate a BamHI restriction site and cloned into a Teasy plasmid for pT-seFvAβ construction, which was identified by PCR amplification and endonuclease digestion. Plasmid pT-scFvA β was cut by EcoRl and Notl endonucleases, and the antibody gene was cloned into pPIC9K plasmid to construct pPIC9K-scFvA β expression vector, which was confirmed by gene sequencing. Linearized pPICgK-scFvA β was used to transform a Pichia pastoris GS115 cell line, and the recombinant was induced by 0.5 % methanol to express human single-chain fragment variable antibody specific to amyloid β peptide.MAIN OUTCOME MEASURES: Protein electrophoresis was used to identify PCR products, gene sequencing was uscd to verify the pPIC9K-scFvA sequence, and SDS-PAGE was used to detect recombinant expression of human single-chain fragment variable antibody specific to amyloid β peptide in Pichia pastoris.RESULTS: Gene sequencing confirmed pPICgK-scFvA β orientation. Rccomhinants were obtained by lineadzed pPIC9K-scFvA β transformation. After induction with 0.5% methanol, the recombinant yeast cells secreted proteins of 33-ku size

  12. Design and construction of a new human naïve single-chain fragment variable antibody library, IORISS1.

    Science.gov (United States)

    Pasello, Michela; Zamboni, Silvia; Mallano, Alessandra; Flego, Michela; Picci, Piero; Cianfriglia, Maurizio; Scotlandi, Katia

    2016-04-20

    Human monoclonal antibodies are a powerful tool with increasingly successful exploitations and the single chain fragment variable format can be considered the building block for the implementation of more complex and effective antibody-based constructs. Phage display is one of the best and most efficient methods to isolate human antibodies selected from an efficient and variable phage display library. We report a method for the construction of a human naïve single-chain variable fragment library, termed IORISS1. Many different sets of oligonucleotide primers as well as optimized electroporation and ligation reactions were used to generate this library of 1.2×10(9) individual clones. The key difference is the diversity of variable gene templates, which was derived from only 15 non-immunized human donors. The method described here, was used to make a new human naïve single-chain fragment variable phage display library that represents a valuable source of diverse antibodies that can be used as research reagents or as a starting point for the development of therapeutics. Using biopanning, we determined the ability of IORISS1 to yield antibodies. The results we obtained suggest that, by using an optimized protocol, an efficient phage antibody library can be generated. PMID:26945728

  13. Radioimmunoimaging of experimental gliomas using radiolabelled monoclonal antibodies

    International Nuclear Information System (INIS)

    The biodistribution and tumour uptake of radiolabelled (131 I) glioma-seeking monoclonal antibodies (14 AC1) and their F(ab')2 fragments were investigated in nude mice having received glioma transplants. Radioimmunoimaging by external scintigraphy at 48 and 96 hours pointed to a superior tumour localisation by the fragments that was clearly related to the dose. Wholebody determinations of the biokinetic behaviour led to the following results: Faster clearance anc more ready elimination from the blood pool for the fragments, preferential uptake in the tumour; intact antibodies; binding in the liver, spleen and lungs. The study confirmed the value of fragments of monoclonal antibodies in the diagnosis of tumours and pointed to the possibility of using intact monoclonal antibodies as carriers of radioisotopes and cytotoxic drugs within the scope of therapeutic programmes. (TRV)

  14. Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage λ immunoexpression library

    International Nuclear Information System (INIS)

    The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and κ light-chain variable and constant region domains, were inserted into modified bacteriophase λ expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2% in the library. These human antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen

  15. Antibody fragment recognition layers for surface plasmon resonance biosensing: a parametric study

    Science.gov (United States)

    Magalhães, André; Bordeira, Sandro; Almeida, Ana Cristina; Fontes, Vanessa; Costa, Maria João L.; Fonseca, Luís P.; da Fonseca, João Garcia

    2009-02-01

    A comparative study is reported regarding the use of two different surface plasmon resonance (SPR) biosensors, a homemade SPR grating biosensor and a reference prism coupled biosensor, to perform quantification of C-reactive protein (CRP) in human blood serum. Surface functionalization was conducted using anti-CRP fragments immobilized directly on gold. Adsorption time optimization for the antibody fragments monolayer, non-specific binding (NSB) resistance evaluation and CRP detection were conducted, with better results achieved by the grating biosensor on all topics, namely less functionalization time, higher resistance to NSB and wider CRP dynamic concentration range. A study regarding comparison between continuous flow and surface coating immobilization is also reported in this work. We have shown that surface coating immobilization achieves similar NSB resistance and CRP detection results, allowing a 75% assay cost reduction by lower solution volume requirement. Results suggest that the coating immobilization technique is the best suited to be used in further studies in order to obtain a viable immunosensor for CRP and other biomarkers detection in complex biological fluids.

  16. Structural characterization of a therapeutic anti-methamphetamine antibody fragment: oligomerization and binding of active metabolites.

    Directory of Open Access Journals (Sweden)

    Eric C Peterson

    Full Text Available Vaccines and monoclonal antibodies (mAb for treatment of (+-methamphetamine (METH abuse are in late stage preclinical and early clinical trial phases, respectively. These immunotherapies work as pharmacokinetic antagonists, sequestering METH and its metabolites away from sites of action in the brain and reduce the rewarding and toxic effects of the drug. A key aspect of these immunotherapy strategies is the understanding of the subtle molecular interactions important for generating antibodies with high affinity and specificity for METH. We previously determined crystal structures of a high affinity anti-METH therapeutic single chain antibody fragment (scFv6H4, K(D = 10 nM in complex with METH and the (+ stereoisomer of 3,4-methylenedioxymethamphetamine (MDMA, or "ecstasy". Here we report the crystal structure of scFv6H4 in homo-trimeric unbound (apo form (2.60Å, as well as monomeric forms in complex with two active metabolites; (+-amphetamine (AMP, 2.38Å and (+-4-hydroxy methamphetamine (p-OH-METH, 2.33Å. The apo structure forms a trimer in the crystal lattice and it results in the formation of an intermolecular composite beta-sheet with a three-fold symmetry. We were also able to structurally characterize the coordination of the His-tags with Ni(2+. Two of the histidine residues of each C-terminal His-tag interact with Ni(2+ in an octahedral geometry. In the apo state the CDR loops of scFv6H4 form an open conformation of the binding pocket. Upon ligand binding, the CDR loops adopt a closed formation, encasing the drug almost completely. The structural information reported here elucidates key molecular interactions important in anti-methamphetamine abuse immunotherapy.

  17. High-Efficiency Screening of Monoclonal Antibodies for Membrane Protein Crystallography

    OpenAIRE

    Lim, Hyun-Ho; Fang, Yiling; Williams, Carole

    2011-01-01

    Determination of crystal structures of membrane proteins is often limited by difficulties obtaining crystals diffracting to high resolution. Co-crystallization with Fab fragments of monoclonal antibodies has been reported to improve diffraction of membrane proteins crystals. However, it is not simple to generate useful monoclonal antibodies for membrane protein crystallography. In this report, we present an optimized process for efficient screening from immunization to final validation of mon...

  18. Quantitation of imaging with I-131-F(ab')/sub 2/ fragments of monoclonal antibody in patients

    International Nuclear Information System (INIS)

    Iodine-131 labeled F(ab')/sub 2/ fragments of monoclonal antibody (IgG/sub 2a/ immunoglobulin with specificity for a cell surface antigen of colon carcinoma) have been used for quantitative imaging of tumor in 27 patients. Activity of I-131 F(ab')/sub 2/ fragments localized in tumor and in liver was quantitated using a modification of the method of Thomas SR, employing computer-acquired conjugate views (i.e. 180 opposed) to eliminate need for tumor or organ depth and tissue attenuation. The method was validated with an abdominal imaging phantom showing accuracy of +/- 10%. Quantitation indicates that activity reaches a peak in tumor at 48-72 hours and the ratio of activity in hepatic metastases to activity in liver peaks at approximately 72 hours. Mean activity in tumor was less than 0.01% of the administered dose per gram of tumor at any imaging time from 24 to 168 hours, while mean activity in surrounding liver was less than .002% of administered dose per gram of liver at any imaging time. Liver activity decreased monotonically with time, showing no peak activity. This non-invasive method of quantitating the distribution of F(ab')/sub 2/ fragments of monoclonal antibody in patients has proven accurate by comparison with phantom simulation. This type of quantitation is necessary for evaluating optimal imaging time, comparing relative utility of various antibodies and has use for therapeutic applications of monoclonal antibody fragments

  19. Passive immunization with llama single-domain antibody fragments reduces foot-and-mouth disease transmission between pigs

    NARCIS (Netherlands)

    Harmsen, M.M.; Fijten, H.P.D.; Engel, B.; Dekker, A.; Eble, P.L.

    2009-01-01

    We aim to develop a method that confers rapid protection against foot-and-mouth disease (FMD) by passive immunization with recombinant llama single-domain antibody fragments (VHHs). Previously constructed genetic fusions of two VHHs (VHH2s) that either neutralizes FMDV or binds to porcine immunoglob

  20. Influence of circulating antigen on blood pool activity of a radioiodinated monoclonal antibody

    International Nuclear Information System (INIS)

    Athymic mice with and without circulating CA 125 antigen were injected with 0.1-100 μg of 131I-labeled OC 125 F(ab')2 antibody fragment. Both the blood clearance of 131I activity and the change in serum CA 125 were monitored over 24 h. Influence of CA 125 on blood pool activity could be avoided only at the 100 μg dose. In patient studies, circulating CA 125 levels decreased for the first 2 h after injection of OC 125 F(ab')2 but generally returned to preinjection levels shortly thereafter. In vitro binding studies using the sera from patients injected with 131I-labeled OC 125 F(ab')2 suggest that circulating CA 125 could interfere with the tumor uptake of the labeled antibody. (author)

  1. Novel human single chain antibody fragments that are rapidly interalizing effectively target epithelioid and sarcomatoid mesotheliomas

    Science.gov (United States)

    Iyer, Arun K.; Lan, Xiaoli; Zhu, Xiaodong; Su, Yang; Feng, Jinjin; Zhang, Xiaoju; Gao, Dongwei; Seo, Youngho; VanBrocklin, Henry F.; Broaddus, V. Courtney; Liu, Bin; He, Jiang

    2011-01-01

    Human antibodies targeting all subtypes of mesothelioma could be useful to image and treat this deadly disease. Here we report tumor targeting of a novel internalizing human single chain antibody fragment (scFv) labeled with 99mTc (99mTc-M40) in murine models of mesothelioma of both epithelioid (M28) and sarcomatoid (VAMT-1) origins. 99mTc-M40 was taken up rapidly and specifically by both subtype tumor cells in vitro, with 68–92% internalized within 1h. The specificity of binding was evidenced by blocking (up to 95%) with 10-fold excess of unlabeled M40. In animal studies, tumors of both subtypes were clearly visualized by SPECT/CT as early as 1h post-injection of 99mTc-M40. Tumor uptake measured as percent of injected dose per gram tissue (%ID/g) at 3h was 4.38 and 5.84 for M28 and VAMT-1 tumors respectively, significantly greater than all organs or tissues studied (liver, 2.62%ID/g; other organs or tissues <1.7%ID/g), except the kidneys (130.7%ID/g), giving tumor-to-blood ratios of 5:1 and 7:1 and tumor-to-muscle ratios of 45:1 and 60:1, for M28 and VAMT-1 respectively. The target-mediated uptake was confirmed by a nearly 70% reduction in tumor activity following administration of 10-fold excess of unlabeled scFv. Taken together, these results indicate that M40 can rapidly and specifically target epithelioid and sarcomatoid tumor cells, demonstrating the potential of this agent as a versatile targeting ligand for imaging and therapy of all subtypes of mesothelioma. PMID:21447742

  2. Isolation and characterisation of Ebolavirus-specific recombinant antibody fragments from murine and shark immune libraries.

    Science.gov (United States)

    Goodchild, Sarah A; Dooley, Helen; Schoepp, Randal J; Flajnik, Martin; Lonsdale, Stephen G

    2011-09-01

    Members of the genus Ebolavirus cause fulminating outbreaks of disease in human and non-human primate populations with a mortality rate up to 90%. To facilitate rapid detection of these pathogens in clinical and environmental samples, robust reagents capable of providing sensitive and specific detection are required. In this work recombinant antibody libraries were generated from murine (single chain variable domain fragment; scFv) and nurse shark, Ginglymostoma cirratum (IgNAR V) hosts immunised with Zaire ebolavirus. This provides the first recorded IgNAR V response against a particulate antigen in the nurse shark. Both murine scFv and shark IgNAR V libraries were panned by phage display technology to identify useful antibodies for the generation of immunological detection reagents. Two murine scFv were shown to have specificity to the Zaire ebolavirus viral matrix protein VP40. Two isolated IgNAR V were shown to bind to the viral nucleoprotein (NP) and to capture viable Zaire ebolavirus with a high degree of sensitivity. Assays developed with IgNAR V cross-reacted to Reston ebolavirus, Sudan ebolavirus and Bundibugyo ebolavirus. Despite this broad reactivity, neither of IgNAR V showed reactivity to Côte d'Ivoire ebolavirus. IgNAR V was substantially more resistant to irreversible thermal denaturation than murine scFv and monoclonal IgG in a comparative test. The demonstrable robustness of the IgNAR V domains may offer enhanced utility as immunological detection reagents in fieldable biosensor applications for use in tropical or subtropical countries where outbreaks of Ebolavirus haemorrhagic fever occur. PMID:21752470

  3. Secretory signal peptide modification for optimized antibody-fragment expression-secretion in Leishmania tarentolae

    Directory of Open Access Journals (Sweden)

    Klatt Stephan

    2012-07-01

    Full Text Available Abstract Background Secretory signal peptides (SPs are well-known sequence motifs targeting proteins for translocation across the endoplasmic reticulum membrane. After passing through the secretory pathway, most proteins are secreted to the environment. Here, we describe the modification of an expression vector containing the SP from secreted acid phosphatase 1 (SAP1 of Leishmania mexicana for optimized protein expression-secretion in the eukaryotic parasite Leishmania tarentolae with regard to recombinant antibody fragments. For experimental design the online tool SignalP was used, which predicts the presence and location of SPs and their cleavage sites in polypeptides. To evaluate the signal peptide cleavage site as well as changes of expression, SPs were N-terminally linked to single-chain Fragment variables (scFv’s. The ability of L. tarentolae to express complex eukaryotic proteins with highly diverse post-translational modifications and its easy bacteria-like handling, makes the parasite a promising expression system for secretory proteins. Results We generated four vectors with different SP-sequence modifications based on in-silico analyses with SignalP in respect to cleavage probability and location, named pLTEX-2 to pLTEX-5. To evaluate their functionality, we cloned four individual scFv-fragments into the vectors and transfected all 16 constructs into L. tarentolae. Independently from the expressed scFv, pLTEX-5 derived constructs showed the highest expression rate, followed by pLTEX-4 and pLTEX-2, whereas only low amounts of protein could be obtained from pLTEX-3 clones, indicating dysfunction of the SP. Next, we analysed the SP cleavage sites by Edman degradation. For pLTEX-2, -4, and -5 derived scFv’s, the results corresponded to in-silico predictions, whereas pLTEX-3 derived scFv’s contained one additional amino-acid (AA. Conclusions The obtained results demonstrate the importance of SP-sequence optimization for efficient

  4. Immunization with recombinant enterovirus 71 viral capsid protein 1 fragment stimulated antibody responses in hamsters

    Directory of Open Access Journals (Sweden)

    Ch’ng Wei-Choong

    2012-08-01

    Full Text Available Abstract Enterovirus 71 (EV71 causes severe neurological diseases resulting in high mortality in young children worldwide. Development of an effective vaccine against EV71 infection is hampered by the lack of appropriate animal models for efficacy testing of candidate vaccines. Previously, we have successfully tested the immunogenicity and protectiveness of a candidate EV71 vaccine, containing recombinant Newcastle disease virus capsids that display an EV71 VP1 fragment (NPt-VP11-100 protein, in a mouse model of EV71 infection. A drawback of this system is its limited window of EV71 susceptibility period, 2 weeks after birth, leading to restricted options in the evaluation of optimal dosing regimens. To address this issue, we have assessed the NPt-VP11-100 candidate vaccine in a hamster system, which offers a 4-week susceptibility period to EV71 infection. Results obtained showed that the NPt-VP11-100 candidate vaccine stimulated excellent humoral immune response in the hamsters. Despite the high level of antibody production, they failed to neutralize EV71 viruses or protect vaccinated hamsters in viral challenge studies. Nevertheless, these findings have contributed towards a better understanding of the NPt-VP11-100 recombinant protein as a candidate vaccine in an alternative animal model system.

  5. Generation and characterization of a human single-chain fragment variable (scFv antibody against cytosine deaminase from Yeast

    Directory of Open Access Journals (Sweden)

    Tombesi Marina

    2008-09-01

    Full Text Available Abstract Background The ability of cytosine deaminase (CD to convert the antifungal agent 5-fluorocytosine (5-FC into one of the most potent and largely used anticancer compound such as 5-fluorouracil (5-FU raised considerable interest in this enzyme to model gene or antibody – directed enzyme-prodrug therapy (GDEPT/ADEPT aiming to improve the therapeutic ratio (benefit versus toxic side-effects of cancer chemotherapy. The selection and characterization of a human monoclonal antibody in single chain fragment (scFv format represents a powerful reagent to allow in in vitro and in vivo detection of CD expression in GDEPT/ADEPT studies. Results An enzymatic active recombinant CD from yeast (yCD was expressed in E. coli system and used as antigen for biopanning approach of the large semi-synthetic ETH-2 antibody phage library. Several scFvs were isolated and specificity towards yCD was confirmed by Western blot and ELISA. Further, biochemical and functional investigations demonstrated that the binding of specific scFv with yCD did not interfere with the activity of the enzyme in converting 5-FC into 5-FU. Conclusion The construction of libraries of recombinant antibody fragments that are displayed on the surface of filamentous phage, and the selection of phage antibodies against target antigens, have become an important biotechnological tool in generating new monoclonal antibodies for research and clinical applications. The scFvH5 generated by this method is the first human antibody which is able to detect yCD in routinary laboratory techniques without interfering with its enzymatic function.

  6. Optimisation of recombinant protein production in Pichia pastoris:single-chain antibody fragment model protein

    OpenAIRE

    Khatri, N. K. (Narendar Kumar)

    2011-01-01

    Abstract Potential lethal diarrhoea caused by enterotoxigenic Escherichia coli strains is one of the most common diseases in young pigs. It can be cured by single-chain antibody fragments (scFv), which can be produced in recombinant microorganisms. Pichia pastoris, a methylotrophic yeast, is generally considered an interesting production system candidate, as it can secrete properly folded proteins. These proteins accumulate in high concentrations during fermentation, reducing the cost for...

  7. Proteomic Profiling of Recombinant Escherichia coli in High-Cell- Density Fermentations for Improved Production of an Antibody Fragment Biopharmaceutical

    OpenAIRE

    Aldor, Ilana S.; Krawitz, Denise C.; Forrest, William; Chen, Christina; Nishihara, Julie C.; Joly, John C.; Champion, Kathleen M.

    2005-01-01

    By using two-dimensional polyacrylamide gel electrophoresis, a proteomic analysis over time was conducted with high-cell-density, industrial, phosphate-limited Escherichia coli fermentations at the 10-liter scale. During production, a recombinant, humanized antibody fragment was secreted and assembled in a soluble form in the periplasm. E. coli protein changes associated with culture conditions were distinguished from protein changes associated with heterologous protein expression. Protein sp...

  8. Injectable formulations for an intravitreal sustained-release application of a novel single-chain VEGF antibody fragment.

    Science.gov (United States)

    Asmus, Lutz R; Grimshaw, John P A; Richle, Philipp; Eicher, Barbara; Urech, David M; Gurny, Robert; Möller, Michael

    2015-09-01

    Sustained-release formulations of a single-chain anti-VEGF-A antibody fragment were investigated in vitro toward their potential use for intravitreal applications. The hydrophobic polyester hexylsubstituted poly(lactic acid) (hexPLA) was selected as the sustained-release excipient for its biodegradability and semi-solid aggregate state, allowing an easy and mild formulation procedure. The lyophilized antibody fragment ESBA903 was micronized and incorporated into the liquid polymer matrix by cryo-milling, forming homogeneous and injectable suspensions. The protein showed excellent compatibility with the hexPLA polymer and storage stability at 4°C for 10 weeks. Additionally, hexPLA shielded the incorporated active substance from the surrounding medium, resulting in a better stability of ESBA903 inside the polymer than after its release in the buffer solution. Formulations of ESBA903 with hexPLA having drug loadings between 1.25% and 5.0% and polymer molecular weights of 1500 g/mol, 2500 g/mol, 3500 g/mol and 5000 g/mol were investigated regarding their in vitro release. All formulations except with the highest molecular weight formed spherical depots in aqueous buffer solutions and released the antibody fragment for at least 6-14 weeks. The polymer viscosity derived from the molecular weight strongly influenced the release rate, while the drug loading had minor influence, allowing customization of the release profile and the daily drug release. Size exclusion chromatography and SDS-PAGE revealed that the antibody fragment structure was kept intact during incorporation and release from the liquid matrix. Furthermore, the released protein monomer maintained its high affinity to human VEGF-A, as measured by surface plasmon resonance analysis. Formulations of ESBA903 in hexPLA meet the basic needs to be used for intravitreal sustained-release applications in age-related macular degeneration treatment. PMID:25779352

  9. Prokaryotic Expression and Purification of Human TLE1 N-terminal Q Domain Fragment and Production of its Polyclonal Antibody

    Directory of Open Access Journals (Sweden)

    Su WANG

    2010-11-01

    Full Text Available Background and objective TLE1 is an important protein in regulating Wnt, Notch and EGFR signaling pathways. The TLE1 N-terminal Q domain regulates the pathways by mediating its oligomerization and interaction with LEF1. The aim of this study is to construct the human TLE1 N-terminal Q domain fragment in prokaryotic expression system, express and purify protein TLE1 N-terminal Q domain and prepare its polyclonal antibody. Methods The sequence of TLE1 N-terminal Q domain obtained by PCR from human lung adenocarcinoma cDNA, was cloned into the prokaryotic expression vector pGEX-4T-1 containing Glutathione S-transferase (GST. Vector pGEX-4T1-TLE1-Q was transformed into E.coli BL21 condon plus. The GST-TLE1-Q(1-136 fusion protein was induced by IPTG, digested by Thrombin, purified with glutathione-sepharose beads and FPLC, identified by SDS-PAGE. Then rabbits were immunized with the purified protein TLE1-Q(1-136 for obtaining the antiserum. The titers and specificity of antibodies were measured by ELISA and Western blot. Results The PCR identification and the sequencing of recombinant plasmid demonstrated that vector pGEX-4T1-TLE1-Q was successfully constructed. The SDS-PAGE shows target protein (14 000 Da is the interest protein TLE1-Q(1-136. The TLE1 N-terminal Q domain fragment TLE1-Q(1-136 and its polyclonal antibody have been acquired, with an antibody titer of 1:20 000. Conclusion Expression vector pGEX-4T1-TLE1-Q is correctly constructed. The TLE1 N-terminal Q domain fragment TLE1-Q(1-136 and its polyclonal antibody have been acquired. These work established the foundation for further biological study between TLE1 and lung cancers.

  10. Redistribution of flexibility in stabilizing antibody fragment mutants follows Le Chatelier's principle.

    Directory of Open Access Journals (Sweden)

    Tong Li

    Full Text Available Le Châtelier's principle is the cornerstone of our understanding of chemical equilibria. When a system at equilibrium undergoes a change in concentration or thermodynamic state (i.e., temperature, pressure, etc., La Châtelier's principle states that an equilibrium shift will occur to offset the perturbation and a new equilibrium is established. We demonstrate that the effects of stabilizing mutations on the rigidity ⇔ flexibility equilibrium within the native state ensemble manifest themselves through enthalpy-entropy compensation as the protein structure adjusts to restore the global balance between the two. Specifically, we characterize the effects of mutation to single chain fragments of the anti-lymphotoxin-β receptor antibody using a computational Distance Constraint Model. Statistically significant changes in the distribution of both rigidity and flexibility within the molecular structure is typically observed, where the local perturbations often lead to distal shifts in flexibility and rigidity profiles. Nevertheless, the net gain or loss in flexibility of individual mutants can be skewed. Despite all mutants being exclusively stabilizing in this dataset, increased flexibility is slightly more common than increased rigidity. Mechanistically the redistribution of flexibility is largely controlled by changes in the H-bond network. For example, a stabilizing mutation can induce an increase in rigidity locally due to the formation of new H-bonds, and simultaneously break H-bonds elsewhere leading to increased flexibility distant from the mutation site via Le Châtelier. Increased flexibility within the VH β4/β5 loop is a noteworthy illustration of this long-range effect.

  11. Stainless steel surface functionalization for immobilization of antibody fragments for cardiovascular applications.

    Science.gov (United States)

    Foerster, A; Hołowacz, I; Sunil Kumar, G B; Anandakumar, S; Wall, J G; Wawrzyńska, M; Paprocka, M; Kantor, A; Kraskiewicz, H; Olsztyńska-Janus, S; Hinder, S J; Bialy, D; Podbielska, H; Kopaczyńska, M

    2016-04-01

    Stainless steel 316 L material is commonly used for the production of coronary and peripheral vessel stents. Effective biofunctionalization is a key to improving the performance and safety of the stents after implantation. This paper reports the method for the immobilization of recombinant antibody fragments (scFv) on stainless steel 316 L to facilitate human endothelial progenitor cell (EPC) growth and thus improve cell viability of the implanted stents for cardiovascular applications. The modification of stent surface was conducted in three steps. First the stent surface was coated with titania based coating to increase the density of hydroxyl groups for successful silanization. Then silanization with 3 aminopropyltriethoxysilane (APTS) was performed to provide the surface with amine groups which presence was verified using FTIR, XPS, and fluorescence microscopy. The maximum density of amine groups (4.8*10(-5) mol/cm(2) ) on the surface was reached after reaction taking place in ethanol for 1 h at 60° C and 0.04M APTS. On such prepared surface the glycosylated scFv were subsequently successfully immobilized. The influence of oxidation of scFv glycan moieties and the temperature on scFv coating were investigated. The fluorescence and confocal microscopy study indicated that the densest and most uniformly coated surface with scFv was obtained at 37°C after oxidation of glycan chain. The results demonstrate that the scFv cannot be efficiently immobilized without prior aminosilanization of the surface. The effect of the chemical modification on the cell viability of EPC line 55.1 (HucPEC-55.1) was performed indicating that the modifications to the 316 L stainless steel are non-toxic to EPCs. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 821-832, 2016. PMID:26566715

  12. Structural comparison of four different antibodies interacting with human papillomavirus 16 and mechanisms of neutralization

    International Nuclear Information System (INIS)

    Cryo-electron microscopy (cryo-EM) was used to solve the structures of human papillomavirus type 16 (HPV16) complexed with fragments of antibody (Fab) from three different neutralizing monoclonals (mAbs): H16.1A, H16.14J, and H263.A2. The structure-function analysis revealed predominantly monovalent binding of each Fab with capsid interactions that involved multiple loops from symmetry related copies of the major capsid protein. The residues identified in each Fab-virus interface map to a conformational groove on the surface of the capsomer. In addition to the known involvement of the FG and HI loops, the DE loop was also found to constitute the core of each epitope. Surprisingly, the epitope mapping also identified minor contributions by EF and BC loops. Complementary immunological assays included mAb and Fab neutralization. The specific binding characteristics of mAbs correlated with different neutralizing behaviors in pre- and post-attachment neutralization assays. - Highlights: • We present HPV16-Fab complexes from neutralizing mAbs: H16.1A, H16.14J, and H263.A2. • The structure-function analysis revealed predominantly monovalent binding of each mAb. • Capsid–Fab interactions involved multiple loops from symmetry related L1 proteins. • Besides the known FG and HI loops, epitope mapping also identified DE, EF, and BC loops. • Neutralizing assays complement the structures to show multiple neutralization mechanisms

  13. Structural comparison of four different antibodies interacting with human papillomavirus 16 and mechanisms of neutralization

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Jian [Department of Medicine, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Bywaters, Stephanie M.; Brendle, Sarah A. [Department of Pathology, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Lee, Hyunwook; Ashley, Robert E. [Department of Medicine, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Makhov, Alexander M.; Conway, James F. [Department of Structural Biology, University of Pittsburgh School of Medicine, 3501 5th Ave, Pittsburgh, PA 15260 (United States); Christensen, Neil D. [Department of Pathology, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Hafenstein, Susan, E-mail: shafenstein@hmc.psu.edu [Department of Medicine, The Pennsylvania State University College of Medicine, 500 University Drive, Hershey, PA 17033 (United States)

    2015-09-15

    Cryo-electron microscopy (cryo-EM) was used to solve the structures of human papillomavirus type 16 (HPV16) complexed with fragments of antibody (Fab) from three different neutralizing monoclonals (mAbs): H16.1A, H16.14J, and H263.A2. The structure-function analysis revealed predominantly monovalent binding of each Fab with capsid interactions that involved multiple loops from symmetry related copies of the major capsid protein. The residues identified in each Fab-virus interface map to a conformational groove on the surface of the capsomer. In addition to the known involvement of the FG and HI loops, the DE loop was also found to constitute the core of each epitope. Surprisingly, the epitope mapping also identified minor contributions by EF and BC loops. Complementary immunological assays included mAb and Fab neutralization. The specific binding characteristics of mAbs correlated with different neutralizing behaviors in pre- and post-attachment neutralization assays. - Highlights: • We present HPV16-Fab complexes from neutralizing mAbs: H16.1A, H16.14J, and H263.A2. • The structure-function analysis revealed predominantly monovalent binding of each mAb. • Capsid–Fab interactions involved multiple loops from symmetry related L1 proteins. • Besides the known FG and HI loops, epitope mapping also identified DE, EF, and BC loops. • Neutralizing assays complement the structures to show multiple neutralization mechanisms.

  14. Production and characterization of a biotinylated single-chain variable fragment antibody for detection of parathion-methyl.

    Science.gov (United States)

    Wang, Huimin; Zhao, Fengchun; Han, Xiao; Yang, Zhengyou

    2016-10-01

    In this article, we reported the development of a biotinylated single-chain variable fragment (scFv) antibody based indirect competitive enzyme-linked immunosorbent assay (IC-ELISA) for parathion-methyl (PM) detection. Firstly, a phage display library was generated using a pre-immunized BALB/C mouse against a specific hapten of PM. After four rounds of panning, the scFv gene fragments were transferred into a secreted expression vector. Then, the scFv antibodies were secreted expressed and screened by IC-ELISA against PM. The selected scFv antibody was fused with a biotin acceptor domain (BAD) and inserted into pET-28a(+) vector for high-level expression in Escherichia coli BL2 (DE3). After optimizing expression conditions, the scFv-BAD antibody was expressed as a soluble protein and biotinylated in vitro by the E. coli biotin ligase (BirA). Subsequently, the biotinylated scFv-BAD antibody was purified with a high yield of 59.2 ± 3.7 mg/L of culture, and was characterized by SDS-PAGE and western blotting. Finally, based on the biotinylated scFv-BAD, a sensitive IC-ELISA for detection of PM was developed, and the 50% inhibition value (IC50) of PM was determined as 14.5 ng/mL, with a limit of detection (LOD, IC10) of 0.9 ng/mL. Cross-reactivity (CR) studies revealed that the scFv antibody showed desirable specificity for PM. PMID:27181246

  15. Regioselective chemical modification of monoclonal antibodies

    Science.gov (United States)

    Ranadive, G.; Rozenzweig, H.S.; Epperly, M.; Bloomer, W.

    1993-05-04

    A method is presented of selectively modifying an immunoglobulin having at least one Fab region and at least one Fc region. Each region has an isoelectric point where the isoelectric point of the Fab fragment of the immunoglobulin is different from the isoelectric point of the Fc fragment of the immunoglobulin. The method comprises of a modification of the immunoglobulin at a pH between the respective isoelectric points of the Fab and Fc fragments of the immunoglobulin.

  16. High throughput ranking of recombinant avian scFv antibody fragments from crude lysates using the Biacore A100.

    Science.gov (United States)

    Leonard, Paul; Säfsten, Pär; Hearty, Stephen; McDonnell, Barry; Finlay, William; O'Kennedy, Richard

    2007-06-30

    Advances in molecular evolution strategies have made it possible to identify antibodies with exquisite specificities and also to fine-tune their biophysical properties for practically any specified application. Depending on the desired function, antibody/antigen interactions can be long-lived or short-lived and, therefore, particular attention is needed when seeking to identify antibodies with specific reaction-rate and affinity properties. Surface plasmon resonance (SPR) biosensors routinely generate sensitive and reliable kinetic data from antibody/antigen interactions for both therapeutic and diagnostic applications. However, many kinetic-based screening assays require rigorous sample preparation and purification prior to analysis. To ameliorate this problem, we developed a rapid and reliable assay for characterising recombinant scFv antibody fragments, directly from crude bacterial lysates. Ninety-six scFv antibodies derived from chickens immunised with C-reactive protein (CRP) were selected by phage display and evaluated using the Biacore A100 protein interaction array system. Antibodies were captured from crude bacterial extracts on the sensor chip surface and ranked based on the percentage of the complex left (% left) after dissociation in buffer. Kinetic rate constants (k(a) and k(d)) and affinity (K(D)) data were obtained for six clones that bound monomeric CRP across a broad affinity range (2.54 x 10(-8) to 3.53 x 10(-10) M). Using this assay format the A100 biosensor yielded high quality kinetic data, permitting the screening of nearly 400 antibody clones per day. PMID:17532001

  17. Chloroquine encapsulated in malaria-infected erythrocyte-specific antibody-bearing liposomes effectively controls chloroquine-resistant Plasmodium berghei infections in mice.

    OpenAIRE

    Owais, M; Varshney, G C; Choudhury, A.; S. Chandra; Gupta, C M

    1995-01-01

    The suitability of liposomes as drug carriers in the treatment of drug-resistant rodent malaria was examined after covalently attaching F(ab')2 fragments of a mouse monoclonal antibody (MAb), MAb F10, raised against the host cell membranes isolated from the Plasmodium berghei-infected mouse erythrocytes, to the liposome surface. The antibody-bearing liposomes thus formed specifically recognized the P. berghei-infected mouse erythrocytes under both in vitro and in vivo conditions. No such spec...

  18. Serum IgG antibodies to C1q in hypocomplementemic urticarial vasculitis syndrome.

    Science.gov (United States)

    Wisnieski, J J; Naff, G B

    1989-09-01

    Urticaria, angioedema, and arthritis are cardinal features of hypocomplementemic urticarial vasculitis syndrome (HUVS). Considered to be an immune complex-mediated disorder, HUVS has been differentiated from systemic lupus erythematosus (SLE), based on its clinical manifestations and the C1q precipitin (C1q-p) reaction, which is manifested as gel precipitation of C1q by a small percentage of HUVS IgG molecules. This phenomenon has been attributed to an Fc region abnormality, and the responsible IgG molecules are said to possess C1q-p activity. We purified IgG from 4 HUVS patients and confirmed that HUVS IgG contains C1q binding activity. F(ab')2 fragments from these patients also bound to C1q, as measured by 2 different C1q binding methods at physiologic ionic strength; HUVS IgG Fc fragments did not bind to C1q. Preincubation of HUVS F(ab')2 fragments with antibody to human F(ab')2 prevented subsequent binding to C1q. We conclude that IgG antibodies to C1q are present in HUVS serum, and it is likely that these antibodies are C1q-p. Because the clinical manifestations of HUVS and the presence of anti-C1q antibodies have been described in patients with SLE, our findings support the concept that HUVS is an autoimmune syndrome related to SLE. PMID:2528353

  19. The Crystal Structure of CD8alpha,Beta in Complex With YTS156.7.7 Fab And Interaction With Other CD8 Antibodies Define the Binding Mode of CD8alpha,Beta to MHC Class I

    Energy Technology Data Exchange (ETDEWEB)

    Shore, D.A.; Issafras, H.; Landais, E.; Teyton, L.; Wilson, I.A.

    2009-05-27

    The CD8{alpha}{beta} heterodimer interacts with class I pMHC on antigen-presenting cells as a co-receptor for TCR-mediated activation of cytotoxic T cells. To characterize this immunologically important interaction, we used monoclonal antibodies (mAbs) specific to either CD8{alpha} or CD8{beta} to probe the mechanism of CD8{alpha}{beta} binding to pMHCI. The YTS156.7 mAb inhibits this interaction and blocks T cell activation. To elucidate the molecular basis for this inhibition, the crystal structure of the CD8{alpha}{beta} immunoglobulin-like ectodomains were determined in complex with mAb YTS156.7 Fab at 2.7 {angstrom} resolution. The YTS156.7 epitope on CD8{beta} was identified and implies that residues in the CDR1 and CDR2-equivalent loops of CD8{beta} are occluded upon binding to class I pMHC. To further characterize the pMHCI/CD8{alpha}{beta} interaction, binding of class I tetramers to CD8{alpha}{beta} on the surface of T cells was assessed in the presence of anti-CD8 mAbs. In contrast to YTS156.7, mAb YTS105.18, which is specific for CD8{alpha}, does not inhibit binding of CD8{alpha}{beta} to class I tetramers, indicating the YTS105.18 epitope is not occluded in the pMHCI/CD8{alpha}{beta} complex. Together, these data indicate a model for the pMHCI/CD8{alpha}{beta} interaction similar to that observed for CD8{alpha}{alpha} in the CD8{alpha}{alpha}/pMHCI complex, but in which CD8{alpha} occupies the lower orientation (membrane proximal to the antigen presenting cell), and CD8{beta} occupies the upper position (membrane distal). The implication of this molecular assembly for the function of CD8{alpha}{beta} in T cell activation is discussed.

  20. Monoclonal Antibody Fragments for Targeting Therapeutics to Growth Plate Cartilage | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The NICHD seeks statements of capability or interest from parties interested in collaborative research to co-develop, evaluate, or commercialize treatment of skeletal disorders using targeting antibodies.

  1. Gluten-specific antibodies of celiac disease gut plasma cells recognize long proteolytic fragments that typically harbor T-cell epitopes.

    Science.gov (United States)

    Dørum, Siri; Steinsbø, Øyvind; Bergseng, Elin; Arntzen, Magnus Ø; de Souza, Gustavo A; Sollid, Ludvig M

    2016-01-01

    This study aimed to identify proteolytic fragments of gluten proteins recognized by recombinant IgG1 monoclonal antibodies generated from single IgA plasma cells of celiac disease lesions. Peptides bound by monoclonal antibodies in complex gut-enzyme digests of gluten treated with the deamidating enzyme transglutaminase 2, were identified by mass spectrometry after antibody pull-down with protein G beads. The antibody bound peptides were long deamidated peptide fragments that contained the substrate recognition sequence of transglutaminase 2. Characteristically, the fragments contained epitopes with the sequence QPEQPFP and variants thereof in multiple copies, and they typically also harbored many different gluten T-cell epitopes. In the pull-down setting where antibodies were immobilized on a solid phase, peptide fragments with multivalent display of epitopes were targeted. This scenario resembles the situation of the B-cell receptor on the surface of B cells. Conceivably, B cells of celiac disease patients select gluten epitopes that are repeated multiple times in long peptide fragments generated by gut digestive enzymes. As the fragments also contain many different T-cell epitopes, this will lead to generation of strong antibody responses by effective presentation of several distinct T-cell epitopes and establishment of T-cell help to B cells. PMID:27146306

  2. Gluten-specific antibodies of celiac disease gut plasma cells recognize long proteolytic fragments that typically harbor T-cell epitopes

    Science.gov (United States)

    Dørum, Siri; Steinsbø, Øyvind; Bergseng, Elin; Arntzen, Magnus Ø.; de Souza, Gustavo A.; Sollid, Ludvig M.

    2016-01-01

    This study aimed to identify proteolytic fragments of gluten proteins recognized by recombinant IgG1 monoclonal antibodies generated from single IgA plasma cells of celiac disease lesions. Peptides bound by monoclonal antibodies in complex gut-enzyme digests of gluten treated with the deamidating enzyme transglutaminase 2, were identified by mass spectrometry after antibody pull-down with protein G beads. The antibody bound peptides were long deamidated peptide fragments that contained the substrate recognition sequence of transglutaminase 2. Characteristically, the fragments contained epitopes with the sequence QPEQPFP and variants thereof in multiple copies, and they typically also harbored many different gluten T-cell epitopes. In the pull-down setting where antibodies were immobilized on a solid phase, peptide fragments with multivalent display of epitopes were targeted. This scenario resembles the situation of the B-cell receptor on the surface of B cells. Conceivably, B cells of celiac disease patients select gluten epitopes that are repeated multiple times in long peptide fragments generated by gut digestive enzymes. As the fragments also contain many different T-cell epitopes, this will lead to generation of strong antibody responses by effective presentation of several distinct T-cell epitopes and establishment of T-cell help to B cells. PMID:27146306

  3. Advancing the global proteome survey platform by using an oriented single chain antibody fragment immobilization approach.

    Science.gov (United States)

    Säll, Anna; Persson, Helena; Ohlin, Mats; Borrebaeck, Carl A K; Wingren, Christer

    2016-09-25

    Increasing the understanding of a proteome and how its protein composition is affected by for example different diseases, such as cancer, has the potential to improve strategies for early diagnosis and therapeutics. The Global Proteome Survey or GPS is a method that combines mass spectrometry and affinity enrichment with the use of antibodies. The technology enables profiling of complex proteomes in a species independent manner. The sensitivity of GPS, and other methods relying on affinity enrichment, is largely affected by the activity of the exploited affinity reagent. We here present an improvement of the GPS platform by utilizing an antibody immobilization approach which ensures a controlled immobilization process of the antibody to the magnetic bead support. More specifically, we make use of an antibody format that enables site-directed biotinylation and use this in combination with streptavidin coated magnetic beads. The performance of the expanded GPS platform was evaluated by profiling yeast proteome samples. We demonstrate that the oriented antibody immobilization strategy increases the ability of the GPS platform and results in larger fraction of functional antibodies. Additionally, we show that this new antibody format enabled in-solution capture, i.e. immobilization of the antibodies after sample incubation. A workflow has been established that permit the use of an oriented immobilization strategy for the GPS platform. PMID:26703809

  4. Gladiolus plants transformed with single-chain variable fragment antibodies to Cucumber mosaic virus

    Science.gov (United States)

    Transgenic plants of Gladiolus ‘Peter Pears’ or ‘Jenny Lee’ were developed that contain single-chain variable fragments (scFv) to Cucumber mosaic virus (CMV) subgroup I or II. The CMV subgroup I heavy and light chain scFv fragments were placed under control of either the duplicated CaMV 35S or suga...

  5. Anti-idiotypic antisera in man. I. Production and immunochemical characterization of anti-idiotypic antisera to human antitetanus antibodies

    International Nuclear Information System (INIS)

    Antisera were raised in rabbits against immunosorbent-purified F(ab')2 fragments of IgG antitetanus toxoid (TT) antibodies obtained from three different donors. The antisera were rendered idiotype specific by absorption with insolubilized TT-nontreactive F(ab')2. The resulting anti-idiotypic antisera precipitated more than 85% of 125I-radiolabeled F(ab')2 anti-TT and were shown to be individual specific in that they reacted only with the immunizing F(ab')2 anti-TT and not with F(ab')2 anti-TT derived from other donors. Anti-idiotypic antiserum inhibited binding of 125I-TT but not of 125I-DT to IgG derived from the donor of the immunizing F(ab')2 anti-TT, but did not inhibit 125I-TT binding to IgG derived from other donors. Finally, binding of 125I-F(ab')2 anti-TT to the anti-idiotypic antiserum was completely inhibited by IgG derived from the same donor but only partially inhibited by a great excess of TT antigen, suggesting that the anti-idiotypic antiserum is recognizing nonantigen-binding idiotypic determinants on F(ab')2 anti-TT. The data presented demonstrate that anti-idiotypic heteroantisera can be successfully raised against human antibodies to TT, indicate minimal cross-reactivity of idiotypic determinants between unrelated individuals, and suggest the presence of nonantigen binding-idiotypic determinants on the antibody molecule

  6. Development of single chain variable fragment (scFv) antibodies against surface proteins of 'Ca. Liberibacter asiaticus'.

    Science.gov (United States)

    Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Minenkova, Olga; Hartung, John

    2016-03-01

    'Candidatus Liberibacter asiaticus' is the causal agent of citrus huanglongbing, the most serious disease of citrus worldwide. We have developed and applied immunization and affinity screening methods to develop a primary library of recombinant single chain variable fragment (scFv) antibodies in an M13 vector, pKM19. The antibody population is enriched for antibodies that bind antigens of 'Ca. Liberibacter asiaticus'. The primary library has more than 10(7) unique antibodies and the genes that encode them. We have screened this library for antibodies that bind to specifically-chosen proteins that are present on the surface of 'Ca. Liberibacter asiaticus'. These proteins were used as targets for affinity-based selection of scFvs that bind to the major outer membrane protein, OmpA; the polysaccharide capsule protein KpsF; a protein component of the type IV pilus (CapF); and, two flagellar proteins FlhA and FlgI. These scFvs have been used in ELISA and dot blot assays against purified protein antigens and 'Ca. Liberibacter asiaticus' infected plant extracts. We have also recloned many of these scFvs into a plasmid expression vector designed for the production of scFvs. Screening of these scFvs was more efficient when phage-bound, rather than soluble scFvs, were used. We have demonstrated a technology to produce antibodies at will and against any protein target encoded by 'Ca. Liberibacter asiaticus'. Applications could include advanced diagnostic methods for huanglongbing and the development of immune labeling reagents for in planta applications. PMID:26744234

  7. Codon-Precise, Synthetic, Antibody Fragment Libraries Built Using Automated Hexamer Codon Additions and Validated through Next Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Laura Frigotto

    2015-05-01

    Full Text Available We have previously described ProxiMAX, a technology that enables the fabrication of precise, combinatorial gene libraries via codon-by-codon saturation mutagenesis. ProxiMAX was originally performed using manual, enzymatic transfer of codons via blunt-end ligation. Here we present Colibra™: an automated, proprietary version of ProxiMAX used specifically for antibody library generation, in which double-codon hexamers are transferred during the saturation cycling process. The reduction in process complexity, resulting library quality and an unprecedented saturation of up to 24 contiguous codons are described. Utility of the method is demonstrated via fabrication of complementarity determining regions (CDR in antibody fragment libraries and next generation sequencing (NGS analysis of their quality and diversity.

  8. Bivalent fragment of the ior-CEA1 antibody. A challenge to the positive CEA tumors radioimmunotherapy

    International Nuclear Information System (INIS)

    The directed radiotherapy of the solid tumors with fragments recombinants of radiolabelled antibodies is a topic of current investigation, so much at preclinical level as clinical. This work describes the preclinical characterization of a new fragment type diabody of the AcMo ior CEA1 that has been labelled with 131 I for their use in the diagnosis and the therapy of CEA positive tumors. The radiolabelling methodology used allows the incorporation of more than 90% of the radio iodine to the molecule without committing the capacity of recognition of its antigen significantly. The combination of the favourable properties pharmacy kinetic and high selective accumulation in the tumor, they make of the diabody anti CEA an appropriate candidate for the radioimmunodiagnosis and the radioimmunotherapy of tumors that expresses CEA (Author)

  9. Recombinant anti-CD20 antibody fragments for microPET imaging of B-cell lymphoma

    Science.gov (United States)

    Olafsen, Tove; Betting, David; Kenanova, Vania E.; Salazar, Felix B.; Clarke, Pat; Said, Jonathan; Raubitschek, Andrew A.; Timmerman, John M.; Wu, Anna M.

    2010-01-01

    The CD20 cell surface antigen is expressed at high levels by over 90% of B cell non-Hodgkin lymphomas (NHL), and is the target of the anti-CD20 monoclonal antibody rituximab. To provide more sensitive, tumor-specific positron emission tomography (PET) imaging of NHL, we sought to develop PET imaging agents targeting CD20. Methods Two recombinant anti-CD20 rituximab fragments, a minibody (scFv-CH3 dimer, 80 kDa) and a modified scFv-Fc fragment (105 kDa), designed to clear rapidly, were generated. Both fragments were radiolabeled with 124I, and the minibody was additionally radiometal labeled with 64Cu following conjugation to 1,4,7,10-tetraazacyclododecane-N,N’,N’’,N’’’-tetraacetic acid (DOTA). The radioiodinated fragments and the radiometal labeled minibody were evaluated in mice as microPET imaging agents for in vivo imaging of human CD20-expressing lymphomas. Results Rapid and specific localization to CD20-positive tumors was observed with the radioiodinated fragments. However, their tumor uptakes and blood activities differed, resulting in different levels of contrast in the images. The best candidate was the minibody, with superior uptake (2-fold higher than the scFv-Fc) in CD20-positive tumor and low uptake in CD20-negative tumor. Positive tumor to negative tumor ratios were 7.0(±3.1) and 3.9(±0.7) for the minibody and scFv-Fc, respectively at 21 hours. About a 5-fold lower ratio was achieved with the 64Cu-DOTA-minibody at 19 hours due to higher residual background activity in CD20 negative tumor. Conclusion Radioiodinated minibody and scFv-Fc fragment produced excellent, high-contrast images in vivo. These new immunoPET agents may prove useful for the imaging CD20 positive lymphomas in preclinical models and in humans with NHL. PMID:19690034

  10. Recombinant Human IgG antibodies against Human Cytomegalovirus

    Institute of Scientific and Technical Information of China (English)

    TAO DUAN; XIAO-FANG WANG; SHU-YUAN XIAO; SHU-YAN GU; MI-FANG LIANG

    2008-01-01

    Objective To study the passive immunization with human monoclonal antibodies as for prophylaxis of human eytomegalovirus (HCMV) infection. Methods Fab monochinal antibodies to HCMV were recovered by repertoire cloning of mRNA from a HCMV infected individual. Antigen binding specificity, CDR sequence of Vhand Vland neutralizing activity on HCMV AD169 stain were analyzed in vitro. The light and heavy chain Fd fragment genes of Fab antibodies were further cloned into a recombinant baculovirus expression vector pAC-κ-Fc to express intact IgG. Secreted products were purified with affinity chromatography using protein G. Results SDS-PAGE and Western blot confirmed the expression of the intact IgG. Immuno-blotting and -precipitation were used to identify HCMV proteins. One Fab monoclonal antibodyrecognized a conformational HCMV protein. Conclusion IgG antibodies can neutralize the HCMV AD169 strain efficiently at a titer of 2.5 μg/mL and may prove valuable for passive immunoprophylaxis against HCMV infection in humans.

  11. A Potent and Broad Neutralizing Antibody Recognizes and Penetrates the HIV Glycan Shield

    Energy Technology Data Exchange (ETDEWEB)

    Pejchal, Robert; Doores, Katie J.; Walker, Laura M.; Khayat, Reza; Huang, Po-Ssu; Wang, Sheng-Kai; Stanfield, Robyn L.; Julien, Jean-Philippe; Ramos, Alejandra; Crispin, Max; Depetris, Rafael; Katpally, Umesh; Marozsan, Andre; Cupo, Albert; Maloveste, Sebastien; Liu, Yan; McBride, Ryan; Ito, Yukishige; Sanders, Rogier W.; Ogohara, Cassandra; Paulson, James C.; Feizi, Ten; Scanlan, Christopher N.; Wong, Chi-Huey; Moore, John P.; Olson, William C.; Ward, Andrew B.; Poignard, Pascal; Schief, William R.; Burton, Dennis R.; Wilson, Ian A. (UWASH); (Progenics); (ICL); (Weill-Med); (NIH); (JSTA); (Scripps); (Oxford)

    2015-10-15

    The HIV envelope (Env) protein gp120 is protected from antibody recognition by a dense glycan shield. However, several of the recently identified PGT broadly neutralizing antibodies appear to interact directly with the HIV glycan coat. Crystal structures of antigen-binding fragments (Fabs) PGT 127 and 128 with Man{sub 9} at 1.65 and 1.29 angstrom resolution, respectively, and glycan binding data delineate a specific high mannose-binding site. Fab PGT 128 complexed with a fully glycosylated gp120 outer domain at 3.25 angstroms reveals that the antibody penetrates the glycan shield and recognizes two conserved glycans as well as a short {beta}-strand segment of the gp120 V3 loop, accounting for its high binding affinity and broad specificify. Furthermore, our data suggest that the high neutralization potency of PGT 127 and 128 immunoglobulin Gs may be mediated by cross-linking Env trimers on the viral surface.

  12. Cell-Free Synthesis Meets Antibody Production: A Review

    Directory of Open Access Journals (Sweden)

    Marlitt Stech

    2015-01-01

    Full Text Available Engineered antibodies are key players in therapy, diagnostics and research. In addition to full size immunoglobulin gamma (IgG molecules, smaller formats of recombinant antibodies, such as single-chain variable fragments (scFv and antigen binding fragments (Fab, have emerged as promising alternatives since they possess different advantageous properties. Cell-based production technologies of antibodies and antibody fragments are well-established, allowing researchers to design and manufacture highly specific molecular recognition tools. However, as these technologies are accompanied by the drawbacks of being rather time-consuming and cost-intensive, efficient and powerful cell-free protein synthesis systems have been developed over the last decade as alternatives. So far, prokaryotic cell-free systems have been the focus of interest. Recently, eukaryotic in vitro translation systems have enriched the antibody production pipeline, as these systems are able to mimic the natural pathway of antibody synthesis in eukaryotic cells. This review aims to overview and summarize the advances made in the production of antibodies and antibody fragments in cell-free systems.

  13. PRODUCTION OF PHAGE-DISPLAYED ANTI-IDIOTYPIC ANTIBODY SINGLE CHAIN VARIABLE FRAGMENTS TO MG7 MONOCLONAL ANTIBODY DIRECTED AGAINST GASTRIC CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    何凤田; 聂勇战; 陈宝军; 乔太东; 韩者艺; 樊代明

    2002-01-01

    Objective. To generate phage-displayed anti-idiotypic antibody single chain variable fragments (anti -Id ScFv) to MG7 monoclonal antibody (McAb) directed against gastric carcinoma so as to lay a foundation for developing anti-Id ScFv vaccine of the cancer.Methods. Balb/c mice were immunized i. p. with MG7 McAb conjugated with keyhole limpet hemocyanin (KLH), and mRNA was isolated from the spleens of the immunized mice. Heavy and light chain (VH and VL)genes of antibody were amplified separately and assembled into ScFv genes with a linker DNA by PCR. The ScFv genes were ligated into the phagemid vector pCANTAB5E and the ligated sample was transformed into competent E. coli TG1. The transformants were infected with M13KO7 helper phage to yield recombinant phages displaying ScFv on the tips of M13 phage. After 4 rounds of panning with MG7, the MG7-positive clones were selected by ELISA from the enriched phages. Thetypesoftheanti-IdScFvdisplayedontheselectedphagecloneswerepreliminarily identified by competition ELISA.Results. The VH, VL and ScFv DNAs were about 340 bp, 320 bp and 750 bp respectively. Twenty-four MG7-positive clones were selected from 60 enriched phage clones, among which 5 displayed β or γtype anti-Id ScFv.Conclsion. The anti-Id ScFv to MG7 McAb can be successfully selected by recombinant phage antibody technique, which paves a way for the study of prevention and cure of gastric carcinoma by using anti-Id ScFv.

  14. Development and characterization of synthetic antibodies binding to the cystic fibrosis conductance regulator.

    Science.gov (United States)

    Gakhal, Amandeep K; Jensen, Timothy J; Bozoky, Zoltan; Roldan, Ariel; Lukacs, Gergely L; Forman-Kay, Julie; Riordan, John R; Sidhu, Sachdev S

    2016-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel in the apical surface of epithelial cells in the airway and gastrointestinal tract, and mutation of CFTR is the underlying cause of cystic fibrosis. However, the precise molecular details of the structure and function of CFTR in native and disease states remains elusive and cystic fibrosis researchers are hindered by a lack of high specificity, high affinity binding reagents for use in structural and biological studies. Here, we describe a panel of synthetic antigen-binding fragments (Fabs) isolated from a phage-displayed library that are specific for intracellular domains of CFTR that include the nucleotide-binding domains (NBD1 and NBD2), the R-region, and the regulatory insertion loop of NBD1. Binding assays performed under conditions that promote the native fold of the protein demonstrated that all Fabs recognized full-length CFTR. However, only the NBD1-specific Fab recognized denatured CFTR by western blot, suggesting a conformational epitope requirement for the other Fabs. Surface plasmon resonance experiments showed that the R-region Fab binds with high affinity to both the phosphorylated and unphosphorylated R-region. In addition, NMR analysis of bound versus unbound R-region revealed a distinct conformational effect upon Fab binding. We further defined residues involved with antibody recognition using an overlapping peptide array. In summary, we describe methodology complementary to previous hybridoma-based efforts to develop antibody reagents to CFTR, and introduce a synthetic antibody panel to aid structural and biological studies. PMID:27185291

  15. Anti-(U1) small nuclear RNA antibodies in anti-small nuclear ribonucleoprotein sera from patients with connective tissue diseases.

    OpenAIRE

    van Venrooij, W J; Hoet, R; Castrop, J.; Hageman, B; Mattaj, I W; van de Putte, L B

    1990-01-01

    Small nuclear ribonucleoprotein (snRNP) particles are a class of RNA-containing particles in the nucleus of eukaryotic cells. Sera from patients with connective tissue diseases often contain antibodies against the proteins present in these snRNPs. Antibodies against the RNA components of snRNPs, the U snRNAs, are thought to be rare. We tested 118 anti-snRNP sera for the presence of anti-snRNA antibodies and found them in 45 sera (38%). In all sera the antibodies (IgG and F(ab)2 fragments ther...

  16. Antibody Derived Peptides for Detection of Ebola Virus Glycoprotein.

    Directory of Open Access Journals (Sweden)

    Luis Mario Rodríguez-Martínez

    Full Text Available Current Ebola virus (EBOV detection methods are costly and impractical for epidemic scenarios. Different immune-based assays have been reported for the detection and quantification of Ebola virus (EBOV proteins. In particular, several monoclonal antibodies (mAbs have been described that bind the capsid glycoprotein (GP of EBOV GP. However, the currently available platforms for the design and production of full-length mAbs are cumbersome and costly. The use of antibody fragments, rather than full-length antibodies, might represent a cost-effective alternative for the development of diagnostic and possibly even therapeutic alternatives for EBOV.We report the design and expression of three recombinant anti-GP mAb fragments in Escherichia coli cultures. These fragments contained the heavy and light variable portions of the three well-studied anti-GP full-length mAbs 13C6, 13F6, and KZ52, and are consequently named scFv-13C6, scFv-13F6, and Fab-KZ52, respectively. All three fragments exhibited specific anti-GP binding activity in ELISA experiments comparable to that of full-length anti-GP antibodies (i.e., the same order of magnitude and they are easily and economically produced in bacterial cultures.Antibody fragments might represent a useful, effective, and low cost alternative to full-length antibodies in Ebola related capture and diagnostics applications.

  17. A chimera of green fluorescent protein with single chain variable fragment antibody against ginsenosides for fluorescence-linked immunosorbent assay.

    Science.gov (United States)

    Sakamoto, Seiichi; Tanizaki, Yusuke; Pongkitwitoon, Benyakan; Tanaka, Hiroyuki; Morimoto, Satoshi

    2011-05-01

    A chimera of green fluorescent protein extracted from Aequorea coerulescens (AcGFP), a mutant that has been codon optimized for mammalian expression, with single-chain variable fragment (scFv) antibody against ginsenoside Re (GRe-scFv), named fluobody, has been successfully expressed in Escherichia coli (E. coli) to develop simple, speedy, and sensitive fluorescence-linked immunosorbent assay (FLISA). Two chimera proteins were constructed to contain GRe-scFv at the C-terminus of AcGFP (C-fluobody) and at the N-terminus of AcGFP (N-fluobody). These fluobodies were then purified by ion metal affinity chromatography and refolded by stepwise dialysis. The characterization of both fluobodies revealed that C-fluobody was found to be appropriate probe for FLISA as compare with N-fluobody. Furthermore, improvement of limit of detection (LOD) was observed in FLISA using C-fluobody (10 ng/mL) due to its strong fluorescence intensity of AcGFP compared with conventional enzyme-linked immunosorbent assay (ELISA) using parental monoclonal antibody against ginsenoside Re (G-Re), MAb-4G10 (100 ng/mL). Since some steps required in ELISA can be avoided in this present FLISA, speedy and sensitive immunoassay also could be performed using fluobody instead of monoclonal antibody and scFv. PMID:21277981

  18. Lymphoma, melanoma, colon cancer: diagnosis and treatment with radiolabeled monoclonal antibodies. The 1986 Eugene P. Pendergrass New Horizons Lecture

    International Nuclear Information System (INIS)

    The development of monoclonal antibodies for use as in vivo carriers of radioactivity for diagnosis and therapy of malignant neoplasms is proceeding rapidly within academic and commercial sectors. The author and his colleagues studied anticancer antibodies formed against tumors of both somatic and hematopoietic origins. Several general principles have been established with the work with somatic tumors, including the following: Improved tumor-to-normal-tissue ratios can be achieved with Fab fragments as opposed to whole IgG; each antitumor antibody has a characteristic biodistribution in humans that cannot be readily predicted from tissue or small animal studies; and for many antibodies, there is a strong dependency of tumor uptake on total mass amount of antibody administered (greater uptake with greater mass dose). Initial work with iodine-131 labeled Fab fragments of the antimelanoma antibodies, 96.5 and 48-7, documented that tumor uptake was broadly proportional to antigen content of the tumors and that under optimal conditions, some tumors were sufficiently loaded with radiolabeled antibody to serve as radiation therapy. The antitumor antibody B-72.3, as IgG, has been particularly promising when administered intraperitoneally. In ten patients who were administered I-131 B-72.3 via a Tenkhoff catheter, the sensitivity and specificity of tumor location were excellent for peritoneal implants, and in three of these patients, surgically confirmed tumor was seen with the radiolabeled antibody technique when abdominal computed tomography and magnetic resonance studies were negative

  19. Production of biologically active scFv and VHH antibody fragments in Bifidobacterium longum.

    Science.gov (United States)

    Shkoporov, A N; Khokhlova, E V; Savochkin, K A; Kafarskaia, L I; Efimov, B A

    2015-06-01

    Bifidobacteria constitute a significant part of healthy intestinal microbiota in adults and infants and present a promising platform for construction of genetically modified probiotic agents for treatment of gastrointestinal disorders. In this study, three strains of Bifidobacterium longum were constructed that express and secrete biologically active single-chain antibodies against human TNF-α and Clostridium difficile exotoxin A. Anti-TNF-α scFv antibody D2E7 was produced at the level of 25 μg L(-1) in broth culture and was mostly retained in the cytoplasm, while VHH-type antibodies A20.1 and A26.8 against C. difficile exotoxin A were produced at the levels of 0.3-1 mg L(-1) and secreted very efficiently. The biological activity of both antibody types was demonstrated in the mammalian cell-based assays. Expression of A20.1 and A26.8 was also observed in vivo after intragastric administration of transformed B. longum strains to (C57/BL6 × DBA/2)F1 mice. The obtained B. longum strains may serve as prototypes for construction of novel probiotic medications against inflammatory bowel disease and C. difficile-associated disease. PMID:25994292

  20. Radioiodination and biodistribution of the monoclonal antibody TU-20 and its scFv fragment

    Czech Academy of Sciences Publication Activity Database

    Kleinová, Veronika; Chaloupková, H.; Švecová, Helena; Fišer, Miroslav

    2010-01-01

    Roč. 286, č. 3 (2010), s. 847-851. ISSN 0236-5731 R&D Projects: GA AV ČR IBS1048301 Institutional research plan: CEZ:AV0Z10480505 Keywords : Monoclonal antibody TU-20 * ScFv TU-20 * Radiolabeling Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 0.777, year: 2010

  1. Crystallization and molecular-replacement studies of the monoclonal antibody mAbR310 specific for the (R)-HNE-modified protein

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Sohei, E-mail: itosohei@u-shizuoka-ken.ac.jp [Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-Ku, Shizuoka 422-8526 (Japan); Tatsuda, Emi [Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601 (Japan); Ishino, Kousuke; Suzuki, Kenichiro; Sakai, Hiroshi [Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-Ku, Shizuoka 422-8526 (Japan); Uchida, Koji [Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601 (Japan); Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-Ku, Shizuoka 422-8526 (Japan)

    2006-06-01

    Antigen-free Fab fragment of mAbR310, which recognizes (R)-HNE modified protein, has been crystallized. Initial phases have been obtained by molecular replacement. 4-Hydroxy-2-nonenal (HNE), a major racemic product of lipid peroxidation, reacts with histidine to form a stable HNE–histidine Michael addition-type adduct possessing three chiral centres in the cyclic hemiacetal structure. Monoclonal antibodies against HNE-modified protein have been widely used for assessing oxidative stress in vitro and in vivo. Here, the purification, crystallization and preliminary crystallographic analysis of a Fab fragment of novel monoclonal antibody R310 (mAbR310), which recognizes (R)-HNE-modified protein, are reported. The Fab fragment of mAbR310 was obtained by digestion with papain, purified and crystallized. Using hanging-drop vapour-diffusion crystallization techniques, crystals of mAbR310 Fab were obtained. The crystal belongs to the monoclinic space group C2 (unit-cell parameters a = 127.04, b = 65.31, c = 64.29 Å, β = 118.88°) and diffracted X-rays to a resolution of 1.84 Å. The asymmetric unit contains one molecule of mAbR310, with a corresponding crystal volume per protein weight of 2.51 Å{sup 3} Da{sup −1} and a solvent content of 51.0%.

  2. Development of single chain variable fragment (scFv) antibodies against Xylella fastidiosa subsp. pauca by phage display.

    Science.gov (United States)

    Yuan, Qing; Jordan, Ramon; Brlansky, Ronald H; Istomina, Olga; Hartung, John

    2015-10-01

    Xylella fastidiosa is a member of the gamma proteobacteria. It is fastidious, insect-vectored and xylem-limited and causes a variety of diseases, some severe, on a wide range of economically important perennial crops, including grape and citrus. Antibody based detection assays are commercially available for X. fastidiosa, and are effective at the species, but not at the subspecies level. We have made a library of scFv antibody fragments directed against X. fastidiosa subsp. pauca strain 9a5c (citrus) by using phage display technology. Antibody gene repertoires were PCR-amplified using 23 primers for the heavy chain variable region (V(H)) and 21 primers for the light chain variable region (V(L)). The V(H) and V(L) were joined by overlap extension PCR, and then the genes of the scFv library were ligated into the phage vector pKM19. The library contained 1.2×10(7) independent clones with full-length scFv inserts. In each of 3cycles of affinity-selection with 9a5c, about 1.0×10(12) phage were used for panning with 4.1×10(6), 7.1×10(6), 2.1×10(7) phage recovered after the first, second and third cycles, respectively. Sixty-six percent of clones from the final library bound X. fastidiosa 9a5c in an ELISA. Some of these scFv antibodies recognized strain 9a5c and did not recognize X. fastidiosa strains that cause Pierce's disease of grapevine. PMID:26232710

  3. Tumor therapy with an antibody-targeted superantigen generates a dichotomy between local and systemic immune responses.

    OpenAIRE

    Litton, M. J.; Dohlsten, M; Hansson, J.; Rosendahl, A; Ohlsson, L.; Kalland, T; Andersson, J; Andersson, U.

    1997-01-01

    Repeated injections of a fusion protein containing the superantigen staphylococcal enterotoxin A (SEA) combined with a Fab fragment of a tumor-specific antibody is a highly efficient immunotherapy for mice expressing lung melanoma micrometastasis. In the present study, the systemic and local immune responses generated by this therapy were analyzed at a cellular level. Two distinct but coupled immune reactions occurred after repeated therapy. Tumor necrosis factor and macrophage inflammatory p...

  4. A novel method for in Situ detection of hydrolyzable casein fragments in a cheese matrix by antibody phage display technique and CLSM

    DEFF Research Database (Denmark)

    Duan, Zhi; Brüggemann, Dagmar Adeline; Siegumfeldt, Henrik

    2009-01-01

    A novel method to monitor in situ hydrolyzable casein fragments during cheese ripening by using immunofluorescent labeling and confocal laser scanning microscopy (CLSM) was developed. Monoclonal single chain variable fragments of antibody (scFvs) were generated by antibody phage display toward...... three small synthetic peptides of the alpha(s1)-casein sequence. These peptides traverse enzymatic cleavage sites of casein during cheese ripening. The specificity of the generated anti-peptide antibodies was determined by ELISA and Western blot. Finally, an immunofluorescent labeling protocol was...... successfully developed for the detection of scFvs binding to different alpha(s1)-casein fragments inside a cheese matrix by CLSM. To our knowledge, this is the first demonstrated immunofluorescent labeling method for in situ analysis of proteolysis phenomena in the cheese matrix. Additionally, this technique...

  5. Generation of recombinant antibody fragments with toxin-neutralizing potential in loxoscelism.

    Science.gov (United States)

    Karim-Silva, Sabrina; Moura, Juliana de; Noiray, Magali; Minozzo, Joao Carlos; Aubrey, Nicolas; Alvarenga, Larissa M; Billiald, Philippe

    2016-08-01

    Loxosceles spider bites often lead to serious envenomings and no definite therapy has yet been established. In such a context, it is of interest to consider an antibody-based targeted therapy. We have previously prepared a murine monoclonal IgG (LiMab7) that binds to 32-35kDa components of Loxosceles intermedia venom and neutralizes the dermonecrotic activity of the venom. Here, we re-engineered LiMab7 into a recombinant diabody. The protein was produced in bacteria and then it was functionally characterized. It proved to be efficient at neutralizing sphingomyelinase and hemolytic activities of the crude venom despite the slightly altered binding kinetic constants and the limited stability of the dimeric configuration. This is the first report of a specific recombinant antibody for a next-generation of Loxosceles antivenoms. PMID:27288291

  6. Noninvasive brain cancer imaging with a bispecific antibody fragment, generated via click chemistry

    OpenAIRE

    Luo, Haiming; Hernandez, Reinier; Hong, Hao; Graves, Stephen A.; Yang, Yunan; England, Christopher G.; Theuer, Charles P.; Robert J. Nickles; Cai, Weibo

    2015-01-01

    Given the success of combination therapies for the treatment of cancer, the use of bispecific antibodies targeting multiple cancerous molecular pathways is an attractive strategy to enhance the efficacy of current therapeutic paradigms. However, parallel development of companion diagnostic tools is essential for patient identification, stratification, and the early assessment of treatment efficacies. Herein, we describe the generation of a bispecific construct for noninvasive PET imaging of g...

  7. Small animal PET imaging of TAG-72 expressing tumor using 68Ga-NOTA-3E8 Fab radioimmunoconjugate

    International Nuclear Information System (INIS)

    The tumor-associated glycoprotein TAG-72 is express ed in the majority of human adenocarcinomas but is rarely expressed in most normal tissues, which makes it a potential target for the diagnosis and therapy of a variety of human cancer. 3E8 is anti-TAG-72 humanized antibody. Antibody fragments have some advantages such as improved pharmacokinetics and reduced immunogenicity compared to whole IgG. 68Ga is a short-lived positron emitter (t1/268 min; β+, 88%) that is produced, independent from a cyclotron, by a 68Ge/68Ga generator. The parent nuclide 68Ge has a long half-life (270.8 day), allowing its use as a generator for more than 1 year. A 68Ga is labeled with antibodies through bifunctional chelators, which allows possible kit formulation and which wide availability of the nuclear imaging agents. In this study, Fab fragment of anti-TAG-72 humanized Ab (3E8) was conjugated with 2-(p-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4, 7-triacetic acid (p-SCN-Bn-NOTA) and radiolabeled with 68Ga and acquire small animal PET image

  8. Targeting Prostate Cancer Cells In Vivo Using a Rapidly Internalizing Novel Human Single-Chain Antibody Fragment

    Science.gov (United States)

    He, Jiang; Wang, Yong; Feng, Jinjin; Zhu, Xiaodong; Lan, Xiaoli; Iyer, Arun K.; Zhang, Niu; Seo, Youngho; VanBrocklin, Henry F.; Liu, Bin

    2010-01-01

    Human antibodies targeting prostate cancer cell surface epitopes may be useful for imaging and therapy. The objective of this study was to evaluate the tumor targeting of an internalizing human antibody fragment, a small-size platform, to provide high contrast in a mouse model of human prostate carcinoma. Methods A prostate tumor-targeting single-chain antibody fragment (scFv), UA20, along with a nonbinding control scFv, N3M2, were labeled with 99mTc and evaluated for binding and rapid internalization into human prostate tumor cells in vitro and tumor homing in vivo using xenograft models. For the in vitro studies, the labeled UA20 scFv was incubated at 37°C for 1 h with metastatic prostate cancer cells (DU145) to assess the total cellular uptake versus intracellular uptake. For the animal studies, labeled UA20 and N3M2 scFvs were administered to athymic mice implanted subcutaneously with DU145 cells. Mice were imaged with small-animal SPECT/CT with concomitant biodistribution at 1 and 3 h after injection. Results The UA20 scFv was labeled in 55%–65% yield and remained stable in phosphate buffer within 24 h. The labeled UA20 scFv was taken up specifically by prostate tumor cells. Internalization was rapid, because incubation at 37°C for less than 1 h resulted in 93% internalization of total cell-associated scFvs. In animal studies, SPECT/CT showed significant tumor uptake as early as 1 h after injection. At 3 h after injection, tumor uptake was 4.4 percentage injected dose per gram (%ID/g), significantly greater than all organs or tissues studied (liver, 2.7 %ID/g; other organs or tissues, <1 %ID/g), except the kidneys (81.4 %ID/g), giving tumor-to-blood and tumor-to-muscle ratios of 12:1 and 70:1, respectively. In contrast, the control antibody exhibited a tumor uptake of only 0.26 %ID/g, similar to that of muscle and fat. Tumor-specific targeting was evidenced by reduced tumor uptake of nearly 70% on administration of a 10-fold excess of unlabeled UA20 sc

  9. Pegylated Trastuzumab Fragments Acquire an Increased in Vivo Stability but Show a Largely Reduced Affinity for the Target Antigen

    Science.gov (United States)

    Selis, Fabio; Focà, Giuseppina; Sandomenico, Annamaria; Marra, Carla; Di Mauro, Concetta; Saccani Jotti, Gloria; Scaramuzza, Silvia; Politano, Annalisa; Sanna, Riccardo; Ruvo, Menotti; Tonon, Giancarlo

    2016-01-01

    PEGylation of biomolecules is a major approach to increase blood stream half-life, stability and solubility of biotherapeutics and to reduce their immunogenicity, aggregation potential and unspecific interactions with other proteins and tissues. Antibodies have generally long half-lives due to high molecular mass and stability toward proteases, however their size lowers to some extent their potential because of a reduced ability to penetrate tissues, especially those of tumor origin. Fab or otherwise engineered smaller fragments are an alternative but are less stable and are much less well retained in circulation. We have here investigated the effects of various PEGylations on the binding properties and in vivo half-life of Fab fragments derived from the enzymatic splitting of Trastuzumab. We find that PEGylation increases the half-life of the molecules but also strongly affects the ability to recognize the target antigen in a way that is dependent on the extent and position of the chemical modification. Data thus support the concept that polyethylene glycol (PEG) conjugation on Trastuzumab Fabs increases half-life but reduces their affinity and this is a fine balance, which must be carefully considered for the design of strategies based on the use of antibody fragments. PMID:27043557

  10. Rainbow trout surviving infections of viral haemorrhagic septicemia virus (VHSV) show lasting antibodies to recombinant G protein fragments

    DEFF Research Database (Denmark)

    Encinas, P.; Gomez-Casado, E.; Grandes, Fregeneda;

    2011-01-01

    Rainbow trout antibodies (Abs) binding to recombinant fragments (frgs) derived from the protein G of the viral haemorrhagic septicemia virus (VHSV)-07.71 strain, could be detected by ELISA (frg-ELISA) in sera from trout surviving laboratory-controlled infections. Abs were detected not only by using...... sera from trout infected with the homologous VHSV isolate but also with the VHSV-DK-201433 heterologous isolate, which had 13 amino acid changes. Sera from healthy trout and/or from trout surviving infectious haematopoietic necrosis virus (IHNV) infection, were used to calculate cut-off absorbances to...... differentiate negative from positive sera. Specific anti-VHSV Abs could then be detected by using any of the following frgs: frg11 (56–110), frg15 (65–250), frg16 (252–450) or G21-465. While high correlations were found among the ELISA values obtained with the different frgs, no correlations between any frg...

  11. Preparation and development of equine hyperimmune globulin F(ab')2 against severe acute respiratory syndrome coronavirus

    Institute of Scientific and Technical Information of China (English)

    Jia-hai LU; Bing L WONG; Nan-shan ZHONG; Zhong-min GUO; Wen-yu HAN; Guo-ling WANG; Ding-mei ZHANG; Yi-fei WANG; Sheng-yun SUN; Qin-he YANG; Huan-ying ZHENG

    2005-01-01

    Aim: The resurgence of severe acute respiratory syndrome (SARS) is still a threat because the causative agent remaining in animal reservoirs is not fully understood,and sporadic cases continue to be reported. Developing high titers of anti-SARS hyperimmune globulin to provide an alternative pathway for emergent future prevention and treatment of SARS. Methods: SARS coronavirus (CoV)F69 (AY313906)and Z2-Y3 (AY394989) were isolated and identified from 2 different Cantonese onset SARS patients. Immunogen was prepared from SARS-CoV F69 strain. Six health horses were immunized 4 times and serum was collected periodically to measure the profile of specific IgG and neutralizing antibodies using indirect enzyme-linked immunosorbent assay and a microneutralization test. Sera were collected in large amounts at the peak, where IgG was precipitated using ammonium sulphate and subsequently digested with pepsin. The product was then purified using anion-exchange chromatography to obtain F(ab')2 fragments. Results: The specific IgG and neutralizing antibody titers peaked at approximately week 7 after the first immunization, with a maximum value of 1:14210. The sera collected at the peak were then purified. Fragment of approximately 15 g F(ab')2 was obtained from 1 litre antiserum and the purity was above 90% with the titer of 1:5120, which could neutralize the other strain (SARS-CoV Z2-Y3) as well. Conclusion: This research provides a viable strategy for the prevention and treatment of SARS coronavirus infection with equine hyperimmune globulin, with the purpose of combating any resurgence of SARS.

  12. The role of indium-111 antimyosin (Fab) imaging as a noninvasive surveillance method of human heart transplant rejection

    International Nuclear Information System (INIS)

    The identification of rejection after heart transplantation in patients receiving cyclosporine immunosuppressive therapy requires the endomyocardial biopsy, an invasive method associated with a finite morbidity. To evaluate the role of indium-111 antimyosin (Fab) scintigraphy as a noninvasive surveillance method of heart transplant rejection, the Fab fragment of murine monoclonal antimyosin antibodies labeled with indium-111 was administered intravenously in 30 scintigraphic studies to 10 consecutive heart transplant recipients. Endomyocardial biopsy specimens were obtained 72 hours after each scintigraphic study. Nineteen scintigraphic studies had negative findings; no false negative finding was obtained. Eleven antimyosin scintigraphic studies had positive findings, and in these studies endomyocardial biopsy revealed mild rejection in two cases, moderate acute rejection with myocyte necrosis in two cases, myocyte necrosis as a consequence of ischemic injury in six cases, and possibly cytotoxic damage in one case. Antimyosin scintigraphy may represent a reliable screening method for the surveillance of heart transplant patients. In the presence of a negative finding from antimyosin scintigraphy, it may be possible to avoid endomyocardial biopsy. Conversely, in patients who have a positive finding from antimyosin scintigraphy, the endomyocardial biopsy is mandatory to establish the definitive diagnosis by histologic examination of the myocardium

  13. The role of indium-111 antimyosin (Fab) imaging as a noninvasive surveillance method of human heart transplant rejection

    Energy Technology Data Exchange (ETDEWEB)

    De Nardo, D.; Scibilia, G.; Macchiarelli, A.G.; Cassisi, A.; Tonelli, E.; Papalia, U.; Gallo, P.; Antolini, M.; Pitucco, G.; Reale, A. (Universita degli Studi di Roma I La Sapienza Policlinico Umberto I (Italy))

    1989-09-01

    The identification of rejection after heart transplantation in patients receiving cyclosporine immunosuppressive therapy requires the endomyocardial biopsy, an invasive method associated with a finite morbidity. To evaluate the role of indium-111 antimyosin (Fab) scintigraphy as a noninvasive surveillance method of heart transplant rejection, the Fab fragment of murine monoclonal antimyosin antibodies labeled with indium-111 was administered intravenously in 30 scintigraphic studies to 10 consecutive heart transplant recipients. Endomyocardial biopsy specimens were obtained 72 hours after each scintigraphic study. Nineteen scintigraphic studies had negative findings; no false negative finding was obtained. Eleven antimyosin scintigraphic studies had positive findings, and in these studies endomyocardial biopsy revealed mild rejection in two cases, moderate acute rejection with myocyte necrosis in two cases, myocyte necrosis as a consequence of ischemic injury in six cases, and possibly cytotoxic damage in one case. Antimyosin scintigraphy may represent a reliable screening method for the surveillance of heart transplant patients. In the presence of a negative finding from antimyosin scintigraphy, it may be possible to avoid endomyocardial biopsy. Conversely, in patients who have a positive finding from antimyosin scintigraphy, the endomyocardial biopsy is mandatory to establish the definitive diagnosis by histologic examination of the myocardium.

  14. Production in yeast of pseudotype virus-like particles harboring functionally active antibody fragments neutralizing the cytolytic activity of vaginolysin

    Directory of Open Access Journals (Sweden)

    Pleckaityte Milda

    2011-12-01

    Full Text Available Abstract Background Recombinant antibodies can be produced in different formats and different expression systems. Single chain variable fragments (scFvs represent an attractive alternative to full-length antibodies and they can be easily produced in bacteria or yeast. However, the scFvs exhibit monovalent antigen-binding properties and short serum half-lives. The stability and avidity of the scFvs can be improved by their multimerization or fusion with IgG Fc domain. The aim of the current study was to investigate the possibilities to produce in yeast high-affinity scFv-Fc proteins neutralizing the cytolytic activity of vaginolysin (VLY, the main virulence factor of Gardnerella vaginalis. Results The scFv protein derived from hybridoma cell line producing high-affinity neutralizing antibodies against VLY was fused with human IgG1 Fc domain. Four different variants of anti-VLY scFv-Fc fusion proteins were constructed and produced in yeast Saccharomyces cerevisiae. The non-tagged scFv-Fc and hexahistidine-tagged scFv-Fc proteins were found predominantly as insoluble aggregates and therefore were not suitable for further purification and activity testing. The addition of yeast α-factor signal sequence did not support secretion of anti-VLY scFv-Fc but increased the amount of its intracellular soluble form. However, the purified protein showed a weak VLY-neutralizing capability. In contrast, the fusion of anti-VLY scFv-Fc molecules with hamster polyomavirus-derived VP2 protein and its co-expression with VP1 protein resulted in an effective production of pseudotype virus-like particles (VLPs that exhibited strong VLY-binding activity. Recombinant scFv-Fc molecules displayed on the surface of VLPs neutralized VLY-mediated lysis of human erythrocytes and HeLa cells with high potency comparable to that of full-length antibody. Conclusions Recombinant scFv-Fc proteins were expressed in yeast with low efficiency. New approach to display the sc

  15. Epiregulin Recognition Mechanisms by Anti-epiregulin Antibody 9E5: STRUCTURAL, FUNCTIONAL, AND MOLECULAR DYNAMICS SIMULATION ANALYSES.

    Science.gov (United States)

    Kado, Yuji; Mizohata, Eiichi; Nagatoishi, Satoru; Iijima, Mariko; Shinoda, Keiko; Miyafusa, Takamitsu; Nakayama, Taisuke; Yoshizumi, Takuma; Sugiyama, Akira; Kawamura, Takeshi; Lee, Young-Hun; Matsumura, Hiroyoshi; Doi, Hirofumi; Fujitani, Hideaki; Kodama, Tatsuhiko; Shibasaki, Yoshikazu; Tsumoto, Kouhei; Inoue, Tsuyoshi

    2016-01-29

    Epiregulin (EPR) is a ligand of the epidermal growth factor (EGF) family that upon binding to its epidermal growth factor receptor (EGFR) stimulates proliferative signaling, especially in colon cancer cells. Here, we describe the three-dimensional structure of the EPR antibody (the 9E5(Fab) fragment) in the presence and absence of EPR. Among the six complementarity-determining regions (CDRs), CDR1-3 in the light chain and CDR2 in the heavy chain predominantly recognize EPR. In particular, CDR3 in the heavy chain dramatically moves with cis-trans isomerization of Pro(103). A molecular dynamics simulation and mutational analyses revealed that Arg(40) in EPR is a key residue for the specific binding of 9E5 IgG. From isothermal titration calorimetry analysis, the dissociation constant was determined to be 6.5 nm. Surface plasmon resonance analysis revealed that the dissociation rate of 9E5 IgG is extremely slow. The superimposed structure of 9E5(Fab)·EPR on the known complex structure of EGF·EGFR showed that the 9E5(Fab) paratope overlaps with Domains I and III on the EGFR, which reveals that the 9E5(Fab)·EPR complex could not bind to the EGFR. The 9E5 antibody will also be useful in medicine as a neutralizing antibody specific for colon cancer. PMID:26627827

  16. An assay for the detection of grapevine leafroll-associated virus 3 using a single-chain fragment variable antibody.

    Science.gov (United States)

    Cogotzi, Laura; Giampetruzzi, Annalisa; Nölke, Greta; Orecchia, Martin; Elicio, Vito; Castellano, Maria Antonietta; Martelli, Giovanni P; Fischer, Rainer; Schillberg, Stefan; Saldarelli, Pasquale

    2009-01-01

    Grapevine leafroll-associated virus 3 (GLRaV-3) is a major pathogen of grapevine. A previously described single-chain fragment variable (scFv) antibody (scFvLR3), directed against the coat protein (CP) of GLRaV-3, was expressed in Escherichia coli and used to develop a diagnostic ELISA kit. The antibody was fused to the light chain constant domain of human immunoglobulin to create the bivalent reagent C(L)-LR3, which was purified from the periplasmic fraction, giving a yield of ~5 mg/l. The sensitivity of the reagent against recombinant GLRaV-3 CP was 0.1 ng. The sensitivity, specificity and durability of the reagent was similar to a commercial kit. The C(L)-LR3 showed a weak cross-reaction in immune electron microscopy assays to GLRaV-1 and -7, but not with the phylogenetically more distant GLRaV-2. A fully recombinant kit was developed with the inclusion of a recombinant GLRaV-3 CP expressed in bacteria, thus avoiding problems associated with virus propagation and purification. This system represents a rapid, simple, sensitive and standardized diagnostic protocol for GLRaV-3 detection. PMID:19082687

  17. Suppression of Aggrus/podoplanin-induced platelet aggregation and pulmonary metastasis by a single-chain antibody variable region fragment

    International Nuclear Information System (INIS)

    Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies

  18. Antibody

    Science.gov (United States)

    An antibody is a protein produced by the body's immune system when it detects harmful substances, called antigens. Examples ... microorganisms (bacteria, fungi, parasites, and viruses) and chemicals. Antibodies may be produced when the immune system mistakenly ...

  19. Binding of a neutralizing antibody to dengue virus alters the arrangement of surface glycoproteins

    Energy Technology Data Exchange (ETDEWEB)

    Lok, Shee-Mei; Kostyuchenko, Victor; Nybakken, Grant E.; Holdaway, Heather A.; Battisti, Anthony J.; Sukupolvi-Petty, Soila; Sedlak, Dagmar; Fremont, Daved H.; Chipman, Paul R.; Roehrig, John T.; Diamond, Michael S.; Kuhn, Richard J.; Rossmann, Michael G. (Purdue); (WU-MED); (CDC)

    2008-04-02

    The monoclonal antibody 1A1D-2 has been shown to strongly neutralize dengue virus serotypes 1, 2 and 3, primarily by inhibiting attachment to host cells. A crystal structure of its antigen binding fragment (Fab) complexed with domain III of the viral envelope glycoprotein, E, showed that the epitope would be partially occluded in the known structure of the mature dengue virus. Nevertheless, antibody could bind to the virus at 37 degrees C, suggesting that the virus is in dynamic motion making hidden epitopes briefly available. A cryo-electron microscope image reconstruction of the virus:Fab complex showed large changes in the organization of the E protein that exposed the epitopes on two of the three E molecules in each of the 60 icosahedral asymmetric units of the virus. The changes in the structure of the viral surface are presumably responsible for inhibiting attachment to cells.

  20. Targeted Multiplex Imaging Mass Spectrometry with Single Chain Fragment Variable (scfv) Recombinant Antibodies

    Science.gov (United States)

    Thiery, Gwendoline; Mernaugh, Ray L.; Yan, Heping; Spraggins, Jeffrey M.; Yang, Junhai; Parl, Fritz F.; Caprioli, Richard M.

    2012-10-01

    Recombinant scfv antibodies specific for CYP1A1 and CYP1B1 P450 enzymes were combined with targeted imaging mass spectrometry to simultaneously detect the P450 enzymes present in archived, paraffin-embedded, human breast cancer tissue sections. By using CYP1A1 and CYP1B1 specific scfv, each coupled to a unique reporter molecule (i.e., a mass tag) it was possible to simultaneously detect multiple antigens within a single tissue sample with high sensitivity and specificity using mass spectrometry. The capability of imaging multiple antigens at the same time is a significant advance that overcomes technical barriers encountered when using present day approaches to develop assays that can simultaneously detect more than a single antigen in the same tissue sample.

  1. Suppression of the growth of human colorectal carcinoma cells (LS174T) by radiolabeled monoclonal antibody (131I-MAbC27) in tissue culture and nude mice

    International Nuclear Information System (INIS)

    A monoclonal antibody against carcinoembryonic antigen (CEA), MAbC27, and its F(ab')2 fragments were prepared and labeled with 131I. They effectively suppressed the growth of a human colorectal carcinoma cell line, LS174T, both in culture medium and in inoculated nude mice, whereas 131I-labeled normal mouse immunoglobulin or 131I itself did not have similar effects. Intravenous injection of 131I-MAbC27 or 131I-MAbF(ab')2 following inoculation of carcinoma cells suppressed their growth in vivo. The suppression effect was even more effective when intact antibody rather than its F(ab')2 fragments was used, especially when the treatment was repeated. This study indicates that radiolabeled MAbC27 may be used as a therapeutic agent in CEA-secreting human colorectal carcinomas

  2. Use of 2D NMR, protein engineering, and molecular modeling to study the hapten-binding site of an antibody Fv fragment against 2-phenyloxazolone

    International Nuclear Information System (INIS)

    Two-dimensional (2D) 1H NMR spectroscopy was used to study the hapten-binding site of a recombinant antibody Fv fragment expressed in Escherichia coli. Point mutations of residues in the CDR loops of the Fv fragment were designed in order to investigate their influence on hapten binding and to make site-specific assignments of aromatic NMR proton signals. Two tyrosines giving NOEs to the ligand 2-phenyloxazolone were identified, residue 33 in CDR1 of the heavy chain and residue 32 in CDR1 of the light chain. The benzyl portion of 2-phenyloxazolone is located between these two residues. The binding site is close to the surface of the Fv fragment. Comparison with a different anti-2-phenyloxazolone antibody, the crystal structure of which has recently been solved, shows that the general location of the hapten-binding site in both antibodies is similar. However, in the crystallographically solved antibody, the hapten is bound farther from the surface in a pocket created by a short CDR3 loop of the heavy chain. In the binding site identified in the Fv fragment studied in this report, this space is probably filled by the extra seven residues of the CDR3

  3. Preparation and Identification of a Single-chain Variable Fragment Antibody Against Canine Distemper Virus.

    Science.gov (United States)

    Yi, Li; Cheng, Shipeng

    2015-08-01

    The variable regions of the heavy chain (VH) and light chain (VL) were amplified by RT-PCR from the hybridoma 1N8, which secretes the monoclonal antibody against CDV N protein (aa 277-471). The VL and VH amplicons were combined using SOE-PCR by a 12 amino acid flexible linker (SSGGGGSGGGGS), which produced the scFv gene (named scFv/1N8). After sequence analysis, the scFv/1N8 gene was cloned into the prokaryotic expression vector PET32a with a His-tag. The recombinant scFv/1N8 protein was successfully expressed in recombinant Escherichia coli by IPTG induction. Moreover, the binding activity and specificity of the scFv were determined by indirect ELISA (His-tag) and competitive ELISA. The recombinant scFv/1N8 protein reported here will provide some basis for further antiviral drug research based on the scFv molecule. PMID:26301925

  4. In vivo characterization of the novel CD44v6-targeting Fab fragment AbD15179 for molecular imaging of squamous cell carcinoma: a dual-isotope study

    OpenAIRE

    Haylock, Anna-Karin; Spiegelberg, Diana; Nilvebrant, Johan; Sandström, Karl; Nestor, Marika

    2014-01-01

    Background Patients with squamous cell carcinoma in the head and neck region (HNSCC) offer a diagnostic challenge due to difficulties to detect small tumours and metastases. Imaging methods available are not sufficient, and radio-immunodiagnostics could increase specificity and sensitivity of diagnostics. The objective of this study was to evaluate, for the first time, the in vivo properties of the radiolabelled CD44v6-targeting fragment AbD15179 and to assess its utility as a targeting agent...

  5. Evaluation of the effects and interactions of gas blending and feeding strategy on a Fab' fermentation process by Escherichia coli.

    OpenAIRE

    Garcia-Arrazola, R.

    2005-01-01

    A method to improve production of Fab' fragments using gas blending and pH-stat feeding strategy in a fermentation process with Escherichia coli has been developed. Regime analysis together with design of experiments (DoE) has been used to evaluate the effect of gas blending and feeding strategy on a Fab' fermentation process. The economic implications of the fermentation strategy have also been considered. Batch-feeding fermentations carried out at 20 L and 450 L scale indicated that cascade...

  6. Development of a Recombinant Antibody with Specificity for Chelated Uranyl Ions

    International Nuclear Information System (INIS)

    The goal of our project is to continue the development of new techniques for rapid, automated identification of radionuclides, metals, and chelators that may contaminant sur face and groundwater at DOE sites. One of the four specific aims of the present project is to develop new technologies in antibody engineering that will enhance our immunosensor program. Recombinant antibodies have potential advantages over monoclonal antibodies produced by standard hybridoma technology. The cloned genes represent a stable, recoverable source for antibody production. In addition, the recombinant format offers opportunities for protein engineering that enhances antibody performance and for studies that relate antibody sequence to binding activity. In this study, a hybridoma that synthesized an antibody (12F6) that recognized a 1:1 complex between 2,9-dicarboxyl-1,10- phenanthroline (DCP) and UO22+ was used as a source of RNA for the development of a recombinant (Fab)2 fragment. RNA was isolated from the 12F6 hybridoma and the cDNA encoding the entire κ light chain and the linked VH and C1 portions of the heavy chain were amplified from total RNA. cDNA sequences were verified by comparison with the N-terminal amino acid sequences of the light and heavy chains of the native 12F6 monoclonal antibody. A leader sequence and appropriate restriction sites were added to each chain, and the fragments were ligated into a commercial dicistronic vector (pBudCE4.1, Invitrogen, Inc.). COS-1 cells were transfected with this vector and the culture supernatant was assayed for activity and the (Fab)2 protein. Cells transfected with vector containing 12F6 cDNA synthesized and secreted recombinant (Fab)2 fragments that bound to the UO22+-DCP complex with an affinity indistinguishable from that of a (Fab)2 fragment prepared from the native antibody. Molecular models of the heavy and light chain variable domains were constructed according to the canonical structures method detailed by Morea et al

  7. Development of a Recombinant Antibody with Specificity for Chelated Uranyl Ions

    Energy Technology Data Exchange (ETDEWEB)

    X. Li; A.M. Kriegel; T.C. Bishop; R.C. Blake; E. Figueiredo; H. Yu; D.A. Blake

    2005-04-18

    The goal of our project is to continue the development of new techniques for rapid, automated identification of radionuclides, metals, and chelators that may contaminant sur face and groundwater at DOE sites. One of the four specific aims of the present project is to develop new technologies in antibody engineering that will enhance our immunosensor program. Recombinant antibodies have potential advantages over monoclonal antibodies produced by standard hybridoma technology. The cloned genes represent a stable, recoverable source for antibody production. In addition, the recombinant format offers opportunities for protein engineering that enhances antibody performance and for studies that relate antibody sequence to binding activity. In this study, a hybridoma that synthesized an antibody (12F6) that recognized a 1:1 complex between 2,9-dicarboxyl-1,10- phenanthroline (DCP) and UO{sub 2}{sup 2+} was used as a source of RNA for the development of a recombinant (Fab){sub 2} fragment. RNA was isolated from the 12F6 hybridoma and the cDNA encoding the entire {kappa} light chain and the linked VH and C1 portions of the heavy chain were amplified from total RNA. cDNA sequences were verified by comparison with the N-terminal amino acid sequences of the light and heavy chains of the native 12F6 monoclonal antibody. A leader sequence and appropriate restriction sites were added to each chain, and the fragments were ligated into a commercial dicistronic vector (pBudCE4.1, Invitrogen, Inc.). COS-1 cells were transfected with this vector and the culture supernatant was assayed for activity and the (Fab){sub 2} protein. Cells transfected with vector containing 12F6 cDNA synthesized and secreted recombinant (Fab){sub 2} fragments that bound to the UO{sub 2}{sup 2+}-DCP complex with an affinity indistinguishable from that of a (Fab){sub 2} fragment prepared from the native antibody. Molecular models of the heavy and light chain variable domains were constructed according to the

  8. Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

    International Nuclear Information System (INIS)

    An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P212121

  9. An Exopolysaccharide-Deficient Mutant of Lactobacillus rhamnosus GG Efficiently Displays a Protective Llama Antibody Fragment against Rotavirus on Its Surface

    OpenAIRE

    Álvarez, Beatriz; Krogh-Andersen, Kasper; Tellgren-Roth, Christian; Martínez, Noelia; Günaydın, Gökçe; Lin, Yin; Martín, M. Cruz; Álvarez, Miguel A; Hammarström, Lennart; Marcotte, Harold

    2015-01-01

    Rotavirus is the leading cause of infantile diarrhea in developing countries, where it causes a high number of deaths among infants. Two vaccines are available, being highly effective in developed countries although markedly less efficient in developing countries. As a complementary treatment to the vaccines, a Lactobacillus strain producing an anti-rotavirus antibody fragment in the gastrointestinal tract could potentially be used. In order to develop such an alternative therapy, the effecti...

  10. Production of a soluble single-chain variable fragment antibody against okadaic acid and exploration of its specific binding.

    Science.gov (United States)

    He, Kuo; Zhang, Xiuyuan; Wang, Lixia; Du, Xinjun; Wei, Dong

    2016-06-15

    Okadaic acid is a lipophilic marine algal toxin commonly responsible for diarrhetic shellfish poisoning (DSP). Outbreaks of DSP have been increasing and are of worldwide public health concern; therefore, there is a growing demand for more rapid, reliable, and economical analytical methods for the detection of this toxin. In this study, anti-okadaic acid single-chain variable fragment (scFv) genes were prepared by cloning heavy and light chain genes from hybridoma cells, followed by fusion of the chains via a linker peptide. An scFv-pLIP6/GN recombinant plasmid was constructed and transformed into Escherichia coli for expression, and the target scFv was identified with IC-CLEIA (chemiluminescent enzyme immunoassay). The IC15 was 0.012 ± 0.02 μg/L, and the IC50 was 0.25 ± 0.03 μg/L. The three-dimensional structure of the scFv was simulated with computer modeling, and okadaic acid was docked to the scFv model to obtain a putative structure of the binding complex. Two predicted critical amino acids, Ser32 and Thr187, were then mutated to verify this theoretical model. Both mutants exhibited significant loss of binding activity. These results help us to understand this specific scFv-antigen binding mechanism and provide guidance for affinity maturation of the antibody in vitro. The high-affinity scFv developed here also has potential for okadaic acid toxin detection. PMID:26772159

  11. Complete regression of a guinea pig hepatocarcinoma by immunotherapy with "tumor-immune" RNA or antibody to fibrin fragment E.

    Science.gov (United States)

    Schlager, S I; Dray, S

    1976-01-01

    Two novel immunotherapeutic regimens were developed for a uniformly lethal, intradermally growing transplantable ascites variant (line 10) of a diethylnitrosamine-induced hepatoma in strain 2 guinea pigs. In an apparently tumor-specific immunotherapy model, 32 guinea pigs were cured by the injection into the tumor area, five or seven days after tumor challenge, of syngeneic or xenogeneic RNA extracts obtained from lymphoid tissues of line 10-immune strain 2 guinea pigs or rhesus monkeys, as part of a total regimen which included syngeneic nonsensitive peritoneal exudate cells injected prior to, and tumor-specific antigen injected after, the RNA. In another immunotherapy model, not tumor-specific, 18 strain 2 guinea pigs were cured by the injection into the tumor area, 6 and 16 days after tumor challenge, of antibody specific for fibrin fragment E (FFE), an essential component in the formation of a fibrin matrix considered to be important in tumor development. When therapy was delayed to 12 days in the RNA test system, or to 16 days in the anti-FFE test system, complete abrogation of the tumors did not occur. The long-term survival of the 50 successfully treated animals and their immunity to further tumor challenge indicated that both immunotherapeutic procedures had systemic effects. To test this further, line 10 cells were injected intradermally simultaneously at two sites and only one site was treated. When the one tumor location was treated with anti-FFE, complete regression of the treated tumor and a 30% retardation in the development of the untreated tumor were observed. When this tumor location was treated with the RNA regimen, complete regression of the tumors occurred at both the treated and the untreated sites. Optimal conditions for both immunotherapeutic models and their combination have yet to be establshed. Nonetheless, both immunotherapeutic regimens were more effective than any other immunotherapy thus far reported for this tumor, including the use

  12. Structural comparison of four different antibodies interacting with human papillomavirus 16 and mechanisms of neutralization.

    Science.gov (United States)

    Guan, Jian; Bywaters, Stephanie M; Brendle, Sarah A; Lee, Hyunwook; Ashley, Robert E; Makhov, Alexander M; Conway, James F; Christensen, Neil D; Hafenstein, Susan

    2015-09-01

    Cryo-electron microscopy (cryo-EM) was used to solve the structures of human papillomavirus type 16 (HPV16) complexed with fragments of antibody (Fab) from three different neutralizing monoclonals (mAbs): H16.1A, H16.14J, and H263.A2. The structure-function analysis revealed predominantly monovalent binding of each Fab with capsid interactions that involved multiple loops from symmetry related copies of the major capsid protein. The residues identified in each Fab-virus interface map to a conformational groove on the surface of the capsomer. In addition to the known involvement of the FG and HI loops, the DE loop was also found to constitute the core of each epitope. Surprisingly, the epitope mapping also identified minor contributions by EF and BC loops. Complementary immunological assays included mAb and Fab neutralization. The specific binding characteristics of mAbs correlated with different neutralizing behaviors in pre- and post-attachment neutralization assays. PMID:25996608

  13. TRAIL-R2 Superoligomerization Induced by Human Monoclonal Agonistic Antibody KMTR2.

    Science.gov (United States)

    Tamada, Taro; Shinmi, Daisuke; Ikeda, Masahiro; Yonezawa, Yasushi; Kataoka, Shiro; Kuroki, Ryota; Mori, Eiji; Motoki, Kazuhiro

    2015-01-01

    The fully human monoclonal antibody KMTR2 acts as a strong direct agonist for tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) receptor 2 (TRAIL-R2), which is capable of inducing apoptotic cell death without cross-linking. To investigate the mechanism of direct agonistic activity induced by KMTR2, the crystal structure of the extracellular region of TRAIL-R2 and a Fab fragment derived from KMTR2 (KMTR2-Fab) was determined to 2.1 Å resolution. Two KMTR2-Fabs assembled with the complementarity-determining region 2 of the light chain via two-fold crystallographic symmetry, suggesting that the KMTR2-Fab assembly tended to enhance TRAIL-R2 oligomerization. A single mutation at Asn53 to Arg located at the two-fold interface in the KMTR2 resulted in a loss of its apoptotic activity, although it retained its antigen-binding activity. These results indicate that the strong agonistic activity, such as apoptotic signaling and tumor regression, induced by KMTR2 is attributed to TRAIL-R2 superoligomerization induced by the interdimerization of KMTR2. PMID:26672965

  14. Using the local immune response from the natural buffalo host to generate an antibody fragment library that binds the early larval stages of Schistosoma japonicum.

    Science.gov (United States)

    Hosking, Christopher G; Driguez, Patrick; McWilliam, Hamish E G; Ilag, Leodevico L; Gladman, Simon; Li, Yuesheng; Piedrafita, David; McManus, Donald P; Meeusen, Els N T; de Veer, Michael J

    2015-09-01

    Antibodies isolated from the local draining inguinal lymph node of field exposed-water buffaloes following challenge with Schistosoma japonicum cercariae showed high reactivity towards S. japonicum antigen preparations and bound specifically to formaldehyde-fixed S. japonicum schistosomules. Using this specific local immune response we produced a series of single-chain antibody Fv domain libraries from the same lymph nodes. Removal of phage that cross reacted with epitopes on adult parasites yielded a single-chain antibody Fv domain-phage library that specifically bound to whole formaldehyde-fixed and live S. japonicum schistosomules. DNA sequencing indicated clear enrichment of the single-chain antibody Fv domain library for buffalo B-cell complementarity determining regions post-selection for schistosomule binding. This study also revealed that long heavy chain complementarity determining regions appear to be an important factor when selecting for antibody binding fragments against schistosomule proteins. The selected single-chain antibody Fv domain-phage were used to probe a schistosome-specific protein microarray, which resulted in the recognition of many proteins expressed across all schistosome life-cycle stages. Following absorption to adult worms, the single-chain antibody Fv domain-phage library showed significantly reduced binding to most proteins, whilst two proteins (NCBI GenBank accession numbers AY915878 and AY815196) showed increased binding. We have thus developed a unique set of host derived single-chain antibody Fv domains comprising buffalo B-cell variable regions that specifically bind to early S. japonicum life-stages. PMID:26116907

  15. Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries

    Science.gov (United States)

    Miersch, Shane; Li, Zhijian; Hanna, Rachel; McLaughlin, Megan E.; Hornsby, Michael; Matsuguchi, Tet; Paduch, Marcin; Sääf, Annika; Wells, Jim; Koide, Shohei; Kossiakoff, Anthony; Sidhu, Sachdev S.

    2015-01-01

    The demand for antibodies that fulfill the needs of both basic and clinical research applications is high and will dramatically increase in the future. However, it is apparent that traditional monoclonal technologies are not alone up to this task. This has led to the development of alternate methods to satisfy the demand for high quality and renewable affinity reagents to all accessible elements of the proteome. Toward this end, high throughput methods for conducting selections from phage-displayed synthetic antibody libraries have been devised for applications involving diverse antigens and optimized for rapid throughput and success. Herein, a protocol is described in detail that illustrates with video demonstration the parallel selection of Fab-phage clones from high diversity libraries against hundreds of targets using either a manual 96 channel liquid handler or automated robotics system. Using this protocol, a single user can generate hundreds of antigens, select antibodies to them in parallel and validate antibody binding within 6-8 weeks. Highlighted are: i) a viable antigen format, ii) pre-selection antigen characterization, iii) critical steps that influence the selection of specific and high affinity clones, and iv) ways of monitoring selection effectiveness and early stage antibody clone characterization. With this approach, we have obtained synthetic antibody fragments (Fabs) to many target classes including single-pass membrane receptors, secreted protein hormones, and multi-domain intracellular proteins. These fragments are readily converted to full-length antibodies and have been validated to exhibit high affinity and specificity. Further, they have been demonstrated to be functional in a variety of standard immunoassays including Western blotting, ELISA, cellular immunofluorescence, immunoprecipitation and related assays. This methodology will accelerate antibody discovery and ultimately bring us closer to realizing the goal of generating renewable

  16. Mapping of Fab-1:VEGF Interface Using Carboxyl Group Footprinting Mass Spectrometry

    Science.gov (United States)

    Wecksler, Aaron T.; Kalo, Matt S.; Deperalta, Galahad

    2015-12-01

    A proof-of-concept study was performed to demonstrate that carboxyl group footprinting, a relatively simple, bench-top method, has utility for first-pass analysis to determine epitope regions of therapeutic mAb:antigen complexes. The binding interface of vascular endothelial growth factor (VEGF) and the Fab portion of a neutralizing antibody (Fab-1) was analyzed using carboxyl group footprinting with glycine ethyl ester (GEE) labeling. Tryptic peptides involved in the binding interface between VEGF and Fab-1 were identified by determining the specific GEE-labeled residues that exhibited a reduction in the rate of labeling after complex formation. A significant reduction in the rate of GEE labeling was observed for E93 in the VEGF tryptic peptide V5, and D28 and E57 in the Fab-1 tryptic peptides HC2 and HC4, respectively. Results from the carboxyl group footprinting were compared with the binding interface identified from a previously characterized crystal structure (PDB: 1BJ1). All of these residues are located at the Fab-1:VEGF interface according to the crystal structure, demonstrating the potential utility of carboxyl group footprinting with GEE labeling for mapping epitopes.

  17. Cyclization strategies of meditopes: affinity and diffraction studies of meditope–Fab complexes

    Energy Technology Data Exchange (ETDEWEB)

    Bzymek, Krzysztof P.; Ma, Yuelong; Avery, Kendra A.; Horne, David A.; Williams, John C., E-mail: jcwilliams@coh.org [Beckman Research Institute of City of Hope, 1710 Flower Street, Duarte, CA 91010 (United States)

    2016-05-23

    An overview of cyclization strategies of a Fab-binding peptide to maximize affinity. Recently, a unique binding site for a cyclic 12-residue peptide was discovered within a cavity formed by the light and heavy chains of the cetuximab Fab domain. In order to better understand the interactions that drive this unique complex, a number of variants including the residues within the meditope peptide and the antibody, as well as the cyclization region of the meditope peptide, were created. Here, multiple crystal structures of meditope peptides incorporating different cyclization strategies bound to the central cavity of the cetuximab Fab domain are presented. The affinity of each cyclic derivative for the Fab was determined by surface plasmon resonance and correlated to structural differences. Overall, it was observed that the disulfide bond used to cyclize the peptide favorably packs against a hydrophobic ‘pocket’ and that amidation and acetylation of the original disulfide meditope increased the overall affinity ∼2.3-fold. Conversely, replacing the terminal cysteines with serines and thus creating a linear peptide reduced the affinity over 50-fold, with much of this difference being reflected in a decrease in the on-rate. Other cyclization methods, including the formation of a lactam, reduced the affinity but not to the extent of the linear peptide. Collectively, the structural and kinetic data presented here indicate that small perturbations introduced by different cyclization strategies can significantly affect the affinity of the meditope–Fab complex.

  18. Treatment with hyperimmune equine immunoglobulin or immunoglobulin fragments completely protects rodents from Ebola virus infection.

    Science.gov (United States)

    Zheng, Xuexing; Wong, Gary; Zhao, Yongkun; Wang, Hualei; He, Shihua; Bi, Yuhai; Chen, Weijin; Jin, Hongli; Gai, Weiwei; Chu, Di; Cao, Zengguo; Wang, Chong; Fan, Quanshui; Chi, Hang; Gao, Yuwei; Wang, Tiecheng; Feng, Na; Yan, Feihu; Huang, Geng; Zheng, Ying; Li, Nan; Li, Yuetao; Qian, Jun; Zou, Yong; Kobinger, Gary; Gao, George Fu; Qiu, Xiangguo; Yang, Songtao; Xia, Xianzhu

    2016-01-01

    Recent successes with monoclonal antibody cocktails ZMapp(TM) and MIL77 against Ebola virus (EBOV) infections have reignited interest in antibody-based therapeutics. Since the production process for monoclonal antibodies can be prolonged and costly, alternative treatments should be investigated. We produced purified equine antisera from horses hyperimmunized with EBOV virus-like particles, and tested the post-exposure efficacy of the antisera in a mouse model of infection. BALB/c mice were given up to 2 mg of purified equine antisera per animal, at 30 minutes, 1 or 2 days post-infection (dpi), in which all animals survived. To decrease the possibility of serum sickness, the equine antisera was digested with pepsin to generate F(ab')2 fragments, with in vitro neutralizing activity comparable to whole immunoglobulin. Full protection was achieved with when treatment was initiated at 1 dpi, but the suboptimal protection observed with the 30 minute and 2 dpi groups demonstrate that in addition to virus neutralization, other Fc-dependent antibody mechanisms may also contribute to survival. Guinea pigs given 20 mg of antisera or F(ab')2 at or starting at 1 or 2 dpi were also fully protected from EBOV infection. These results justify future efficacy studies for purified equine products in NHPs. PMID:27067649

  19. Comparison of the C-mediating killing activity and C-activating properties of mouse monoclonal and polyclonal antibodies against Trypanosoma cruzi

    Directory of Open Access Journals (Sweden)

    T. L. Kipnis

    1992-01-01

    Full Text Available A Mouse polyclonal antiserum against Trypanosoma cruzi or its IgG and IgM fractions and five monoclonal antibodies (two IgM, two IgG1 and one IgG2a recognize and combine with membrane components of trypomastigote forms of the parasite as revealed by immunofluorescence. Although all these antibodies sensitize trypomastigotes and prepare them to activate the complement (C system, as measured by consumption of total C, C4, B and C3, only the polyclonal antiserum or its IgG, IgM and Fabμ fragments were able to induce trypanosome lysis by the alternative C pathway.

  20. Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

    Science.gov (United States)

    Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

    2016-04-01

    The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

  1. Optimal Neutralization of Centruroides noxius Venom Is Understood through a Structural Complex between Two Antibody Fragments and the Cn2 Toxin.

    Science.gov (United States)

    Riaño-Umbarila, Lidia; Ledezma-Candanoza, Luis M; Serrano-Posada, Hugo; Fernández-Taboada, Guillermo; Olamendi-Portugal, Timoteo; Rojas-Trejo, Sonia; Gómez-Ramírez, Ilse V; Rudiño-Piñera, Enrique; Possani, Lourival D; Becerril, Baltazar

    2016-01-22

    The current trend of using recombinant antibody fragments in research to develop novel antidotes against scorpion stings has achieved excellent results. The polyclonal character of commercial antivenoms, obtained through the immunization of animals and which contain several neutralizing antibodies that recognize different epitopes on the toxins, guarantees the neutralization of the venoms. To avoid the use of animals, we aimed to develop an equivalent recombinant antivenom composed of a few neutralizing single chain antibody fragments (scFvs) that bind to two different epitopes on the scorpion toxins. In this study, we obtained scFv RU1 derived from scFv C1. RU1 showed a good capacity to neutralize the Cn2 toxin and whole venom of the scorpion Centruroides noxius. Previously, we had produced scFv LR, obtained from a different parental fragment (scFv 3F). LR also showed a similar neutralizing capacity. The simultaneous administration of both scFvs resulted in improved protection, which was translated as a rapid recovery of previously poisoned animals. The crystallographic structure of the ternary complex scFv LR-Cn2-scFv RU1 allowed us to identify the areas of interaction of both scFvs with the toxin, which correspond to non-overlapping sites. The epitope recognized by scFv RU1 seems to be related to a greater efficiency in the neutralization of the whole venom. In addition, the structural analysis of the complex helped us to explain the cross-reactivity of these scFvs and how they neutralize the venom. PMID:26589800

  2. Development of a biotinylated broad-specificity single-chain variable fragment antibody and a sensitive immunoassay for detection of organophosphorus pesticides.

    Science.gov (United States)

    Zhao, Fengchun; Tian, Yuan; Wang, Huimin; Liu, Jiye; Han, Xiao; Yang, Zhengyou

    2016-09-01

    Organophosphorus pesticides (OPs) are the most widely used pesticides in agriculture, and OP residues have been broadly reported in food and environmental samples. The aim of this study is to develop a recombinant antibody-based broad-specificity immunoassay for OPs. A phage display library was prepared from a mouse pre-immunized with a generic immunogen of OPs, and a single-chain variable fragment (scFv) antibody was selected. The selected scFv antibody was fused with biotin acceptor domain (BAD) and overexpressed as an inclusion body in Escherichia coli BL21 (DE3). Then, the protein was refolded by stepwise urea gradient dialysis and biotinylated in vitro by E. coli biotin ligase (BirA). Subsequently, the scFv-BAD protein was purified from the biotinylated system with high yield (66.7 mg L(-1)) and confirmed by SDS-PAGE and Western blot. Based on the biotinylated scFv-BAD, a sensitive and broad-specificity competitive indirect enzyme-linked immunosorbent assay (ciELISA) for detection of OPs was developed. The cross-reactivity (CR) studies demonstrated that the ciELISA described here exhibited the broadest detection spectrum for OPs up to now, and 30 OPs could be determined with 50 % inhibition value (IC50) values ranging from 19.4 to 515.2 ng mL(-1). Moreover, the developed ciELISA was used for the recovery study of the spiked samples and showed satisfactory recoveries. Graphical Abstract Schematic diagram of the development of biotinylated broad-specificity single-chain variable fragment antibody-based immunoassay for organophosphorus pesticides. PMID:27411546

  3. Negative effects of a disulfide bond mismatch in anti-rabies G protein single-chain antibody variable fragment FV57.

    Science.gov (United States)

    Duan, Ye; Gu, Tiejun; Zhang, Xizhen; Jiang, Chunlai; Yuan, Ruosen; Li, Zhuang; Wang, Dandan; Chen, Xiaoxu; Wu, Chunlai; Chen, Yan; Wu, Yongge; Kong, Wei

    2014-06-01

    Rabies virus (RV) causes a fatal infectious disease requiring efficient post-exposure prophylaxis (PEP), which includes a rabies vaccine and rabies immunoglobulin (RIG). The single-chain antibody variable fragment (scFv), a small engineered antibody fragment derived from an antibody variable heavy chain and light chain, has the potential to replace the current application of RIG. In previous studies, we constructed and evaluated an anti-rabies virus G protein scFv (FV57) based on the monoclonal antibody CR57. Of the five cysteines in FV57, four are linked in intra-chain disulfide bonds (Cys-VH28/Cys-VH98 and Cys-VL16/Cys-VL84), and one is free (Cys-VL85). However, the thiol in Cys-VL85 neighboring Cys-VL84 in the CDR3 of the light chain is likely to mismatch with the thiol in Cys-VL16 during the renaturing process. In order to study effects of the mismatched disulfide bond, Cys-VL85 and Cys-VL84 of FV57 were mutated to serine to construct mutants FV57(VL85S) and FV57(VL84S). Furthermore, the disulfide bonds in the light chain of FV57, FV57(VL85S) and FV57(VL84S) were deleted by mutating Cys-VL16 to serine. All mutants were prepared and evaluated along with the original FV57. The results indicated that the mismatched disulfide bond of FV57 linking the light chain FR1 and CDR3 would confer deleterious negative effects on its activity against RV, likely due to spatial hindrance in the light chain CDR3. Moreover, avoidance of the disulfide bond mismatch provided an additional 30% protective efficacy against RV infection in the mouse RV challenge model. Thus, modifications of FV57 to eliminate the disulfide bond mismatch may provide a candidate therapeutic agent for effective PEP against rabies. PMID:24598312

  4. A human recombinant Fab identifies a human immunodeficiency virus type 1-induced conformational change in cell surface-expressed CD4.

    OpenAIRE

    Bachelder, R E; Bilancieri, J; W. Lin; Letvin, N. L.

    1995-01-01

    To explore the role of the CD4 molecule in human immunodeficiency virus (HIV) infection following initial virus-CD4 binding, we have characterized CD4-specific antibodies raised by immunizing an HIV-1-infected human with human recombinant soluble CD4 (rsCD4). Fabs were selected from a human recombinant Fab library constructed from the bone marrow of this immunized individual. Here, we describe a human rsCD4-specific recombinant Fab clone selected by panning the library over complexes of human...

  5. Visualizing inflammation activity in rheumatoid arthritis with Tc-99 m Anti-CD4-mAb fragment scintigraphy

    International Nuclear Information System (INIS)

    Purpose: T-cell-located CD4 antigen represents one of the therapeutic targets in rheumatoid arthritis (RA). However, up to now there is no established imaging tool to visualize this target in vivo. The aim of our study was to assess the safety and tolerability of a technetium-99 m labelled murine anti-human CD4 IgG1-Fab fragment ([99mTc]-anti-CD4-Fab, [99mTc]-EP1645) in patients with active synovitis due to RA, and to evaluate its potential as a marker of disease activity. Methods: In the present phase I proof of principle study five patients with RA were examined. Planar scans of the whole body, hands, and feet were taken 30 min up to 24 h after application of 550 ± 150 MBq [99mTc]-anti-CD4-Fab, followed by visual analyses, comparison with clinical data in 68 joints per patient and semiquantitative analysis of hand and wrist joints. Results: Neither infusion related adverse events nor adverse events during follow up were observed. No increase in human anti-murine antibody titres was seen. All patients had positive scans in almost 70% of clinically affected joints. Positive scans were also found in 8% of joints without evidence of swelling or tenderness. Conclusion: Scintigraphy with [99mTc]-anti-CD4-Fab is a promising technique for evaluation of inflammatory activity in patients with RA, pre-therapeutical evaluation of CD4 status and therapy control. Tracer uptake in clinically inconspicuous joints strongly indicates diagnostic potential of [99mTc]-anti-CD4-Fab. Whether this technique is eligible as a prognostic factor in RA needs to be analysed in further studies as well as the pathophysiological background of clinically affected joints lacking tracer uptake

  6. Discovery and characterization of antibody variants using mass spectrometry-based comparative analysis for biosimilar candidates of monoclonal antibody drugs.

    Science.gov (United States)

    Li, Wenhua; Yang, Bin; Zhou, Dongmei; Xu, Jun; Ke, Zhi; Suen, Wen-Chen

    2016-07-01

    Liquid chromatography mass spectrometry (LC-MS) is the most commonly used technique for the characterization of antibody variants. MAb-X and mAb-Y are two approved IgG1 subtype monoclonal antibody drugs recombinantly produced in Chinese hamster ovary (CHO) cells. We report here that two unexpected and rare antibody variants have been discovered during cell culture process development of biosimilars for these two approved drugs through intact mass analysis. We then used comprehensive mass spectrometry-based comparative analysis including reduced light, heavy chains, and domain-specific mass as well as peptide mapping analysis to fully characterize the observed antibody variants. The "middle-up" mass comparative analysis demonstrated that the antibody variant from mAb-X biosimilar candidate was caused by mass variation of antibody crystalline fragment (Fc), whereas a different variant with mass variation in antibody antigen-binding fragment (Fab) from mAb-Y biosimilar candidate was identified. Endoproteinase Lys-C digested peptide mapping and tandem mass spectrometry analysis further revealed that a leucine to glutamine change in N-terminal 402 site of heavy chain was responsible for the generation of mAb-X antibody variant. Lys-C and trypsin coupled non-reduced and reduced peptide mapping comparative analysis showed that the formation of the light-heavy interchain trisulfide bond resulted in the mAb-Y antibody variant. These two cases confirmed that mass spectrometry-based comparative analysis plays a critical role for the characterization of monoclonal antibody variants, and biosimilar developers should start with a comprehensive structural assessment and comparative analysis to decrease the risk of the process development for biosimilars. PMID:27214604

  7. Inhibitory and neutral antibodies to Plasmodium falciparum MSP119 form ring structures with their antigen.

    Science.gov (United States)

    Dekker, Carien; Uthaipibull, Chairat; Calder, Lesley J; Lock, Matthew; Grainger, Munira; Morgan, William D; Dodson, Guy G; Holder, Anthony A

    2004-09-01

    Blood-stage malaria vaccine candidates include surface proteins of the merozoite. Antibodies to these proteins may either block essential steps during invasion or render the merozoite susceptible to phagocytosis or complement-mediated degradation. Structural information on merozoite surface proteins complexed to antibodies provides crucial information for knowledge-based vaccine design. The major merozoite surface protein MSP1 is an abundant surface molecule in Plasmodium falciparum. Only a subset of antibodies against MSP119 inhibits invasion (inhibitory antibodies), whereas other antibodies binding to MSP119 have no effect on invasion (neutral antibodies). Here we report on the complex of MSP119 with both inhibitory monoclonal antibody 12.10 and neutral monoclonal antibody 2F10. The complexes were established using both whole IgG's and Fab fragments, and analysed by dynamic light scattering, electron microscopy and analytical ultra centrifugation. Specific ring structures were formed in the ternary complex with the two antibodies, providing direct evidence of non-overlapping epitopes on MSP119. Mutational studies also indicated that the epitopes of the inhibitory and neutral antibodies are spatially remote. PMID:15279960

  8. Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

    Directory of Open Access Journals (Sweden)

    Rui Liu

    2016-06-01

    Full Text Available Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples.

  9. Isolation and characterisation of a human-like antibody fragment (scFv) that inactivates VEEV in vitro and in vivo.

    Science.gov (United States)

    Rülker, Torsten; Voß, Luzie; Thullier, Philippe; O' Brien, Lyn M; Pelat, Thibaut; Perkins, Stuart D; Langermann, Claudia; Schirrmann, Thomas; Dübel, Stefan; Marschall, Hans-Jürgen; Hust, Michael; Hülseweh, Birgit

    2012-01-01

    Venezuelan equine encephalitis virus (VEEV) belongs to the Alphavirus genus and several species of this family are pathogenic to humans. The viruses are classified as potential agents of biological warfare and terrorism and sensitive detection as well as effective prophylaxis and antiviral therapies are required.In this work, we describe the isolation of the anti-VEEV single chain Fragment variable (scFv), ToR67-3B4, from a non-human primate (NHP) antibody gene library. We report its recloning into the bivalent scFv-Fc format and further immunological and biochemical characterisation.The scFv-Fc ToR67-3B4 recognised viable as well as formalin and ß-propionolactone (ß-Pl) inactivated virus particles and could be applied for immunoblot analysis of VEEV proteins and immuno-histochemistry of VEEV infected cells. It detected specifically the viral E1 envelope protein of VEEV but did not react with reduced viral glycoprotein preparations suggesting that recognition depends upon conformational epitopes. The recombinant antibody was able to detect multiple VEEV subtypes and displayed only marginal cross-reactivity to other Alphavirus species except for EEEV. In addition, the scFv-Fc fusion described here might be of therapeutic use since it successfully inactivated VEEV in a murine disease model. When the recombinant antibody was administered 6 hours post challenge, 80% to 100% of mice survived lethal VEEV IA/B or IE infection. Forty to sixty percent of mice survived when scFv-Fc ToR67-3B4 was applied 6 hours post challenge with VEEV subtypes II and former IIIA. In combination with E2-neutralising antibodies the NHP antibody isolated here could significantly improve passive protection as well as generic therapy of VEE. PMID:22666347

  10. An Immunosensor Based on Antibody Binding Fragments Attached to Gold Nanoparticles for the Detection of Peptides Derived from Avian Influenza Hemagglutinin H5

    Directory of Open Access Journals (Sweden)

    Urszula Jarocka

    2014-08-01

    Full Text Available This paper concerns the development of an immunosensor for detection of peptides derived from avian influenza hemagglutinin H5. Its preparation consists of successive gold electrode modification steps: (i modification with 1,6-hexanedithiol and gold colloidal nanoparticles; (ii immobilization of antibody-binding fragments (Fab’ of anti-hemagglutinin H5 monoclonal antibodies Mab 6-9-1 via S-Au covalent bonds; and (iii covering the remaining free space on the electrode surfaces with bovine serum albumin. The interactions between Fab’ fragments and hemagglutinin (HA variants have been explored with electrochemical impedance spectroscopy (EIS in the presence of [Fe(CN6]3−/4− as an electroactive marker. The immunosensor was able to recognize three different His-tagged variants of recombinant hemagglutinin from H5N1 viruses: H1 subunit (17–340 residues of A/swan/Poland/305-135V08/2006, the long HA (17–530 residues A/Bar-headed Goose/Qinghai/12/2005 and H1 subunit (1–345 residues of A/Vietnam/1194/2004. The strongest response has been observed for the long variant with detection limit of 2.2 pg/mL and dynamic range from 4.0 to 20.0 pg/mL.

  11. Reverse calcium affinity purification of Fab with calcium derivatized hydroxyapatite

    OpenAIRE

    Gagnon, Pete; Cheung, Chia-wei; Yazaki, Paul J.

    2009-01-01

    This study introduces the application of calcium-derivatized hydroxyapatite for purification of Fab. Fab binds to native hydroxyapatite but fails to bind to the calcium derivatized form. IgG, Fc, and most other protein contaminants bind to the calcium form. This supports Fab purification by a simple flow-through method that achieves greater than 95% purity from papain digests and mammalian cell culture supernatants. Alternatively, Fab can be concentrated on native hydroxyapatite then eluted s...

  12. Advantages of detecting monoclonal antibody binding to tissue sections with biotin and avidin reagents in Coplin jars.

    Science.gov (United States)

    Bindl, J M; Warnke, R A

    1986-04-01

    We describe a method of biotin/avidin-peroxidase detection using second and third stage reagents in Coplin jars. This method allows a large quantity of sections to be stained simultaneously with a minimal amount of technical time involved. A wide range of mouse monoclonal antibodies of varying specificities and isotypes were used to stain both frozen and paraffin-embedded sections of various normal and neoplastic tissues. Three different biotinylated anti-mouse antibodies were tested, including F(ab')2 antibody fragments of one, followed by horseradish peroxidase conjugated avidin. All monoclonal antibodies employed gave good staining, using incubation times of 30-50 minutes. The staining was done during a mean period of 25 to 27 days with an average staining load of 500 sections per Coplin jar. PMID:2420169

  13. The effect of anti-human plasminogen monoclonal antibodies on Glu-plasminogen activation by plasminogen activators

    Directory of Open Access Journals (Sweden)

    M. Akrami

    2006-07-01

    the A1D12 F(ab region to Glu-plasminogen increases the catalytic efficiency of plasminogen activation by plasminogen activators. Therefore, it may be useful to apply clinically A1D12 for the therapy of thromboembolic events such as myocardial infarction by humanizing the F(ab fragment of the A1D12 antibody. Inhibition pattern of antibody MC2B8 obey the mixed type of enzyme inhibition by binding the antibody probably at, or near, the cleavage site of Glu-plasminogen.

  14. FAB (Functionally Alert Behavior Strategies) to Improve Self-Control

    Science.gov (United States)

    Pagano, John

    2015-01-01

    This paper describes the FAB (Functionally Alert Behavior) Strategies approach to improve behavior in children and adolescents with complex behavioral challenges. FAB Strategies include evidence-based environmental adaptations, sensory modulation, positive behavioral support, and physical self-regulation strategies. FAB Strategies can be used by…

  15. New Insights into the Functional Behavior of Antibodies as Revealed by Binding Studies on an Anti-Uranium Monoclonal Antibody

    Energy Technology Data Exchange (ETDEWEB)

    Blake, Diane A.; Xia Li; Haini Yu; Blake, Robert C.

    2004-03-17

    As part of an ongoing effort to develop immunoassays for chelated uranium(VI) on a hand-held flow fluorimeter, an anti-uranium monoclonal antibody designated as 8A11 was fluorescently labeled using two different strategies. When 8A11 was coupled via reactive lysines to either ALEXATM 488 or Cy5TM, the resulting fluorescent antibody conjugate exhibited positive cooperativity in the presence of its antigen, U(VI) chelated with 2,9-dicarboxy-1,10-phenanthroline (U(VI)-DCP). That is, when one of the two binding sites on the covalently modified 8A11 was occupied with bound antigen, the affinity of the remaining site on the antibody for U(VI)-DCP appeared to increase. Unmodified 8A11 bound U(VI)-DCP with the expected hyperbolic dependence on the concentration of antigen, consistent with independent and equal binding of ligand at both sites. Proteolytic cleavage of the fluorescently conjugated 8A11 to produce the fluorescent monovalent Fab fragment yielded an active preparation that now bound U(VI)-DCP with no evidence of positive cooperativity. Although, in principle, any divalent antibody has the potential to exhibit positive cooperativity in its binding interactions with its antigen, very little literature precedent for this type of behavior exists. Native 8A11 was also noncovalently labeled with highly fluorescent ZENONTM reagents. These reagents are fluorescently-labeled Fab fragments of goat anti-mouse antibodies that bind to the Fc portion of 8A11. These high-affinity, monovalent fluorescent reagents permitted the intact 8A11 mouse antibody to be labeled in situ with no covalent modifications. Incubation of the 8A11 with ZENON 647 produced a fluorescent protein complex that showed an 8-fold higher affinity for U(VI)-DCP than did the free 8A11 alone. Again, very few literature precedents exist for this phenomenon, where agents that bind to the Fc portion of an intact antibody change the affinity of the antibody for the antigen at the structurally distant Fab portion

  16. New Insights into the Functional Behavior of Antibodies as Revealed by Binding Studies on an Anti-Uranium Monoclonal Antibody

    International Nuclear Information System (INIS)

    As part of an ongoing effort to develop immunoassays for chelated uranium(VI) on a hand-held flow fluorimeter, an anti-uranium monoclonal antibody designated as 8A11 was fluorescently labeled using two different strategies. When 8A11 was coupled via reactive lysines to either ALEXATM 488 or Cy5TM, the resulting fluorescent antibody conjugate exhibited positive cooperativity in the presence of its antigen, U(VI) chelated with 2,9-dicarboxy-1,10-phenanthroline (U(VI)-DCP). That is, when one of the two binding sites on the covalently modified 8A11 was occupied with bound antigen, the affinity of the remaining site on the antibody for U(VI)-DCP appeared to increase. Unmodified 8A11 bound U(VI)-DCP with the expected hyperbolic dependence on the concentration of antigen, consistent with independent and equal binding of ligand at both sites. Proteolytic cleavage of the fluorescently conjugated 8A11 to produce the fluorescent monovalent Fab fragment yielded an active preparation that now bound U(VI)-DCP with no evidence of positive cooperativity. Although, in principle, any divalent antibody has the potential to exhibit positive cooperativity in its binding interactions with its antigen, very little literature precedent for this type of behavior exists. Native 8A11 was also noncovalently labeled with highly fluorescent ZENONTM reagents. These reagents are fluorescently-labeled Fab fragments of goat anti-mouse antibodies that bind to the Fc portion of 8A11. These high-affinity, monovalent fluorescent reagents permitted the intact 8A11 mouse antibody to be labeled in situ with no covalent modifications. Incubation of the 8A11 with ZENON 647 produced a fluorescent protein complex that showed an 8-fold higher affinity for U(VI)-DCP than did the free 8A11 alone. Again, very few literature precedents exist for this phenomenon, where agents that bind to the Fc portion of an intact antibody change the affinity of the antibody for the antigen at the structurally distant Fab portion

  17. Construction and bacterial expression of a recombinant single-chain antibody fragment against Wuchereria bancrofti SXP-1 antigen for the diagnosis of lymphatic filariasis.

    Science.gov (United States)

    Kamatchi, R; Charumathi, J; Ravishankaran, R; Kaliraj, P; Meenakshisundaram, S

    2016-01-01

    Global programmes to eliminate lymphatic filariasis (GPELF) require mapping, monitoring and evaluation using filarial antigen diagnostic kits. To meet this objective, a functional single-chain fragment variable (ScFv) specific for filarial Wuchereria bancrofti SXP-1 (Wb-SXP-1) antigen was constructed for the diagnosis of active filarial infection, an alternative to the production of complete antibodies using hybridomas. The variable heavy chain (VH) and the variable light chain (kappa) (Vκ) genes were amplified from the mouse hybridoma cell line and were linked together with a flexible linker by overlap extension polymerase chain reaction (PCR). The ScFv construct (Vκ-Linker-VH) was expressed as a fusion protein with N-terminal His tag in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC) without the addition of reducing agents. Immunoblotting and sandwich enzyme-linked immunosorbent assay (ELISA) were used to analyse the antigen binding affinity of purified ScFv. The purified ScFv was found to recognize recombinant and native Wb-SXP-1 antigen in microfilariae (Mf)-positive patient sera. The affinity of ScFv was comparable with that of the monoclonal antibody. The development of recombinant ScFv to replace monoclonal antibody for detection of filarial antigen was achieved. The recombinant ScFv was purified, on-column refolded and its detection ability validated using field samples. PMID:26693887

  18. Differential analyses of major allergen proteins in wild-type rice and rice producing a fragment of anti-rotavirus antibody.

    Science.gov (United States)

    Yuki, Yoshikazu; Kurokawa, Shiho; Kozuka-Hata, Hiroko; Tokuhara, Daisuke; Mejima, Mio; Kuroda, Masaharu; Oyama, Masaaki; Nishimaki-Mogami, Tomoko; Teshima, Reiko; Kiyono, Hiroshi

    2016-04-01

    To develop oral antibody therapy against rotavirus infection, we previously produced a recombinant fragment of llama heavy-chain antibody to rotavirus (ARP1) in rice seeds (MucoRice-ARP1). We intend to use a purification-free rice powder for clinical application but needed to check whether MucoRice-ARP1 had increased levels of known allergen proteins. For this purpose, we used two-dimensional fluorescence difference gel electrophoresis to compare the allergen protein levels in MucoRice-ARP1 and wild-type rice. We detected no notable differences, except in the levels of α-amylase/trypsin inhibitor-like family proteins. Because by this approach we could not completely separate ARP1 from the proteins of this family, we confirmed the absence of changes in the levels of these allergens by using shotgun mass spectrometry as well as immunoblot. By using immunoelectron microscopy, we also showed that RAG2, a member of the α-amylase/trypsin inhibitor-like protein family, was relocated from protein bodies II to the plasma membrane or cell wall in MucoRice-ARP1 seed. The relocation did not affect the level of RAG2. We demonstrated that most of the known rice allergens were not considerably upregulated by the genetic modification in MucoRice-ARP1. Our data suggest that MucoRice-ARP1 is a potentially safe oral antibody for clinical application. PMID:26851506

  19. EFFECT OF VL AND VH CONSENSUS SEQUENCE-SPECIFIC PRIMERS ON THE BINDING AND EXPRESSION OF A MINI- MOLECULE ANTIBODY DIRECTED TOWARDS HUMAN GASTRIC CANCER

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective. To construct ScFv and Fab from murine anti-gastric cancer monoclonal antibody( mAb)3H11. Methods. At first,3H11 ScFv and Fab were constructed with V genes PCR amplified by degenerate primers for FRI. The bacterial expressed 3H11 Ab fragments showed no antigen binding activity. Then, phage antibody library andrandom mutated library were constructed from 3H1 1 hybridoma cells and panning selection was performed. Again the i-dentification of positive clone was failed. Finally the N-terminal sequences of V regions were resumed to 3H1 1 original sequences by site-directed mutagenesis via PCR. Results. Binding activity to gastric cancer cells was detected only from N-terminal sequence corrected 3H11 ScFv and Fab,though the expression of the Ab fiagments was not affected. Correction of either VL or VH N-terminal se-quences could partially resume the antigen binding activity. Conclusion. Sequence changes of V region N terminal introduced by PCR may seriously affect antigen binding without affecting the expression of antibody. Received for publication Oct. 26,1998.

  20. Passive immunization of guinea-pigs with llama single-domain antibody fragments against foot-and-mouth disease

    NARCIS (Netherlands)

    Harmsen, M.M.; Solt, van C.B.; Fijten, H.P.D.; Keulen, van L.; Rosalia, R.A.; Weerdmeester, K.; Cornelissen, A.H.M.; Bruin, de M.G.M.; Eble, P.L.; Dekker, A.

    2007-01-01

    Foot-and-mouth disease (FMD) is a highly contagious disease that occasionally causes outbreaks in Europe. There is a need for therapies that provide rapid protection against FMD in outbreak situations. We aim to provide such rapid protection by passive immunization with llama single-domain antibody

  1. A Camelid-derived Antibody Fragment Targeting the Active Site of a Serine Protease Balances between Inhibitor and Substrate Behavior

    DEFF Research Database (Denmark)

    Kromann-Hansen, Tobias; Oldenburg, Emil; Yung, Kristen Wing Yu;

    2016-01-01

    -ray crystal structure of a nanobody in complex with a serine protease. The nanobody displays a new type of interaction between an antibody and a serine protease as it inserts its CDR-H3 loop into the active site of the protease in a substrate-like manner. The unique binding mechanism causes the nanobody to...

  2. Cyclization strategies of meditopes: affinity and diffraction studies of meditope-Fab complexes.

    Science.gov (United States)

    Bzymek, Krzysztof P; Ma, Yuelong; Avery, Kendra A; Horne, David A; Williams, John C

    2016-06-01

    Recently, a unique binding site for a cyclic 12-residue peptide was discovered within a cavity formed by the light and heavy chains of the cetuximab Fab domain. In order to better understand the interactions that drive this unique complex, a number of variants including the residues within the meditope peptide and the antibody, as well as the cyclization region of the meditope peptide, were created. Here, multiple crystal structures of meditope peptides incorporating different cyclization strategies bound to the central cavity of the cetuximab Fab domain are presented. The affinity of each cyclic derivative for the Fab was determined by surface plasmon resonance and correlated to structural differences. Overall, it was observed that the disulfide bond used to cyclize the peptide favorably packs against a hydrophobic `pocket' and that amidation and acetylation of the original disulfide meditope increased the overall affinity ∼2.3-fold. Conversely, replacing the terminal cysteines with serines and thus creating a linear peptide reduced the affinity over 50-fold, with much of this difference being reflected in a decrease in the on-rate. Other cyclization methods, including the formation of a lactam, reduced the affinity but not to the extent of the linear peptide. Collectively, the structural and kinetic data presented here indicate that small perturbations introduced by different cyclization strategies can significantly affect the affinity of the meditope-Fab complex. PMID:27303895

  3. Cross-reacting antibacterial auto-antibodies are produced within coronary atherosclerotic plaques of acute coronary syndrome patients.

    Directory of Open Access Journals (Sweden)

    Filippo Canducci

    Full Text Available Coronary atherosclerosis, the main condition predisposing to acute myocardial infarction, has an inflammatory component caused by stimuli that are yet unknown. We molecularly investigated the nature of the immune response within human coronary lesion in four coronary plaques obtained by endoluminal atherectomy from four patients. We constructed phage-display libraries containing the IgG1/kappa antibody fragments produced by B-lymphocytes present in each plaque. By immunoaffinity, we selected from these libraries a monoclonal antibody, arbitrarily named Fab7816, able to react both with coronary and carotid atherosclerotic tissue samples. We also demonstrated by confocal microscopy that this monoclonal antibody recognized human transgelin type 1, a cytoskeleton protein involved in atherogenesis, and that it co-localized with fibrocyte-like cells transgelin+, CD68+, CD45+ in human sections of coronary and carotid plaques. In vitro fibrocytes obtained by differentiating CD14+ cells isolated from peripheral blood mononuclear cells also interacted with Fab7816, thus supporting the hypothesis of a specific recognition of fibrocytes into the atherosclerotic lesions. Interestingly, the same antibody, cross-reacted with the outer membrane proteins of Proteus mirabilis and Klebsiella pneumoniae (and possibly with homologous proteins of other enterobacteriaceae present in the microbiota. From all the other three libraries, we were able to clone, by immunoaffinity selection, human monoclonal antibodies cross-reacting with bacterial outer membrane proteins and with transgelin. These findings demonstrated that in human atherosclerotic plaques a local cross-reactive immune response takes place.

  4. 溶组织内阿米巴重组人单克隆抗体Fab段的筛选与表达%Screening and Expression of Recombinant Human Monoclonal Antibody Fab Fragments Specific to Entamoeba histolytica

    Institute of Scientific and Technical Information of China (English)

    舒勍; 邵红霞; Hiroshi Tachibana; 程训佳

    2004-01-01

    目的制备抗溶组织内阿米巴滋养体表面抗原的重组人单克隆抗体Fab段.方法提取无症状溶组织内阿米巴包囊携带者外周血淋巴细胞,分离总RNA,行逆转录聚合酶链反应扩增IgG轻链和重链Fd片段,并与原核表达质粒连接,转化大肠埃希菌构建抗体库.通过抗原夹心膜法、间接荧光抗体试验等方法,筛选特异性表达抗溶组织内阿米巴滋养体表面抗原的重组人单克隆抗体Fab段的克隆,并纯化其表达产物.结果共筛选3×104个克隆,其中一个克隆表达的Fab段识别的抗原表位位于滋养体表面.结论运用原核表达系统可制备抗溶组织内阿米巴重组人单克隆抗体Fab段,在临床诊断和治疗上均有应用前景.

  5. Fragments of the V1/V2 domain of HIV-1 glycoprotein 120 engineered for improved binding to the broadly neutralizing PG9 antibody.

    Science.gov (United States)

    Morales, Javier F; Yu, Bin; Perez, Gerardo; Mesa, Kathryn A; Alexander, David L; Berman, Phillip W

    2016-09-01

    The V1/V2 domain of the HIV-1 envelope protein gp120 possesses two important epitopes: a glycan-dependent epitope recognized by the prototypic broadly neutralizing monoclonal antibody (bN-mAb), PG9, as well as an epitope recognized by non-neutralizing antibodies that has been associated with protection from HIV infection in the RV144 HIV vaccine trial. Because both of these epitopes are poorly immunogenic in the context of full length envelope proteins, immunization with properly folded and glycosylated fragments (scaffolds) represents a potential way to enhance the immune response to these specific epitopes. Previous studies showed that V1/V2 domain scaffolds could be produced from a few selected isolates, but not from many of the isolates that would be advantageous in a multivalent vaccine. In this paper, we used a protein engineering approach to improve the conformational stability and antibody binding activity of V1/V2 domain scaffolds from multiple diverse isolates, including several that were initially unable to bind the prototypic PG9 bN-mAb. Significantly, this effort required replicating both the correct glycan structure as well as the β-sheet structure required for PG9 binding. Although scaffolds incorporating the glycans required for PG9 binding (e.g., mannose-5) can be produced using glycosylation inhibitors (e.g., swainsonine), or mutant cell lines (e.g. GnTI(-) 293 HEK), these are not practical for biopharmaceutical production of proteins intended for clinical trials. In this report, we describe engineered glycopeptide scaffolds from three different clades of HIV-1 that bind PG9 with high affinity when expressed in a wildtype cell line suitable for biopharmaceutical production. The mutations that improved PG9 binding to scaffolds produced in normal cells included amino acid positions outside of the antibody contact region designed to stabilize the β-sheet and turn structures. The scaffolds produced address three major problems in HIV vaccine

  6. Monoclonal antibody imaging of human melanoma. Radioimmunodetection by subcutaneous or systemic injection

    International Nuclear Information System (INIS)

    Fab fragments of monoclonal antibodies (MoAb) to melanoma, radiolabeled with 131I, were evaluated as diagnostic reagents to determine their ability to localize systemic--MoAb injected intravenously (IV)--or nodal metastatic disease--injected subcutaneously (SQ) at a site proximal to draining lymph nodes. Sixty-one scans were performed (40 IV, 21 SQ) in 59 patients who had injections of 0.2-50 mg of 131I coupled (0.2-12 mCi) antibody. These included 48.7, which identifies a high molecular weight antigen (HMW), or 96.5, which identifies a transferrin like molecule, p97. 125I coupled nonspecific Fab 1.4, reacting with murine leukemia virus, or the whole antibody BL3, reactive with a human B cell idiotypic determinant, was generally used in tandem with the patients injected SQ as a nonspecific control. All patients had immunohistochemical studies performed and demonstrated binding to the antibodies injected. Of the IV patients, 22/38 (58%) had (+) scans, 13 at SQ or nodal sites, four at visceral sites, and five at visceral and SQ sites. Patients with clinical stage II disease had SQ injection of MoAb, including 11 additional patients injected with the whole antibody 9.2.27 (anti-HMW) labeled with 111In (6 patients) or 131I (5 patients). Nodal dissection was performed 2-4 days later. All 111In coupled antibodies demonstrated excellent nodal delineation without specific identification of tumor deposits. Of the 21 patients injected SQ with MoAb, 17 had confirmed tumor in nodes. Of patients injected with Fab fragments, 50% had specific uptake of MoAb, although only two were successfully imaged. Increased uptake of antimelanoma antibodies was observed in some patients in lymph nodes not containing tumor. Clearance of labeled antibody from the injection site occurred with a half life of 16-50 hours. Toxicity was limited to local discomfort at the site of SQ injection

  7. An Exopolysaccharide-Deficient Mutant of Lactobacillus rhamnosus GG Efficiently Displays a Protective Llama Antibody Fragment against Rotavirus on Its Surface.

    Science.gov (United States)

    Álvarez, Beatriz; Krogh-Andersen, Kasper; Tellgren-Roth, Christian; Martínez, Noelia; Günaydın, Gökçe; Lin, Yin; Martín, M Cruz; Álvarez, Miguel A; Hammarström, Lennart; Marcotte, Harold

    2015-09-01

    Rotavirus is the leading cause of infantile diarrhea in developing countries, where it causes a high number of deaths among infants. Two vaccines are available, being highly effective in developed countries although markedly less efficient in developing countries. As a complementary treatment to the vaccines, a Lactobacillus strain producing an anti-rotavirus antibody fragment in the gastrointestinal tract could potentially be used. In order to develop such an alternative therapy, the effectiveness of Lactobacillus rhamnosus GG to produce and display a VHH antibody fragment (referred to as anti-rotavirus protein 1 [ARP1]) on the surface was investigated. L. rhamnosus GG is one of the best-characterized probiotic bacteria and has intrinsic antirotavirus activity. Among four L. rhamnosus GG strains [GG (CMC), GG (ATCC 53103), GG (NCC 3003), and GG (UT)] originating from different sources, only GG (UT) was able to display ARP1 on the bacterial surface. The genomic analysis of strain GG (UT) showed that the genes welE and welF of the EPS cluster are inactivated, which causes a defect in exopolysaccharide (EPS) production, allowing efficient display of ARP1 on its surface. Finally, GG (UT) seemed to confer a level of protection against rotavirus-induced diarrhea similar to that of wild-type GG (NCC 3003) in a mouse pup model, indicating that the EPS may not be involved in the intrinsic antirotavirus activity. Most important, GG (EM233), a derivative of GG (UT) producing ARP1, was significantly more protective than the control strain L. casei BL23. PMID:26092449

  8. Breakdown of C3 after complement activation. Identification of a new fragment C3g, using monoclonal antibodies

    OpenAIRE

    1982-01-01

    The physiological breakdown of C3 has been studied using monoclonal anti-C3 antibodies, and it has been found that the later stages of this process--the breakdown of C3bi--is more complex than had previously been recognized. C3bi is the reaction product produced from C3b by the action of factor I which, in the presence of factor H, produces a double cleavage in the alpha chain of C3b. It is here reported that, both on cells and in the fluid phase, the breakdown of C3bi in serum gives rise to ...

  9. Structural basis for the binding of the neutralizing antibody, 7D11, to the poxvirus L1 protein

    International Nuclear Information System (INIS)

    Medical countermeasures to prevent or treat smallpox are needed due to the potential use of poxviruses as biological weapons. Safety concerns with the currently available smallpox vaccine indicate a need for research on alternative poxvirus vaccine strategies. Molecular vaccines involving the use of proteins and/or genes and recombinant antibodies are among the strategies under current investigation. The poxvirus L1 protein, encoded by the L1R open reading frame, is the target of neutralizing antibodies and has been successfully used as a component of both protein subunit and DNA vaccines. L1-specific monoclonal antibodies (e.g., mouse monoclonal antibody mAb-7D11, mAb-10F5) with potent neutralizing activity bind L1 in a conformation-specific manner. This suggests that proper folding of the L1 protein used in molecular vaccines will affect the production of neutralizing antibodies and protection. Here, we co-crystallized the Fab fragment of mAb-7D11 with the L1 protein. The crystal structure of the complex between Fab-7D11 and L1 reveals the basis for the conformation-specific binding as recognition of a discontinuous epitope containing two loops that are held together by a disulfide bond. The structure of this important conformational epitope of L1 will contribute to the development of molecular poxvirus vaccines and also provides a novel target for anti-poxvirus drugs. In addition, the sequence and structure of Fab-7D11 will contribute to the development of L1-targeted immunotherapeutics

  10. Structural Basis of Neutralization of the Major Toxic Component from the Scorpion Centruroides noxius Hoffmann by a Human-derived Single-chain Antibody Fragment

    Energy Technology Data Exchange (ETDEWEB)

    Canul-Tec, Juan Carlos; Riaño-Umbarila, Lidia; Rudiño-Piñera, Enrique; Becerril, Baltazar; Possani, Lourival D.; Torres-Larios, Alfredo (U. NAM)

    2011-08-09

    It has previously been reported that several single-chain antibody fragments of human origin (scFv) neutralize the effects of two different scorpion venoms through interactions with the primary toxins of Centruroides noxius Hoffmann (Cn2) and Centruroides suffusus suffusus (Css2). Here we present the crystal structure of the complex formed between one scFv (9004G) and the Cn2 toxin, determined in two crystal forms at 2.5 and 1.9 {angstrom} resolution. A 15-residue span of the toxin is recognized by the antibody through a cleft formed by residues from five of the complementarity-determining regions of the scFv. Analysis of the interface of the complex reveals three features. First, the epitope of toxin Cn2 overlaps with essential residues for the binding of {beta}-toxins to its Na+ channel receptor site. Second, the putative recognition of Css2 involves mainly residues that are present in both Cn2 and Css2 toxins. Finally, the effect on the increase of affinity of previously reported key residues during the maturation process of different scFvs can be inferred from the structure. Taken together, these results provide the structural basis that explain the mechanism of the 9004G neutralizing activity and give insight into the process of directed evolution that gave rise to this family of neutralizing scFvs.

  11. Photoluminescence detection of 2,4,6-trinitrotoluene (TNT) binding on diatom frustule biosilica functionalized with an anti-TNT monoclonal antibody fragment.

    Science.gov (United States)

    Zhen, Le; Ford, Nicole; Gale, Debra K; Roesijadi, Guritno; Rorrer, Gregory L

    2016-05-15

    A selective and label-free biosensor for detection of the explosive compound 2,4,6-trinitrotoluene (TNT) in aqueous solution was developed based on the principle of photoluminescence quenching of upon immunocomplex formation with antibody-functionalized diatom frustule biosilica. The diatom frustule is an intricately nanostructured, highly porous biogenic silica material derived from the shells of microscopic algae called diatoms. This material emits strong visible blue photoluminescence (PL) upon UV excitation. PL-active frustule biosilica was isolated from cultured cells of the marine diatom Pinnularia sp. and functionalized with a single chain variable fragment (scFv) derived from an anti-TNT monoclonal antibody. When TNT was bound to the anti-TNT scFv-functionalized diatom frustule biosilica, the PL emission from the biosilica was partially quenched due to the electrophilic nature of the nitro (-NO2) groups on the TNT molecule. The dose-response curve for immunocomplex formation of TNT on the scFv-functionalized diatom frustule biosilica had a half-saturation binding constant of 6.4 ± 2.4·10(-8)M and statistically-significant measured detection limit of 3.5·10(-8)M. The binding and detection were selective for TNT and TNB (trinitrobenzene) but not RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) or 2,6-DNT (2,6-dinitrotoluene). PMID:26774089

  12. The use of a cocktail of single chain Fv antibody fragments to improve the in vitro and in vivo targeting of melanoma

    International Nuclear Information System (INIS)

    Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 125Iodine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells

  13. Radioimmunoimaging of experimental thrombi in dogs using Tc-99m labeled monoclonal antibody fragments [MAPab-F(ab')/sub 2/] reactive with human platelets

    International Nuclear Information System (INIS)

    Radioimmunoimaging of thrombi could have great clinical value in the management of coronary artery and thromboembolic disease. In-111-oxine-labeled platelets currently used require platelet isolation, delayed imaging, background subtraction and there is also potential for damaging or contaminating platelets during labeling. Murine monoclonal antibody (IgG/sub 2/a) fragments directed against human platelet membrane components (cross-reactive with dog platelets) were labeled with Tc-99m and repurified from ''kits''. After radiolabeling, 91.5-93.3% of the Tc-99m was antibody-associated. The preparations retained immunoreactivity, as determined by the ratio of cell to plasma-associated radioactivity (ratios 54.7-63.8). Tc-99m-MAPAb-F(ab')/sub 2/ were injected i.v. into dogs with thrombi produced in peripheral and pulmonary veins and arteries. About 50% of the radioactivity was cleared from the blood in 3-6 min. and 18-24% was excreted in the urine within 3 hrs. The thrombi were consistently and easily visible within 1-3 hrs. with no need for blood pool subtraction. In some cases, intimal damage along the path of catheters was seen. No adverse side effects were observed. The advantages of this method are: short and simple preparation, no need for blood pool subtraction and early visualization of thrombi. Human studies are warranted to determine its clinical efficacy

  14. Directed Selection of Recombinant Human Monoclonal Antibodies to Herpes Simplex Virus Glycoproteins from Phage Display Libraries

    Science.gov (United States)

    Sanna, Pietro Paolo; Williamson, R. Anthony; de Logu, Alessandro; Bloom, Floyd E.; Burton, Dennis R.

    1995-07-01

    Human monoclonal antibodies have considerable potential in the prophylaxis and treatment of viral disease. However, only a few such antibodies suitable for clinical use have been produced to date. We have previously shown that large panels of human recombinant monoclonal antibodies against a plethora of infectious agents, including herpes simplex virus types 1 and 2, can be established from phage display libraries. Here we demonstrate that facile cloning of recombinant Fab fragments against specific viral proteins in their native conformation can be accomplished by panning phage display libraries against viral glycoproteins "captured" from infected cell extracts by specific monoclonal antibodies immobilized on ELISA plates. We have tested this strategy by isolating six neutralizing recombinant antibodies specific for herpes simplex glycoprotein gD or gB, some of which are against conformationally sensitive epitopes. By using defined monoclonal antibodies for the antigen-capture step, this method can be used for the isolation of antibodies to specific regions and epitopes within the target viral protein. For instance, monoclonal antibodies to a nonneutralizing epitope can be used in the capture step to clone antibodies to neutralizing epitopes, or antibodies to a neutralizing epitope can be used to clone antibodies to a different neutralizing epitope. Furthermore, by using capturing antibodies to more immunodominant epitopes, one can direct the cloning to less immunogenic ones. This method should be of value in generating antibodies to be used both in the prophylaxis and treatment of viral infections and in the characterization of the mechanisms of antibody protective actions at the molecular level.

  15. A recombinant mimetics of the HIV-1 gp41 prehairpin fusion intermediate fused with human IgG Fc fragment elicits neutralizing antibody response in the vaccinated mice

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Zhi; Pan, Chungen; Lu, Hong; Shui, Yuan [Lindsley F. Kimball Research Institute, New York Blood Center, New York, NY 10065 (United States); Li, Lin [Lindsley F. Kimball Research Institute, New York Blood Center, New York, NY 10065 (United States); School of Pharmaceutical Sciences, Southern Medical University, Guangzhou, Guangdong 510515 (China); Li, Xiaojuan; Xu, Xueqing; Liu, Shuwen [School of Pharmaceutical Sciences, Southern Medical University, Guangzhou, Guangdong 510515 (China); Jiang, Shibo, E-mail: sjiang@nybloodcenter.org [Lindsley F. Kimball Research Institute, New York Blood Center, New York, NY 10065 (United States); School of Pharmaceutical Sciences, Southern Medical University, Guangzhou, Guangdong 510515 (China)

    2010-07-30

    Research highlights: {yields} One recombinant mimetics of gp41 prehairpin fusion intermediate (PFI) consisting of gp41 N46 sequence, foldon and IgG Fc, designated N46FdFc, was expressed. {yields} N46FdFc-induced antibodies in mice that neutralized HIV-1 infection, inhibited PIE7 binding to PFI, blocked gp41 six-helix bundle formation, and suppressed HIV-1 mediated cell-cell fusion. {yields} These findings provide an important clue for developing recombinant gp41 PFI mimetics-based HIV vaccines. -- Abstract: HIV-1 gp41 prehairpin fusion intermediate (PFI) composed of three N-terminal heptad repeats (NHR) plays a crucial role in viral fusion and entry and represents an attractive target for anti-HIV therapeutics (e.g., enfuvirtide) and vaccines. In present study, we constructed and expressed two recombinant gp41 PFI mimetics, designated N46Fd and N46FdFc. N46Fd consists of N46 (residues 536-581) in gp41 NHR and foldon (Fd), a trimerization motif. N46FdFc is composed of N46Fd fused with human IgG Fc fragment as an immunoenhancer. We immunized mice with N46 peptide, N46Fd and N46FdFc, respectively, and found that only N46FdFc elicited neutralizing antibody response in mice against infection by HIV-1 strains IIIB (clade B, X4), 92US657 (clade B, R5), and 94UG103 (clade A, X4R5). Anti-N46FdFc antibodies inhibited PIE7 binding to PFI, blocked gp41 six-helix bundle formation, and suppressed HIV-1 mediated cell-cell fusion. These findings provide an important clue for developing recombinant gp41 PFI mimetics-based HIV vaccines.

  16. A recombinant mimetics of the HIV-1 gp41 prehairpin fusion intermediate fused with human IgG Fc fragment elicits neutralizing antibody response in the vaccinated mice

    International Nuclear Information System (INIS)

    Research highlights: → One recombinant mimetics of gp41 prehairpin fusion intermediate (PFI) consisting of gp41 N46 sequence, foldon and IgG Fc, designated N46FdFc, was expressed. → N46FdFc-induced antibodies in mice that neutralized HIV-1 infection, inhibited PIE7 binding to PFI, blocked gp41 six-helix bundle formation, and suppressed HIV-1 mediated cell-cell fusion. → These findings provide an important clue for developing recombinant gp41 PFI mimetics-based HIV vaccines. -- Abstract: HIV-1 gp41 prehairpin fusion intermediate (PFI) composed of three N-terminal heptad repeats (NHR) plays a crucial role in viral fusion and entry and represents an attractive target for anti-HIV therapeutics (e.g., enfuvirtide) and vaccines. In present study, we constructed and expressed two recombinant gp41 PFI mimetics, designated N46Fd and N46FdFc. N46Fd consists of N46 (residues 536-581) in gp41 NHR and foldon (Fd), a trimerization motif. N46FdFc is composed of N46Fd fused with human IgG Fc fragment as an immunoenhancer. We immunized mice with N46 peptide, N46Fd and N46FdFc, respectively, and found that only N46FdFc elicited neutralizing antibody response in mice against infection by HIV-1 strains IIIB (clade B, X4), 92US657 (clade B, R5), and 94UG103 (clade A, X4R5). Anti-N46FdFc antibodies inhibited PIE7 binding to PFI, blocked gp41 six-helix bundle formation, and suppressed HIV-1 mediated cell-cell fusion. These findings provide an important clue for developing recombinant gp41 PFI mimetics-based HIV vaccines.

  17. Synthesis and pre-clinical evaluation of an (18)F-labeled single-chain antibody fragment for PET imaging of epithelial ovarian cancer.

    Science.gov (United States)

    Sharma, Sai Kiran; Wuest, Melinda; Way, Jenilee D; Bouvet, Vincent R; Wang, Monica; Wuest, Frank R

    2016-01-01

    Anti-CA125 antibodies have been used in immunoassays to quantify levels of shed antigen in the serum of patients who are under surveillance for epithelial ovarian cancer (EOC). However, there is currently no molecular imaging probe in the clinic for the assessment of CA125 expression in vivo. The present study describes the development of an (18)F-labeled single-chain variable fragment (scFv) for PET imaging of CA125 in preclinical EOC models. Anti-CA125 scFv was derived from MAb-B43.13 by recombinant expression of the fragment in E.coli. Fragment scFv-B43.13 was purified via immobilized metal affinity chromatography and characterized for antigen binding via immuno-staining and flow cytometry. Prosthetic group N-succinimidyl 4-[(18)F]fluorobenzoate ([(18)F]SFB) was used for radiolabeling of scFv-B43.13. Preclinical ovarian cancer models were developed based on ovarian cancer cell lines OVCAR3 (CA125-positive) and SKOV3 (CA125-negative) in NIH-III mice. The radiopharmacological profile of (18)F-labeled scFv-B43.13 ([(18)F]FBz-scFv-B43.13) was studied with PET. [(18)F]FBz-scFv-B43.13 was prepared in radiochemical yields of 3.7 ± 1.8% (n = 5) at an effective specific activity of 3.88 ± 0.76 GBq/µmol (n = 5). The radiotracer demonstrated selective uptake in CA125-positive OVCAR3 cells and virtually no uptake in CA125-negative SKOV3 cells. Standardized uptake values (SUV) of radioactivity uptake in OVCAR3 tumors was 0.5 (n = 3) and 0.3 (n = 2) in SKOV3 tumors after 60 min post injection (p.i.). PMID:27508105

  18. Synthesis and pre-clinical evaluation of an 18F-labeled single-chain antibody fragment for PET imaging of epithelial ovarian cancer

    Science.gov (United States)

    Sharma, Sai Kiran; Wuest, Melinda; Way, Jenilee D; Bouvet, Vincent R; Wang, Monica; Wuest, Frank R

    2016-01-01

    Anti-CA125 antibodies have been used in immunoassays to quantify levels of shed antigen in the serum of patients who are under surveillance for epithelial ovarian cancer (EOC). However, there is currently no molecular imaging probe in the clinic for the assessment of CA125 expression in vivo. The present study describes the development of an 18F-labeled single-chain variable fragment (scFv) for PET imaging of CA125 in preclinical EOC models. Anti-CA125 scFv was derived from MAb-B43.13 by recombinant expression of the fragment in E.coli. Fragment scFv-B43.13 was purified via immobilized metal affinity chromatography and characterized for antigen binding via immuno-staining and flow cytometry. Prosthetic group N-succinimidyl 4-[18F]fluorobenzoate ([18F]SFB) was used for radiolabeling of scFv-B43.13. Preclinical ovarian cancer models were developed based on ovarian cancer cell lines OVCAR3 (CA125-positive) and SKOV3 (CA125-negative) in NIH-III mice. The radiopharmacological profile of 18F-labeled scFv-B43.13 ([18F]FBz-scFv-B43.13) was studied with PET. [18F]FBz-scFv-B43.13 was prepared in radiochemical yields of 3.7 ± 1.8% (n = 5) at an effective specific activity of 3.88 ± 0.76 GBq/µmol (n = 5). The radiotracer demonstrated selective uptake in CA125-positive OVCAR3 cells and virtually no uptake in CA125-negative SKOV3 cells. Standardized uptake values (SUV) of radioactivity uptake in OVCAR3 tumors was 0.5 (n = 3) and 0.3 (n = 2) in SKOV3 tumors after 60 min post injection (p.i.). PMID:27508105

  19. Novel Camelid Antibody Fragments Targeting Recombinant Nucleoprotein of Araucaria hantavirus: A Prototype for an Early Diagnosis of Hantavirus Pulmonary Syndrome

    Science.gov (United States)

    Pereira, Soraya S.; Moreira-Dill, Leandro S.; Morais, Michelle S. S.; Prado, Nidiane D. R.; Barros, Marcos L.; Koishi, Andrea C.; Mazarrotto, Giovanny A. C. A.; Gonçalves, Giselle M.; Zuliani, Juliana P.; Calderon, Leonardo A.; Soares, Andreimar M.; Pereira da Silva, Luiz H.; Duarte dos Santos, Claudia N.; Fernandes, Carla F. C.; Stabeli, Rodrigo G.

    2014-01-01

    In addition to conventional antibodies, camelids produce immunoglobulins G composed exclusively of heavy chains in which the antigen binding site is formed only by single domains called VHH. Their particular characteristics make VHHs interesting tools for drug-delivery, passive immunotherapy and high-throughput diagnosis. Hantaviruses are rodent-borne viruses of the Bunyaviridae family. Two clinical forms of the infection are known. Hemorrhagic Fever with Renal Syndrome (HFRS) is present in the Old World, while Hantavirus Pulmonary Syndrome (HPS) is found on the American continent. There is no specific treatment for HPS and its diagnosis is carried out by molecular or serological techniques, using mainly monoclonal antibodies or hantavirus nucleoprotein (N) to detect IgM and IgG in patient serum. This study proposes the use of camelid VHHs to develop alternative methods for diagnosing and confirming HPS. Phage display technology was employed to obtain VHHs. After immunizing one Lama glama against the recombinant N protein (prNΔ85) of a Brazilian hantavirus strain, VHH regions were isolated to construct an immune library. VHHs were displayed fused to the M13KO7 phage coat protein III and the selection steps were performed on immobilized prNΔ85. After selection, eighty clones recognized specifically the N protein. These were sequenced, grouped based mainly on the CDRs, and five clones were analyzed by western blot (WB), surface plasmon resonance (SPR) device, and ELISA. Besides the ability to recognize prNΔ85 by WB, all selected clones showed affinity constants in the nanomolar range. Additionaly, the clone KC329705 is able to detect prNΔ85 in solution, as well as the native viral antigen. Findings support the hypothesis that selected VHHs could be a powerful tool in the development of rapid and accurate HPS diagnostic assays, which are essential to provide supportive care to patients and reduce the high mortality rate associated with hantavirus infections. PMID

  20. The effect of internalizing human single chain antibody fragment on liposome targeting to epithelioid and sarcomatoid mesothelioma

    Science.gov (United States)

    Iyer, Arun K.; Su, Yang; Feng, Jinjin; Lan, Xiaoli; Zhu, Xiaodong; Liu, Yue; Gao, Dongwei; Seo, Youngho; VanBrocklin, Henry F.; Broaddus, V. Courtney; Liu, Bin; He, Jiang

    2011-01-01

    Immunoliposomes (ILs) anchored with internalizing human antibodies capable of targeting all subtypes of mesothelioma can be useful for targeted imaging and therapy of this malignant disease. The objectives of this study were to evaluate both the in vitro and in vivo tumor targeted internalization of novel internalizing human single chain antibody (scFv) anchored ILs on both epithelioid (M28) and sarcomatoid (VAMT-1) subtypes of human mesothelioma. ILs were prepared by post-insertion of mesothelioma-targeting human scFv (M1) onto preformed liposomes and radiolabeled with 111In (111In-IL-M1), along with control non-targeted liposomes (111In-CL). Incubation of 111In-IL-M1 with M28, VAMT-1, and a control non-tumorigenic cell-line (BPH-1) at 37°C for 24 h revealed efficient binding and rapid internalization of ILs into both subtypes of tumor cells but not into the BPH-1 cells; internalization accounted for approximately 81-94% of total cell accumulation in mesothelioma cells compared to 37-55% in control cells. In tumor bearing mice intravenous (i.v.) injection of 111In-IL-M1 led to remarkable tumor accumulation: 4 % and 4.7% injected dose per gram (% ID/g) for M28 and VAMT-1 tumors, respectively, 48 h after injection. Furthermore, tumor uptake of 111In-IL-M1 in live xenograft animal models was verified by single photon emission computed tomography (SPECT/CT). In contrast, i.v. injection of 111In-CL in tumor-bearing mice revealed very low uptake in both subtypes of mesothelioma, 48 h after injection. In conclusion, M1 scFv-anchored ILs showed selective tumor targeting and rapid internalization into both epithelioid and sarcomatoid subtypes of human mesothelioma, demonstrating its potential as a promising vector for enhanced tumor drug targeting. PMID:21255833

  1. Mask qualification strategies in a wafer fab

    Science.gov (United States)

    Jaehnert, Carmen; Kunowski, Angela

    2007-02-01

    Having consistent high quality photo masks is one of the key factors in lithography in the wafer fab. Combined with stable exposure- and resist processes, it ensures yield increases in production and fast learning cycles for technology development and design evaluation. Preventive controlling of incoming masks and quality monitoring while using the mask in production is essential for the fab to avoid yield loss or technical problems caused by mask issues, which eventually result in delivery problems to the customer. In this paper an overview of the procedures used for mask qualification and production release, for both logic and DRAM, at Infineon Dresden is presented. Incoming qualification procedures, such as specification checks, incoming inspection, and inline litho process window evaluation, are described here. Pinching and electrical tests, including compatibility tests for mask copies for high volume products on optimized litho processes, are also explained. To avoid mask degradation over lifetime, re-inspection checks are done for re-qualification while using the mask in production. The necessity of mask incoming inspection and re-qualification, due to the repeater printing from either the processing defects of the original mask or degrading defects of being used in the fab (i.e. haze, ESD, and moving particles, etc.), is demonstrated. The need and impact of tight mask specifications, such as CD uniformity signatures and corresponding electrical results, are shown with examples of mask-wafer CD correlation.

  2. Validated LC-MS/MS analysis of immune checkpoint inhibitor Nivolumab in human plasma using a Fab peptide-selective quantitation method: nano-surface and molecular-orientation limited (nSMOL) proteolysis.

    Science.gov (United States)

    Iwamoto, Noriko; Shimada, Takashi; Terakado, Hiroyuki; Hamada, Akinobu

    2016-06-15

    We previously reported the nano-surface and molecular-orientation limited (nSMOL) proteolysis, which is a novel method for selective quantitation of monoclonal antibody Fab. The nSMOL strategy is a Fab-selective limited proteolysis which utilizes the size difference between the protease nanoparticle (200nm) and the antibody resin pore (100nm). Here, we applied this method to a fully validated LCMS analysis of Nivolumab in human plasma. The immunoglobulin fraction was collected using Protein A resin, which was then followed by nSMOL reaction using the FG nanoparticle surface-immobilized trypsin under a nondenaturing physiological condition at 50°C for 7h. After removal of resin and nanoparticles by filter centrifugation, signature peptides were separated using the ODS column liquid chromatography. The signature peptide ASGITFSNSGMHWVR from Nivolumab complementarity-determining region (CDR) and the P14R internal standard were simultaneously quantified by multiple-reaction monitoring (MRM) LCMS, with parent m/z 550.8>fragment m/z 661.5 (y11 2+). The lower limit of quantification (LLOQ) of Nivolumab using the nSMOL method was 0.977μg/ml, with a linear dynamic range of from 0.977 to 250μg/ml. The intra- and inter-assay precision of LLOQ, low quality control (LQC), middle quality control (MQC), and high quality control (HQC) were 7.56-17.9% and 15.6%, 6.99-9.25% and 7.51%, 2.51-8.85% and 8.01%, and 4.78-7.33% and 6.75%, respectively. Our study demonstrates that the nSMOL bioanalysis can be utilized as a reliable method for clinical pharmacokinetic studies of Nivolumab and other antibody drugs. PMID:27155936

  3. Radioimmunoscintigraphy of non-small cell lung cancer using Tc-99m ANTI-CEA FAB` (immuRAID CEA)

    Energy Technology Data Exchange (ETDEWEB)

    Fig, L.M. [DVA Medical Center, Ann Arbor, MI (United States); Hughes, L.; Pinsky, C.M. [Immunomedics Inc., Morris Plains, NJ (United States)] [and others

    1994-05-01

    We conducted a Phase II prospective multicenter clinical trial to investigate the safety and efficacy of Tc-99M anti-CEA Fab`(ImmuRAID-CEA) in patients with non-small cell lung cancer. Fifty four patients (42 male; 12 female; age range 40-93 yr) had primary operable (19), primary inoperable (7), occult (9), metastatic (15) or recurrent (4) disease. Patients were injected with 1 mg ImmuRAID-CEA radiolabeled with 20-30 mCi Tc-99m pertechnetate and imaged at 4-8 and 18-24 hr by planar and SPECT techniques; ten were imaged at 15-18 hr only. Despite prominent blood pool activity at 4-8 hr. overall imaging statistics on a per patient basis revealed a sensitivity of tumor detection of 90%, accuracy 85% and positive predictive value 94%. The later images had lower count rates but target to background ratios were improved. On a per lesion basis, sensitivity in the chest was 69% and in liver 88%. Twenty four patients had additional foci of antibody uptake at sites previously believed to be uninvolved; cancer was confirmed in 11, not confirmed in 2 and currently indeterminate in 11. Furthermore, a negative scan confirmed equivocal radiographic studies as true negative in 5 patients. With respect to safety, there were no adverse clinical reactions and four minor, transient changes in hematologic and/or biochemical parameters. Human anti-mouse antibody (HAMA) determinations on 27 patients using ImmuSTRIP{reg_sign} HAMA Fragment assay were negative at 4-6 weeks or 3 months post-infusion. We conclude that imaging with ImmuRAID-CEA is safe and potentially useful for the evaluation and staging of lung cancer patients.

  4. A Camelid-derived Antibody Fragment Targeting the Active Site of a Serine Protease Balances between Inhibitor and Substrate Behavior.

    Science.gov (United States)

    Kromann-Hansen, Tobias; Oldenburg, Emil; Yung, Kristen Wing Yu; Ghassabeh, Gholamreza H; Muyldermans, Serge; Declerck, Paul J; Huang, Mingdong; Andreasen, Peter A; Ngo, Jacky Chi Ki

    2016-07-15

    A peptide segment that binds the active site of a serine protease in a substrate-like manner may behave like an inhibitor or a substrate. However, there is sparse information on which factors determine the behavior a particular peptide segment will exhibit. Here, we describe the first x-ray crystal structure of a nanobody in complex with a serine protease. The nanobody displays a new type of interaction between an antibody and a serine protease as it inserts its complementary determining region-H3 loop into the active site of the protease in a substrate-like manner. The unique binding mechanism causes the nanobody to behave as a strong inhibitor as well as a poor substrate. Intriguingly, its substrate behavior is incomplete, as 30-40% of the nanobody remained intact and inhibitory after prolonged incubation with the protease. Biochemical analysis reveals that an intra-loop interaction network within the complementary determining region-H3 of the nanobody balances its inhibitor versus substrate behavior. Collectively, our results unveil molecular factors, which may be a general mechanism to determine the substrate versus inhibitor behavior of other protease inhibitors. PMID:27226628

  5. Evaluation of indium-111-labeled anti-fibrin antibody for imaging vascular thrombi

    International Nuclear Information System (INIS)

    Monoclonal antibody 59D8 developed by Hui et al., binds to fibrin but not fibrinogen. An 111In-labeled Fab fragment of 59D8 was studied in vitro and in animal models to evaluate its potential for imaging thrombi and emboli in man. Rabbits and dogs were used as models for studying thrombus uptake in vivo. Thrombi and emboli up to 4 days old were successfully visualized at 4-24 hr postinjection in five of eight rabbits. In dogs, 0.5-hr-old and 24-hr-old thrombi were successfully imaged at 24 hr in six of eight animals, and 3/6 of these were positive at 3-4 hr postinjection. Thrombus-to-blood ratios in the dogs averaged 7.1 +/- 1.3. The findings suggest this antibody may be useful for imaging thrombi in man

  6. The antitumor efficacy of a novel adenovirus-mediated anti-p21Ras single chain fragment variable antibody on human cancers in vitro and in vivo.

    Science.gov (United States)

    Yang, Ju-Lun; Pan, Xin-Yan; Zhao, Wen-Xing; Hu, Qi-Chan; Ding, Feng; Feng, Qiang; Li, Gui-Yun; Luo, Ying

    2016-03-01

    Activated ras genes are found in a large number of human tumors, and therefore are one of important targets for cancer therapy. This study investigated the antitumor effects of a novel single chain fragment variable antibody (scFv) against ras protein, p21Ras. The anti-p21Ras scFv gene was constructed by phage display library from hybridoma KGHR1, and then subcloned into replication-defective adenovirus vector to obtain recombinant adenovirus KGHV100. Human tumor cell lines with high expression of p21Ras SW480, MDA-MB‑231, OVCAR-3, BEL-7402, as well as tumor cell line with low expression of p21Ras, SKOV3, were employed to investigate antitumor effects in vitro and in vivo. Fluorescence microscopy demonstrated that KGHV100 was able to express intracellularly anti-p21Ras scFv antibody in cultured tumor cells and in transplantation tumor cells. MTT, Transwell, colony formation, and flow cytometry analysis showed that KGHV100 led to significant growth arrest in tumor cells with high p21Ras expression, and induced G0/G1 cell cycle arrest in the studied tumor cell lines. In vivo, KGHV100 significantly inhibited tumor growth following intratumoral injection, and the survival rates of the mice were higher than the control group. These results indicate that the adenovirus-mediated intracellular expression of the novel anti-p21Ras scFv exerted strong antitumoral effects, and may be a potential method for therapy of cancers with p21Ras overexpression. PMID:26780944

  7. Anti-CD20 single chain variable antibody fragment-apolipoprotein A-I chimera containing nanodisks promote targeted bioactive agent delivery to CD20-positive lymphomas.

    Science.gov (United States)

    Crosby, Natasha M; Ghosh, Mistuni; Su, Betty; Beckstead, Jennifer A; Kamei, Ayako; Simonsen, Jens B; Luo, Bing; Gordon, Leo I; Forte, Trudy M; Ryan, Robert O

    2015-08-01

    A fusion protein comprising an α-CD20 single chain variable fragment (scFv) antibody, a spacer peptide, and human apolipoprotein (apo) A-I was constructed and expressed in Escherichia coli. The lipid interaction properties intrinsic to apoA-I as well as the antigen recognition properties of the scFv were retained by the chimera. scFv•apoA-I was formulated into nanoscale reconstituted high-density lipoprotein particles (termed nanodisks; ND) and incubated with cultured cells. α-CD20 scFv•apoA-I ND bound to CD20-positive non-Hodgkins lymphoma (NHL) cells (Ramos and Granta) but not to CD20-negative T lymphocytes (i.e., Jurkat). Binding to NHL cells was partially inhibited by pre-incubation with rituximab, a monoclonal antibody directed against CD20. Confocal fluorescence microscopy analysis of Granta cells following incubation with α-CD20 scFv•apoA-I ND formulated with the intrinsically fluorescent hydrophobic polyphenol, curcumin, revealed α-CD20 scFv•apoA-I localizes to the cell surface, while curcumin off-loads and gains entry to the cell. Compared to control incubations, viability of cultured NHL cells was decreased upon incubation with α-CD20 scFv•apoA-I ND harboring curcumin. Thus, formulation of curcumin ND with α-CD20 scFv•apoA-I as the scaffold component confers cell targeting and enhanced bioactive agent delivery, providing a strategy to minimize toxicity associated with chemotherapeutic agents. PMID:25994015

  8. Application of adaptive DO-stat feeding control to Pichia pastoris X33 cultures expressing a single chain antibody fragment (scFv).

    Science.gov (United States)

    Ferreira, A R; Ataíde, F; von Stosch, M; Dias, J M L; Clemente, J J; Cunha, A E; Oliveira, R

    2012-11-01

    In this study, fed-batch cultures of a Pichia pastoris strain constitutively expressing a single chain antibody fragment (scFv) under the control of the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter were performed in a pilot 50 L bioreactor. Due to the very high cell density achieved within the first 75 h, typically between 140 and 160 g-DCW/L of dry cell weight (DCW), most of the scFv is produced under hard oxygen transfer limitation. To improve scFv productivity, a direct adaptive dissolved oxygen (DO)-stat feeding controller that maximizes glycerol feeding under the constraint of available oxygen transfer capacity was developed and applied to this process. The developed adaptive controller enabled to maximize glycerol feeding through the regulation of DO concentration between 3 and 5 % of saturation, thereby improving process productivity. Set-point convergence dynamics are characterized by a fast response upon large perturbations to DO, followed by a slower but very robust convergence in the vicinity of the boundary with almost imperceptible overshoot. Such control performance enabled operating closer to the 0 % boundary for longer periods of time when compared to a traditional proportional-integral-derivative algorithm, which tends to destabilize with increasing cell density. PMID:22610694

  9. The cosmology of the Fab-Four

    CERN Document Server

    Copeland, Edmund J; Saffin, Paul M

    2012-01-01

    We have recently proposed a novel self tuning mechanism to alleviate the famous cosmological constant problem, based on the general scalar tensor theory proposed by Horndeski. The self-tuning model ends up consisting of four geometric terms in the action, with each term containing a free potential function of the scalar field; the four together being labeled as the Fab-Four. In this paper we begin the important task of deriving the cosmology associated with the Fab-Four Lagrangian. Performing a phase plane analysis of the system we are able to obtain a number of fixed points for the system, with some remarkable new solutions emerging from the trade-off between the various potentials. As well as obtaining inflationary solutions we also find conventional radiation/matter-like solutions, but in regimes where the energy density is dominated by a cosmological constant, and where we do not have any explicit forms of radiation or matter. Stability conditions for matter solutions are obtained and we show how it is po...

  10. Antibody-dependent cellular cytotoxicity-mediating antibodies from an HIV-1 vaccine efficacy trial target multiple epitopes and preferentially use the VH1 gene family.

    Science.gov (United States)

    Bonsignori, Mattia; Pollara, Justin; Moody, M Anthony; Alpert, Michael D; Chen, Xi; Hwang, Kwan-Ki; Gilbert, Peter B; Huang, Ying; Gurley, Thaddeus C; Kozink, Daniel M; Marshall, Dawn J; Whitesides, John F; Tsao, Chun-Yen; Kaewkungwal, Jaranit; Nitayaphan, Sorachai; Pitisuttithum, Punnee; Rerks-Ngarm, Supachai; Kim, Jerome H; Michael, Nelson L; Tomaras, Georgia D; Montefiori, David C; Lewis, George K; DeVico, Anthony; Evans, David T; Ferrari, Guido; Liao, Hua-Xin; Haynes, Barton F

    2012-11-01

    The ALVAC-HIV/AIDSVAX-B/E RV144 vaccine trial showed an estimated efficacy of 31%. RV144 secondary immune correlate analysis demonstrated that the combination of low plasma anti-HIV-1 Env IgA antibodies and high levels of antibody-dependent cellular cytotoxicity (ADCC) inversely correlate with infection risk. One hypothesis is that the observed protection in RV144 is partially due to ADCC-mediating antibodies. We found that the majority (73 to 90%) of a representative group of vaccinees displayed plasma ADCC activity, usually (96.2%) blocked by competition with the C1 region-specific A32 Fab fragment. Using memory B-cell cultures and antigen-specific B-cell sorting, we isolated 23 ADCC-mediating nonclonally related antibodies from 6 vaccine recipients. These antibodies targeted A32-blockable conformational epitopes (n = 19), a non-A32-blockable conformational epitope (n = 1), and the gp120 Env variable loops (n = 3). Fourteen antibodies mediated cross-clade target cell killing. ADCC-mediating antibodies displayed modest levels of V-heavy (VH) chain somatic mutation (0.5 to 1.5%) and also displayed a disproportionate usage of VH1 family genes (74%), a phenomenon recently described for CD4-binding site broadly neutralizing antibodies (bNAbs). Maximal ADCC activity of VH1 antibodies correlated with mutation frequency. The polyclonality and low mutation frequency of these VH1 antibodies reveal fundamental differences in the regulation and maturation of these ADCC-mediating responses compared to VH1 bNAbs. PMID:22896626

  11. Maturation Pathways of Cross-Reactive HIV-1 Neutralizing Antibodies

    Directory of Open Access Journals (Sweden)

    Dimiter S. Dimitrov

    2009-11-01

    Full Text Available Several human monoclonal antibodies (hmAbs and antibody fragments, including the best characterized in terms of structure-function b12 and Fab X5, exhibit relatively potent and broad HIV-1 neutralizing activity. However, the elicitation of b12 or b12-like antibodies in vivo by vaccine immunogens based on the HIV-1 envelope glycoprotein (Env has not been successful. B12 is highly divergent from the closest corresponding germline antibody while X5 is less divergent. We have hypothesized that the relatively high degree of specific somatic hypermutations may preclude binding of the HIV-1 envelope glycoprotein (Env to closest germline antibodies, and that identifying antibodies that are intermediates in the pathways to maturation could help design novel vaccine immunogens to guide the immune system for their enhanced elicitation. In support of this hypothesis we have previously found that a germline-like b12 (monovalent and bivalent scFv as an Fc fusion protein or IgG lacks measurable binding to an Env as measured by ELISA with a sensitivity in the μM range [1]; here we present evidence confirming and expanding these findings for a panel of Envs. In contrast, a germline-like scFv X5 bound Env with high (nM affinity. To begin to explore the maturation pathways of these antibodies we identified several possible b12 intermediate antibodies and tested their neutralizing activity. These intermediate antibodies neutralized only some HIV-1 isolates and with relatively weak potency. In contrast, germline-like scFv X5 neutralized a subset of the tested HIV-1 isolates with comparable efficiencies to that of the mature X5. These results could help explain the relatively high immunogenicity of the coreceptor binding site on gp120 and the abundance of CD4-induced (CD4i antibodies in HIV-1-infected patients (X5 is a CD4i antibody as well as the maturation pathway of X5. They also can help identify antigens that can bind specifically to b12 germline and

  12. Radioimmunotherapy with 90Y-labeled monoclonal antibodies in a nude mouse ovarian cancer model

    International Nuclear Information System (INIS)

    Tumor stroma contains much fibrin, and so monoclonal antifibrin antibody can accumulate in tumors. We treated nude mice bearing human ovarian carcinoma xenografts with 90Y-labeled monoclonal antifibrin antibody Fab fragments administered intratumorally. The survival time vs. a control group was significantly prolonged and tumor growth rate was decreased. Another group of animals was treated with 90Y-labeled OC 125-monoclonal antibody; these mice received the antibodies intratumorally, intraperitoneally or intravenously. The survival time was longest in the intratumorally treated group. There was no significant difference in survival between 90Y-labeled OC 125 and antifibrin in the intratumorally treated animal groups. The tissue activity distribution studies revealed that bone marrow is the critical organ. Intratumorally injected monoclonal 90Y-antifibrin antibodies were retained at least 36 h (up to 50% of injected activity per gram tumor tissue) in the xenograft after one treatment, causing cell death. Beta-camera imaging and immunohistochemistry were performed for studies of the correlation between 90Y activity and fibrin distribution in tumor specimens. These results were in concordance. In conclusion, intratumoral administration seems suitable for radioimmunotherapy, with an antibody that targets stromal structures. The accumulation can be successfully monitored by a beta-camera. (orig.)

  13. Tumor imaging with monoclonal antibodies

    International Nuclear Information System (INIS)

    Many monoclonal antibodies directed against tumor-associated antigens have been identified, but so far none of these are tumor specific. Polyclonal and monoclonal antibodies have been used for imaging of a wide variety of tumors with success. Radiolabeling of antibody is usually done with iodine isotopes of which 123I is the best candidate for radioimmunodetection purposes. The labeling of antibodies through chelates makes it possible to use metal radioisotopes like 111In, which is the best radioisotope for imaging with monoclonal antibodies due to its favorable half-life of 2.5 days. Usually imaging cannot be performed within 24 h after injection, but clearance of antibody can be increased by using F(ab)2 of Fab. Another approach is to clear non-bound antibody by a second antibody, directed against the first. The detection limit of immunoimaging is about 2 cm, but will be improved by tomography or SPECT. There is still a high false positive and false negative rate, which makes it impossible to use radioimmunodetection as the only technique for diagnosis of tumors. In combination with other detection techniques, tumor imaging with monoclonal antibodies can improve diagnosis. 44 refs.; 3 tabs

  14. Mapping the epitopes of a neutralizing antibody fragment directed against the lethal factor of Bacillus anthracis and cross-reacting with the homologous edema factor.

    Directory of Open Access Journals (Sweden)

    Philippe Thullier

    Full Text Available The lethal toxin (LT of Bacillus anthracis, composed of the protective antigen (PA and the lethal factor (LF, plays an essential role in anthrax pathogenesis. PA also interacts with the edema factor (EF, 20% identity with LF to form the edema toxin (ET, which has a lesser role in anthrax pathogenesis. The first recombinant antibody fragment directed against LF was scFv 2LF; it neutralizes LT by blocking the interaction between PA and LF. Here, we report that scFv 2LF cross-reacts with EF and cross-neutralizes ET, and we present an in silico method taking advantage of this cross-reactivity to map the epitope of scFv 2LF on both LF and EF. This method identified five epitope candidates on LF, constituted of a total of 32 residues, which were tested experimentally by mutating the residues to alanine. This combined approach precisely identified the epitope of scFv 2LF on LF as five residues (H229, R230, Q234, L235 and Y236, of which three were missed by the consensus epitope candidate identified by pre-existing in silico methods. The homolog of this epitope on EF (H253, R254, E258, L259 and Y260 was experimentally confirmed to constitute the epitope of scFv 2LF on EF. Other inhibitors, including synthetic molecules, could be used to target these epitopes for therapeutic purposes. The in silico method presented here may be of more general interest.

  15. Inhibition of the Myotoxicity Induced by Bothrops jararacussu Venom and Isolated Phospholipases A2 by Specific Camelid Single-Domain Antibody Fragments

    Science.gov (United States)

    Prado, Nidiane D. R.; Pereira, Soraya S.; da Silva, Michele P.; Morais, Michelle S. S.; Kayano, Anderson M.; Moreira-Dill, Leandro S.; Luiz, Marcos B.; Zanchi, Fernando B.; Fuly, André L.; E. F. Huacca, Maribel; Fernandes, Cleberson F.; Calderon, Leonardo A.; Zuliani, Juliana P.; Soares, Andreimar M.; Stabeli, Rodrigo G.; F. C. Fernandes, Carla

    2016-01-01

    Antivenoms, produced using animal hyperimmune plasma, remains the standard therapy for snakebites. Although effective against systemic damages, conventional antivenoms have limited efficacy against local tissue damage. Additionally, the hypersensitivity reactions, often elicited by antivenoms, the high costs for animal maintenance, the difficulty of producing homogeneous lots, and the instability of biological products instigate the search for innovative products for antivenom therapy. In this study, camelid antibody fragments (VHH) with specificity to Bothropstoxin I and II (BthTX-I and BthTX-II), two myotoxic phospholipases from Bothrops jararacussu venom, were selected from an immune VHH phage display library. After biopanning, 28 and 6 clones recognized BthTX-I and BthTX-II by ELISA, respectively. Complementarity determining regions (CDRs) and immunoglobulin frameworks (FRs) of 13 VHH-deduced amino acid sequences were identified, as well as the camelid hallmark amino acid substitutions in FR2. Three VHH clones (KF498607, KF498608, and KC329718) were capable of recognizing BthTX-I by Western blot and showed affinity constants in the nanomolar range against both toxins. VHHs inhibited the BthTX-II phospholipase A2 activity, and when tested for cross-reactivity, presented specificity to the Bothrops genus in ELISA. Furthermore, two clones (KC329718 and KF498607) neutralized the myotoxic effects induced by B. jararacussu venom, BthTX-I, BthTX-II, and by a myotoxin from Bothrops brazili venom (MTX-I) in mice. Molecular docking revealed that VHH CDRs are expected to bind the C-terminal of both toxins, essential for myotoxic activity, and to epitopes in the BthTX-II enzymatic cleft. Identified VHHs could be a biotechnological tool to improve the treatment for snake envenomation, an important and neglected world public health problem. PMID:27028872

  16. High-level production in Pichia pastoris of an anti-p185HER-2 single-chain antibody fragment using an alternative secretion expression vector.

    Science.gov (United States)

    Gurkan, Cemal; Symeonides, Stefan N; Ellar, David J

    2004-02-01

    The methylotrophic yeast Pichia pastoris has become a highly popular expression host for the recombinant production of a wide variety of proteins. Initial success with this system was greatly facilitated by the development of versatile expression vectors that were almost exclusively based on the strong, tightly regulated promoter of the P. pastoris major alcohol oxidase gene ( AOX1 ). For example, pIB4 is an Escherichia coli - P. pastoris shuttle vector that also uses the AOX1 promoter to allow intracellular expression of endogenous and foreign genes in the latter organism. Since the eukaryotic advantages of P. pastoris would be best harnessed through the secretory targeting of the recombinant proteins, we modified the pIB4 vector by adding the Saccharomyces cerevisiae alpha-factor secretion signal immediately upstream of its multiple cloning site. Here we describe the construction of this modified vector, pIB4alpha, and its successful use for the high-level expression and secretion of a functional single-chain antibody fragment (scFv), C6.5, which targets p185(HER-2), a cell-surface glycoprotein overexpressed in about 30% of human breast and ovarian cancers. The PCR strategy used for the subcloning of the C6.5 construct into pIB4alpha also introduced a short DNA sequence coding for a C-terminal hexahistidine tag, which allowed subsequent purification of the secreted scFv, by immobilized-metal-affinity chromatography, to a yield of 70 mg x l(-1) of shake-flask culture. In conclusion, our results suggest that the secretion expression vector pIB4alpha not only complements the original pIB4 vector for intracellular expression in P. pastoris, but might also constitute an attractive alternative to the commercially available secretion expression vectors. PMID:12962542

  17. Inhibition of the Myotoxicity Induced by Bothrops jararacussu Venom and Isolated Phospholipases A2 by Specific Camelid Single-Domain Antibody Fragments.

    Science.gov (United States)

    Prado, Nidiane D R; Pereira, Soraya S; da Silva, Michele P; Morais, Michelle S S; Kayano, Anderson M; Moreira-Dill, Leandro S; Luiz, Marcos B; Zanchi, Fernando B; Fuly, André L; E F Huacca, Maribel; Fernandes, Cleberson F; Calderon, Leonardo A; Zuliani, Juliana P; Pereira da Silva, Luiz H; Soares, Andreimar M; Stabeli, Rodrigo G; F C Fernandes, Carla

    2016-01-01

    Antivenoms, produced using animal hyperimmune plasma, remains the standard therapy for snakebites. Although effective against systemic damages, conventional antivenoms have limited efficacy against local tissue damage. Additionally, the hypersensitivity reactions, often elicited by antivenoms, the high costs for animal maintenance, the difficulty of producing homogeneous lots, and the instability of biological products instigate the search for innovative products for antivenom therapy. In this study, camelid antibody fragments (VHH) with specificity to Bothropstoxin I and II (BthTX-I and BthTX-II), two myotoxic phospholipases from Bothrops jararacussu venom, were selected from an immune VHH phage display library. After biopanning, 28 and 6 clones recognized BthTX-I and BthTX-II by ELISA, respectively. Complementarity determining regions (CDRs) and immunoglobulin frameworks (FRs) of 13 VHH-deduced amino acid sequences were identified, as well as the camelid hallmark amino acid substitutions in FR2. Three VHH clones (KF498607, KF498608, and KC329718) were capable of recognizing BthTX-I by Western blot and showed affinity constants in the nanomolar range against both toxins. VHHs inhibited the BthTX-II phospholipase A2 activity, and when tested for cross-reactivity, presented specificity to the Bothrops genus in ELISA. Furthermore, two clones (KC329718 and KF498607) neutralized the myotoxic effects induced by B. jararacussu venom, BthTX-I, BthTX-II, and by a myotoxin from Bothrops brazili venom (MTX-I) in mice. Molecular docking revealed that VHH CDRs are expected to bind the C-terminal of both toxins, essential for myotoxic activity, and to epitopes in the BthTX-II enzymatic cleft. Identified VHHs could be a biotechnological tool to improve the treatment for snake envenomation, an important and neglected world public health problem. PMID:27028872

  18. Inhibition of the Myotoxicity Induced by Bothrops jararacussu Venom and Isolated Phospholipases A2 by Specific Camelid Single-Domain Antibody Fragments.

    Directory of Open Access Journals (Sweden)

    Nidiane D R Prado

    Full Text Available Antivenoms, produced using animal hyperimmune plasma, remains the standard therapy for snakebites. Although effective against systemic damages, conventional antivenoms have limited efficacy against local tissue damage. Additionally, the hypersensitivity reactions, often elicited by antivenoms, the high costs for animal maintenance, the difficulty of producing homogeneous lots, and the instability of biological products instigate the search for innovative products for antivenom therapy. In this study, camelid antibody fragments (VHH with specificity to Bothropstoxin I and II (BthTX-I and BthTX-II, two myotoxic phospholipases from Bothrops jararacussu venom, were selected from an immune VHH phage display library. After biopanning, 28 and 6 clones recognized BthTX-I and BthTX-II by ELISA, respectively. Complementarity determining regions (CDRs and immunoglobulin frameworks (FRs of 13 VHH-deduced amino acid sequences were identified, as well as the camelid hallmark amino acid substitutions in FR2. Three VHH clones (KF498607, KF498608, and KC329718 were capable of recognizing BthTX-I by Western blot and showed affinity constants in the nanomolar range against both toxins. VHHs inhibited the BthTX-II phospholipase A2 activity, and when tested for cross-reactivity, presented specificity to the Bothrops genus in ELISA. Furthermore, two clones (KC329718 and KF498607 neutralized the myotoxic effects induced by B. jararacussu venom, BthTX-I, BthTX-II, and by a myotoxin from Bothrops brazili venom (MTX-I in mice. Molecular docking revealed that VHH CDRs are expected to bind the C-terminal of both toxins, essential for myotoxic activity, and to epitopes in the BthTX-II enzymatic cleft. Identified VHHs could be a biotechnological tool to improve the treatment for snake envenomation, an important and neglected world public health problem.

  19. In vivo detection of amyloid-β deposits using heavy chain antibody fragments in a transgenic mouse model for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Rob J A Nabuurs

    Full Text Available This study investigated the in vivo properties of two heavy chain antibody fragments (V(HH, ni3A and pa2H, to differentially detect vascular or parenchymal amyloid-β deposits characteristic for Alzheimer's disease and cerebral amyloid angiopathy. Blood clearance and biodistribution including brain uptake were assessed by bolus injection of radiolabeled V(HH in APP/PS1 mice or wildtype littermates. In addition, in vivo specificity for Aβ was examined in more detail with fluorescently labeled V(HH by circumventing the blood-brain barrier via direct application or intracarotid co-injection with mannitol. All V(HH showed rapid renal clearance (10-20 min. Twenty-four hours post-injection (99mTc-pa2H resulted in a small yet significant higher cerebral uptake in the APP/PS1 animals. No difference in brain uptake were observed for (99mTc-ni3A or DTPA((111In-pa2H, which lacked additional peptide tags to investigate further clinical applicability. In vivo specificity for Aβ was confirmed for both fluorescently labeled V(HH, where pa2H remained readily detectable for 24 hours or more after injection. Furthermore, both V(HH showed affinity for parenchymal and vascular deposits, this in contrast to human tissue, where ni3A specifically targeted only vascular Aβ. Despite a brain uptake that is as yet too low for in vivo imaging, this study provides evidence that V(HH detect Aβ deposits in vivo, with high selectivity and favorable in vivo characteristics, making them promising tools for further development as diagnostic agents for the distinctive detection of different Aβ deposits.

  20. In vivo detection of amyloid-β deposits using heavy chain antibody fragments in a transgenic mouse model for Alzheimer's disease.

    Science.gov (United States)

    Nabuurs, Rob J A; Rutgers, Kim S; Welling, Mick M; Metaxas, Athanasios; de Backer, Maaike E; Rotman, Maarten; Bacskai, Brian J; van Buchem, Mark A; van der Maarel, Silvère M; van der Weerd, Louise

    2012-01-01

    This study investigated the in vivo properties of two heavy chain antibody fragments (V(H)H), ni3A and pa2H, to differentially detect vascular or parenchymal amyloid-β deposits characteristic for Alzheimer's disease and cerebral amyloid angiopathy. Blood clearance and biodistribution including brain uptake were assessed by bolus injection of radiolabeled V(H)H in APP/PS1 mice or wildtype littermates. In addition, in vivo specificity for Aβ was examined in more detail with fluorescently labeled V(H)H by circumventing the blood-brain barrier via direct application or intracarotid co-injection with mannitol. All V(H)H showed rapid renal clearance (10-20 min). Twenty-four hours post-injection (99m)Tc-pa2H resulted in a small yet significant higher cerebral uptake in the APP/PS1 animals. No difference in brain uptake were observed for (99m)Tc-ni3A or DTPA((111)In)-pa2H, which lacked additional peptide tags to investigate further clinical applicability. In vivo specificity for Aβ was confirmed for both fluorescently labeled V(H)H, where pa2H remained readily detectable for 24 hours or more after injection. Furthermore, both V(H)H showed affinity for parenchymal and vascular deposits, this in contrast to human tissue, where ni3A specifically targeted only vascular Aβ. Despite a brain uptake that is as yet too low for in vivo imaging, this study provides evidence that V(H)H detect Aβ deposits in vivo, with high selectivity and favorable in vivo characteristics, making them promising tools for further development as diagnostic agents for the distinctive detection of different Aβ deposits. PMID:22675537

  1. Kinetic screening of antibody-Im7 conjugates by capture on a colicin E7 DNase domain using optical biosensors.

    Science.gov (United States)

    Hosse, Ralf J; Tay, Leigh; Hattarki, Meghan K; Pontes-Braz, Luisa; Pearce, Lesley A; Nuttall, Stewart D; Dolezal, Olan

    2009-02-15

    Antibody generation by phage display and related in vitro display technologies routinely yields large panels of clones detected in primary end-point screenings such as enzyme-linked immunosorbent assay (ELISA). However, for the development of clinical lead candidates, rapid determination of secondary characteristics such as kinetics and thermodynamics is of nearly equal importance. Surface plasmon resonance-based biosensors are ideal tools for carrying out such high-throughput secondary screenings, allowing preliminary but confident ranking and identification of lead clones. A key feature of these assays is the stable and reversible capture of antibody fragments from crude samples leading to high-resolution kinetic analysis of library outputs. Here we exploit the high-affinity interaction between the naturally occurring nuclease domain of E. coli colicin E7 (DNaseE7) and its cognate partner, the immunity protein 7 (Im7), to develop a ligand capture system suitable for accurate kinetic ranking of library clones. We demonstrate generic applicability for a range of antibody formats: scFv antibodies, diabodies, antigen binding fragments (Fabs), and shark V(NAR) single domain antibodies. The system is adaptable and reproducible, with comparable results achieved for both the Biacore T100 and ProteOn XPR36 array biosensors. PMID:19073134

  2. Platelet-collagen interaction: inhibition by a monoclonal antibody raised against collagen receptor

    International Nuclear Information System (INIS)

    The authors have previously reported that polyclonal antibody raised against the purified platelet collagen receptor cross reacted with glycoprotein IIb-IIIa complex of platelets. In order to study the receptor function further, the authors prepared a monoclonal antibody to the collagen receptor (65K). Platelet collagen receptor was purified as described previously by the authors. Mice were immunized by injection of purified 65K protein emulsified in complete Freund's adjuvant, and hybridomas were obtained from the fusion of spleen cells of immunized mice with myeloma cells (SP 2/0). The assay for antibody was performed with enzyme-linked immunosorbent assay. The hybridoma cells producing specific anti-65K protein were subcloned and the subcloned cells were injected into peritoneal cavity of Pristane-Primed mice. Immunoglobulin G(IgG) was isolated from ascitic fluids by an Affigel Blue chromatography. The Fab' fragments were isolated from papain digested IgG followed by an Affigel Blue chromatography. Immunoblot experiments using the monoclonal IgG of solubilized platelet membrane proteins following NaDodSO4-polyacrylamide gel electrophoresis showed that the monoclonal IgG reacted with the antigen specifically. It did not react with glycoprotein IIb-IIIa. The isolated IgG and Fab' fragments inhibited competitively the binding of radiolabelled α1(I) to washed platelets and soluble collagen- as well as fibrillar collagen-induced but not ADP-induced platelet aggregation. This indicates that collagen-induced platelet aggregation is mediated through interaction of collagen with 65K platelet receptor

  3. Platelet-collagen interaction: inhibition by a monoclonal antibody raised against collagen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, T.; Jin, A.; Kang, A.

    1986-05-01

    The authors have previously reported that polyclonal antibody raised against the purified platelet collagen receptor cross reacted with glycoprotein IIb-IIIa complex of platelets. In order to study the receptor function further, the authors prepared a monoclonal antibody to the collagen receptor (65K). Platelet collagen receptor was purified as described previously by the authors. Mice were immunized by injection of purified 65K protein emulsified in complete Freund's adjuvant, and hybridomas were obtained from the fusion of spleen cells of immunized mice with myeloma cells (SP 2/0). The assay for antibody was performed with enzyme-linked immunosorbent assay. The hybridoma cells producing specific anti-65K protein were subcloned and the subcloned cells were injected into peritoneal cavity of Pristane-Primed mice. Immunoglobulin G(IgG) was isolated from ascitic fluids by an Affigel Blue chromatography. The Fab' fragments were isolated from papain digested IgG followed by an Affigel Blue chromatography. Immunoblot experiments using the monoclonal IgG of solubilized platelet membrane proteins following NaDodSO/sub 4/-polyacrylamide gel electrophoresis showed that the monoclonal IgG reacted with the antigen specifically. It did not react with glycoprotein IIb-IIIa. The isolated IgG and Fab' fragments inhibited competitively the binding of radiolabelled ..cap alpha..1(I) to washed platelets and soluble collagen- as well as fibrillar collagen-induced but not ADP-induced platelet aggregation. This indicates that collagen-induced platelet aggregation is mediated through interaction of collagen with 65K platelet receptor.

  4. Clonal relationships between thyroid-stimulating hormone receptor-stimulating antibodies illustrate the effect of hypermutation on antibody function

    DEFF Research Database (Denmark)

    Padoa, Carolyn J; Larsen, Sanne L; Hampe, Christiane S;

    2009-01-01

    Summary Graves' disease is characterized by production of agonist antibodies to the thyroid-stimulating hormone receptor (TSHR), but knowledge of the genetic and somatic events leading to their aberrant production is limited. We describe the genetic analysis of two monoclonal antibodies (mAbs) with......-determining regions (CDRs) and the framework regions. The cloned IGHV and IGLV genes were confirmed to have TSAb properties in experiments in which they were expressed as recombinant Fabs (rFabs). In other experiments, we swapped the IGLV genes with IGHV genes by constructing chimeric rFabs and showed that the...... experimentally immunized mice, multiple pathogenic antibodies to TSHR can arise from a single clone by a series of somatic mutations in the V-region genes and may give an insight into how such antibodies develop spontaneously in autoimmune Graves' disease....

  5. Structural Basis of Zika Virus-Specific Antibody Protection.

    Science.gov (United States)

    Zhao, Haiyan; Fernandez, Estefania; Dowd, Kimberly A; Speer, Scott D; Platt, Derek J; Gorman, Matthew J; Govero, Jennifer; Nelson, Christopher A; Pierson, Theodore C; Diamond, Michael S; Fremont, Daved H

    2016-08-11

    Zika virus (ZIKV) infection during pregnancy has emerged as a global public health problem because of its ability to cause severe congenital disease. Here, we developed six mouse monoclonal antibodies (mAbs) against ZIKV including four (ZV-48, ZV-54, ZV-64, and ZV-67) that were ZIKV specific and neutralized infection of African, Asian, and American strains to varying degrees. X-ray crystallographic and competition binding analyses of Fab fragments and scFvs defined three spatially distinct epitopes in DIII of the envelope protein corresponding to the lateral ridge (ZV-54 and ZV-67), C-C' loop (ZV-48 and ZV-64), and ABDE sheet (ZV-2) regions. In vivo passive transfer studies revealed protective activity of DIII-lateral ridge specific neutralizing mAbs in a mouse model of ZIKV infection. Our results suggest that DIII is targeted by multiple type-specific antibodies with distinct neutralizing activity, which provides a path for developing prophylactic antibodies for use in pregnancy or designing epitope-specific vaccines against ZIKV. PMID:27475895

  6. Combining somatic mutations present in different in vivo affinity-matured antibodies isolated from immunized Lama glama yields ultra-potent antibody therapeutics.

    Science.gov (United States)

    Klarenbeek, Alex; Blanchetot, Christophe; Schragel, Georg; Sadi, Ava S; Ongenae, Nico; Hemrika, Wieger; Wijdenes, John; Spinelli, Silvia; Desmyter, Aline; Cambillau, Christian; Hultberg, Anna; Kretz-Rommel, Anke; Dreier, Torsten; De Haard, Hans J W; Roovers, Rob C

    2016-04-01

    Highly potent human antibodies are required to therapeutically neutralize cytokines such as interleukin-6 (IL-6) that is involved in many inflammatory diseases and malignancies. Although a number of mutagenesis approaches exist to perform antibody affinity maturation, these may cause antibody instability and production issues. Thus, a robust and easy antibody affinity maturation strategy to increase antibody potency remains highly desirable. By immunizing llama, cloning the 'immune' antibody repertoire and using phage display, we selected a diverse set of IL-6 antagonistic Fabs. Heavy chain shuffling was performed on the Fab with lowest off-rate, resulting in a panel of variants with even lower off-rate. Structural analysis of the Fab:IL-6 complex suggests that the increased affinity was partly due to a serine to tyrosine switch in HCDR2. This translated into neutralizing capacity in an in vivo model of IL-6 induced SAA production. Finally, a novel Fab library was designed, encoding all variations found in the natural repertoire of VH genes identified after heavy chain shuffling. High stringency selections resulted in identification of a Fab with 250-fold increased potency when re-formatted into IgG1. Compared with a heavily engineered anti-IL-6 monoclonal antibody currently in clinical development, this IgG was at least equally potent, showing the engineering process to have had led to a highly potent anti-IL-6 antibody. PMID:26945588

  7. Comparison of IgG and F(ab'){sub 2} fragments of bispecific anti-RCC x anti-DTIn-1 antibody for pretargeting purposes

    Energy Technology Data Exchange (ETDEWEB)

    Schaijk, Frank G. van; Boerman, Otto C.; Soede, Annemieke C.; Corstens, Frans H.M. [Radboud University Nijmegen Medical Centre, Department of Nuclear Medicine, P.O. Box 9101, Nijmegen (Netherlands); McBride, William J. [Immunomedics, Inc., Morris Plains, NJ (United States); Goldenberg, David M. [Immunomedics, Inc., Morris Plains, NJ (United States); Center for Molecular Medicine and Immunology, Garden State Cancer Center, Belleville, NJ (United States); Oosterwijk, Egbert [Radboud University Nijmegen Medical Center, Department of Urology, Nijmegen (Netherlands); Ludwig Institute for Cancer Research, New York, NY (United States)

    2005-09-01

    An effective pretargeting strategy was developed for renal cell carcinoma (RCC) based on a biologically produced bispecific monoclonal antibody: anti-RCC x anti-DTPA(In) (bsMAb: G250 x DTIn-1). Tumour uptake of a {sup 111}In-labelled bivalent peptide after pretargeting with bsMAb G250 x DTIn-1 was relatively high compared with that in other pretargeting systems using chemically coupled F(ab'){sub 2} fragments. Here, we investigated the effect of the bsMAb form in the pretargeting strategy. To determine the optimal interval between the administration of each of the bsMAb forms and the {sup 111}In-labelled bivalent peptide, the biodistribution of the radioiodinated bsMAb forms was studied in athymic mice with subcutaneous SK-RC-1 RCC tumours. Since tumour targeting of the radiolabelled peptide depends on the bsMAb form and dose, a bsMAb dose escalation study was carried out for both bsMAb forms. Under optimised conditions, the biodistribution of the {sup 111}In label in mice with pretargeted RCC was determined from 4 h up to 7 days p.i. The optimal interval between the two administrations was 72 h for the bsMAb IgG and 4 h for the bsMAb F(ab'){sub 2}. The optimal bsMAb dose for intact IgG was 67 pmol and the optimal bsMAb F(ab'){sub 2} dose was 200 pmol. Targeting of the pretargeted RCC with 4 pmol {sup 111}In-labelled bivalent peptide revealed high tumour uptake with both bsMAb forms. With the pretargeting strategy, using either bsMAb IgG or bsMAb F(ab'){sub 2}, very efficient peptide targeting of the tumour was obtained. Uptake and retention of the radiolabel in the tumour with the pretargeting approach are not affected by the bsMAb form used. (orig.)

  8. Structural Characterisation of the Beta-Ketoacyl-Acyl Carrier Protein Synthases, FabF and FabH, of Yersinia pestis.

    Science.gov (United States)

    Nanson, Jeffrey D; Himiari, Zainab; Swarbrick, Crystall M D; Forwood, Jade K

    2015-01-01

    Yersinia pestis, the causative agent of bubonic, pneumonic, and septicaemic plague, remains a major public health threat, with outbreaks of disease occurring in China, Madagascar, and Peru in the last five years. The existence of multidrug resistant Y. pestis and the potential of this bacterium as a bioterrorism agent illustrates the need for new antimicrobials. The β-ketoacyl-acyl carrier protein synthases, FabB, FabF, and FabH, catalyse the elongation of fatty acids as part of the type II fatty acid biosynthesis (FASII) system, to synthesise components of lipoproteins, phospholipids, and lipopolysaccharides essential for bacterial growth and survival. As such, these enzymes are promising targets for the development of novel therapeutic agents. We have determined the crystal structures of the Y. pestis β-ketoacyl-acyl carrier protein synthases FabF and FabH, and compared these with the unpublished, deposited structure of Y. pestis FabB. Comparison of FabB, FabF, and FabH provides insights into the substrate specificities of these enzymes, and investigation of possible interactions with known β-ketoacyl-acyl carrier protein synthase inhibitors suggests FabB, FabF and FabH may be targeted simultaneously to prevent synthesis of the fatty acids necessary for growth and survival. PMID:26469877

  9. HLA Class II Antibody Activation of Endothelial Cells Promotes Th17 and Disrupts Regulatory T Lymphocyte Expansion.

    Science.gov (United States)

    Lion, J; Taflin, C; Cross, A R; Robledo-Sarmiento, M; Mariotto, E; Savenay, A; Carmagnat, M; Suberbielle, C; Charron, D; Haziot, A; Glotz, D; Mooney, N

    2016-05-01

    Kidney transplantation is the most successful treatment option for patients with end-stage renal disease, and chronic antibody-mediated rejection is the principal cause of allograft loss. Predictive factors for chronic rejection include high levels of HLA alloantibodies (particularly HLA class II) and activation of graft endothelial cells (ECs). The mechanistic basis for this association is unresolved. We used an experimental model of HLA-DR antibody stimulation of microvascular ECs to examine the mechanisms underlying the association between HLA class II antibodies, EC activation and allograft damage. Activation of ECs with the F(Ab')2 fragment of HLA-DR antibody led to phosphorylation of Akt, ERK and MEK and increased IL-6 production by ECs cocultured with allogeneic peripheral blood mononuclear cells (PBMCs) in an Akt-dependent manner. We previously showed that HLA-DR-expressing ECs induce polarization of Th17 and FoxP3(bright) regulatory T cell (Treg) subsets. Preactivation of ECs with anti-HLA-DR antibody redirected EC allogenicity toward a proinflammatory response by decreasing amplification of functional Treg and by further increasing IL-6-dependent Th17 expansion. Alloimmunized patient serum containing relevant HLA-DR alloantibodies selectively bound and increased EC secretion of IL-6 in cocultures with PBMCs. These data contribute to understanding of potential mechanisms of antibody-mediated endothelial damage independent of complement activation and FcR-expressing effector cells. PMID:26614587

  10. /sup 99m/Tc radiolabelling and quality control tests of anti-melanoma monoclonal antibodies and F(ab')/sub 2/ fragments for immunoscintigraphy

    International Nuclear Information System (INIS)

    Tumour radioimmunodetection was first developed by using radiolabelled polyclonal antibodies, raised in goats against tumour associated antigens (TAA). The availability of monoclonal antibodies to TAA has definitely contributed to more extensive in vivo use of radiolabelled antibodies. However, many factors are involved in tumour radioimmunolocalization, related either to the antibody and radioisotope features or to the natural history of the tumour itself. The experimental protocol developed by the authors allows a full evaluation of the properties of a particular MoAb.This paper illustrates the work done with on a particular set of monoclonal antibodies, raised against human melanoma associated antigens, with the aim of visualizing primary and metastatic lesions in melanoma patients

  11. Separation of human IgG fragments using copper, nickel, zinc, and cobalt chelated to CM-Asp-agarose by positive and negative chromatography.

    Science.gov (United States)

    Mourão, Cecília Alves; Carmignotto, Gabriela Pannunzio; Bueno, Sonia Maria Alves

    2016-04-01

    This study evaluated the feasibility of using immobilized metal-ion affinity chromatography (IMAC) for separation of human Fab fragments using four different transition metal ions copper, nickel, zinc, and cobalt chelated to CM-Asp (carboxymethylaspartate) immobilized on the agarose gel. The Fab and Fc fragments (from human IgG digested with papain) interacted differently with the chelates studied, depending on the adsorption buffer system. The interaction between chelate and Fc fragment is predominantly based on the coordination bonds using adsorption buffer containing NaCl. Negative chromatography was performed on Cu(II)-CM-Asp-agarose obtaining 2.9mg of Fab per mL of adsorbent in nonretained fractions (Fc fragment-free without uncleaved IgG). The adsorption of Fab fragments is governed by electrostatic forces in the absence of NaCl in the adsorption buffer. High selectivity was achieved on Co(II)-CM-Asp-agarose and 5.7mg of Fab per mL of adsorbent was obtained in eluted fractions without Fc fragments, although having uncleaved IgG. The results showed that chromatography on transition metal ions chetated to CM-Asp-agarose is a promising approach to separation of Fab fragments from papain-digested human IgG solution. PMID:26974869

  12. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S;

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect the...... development of lupus nephritis at an early stage....

  13. Epstein-Barr virus/complement fragment C3d receptor (CR2) reacts with p53, a cellular antioncogene-encoded membrane phosphoprotein: detection by polyclonal anti-idiotypic anti-CR2 antibodies.

    OpenAIRE

    Barel, M; Fiandino, A; Lyamani, F; Frade, R

    1989-01-01

    Epstein-Barr virus and the C3d fragment of the third component of complement are specific extracellular ligands for complement receptor type 2 (CR2). However, intracellular proteins that react specifically with CR2 and are involved in post-membrane signals remain unknown. We recently prepared polyclonal anti-idiotypic anti-CR2 antibodies (Ab2) by using the highly purified CR2 molecule as original immunogen. We showed that Ab2 contained anti-idiotypic specificities that mimicked extracellular ...

  14. Anti-ganglioside antibody-induced tumor cell death by loss of membrane integrity.

    Science.gov (United States)

    Roque-Navarro, Lourdes; Chakrabandhu, Krittalak; de León, Joel; Rodríguez, Sandra; Toledo, Carlos; Carr, Adriana; de Acosta, Cristina Mateo; Hueber, Anne-Odile; Pérez, Rolando

    2008-07-01

    Gangliosides have been involved in multiple cellular processes such as growth, differentiation and adhesion, and more recently as regulators of cell death signaling pathways. Some of these molecules can be considered as tumor-associated antigens, in particular, N-glycolyl sialic acid-containing gangliosides, which are promising candidates for cancer-targeted therapy because of their low expression in normal human tissues. In this study, we provided the molecular and cellular characterization of a novel cell death mechanism induced by the anti-NGcGM3 14F7 monoclonal antibody (mAb) in L1210 murine tumor cell line but not in mouse normal cells (B and CD4(+) T lymphocytes) that expressed the antigen. Impairment of ganglioside synthesis in tumor cells abrogated the 14F7 mAb cytotoxic effect; however, exogenous reincorporation of the ganglioside did not restore tumor cell sensitivity to 14F7 mAb-induced cytotoxicity. 14F7 F(ab')(2) but not Fab fragments retained the cytotoxic capacity of the whole mAb. By contrary, other mAb, which recognizes N-glycolylated gangliosides, did not show any cytotoxic effect. These mAbs showed quite different capacities to bind NGcGM3-positive cell lines measured by binding inhibition experiments. Interestingly, this complement-independent cell death mechanism did not resemble apoptosis, because no DNA fragmentation, caspase activation, or Fas mediation were observed. However, NGcGM3 ganglioside-mediated 14F7 mAb-induced cell death was accompanied by cellular swelling, membrane lesion formation, and cytoskeleton activation, suggesting an oncosis-like phenomenon. This novel mechanism of cell death lets us to support further therapeutic approaches using NGcGM3 as a molecular target for antibody-based cancer immunotherapy. PMID:18645013

  15. Synthesis of CCK-8 Tetrapeptide Fragment by Enzymatic Method

    Institute of Scientific and Technical Information of China (English)

    XIANG Guangya (项光亚); Heiner Eckstein

    2003-01-01

    The enzymatic synthesis of a tetrapeptide Phac-Met-Gly-Trp-Met-OEt, a fragment of thecholecystokinin C-terminal octapeptide CCK-8, was reported. This fragment was synthesized bycoupling Phac-Met-OEt with Gly-OMe, Trp-OMe and Met-OEt successively. These three stepswere catalyzed by α-chymotrpsin, Papain and α-chymotrpsin respectively. The results of FAB-MSshowed that all the products had the correct molecular mass.

  16. Compact quantum dot-antibody conjugates for FRET immunoassays with subnanomolar detection limits

    Science.gov (United States)

    Mattera, Lucia; Bhuckory, Shashi; Wegner, K. David; Qiu, Xue; Agnese, Fabio; Lincheneau, Christophe; Senden, Tim; Djurado, David; Charbonnière, Loïc J.; Hildebrandt, Niko; Reiss, Peter

    2016-05-01

    A novel two-step approach for quantum dot (QD) functionalization and bioconjugation is presented, which yields ultra-compact, stable, and highly luminescent antibody-QD conjugates suitable for use in FRET immunoassays. Hydrophobic InPZnS/ZnSe/ZnS (emission wavelength: 530 nm), CdSe/ZnS (605 nm), and CdSeTe/ZnS (705 nm) QDs were surface functionalized with zwitterionic penicillamine, enabling aqueous phase transfer under conservation of the photoluminescence properties. Post-functionalization with a heterobifunctional crosslinker, containing a lipoic acid group and a maleimide function, enabled the subsequent coupling to sulfhydryl groups of proteins. This was demonstrated by QD conjugation with fragmented antibodies (F(ab)). The obtained F(ab)-QD conjugates range among the smallest antibody-functionalized nanoprobes ever reported, with a hydrodynamic diameter 26 nm without biomolecules). The LODs of 0.8 and 3.7 ng mL-1 obtained in 50 μL serum samples are below the clinical cut-off level of PSA (4 ng mL-1) and demonstrate their direct applicability in clinical diagnostics.A novel two-step approach for quantum dot (QD) functionalization and bioconjugation is presented, which yields ultra-compact, stable, and highly luminescent antibody-QD conjugates suitable for use in FRET immunoassays. Hydrophobic InPZnS/ZnSe/ZnS (emission wavelength: 530 nm), CdSe/ZnS (605 nm), and CdSeTe/ZnS (705 nm) QDs were surface functionalized with zwitterionic penicillamine, enabling aqueous phase transfer under conservation of the photoluminescence properties. Post-functionalization with a heterobifunctional crosslinker, containing a lipoic acid group and a maleimide function, enabled the subsequent coupling to sulfhydryl groups of proteins. This was demonstrated by QD conjugation with fragmented antibodies (F(ab)). The obtained F(ab)-QD conjugates range among the smallest antibody-functionalized nanoprobes ever reported, with a hydrodynamic diameter 26 nm without biomolecules). The LODs

  17. Phage displayed peptides and anti-idiotype antibodies recognised by a monoclonal antibody directed against a diagnostic antigen of Mycoplasma capricolum subsp. capripneumoniae.

    Science.gov (United States)

    Bengurić, D R; Dungu, B; Thiaucourt, F; du Plessis, D H

    2001-07-26

    A monoclonal antibody (Mab 4.52) raised against Mycoplasma capricolum subsp. capripneumoniae (Mccp) cell lysate was used as a template to obtain substitute antigens recognised by its paratope. Two approaches were investigated: a 17-mer random peptide library displayed on the surface of a filamentous phage was screened by panning on the immobilised Mab 4.52 and anti-idiotype antibodies were generated by immunising a chicken with the F(ab')(2) fragments of the antibody. Analysis of the peptide sequences displayed by the isolated phages identified two peptides. Both contained two cysteine residues and had identical or similar amino acids in positions 5 (P), 8 (I/L) and 13 (L). The fusion phages were also recognised by Mab 4.52 in enzyme-linked immunosorbent assay (ELISA) and binding was shown by surface plasmon resonance. One of the peptides was a markedly better inhibitor (67%) of the binding of Mab 4.52 to its original antigen than the other (20%) at 1mg/ml. After absorption, to remove isotypic and allotypic reactivities, the anti-idiotype IgY was specifically recognised by Mab 4.52 in ELISA and was able to inhibit its binding to the original antigen, whereas anti-idiotype antibodies raised against a bluetongue virus-specific antibody had no effect. In spite of unequivocal binding of the anti-idiotype antibodies and the fusion phages to the paratope of Mab 4.52, goat antisera appeared not to react with either of the surrogate antigens. In contrast, the test sera bound to the original antigen suggesting that Mab 4.52 does not recognise exactly the same antigenic site as antibodies in the goat antisera. PMID:11376960

  18. Inhibitory activity of antibodies against the human atrial 5-HT(4)receptor.

    Science.gov (United States)

    Sallé, L; Eftekhari, P; Aupart, M; Cosnay, P; Hoebeke, J; Argibay, J A

    2001-03-01

    Antibodies directed against the second extracellular loop of G protein-coupled receptors have been shown to exert "agonist-like" activities. In order to test the hypothesis that this is a general phenomenon, antibodies were raised in rabbits against a synthetic peptide corresponding to the second extracellular loop of the newly sequenced human cardiac 5-HT(4)receptor. The antibodies were affinity-purified and shown to recognize the 5-HT(4)receptor in immunoblots of Chinese hamster ovary (CHO) cells expressing the receptor. The antibodies had no intrinsic effect but could depress the activation of L -type calcium channel induced by serotonin in human atrial cells. This antagonist-like effect was exerted both by intact IgG and by Fab fragments. These results are physiologically important since it has been shown that the 5-HT(4)receptor could be a target for autoantibodies in mothers at risk of giving birth to children with neonatal atrio-ventricular block. PMID:11181010

  19. Construction of a human antibody domain (VH) library

    OpenAIRE

    Chen, Weizao; Zhu, Zhongyu; Xiao, Xiaodong; Dimitrov, Dimiter S.

    2009-01-01

    Highly diverse antibody (Fab or scFv) libraries have become vital sources to select antibodies with high affinity and novel properties. Combinatorial strategies provide efficient ways of creating antibody libraries containing a large number of individual clones. These strategies include the reassembly of naturally occurring genes encoding the heavy and light chains from either immune or nonimmune B-cell sources, or introduction of synthetic diversity to either the framework regions (FRs) or t...

  20. An ultra-specific avian antibody to phosphorylated tau protein reveals a unique mechanism for phosphoepitope recognition.

    Science.gov (United States)

    Shih, Heather H; Tu, Chao; Cao, Wei; Klein, Anne; Ramsey, Renee; Fennell, Brian J; Lambert, Matthew; Ní Shúilleabháin, Deirdre; Autin, Bénédicte; Kouranova, Eugenia; Laxmanan, Sri; Braithwaite, Steven; Wu, Leeying; Ait-Zahra, Mostafa; Milici, Anthony J; Dumin, Jo Ann; LaVallie, Edward R; Arai, Maya; Corcoran, Christopher; Paulsen, Janet E; Gill, Davinder; Cunningham, Orla; Bard, Joel; Mosyak, Lydia; Finlay, William J J

    2012-12-28

    Highly specific antibodies to phosphoepitopes are valuable tools to study phosphorylation in disease states, but their discovery is largely empirical, and the molecular mechanisms mediating phosphospecific binding are poorly understood. Here, we report the generation and characterization of extremely specific recombinant chicken antibodies to three phosphoepitopes on the Alzheimer disease-associated protein tau. Each antibody shows full specificity for a single phosphopeptide. The chimeric IgG pT231/pS235_1 exhibits a K(D) of 0.35 nm in 1:1 binding to its cognate phosphopeptide. This IgG is murine ortholog-cross-reactive, specifically recognizing the pathological form of tau in brain samples from Alzheimer patients and a mouse model of tauopathy. To better understand the underlying binding mechanisms allowing such remarkable specificity, we determined the structure of pT231/pS235_1 Fab in complex with its cognate phosphopeptide at 1.9 Å resolution. The Fab fragment exhibits novel complementarity determining region (CDR) structures with a "bowl-like" conformation in CDR-H2 that tightly and specifically interacts with the phospho-Thr-231 phosphate group, as well as a long, disulfide-constrained CDR-H3 that mediates peptide recognition. This binding mechanism differs distinctly from either peptide- or hapten-specific antibodies described to date. Surface plasmon resonance analyses showed that pT231/pS235_1 binds a truly compound epitope, as neither phosphorylated Ser-235 nor free peptide shows any measurable binding affinity. PMID:23148212

  1. Production and Evaluation of Immunoreactivity of Poly Lysine-Tagged Single Chain Fragment Variable (ScFv) Lym-1 Antibody for Direct Conjugation to Fluorescence Dye

    International Nuclear Information System (INIS)

    Small size of recombinant scFv antibody has many advantages such as rapid blood clearances and improved targeting antibodies to tumor region. On the other hand owing to small size, number of amino group is insufficient in conjugation with chelator and fluorescence labeling. This study is to introduce poly lysine tag to the C-terminal end of scFv lym-1 sequence for fluorescence chelator conjugation. Poly lysine scFv lym-1 gene, cloned into pET-22b (+) vector, was expressed in E. coli BL21 (DE3) strain. Antibody purification was performed with Ni-NTA column and then size exclusion column chromatography. Expression and purification levels of poly lysine tagged scFv lym-1 antibody were confirmed by western blot analysis. I-124, I-125, I-131 and Tc-99m were used for radiolabeling of purified poly lysine scFv lym-1. Flow cytometry analysis of FITC conjugated poly lysine scFv lym-1 was performed for confirmation of immunoreactivity of human Burkitt's lymphoma cells. Poly lysine scFv lym-1 antibody was purified through two steps and identified as molecular weight of 48 KDa. Radiolabeling yields of I-124, I-125, I-131 and Tc-99m into poly lysine scFv lym-1 were >99%, >99%, >95% and >99%, respectively. Flow cytometry analysis of poly lysine scFv and scFv lym-1 was showed similar immunoreactivity to human Burkitt's lymphoma cells. Poly lysine tag was useful for the sufficient number of amino groups to scFv lym-1 antibody for chelator conjugation with minimizing loss of immunoreactivity

  2. Production and Evaluation of Immunoreactivity of Poly Lysine-Tagged Single Chain Fragment Variable (ScFv) Lym-1 Antibody for Direct Conjugation to Fluorescence Dye

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Jae Ho; Choi, Tae Hyun; Woo, Kwang Sun; Chung, Wee Sup; Kang, Joo Hyun; Jeong, Su Young; Choi, Chang Woon; Lim, Sang Moo; Cheon, Gi Jeong [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-10-15

    Small size of recombinant scFv antibody has many advantages such as rapid blood clearances and improved targeting antibodies to tumor region. On the other hand owing to small size, number of amino group is insufficient in conjugation with chelator and fluorescence labeling. This study is to introduce poly lysine tag to the C-terminal end of scFv lym-1 sequence for fluorescence chelator conjugation. Poly lysine scFv lym-1 gene, cloned into pET-22b (+) vector, was expressed in E. coli BL21 (DE3) strain. Antibody purification was performed with Ni-NTA column and then size exclusion column chromatography. Expression and purification levels of poly lysine tagged scFv lym-1 antibody were confirmed by western blot analysis. I-124, I-125, I-131 and Tc-99m were used for radiolabeling of purified poly lysine scFv lym-1. Flow cytometry analysis of FITC conjugated poly lysine scFv lym-1 was performed for confirmation of immunoreactivity of human Burkitt's lymphoma cells. Poly lysine scFv lym-1 antibody was purified through two steps and identified as molecular weight of 48 KDa. Radiolabeling yields of I-124, I-125, I-131 and Tc-99m into poly lysine scFv lym-1 were >99%, >99%, >95% and >99%, respectively. Flow cytometry analysis of poly lysine scFv and scFv lym-1 was showed similar immunoreactivity to human Burkitt's lymphoma cells. Poly lysine tag was useful for the sufficient number of amino groups to scFv lym-1 antibody for chelator conjugation with minimizing loss of immunoreactivity

  3. Detection of biomarkers using recombinant antibodies coupled to nanostructured platforms

    Directory of Open Access Journals (Sweden)

    Michael R. Kierny

    2012-07-01

    Full Text Available The utility of biomarker detection in tomorrow's personalized health care field will mean early and accurate diagnosis of many types of human physiological conditions and diseases. In the search for biomarkers, recombinant affinity reagents can be generated to candidate proteins or post-translational modifications that differ qualitatively or quantitatively between normal and diseased tissues. The use of display technologies, such as phage-display, allows for manageable selection and optimization of affinity reagents for use in biomarker detection. Here we review the use of recombinant antibody fragments, such as scFvs and Fabs, which can be affinity-selected from phage-display libraries, to bind with both high specificity and affinity to biomarkers of cancer, such as Human Epidermal growth factor Receptor 2 (HER2 and Carcinoembryonic antigen (CEA. We discuss how these recombinant antibodies can be fabricated into nanostructures, such as carbon nanotubes, nanowires, and quantum dots, for the purpose of enhancing detection of biomarkers at low concentrations (pg/mL within complex mixtures such as serum or tissue extracts. Other sensing technologies, which take advantage of ‘Surface Enhanced Raman Scattering’ (gold nanoshells, frequency changes in piezoelectric crystals (quartz crystal microbalance, or electrical current generation and sensing during electrochemical reactions (electrochemical detection, can effectively provide multiplexed platforms for detection of cancer and injury biomarkers. Such devices may soon replace the traditional time consuming ELISAs and Western blots, and deliver rapid, point-of-care diagnostics to market.

  4. Limitation of tuning the antibody-antigen reaction by changing the value of pH and its consequence for hyperthermia.

    Science.gov (United States)

    Mleczko, J; Defort, A; Kozioł, J J; Nguyen, T T; Mirończyk, A; Zapotoczny, B; Nowak-Jary, J; Gronczewska, E; Marć, M; Dudek, M R

    2016-04-01

    Distribution of the isoelectric point (pI) was calculated for the hypervariable regions of Fab fragments of the antibody molecules, which structure is annotated in the structural antibody database SabDab. The distribution is consistent with the universal for all organisms dividing the proteome into two sets of acidic and basic proteins. It shows the additional fine structure in a form of the narrow-sized peaks of pI values. This is an explanation why a small change of the environmental pH can have a strong effect on the antibody-antigen affinity. To show this, a typical enzyme-linked immunospecific assay experiment for testing the reaction of goat anti-human IgA antibodies with human IgA immunoglobulins of saliva as antigens was modified in such a way that Fe3O4magnetic nanoparticles were added to PBS buffer. The magnetic nanoparticles were remotely heated by the radio frequency magnetic field providing the local change of temperature and pH. It was observed that short times of the heating were significantly increasing the antibody-antigen binding strength while it was not the case for a longer time. The finding discussed in the study can be useful for biopharmaceuticals using antibodies, the immunoassay techniques as well as for control over the use of hyperthermia. PMID:26634446

  5. Passive immunization of pigs with bispecific llama single-domain antibody fragments against foot-and-mouth disease and porcine immunoglobulin

    NARCIS (Netherlands)

    Harmsen, M.M.; Fijten, H.P.D.; Dekker, A.; Eble, P.L.

    2008-01-01

    Foot-and-mouth disease (FMD) is a contagious viral disease of cloven-hoofed animals that occasionally causes outbreaks in Europe. We aim to develop an immunotherapy that confers rapid protection against FMD in outbreak situations. For this purpose, we previously isolated llama single-domain antibody

  6. Randomized, placebo-controlled trial of the anti-tumor necrosis factor antibody fragment afelimomab in hyperinflammatory response during severe sepsis : The RAMSES Study

    NARCIS (Netherlands)

    Reinhart, K; Menges, T; Gardlund, B; Zwaveling, JH; Smithes, M; Vincent, JL; Tellado, JM; Salgado-Remigio, A; Zimlichman, R; Withington, S; Tschaikowsky, K; Brase, R; Damas, P; Kupper, H; Kempeni, J; Eiselstein, J; Kaul, M

    2001-01-01

    Objective: This study investigated whether treatment with the anti-tumor necrosis factor-or monoclonal antibody afelimomab would improve survival in septic patients with serum interleukin (IL)-6 concentrations of >1000 pg/ml, Design: Multicenter, double-blind, randomized, placebo-controlled study. S

  7. Dulaglutide, a long-acting GLP-1 analog fused with an Fc antibody fragment for the potential treatment of type 2 diabetes

    DEFF Research Database (Denmark)

    Jimenez-Solem, Espen; Rasmussen, Mette H; Christensen, Mikkel;

    2010-01-01

    Dulaglutide (LY-2189265) is a novel, long-acting glucagon-like peptide 1 (GLP-1) analog being developed by Eli Lilly for the treatment of type 2 diabetes mellitus (T2DM). Dulaglutide consists of GLP-1(7-37) covalently linked to an Fc fragment of human IgG4, thereby protecting the GLP-1 moiety fro...

  8. Pollution prevention opportunity assessment for MicroFab and SiFab facilities at Sandia National Laboratories.

    Energy Technology Data Exchange (ETDEWEB)

    Gerard, Morgan Evan

    2011-12-01

    This Pollution Prevention Opportunity Assessment (PPOA) was conducted for the MicroFab and SiFab facilities at Sandia National Laboratories/New Mexico in Fiscal Year 2011. The primary purpose of this PPOA is to provide recommendations to assist organizations in reducing the generation of waste and improving the efficiency of their processes and procedures. This report contains a summary of the information collected, the analyses performed, and recommended options for implementation. The Sandia National Laboratories Environmental Management System (EMS) and Pollution Prevention (P2) staff will continue to work with the organizations to implement the recommendations.

  9. Progress in the development of immunoanalytical methods incorporating recombinant antibodies to small molecular weight biotoxins.

    Science.gov (United States)

    Kavanagh, Owen; Elliott, Christopher T; Campbell, Katrina

    2015-04-01

    Rapid immunoanalytical screening of food and environmental samples for small molecular weight (hapten) biotoxin contaminations requires the production of antibody reagents that possess the requisite sensitivity and specificity. To date animal-derived polyclonal (pAb) and monoclonal (mAb) antibodies have provided the binding element of the majority of these assays but recombinant antibodies (rAb) isolated from in vitro combinatorial phage display libraries are an exciting alternative due to (1) circumventing the need for experimental animals, (2) speed of production in commonly used in vitro expression systems and (3) subsequent molecular enhancement of binder performance. Short chain variable fragments (scFv) have been the most commonly employed rAb reagents for hapten biotoxin detection over the last two decades but antibody binding fragments (Fab) and single domain antibodies (sdAb) are increasing in popularity due to increased expression efficiency of functional binders and superior resistance to solvents. rAb-based immunochromatographic assays and surface plasmon resonance (SPR) biosensors have been reported to detect sub-regulatory levels of fungal (mycotoxins), marine (phycotoxins) and aquatic biotoxins in a wide range of food and environmental matrices, however this technology has yet to surpass the performances of the equivalent mAb- and pAb-based formats. As such the full potential of rAb technology in hapten biotoxin detection has yet to be achieved, but in time the inherent advantages of engineered rAb are set to provide the next generation of ultra-high performing binder reagents for the rapid and specific detection of hapten biotoxins. PMID:25716465

  10. Preparation of monoclonal antibodies against cardiac myosin and some radiolabelling studies

    International Nuclear Information System (INIS)

    Monoclonal antibodies were raised against myosin, a specific indicator of myocardial infarction and labelled with 125I and 99mTc. Human cardiac myosin was isolated from normal human heart and was used for raising the monoclonal antibodies by the hybridoma technique. Antibody producing clones were identified by ELISA and cloning was done by the limiting dilution technique. Of the 13 clones obtained, 4 were deemed suitable for further studies. The antibodies were grown in ascites, purified, isotyped and their cross reactions with other forms of myosin were estimated. All the clones showed negligible cross reaction with rabbit myosin, but reacted to different extents with bovine skeletal myosin. The most avid antibody Mab-4G4 was chosen for further labelling studies. Mab-4G4 was labelled with 125I using different oxidising agents such as iodogen, chloramine-T and lactoperoxidase. Purified radioiodinated antibody with radiochemical purity >95% could be obtained by gel filtration. Immunoreactivity was retained as tested by binding to myosin immobilised on a solid support. Mab-4G4 was also labelled with 99mTc using stannous tartrate as the reducing agent. Radiolabelling yield was ∼60%, the purity was >95% and the immunoreactivity was retained. Both the labelled preparations were tested for bio-distribution in normal and infarcted rats. The activity accumulation in the infarcted region was ∼ 1.5 and 3.5 times as that in normal heart muscle for 125I and 99mTc labelled Mab-4G4 respectively. The major problem with the iodinated antibody was the in vivo deiodination resulting in very high percentage of activity in the thyroid. Although the fraction of the total activity associated with the infarcted heart is not very impressive, the fact that the activities with the infarcted and normal hearths are significantly different is heartening. With further optimisation of labelling and use of F(ab)'2 fragments, better delineation of the infarct sites is aspired. (author)

  11. Preparation and Evaluation of Human-Murine Chimeric Antibody against Protective Antigen of Bacillus anthracis

    Directory of Open Access Journals (Sweden)

    Lina Hao

    2014-10-01

    Full Text Available The aim of this research is to develop a human/murine chimeric Fab antibody which neutralizes the anthrax toxin, protective antigen (PA. The chimeric Fab was constructed using variable regions of murine anti-PA monoclonal antibody in combination with constant regions of human IgG. The chimeric PA6-Fab was expressed in E. coli. BL21 and evaluated by ELISA and co-immunoprecipitation- mass spectra. The potency of PA6-Fab to neutralize LeTx was examined in J774A.1 cell viability in vitro and in Fisher 344 rats in vivo. The PA6-Fab did not have domain similarity corresponding to the current anti PA mAbs, but specifically bound to anthrax PA at an affinity of 1.76 nM, and was able to neutralize LeTx in vitro and protected 56.9% cells at 20 μg/mL against anthrax LeTx. One hundred μg PA6-Fab could neutralize 300 μg LeTx in vivo. The PA6-Fab has potential as a therapeutic mAb for treatment of anthrax.

  12. Construction of human single-chain variable fragment antibodies of medullary thyroid carcinoma and single photon emission computed tomography/computed tomography imaging in tumor-bearing nude mice.

    Science.gov (United States)

    Liu, Qiong; Pang, Hua; Hu, Xiaoli; Li, Wenbo; Xi, Jimei; Xu, Lu; Zhou, Jing

    2016-01-01

    Medullary thyroid carcinoma (MTC) is a rare tumor of the endocrine system with poor prognosis as it exhibits high resistance against conventional therapy. Recent studies have shown that monoclonal antibodies labeled with radionuclide have become important agents for diagnosing tumors. To elucidate whether single-chain fragment of variable (scFv) antibody labeled with 131I isotope is a potential imaging agent for diagnosing MTC. A human scFv antibody library of MTC using phage display technique was constructed with a capacity of 3x10(5). The library was panned with thyroid epithelial cell lines and MTC cell lines (TT). Western blotting and enzyme-linked immunosorbent assay (ELISA) were used to identify the biological characteristics of the panned scFv. Methyl thiazolyl tetrazolium (MTT) assay was also used to explore the optimal concentration of the TT cell proliferation inhibition rate. They were categorized into TT, SW480 and control groups using phosphate-buffered saline. Western blotting showed that molecular weight of scFv was 28 kDa, cell ELISA showed that the absorbance of TT cell group was significantly increased (P=0.000??) vs. the other three groups, and MTT assay showed that the inhibition rate between the two cell lines was statistically significantly different (P<0.05) when the concentration of scFv was 0.1, 1 and 10 µmol/l. The tumor uptake of 131I-scFv was visible at 12 h and clear image was obtained at 48 h using the single photon emission computed tomography. scFv rapidly and specifically target MTC cells, suggesting the potential of this antibody as an imaging agent for diagnosing MTC. PMID:26498224

  13. Construction of prokaryotic expression system of 2 148-bp fragment from cagA gene and detection of cagA gene, CagA protein in Helicobacter pyloriisolates and its antibody in sera of patients

    Institute of Scientific and Technical Information of China (English)

    Jie Yan; Yuan Wang; Shi-He Shao; Ya-Fei Mao; Hua-Wen Li; Yi-Hui Luo

    2004-01-01

    AIM: To construct a prokaryotic expression system of a Helicobacter pylori ( H pylori) cagA gene fragment and establish enzyme-linked immunosorbent assays (ELISA) for detecting CagA and its antibody, so as to understand the manner in which the infection of CagA-expressing H pylori (CagA+ H pylori) isolates cause diseases.METHODS: H pylori strains in gastric biopsy specimens from 156 patients with positive results in rapid urease test were isolated. PCR was used to detect the frequency of cagA gene in the 109 H pylori isolates and to amplify a 2 148-bp fragment (cagA1) of cagA gene from a clinical strain Y06. A prokaryotic expression system of cagA1 gene was constructed,and the expression of the target recombinant protein (rCagA1) was examined by SDS-PAGE. Western blotting and immunodiffusion assay were employed to determine the immunoreactivity and antigenicity of rCagA1, respectively.Two ELISAs were established to detect CagA expression in 109 H pylori isolates and the presence of CagA antibody in the corresponding patients′ sera, and the correlations between infection with CagA+ H pylori and gastritis as well as peptic ulcer were analyzed.RESULTS: Of all the clinical specimens obtained, 80.8%(126/156) were found to have H pylori isolates and 97.2%of the isolates (106/109) were positive for caaA gene. In comparison with the reported data, the cloned cagA1fragment possessed 94.83% and 93.30% homologies with the nucleotide and putative amino acid sequences,respectively. The output of rCagA1 produced by the constructed recombinant prokaryotic expression system was approximately 30% of the total bacterial protein, rCagA1was able to bind to the commercial antibody against the whole-cells of H pylori and to induce the immunized rabbits to produce antibody with an immunodiffusion titer of 1:4. A proportion as high as 92.6% of the H pylori isolates (101/109)expressed CagA and 88.1% of the patients′ serum samples (96/109) were CagA antibody-positive. The percentage of

  14. A single-dose cytomegalovirus-based vaccine encoding tetanus toxin fragment C induces sustained levels of protective tetanus toxin antibodies in mice.

    Science.gov (United States)

    Tierney, Rob; Nakai, Toru; Parkins, Christopher J; Caposio, Patrizia; Fairweather, Neil F; Sesardic, Dorothea; Jarvis, Michael A

    2012-04-26

    The current commercially available vaccine used to prevent tetanus disease following infection with the anaerobic bacterium Clostridium tetani is safe and effective. However, tetanus remains a major source of mortality in developing countries. In 2008, neonatal tetanus was estimated to have caused >59,000 deaths, accounting for 1% of worldwide infant mortality, primarily in poorer nations. The cost of multiple vaccine doses administered by injection necessary to achieve protective levels of anti-tetanus toxoid antibodies is the primary reason for low vaccine coverage. Herein, we show that a novel vaccine strategy using a cytomegalovirus (CMV)-based vaccine platform induces protective levels of anti-tetanus antibodies that are durable (lasting >13 months) in mice following only a single dose. This study demonstrates the ability of a 'single-dose' CMV-based vaccine strategy to induce durable protection, and supports the potential for a tetanus vaccine based on CMV to impact the incidence of tetanus in developing countries. PMID:22414558

  15. Technetium-99m labeled monoclonal antibodies in the detection of metastatic melanoma

    International Nuclear Information System (INIS)

    Twenty-six stage II/III malignant melanoma patients with 321 measurable metastatic lesions were imaged using Fab fragments of an IgG murine monoclonal antibody labeled specifically with 10-30 mCi Tc-99m with a bi-functional chelating method (NeoRx, Seattle, WA). There were no side effects or adverse reactions. Immunoscintigraphy demonstrated 66.6% of lesions larger than 1 cm and 92.5% of lesions larger than 3 cm. Most frequently detected metastases were in lymph nodes, subcutaneous areas, and bone. Of lesions less than 1 cm, 23.6% were detected if superficial cutaneous lesions were excluded. The smallest detectable lesion was 4 mm. Twenty-one additional clinically unsuspected sites were visualized in 12 of the 26 patients studied. Of these, 56% were confirmed as metastasis by other tests. There were apparent nonspecific localizations owing to other causes, including fracture, varicosities, skin abscess and pneumonitis. Increased experience in image analysis facilitates correct interpretation of these localizations. This study demonstrates that imaging with Tc-99m labeled antibody fragments detects melanoma lesions in organs routinely surveyed and in other areas not routinely assessed by other imaging techniques. The procedure is readily performed and safe. The principal advantage of the test is its ability to survey the entire body and all organs with a single test. Its principal limitation, in common with other diagnostic imaging procedures, is its poor sensitivity for detecting lesions less than 1 cm

  16. Fusion of hIgG1-Fc to 111In-anti-amyloid single domain antibody fragment VHH-pa2H prolongs blood residential time in APP/PS1 mice but does not increase brain uptake

    International Nuclear Information System (INIS)

    Introduction: Llama single domain antibody fragments (VHH), which can pass endothelial barriers, are being investigated for targeting amyloid plaque load in Alzheimer's disease (AD). Contrary to conventional human or murine antibodies consisting of IgG or F(ab′)2 antibody fragments, VHH are able to effectively pass the blood brain barrier (BBB) in vitro. However, in earlier in vivo studies, anti-amyloid VHH showed poor BBB passage due to their short serum half-lives. It would be of interest to develop a VHH based protein with elongated serum half-life to enhance BBB passage, allowing the VHH to more easily reach the cerebral amyloid deposits. Methods: To increase serum persistence, the Fc portion of the human IgG1 antibody (hinge plus CH2 and CH3 domains) was fused to the C-terminus of the VHH (VHH-pa2H-Fc). To determine the pharmacokinetics and biodistribution profile of the fusion protein, the chelator p-SCN-Bz-DTPA was linked to the protein and thereafter labeled with radioactive indium-111 (111In). Double transgenic APPswe/PS1dE9 and wild type littermates were injected with 20 μg VHH-pa2H-Fc-DTPA-111In (10-20 MBq). Pharmacokinetics of the tracer was determined in blood samples at 10 intervals after injection and imaging using microSPECT was performed. The biodistribution of the radioactivity in various excised tissues was measured at 48 h after injection. Results: We succeeded in the expression of the fusion protein VHH-pa2H-Fc in HEK293T cells with a yield of 50 mg/L growth medium. The fusion protein showed homodimerization – necessary for successful Fc neonatal receptor recycling. Compared to VHH-pa2H, the Fc tailed protein retained high affinity for amyloid beta on human AD patient brain tissue sections, and significantly improved serum retention of the VHH. However, at 48 h after systemic injection of the non-fused VHH-DTPA-111In and the VHH-Fc-DTPA-111In fusion protein in transgenic mice, the specific brain uptake of VHH-Fc-DTPA-111In was not

  17. Clinical application of a new antimyosin antibody

    International Nuclear Information System (INIS)

    A mouse monoclonal antibody, 3-48 (Rougier Bio-Tech Ltd, Montreal) which recognizes the alpha and beta heavy chains of human atrial and ventricular myosin, and the beta heavy chain of human slow skeletal muscle, has recently been developed. In the rat isoproterenol-induced infarction model and the canine model of selective obstruction of a coronary artery, the antibody was shown to be specifically localized to the necrotic myocardium. A selected group of patients with known infarction was imaged with the 111indium labeled F(ab')2 protion of this antibody in a pre-clinical feasibility study, and the results therefrom are reported in this communication. (orig.)

  18. In vitro affinity maturation of a natural human antibody overcomes a barrier to in vivo affinity maturation

    Science.gov (United States)

    Li, Bing; Fouts, Ashley E; Stengel, Katharina; Luan, Peng; Dillon, Michael; Liang, Wei-Ching; Feierbach, Becket; Kelley, Robert F; Hötzel, Isidro

    2014-01-01

    Antibodies isolated from human donors are increasingly being developed for anti-infective therapeutics. These antibodies undergo affinity maturation in vivo, minimizing the need for engineering of therapeutic leads for affinity. However, the affinities required for some therapeutic applications may be higher than the affinities of the leads obtained, requiring further affinity maturation in vitro. To improve the neutralization potency of natural human antibody MSL-109 targeting human cytomegalovirus (CMV), we affinity matured the antibody against the gH/gL glycoprotein complex. A phage display library where most of the six complementary-determining regions (CDRs) were allowed to vary in only one amino acid residue at a time was used to scan for mutations that improve binding affinity. A T55R mutation and multiple mutations in position 53 of the heavy chain were identified that, when present individually or in combination, resulted in higher apparent affinities to gH/gL and improved CMV neutralization potency of Fab fragments expressed in bacterial cells. Three of these mutations in position 53 introduced glycosylation sites in heavy chain CDR 2 (CDR H2) that impaired binding of antibodies expressed in mammalian cells. One high affinity (KD < 10 pM) variant was identified that combined the D53N and T55R mutations while avoiding glycosylation of CDR H2. However, all the amino acid substitutions identified by phage display that improved binding affinity without introducing glycosylation sites required between two and four simultaneous nucleotide mutations to avoid glycosylation. These results indicate that the natural human antibody MSL-109 is close to a local affinity optimum. We show that affinity maturation by phage display can be used to identify and bypass barriers to in vivo affinity maturation of antibodies imposed by glycosylation and codon usage. These constraints may be relatively prevalent in human antibodies due to the codon usage and the amino acid

  19. Tetanus Toxin Fragment C Expressed in Live Salmonella Vaccines Enhances Antibody Responses to Its Fusion Partner Schistosoma haematobium Glutathione S-Transferase

    OpenAIRE

    Lee, Jeong Jin; Sinha, Katharine A.; Harrison, Julia A.; de Hormaeche, Raquel Demarco; Riveau, Gilles; Pierce, Raymond J.; Capron, Andre; Wilson, R. Alan; Khan, C.M. Anjam

    2000-01-01

    Tetanus toxoid has been used widely as an adjuvant. The atoxic fragment C from tetanus toxin (TetC) is potently immunogenic when expressed in Salmonella vaccine strains and has been used as a fusion partner for antigens (Ag). However, there has been no formal comparison of the immunomodulatory impact of TetC on its fusion partners. In this study, we have addressed this important issue. The protective 28-kDa glutathione S-transferase (GST) from Schistosoma haematobium (Sh28GST) was expressed e...

  20. Dulaglutide, a long-acting GLP-1 analog fused with an Fc antibody fragment for the potential treatment of type 2 diabetes

    DEFF Research Database (Denmark)

    Jimenez-Solem, Espen; Rasmussen, Mette H; Christensen, Mikkel; Knop, Filip Krag

    2010-01-01

    Dulaglutide (LY-2189265) is a novel, long-acting glucagon-like peptide 1 (GLP-1) analog being developed by Eli Lilly for the treatment of type 2 diabetes mellitus (T2DM). Dulaglutide consists of GLP-1(7-37) covalently linked to an Fc fragment of human IgG4, thereby protecting the GLP-1 moiety from...... dulaglutide reduces plasma glucose, and has an insulinotropic effect increasing insulin and C-peptide levels. Two phase II clinical trials demonstrated a dose-dependent reduction in glycated hemoglobin (HbA1c) of up to 1.52% compared with placebo. Side effects associated with dulaglutide administration were...

  1. Compact quantum dot-antibody conjugates for FRET immunoassays with subnanomolar detection limits.

    Science.gov (United States)

    Mattera, Lucia; Bhuckory, Shashi; Wegner, K David; Qiu, Xue; Agnese, Fabio; Lincheneau, Christophe; Senden, Tim; Djurado, David; Charbonnière, Loïc J; Hildebrandt, Niko; Reiss, Peter

    2016-06-01

    A novel two-step approach for quantum dot (QD) functionalization and bioconjugation is presented, which yields ultra-compact, stable, and highly luminescent antibody-QD conjugates suitable for use in FRET immunoassays. Hydrophobic InPZnS/ZnSe/ZnS (emission wavelength: 530 nm), CdSe/ZnS (605 nm), and CdSeTe/ZnS (705 nm) QDs were surface functionalized with zwitterionic penicillamine, enabling aqueous phase transfer under conservation of the photoluminescence properties. Post-functionalization with a heterobifunctional crosslinker, containing a lipoic acid group and a maleimide function, enabled the subsequent coupling to sulfhydryl groups of proteins. This was demonstrated by QD conjugation with fragmented antibodies (F(ab)). The obtained F(ab)-QD conjugates range among the smallest antibody-functionalized nanoprobes ever reported, with a hydrodynamic diameter LOD) for PSA compared to commercially available hydrophilic QDs emitting at 605 and 705 nm, respectively. While the commercial QDs contain identical inorganic cores responsible for their fluorescence, they are coated with a comparably thick amphiphilic polymer layer leading to much larger hydrodynamic diameters (>26 nm without biomolecules). The LODs of 0.8 and 3.7 ng mL(-1) obtained in 50 μL serum samples are below the clinical cut-off level of PSA (4 ng mL(-1)) and demonstrate their direct applicability in clinical diagnostics. PMID:27188210

  2. Monoclonal antibodies against ROR1 induce apoptosis of chronic lymphocytic leukemia (CLL) cells.

    Science.gov (United States)

    Daneshmanesh, A H; Hojjat-Farsangi, M; Khan, A S; Jeddi-Tehrani, M; Akhondi, M M; Bayat, A A; Ghods, R; Mahmoudi, A-R; Hadavi, R; Österborg, A; Shokri, F; Rabbani, H; Mellstedt, H

    2012-06-01

    ROR1 is a receptor tyrosine kinase (RTK) recently identified to be overexpressed at the gene and protein levels in chronic lymphocytic leukemia (CLL). Monoclonal antibodies (MAbs) against RTKs have been successfully applied for therapy of solid tumors. We generated five MAbs against the Ig (n = 1), cysteine-rich (CRD) (n = 2) and kringle (KNG) (n = 2) domains, respectively, of the extracellular part of ROR1. All CLL patients (n = 20) expressed ROR1 on the surface of the leukemic cells. A significantly higher frequency of ROR1 expression was found in patients with progressive versus non-progressive disease, and in those with unmutated versus mutated IgVH genes. All five MAbs alone induced apoptosis in the absence of complement or added effector cells (Annexin-V and MTT, as well as cleavage of poly-(ADP ribose)-polymerase, caspase-8 and caspase-9) of CLL cells but not of normal B cells. Most effective were MAbs against CRD and KNG, significantly superior to rituximab (P < 0.005). Cross-linking of anti-ROR1 MAbs using the F(ab')(2) fragments of anti-Fc antibodies significantly augmented apoptosis. Two of the MAbs induced complement-dependent cytotoxicity (CDC) similar to that of rituximab and one anti-ROR1 MAb (KNG) (IgG1) showed killing activity by antibody-dependent cellular cytotoxicity. The identified ROR1 epitopes may provide a basis for generating human ROR1 MAbs for therapy. PMID:22289919

  3. Jet fragmentation

    International Nuclear Information System (INIS)

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  4. Efficient silkworm expression of single-chain variable fragment antibody against ginsenoside Re using Bombyx mori nucleopolyhedrovirus bacmid DNA system and its application in enzyme-linked immunosorbent assay for quality control of total ginsenosides.

    Science.gov (United States)

    Sakamoto, Seiichi; Pongkitwitoon, Benyakan; Nakamura, Seiko; Maenaka, Katsumi; Tanaka, Hiroyuki; Morimoto, Satoshi

    2010-09-01

    A single-chain variable fragment (scFv) antibody against ginsenoside Re (G-Re) have been successfully expressed in the silkworm larvae using Bombyx mori nucleopolyhedrovirus (BmNPV) bacmid DNA system. The baculovirus donor vector for expression of scFv against G-Re (GRe-scFv) was constructed to contain honeybee melittin signal sequence to accelerate secretion of the recombinant GRe-scFv into the haemolymph of silkworm larvae. Functional recombinant GRe-scFv was purified by cation exchange chromatography followed by immobilized metal ion affinity chromatography. The yield of purified GRe-scFv was 6.5 mg per 13 silkworm larvae, which is equivalent to 650 mg/l of the haemolymph, exhibiting extremely higher yield than that expressed in Escherichia coli (1.7 mg/l of culture medium). It was revealed from characterization that GRe-scFv retained similar characteristic of the parental monoclonal antibody (MAb) against G-Re (MAb-4G10), making it possible to develop indirect competitive enzyme-linked immunosorbent assay (icELISA) for quality control of total ginsenosides in various ginsengs. The detectable range for calibration of G-Re by developed icELISA shows 0.05-10 microg/ml. These results clearly suggested that the silkworm expression system is quite useful for the expression of functional scFv that frequently required time- and cost-consuming re-folding when it expressed in E. coli. PMID:20592135

  5. Highly immunoreactive antibodies against the rHup-F2 fragment (aa 63-161) of the iron-regulated HupB protein of Mycobacterium tuberculosis and its potential for the serodiagnosis of extrapulmonary and recurrent tuberculosis.

    Science.gov (United States)

    Sritharan, N; Choudhury, M; Sivakolundu, S; Chaurasia, R; Chouhan, N; Rao, P P; Sritharan, M

    2015-01-01

    HupB is an iron-regulated protein in Mycobacterium tuberculosis that functions as a positive regulator of mycobactin biosynthesis. It is essential for the growth and survival of the pathogen inside macrophages. Previously, using the full-length rHupB of M. tuberculosis, we demonstrated high levels of anti-HupB antibodies in the serum of pulmonary tuberculosis (TB) and, interestingly, extrapulmonary TB patients with negligible levels in household contacts and healthy controls. Here, we used three antigenic fragments of HupB, namely the recombinant HupB-F1 (aa 1-71), HupB-F2 (aa 63-161) and HupB-F3 (aa 164-214), as antigens in enzyme-linked immunosorbent assay (ELISA) to screen serum from TB patients. HupB-F2 showed enhanced immunoreactivity with serum from patients with pulmonary TB (three groups consisting of new cases, defaulters and recurrent cases) and extrapulmonary TB, with negligible levels in normal healthy controls. The negative correlation of the anti-(HupB-F2) antibodies with serum iron was maximal, with a Pearson's correlation coefficient value of -0.415. The study, in addition to strengthening the diagnostic potential of HupB, reflected the superior performance of HupB-F2 as an antigen in screening pulmonary and extrapulmonary TB. PMID:25037869

  6. Study of the viability of technetium-{sup 99m} labeling of whole antimyosin antibody and its fragment: development of radiopharmaceutical for cardiac survey; Estudo da viabilidade da marcacao com tecnecio-99m do anticorpo antimiosina integro e seu fragmento: desenvolvimento de radiofarmaco para avaliacao cardiaca

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Guilherme Luiz de Castro

    2007-07-01

    In the acute myocardium infarction, the myocytes cell membrane loses its integrity, allowing the influx of extracellular macromolecules such as circulating antibody into the damaged cell. The use of the specific antibodies against cardiac myosin labeled with {sup 99m}Tc allows to determine the localization and extension of myocardial infarction. The purpose of this work was to study the viability of labeling of the antimyosin monoclonal antibody and its fragment F(ab')2 with {sup 99m}Tc. Because of the high cost of antimyosin antibody, others antibodies were used to optimize the methodology and the best condition was used for antimyosin antibody. The intact antibody was cleaved by pepsin to produce F(ab'){sub 2} fragment. The F(ab'){sub 2} and the intact antibody were reduced by treatment with Dithiothreitol (DTT) and 2-Mercaptoethanol (2-ME) and labeled with {sup 99m}Tc by direct method. Different concentrations of reductant, mixing conditions and incubation times were studied. In the standard condition, incubation at molar ratio 1:1000 (antibody:reducing agent) at room temperature for 30 minutes with continuous rotation (850 rpm), 13.28 - SH groups were formed per molecule. It was studied the influence of p H, of the concentration of stannous chloride (Sn{sup 2+}) and incubation time in the labeling condition. The better radiochemical yield (90.06 +- 1.53%) was obtained using 2.5 {mu}g of Sn{sup 2+} in p H 4.5 for 60 minutes. The labeling of the fragment F(ab'){sub 2} did not present satisfactory results because of the low yield of the digestion. After purification by PD-10, the biodistribution study was performed and showed that the intact antimyosin antibody labeled with {sup 99m}Tc presented fast kinetic compatible with the biodistribution of an intact antibody labeled with {sup 99m}Tc. Scintigraphy image of the animal with myocardial infarction was obtained and compared with the image of a normal animal. The studies allow to conclude that

  7. A simple vector system to improve performance and utilisation of recombinant antibodies

    OpenAIRE

    Vincent Karen J; Mitchell Joanne N; Rojas Gertrudis; Martin Cecile D; Wu Jiahua; McCafferty John; Schofield Darren J

    2006-01-01

    Abstract Background Isolation of recombinant antibody fragments from antibody libraries is well established using technologies such as phage display. Phage display vectors are ideal for efficient display of antibody fragments on the surface of bacteriophage particles. However, they are often inefficient for expression of soluble antibody fragments, and sub-cloning of selected antibody populations into dedicated soluble antibody fragment expression vectors can enhance expression. Results We ha...

  8. Spherical cows in the sky with fab four

    Energy Technology Data Exchange (ETDEWEB)

    Kaloper, Nemanja; Sandora, McCullen, E-mail: kaloper@physics.ucdavis.edu, E-mail: mesandora@ucdavis.edu [Department of Physics, University of California, Davis, CA 95616 (United States)

    2014-05-01

    We explore spherically symmetric static solutions in a subclass of unitary scalar-tensor theories of gravity, called the 'Fab Four' models. The weak field large distance solutions may be phenomenologically viable, but only if the Gauss-Bonnet term is negligible. Only in this limit will the Vainshtein mechanism work consistently. Further, classical constraints and unitarity bounds constrain the models quite tightly. Nevertheless, in the limits where the range of individual terms at large scales is respectively Kinetic Braiding, Horndeski, and Gauss-Bonnet, the horizon scale effects may occur while the theory satisfies Solar system constraints and, marginally, unitarity bounds. On the other hand, to bring the cutoff down to below a millimeter constrains all the couplings scales such that 'Fab Fours' can't be heard outside of the Solar system.

  9. Construction of bifunctional molecules specific to antigen and antibody’s Fc-fragment by fusion of scFv-antibodies with staphylococcal protein A

    Directory of Open Access Journals (Sweden)

    Kolibo D. V.

    2009-06-01

    Full Text Available Aim. To develop approach for detection of scFv and their complexes with antigens. Methods. The fusion proteins, which include sequences of scFv and staphylococcal protein A, were constructed and the obtained bifunctional molecules were immunochemically analysed. Results. It was shown, that scFv fused with protein A and their complexes with antigens are effectively recognized by labelled immunoglobulins with unrestricted antigenic specificity. Conclusions. The fusion of scFv with protein A fragment is a perspective approach to increase the efficiency of application in ELISA. The obtained scFv, fused with protein A, could be used for development of test-systems for the detection of diphtheria toxin.

  10. Structure determination of an anti-HIV-1 Fab 447-52D–peptide complex from an epitaxially twinned data set

    International Nuclear Information System (INIS)

    Separation of two individual lattices within an epitaxially twinned data set allowed the crystal structure of the V3-specific neutralizing antibody 447-52D in complex with a V3 peptide (UG1033) to be determined. The structure confirms that the neutralization breadth of Fab 447-52D is likely to be attributable to the extensive focus on main-chain hydrogen-bond interactions with the peptide that permit the recognition of a range of V3 sequences. Although antibodies against the third variable loop (V3) of the HIV-1 viral envelope glycoprotein are among the first neutralizing antibodies to be detected in infected individuals, they are normally restricted in their specificity. X-ray crystallographic studies of V3-specific antibodies have contributed to a more thorough understanding of recognition of this epitope and of conserved features in the V3 loop that could potentially aid in the design of a multi-component vaccine. The human antibody 447-52D exhibits relatively broad neutralization of primary viral isolates compared with other V3-loop antibodies. A crystal structure of Fab 447-52D in complex with a V3 peptide (UG1033) was determined at 2.1 Å resolution. The structure was determined using an epitaxially twinned data set and in-house programs to detect and remove overlapping reflections. Although the processed data have lower than desired completeness and slightly higher than normal R values for the resolution, good-quality electron-density maps were obtained that enabled structure determination. The structure revealed an extended CDR H3 loop that forms a β-sheet with the peptide, with the predominant contacts being main-chain hydrogen bonds. The V3 peptide and Fab show high structural homology with the previously reported structures of other Fab 447-52D complexes, reinforcing the idea that the V3 loop may adopt a small set of conserved structures, particularly around the crown of the β-hairpin

  11. Novel antibody conjugates for enhanced tumor uptake. Final report, September 1, 1992--August 31, 1997

    International Nuclear Information System (INIS)

    Progress in three areas of research is summarized. These are as follows: Labeling Monoclonal antibodies (MAbs) with Tc-99m and Re-186; human melanoma tumors and specific MAbs; evaluation of biological response modifiers (BRM). The techniques of labeling MAbs (IgM, IgG, F(ab')2 or F(ab')) with Tc-99m was developed in the author's laboratory in 1989 and that with Re-186 in 1992. The techniques are in daily use in the laboratory since then and are adapted to a convenient kit formulation. The metal ions are bound at MAb sulfhydryls generated by a controlled reduction of a pair of disulfide groups. At least two types of MAbs labeled with Tc-99m by this method have been administered into patients and excellent diagnostic results have been obtained. Over the past two and a half years the author has been successfully growing human melanoma tumors in athymic Balb/c nude mice. The cell LINE, WM-9, was obtained from Dr. D Herlyn's laboratory at Wistar Institute in Philadelphia. Sufficient quantities of antihuman melanoma specific antibodies ME 31.3 (Wistar, IgG-1) and MEM-136 (Hybritech, IgG-2A) and their F(ab')2 fragments are also available in the laboratory. The use of BRM is a rapidly evolving field. Over the past four years, the author has evaluated a number of BRMs in a quest for agents that may augment MAb tumor uptake. These included interferon-α; a pokeweed mitogen and Ukrain, an alkaloid separated from a plant Chelideonium Majis. In these preliminary studies, normal Balb/c mice were used and the BRMs were given i.p. one hour prior to the i.v. administration of tumor necrosis factor or an MAb (TNT-F(ab')2) labeled with Tc-99m which served as an imaging agent. Animals were sacrificed at 1.5 hr or 4 hrs post-injection. Highlights of the work are given here in a table

  12. Generation of a Novel Bacteriophage Library Displaying scFv Antibody Fragments from the Natural Buffalo Host to Identify Antigens from Adult Schistosoma japonicum for Diagnostic Development.

    Directory of Open Access Journals (Sweden)

    Christopher G Hosking

    2015-12-01

    Full Text Available The development of effective diagnostic tools will be essential in the continuing fight to reduce schistosome infection; however, the diagnostic tests available to date are generally laborious and difficult to implement in current parasite control strategies. We generated a series of single-chain antibody Fv domain (scFv phage display libraries from the portal lymph node of field exposed water buffaloes, Bubalus bubalis, 11-12 days post challenge with Schistosoma japonicum cercariae. The selected scFv-phages showed clear enrichment towards adult schistosomes and excretory-secretory (ES proteins by immunofluorescence, ELISA and western blot analysis. The enriched libraries were used to probe a schistosome specific protein microarray resulting in the recognition of a number of proteins, five of which were specific to schistosomes, with RNA expression predominantly in the adult life-stage based on interrogation of schistosome expressed sequence tags (EST. As the libraries were enriched by panning against ES products, these antigens may be excreted or secreted into the host vasculature and hence may make good targets for a diagnostic assay. Further selection of the scFv library against infected mouse sera identified five soluble scFv clones that could selectively recognise soluble whole adult preparations (SWAP relative to an irrelevant protein control (ovalbumin. Furthermore, two of the identified scFv clones also selectively recognised SWAP proteins when spiked into naïve mouse sera. These host B-cell derived scFvs that specifically bind to schistosome protein preparations will be valuable reagents for further development of a cost effective point-of-care diagnostic test.

  13. Generation of a Novel Bacteriophage Library Displaying scFv Antibody Fragments from the Natural Buffalo Host to Identify Antigens from Adult Schistosoma japonicum for Diagnostic Development.

    Science.gov (United States)

    Hosking, Christopher G; McWilliam, Hamish E G; Driguez, Patrick; Piedrafita, David; Li, Yuesheng; McManus, Donald P; Ilag, Leodevico L; Meeusen, Els N T; Veer, Michael J de

    2015-12-01

    The development of effective diagnostic tools will be essential in the continuing fight to reduce schistosome infection; however, the diagnostic tests available to date are generally laborious and difficult to implement in current parasite control strategies. We generated a series of single-chain antibody Fv domain (scFv) phage display libraries from the portal lymph node of field exposed water buffaloes, Bubalus bubalis, 11-12 days post challenge with Schistosoma japonicum cercariae. The selected scFv-phages showed clear enrichment towards adult schistosomes and excretory-secretory (ES) proteins by immunofluorescence, ELISA and western blot analysis. The enriched libraries were used to probe a schistosome specific protein microarray resulting in the recognition of a number of proteins, five of which were specific to schistosomes, with RNA expression predominantly in the adult life-stage based on interrogation of schistosome expressed sequence tags (EST). As the libraries were enriched by panning against ES products, these antigens may be excreted or secreted into the host vasculature and hence may make good targets for a diagnostic assay. Further selection of the scFv library against infected mouse sera identified five soluble scFv clones that could selectively recognise soluble whole adult preparations (SWAP) relative to an irrelevant protein control (ovalbumin). Furthermore, two of the identified scFv clones also selectively recognised SWAP proteins when spiked into naïve mouse sera. These host B-cell derived scFvs that specifically bind to schistosome protein preparations will be valuable reagents for further development of a cost effective point-of-care diagnostic test. PMID:26684756

  14. Nuclear fragmentation

    International Nuclear Information System (INIS)

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  15. Characterization for Binding Complex Formation with Site-Directly Immobilized Antibodies Enhancing Detection Capability of Cardiac Troponin I

    OpenAIRE

    Il-Hoon Cho; Sung-Min Seo; Jin-Woo Jeon; Se-Hwan Paek

    2009-01-01

    The enhanced analytical performances of immunoassays that employed site-directly immobilized antibodies as the capture binders have been functionally characterized in terms of antigen-antibody complex formation on solid surfaces. Three antibody species specific to cardiac troponin I, immunoglobulin G (IgG), Fab, and F(ab′)2 were site-directly biotinylated within the hinge region and then immobilized via a streptavidin-biotin linkage. The new binders were more efficient capture antibodies ...

  16. Purification and characterisation of immunoglobulins from the Australian black flying fox (Pteropus alecto using anti-fab affinity chromatography reveals the low abundance of IgA.

    Directory of Open Access Journals (Sweden)

    James W Wynne

    Full Text Available There is now an overwhelming body of evidence that implicates bats in the dissemination of a long list of emerging and re-emerging viral agents, often causing illnesses or death in both animals and humans. Despite this, there is a paucity of information regarding the immunological mechanisms by which bats coexist with highly pathogenic viruses. Immunoglobulins are major components of the adaptive immune system. Early studies found bats may have quantitatively lower antibody responses to model antigens compared to conventional laboratory animals. To further understand the antibody response of bats, the present study purified and characterised the major immunoglobulin classes from healthy black flying foxes, Pteropus alecto. We employed a novel strategy, where IgG was initially purified and used to generate anti-Fab specific antibodies. Immobilised anti-Fab specific antibodies were then used to capture other immunoglobulins from IgG depleted serum. While high quantities of IgM were successfully isolated from serum, IgA was not. Only trace quantities of IgA were detected in the serum by mass spectrometry. Immobilised ligands specific to IgA (Jacalin, Peptide M and staphylococcal superantigen-like protein also failed to capture P. alecto IgA from serum. IgM was the second most abundant serum antibody after IgG. A survey of mucosal secretions found IgG was the dominant antibody class rather than IgA. Our study demonstrates healthy P. alecto bats have markedly less serum IgA than expected. Higher quantities of IgG in mucosal secretions may be compensation for this low abundance or lack of IgA. Knowledge and reagents developed within this study can be used in the future to examine class-specific antibody response within this important viral host.

  17. Structural Characterisation of the Beta-Ketoacyl-Acyl Carrier Protein Synthases, FabF and FabH, of Yersinia pestis

    OpenAIRE

    Nanson, Jeffrey D.; Zainab Himiari; Swarbrick, Crystall M. D.; Forwood, Jade K.

    2015-01-01

    Yersinia pestis, the causative agent of bubonic, pneumonic, and septicaemic plague, remains a major public health threat, with outbreaks of disease occurring in China, Madagascar, and Peru in the last five years. The existence of multidrug resistant Y. pestis and the potential of this bacterium as a bioterrorism agent illustrates the need for new antimicrobials. The β-ketoacyl-acyl carrier protein synthases, FabB, FabF, and FabH, catalyse the elongation of fatty acids as part of the type II f...

  18. An optimized Fermentation and Purification Process for a Recombinant Human Antibody ScFv-Fc Fragment Expressed in Pichia Pastoris%重组人小分子抗体ScFv-Fc发酵条件的优化及纯化

    Institute of Scientific and Technical Information of China (English)

    王丁丁; 苏曼曼; 胡丽莉; 袁丽颖; 颜炜群

    2011-01-01

    Objective: To obtain an optimized fermentation and purification process for high-level production of a recombinant human antibody ScFv-Fc fragment expression secreted in Pichia pastoris. Methods: The growth conditions of the transformant strain were optimized in 50 ml conical tubes including pH, methanol concentration and inducing time. The ScFv-Fc was purified using a two-step scheme: ammonium sulfate fractionation, protein A Sepharose. Results: ScFv-Fc production was found to increase with 0.5% (v/v) methanol concentration after 72 h induction. Protein production was also greatly affected by pH, resulting in higher yields at 5.2 pH value. The ScFv-Fc was purified more than 94% purity by using protein A Sepharose. Conclusions: The results provided a best process for expression and purification of functional recombinant human monoclonal antibody ScFv-Fc. It suggests a potential use of this antibody generating method by Pichia pastoris and indicates the potential of scFv-Fc fusion proteins as therapeutic candidates.%目的:研究重组人小分子抗体ScFv-Fc在毕赤酵母中分泌表达的最佳条件,以及ScFv-Fc的纯化方法.方法:分别从甲醇浓度、pH、诱导时间等方面对毕赤酵母重组菌株产生ScFv-Fc的发酵过程进行了优化;通过硫酸铵沉淀结合protein A亲和层析柱,对ScFv-Fc的纯化方法进行了研究.结果:确定ScFv-Fc在毕赤酵母中分泌表达的最佳条件为:在pH5.2的条件下,以0.5%甲醇诱导72 h.经过protein A亲和层析柱纯化后,ScFv-Fc纯度可达94%以上.结论:确定了ScFv-Fc在毕赤酵母中分泌表达的最佳条件以及纯化方法,为重组抗体分子诊断、治疗试剂的开发以及抗体的人源化奠定了物质基础.

  19. Detection of experimental thrombi in rabbits with an 131I-labelled fibrin-specific monoclonal antibody

    International Nuclear Information System (INIS)

    The detection of thrombi in rabbits has been investigated with 131I-labelled DD-3B6/22, a monoclonal antibody (Mab) reactive at high affinity (Kd=2.68x10-10 M) with human D Dimer (DD). DD-3B6/22 bound well to both 'fresh' and 'aged' human clots in an in vitro assay but showed poor binding to rabbit clots. However, reactivity was restored to rabbit blood if it was seeded, before clotting, with human DD covalently coupled to Sepharose beads. Thus, a rabbit model was developed in which blood was allowed to clot around DD-Sepharose beads introduced into the jugular vein. Gamma camera imaging showed that intact 131I-labelled DD-3B6/22 localised to these clots within 24 h. Uptake at this time was 0.202%±0.012% injected dose per gram (%ID/g) compared with 0.086±0.018%ID/g after injection of control antibody. 131I-labelled F(ab')2 fragments of DD-3B6/22 allowed earlier scintigraphic detection of the clot which was evident 4 h after injection. Uptake in the clot at 24 h was 0.154±0.038% ID/g compared with 0.109±0.027% ID/g for a control F(ab')2. As antigen levels in the clot are estimated to be less than 300 μg DD, thus representing a very small human clot, the DD-3B6/22 Mab would appear to have a good potential for the sensitive detection of thrombi in a clinical setting. (orig.)

  20. Contribution of tryptophan residues to the combining site of a monoclonal anti dinitrophenyl spin-label antibody

    International Nuclear Information System (INIS)

    Two Fab fragments of the monoclonal anti dinitrophenyl (DNP) spin-label antibody AN02 were prepared by recombination of specifically deuterated heavy and light chains. In the recombinant H(I)L(II) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the heavy chain. In the recombinant H(II)L(I) all the tyrosines and phenylalanines were perdeuterated as were the tryptophan residues of the light chain. Saturation of three resonances of H(I)L(II), assigned to tryptophan protons of the light chain, resulted in magnetization transfer to the aromatic proton at position 6 of the DNP ring and to the CH2 protons of the glycines linked to the DNP in a diamagnetic hapten (DNP-DG). Saturation of three resonances of H(II)L(I) assigned to tryptophan protons of the heavy chain resulted in magnetization transfer to the CH2 protons of the glycines in DNP-DG. From the dependence of the magnetization transfer on the irradiation time, the cross relaxation rates between the involved protons were estimated. The inferred distances between these protons of the hapten and certain tryptophan protons are 3-4 A. It is concluded that in the combining site of AN02 there is one tryptophan from the light chain and one tryptophan from the heavy chain that are very near the hapten. When all tyrosines and phenylalanines were perdeuterated and all tryptophan aromatic protons were deuterated except for the protons at positions 2 and 5, titration of the Fab fragments with variable amounts of paramagnetic hapten showed that one proton from the light chain tryptophan is near (less than 7 A) the unpaired electron and that three other protons are significantly closer than 15 A

  1. Broadly Neutralizing Alphavirus Antibodies Bind an Epitope on E2 and Inhibit Entry and Egress.

    Science.gov (United States)

    Fox, Julie M; Long, Feng; Edeling, Melissa A; Lin, Hueylie; van Duijl-Richter, Mareike K S; Fong, Rachel H; Kahle, Kristen M; Smit, Jolanda M; Jin, Jing; Simmons, Graham; Doranz, Benjamin J; Crowe, James E; Fremont, Daved H; Rossmann, Michael G; Diamond, Michael S

    2015-11-19

    We screened a panel of mouse and human monoclonal antibodies (MAbs) against chikungunya virus and identified several with inhibitory activity against multiple alphaviruses. Passive transfer of broadly neutralizing MAbs protected mice against infection by chikungunya, Mayaro, and O'nyong'nyong alphaviruses. Using alanine-scanning mutagenesis, loss-of-function recombinant proteins and viruses, and multiple functional assays, we determined that broadly neutralizing MAbs block multiple steps in the viral lifecycle, including entry and egress, and bind to a conserved epitope on the B domain of the E2 glycoprotein. A 16 Å resolution cryo-electron microscopy structure of a Fab fragment bound to CHIKV E2 B domain provided an explanation for its neutralizing activity. Binding to the B domain was associated with repositioning of the A domain of E2 that enabled cross-linking of neighboring spikes. Our results suggest that B domain antigenic determinants could be targeted for vaccine or antibody therapeutic development against multiple alphaviruses of global concern. PMID:26553503

  2. Efficient inhibition of B-cell lymphoma xenografts with a novel recombinant fusion protein: anti-CD20Fab-LDM.

    Science.gov (United States)

    Xin, C; Ye, S; Ming, Y; Shenghua, Z; Qingfang, M; Hongxing, G; Xu, S; Yuanfu, X; Yuan, Z; Dongmei, F; Juanni, L; Yingdai, G; Lianfang, J; Rongguang, S; Zhenping, Z; Jianxiang, W; Tao, C; Chunzheng, Y; Dongsheng, X; Yongsu, Z

    2010-10-01

    Lidamycin (LDM) is a new member of enediyne antitumor antibiotics family that can be separated and reconstituted. It consists of a labile active enediyne chromophore (AE) and a noncovalently bound apoprotein (LDP). LDM is now in phase II clinical trials. In this study, we described the antitumor features of a fusion protein of LDM, anti-CD20Fab-LDM, targeted to CD20 expressed by B-lymphoid malignancies. Especially, LDM was prepared by a novel two-step method including DNA recombination and molecular reconstitution. Anti-CD20Fab-LDM exerted potent cytotoxicity against CD20+ B-cell lymphoma cell lines in vitro (IC50: 10-30 pM) and in the Raji xenograft model. Two Raji xenografts were allowed to grow to an initial mass of 80 and 500 mm³, respectively, and then anti-CD20Fab-LDM was administered intravenously with the highest dose of 4 nmol kg⁻¹ . The inhibition rates of tumor growth were 90.1 and 85%, which were saliently superior to those of nontargeted LDM. It is noteworthy that anti-CD20Fab-LDM can inhibit the growth of patient-derived cells, including rituximab-resistant patient-derived cells. Thus, CD20-targeted delivery of LDM is a specific and potent therapeutic strategy for B-lymphoid malignancies. In addition, the two-step approach could serve as a new technology platform for making a series of highly potent engineered antibody-based drugs. PMID:20463754

  3. Crystallization and preliminary X-ray analysis of the complexes between a Fab and two forms of human insulin-like growth factor II

    Science.gov (United States)

    Newman, Janet; Cohen, Edward H.; Cosgrove, Leah; Kopacz, Kris; Dransfield, Daniel T.; Adams, Timothy E.; Peat, Thomas S.

    2009-01-01

    Elevated expression of insulin-like growth factor II (IGF-II) is frequently observed in a variety of human malignancies, including breast, colon and liver cancer. As IGF-II can deliver a mitogenic signal through both the type 1 insulin-like growth factor receptor (IGF-IR) and an alternately spliced form of the insulin receptor (IR-A), neutralizing the biological activity of this growth factor directly is an attractive therapeutic option. One method of doing this would be to find antibodies that bind tightly and specifically to the peptide, which could be used as protein therapeutics to lower the peptide levels in vivo and/or to block the peptide from binding to the IGF-IR or IR-A. To address this, Fabs were selected from a phage-display library using a biotinylated precursor form of the growth factor known as IGF-IIE as a target. Fabs were isolated that were specific for the E-­domain C-terminal extension and for mature IGF-II. Four Fabs selected from the library were produced, complexed with IGF-II and set up in crystallization trials. One of the Fab–IGF-II complexes (M64-F02–IGF-II) crystallized readily, yielding crystals that diffracted to 2.2 Å resolution and belonged to space group P212121, with unit-cell parameters a = 50.7, b = 106.9, c = 110.7 Å. There was one molecule of the complete complex in the asymmetric unit. The same Fab was also crystallized with a longer form of the growth factor, IGF-IIE. This complex crystallized in space group P212121, with unit-cell parameters a = 50.7, b = 107, c = 111.5 Å, and also diffracted X-rays to 2.2 Å resolution. PMID:19724140

  4. Assessment of myocardial damage in cardiomyopathy using 111In-antimyosin Fab myocardial scintigraphy

    International Nuclear Information System (INIS)

    111In-antimyosin Fab (AM) myocardial scintigraphy was carried out in (A) 10 patients with idiopathic dilated cardiomyopathy, (B) 7 with dilated phase of hypertrophic cardiomyopathy and (C) 8 with normal (control) individuals. Imaging was taken 48 hours after intravenous injection of 74 MBq of AM. Myocardial uptake of AM was evaluated qualitatively and quantitatively. Positive uptake was observed in 9/10 (90%), 7/7 (100%) and 0/8 (0%) in groups A, B and C, respectively. AM index (heart/lung ratio) in groups A and B were 2.04±0.24 and 2.46±0.49, Values significantly higher than that obtained in the control patient without cardiomyopathy (1.51±0.13)(p<0.01). Positive monoclonal antimyosin antibody studies were highly prevalent in dilated cardiomyopathic and dilated phase of hypertrophic cardiomyopathic patients, even in the presence of negative right ventricular biopsy. It is suggested that this method was useful for the noninvasive assessment of active myocardial damage in these patients. (author)

  5. Thyroid Antibodies

    Science.gov (United States)

    ... be limited. Home Visit Global Sites Search Help? Thyroid Antibodies Share this page: Was this page helpful? Also known as: Thyroid Autoantibodies; Antithyroid Antibodies; Antimicrosomal Antibody; Thyroid Microsomal Antibody; ...

  6. Stable coordination of the inhibitory Ca2+ ion at MIDAS in integrin CD11b/CD18 by an antibody-derived ligand aspartate: Implications for integrin regulation and structure-based drug design

    Science.gov (United States)

    Mahalingam, Bhuvaneshwari; Ajroud, Kaouther; Alonso, Jose Luis; Anand, Saurabh; Adair, Brian; Horenstein, Alberto L; Malavasi, Fabio; Xiong, Jian-Ping; Arnaout, M. Amin

    2011-01-01

    A central feature of integrin interaction with physiologic ligands is the monodentate binding of a ligand carboxylate to a Mg2+ ion hexacoordinated at the metal-ion-dependent-adhesion site (MIDAS) in the integrin A-domain. This interaction stabilizes the A-domain in the high-affinity state, which is distinguished from the default low-affinity state by tertiary changes in the domain that culminate in cell adhesion. Small molecule ligand-mimetic integrin antagonists act as partial agonists, eliciting similar activating conformational changes in the A-domain, which has contributed to paradoxical adhesion and increased patient mortality in large clinical trials. As with other ligand-mimetic integrin antagonists, the function-blocking monoclonal antibody (mAb) 107 binds MIDAS of integrin CD11b/CD18 A-domain (CD11bA), but in contrast, it favors the inhibitory Ca2+ ion over Mg2+ at MIDAS. We determined the crystal structures of the Fab fragment of mAb 107 complexed to the low- and high-affinity states of CD11bA. Favored binding of Ca2+ at MIDAS is caused by the unusual symmetric bidentate ligation of a Fab-derived ligand Asp to a heptacoordinated MIDAS Ca2+. Binding of Fab 107 to CD11bA did not trigger the activating tertiary changes in the domain or in the full-length integrin. These data show that denticity of the ligand Asp/Glu can modify divalent cation selectivity at MIDAS and hence integrin function. Stabilizing the Ca2+ ion at MIDAS by bidentate ligation to a ligand Asp/Glu may provide one approach for designing pure integrin antagonists. PMID:22095715

  7. Single-chain antibody-fragment M6P-1 possesses a mannose 6-phosphate monosaccharide-specific binding pocket that distinguishes N-glycan phosphorylation in a branch-specific manner†.

    Science.gov (United States)

    Blackler, Ryan J; Evans, Dylan W; Smith, David F; Cummings, Richard D; Brooks, Cory L; Braulke, Thomas; Liu, Xinyu; Evans, Stephen V; Müller-Loennies, Sven

    2016-02-01

    The acquisition of mannose 6-phosphate (Man6P) on N-linked glycans of lysosomal enzymes is a structural requirement for their transport from the Golgi apparatus to lysosomes mediated by the mannose 6-phosphate receptors, 300 kDa cation-independent mannose 6-phosphate receptor (MPR300) and 46 kDa cation-dependent mannose 6-phosphate receptor (MPR46). Here we report that the single-chain variable domain (scFv) M6P-1 is a unique antibody fragment with specificity for Man6P monosaccharide that, through an array-screening approach against a number of phosphorylated N-glycans, is shown to bind mono- and diphosphorylated Man6 and Man7 glycans that contain terminal αMan6P(1 → 2)αMan(1 → 3)αMan. In contrast to MPR300, scFv M6P-1 does not bind phosphodiesters, monophosphorylated Man8 or mono- or diphosphorylated Man9 structures. Single crystal X-ray diffraction analysis to 2.7 Å resolution of Fv M6P-1 in complex with Man6P reveals that specificity and affinity is achieved via multiple hydrogen bonds to the mannose ring and two salt bridges to the phosphate moiety. In common with both MPRs, loss of binding was observed for scFv M6P-1 at pH values below the second pKa of Man6P (pKa = 6.1). The structures of Fv M6P-1 and the MPRs suggest that the change of the ionization state of Man6P is the main driving force for the loss of binding at acidic lysosomal pH (e.g. lysosome pH ∼ 4.6), which provides justification for the evolution of a lysosomal enzyme transport pathway based on Man6P recognition. PMID:26503547

  8. Engineered antibodies for monitoring of polynuclear aromatic hydrocarbons

    International Nuclear Information System (INIS)

    'The long-term goal of this project is to develop antibodies and antibody-based methods for detection and recovery of polynuclear aromatic hydrocarbons (PAHs) and PAH adducts that are potential biomarkers in environmental and biological samples. The inherent cross-reactivity will be exploited by pattern recognition methods. Dr. Karu''s laboratory uses new haptens representing key PAHs to derive recombinant Fab (rFab) and single-chain Fv (scFv) antibodies from hybridoma lines and combinatorial phage display libraries. Computational models of the haptens and combining sites made by Dr. Roberts''s group are used to guide antibody engineering by mutagenesis. Dr. Li''s laboratory develops enzyme immunoassays (EIAs), sensors, and immunoaffinity methods that make use of the novel haptens and antibodies for practical analytical applications in support of DOE''s mission. This report summarizes work completed in one and one-half years of a 3-year project, with close collaboration between the three research groups. Dr. Alexander Karu''s laboratory: the authors proceeded with the two strategies described in the original proposal. Site-directed mutagenesis was used to correct differences in the rFab N-terminal amino acids that were introduced by the degenerate PCR primers used for gene amplification. The binding constants of the rFabs with the corrected sequences will be compared with those of the parent MAbs, and should be very similar. The 4D5 and 10C10 heavy and light chain sequences are being moved to the pCOMB3H phagemid vector to facilitate selection of new engineered mutants.'

  9. Rational development of high-affinity T-cell receptor-like antibodies.

    Science.gov (United States)

    Stewart-Jones, Guillaume; Wadle, Andreas; Hombach, Anja; Shenderov, Eugene; Held, Gerhard; Fischer, Eliane; Kleber, Sascha; Nuber, Natko; Stenner-Liewen, Frank; Bauer, Stefan; McMichael, Andrew; Knuth, Alexander; Abken, Hinrich; Hombach, Andreas A; Cerundolo, Vincenzo; Jones, E Yvonne; Renner, Christoph

    2009-04-01

    T-cell interaction with a target cell is a key event in the adaptive immune response and primarily driven by T-cell receptor (TCR) recognition of peptide-MHC (pMHC) complexes. TCR avidity for a given pMHC is determined by number of MHC molecules, availability of coreceptors, and TCR affinity for MHC or peptide, respectively, with peptide recognition being the most important factor to confer target specificity. Here we present high-resolution crystal structures of 2 Fab antibodies in complex with the immunodominant NY-ESO-1(157-165) peptide analogue (SLLMWITQV) presented by HLA-A*0201 and compare them with a TCR recognizing the same pMHC. Binding to the central methionine-tryptophan peptide motif and orientation of binding were almost identical for Fabs and TCR. As the MW "peg" dominates the contacts between Fab and peptide, we estimated the contributions of individual amino acids between the Fab and peptide to provide the rational basis for a peptide-focused second-generation, high-affinity antibody library. The final Fab candidate achieved better peptide binding by 2 light-chain mutations, giving a 20-fold affinity improvement to 2-4 nM, exceeding the affinity of the TCR by 1,000-fold. The high-affinity Fab when grafted as recombinant TCR on T cells conferred specific killing of HLA-A*0201/NY-ESO-1(157-165) target cells. In summary, we prove that affinity maturation of antibodies mimicking a TCR is possible and provide a strategy for engineering high-affinity antibodies that can be used in targeting specific pMHC complexes for diagnostic and therapeutic purposes. PMID:19307587

  10. The community FabLab platform: applications and implications in biomedical engineering.

    Science.gov (United States)

    Stephenson, Makeda K; Dow, Douglas E

    2014-01-01

    Skill development in science, technology, engineering and math (STEM) education present one of the most formidable challenges of modern society. The Community FabLab platform presents a viable solution. Each FabLab contains a suite of modern computer numerical control (CNC) equipment, electronics and computing hardware and design, programming, computer aided design (CAD) and computer aided machining (CAM) software. FabLabs are community and educational resources and open to the public. Development of STEM based workforce skills such as digital fabrication and advanced manufacturing can be enhanced using this platform. Particularly notable is the potential of the FabLab platform in STEM education. The active learning environment engages and supports a diversity of learners, while the iterative learning that is supported by the FabLab rapid prototyping platform facilitates depth of understanding, creativity, innovation and mastery. The product and project based learning that occurs in FabLabs develops in the student a personal sense of accomplishment, self-awareness, command of the material and technology. This helps build the interest and confidence necessary to excel in STEM and throughout life. Finally the introduction and use of relevant technologies at every stage of the education process ensures technical familiarity and a broad knowledge base needed for work in STEM based fields. Biomedical engineering education strives to cultivate broad technical adeptness, creativity, interdisciplinary thought, and an ability to form deep conceptual understanding of complex systems. The FabLab platform is well designed to enhance biomedical engineering education. PMID:25570331

  11. Jet fragmentation

    International Nuclear Information System (INIS)

    Data on jet fragmentation, in particular recent results from e+e- and anti pp collisions, are presented in the framework of phenomenological models. The Lund string model and the Webber QCD cluster model turn out to describe the data quite well. Shortcomings of both models are discussed. (orig.)

  12. Meleagrin, a new FabI inhibitor from Penicillium chryosogenum with at least one additional mode of action.

    Directory of Open Access Journals (Sweden)

    Chang Ji Zheng

    Full Text Available Bacterial enoyl-acyl carrier protein reductase (FabI is a promising novel antibacterial target. We isolated a new class of FabI inhibitor from Penicillium chrysogenum, which produces various antibiotics, the mechanisms of some of them are unknown. The isolated FabI inhibitor was determined to be meleagrin by mass spectroscopy and nuclear magnetic resonance spectral analyses, and its more active and inactive derivatives were chemically prepared. Consistent with their selective inhibition of Staphylococcus aureus FabI, meleagrin and its more active derivatives directly bound to S. aureus FabI in a fluorescence quenching assay, inhibited intracellular fatty acid biosynthesis and growth of S. aureus, and increased the minimum inhibitory concentration for fabI-overexpressing S. aureus. The compounds that were not effective against the FabK isoform, however, inhibited the growth of Streptococcus pneumoniae that contained only the FabK isoform. Additionally no resistant mutant to the compounds was obtained. Importantly, fabK-overexpressing Escherichia coli was not resistant to these compounds, but was resistant to triclosan. These results demonstrate that the compounds inhibited another target in addition to FabI. Thus, meleagrin is a new class of FabI inhibitor with at least one additional mode of action that could have potential for treating multidrug-resistant bacteria.

  13. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  14. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  15. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...

  16. Budding yeast cDNA sequencing project: Y072_P20_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y072_P20_F.ab1 Y072_P20_F.ab1 DB661654 DB661654 Show Y072_P20_F.ab1 Seqid Y072_P20_F.ab1 Link to ... AATGCTGAGAT CGTTATTGCAAAGCGGCCACCGCAGGGTGGTTGCTTCTTCAT GTGCTACC AT GGTGCGTTGCAGTTCCTCGTCGACCTCCGCGTTGGCGTAC ... TCCCTTGCCCACACTAGACACTCCTTCCT GGAATGCCAACAGTGCCGTTTCAT CCATCAT TTACGAAACACCAGCGCCT TCTCGTCAACCAAGAAAACAGCAT ...

  17. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  18. Budding yeast cDNA sequencing project: Y114_D11_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y114_D11_F.ab1 Y114_D11_F.ab1 DB668015 DB668015 Show Y114_D11_F.ab1 Seqid Y114_D11_F.ab1 Link to ... CGAGTGTNNNAAGAGGNCATCTCTNAAATAGGG GANTNANNATAGGGAATTCC TTAAGATTTGGCGAGCAAATTAACAGACCT AATTGAACTGGAAAACATGT ... AAACCCATTGACAACTACATCACGA ACAGTGTTCGCCTTTTTGAGGTGAATCC ATCTCAAACGCTCTTCTCC ATA TCGTATAAACCACCAACACAGAAGACAG ... ACACCAAAGTGTCC TTTAGAAC TCATAACTCGCATTTATCC TTGAACTATAAATTTACTACTAA ... GATGTTTCAAGATTACTTAGTGCATTAGGCCCACGAGGCGTATCTATA ACTCC AGGTAAAATTGAAAAAATAGCACAGTCGAAGAAGAAAAATAACAA AATAA ...

  19. Budding yeast cDNA sequencing project: Y077_A07_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y077_A07_F.ab1 - - - Show Y077_A07_F.ab1 Seqid Y077_A07_F.ab1 Link to SGD - Link to dbEST - Link ... GGGGGGG GGGGGGGGGGGGGTATTCGTTTTAAAGGAATAAATTCGGGGTTTCC CCTT TCC ... Quality >Y077_A07_F.ab1 203 0 203 ABI 7 7 ...

  20. Budding yeast cDNA sequencing project: Y086_E03_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y086_E03_F.ab1 Y086_E03_F.ab1 DB663490 DB663490 Show Y086_E03_F.ab1 Seqid Y086_E03_F.ab1 Link to ... CGAGTGTAAAAGTACGGATACAAAAGAGGGGAC GACTCACTATAGTTACTTCC TTAAGATTTGAGCGATGAGAGCAGCTACAT AACACATAGTAAATCACACA ... TCTACGCAACACACACACACACGCATACAC TCACCCTCATGACAGATCC CCACTTGAACACGCCCCAAGTGAGCACGTCA CCCACATTTGAAAGATCAC ... AGGACTTCC TCAACATCGACGAACCGCCCTG TGCACAGGAAACACCTAGTGTTTCTACA ... TTCAACCTCC CGGGTCC AAGCG CTCC CGCTCAAAGCGTAGACAAGCCAGTCC CCATGATT ...

  1. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...

  2. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  3. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  4. Budding yeast cDNA sequencing project: Y016_M23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y016_M23_F.ab1 Y016_M23_F.ab1 - - Show Y016_M23_F.ab1 Seqid Y016_M23_F.ab1 Link to SGD Y016_M23_ ... GAGTGTAAACGACGGCCAGTATCTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTACTCC TCTCAGCCTCAGTCA TCATCC GCTCAAACCCAGCCG ... TCGTTCC AACCTAAAGAAAACCTTTTCGT ACCACGGGTAAAAATTTTGCATCGTGAT ... TAAAATAATA AGAATTATATATTTTATGATTATATTATTACATAAAGTATTCC CCATTAT AAATTCTGAGTTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAA ... AAAAAAA AAAAAAAAAAAAAAAAAAGTACCGCGGCCGCGGATCTCC CTTTAGGGAGG GTTAATTGGATCC AAACATGATAAAATACATTGATGAGT ...

  5. Automated reticle inspection data analysis for wafer fabs

    Science.gov (United States)

    Summers, Derek; Chen, Gong; Reese, Bryan; Hutchinson, Trent; Liesching, Marcus; Ying, Hai; Dover, Russell

    2009-04-01

    To minimize potential wafer yield loss due to mask defects, most wafer fabs implement some form of reticle inspection system to monitor photomask quality in high-volume wafer manufacturing environments. Traditionally, experienced operators review reticle defects found by an inspection tool and then manually classify each defect as 'pass, warn, or fail' based on its size and location. However, in the event reticle defects are suspected of causing repeating wafer defects on a completed wafer, potential defects on all associated reticles must be manually searched on a layer-by-layer basis in an effort to identify the reticle responsible for the wafer yield loss. This 'problem reticle' search process is a very tedious and time-consuming task and may cause extended manufacturing line-down situations. Often times, Process Engineers and other team members need to manually investigate several reticle inspection reports to determine if yield loss can be tied to a specific layer. Because of the very nature of this detailed work, calculation errors may occur resulting in an incorrect root cause analysis effort. These delays waste valuable resources that could be spent working on other more productive activities. This paper examines an automated software solution for converting KLA-Tencor reticle inspection defect maps into a format compatible with KLA-Tencor's Klarity Defect(R) data analysis database. The objective is to use the graphical charting capabilities of Klarity Defect to reveal a clearer understanding of defect trends for individual reticle layers or entire mask sets. Automated analysis features include reticle defect count trend analysis and potentially stacking reticle defect maps for signature analysis against wafer inspection defect data. Other possible benefits include optimizing reticle inspection sample plans in an effort to support "lean manufacturing" initiatives for wafer fabs.

  6. Use of antibodies specific to defined regions of scorpion α-toxin to study its interaction with its receptor site on the sodium channel

    International Nuclear Information System (INIS)

    Five antibody populations selected by immunoaffinity chromatography for the specificity toward various regions of toxin II of the scorpion Androctonus australis Hector were used to probe the interaction of this protein with its receptor site on the sodium channel. These studies indicate that two antigenic sites, one located around the disulfide bridge 12-63 and one encompassing residues 50-59, are involved in the molecular mechanisms of toxicity neutralization. Fab fragments specific to the region around disulfide bridge 12-63 inhibit binding of the 125I-labeled toxin to its receptor site. Also, these two antigenic regions are inaccessible to the antibodies when the toxin is bound to its receptor site. In contrast, the two other antigenic sites encompassing the only α-helix region (residues 23-32) and a β-turn structure (residues 32-35) are accessible to the respective antibodies when the toxin is bound to its receptor. Together, these data support the recent proposal that a region made of residues that are conserved in the scorpion toxin family is involved in the binding of the toxin to the receptor

  7. Diagnosis of acute myocardial infarction by indium-111 antimyosin antibodies and correlation with the traditional techniques for the evaluation of extent and localization

    International Nuclear Information System (INIS)

    This clinical study evaluated the accuracy of planar myocardial scintigraphy with antimyosin monoclonal antibodies radiolabeled with indium-111 (AMA-Fab) in the detection and localization of acute myocardial infarction (AMI). Fifty-seven patients admitted for suspected AMI were studied; 17 patients underwent thrombolytic therapy with intravenous streptokinase and 11 had clinical signs of reperfusion; 9 had had a previous myocardial infarction. Fifty of 57 patients were discharged from the coronary care unit with a confirmed diagnosis of AMI. The AMA-Fab study results were positive for AMI in 49 patients (98%) and negative in 1 (2%). Among the 7 patients without AMI, 5 had unstable angina, 1 had Prinzmetal's variant angina and 1 had acute pancreatitis. AMA-Fab results were negative in 6 of 7 patients (85%) and positive in 1 (15%). Therefore, the sensitivity and specificity of AMA-Fab scintigraphy were 0.98 and 0.85, respectively. To assess accuracy in defining the extent and location of AMI, AMA-Fab results were compared with those of the electrocardiogram, echocardiogram, technetium-99m pyrophosphate myocardial scintigraphy and coronary angiography and left ventriculography. AMA-Fab scintigraphy showed a good concordance with the traditional techniques in the topographic definition of the infarcted regions. No uptake of AMA-Fab was seen in the regions of previous old infarcts. Ten healthy volunteers also underwent AMA-Fab scintigraphy. No evidence of myocardial tracer uptake was noted in them. No adverse reactions or side effects were noted after injection of AMA-Fab in any patient. It is concluded that planar myocardial scintigraphy with AMA-Fab is a reliable method for AMI detection and location

  8. Pretargeting of human mammary carcinoma xenografts with bispecific anti-MUC1/anti-Ga chelate antibodies and immunoscintigraphy with PET

    International Nuclear Information System (INIS)

    We recently demonstrated the feasibility of combining enhanced tumor-to-tissue contrast and PET imaging for immunoscintigraphic tumor localization in pancreas and colon carcinoma bearing nude mice. Contrast enhancement was obtained with a multistep targeting technique that consists of the sequential administration of an antitumor/antihapten bispecific antibody (BS-MAb), a blocker to saturate the antihapten binding sites of the BS-MAb that remains in circulation, and a low molecular weight Ga chelate, labeled with the positron emitter 68Ga, which serves as the hapten. To evaluate the efficacy of this pretargeting technique for breast cancer localization, we synthesized a BS-MAb from the F(ab')2 fragments of the anti-MUC1 MAb 12H12 which reacts with the vast majority of human breast carcinomas, and the F(ab') fragment of an anti-Ga chelate MAb using a bifunctional chemical linker. The BS-MAb was tested for its affinity and its biokinetics in nude mice bearing a human mammary carcinoma. Equilibrium binding of the BS-MAb for mammary carcinoma cells was low (1.2 x 107 M-1) while the binding capacity of cells was high (8.4 x 106 BS-MAbs per cell). Tumor uptake of the 67Ga labeled chelate in pretargeted animals was to 5.8 ± 0.8% iD/g resulting in a tumor-to-blood ratio of 2.6 at 1h postinjection. This compares with a ratio of 0.65 and 0.85 obtained with 125I-labeled native 12H12 at 24h and 48h postinjection. No difference in the tumor uptake of both the 68Ga and 67Ga labeled chelate was observed. PET imaging of mice, started 1h postinjection of the 68Ga chelate, clearly visualized all tumors

  9. Well-oriented ZZ-PS-tag with high Fc-binding onto polystyrene surface for controlled immobilization of capture antibodies.

    Science.gov (United States)

    Tang, Jin-Bao; Sun, Xi-Feng; Yang, Hong-Ming; Zhang, Bao-Gang; Li, Zhi-Jian; Lin, Zhi-Juan; Gao, Zhi-Qin

    2013-05-01

    The site specificity and bioactivity retention of antibodies immobilized on a solid substrate are crucial requirements for solid phase immunoassays. A fusion protein between an immunoglobulin G (IgG)-binding protein (ZZ protein) and a polystyrene-binding peptide (PS-tag) was constructed, and then used to develop a simple method for the oriented immobilization of the ZZ protein onto a PS support by the specific attachment of the PS-tag onto a hydrophilic PS. The orientation of intact IgG was achieved via the interaction of the ZZ protein and the constant fragment (Fc), thereby displayed the Fab fragment for binding antigen. The interaction between rabbit IgG anti-horseradish peroxidase (anti-HRP) and its binding partner HRP was analyzed. Results showed that the oriented ZZ-PS-tag yielded an IgG-binding activity that is fivefold higher than that produced by the passive immobilization of the ZZ protein. The advantage of the proposed immunoassay strategy was demonstrated through an enzyme-linked immunosorbent assay, in which monoclonal mouse anti-goat IgG and HRP-conjugated rabbit F(ab')2 anti-goat IgG were used to detect goat IgG. The ZZ-PS-tag presented a tenfold higher sensitivity and a wider linear range than did the passively immobilized ZZ protein. The proposed approach may be an attractive strategy for a broad range of applications involving the oriented immobilization of intact IgGs onto PS supports, in which only one type of phi-PS (ZZ-PS-tag) surface is used. PMID:23601284

  10. Crystallization and preliminary X-ray analysis of the complexes between a Fab and two forms of human insulin-like growth factor II

    International Nuclear Information System (INIS)

    Complexes of both hIGF-II and hIGF-IIE with a Fab have been crystallized and investigated by X-ray analysis. Elevated expression of insulin-like growth factor II (IGF-II) is frequently observed in a variety of human malignancies, including breast, colon and liver cancer. As IGF-II can deliver a mitogenic signal through both the type 1 insulin-like growth factor receptor (IGF-IR) and an alternately spliced form of the insulin receptor (IR-A), neutralizing the biological activity of this growth factor directly is an attractive therapeutic option. One method of doing this would be to find antibodies that bind tightly and specifically to the peptide, which could be used as protein therapeutics to lower the peptide levels in vivo and/or to block the peptide from binding to the IGF-IR or IR-A. To address this, Fabs were selected from a phage-display library using a biotinylated precursor form of the growth factor known as IGF-IIE as a target. Fabs were isolated that were specific for the E-domain C-terminal extension and for mature IGF-II. Four Fabs selected from the library were produced, complexed with IGF-II and set up in crystallization trials. One of the Fab–IGF-II complexes (M64-F02–IGF-II) crystallized readily, yielding crystals that diffracted to 2.2 Å resolution and belonged to space group P212121, with unit-cell parameters a = 50.7, b = 106.9, c = 110.7 Å. There was one molecule of the complete complex in the asymmetric unit. The same Fab was also crystallized with a longer form of the growth factor, IGF-IIE. This complex crystallized in space group P212121, with unit-cell parameters a = 50.7, b = 107, c = 111.5 Å, and also diffracted X-rays to 2.2 Å resolution

  11. Kinetic epitope mapping of monoclonal antibodies raised against the Yersinia pestis virulence factor LcrV.

    Science.gov (United States)

    Read, Thomas; Olkhov, Rouslan V; Williamson, E Diane; Shaw, Andrew M

    2014-10-01

    Five monoclonal antibodies, mAb7.3, mAb29.3, mAb46.3, mAb12.3 and mAb36.3, raised to the LcrV virulence factor from Yersinia pestis were characterised for their Fab affinity against the purified protein and their Fc affinity to Protein A/G as a proxy for the FcγR receptor. Kinetic measurements were performed label-free in a localised particle plasmon array reader. The Fc-ProteinA/G complex first-order half-life was determined for each antibody and fell in the range of 0.8-3.8h. The Fab first-order half-lives had ranged from 3.4 to 9.2h although two antibodies, mAb12.3 and mAb36.3, showed low affinity interactions. Competitive binding studies of mixtures of the Fab-active antibodies were performed to measure the relative binding efficiency of one antibody in the presence of the other. A geometric relative positioning of the epitopes of mAb7.3, mAb29.3 and mAb46.3 was determined based on the footprint locus of the antibody and the percentage of competitive binding. The two known protective antibodies mAb7.3 and mAb29.3 showed greater interference, indicating epitopes close to one another compared to the non-protective mAb46.3 antibody. The Fab-Fc complex half-life screen and epitope mapping are potentially useful tools in the screening of therapeutic antibodies or vaccine candidates. PMID:25461137

  12. Antibodies to poliovirus detected by immunoradiometric assay with a monoclonal antibody

    Energy Technology Data Exchange (ETDEWEB)

    Spitz, M.; Fossati, C.A.; Schild, G.C.; Spitz, L.; Brasher, M. (National Inst. for Biological Standards and Control, London (UK))

    1982-10-01

    An immunoradiometric assay (IRMA) for the assay of antibodies to poliovirus antigens is described. Dilutions of the test sera or whole (finger prick) blood samples were incubated with the poliovirus antigen bound to a solid phase and the specific antibody was detected by the addition of a mouse anti-human IgG monoclonal antibody (McAb), which was itself revealed by iodinated sheep IgG antimouse F(ab). The authors have shown that this technique is suitable for the estimation of IgG anti-poliovirus antibodies induced in children following polio vaccine. The present study shows that SPRIA provides a simple and inexpensive method for serological studies with poliovirus particularly for use in large-scale surveys.

  13. SpiderFab: Architecture for On-Orbit Construction of Kilometer-Scale Apertures Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The SpiderFab effort has investigated the value proposition and technical feasibility of radically changing the way we build and deploy spacecraft in order to...

  14. Reclassification of leukemia among A-bomb survivors by French-American-British (FAB) classification, 1

    International Nuclear Information System (INIS)

    The concordance rate for the French-American-British (FAB) reclassification diagnoses of atomic bomb-related cases of leukemia in Nagasaki was determined by a group of RERF hematologists and one of the members of the FAB cooperative gruop. The peripheral blood and/or bone marrow smears from 193 persons with leukemia or related disorder were reviewed. There was 85% agreement in the identification of leukemia types and subtypes. There was almost complete agreement for the diagnosis of non-FAB disorders (chronic myeloid leukemia and others) resulting in overall concordance of 88.2%. The conclusion from this remarkably high rate of concordance is that it is feasible to accurately apply the FAB classification system to the cases of A-bomb-related leukemia. These preliminary observations suggest that the previously established leukemia types for about a quarter of the cases of acute leukemia and related disorders should be changed. (author)

  15. Finanční analýza podniku FAB s.r.o.

    OpenAIRE

    Mitvalská, Žaneta

    2009-01-01

    The assignment is focused on financial analysis of the FAB ltd. It is divided into two parts -- theoretical and practical. The theoretical part deals with characteristic and description of the purpose, methods and basic spheres of financial analysis. The second part consists of a particular financial analysis based on essential financial statements of the FAB ltd. in time 2005 -- 2007. The conclusion summarizes the financial analysis and also suggests useful solution for successful improvemen...

  16. Anti-sulfotyrosine antibodies

    Science.gov (United States)

    Bertozzi, Carolyn R.; Kehoe, John; Bradbury, Andrew M.

    2009-09-15

    The invention provides anti-sulfotyrosine specific antibodies capable of detecting and isolating polypeptides that are tyrosine-sulfated. The sulfotyrosine antibodies and antibody fragments of the invention may be used to discriminate between the non-sulfated and sulfated forms of such proteins, using any number of immunological assays, such ELISAs, immunoblots, Western Blots, immunoprecipitations, and the like. Using a phage-display system, single chain antibodies (scFvs) were generated and screened against tyrosine-sulfated synthetic peptide antigens, resulting in the isolation of scFvs that specifically recognize sulfotyrosine-containing peptides and/or demonstrate sulfotyrosine-specific binding in tyrosine sulfated proteins. The VH and VL genes from one such sulfotyrosine-specific scFv were employed to generate a full length, sulfotyrosine-specific immunoglobulin.

  17. Analysis of memory B cell responses and isolation of novel monoclonal antibodies with neutralizing breadth from HIV-1-infected individuals.

    Directory of Open Access Journals (Sweden)

    Davide Corti

    Full Text Available BACKGROUND: The isolation of human monoclonal antibodies (mAbs that neutralize a broad spectrum of primary HIV-1 isolates and the characterization of the human neutralizing antibody B cell response to HIV-1 infection are important goals that are central to the design of an effective antibody-based vaccine. METHODS AND FINDINGS: We immortalized IgG(+ memory B cells from individuals infected with diverse clades of HIV-1 and selected on the basis of plasma neutralization profiles that were cross-clade and relatively potent. Culture supernatants were screened using various recombinant forms of the envelope glycoproteins (Env in multiple parallel assays. We isolated 58 mAbs that were mapped to different Env surfaces, most of which showed neutralizing activity. One mAb in particular (HJ16 specific for a novel epitope proximal to the CD4 binding site on gp120 selectively neutralized a multi-clade panel of Tier-2 HIV-1 pseudoviruses, and demonstrated reactivity that was comparable in breadth, but distinct in neutralization specificity, to that of the other CD4 binding site-specific neutralizing mAb b12. A second mAb (HGN194 bound a conserved epitope in the V3 crown and neutralized all Tier-1 and a proportion of Tier-2 pseudoviruses tested, irrespective of clade. A third mAb (HK20 with broad neutralizing activity, particularly as a Fab fragment, recognized a highly conserved epitope in the HR-1 region of gp41, but showed striking assay-dependent selectivity in its activity. CONCLUSIONS: This study reveals that by using appropriate screening methods, a large proportion of memory B cells can be isolated that produce mAbs with HIV-1 neutralizing activity. Three of these mAbs show unusual breadth of neutralization and therefore add to the current panel of HIV-1 neutralizing antibodies with potential for passive protection and template-based vaccine design.

  18. Monoclonal antibodies.

    Science.gov (United States)

    2009-01-01

    The ability to produce and exploit monoclonal antibodies (mAbs) has revolutionized many areas of biological sciences. The unique property of an mAb is that it is a single species of immunoglobulin (IG) molecule. This means that the specificity of the interaction of the paratopes on the IG, with the epitopes on an antigenic target, is the same on every molecule. This property can be used to great benefit in immunoassays to provide tests of defined specificity and sensitivity, which improve the possibilities of standardization. The performance of assays can often be determined relating the actual weight of antibody (hence the number of molecules) to the activity. Often the production of an mAb against a specific epitope is the only way that biological entities can be differentiated. This chapter outlines the areas involving the development of assays based on mAbs. The problems involved address include the physical aspects of mAbs and how they may affect assay design and also the implications of results based on monospecific reagents. Often these are not fully understood, leading to assays that are less than satisfactory, which does not justify the relatively high cost of preparing and screening of mAbs. There are many textbooks and reviews dealing with the preparation of mAbs, the principles involved, and various purification and manipulative methods for the preparation of fragments and conjugation. There has been little general information attempting to summarize the best approaches to assay design using mAbs. Much time can be wasted through bad planning, and this is particularly relevant to mAbs. A proper understanding of some basic principles is essential. It is beyond the scope of this chapter to discuss all aspects, but major areas are highlighted. PMID:19219589

  19. Generation and characterization of heavy chain antibodies derived from Camelids

    OpenAIRE

    Schmidthals, Katrin

    2013-01-01

    Antibodies and antibody fragments are essential tools in basic research, diagnostics and therapy. Conventional antibodies consist of two heavy and two light chains with both chains contributing to the antigen-binding site. In addition to these conventional antibodies, camelids (llamas, alpacas, dromedaries and camels) possess so-called heavy chain antibodies (hcAbs) that lack the light chains. The antigen binding site of these unusual antibodies is formed by one single domain only, the so cal...

  20. Overcoming the Constraints of Anti-HIV/CD89 Bispecific Antibodies That Limit Viral Inhibition

    Directory of Open Access Journals (Sweden)

    Xiaocong Yu

    2016-01-01

    Full Text Available Innovative strategies are necessary to maximize the clinical application of HIV neutralizing antibodies. To this end, bispecific constructs of human antibody F240, reactive with well-conserved gp41 epitope and antibody 14A8, reactive with the IgA receptor (CD89 on effector cells, were constructed. A F240 × 14A8 bispecific single chain variable region (scFv molecule was constructed by linking two scFvs using a conventional GGGGS linker. Despite immunoreactivity with HIV gp41 and neutrophils, this bispecific scFv failed to inhibit HIV infection. This is in sharp contrast to viral inhibition using a chemical conjugate of the Fab of these two antibodies. Therefore, we constructed two novel Fab-like bispecific antibody molecules centered on fusion of the IgG1 CH1 domain or CH1-hinge domain to the C-terminus of F240scFv and fusion of the kappa chain CL domain to the C-terminus of 14A8scFv. Both Bi-Fab antibodies showed significant ADCVI activity for multiple clade B and clade C isolates by arming the neutrophils to inhibit HIV infection. The approach presented in this study is unique for HIV immunotherapy in that the impetus of neutralization is to arm and mobilize PMN to destroy HIV and HIV infected cells.

  1. Overcoming the Constraints of Anti-HIV/CD89 Bispecific Antibodies That Limit Viral Inhibition.

    Science.gov (United States)

    Yu, Xiaocong; Duval, Mark; Gawron, Melissa; Posner, Marshall R; Cavacini, Lisa A

    2016-01-01

    Innovative strategies are necessary to maximize the clinical application of HIV neutralizing antibodies. To this end, bispecific constructs of human antibody F240, reactive with well-conserved gp41 epitope and antibody 14A8, reactive with the IgA receptor (CD89) on effector cells, were constructed. A F240 × 14A8 bispecific single chain variable region (scFv) molecule was constructed by linking two scFvs using a conventional GGGGS linker. Despite immunoreactivity with HIV gp41 and neutrophils, this bispecific scFv failed to inhibit HIV infection. This is in sharp contrast to viral inhibition using a chemical conjugate of the Fab of these two antibodies. Therefore, we constructed two novel Fab-like bispecific antibody molecules centered on fusion of the IgG1 CH1 domain or CH1-hinge domain to the C-terminus of F240scFv and fusion of the kappa chain CL domain to the C-terminus of 14A8scFv. Both Bi-Fab antibodies showed significant ADCVI activity for multiple clade B and clade C isolates by arming the neutrophils to inhibit HIV infection. The approach presented in this study is unique for HIV immunotherapy in that the impetus of neutralization is to arm and mobilize PMN to destroy HIV and HIV infected cells. PMID:27419146

  2. Virus Strain Discrimination Using Recombinant Antibodies

    OpenAIRE

    Boonham, N.; Barker, I.

    2002-01-01

    Most routine testing for plant viruses is currently carried out using monoclonal and polyclonal antibodies. Traditional methods of antibody production however can be time consuming and require the use of expensive cell culture facilities. Recombinant antibody technology however is starting to make an impact in this area, enabling the selection of antibody fragments in a few weeks compared with the many months associated with traditional methods and requires only basic microbiological faciliti...

  3. Fab Four: When John and George Play Gravitation and Cosmology

    Directory of Open Access Journals (Sweden)

    J.-P. Bruneton

    2012-01-01

    Full Text Available Scalar-tensor theories of gravitation attract again a great interest since the discovery of the Chameleon mechanism and of the Galileon models. The former allows reconciling the presence of a scalar field with the constraints from Solar System experiments. The latter leads to inflationary models that do not need ad hoc potentials. Further generalizations lead to a tensor-scalar theory, dubbed the “Fab Four,” with only first and second order derivatives of the fields in the equations of motion that self-tune to a vanishing cosmological constant. This model needs to be confronted with experimental data in order to constrain its large parameter space. We present some results regarding a subset of this theory named “John,” which corresponds to a nonminimal derivative coupling between the scalar field and the Einstein tensor in the action. We show that this coupling gives rise to an inflationary model with very unnatural initial conditions. Thus, we include the term named “George,” namely, a nonminimal, but nonderivative, coupling between the scalar field and Ricci scalar. We find a more natural inflationary model, and, by performing a post-Newtonian analysis, we derive the set of equations that constrain the parameter space with data from experiments in the Solar System.

  4. Structure of adeno-associated virus-2 in complex with neutralizing monoclonal antibody A20

    Energy Technology Data Exchange (ETDEWEB)

    McCraw, Dustin M. [Department of Biochemistry and Molecular Biology, School of Medicine, Mail code L224, Oregon Health and Science University, 3181 S.W. Sam Jackson Park Road, Portland, OR 97239-3098 (United States); O& #x27; Donnell, Jason K. [Institute of Molecular Biophysics, Florida State University, Tallahassee, FL 32306-4380 (United States); Taylor, Kenneth A. [Department of Biological Science, Florida State University, Tallahassee, FL 32306-4295 (United States); Stagg, Scott M. [Institute of Molecular Biophysics, Florida State University, Tallahassee, FL 32306-4380 (United States); Department of Chemistry and Biochemistry, Florida State University, Tallahassee, FL 32306 (United States); Chapman, Michael S., E-mail: chapmami@ohsu.edu [Department of Biochemistry and Molecular Biology, School of Medicine, Mail code L224, Oregon Health and Science University, 3181 S.W. Sam Jackson Park Road, Portland, OR 97239-3098 (United States)

    2012-09-15

    The use of adeno-associated virus (AAV) as a gene therapy vector is limited by the host neutralizing immune response. The cryo-electron microscopy (EM) structure at 8.5 A resolution is determined for a complex of AAV-2 with the Fab' fragment of monoclonal antibody (MAb) A20, the most extensively characterized AAV MAb. The binding footprint is determined through fitting the cryo-EM reconstruction with a homology model following sequencing of the variable domain, and provides a structural basis for integrating diverse prior epitope mappings. The footprint extends from the previously implicated plateau to the side of the spike, and into the conserved canyon, covering a larger area than anticipated. Comparison with structures of binding and non-binding serotypes indicates that recognition depends on a combination of subtle serotype-specific features. Separation of the neutralizing epitope from the heparan sulfate cell attachment site encourages attempts to develop immune-resistant vectors that can still bind to target cells.

  5. Development of antibody-siRNA conjugate targeted to cardiac and skeletal muscles.

    Science.gov (United States)

    Sugo, Tsukasa; Terada, Michiko; Oikawa, Tatsuo; Miyata, Kenichi; Nishimura, Satoshi; Kenjo, Eriya; Ogasawara-Shimizu, Mari; Makita, Yukimasa; Imaichi, Sachiko; Murata, Shumpei; Otake, Kentaro; Kikuchi, Kuniko; Teratani, Mika; Masuda, Yasushi; Kamei, Takayuki; Takagahara, Shuichi; Ikeda, Shota; Ohtaki, Tetsuya; Matsumoto, Hirokazu

    2016-09-10

    Despite considerable efforts to develop efficient carriers, the major target organ of short-interfering RNAs (siRNAs) remains limited to the liver. Expanding the application outside the liver is required to increase the value of siRNAs. Here we report on a novel platform targeted to muscular organs by conjugation of siRNAs with anti-CD71 Fab' fragment. This conjugate showed durable gene-silencing in the heart and skeletal muscle for one month after intravenous administration in normal mice. In particular, 1μg siRNA conjugate showed significant gene-silencing in the gastrocnemius when injected intramuscularly. In a mouse model of peripheral artery disease, the treatment with myostatin-targeting siRNA conjugate by intramuscular injection resulted in significant silencing of myostatin and hypertrophy of the gastrocnemius, which was translated into the recovery of running performance. These data demonstrate the utility of antibody conjugation for siRNA delivery and the therapeutic potential for muscular diseases. PMID:27369865

  6. Aggregation of macrophages and fibroblasts is inhibited by a monoclonal antibody to the hyaluronate receptor

    Energy Technology Data Exchange (ETDEWEB)

    Green, S.J.; Underhill, C.B. (Georgetown Univ. Medical Center, Washington, DC (USA)); Tarone, G. (Univ. of Turin (Italy))

    1988-10-01

    To examine the role of the hyaluronate receptor in cell to cell adhesion, the authors have employed the K-3 monoclonal antibody (MAb) which specifically binds to the hyaluronate receptor and blocks its ability to interact with hyaluronate. In the first set of experiments, they investigated the spontaneous aggregation of SV-3T3 cells, which involves two distinct mechanisms, one of which is dependent upon the presence of divalent cation and the other is independent. The divalent cation-independent aggregation was found to be completely inhibited by both intact and Fab fragments of the K-3 MAb. In contrast, the K-3 MAb had no effect on the divalent cation-dependent aggregation of cells. In a second set of experiments, we examined alveolar macrophages. The presence of hyaluronate receptors on alveolar macrophages was demonstrated by the fact that detergent extracts of these cells could bind ({sup 3})hyaluronate, and this binding was blocked by the K-3 MAb. Immunoblot analysis of alveolar macrophages showed that the hyaluronate receptor had a M{sub r} of 99,500, which is considerably larger than the 85,000 M{sub r} for that on BHK cells. When hyaluronate was added to suspensions of alveolar macrophages, the cells were induced to aggregate. This effect was inhibited by the K-3 MAb, suggesting that the hyaluronate-induced aggregation was mediated by the receptor.

  7. Structure and function of broadly reactive antibody PG16 reveal an H3 subdomain that mediates potent neutralization of HIV-1

    Energy Technology Data Exchange (ETDEWEB)

    Pejchal, Robert; Walker, Laura M.; Stanfield, Robyn L.; Phogat, Sanjay K.; Koff, Wayne C.; Poignard, Pascal; Burton, Dennis R.; Wilson, Ian A. (Scripps); (IAVI)

    2010-11-15

    Development of an effective vaccine against HIV-1 will likely require elicitation of broad and potent neutralizing antibodies against the trimeric surface envelope glycoprotein (Env). Monoclonal antibodies (mAbs) PG9 and PG16 neutralize {approx}80% of HIV-1 isolates across all clades with extraordinary potency and target novel epitopes preferentially expressed on Env trimers. As these neutralization properties are ideal for a vaccine-elicited antibody response to HIV-1, their structural basis was investigated. The crystal structure of the antigen-binding fragment (Fab) of PG16 at 2.5 {angstrom} resolution revealed its unusually long, 28-residue, complementarity determining region (CDR) H3 forms a unique, stable subdomain that towers above the antibody surface. A 7-residue 'specificity loop' on the 'hammerhead' subdomain was identified that, when transplanted from PG16 to PG9 and vice versa, accounted for differences in the fine specificity and neutralization of these two mAbs. The PG16 electron density maps also revealed that a CDR H3 tyrosine was sulfated, which was confirmed for both PG9 (doubly) and PG16 (singly) by mass spectral analysis. We further showed that tyrosine sulfation plays a role in binding and neutralization. An N-linked glycan modification is observed in the variable light chain, but not required for antigen recognition. Further, the crystal structure of the PG9 light chain at 3.0 {angstrom} facilitated homology modeling to support the presence of these unusual features in PG9. Thus, PG9 and PG16 use unique structural features to mediate potent neutralization of HIV-1 that may be of utility in antibody engineering and for high-affinity recognition of a variety of therapeutic targets.

  8. Triclosan Resistance in a Bacterial Fish Pathogen, Aeromonas salmonicida subsp. salmonicida, is Mediated by an Enoyl Reductase, FabV.

    Science.gov (United States)

    Khan, Raees; Lee, Myung Hwan; Joo, Hae-Jin; Jung, Yong-Hoon; Ahmad, Shabir; Choi, Jin-Hee; Lee, Seon-Woo

    2015-04-01

    Triclosan, the widely used biocide, specifically targets enoyl-acyl carrier protein reductase (ENR) in the bacterial fatty acid synthesis system. Although the fish pathogen Aeromonas salmonicida subsp. salmonicida exhibits triclosan resistance, the nature of this resistance has not been elucidated. Here, we aimed to characterize the triclosan resistance of A. salmonicida subsp. salmonicida causing furunculosis. The fosmid library of triclosan-resistant A. salmonicida subsp. salmonicida was constructed to select a fosmid clone showing triclosan resistance. With the fosmid clone showing triclosan resistance, a subsequent secondary library search resulted in the selection of subclone pTSR-1. DNA sequence analysis of pTSR-1 revealed the presence of a chromosomal-borne fabV-encoding ENR homolog. The ENR of A. salmonicida (FabVas) exhibited significant homology with previously known FabV, including the catalytic domain YX(8)K. fabVas introduction into E. coli dramatically increased its resistance to triclosan. Heterologous expression of FabVas might functionally replace the triclosan-sensitive FabI in vivo to confer E. coli with triclosan resistance. A genome-wide search for fabVas homologs revealed the presence of an additional fabV gene (fabVas2) paralog in A. salmonicida strains and the fabVas orthologs from other gram-negative fish pathogens. Both of the potential FabV ENRs expressed similarly with or without triclosan supplement. This is the first report about the presence of two potential FabV ENRs in a single pathogenic bacterium. Our result suggests that triclosan-resistant ENRs are widely distributed in various bacteria in nature, and the wide use of this biocide can spread these triclosan-tolerant ENRs among fish pathogens and other pathogenic bacteria. PMID:25370725

  9. The diagnostic value of monoclonal antibody scan (leucoscan) compared with 99mTc MDP bone scan and Ga 67 in diagnosing bone and joint infection

    International Nuclear Information System (INIS)

    Full text: Nowadays different radiopharmaceuticals have been developed as 99mTc MDP, 67Ga citrate, 111In oxine- and 99mTc HMPAO labeled leucocytes for the accurate localization of bone/joint infection, but all of them have limitations that encouraged the search of new agents characterized from high and early uptake in infectious/inflammatory tissues, low toxicity and no accumulation in non inflamed tissues. The purpose of this study is to compare the diagnostic value of a 99mTc labeled antigranulocyte Fab' fragment (Leucoscan) with 99mTc MDP bone scan and 67 Ga. The monoclonal antibody, Leucoscan, is an IgG murine Fab' fragment directed against a NCA-90 epitope located on the surface of granulocytes. 45 patients with suspected bone and joint infection (18 total hip prosthesis, 4 knee prosthesis, 8 vertebral infection and 15 long bones) were included in this study. All patients underwent conventional Rx, bone scan, 67Ga scan and Leucoscan. Three phase 99mTc MDP bone scan and 67Ga scan were performed using standard procedures. For Leucoscan the antibody was labeled with 25 mCi of 99mTc and was infected intravenously over 30 seconds. Ten minutes planar images were taken 1 h and 2 hrs p.i using a GE Millennium γ camera provided with a LEGP collimator. Images were evaluated as score 1 (no abnormal uptake), score 2 (probably positive), score 3 (definitely infected) according the intensity of abnormally increased uptake. Results were compared with 99mTc MDP bone scan and 67Ga scans. The final diagnosis was given by the surgical verification with histopathology or culture. All 45 patients had pathologic proof of presence/absence of bone and joint infection. 36/45 were positive for bone or joint infection and 9/45 were negative.30/36 patients with surgically proven bone and joint infection had true positive Leucoscan, 26/36 had true positive MDP bone scan and 20/36 true positive 67Ga scan. Nine out of 9 patients with proven absence of inflammation had true negative

  10. Disassembly and reassembly of human papillomavirus virus-like particles produces more virion-like antibody reactivity

    Directory of Open Access Journals (Sweden)

    Zhao Qinjian

    2012-02-01

    Full Text Available Abstract Background Human papillomavirus (HPV vaccines based on major capsid protein L1 are licensed in over 100 countries to prevent HPV infections. The yeast-derived recombinant quadrivalent HPV L1 vaccine, GARDASIL(R, has played an important role in reducing cancer and genital warts since its introduction in 2006. The L1 proteins self-assemble into virus-like particles (VLPs. Results VLPs were subjected to post-purification disassembly and reassembly (D/R treatment during bioprocessing to improve VLP immunoreactivity and stability. The post-D/R HPV16 VLPs and their complex with H16.V5 neutralizing antibody Fab fragments were visualized by cryo electron microscopy, showing VLPs densely decorated with antibody. Along with structural improvements, post-D/R VLPs showed markedly higher antigenicity to conformational and neutralizing monoclonal antibodies (mAbs H16.V5, H16.E70 and H263.A2, whereas binding to mAbs recognizing linear epitopes (H16.J4, H16.O7, and H16.H5 was greatly reduced. Strikingly, post-D/R VLPs showed no detectable binding to H16.H5, indicating that the H16.H5 epitope is not accessible in fully assembled VLPs. An atomic homology model of the entire HPV16 VLP was generated based on previously determined high-resolution structures of bovine papillomavirus and HPV16 L1 pentameric capsomeres. Conclusions D/R treatment of HPV16 L1 VLPs produces more homogeneous VLPs with more virion-like antibody reactivity. These effects can be attributed to a combination of more complete and regular assembly of the VLPs, better folding of L1, reduced non-specific disulfide-mediated aggregation and increased stability of the VLPs. Markedly different antigenicity of HPV16 VLPs was observed upon D/R treatment with a panel of monoclonal antibodies targeting neutralization sensitive epitopes. Multiple epitope-specific assays with a panel of mAbs with different properties and epitopes are required to gain a better understanding of the immunochemical

  11. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    , contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...... developments within the construction sector imply a marginalized role for the architect, this strategy suggests a strong repositioning. In Danish building practice the construction industry is increasingly organized within terms like ”systemized prefab delivery” and ”digital building”. The building is divided...

  12. Monoclonal antibodies

    International Nuclear Information System (INIS)

    kits available commercially. There must, however, be a realistic pricing structure and some identification of the needs of developing countries to balance the costs of the kits, which are generally far too expensive. There is extensive literature concerning the preparation, characterization and application of MAbs. Areas of their use as therapeutics, the prophylactic prevention of diseases, or the development of anti-idiotypic vaccines are not examined. There is also no mention of engineered MAbs, in which recombinant technologies are used to produce bispecific antibodies and antibody fragments. These areas are being exploited in the human fields where, in terms of process biotechnology, kilograms of MAbs are routinely produced. It is reasonable to consider such exploitation in the veterinary sphere, whereby animals are protected by designer antibodies against defined epitopes. The main danger in the use of MAbs is that the research base necessary to understand the biology of host/pathogen relationships and the epidemiology of disease is being constantly eroded. (author)

  13. Patient biodistribution of intraperitoneally administered yttrium-90-labeled antibody.

    Science.gov (United States)

    Hnatowich, D J; Chinol, M; Siebecker, D A; Gionet, M; Griffin, T; Doherty, P W; Hunter, R; Kase, K R

    1988-08-01

    Although 90Y is one of the best radionuclides for radioimmunotherapeutic applications, the lack of gamma rays in its decay complicates the estimation of radiation dose since its biodistribution cannot be accurately determined by external imaging. A limited clinical trial has been conducted with tracer doses (1 mCi) of 90Y in five patients who then received second-look surgery such that tissue samples were obtained for accurate radioactivity quantitation by in vitro counting. The anti-ovarian antibody OC-125 as the F(ab')2 fragment was coupled with diethylenetriaminepentaacetic acid, radiolabeled with 90Y and administered intraperitoneally to patients with suspected or documented ovarian cancer. Size exclusion and ion exchange high performance liquid chromatography analysis of patient ascitic fluid and serum samples showed no evidence of radiolabel instability although a high molecular weight species (presumably immune complex) was observed in three patients. Total urinary excretion of radioactivity prior to surgery averaged 7% of the administered radioactivity while at surgery the mean organ accumulation was 8% of the administered radioactivity in serum, 10% in liver, 7% in bone marrow, and 19% in bone with large patient to patient variation. The mean tumor/normal tissue radioactivity ratio varied between 3 and 25. On the assumption that the above radioactivity levels were achieved immediately following administration, that the radioactivity remained in situ until decayed and that the dimensions of tumor were sufficient to completely attenuate the emissions of 90Y, the dose to tumor for a 1-mCi administration would be approximately 50 rad with normal tissues receiving approximately 8 rad. PMID:3404257

  14. Altered specificity of single-chain antibody fragments bound to pandemic H1N1-2009 influenza virus after conversion of the phage-bound to the soluble form

    Directory of Open Access Journals (Sweden)

    Kaku Yoshihiro

    2012-09-01

    Full Text Available Abstract Background In 2009, a novel influenza A/H1N1 virus (H1N1pdm quickly spread worldwide and co-circulated with then-existing seasonal H1N1 virus (sH1N1. Distinguishing between these 2 viruses was necessary to better characterize the epidemiological properties of the emergent virus, including transmission patterns, pathogenesis, and anti-influenza drug resistance. This situation prompted us to develop a point-of-care virus differentiation system before entering the 2009–2010 influenza season. Aiming to establish H1N1pdm-specific detection tools rapidly, we employed phage display libraries to select H1N1pdm-specific single-chain variable fragments (scFvs. Findings Human single-fold scFv libraries (Tomlinson I + J underwent selection for the ability to bind H1N1pdm virus particles. Three rounds of panning brought 1152 phage-bound scFvs, of which 58 clones reacted with H1N1pdm specifically or preferentially over sH1N1 in an enzyme-linked immunosorbent assay (ELISA. After conversion of the scFvs to soluble form, 7 clones demonstrating high/stable expression were finally obtained. However, all the soluble scFvs except No. 29 were found to have lost their specificity/preference for H1N1pdm in ELISA. The specificity/preference of No. 29 was also confirmed by immunofluorescence assay and immunoprecipitation, and the viral nucleoprotein was identified by ELISA as its target protein. The change in specificity associated with scFv conversion from phage-bound to soluble form could be due to loss of phage scaffold pIII protein, which likely provides structural support for the scFv antigen-binding site. It is also possible that the similar antigenic properties of H1N1pdm and sH1N1 led to the observed alterations in scFv specificity. Discussion Using a phage display library, we obtained 7 soluble scFv clones reactive against H1N1pdm; however, only 1 showed specificity/preference toward H1N1pdm. Our results confirmed that using phage display

  15. Humoral immune responses induced by anti-idiotypic antibody fusion protein of 6B11scFv/hGM-CSF in BALB/c mice

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background We have previously developed and characterized a monoclonal anti-idiotype antibody, designated 6B11, which mimics an ovarian carcinoma associated antigen OC166-9 and whose corresponding monoclonal antibody is COC166-9 (Ab1). In this study, we evaluate the humoral immune responses induced by the fusion protein 6B11 single-chain variable fragment (scFv)/human granulocyte macrophage colony-stimulating factor (hGM-CSF) and 6B11scFv in BALB/c mice. Methods The fusion protein 6B11scFv/hGM-CSF was constructed by fusing a recombinant single-chain variable fragment of 6B11scFv to GM-CSF. BALB/c mice were administrated by 6B11scFv/hGM-CSF and 6B11scFv, respectively. Results The fusion protein 6B11scFv/hGM-CSF retained binding to the anti-mouse F(ab)2' and was also biologically active as measured by proliferation of human GM-CSF dependent cell TF1 in vitro. After immunization with the 6B11scFv/hGM-CSF and 6B11ScFv, BALB/c mice showed significantly enhanced Ab3 antibody responses to 6B11scFv/hGM-CSF compared with the 6B11scFv alone. The level of Ab3 was the highest after the first week and maintained for five weeks after the last immunization. Another booster was given when the Ab3 titer descended, and it would reach to the high level in a week. Conclusion The fusion protein 6B11scFv/hGM-CSF can induce humoral immunity against ovarian carcinoma in vivo. We also provide the theoretical foundation for the application of the fusion protein 6B11scFv/hGM-CSF for active immunotherapy of ovarian cancer.

  16. Monoclonal antibody as radiopharmaceutical

    International Nuclear Information System (INIS)

    The purification of anti-CEA monoclonal antibody 4C11 belonging to IgG sub(2a) subclass from mouse ascitis, donated by Ludwig Institute, Brazil was developed. The fragmentation of purified IgG sub(2a) by pepsin digestion and analytical studies by polyacrilamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) were done as preliminary assessment for their specific application in immunoscintigraphy. (author)

  17. Antibody Response to Pneumocystis jirovecii

    OpenAIRE

    Daly, Kieran R.; Huang, Laurence; Morris, Alison; Koch, Judy; Crothers, Kristina; Levin, Linda; Eiser, Shary; Satwah, Supriya; Zucchi, Patrizia; Walzer, Peter D.

    2006-01-01

    We conducted a prospective pilot study of the serologic responses to overlapping recombinant fragments of the Pneumocystis jirovecii major surface glycoprotein (Msg) in HIV-infected patients with pneumonia due to P. jirovecii and other causes. Similar baseline geometric mean antibody levels to the fragments measured by an ELISA were found in both groups. Serum antibodies to MsgC in P. jirovecii patients rose to a peak level 3–4 weeks (p50 cells/μL and first episode of pneumocystosis were the ...

  18. Experience in immunoscintigraphy with 131I-labelled OC-125 F(ab')2 in patients with ovarian carcinoma

    International Nuclear Information System (INIS)

    In the specialized postoperative follow-up of patients with epithelial ovarian carcinoma, radioimmunoscintigraphy could usefully complete computed tomography and ultrasound results. Restrictions concerning the use of 131I labelled antibody fragments result, however, from radiation dosimetry and protection aspects: Although not more than 140 MBq of the 131I agent is administered because of the high thyroid and whole-body radiation exposure, for some days substantial excretion of 131I into urine occurs. This prevents us drastically from applying the method to the same extent as recommended in the literature. These limitations are expected to be overcome with 99mTc or 111In antibodies. (author)

  19. High level transient production of recombinant antibodies and antibody fusion proteins in HEK293 cells

    OpenAIRE

    Jäger, Volker; Büssow, Konrad; Wagner, Andreas; Weber, Susanne; Hust, Michael; Frenzel, André; Schirrmann, Thomas

    2013-01-01

    Background The demand of monospecific high affinity binding reagents, particularly monoclonal antibodies, has been steadily increasing over the last years. Enhanced throughput of antibody generation has been addressed by optimizing in vitro selection using phage display which moved the major bottleneck to the production and purification of recombinant antibodies in an end-user friendly format. Single chain (sc)Fv antibody fragments require additional tags for detection and are not as suitable...

  20. Antibodies to human fetal erythroid cells from a nonimmune phage antibody library

    OpenAIRE

    Huie, Michael A.; Cheung, Mei-Chi; Muench, Marcus O.; Becerril, Baltazar; Kan, Yuet W.; Marks, James D.

    2001-01-01

    The ability to isolate fetal nucleated red blood cells (NRBCs) from the maternal circulation makes possible prenatal genetic analysis without the need for diagnostic procedures that are invasive for the fetus. Such isolation requires antibodies specific to fetal NRBCs. To generate a panel of antibodies to antigens present on fetal NRBCs, a new type of nonimmune phage antibody library was generated in which multiple copies of antibody fragments are displayed on each pha...

  1. Antithyroid microsomal antibody

    Science.gov (United States)

    Thyroid antimicrosomal antibody; Antimicrosomal antibody; Microsomal antibody; Thyroid peroxidase antibody; TPOAb ... Granulomatous thyroiditis Hashimoto thyroiditis High levels of these antibodies have also been linked to an increased risk ...

  2. Direct and indirect interactions in the recognition between a cross-neutralizing antibody and the four serotypes of dengue virus.

    Science.gov (United States)

    Lisova, Olesia; Belkadi, Laurent; Bedouelle, Hugues

    2014-04-01

    Dengue fever is the most important vector-borne viral disease. Four serotypes of dengue virus, DENV1 to DENV4, coexist. Secondary infection by a different serotype is a risk factor for severe dengue. Monoclonal antibody mAb4E11 neutralizes the four serotypes of DENV with varying efficacies by recognizing an epitope located within domain-III (ED3) of the viral envelope (E) protein. To better understand the cross-reactivities between mAb4E11 and the four serotypes of DENV, we constructed mutations in both Fab4E11 fragment and ED3, and we searched for indirect interactions in the crystal structures of the four complexes. According to the serotype, 7 to 12 interactions are mediated by one water molecule, 1 to 10 by two water molecules, and several of these interactions are conserved between serotypes. Most interfacial water molecules make hydrogen bonds with both antibody and antigen. Some residues or atomic groups are engaged in both direct and water-mediated interactions. The doubly-indirect interactions are more numerous in the complex of lowest affinity. The third complementarity determining region of the light chain (L-CDR3) of mAb4E11 does not contact ED3. The structures and double-mutant thermodynamic cycles showed that the effects of (hyper)-mutations in L-CDR3 on affinity were caused by conformational changes and indirect interactions with ED3 through other CDRs. Exchanges of residues between ED3 serotypes showed that their effects on affinity were context dependent. Thus, conformational changes, structural context, and indirect interactions should be included when studying cross-reactivity between antibodies and different serotypes of viral antigens for a better design of diagnostics, vaccine, and therapeutic tools against DENV and other Flaviviruses. PMID:24591178

  3. AGILE integration into APC for high mix logic fab

    Science.gov (United States)

    Gatefait, M.; Lam, A.; Le Gratiet, B.; Mikolajczak, M.; Morin, V.; Chojnowski, N.; Kocsis, Z.; Smith, I.; Decaunes, J.; Ostrovsky, A.; Monget, C.

    2015-09-01

    mix logic Fab) in term of product and technology portfolio AGILE corrects for up to 120nm of product topography error on process layer with less than 50nm depth of focus Based on tool functionalities delivered by ASML and on high volume manufacturing requirement, AGILE integration is a real challenge. Regarding ST requirements "Automatic AGILE" functionality developed by ASML was not a turnkey solution and a dedicated functionality was needed. A "ST homemade AGILE integration" has been fully developed and implemented within ASML and ST constraints. This paper describes this integration in our Advanced Process Control platform (APC).

  4. MicroPET/CT imaging of patient-derived pancreatic cancer xenografts implanted subcutaneously or orthotopically in NOD-scid mice using 64Cu-NOTA-panitumumab F(ab')2 fragments

    International Nuclear Information System (INIS)

    Introduction: Our objective was to study microPET/CT imaging of patient-derived pancreatic cancer xenografts in NOD-scid mice using F(ab')2 fragments of the fully-human anti-EGFR monoclonal antibody, panitumumab (Vectibix) labeled with 64Cu. More than 90% of pancreatic cancers are EGFR-positive. Methods: F(ab')2 fragments were produced by proteolytic digestion of panitumumab IgG or non-specific human IgG, purified by ultrafiltration then modified with NOTA chelators for complexing 64Cu. Panitumumab IgG and Fab fragments were similarly labeled with 64Cu. EGFR immunoreactivity was determined in competition and direct (saturation) cell binding assays. The biodistribution of 64Cu-labeled panitumumab IgG, F(ab')2 and Fab was compared in non-tumor-bearing Balb/c mice. MicroPET/CT and biodistribution studies were performed in NOD-scid mice engrafted subcutaneously (s.c.) or orthotopically with patient-derived OCIP23 pancreatic tumors, or in NOD-scid with s.c. PANC-1 human pancreatic cancer xenografts. Results: Panitumumab F(ab')2 fragments were produced in high purity (> 90%), derivitized with 3.2 ± 0.7 NOTA/F(ab')2, and labeled with 64Cu (0.3–3.6 MBq/μg). The binding of 64Cu-NOTA-panitumumab F(ab')2 to OCIP23 or PANC-1 cells was decreased significantly by an excess of panitumumab IgG. The Kd for binding of 64Cu-NOTA-panitumumab F(ab')2 to EGFR on PANC-1 cells was 0.14 ± 0.05 nmol/L. F(ab')2 fragments exhibited more suitable normal tissue distribution for tumor imaging with 64Cu than panitumumab IgG or Fab. Tumor uptake at 48 h post injection (p.i.) of 64Cu-NOTA-panitumumab F(ab')2 was 12.0 ± 0.9% injected dose/g (ID/g) in s.c. and 11.8 ± 0.9% ID/g in orthotopic OCIP23 tumors vs. 6.1 ± 1.1% ID/g in s.c. PANC-1 xenografts. Tumor/Blood (T/B) ratios were 5:1 to 9:1 for OCIP23 and 2.4:1 for PANC-1 tumors. Tumor uptake of 64Cu-NOTA-non-specific F(ab')2 in OCIP23 xenografts was 5-fold lower than 64Cu-panitumumab F

  5. Process monitoring in high volume semiconductor production environment with in-fab TXRF

    International Nuclear Information System (INIS)

    After its introduction in the 80's, TXRF has become an important tool for surface contamination analysis. This is particularly true for the semiconductor industries, where monitoring trace level contamination in ultra clean environment is absolutely necessary for successful device production with reasonable yield. In FAB 25 of the Advanced Micro Devices in Austin, we have installed two TXRF tools, which are model TXRF3750 manufactured by Rigaku. They contain rotating tungsten anodes with three beam capability for wide selection of elements. One of the beams (WM) is used for monitoring of low Z elements such as Na, Mg and Al. The standard output is 9 kW with 300 mA at 30 kV. The tool runs 24 hours a day, 7 days a week, except for maintenance and breakdowns. We have been using TXRF for in-fab monitoring of various tools and processes for trace contamination and some quantification of materials. This in-fab operation is important because it gives real time monitoring without the necessity of bringing the wafers out of the fab. Secondly, being in ultra clean fab environment, the risk of background contamination is minimized. Since TXRF measurement is fast and does not need any sample preparation, this works very well as production support tool. Several wafer fab technicians have been trained to use the tool for round the clock operation. We have successfully monitored tools and processes in our fab. One example is the monitoring of numerous sinks used in the cleaning of production wafers after various processes. Monitor wafers are run after sink cleaning and solvent changes and they are then analyzed for any contamination. Another example is the monitoring of tools that use Ferrofluidic seals so as to prevent any contamination from Fe and Cr. Other tools using TXRF include diffusion furnaces, etchers and plasma cleaning tools. We have also been monitoring processes such as ion implantation, metal deposition and rapid thermal annealing. In this presentation, we will

  6. Budding yeast cDNA sequencing project: Y102_P06_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_P06_F.ab1 - - - Show Y102_P06_F.ab1 Seqid Y102_P06_F.ab1 Link to SGD - Link to dbEST - Link ... TTGACTGNNGCGTGTGTT GAGGTGGGGGGGAGGGAAATTATAAAAGAGGATCC GGGGAGAGGGGGGTT TCTCC ANTTNTTNGGNGNNNNNNNNNNNNNNNCNT ... NANNNNNNNTGTTTTAGGGGGGGGGG AGACTTTTTTTTGGGGGGGTTTTTTCC CCCCAAAAAAAAAAATTTTTGTG TGTGGGCCCCCCCCCCACCGGGGGAAA ... AAAAAATTTTTTTTAAAAAAGGG GGGGGTTTTTTTTTTTTCC CCCCGCGGGGAAAAAAAAAAAAAAAAAGCCC TCTTTTTTTTTTTTGGAGG ... TTAAATAAACCCCCCGCCAACCCCCCCCGGGAGGTTTTTGGGCGCCCCTT TCC ... Quality >Y102_P06_F.ab1 653 0 653 ABI 12 12 12 12 ...

  7. Isolation of Vibrio harveyi acyl carrier protein and the fabG, acpP, and fabF genes involved in fatty acid biosynthesis.

    Science.gov (United States)

    Shen, Z; Byers, D M

    1996-01-01

    We report the isolation of Vibrio harveyi acyl carrier protein (ACP) and cloning of a 3,973-bp region containing the fabG (encoding 3-ketoacyl-ACP reductase, 25.5 kDa), acpP (encoding ACP, 8.7 kDa), fabF (encoding 3-ketoacyl-ACP synthase II, 43.1 kDa), and pabC (encoding aminodeoxychorismate lyase, 29.9 kDa) genes. Predicted amino acid sequences were, respectively, 78, 86, 76, and 35% identical to those of the corresponding Escherichia coli proteins. Five of the 11 sequence differences between V. harveyi and E. coli ACP were nonconservative amino acid differences concentrated in a loop region between helices I and II. PMID:8550484

  8. Human anti-animal antibody and the interference in immunological assays%人抗动物抗体及其对免疫分析的干扰

    Institute of Scientific and Technical Information of China (English)

    杨朝国

    2001-01-01

    人抗动物抗体可引起临床不良反应,干扰动物源性抗体制剂治疗或成像,干扰免疫分析而引起假性结果。临床上可通过应用免疫抑制剂治疗和人源性抗体、聚乙二醇处理的抗体或抗体Fab段制剂等方法防止人抗动物抗体应答形成;样品预处理或分析技术的改进可消除人抗动物抗体对免疫分析的干扰。目前已设计出了多种分析技术检测人抗动物抗体,并形成了检测试剂盒,甚至床边检验试剂。%Human anti-animal antibody response may result in some adversereaction interfere with antibodies from animal therapy or imaging,and cause both false-positive and false-negative test results in immunoassays Strategies to prevent the development of human anti-animal antibody responses include immunosuppressant therapy and the use of humanized,polyethylene glycolytated antibodies,or Fab fragment of antibody agents.Sample pretreatments or assay redesign can eliminate immunoassay interference caused by human anti-animal antibodies.Currently,several assays have been designed to detect human anti-animal antibodies.There are the assays available in kit form,even a simple point-of care test.

  9. β-Hydroxyacyl-acyl Carrier Protein Dehydratase (FabZ) from Francisella tularensis and Yersinia pestis: Structure Determination, Enzymatic Characterization, and Cross-Inhibition Studies.

    Science.gov (United States)

    McGillick, Brian E; Kumaran, Desigan; Vieni, Casey; Swaminathan, Subramanyam

    2016-02-23

    The bacterial system for fatty acid biosynthesis (FAS) contains several enzymes whose sequence and structure are highly conserved across a vast array of pathogens. This, coupled with their low homology and difference in organization compared to the equivalent system in humans, makes the FAS pathway an excellent target for antimicrobial drug development. To this end, we have cloned, expressed, and purified the β-hydroxyacyl-acyl carrier protein dehydratase (FabZ) from both Francisella tularensis (FtFabZ) and Yersinia pestis (YpFabZ). We also solved the crystal structures and performed an enzymatic characterization of both enzymes and several mutant forms of YpFabZ. Additionally, we have discovered two novel inhibitors of FabZ, mangostin and stictic acid, which show similar potencies against both YpFabZ and FtFabZ. Lastly, we selected several compounds from the literature that have been shown to be active against single homologues of FabZ and tested them against both YpFabZ and FtFabZ. These results have revealed clues as to which scaffolds are likely to lead to broad-spectrum antimicrobials targeted against FabZ as well as modifications to existing FabZ inhibitors that may improve potency. PMID:26818694

  10. Budding yeast cDNA sequencing project: Y031_N21_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y031_N21_F.ab1 - - - Show Y031_N21_F.ab1 Seqid Y031_N21_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCG GATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT T GATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTAT TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCA ATAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  11. Budding yeast cDNA sequencing project: Y073_K23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y073_K23_F.ab1 - - - Show Y073_K23_F.ab1 Seqid Y073_K23_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCGG ATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT TG ATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTATT TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCAA TAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  12. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  13. Generation and Characterization of a Novel Recombinant Antibody against LMP1-TES1 of Epstein-Barr Virus Isolated by Phage Display

    Directory of Open Access Journals (Sweden)

    Jin Zhu

    2013-04-01

    Full Text Available Latent Membrane Protein 1 (LMP1 is a primary target for controlling tumorigenesis in Epstein-Barr virus related malignancies; in this study, we aimed to develop a specific antibody against the TES1 domain of the oncogenic LMP1. We screened a full human naïve Fab phage library against TES1 peptide, which consisted of C terminal-activating regions proximal 44 amino acids. After three rounds of panning, enrichment and testing by phage ELISA and further analyzed by DNA sequencing, we selected a phage clone with the highest affinity to LMP1-TES1 and designated it as htesFab. The positive clone was expressed in Escherichia coli and the purified htesFab was characterized for its binding specificity and affinity to LMP1. ELISA, immunofluorescence and FACS analysis confirmed that htesFab could recognize LMP1 TES1 both in vitro and in LMP1 expressing HNE2-LMP1 cells. Furthermore, MTT assay showed that htesFab inhibited the proliferation of HNE2-LMP1 cells in a dose-dependent manner. In summary, this study reported the isolation and characterization of human Fab, which specifically targets the C terminal region/TES1 of LMP1, and has potential to be developed as novel tool for the diagnosis and therapy of Epstein-Barr virus related carcinoma

  14. A solid phase radioimmunoassay for detection of antibodies to extractable nuclear antigens

    International Nuclear Information System (INIS)

    A solid phase radioimmunoassay is described for the detection of autoantibodies to the saline-soluble extractable nuclear antigens, ribonucleoprotein (RNP) and SS-B (or La). This assay depends on enrichment of antigens from a crude, commercially available (Pel Freez, USA) extract of rabbit thymus by absorption to the F(ab)2 fraction of specific high titre antibody attached to a microtitre plate. Serum antibody reactive with this antigen is then detected by 125I-labelled Protein A. The assay is simple and is more sensitive than the gel diffusion assays in general use for detecting such antibodies. (Auth.)

  15. Lysosomally cleavable peptide-containing polymersomes modified with anti-EGFR antibody for systemic cancer chemotherapy.

    Science.gov (United States)

    Lee, Jung S; Groothuis, Tom; Cusan, Claudia; Mink, Daniel; Feijen, Jan

    2011-12-01

    EGFR-conjugated Ps (pep) (abEGFR-Ps (pep)) were directly bound to the membrane of the cells and were endocytosed more rapidly as compared to Ps (pep)without abEGFR. Intracellular release of FD40 from Ps (pep) was observed, suggesting that the peptide linker in Ps (pep) was cleaved in the lysosomal compartments of the cells leading to Ps (pep) membrane disruption. An Alexa Fluor(®) 488 labeled fragment of anti-mouse IgG (F(ab')(2)A) was also coupled to Ps (pep). Specific binding of the Ps (pep) coupled IgG (F(ab')(2)A) onto SKBR3 cells treated with primary mouse antibody was observed, whereas no binding was found with SKBR3 cells treated with goat antibody. PMID:21872328

  16. 75 FR 9438 - Samsung Austin Semiconductor, LLC, DRAM Fab 1, a Subsidiary of Samsung Electronics Corporation...

    Science.gov (United States)

    2010-03-02

    ... Employment and Training Administration Samsung Austin Semiconductor, LLC, DRAM Fab 1, a Subsidiary of Samsung..., applicable to workers of Samsung Austin Semiconductor, LLC, a subsidiary of Samsung Electronics Corporation... Systems, Inc. were employed on-site at the Austin, Texas location of Samsung Austin Semiconductor, LLC,...

  17. Part I, FAB evaluation & application trials AFUE measurements: Part II, Integrated heating system (IHS) development

    Energy Technology Data Exchange (ETDEWEB)

    Leigh, R.W. [Brookhaven National Lab., Upton, NY (United States); Fisher, L. [BNL Consultant, Colrain, MA (United States)

    1996-07-01

    An oil burner/boiler efficiency test stand has been set up in the BNL oil heat laboratory which can measure the Annual Fuel Utilization Efficiency (AFUE) of burner/boiler combinations in accordance with ASHRAE and DOE standards. Measurements include both steady state efficiencies and heat-up and cool-down characteristics so that cycling effects can be included in an estimate of seasonal average performance. In addition to AFUE measurements, the direct conversion of fuel energy content to enthalpy increase in the boiler water is monitored. The system is largely automated, with most control functions under computer control and data taken electronically and permanently recorded on disks for future reference. To date, a retention-head burner and a fan atomized burner (FAB) have been tested in a steel boiler, the latter operating at two different fuel flow rates. The results are presented below, and verify that the very tight construction of the FAB`s fan results in a significant decrease in off-cycle sensible heat losses. Tests were also performed on a center-flue water heater fired with a conventional retention-head burner and with an FAB. The tests conformed to DOE standard procedures for hot water heaters, and the results are discussed below.

  18. Mass spectra of alkaline earth salts with a FAB source. Complexation with crown ethers

    International Nuclear Information System (INIS)

    With a liquid desorption FAB source it is possible to obtain alkaline earth metal ions complexed by a crown ether. Conditions for formation of these complexes ions are examined for selection of the complexing agent in function of cation size. Behaviour of alkaline and alkaline earth compounds are compared allowing the differentiation of ion extraction phenomena by liquid desorption ion source and solvent extraction

  19. Effect of the route of administration on the biodistribution of radioiodinated OV-TL 3 F(ab')2 in experimental ovarian cancer

    International Nuclear Information System (INIS)

    The effect of the route administration on the distribution of radioiodinated OV-TL 3 F(ab')2 was studied in Balb/c female mice with intraperitoneal or subcutaneous ovarian carcinoma xenografts. In the intraperitoneal tumour model in which both ascites and solid tumour deposits were present, intraperitoneal administration resulted in a lower estimated radiation dose to blood as compared with intravenous administration. In this model normalization to equal estimated radiation doses to blood for both routes of administration indicated that a twice as high estimated radiation dose can be guided to solid intraperitoneal tumour deposits following intraperitoneal administration. Evacuation of ascitic tumour cells prior to monoclonal antibody injection further increased the estimated radiation dose to solid intraperitoneal tumour deposits following intraperitoneal delivery. Following simultaneous intravenous and intraperitoneal injection of the monoclonal antibody, tissue uptake showed no relevant differences in the subcutaneous tumour model. Overall, the intraperitoneal route of administration was found to be the best choice for therapeutic delivery of iodine-131 labelled monoclonal antibodies. (orig.)

  20. Functional expression of a single-chain antibody to ErbB-2 in plants and cell-free systems

    Directory of Open Access Journals (Sweden)

    Benevolo Maria

    2006-09-01

    Full Text Available Abstract Background Aberrant signaling by ErbB-2 (HER 2, Neu, a member of the human Epidermal Growth Factor (EGF receptor family, is associated with an aggressive clinical behaviour of carcinomas, particularly breast tumors. Antibodies targeting the ErbB-2 pathway are a preferred therapeutic option for patients with advanced breast cancer, but a worldwide deficit in the manufacturing capacities of mammalian cell bioreactors is foreseen. Methods Herein, we describe a multi-platform approach for the production of recombinant Single chain Fragments of antibody variable regions (ScFvs to ErbB-2 that involves their functional expression in (a bacteria, (b transient as well as stable transgenic tobacco plants, and (c a newly developed cell-free transcription-translation system. Results An ScFv (ScFv800E6 was selected by cloning immunoglobulin sequences from murine hybridomas, and was expressed and fully functional in all the expression platforms, thereby representing the first ScFv to ErbB-2 produced in hosts other than bacteria and yeast. ScFv800E6 was optimized with respect to redox synthesis conditions. Different tags were introduced flanking the ScFv800E6 backbone, with and without spacer arms, including a novel Strep II tag that outperforms conventional streptavidin-based detection systems. ScFv800E6 was resistant to standard chemical radiolabeling procedures (i.e. Chloramine T, displayed a binding ability extremely similar to that of the parental monovalent Fab' fragment, as well as a flow cytometry performance and an equilibrium binding affinity (Ka approximately 2 × 108 M-1 only slightly lower than those of the parental bivalent antibody, suggesting that its binding site is conserved as compared to that of the parental antibody molecule. ScFv800E6 was found to be compatible with routine reagents for immunohistochemical staining. Conclusion ScFv800E6 is a useful reagent for in vitro biochemical and immunodiagnostic applications in oncology

  1. TriFabs—Trivalent IgG-Shaped Bispecific Antibody Derivatives: Design, Generation, Characterization and Application for Targeted Payload Delivery

    Directory of Open Access Journals (Sweden)

    Klaus Mayer

    2015-11-01

    Full Text Available TriFabs are IgG-shaped bispecific antibodies (bsAbs composed of two regular Fab arms fused via flexible linker peptides to one asymmetric third Fab-sized binding module. This third module replaces the IgG Fc region and is composed of the variable region of the heavy chain (VH fused to CH3 with “knob”-mutations, and the variable region of the light chain (VL fused to CH3 with matching “holes”. The hinge region does not contain disulfides to facilitate antigen access to the third binding site. To compensate for the loss of hinge-disulfides between heavy chains, CH3 knob-hole heterodimers are linked by S354C-Y349C disulphides, and VH and VL of the stem region may be linked via VH44C-VL100C disulphides. TriFabs which bind one antigen bivalent in the same manner as IgGs and the second antigen monovalent “in between” these Fabs can be applied to simultaneously engage two antigens, or for targeted delivery of small and large (fluorescent or cytotoxic payloads.

  2. Sequential imaging of indium-111-labeled monoclonal antibody in human mammary tumors hosted in nude mice

    International Nuclear Information System (INIS)

    Using a bifunctional chelating agent, indium-111 was attached to a monoclonal antibody 10-3D2, specific for a 126-kilodalton phosphoglycoprotein antigen associated with human mammary carcinoma, and was then used to localize and visualize human mammary tumors hosted in nude mice. Simultaneous tumor concentration of In-111-10-3D2 was eight times greater than that of control I-125-MOPC-21. Uptake of F(ab')2 and Fab of 10-3D2 was also compared. The scintigrams demonstrated that intact antibody provided the best images. Control In-111-labeled MOPC-21 and plasma did not show specific localization in the tumor. Uptake of In-111-labeled 10-3D2 was also compared in two lines of human mammary tumors, BT-20 and HS-578T. Imaging with 10-3D2 was better for BT-20 than for HS-578T

  3. FabSim: facilitating computational research through automation on large-scale and distributed e-infrastructures

    CERN Document Server

    Groen, Derek; Suter, James; Hetherington, James; Zasada, Stefan; Coveney, Peter

    2015-01-01

    We present FabSim, a toolkit developed to simplify a range of computational tasks for researchers in diverse disciplines. FabSim is flexible, adaptable, and allows users to perform a wide range of tasks with ease. It also provides a systematic way to automate the use of resourcess, including HPC and distributed resources, and to make tasks easier to repeat by recording contextual information. To demonstrate this, we present three use cases where FabSim has enhanced our research productivity. These include simulating cerebrovascular bloodflow, modelling clay-polymer nanocomposites across multiple scales, and calculating ligand-protein binding affinities.

  4. Natural anti-oxLDL IgM monoclonal antibody in the pathogenesis of atherosclerosis

    Institute of Scientific and Technical Information of China (English)

    Xuyang Feng; Ruifen Xu; Yan Gao; Haokao Gao; Zheng He; Haichang Wang

    2009-01-01

    Objective To explore the role and the possible molecular mechanisms of natural anti-oxLDL IgM monoclonal antibody played and involved in pathogenesis of atherosclerosis. Methods Natural anti-oxLDL IgM monoclonal antibody 3A6 was generated by using standard hybridoma production techniques. Influence of 3A6 on formation of foam cells was observed by Oil Red O staining and affinity of Na125I-conjugated oxLDL on the naive and LPS-activated macrophages. After LPS stimulation on macrophages, anti-TLR4 neutralizing mAb, p38MAPK specific inhibitor SB203580, NF-kB specific inhibitor PDTC or RNAi targeting Fcα/μ receptor (Fcamr) were applied, respectively. Results Natural anti-oxLDL IgM monoclonal antibody 3 A6 were found specifically inhibit the binding of CuoxLDL to naive macrophages but not the binding of CuoxLDL to LPS-activated macrophages. It also promoted the formation of CuoxLDL-mediated foam macrophages. 3A6 F(ab')2 or pre-incubation with un-related IgM inhibited the binding of 3A6/CuoxLDL complex to LPS-activated macrophages. LPS up-regulated the expression of Fcamr in macrophages in a dose- and time-dependent manner, which was attenuated by treatment with anti-TLR4. LPS induced the phosphorylation of p38MAPK and translocation of NF-kB p65, contributing to the up-regulated expression of Fcα/μ receptor in macrophages. Conclusions Natural anti-oxLDL IgM monoclonal antibody 3A6 specifically inhibited the binding of CuoxLDL to naive macrophages in vitro. However, LPS, through the Toll-like receptor (TLR)4 receptor, activated the p38MAPK and NF-kB pathways and up-regulated the expression of Fcα/μ receptor in macrophages, which promoted the binding of 3A6/CuoxLDL complex to macrophages through binding with Fc fragments and the formation of foam macrophages. Therefore, our findings provide a new explanation why bacterial infection deteriorates the pathogenesis of atherosclerosis.

  5. Campylobacter jejuni fatty acid synthase II: Structural and functional analysis of [beta]-hydroxyacyl-ACP dehydratase (FabZ)

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, Andrew S.; Yokoyama, Takeshi; Choi, Kyoung-Jae; Yeo, Hye-Jeong; (Houston)

    2009-08-14

    Fatty acid biosynthesis is crucial for all living cells. In contrast to higher organisms, bacteria use a type II fatty acid synthase (FAS II) composed of a series of individual proteins, making FAS II enzymes excellent targets for antibiotics discovery. The {beta}-hydroxyacyl-ACP dehydratase (FabZ) catalyzes an essential step in the FAS II pathway. Here, we report the structure of Campylobacter jejuni FabZ (CjFabZ), showing a hexamer both in crystals and solution, with each protomer adopting the characteristic hot dog fold. Together with biochemical analysis of CjFabZ, we define the first functional FAS II enzyme from this pathogen, and provide a framework for investigation on roles of FAS II in C. jejuni virulence

  6. Study of the regulation of Fab1p, a phosphatidylinositol 3-phosphate 5 kinase in Saccharomyces cerevisiae.

    OpenAIRE

    Phelan, J. P.

    2005-01-01

    The Saccharomyces cerevisiae protein Fab1p is the archetypal type III phosphatidyl inositol phosphate kinase. This family of enzymes is universal to all eukaryotes and is responsible for the synthesis of phosphatidylinositol 3,5-bisphosphate from phosphatidylinositol 3- phosphate. In S. cerevisiae , Fab1p regulates a number of cellular processes via the production of phosphatidylinositol 3,5-bisphosphate including: vacuole acidification, protein trafficking to the vacuole lumen, vacuole membr...

  7. An ordered water channel in Staphylococcus aureus FabI: unraveling the mechanism of substrate recognition and reduction.

    Science.gov (United States)

    Schiebel, Johannes; Chang, Andrew; Merget, Benjamin; Bommineni, Gopal R; Yu, Weixuan; Spagnuolo, Lauren A; Baxter, Michael V; Tareilus, Mona; Tonge, Peter J; Kisker, Caroline; Sotriffer, Christoph A

    2015-03-17

    One third of all drugs in clinical use owe their pharmacological activity to the functional inhibition of enzymes, highlighting the importance of enzymatic targets for drug development. Because of the close relationship between inhibition and catalysis, understanding the recognition and turnover of enzymatic substrates is essential for rational drug design. Although the Staphylococcus aureus enoyl-acyl carrier protein reductase (saFabI) involved in bacterial fatty acid biosynthesis constitutes a very promising target for the development of novel, urgently needed anti-staphylococcal agents, the substrate binding mode and catalytic mechanism remained unclear for this enzyme. Using a combined crystallographic, kinetic, and computational approach, we have explored the chemical properties of the saFabI binding cavity, obtaining a consistent mechanistic model for substrate binding and turnover. We identified a water-molecule network linking the active site with a water basin inside the homo-tetrameric protein, which seems to be crucial for the closure of the flexible substrate binding loop as well as for an effective hydride and proton transfer during catalysis. On the basis of our results, we also derive a new model for the FabI-ACP complex that reveals how the ACP-bound acyl-substrate is injected into the FabI binding crevice. These findings support the future development of novel FabI inhibitors that target the FabI-ACP interface leading to the disruption of the interaction between these two proteins. PMID:25706582

  8. Effect of PONNEEM# on Spodoptera litura (Fab.) and its compatibility with Trichogramma chilonis Ishii

    OpenAIRE

    Soosaimanickam Maria Packiam; Savarimuthu Ignacimuthu

    2012-01-01

    Antifeedant and growth regulating activities of PONNEEM, an oil formulation containing neem and pungam (karanj) oils were evaluated along with individual neem and karanj oils and Nimbicidine, a commercial neem-based pesticide against fourth instar larvae of Spodoptera litura (Fab.). Among all the treatments, PONNEEM recorded the maximum antifeedant activity (88.6%) at 0.6%. Neem and karanj individual treatments as well as PONNEEM extended larval duration compared to control. Pupal weight and ...

  9. Fab the coming revolution on you desktop : from personal computers to personal fabrication

    CERN Document Server

    Gershenfeld, Neil

    2005-01-01

    What if you could someday put the manufacturing power of an automobile plant on your desktop? According to Neil Gershenfeld, the renowned MIT scientist and inventor, the next big thing is personal fabrication-the ability to design and produce your own products, in your own home, with a machine that combines consumer electronics and industrial tools. Personal fabricators are about to revolutionize the world just as personal computers did a generation ago, and Fab shows us how.

  10. A status analysis of current digital marketing: a case study of Kauneusstudio FAB

    OpenAIRE

    Tran, Trong

    2015-01-01

    The subject of this thesis is a small company's current digital marketing status. This study was con-ducted in order for the owners of the beauty and hair salon Kauneusstudio FAB to improve their understanding of their customers’ behavior online and the significance of each digital channel they are using in the present marketing strategy. The goal of this study is to provide information for the company to recognize the strengths and the development points of the current digital marketing stra...

  11. Parton Fragmentation Functions

    CERN Document Server

    Metz, Andreas

    2016-01-01

    The field of fragmentation functions of light quarks and gluons is reviewed. In addition to integrated fragmentation functions, attention is paid to the dependence of fragmentation functions on transverse momenta and on polarization degrees of freedom. Higher-twist and di-hadron fragmentation functions are considered as well. Moreover, the review covers both theoretical and experimental developments in single-inclusive hadron production in electron-positron annihilation, deep-inelastic lepton-nucleon scattering, and proton-proton collisions.

  12. An Efficient and Economical Assay to Screen for Triclosan Binding to FabI.

    Science.gov (United States)

    Demissie, Robel D; Kabre, Pauline; Tuntland, Micheal L; Fung, Leslie W-M

    2016-04-01

    Triclosan is an effective inhibitor for enoyl acyl carrier protein reductase (ENR) in fatty acid biosynthesis. Triclosan-resistant mutants of ENR have emerged. Thus, it is important to detect these triclosan-resistant mutations in ENR. Generally, enzyme activity assays on the mutants are used to determine the effect of triclosan on ENR activity. Since the substrates are linked to acyl carrier protein (ACP), the assays are challenging due to the need to prepare the ACP and link it to the substrates. Non-ACP-linked (coenzyme A [CoA]-linked) substrates can be used in some ENR, but not in all. Consequently, screening for triclosan-resistant mutants is also challenging. We have developed a simple thermal shift assay, which does not use ACP-linked substrates, to determine the binding ability of triclosan to the ENR active site, and thus it can be used for screening for triclosan-resistant mutants. Staphylococcus aureus FabI enzyme and its mutants were used to demonstrate the binding ability of triclosan with NADP(+) to FabI. The direct correlation between the binding ability and enzyme activity was demonstrated with Francisella tularensis FabI. This method may also be applied to select effective triclosan analogues that inhibit ENR activity. PMID:26538431

  13. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants

    OpenAIRE

    Hehle, Verena K; Paul, Matthew J.; Roberts, Victoria A.; van Dolleweerd, Craig J.; Ma, Julian K.-C.

    2015-01-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformed Nicotiana tabacum. Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody...

  14. Impact of DNA Hairpin Folding Energetics on Antibody - ssDNA Association

    OpenAIRE

    Ou, Zhonghui; Bottoms, Christopher A.; Henzl, Michael T.; Tanner, John J.

    2007-01-01

    Deposition of anti-DNA antibodies in the kidney contributes to the pathogenesis of the autoimmune disease, systemic lupus erythematosus. Antibodies that bind to hairpin-forming DNA ligands may be particularly prone to deposition. Here we report the first structure of a Fab complexed with hairpin-forming DNA. The ligand used for co-crystallization is 5’-d[CTG(CCTT)CAG]-3’, which has a predicted hairpin structure consisting of a four-nucleotide loop (CCTT) and a stem of three base-pairs. The 1....

  15. Antibody elicited against the gp41 N-heptad repeat (NHR) coiled-coil can neutralize HIV-1 with modest potency but non-neutralizing antibodies also bind to NHR mimetics

    International Nuclear Information System (INIS)

    Following CD4 receptor binding to the HIV-1 envelope spike (Env), the conserved N-heptad repeat (NHR) region of gp41 forms a coiled-coil that is a precursor to the fusion reaction. Although it has been a target of drug and vaccine design, there are few monoclonal antibody (mAb) tools with which to probe the antigenicity and immunogenicity specifically of the NHR coiled-coil. Here, we have rescued HIV-1-neutralizing anti-NHR mAbs from immune phage display libraries that were prepared (i) from b9 rabbits immunized with a previously described mimetic of the NHR coiled-coil, N35CCG-N13, and (ii) from an HIV-1 infected individual. We describe a rabbit single-chain Fv fragment (scFv), 8K8, and a human Fab, DN9, which specifically recognize NHR coiled-coils that are unoccupied by peptide corresponding to the C-heptad repeat or CHR region of gp41 (e.g. C34). The epitopes of 8K8 and DN9 were found to partially overlap with that of a previously described anti-NHR mAb, IgG D5; however, 8K8 and DN9 were much more specific than D5 for unoccupied NHR trimers. The mAbs, including a whole IgG 8K8 molecule, neutralized primary HIV-1 of clades B and C in a pseudotyped virus assay with comparable, albeit relatively modest potency. Finally, a human Fab T3 and a rabbit serum (both non-neutralizing) were able to block binding of D5 and 8K8 to a gp41 NHR mimetic, respectively, but not the neutralizing activity of these mAbs. We conclude from these results that NHR coiled-coil analogs of HIV-1 gp41 elicit many Abs during natural infection and through immunization, but that due to limited accessibility to the corresponding region on fusogenic gp41 few can neutralize. Caution is therefore required in targeting the NHR for vaccine design. Nevertheless, the mAb panel may be useful as tools for elucidating access restrictions to the NHR of gp41 and in designing potential improvements to mimetics of receptor-activated Env

  16. Budding yeast cDNA sequencing project: Y074_N01_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y074_N01_F.ab1 - - - Show Y074_N01_F.ab1 Seqid Y074_N01_F.ab1 Link to SGD - Link to dbEST - Link ... to UC SC ... Genome Browser - Sequenc e >Y074_N01_F.ab1 301 0 ... 301 ABI GAACCCC AACCCCC AAAAAAGGC ATC AGGNATTCC GAAAC AC ACCCCC AA CC AC C AAAC AC ACC AAC ACC AAC AAC AAC AC AC AC AAC AAACCC ACCCCC ... AAAAAAAAC ... AC ACCC AC AC AACCCC AAAC AC AAC AAAC AC AAAAAAAC AA AAAAACC AC AA ...

  17. Epitope Mapping of Anti-Interleukin-13 Neutralizing Antibody CNTO607

    Energy Technology Data Exchange (ETDEWEB)

    Teplyakov, Alexey; Obmolova, Galina; Wu, Sheng-Jiun; Luo, Jinquan; Kang, James; O' Neil, Karyn; Gilliland, Gary L.; (Centocor)

    2009-06-24

    CNTO607 is a neutralizing anti-interleukin-13 (IL-13) human monoclonal antibody obtained from a phage display library. To determine how this antibody inhibits the biological effect of IL-13, we determined the binding epitope by X-ray crystallography. The crystal structure of the complex between CNTO607 Fab and IL-13 reveals the antibody epitope at the surface formed by helices A and D of IL-13. This epitope overlaps with the IL-4Ralpha/IL-13Ralpha1 receptor-binding site, which explains the neutralizing effect of CNTO607. The extensive antibody interface covers an area of 1000 A(2), which is consistent with the high binding affinity. The key features of the interface are the charge and shape complementarity of the molecules that include two hydrophobic pockets on IL-13 that accommodate Phe32 [complementarity-determining region (CDR) L2] and Trp100a (CDR H3) and a number of salt bridges between basic residues of IL-13 and acidic residues of the antibody. Comparison with the structure of the free Fab shows that the CDR residues do not change their conformation upon complex formation, with the exception of two residues in CDR H3, Trp100a and Asp100b, which change rotamer conformations. To evaluate the relative contribution of the epitope residues to CNTO607 binding, we performed alanine-scanning mutagenesis of the A-D region of IL-13. This study confirmed the primary role of electrostatic interactions for antigen recognition.

  18. Bispecific antibodies.

    Science.gov (United States)

    Kontermann, Roland E; Brinkmann, Ulrich

    2015-07-01

    Bispecific antibodies (bsAbs) combine specificities of two antibodies and simultaneously address different antigens or epitopes. BsAbs with 'two-target' functionality can interfere with multiple surface receptors or ligands associated, for example with cancer, proliferation or inflammatory processes. BsAbs can also place targets into close proximity, either to support protein complex formation on one cell, or to trigger contacts between cells. Examples of 'forced-connection' functionalities are bsAbs that support protein complexation in the clotting cascade, or tumor-targeted immune cell recruiters and/or activators. Following years of research and development (R&D), the first bsAb was approved in 2009. Another bsAb entered the market in December 2014 and several more are in clinical trials. Here, we describe the potentials of bsAbs to become the next wave of antibody-based therapies, focusing on molecules in clinical development. PMID:25728220

  19. Radioimmunotherapy with Tenarad, a {sup 131}I-labelled antibody fragment targeting the extra-domain A1 of tenascin-C, in patients with refractory Hodgkin's lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Aloj, Luigi [Istituto Nazionale Tumori ' ' Fondazione G. Pascale' ' - IRCCS, Struttura Complessa di Medicina Nucleare, Napoli (Italy); D' Ambrosio, Laura; Aurilio, Michela; Morisco, Anna; Caraco' , Corradina; Di Gennaro, Francesca; Lastoria, Secondo [Istituto Nazionale Tumori ' ' Fondazione G. Pascale' ' - IRCCS, Struttura Complessa Medicina Nucleare, Napoli (Italy); Frigeri, Ferdinando; Capobianco, Gaetana; Pinto, Antonio [Istituto Nazionale Tumori ' ' Fondazione G. Pascale' ' - IRCCS, Struttura Complessa di Ematologia Oncologica, Napoli (Italy); Giovannoni, Leonardo; Menssen, Hans D. [Philogen, SpA, Siena (Italy); Neri, Dario [Institute of Pharmaceutical Sciences, ETH, Zurich (Switzerland)

    2014-05-15

    The extra-domain A1 of tenascin-C (TC-A1) is highly expressed in the extracellular matrix of tumours and on newly formed blood vessels and is thus a valuable target for radionuclide therapy. Tenarad is a fully human miniantibody or small immunoprotein (SIP, molecular weight 80 kDa) labelled with {sup 131}I that is derived from a TC-A1-binding antibody. Previous phase I/II studies with a similar compound ({sup 131}I-L19SIP) used for radioimmunotherapy (RIT) have shown preliminary efficacy in a variety of cancer types. In this ongoing phase I/II trial, Tenarad was administered to patients with recurrent Hodgkin's lymphoma (HL) refractory to conventional treatments. Eight patients (four men, four women; age range 19 - 41) were enrolled between April 2010 and March 2011. All patients had received a median of three previous lines of chemotherapy (range three to six) and seven had also undergone autologous stem cell transplantation (ASCT) or bone marrow transplantation. In addition, seven patients received external beam radiation. All patients had nodal disease, constitutional B symptoms and some showed extranodal disease in skeletal bone (four patients), lung (three), liver (two) and spleen (one). Baseline assessments included whole-body FDG PET with contrast-enhanced CT and diagnostic Tenarad planar and SPECT studies. Patients were considered eligible to receive a therapeutic dose of Tenarad (2.05 GBq/m{sup 2}) if tumour uptake was more than four times higher than that of muscle. All patients were eligible and received the therapeutic dose of Tenarad. Only one patient developed grade 4 thrombocytopenia and leucocytopenia, requiring hospitalization and therapeutic intervention. All other patients had haematological toxicity of grade 3 or lower, which resolved spontaneously. At the first response assessment (4 - 6 weeks after therapy), one patient showed a complete response, one showed a partial response (PR) and five had disease stabilization (SD). Five patients

  20. Single-domain antibodies for brain targeting

    OpenAIRE

    Lalatsa, Katerina; Moreira Leite, Diana

    2014-01-01

    Smaller recombinant antibody fragments as single-domain antibodies (sdAbs) are emerging as credible alternatives because of their target specificity, high affinity, and cost-effective recombinant production. sdAbs have been forged into multivalent and multispecif ic therapeutics, or targeting moieties, that are able to shuttle their linked therapeutic cargo (i.e., drugs, nanoparticles, toxins, enzymes, and radionuclides) to the receptor of interest. Their ability to permeate across the blood ...