WorldWideScience

Sample records for analysis identifies mitochondrial

  1. Transcriptome-wide co-expression analysis identifies LRRC2 as a novel mediator of mitochondrial and cardiac function

    Science.gov (United States)

    Leleu, Marion; Rowe, Glenn C.; Palygin, Oleg; Bukowy, John D.; Kuo, Judy; Rech, Monika; Hermans-Beijnsberger, Steffie; Schaefer, Sebastian; Adami, Eleonora; Creemers, Esther E.; Heinig, Matthias; Schroen, Blanche; Arany, Zoltan; Petretto, Enrico; Geurts, Aron M.

    2017-01-01

    Mitochondrial dysfunction contributes to myriad monogenic and complex pathologies. To understand the underlying mechanisms, it is essential to define the full complement of proteins that modulate mitochondrial function. To identify such proteins, we performed a meta-analysis of publicly available gene expression data. Gene co-expression analysis of a large and heterogeneous compendium of microarray data nominated a sub-population of transcripts that whilst highly correlated with known mitochondrial protein-encoding transcripts (MPETs), are not themselves recognized as generating proteins either localized to the mitochondrion or pertinent to functions therein. To focus the analysis on a medically-important condition with a strong yet incompletely understood mitochondrial component, candidates were cross-referenced with an MPET-enriched module independently generated via genome-wide co-expression network analysis of a human heart failure gene expression dataset. The strongest uncharacterized candidate in the analysis was Leucine Rich Repeat Containing 2 (LRRC2). LRRC2 was found to be localized to the mitochondria in human cells and transcriptionally-regulated by the mitochondrial master regulator Pgc-1α. We report that Lrrc2 transcript abundance correlates with that of β-MHC, a canonical marker of cardiac hypertrophy in humans and experimentally demonstrated an elevation in Lrrc2 transcript in in vitro and in vivo rodent models of cardiac hypertrophy as well as in patients with dilated cardiomyopathy. RNAi-mediated Lrrc2 knockdown in a rat-derived cardiomyocyte cell line resulted in enhanced expression of canonical hypertrophic biomarkers as well as increased mitochondrial mass in the context of increased Pgc-1α expression. In conclusion, our meta-analysis represents a simple yet powerful springboard for the nomination of putative mitochondrially-pertinent proteins relevant to cardiac function and enabled the identification of LRRC2 as a novel mitochondrially

  2. Analysis of Mitochondrial Proteins in the Surviving Myocardium after Ischemia Identifies Mitochondrial Pyruvate Carrier Expression as Possible Mediator of Tissue Viability.

    Science.gov (United States)

    Fernández-Caggiano, Mariana; Prysyazhna, Oleksandra; Barallobre-Barreiro, Javier; CalviñoSantos, Ramón; Aldama López, Guillermo; Generosa Crespo-Leiro, Maria; Eaton, Philip; Doménech, Nieves

    2016-01-01

    The endogenous mechanisms contributing to tissue survival following myocardial infarction are not fully understood. We investigated the alterations in the mitochondrial proteome after ischemia-reperfusion (I/R) and its possible implications on cell survival. Mitochondrial proteomic analysis of cardiac tissue from an in vivo porcine I/R model found that surviving tissue in the peri-infarct border zone showed increased expression of several proteins. Notably, these included subunits of the mitochondrial pyruvate carrier (MPC), namely MPC1 and MPC2. Western blot, immunohistochemistry, and mRNA analysis corroborated the elevated expression of MPC in the surviving tissue. Furthermore, MPC1 and MPC2 protein levels were found to be markedly elevated in the myocardium of ischemic cardiomyopathy patients. These findings led to the hypothesis that increased MPC expression is cardioprotective due to enhancement of mitochondrial pyruvate uptake in the energy-starved heart following I/R. To test this, isolated mouse hearts perfused with a modified Krebs buffer (containing glucose, pyruvate, and octanoate as metabolic substrates) were subjected to I/R with or without the MPC transport inhibitor UK5099. UK5099 increased myocardial infarction and attenuated post-ischemic recovery of left ventricular end-diastolic pressure. However, aerobically perfused control hearts that were exposed to UK5099 did not modulate contractile function, although pyruvate uptake was blocked as evidenced by increased cytosolic lactate and pyruvate levels. Our findings indicate that increased expression of MPC leads to enhanced uptake and utilization of pyruvate during I/R. We propose this as a putative endogenous mechanism that promotes myocardial survival to limit infarct size.

  3. High-throughput respirometric assay identifies predictive toxicophore of mitochondrial injury

    Energy Technology Data Exchange (ETDEWEB)

    Wills, Lauren P. [MitoHealth Inc., Charleston, SC 29403 (United States); Beeson, Gyda C.; Trager, Richard E.; Lindsey, Christopher C. [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Beeson, Craig C. [MitoHealth Inc., Charleston, SC 29403 (United States); Peterson, Yuri K. [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Schnellmann, Rick G., E-mail: schnell@musc.edu [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Ralph H. Johnson VA Medical Center, Charleston, SC 29401 (United States)

    2013-10-15

    Many environmental chemicals and drugs negatively affect human health through deleterious effects on mitochondrial function. Currently there is no chemical library of mitochondrial toxicants, and no reliable methods for predicting mitochondrial toxicity. We hypothesized that discrete toxicophores defined by distinct chemical entities can identify previously unidentified mitochondrial toxicants. We used a respirometric assay to screen 1760 compounds (5 μM) from the LOPAC and ChemBridge DIVERSet libraries. Thirty-one of the assayed compounds decreased uncoupled respiration, a stress test for mitochondrial dysfunction, prior to a decrease in cell viability and reduced the oxygen consumption rate in isolated mitochondria. The mitochondrial toxicants were grouped by chemical similarity and two clusters containing four compounds each were identified. Cheminformatic analysis of one of the clusters identified previously uncharacterized mitochondrial toxicants from the ChemBridge DIVERSet. This approach will enable the identification of mitochondrial toxicants and advance the prediction of mitochondrial toxicity for both drug discovery and risk assessment. - Highlights: • Respirometric assay conducted in RPTC to create mitochondrial toxicant database. • Chemically similar mitochondrial toxicants aligned as mitochondrial toxicophores • Mitochondrial toxicophore identifies five novel mitochondrial toxicants.

  4. Proteomic profiling of the mitochondrial ribosome identifies Atp25 as a composite mitochondrial precursor protein.

    Science.gov (United States)

    Woellhaf, Michael W; Sommer, Frederik; Schroda, Michael; Herrmann, Johannes M

    2016-10-15

    Whereas the structure and function of cytosolic ribosomes are well characterized, we only have a limited understanding of the mitochondrial translation apparatus. Using SILAC-based proteomic profiling, we identified 13 proteins that cofractionated with the mitochondrial ribosome, most of which play a role in translation or ribosomal biogenesis. One of these proteins is a homologue of the bacterial ribosome-silencing factor (Rsf). This protein is generated from the composite precursor protein Atp25 upon internal cleavage by the matrix processing peptidase MPP, and in this respect, it differs from all other characterized mitochondrial proteins of baker's yeast. We observed that cytosolic expression of Rsf, but not of noncleaved Atp25 protein, is toxic. Our results suggest that eukaryotic cells face the challenge of avoiding negative interference from the biogenesis of their two distinct translation machineries.

  5. Longitudinal RNA-Seq Analysis of Vertebrate Aging Identifies Mitochondrial Complex I as a Small-Molecule-Sensitive Modifier of Lifespan.

    Science.gov (United States)

    Baumgart, Mario; Priebe, Steffen; Groth, Marco; Hartmann, Nils; Menzel, Uwe; Pandolfini, Luca; Koch, Philipp; Felder, Marius; Ristow, Michael; Englert, Christoph; Guthke, Reinhard; Platzer, Matthias; Cellerino, Alessandro

    2016-02-24

    Mutations and genetic variability affect gene expression and lifespan, but the impact of variations in gene expression within individuals on their aging-related mortality is poorly understood. We performed a longitudinal study in the short-lived killifish, Nothobranchius furzeri, and correlated quantitative variations in gene expression during early adult life with lifespan. Shorter- and longer-lived individuals differ in their gene expression before the onset of aging-related mortality; differences in gene expression are more pronounced early in life. We identified mitochondrial respiratory chain complex I as a hub in a module of genes whose expression is negatively correlated with lifespan. Accordingly, partial pharmacological inhibition of complex I by the small molecule rotenone reversed aging-related regulation of gene expression and extended lifespan in N. furzeri by 15%. These results support the use of N. furzeri as a vertebrate model for identifying the protein targets, pharmacological modulators, and individual-to-individual variability associated with aging.

  6. OXPHOS-Dependent Cells Identify Environmental Disruptors of Mitochondrial Function

    Science.gov (United States)

    Mitochondrial dysfunction is associated with numerous chronic diseases including metabolic syndrome. Environmental chemicals can impair mitochondrial function through numerous mechanisms such as membrane disruption, complex inhibition and electron transport chain uncoupling. Curr...

  7. Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter.

    Science.gov (United States)

    Baughman, Joshua M; Perocchi, Fabiana; Girgis, Hany S; Plovanich, Molly; Belcher-Timme, Casey A; Sancak, Yasemin; Bao, X Robert; Strittmatter, Laura; Goldberger, Olga; Bogorad, Roman L; Koteliansky, Victor; Mootha, Vamsi K

    2011-06-19

    Mitochondria from diverse organisms are capable of transporting large amounts of Ca(2+) via a ruthenium-red-sensitive, membrane-potential-dependent mechanism called the uniporter. Although the uniporter's biophysical properties have been studied extensively, its molecular composition remains elusive. We recently used comparative proteomics to identify MICU1 (also known as CBARA1), an EF-hand-containing protein that serves as a putative regulator of the uniporter. Here, we use whole-genome phylogenetic profiling, genome-wide RNA co-expression analysis and organelle-wide protein coexpression analysis to predict proteins functionally related to MICU1. All three methods converge on a novel predicted transmembrane protein, CCDC109A, that we now call 'mitochondrial calcium uniporter' (MCU). MCU forms oligomers in the mitochondrial inner membrane, physically interacts with MICU1, and resides within a large molecular weight complex. Silencing MCU in cultured cells or in vivo in mouse liver severely abrogates mitochondrial Ca(2+) uptake, whereas mitochondrial respiration and membrane potential remain fully intact. MCU has two predicted transmembrane helices, which are separated by a highly conserved linker facing the intermembrane space. Acidic residues in this linker are required for its full activity. However, an S259A point mutation retains function but confers resistance to Ru360, the most potent inhibitor of the uniporter. Our genomic, physiological, biochemical and pharmacological data firmly establish MCU as an essential component of the mitochondrial Ca(2+) uniporter.

  8. Mytoe: automatic analysis of mitochondrial dynamics.

    NARCIS (Netherlands)

    Lihavainen, E.; Makela, J.; Spelbrink, J.N.; Ribeiro, A.S.

    2012-01-01

    SUMMARY: We present Mytoe, a tool for analyzing mitochondrial morphology and dynamics from fluorescence microscope images. The tool provides automated quantitative analysis of mitochondrial motion by optical flow estimation and of morphology by segmentation of individual branches of the network-like

  9. Integrative analysis of the mitochondrial proteome in yeast.

    Directory of Open Access Journals (Sweden)

    Holger Prokisch

    2004-06-01

    Full Text Available In this study yeast mitochondria were used as a model system to apply, evaluate, and integrate different genomic approaches to define the proteins of an organelle. Liquid chromatography mass spectrometry applied to purified mitochondria identified 546 proteins. By expression analysis and comparison to other proteome studies, we demonstrate that the proteomic approach identifies primarily highly abundant proteins. By expanding our evaluation to other types of genomic approaches, including systematic deletion phenotype screening, expression profiling, subcellular localization studies, protein interaction analyses, and computational predictions, we show that an integration of approaches moves beyond the limitations of any single approach. We report the success of each approach by benchmarking it against a reference set of known mitochondrial proteins, and predict approximately 700 proteins associated with the mitochondrial organelle from the integration of 22 datasets. We show that a combination of complementary approaches like deletion phenotype screening and mass spectrometry can identify over 75% of the known mitochondrial proteome. These findings have implications for choosing optimal genome-wide approaches for the study of other cellular systems, including organelles and pathways in various species. Furthermore, our systematic identification of genes involved in mitochondrial function and biogenesis in yeast expands the candidate genes available for mapping Mendelian and complex mitochondrial disorders in humans.

  10. A comprehensive analysis of bilaterian mitochondrial genomes and phylogeny.

    Science.gov (United States)

    Bernt, Matthias; Bleidorn, Christoph; Braband, Anke; Dambach, Johannes; Donath, Alexander; Fritzsch, Guido; Golombek, Anja; Hadrys, Heike; Jühling, Frank; Meusemann, Karen; Middendorf, Martin; Misof, Bernhard; Perseke, Marleen; Podsiadlowski, Lars; von Reumont, Björn; Schierwater, Bernd; Schlegel, Martin; Schrödl, Michael; Simon, Sabrina; Stadler, Peter F; Stöger, Isabella; Struck, Torsten H

    2013-11-01

    About 2800 mitochondrial genomes of Metazoa are present in NCBI RefSeq today, two thirds belonging to vertebrates. Metazoan phylogeny was recently challenged by large scale EST approaches (phylogenomics), stabilizing classical nodes while simultaneously supporting new sister group hypotheses. The use of mitochondrial data in deep phylogeny analyses was often criticized because of high substitution rates on nucleotides, large differences in amino acid substitution rate between taxa, and biases in nucleotide frequencies. Nevertheless, mitochondrial genome data might still be promising as it allows for a larger taxon sampling, while presenting a smaller amount of sequence information. We present the most comprehensive analysis of bilaterian relationships based on mitochondrial genome data. The analyzed data set comprises more than 650 mitochondrial genomes that have been chosen to represent a profound sample of the phylogenetic as well as sequence diversity. The results are based on high quality amino acid alignments obtained from a complete reannotation of the mitogenomic sequences from NCBI RefSeq database. However, the results failed to give support for many otherwise undisputed high-ranking taxa, like Mollusca, Hexapoda, Arthropoda, and suffer from extreme long branches of Nematoda, Platyhelminthes, and some other taxa. In order to identify the sources of misleading phylogenetic signals, we discuss several problems associated with mitochondrial genome data sets, e.g. the nucleotide and amino acid landscapes and a strong correlation of gene rearrangements with long branches.

  11. Identification of a mitochondrial target of thiazolidinedione insulin sensitizers (mTOT--relationship to newly identified mitochondrial pyruvate carrier proteins.

    Directory of Open Access Journals (Sweden)

    Jerry R Colca

    Full Text Available Thiazolidinedione (TZD insulin sensitizers have the potential to effectively treat a number of human diseases, however the currently available agents have dose-limiting side effects that are mediated via activation of the transcription factor PPARγ. We have recently shown PPARγ-independent actions of TZD insulin sensitizers, but the molecular target of these molecules remained to be identified. Here we use a photo-catalyzable drug analog probe and mass spectrometry-based proteomics to identify a previously uncharacterized mitochondrial complex that specifically recognizes TZDs. These studies identify two well-conserved proteins previously known as brain protein 44 (BRP44 and BRP44 Like (BRP44L, which recently have been renamed Mpc2 and Mpc1 to signify their function as a mitochondrial pyruvate carrier complex. Knockdown of Mpc1 or Mpc2 in Drosophila melanogaster or pre-incubation with UK5099, an inhibitor of pyruvate transport, blocks the crosslinking of mitochondrial membranes by the TZD probe. Knockdown of these proteins in Drosophila also led to increased hemolymph glucose and blocked drug action. In isolated brown adipose tissue (BAT cells, MSDC-0602, a PPARγ-sparing TZD, altered the incorporation of (13C-labeled carbon from glucose into acetyl CoA. These results identify Mpc1 and Mpc2 as components of the mitochondrial target of TZDs (mTOT and suggest that understanding the modulation of this complex, which appears to regulate pyruvate entry into the mitochondria, may provide a viable target for insulin sensitizing pharmacology.

  12. Analysis of Mitochondrial Network Morphology in Cultured Myoblasts from Patients with Mitochondrial Disorders.

    Science.gov (United States)

    Sládková, J; Spáčilová, J; Čapek, M; Tesařová, M; Hansíková, H; Honzík, T; Martínek, J; Zámečník, J; Kostková, O; Zeman, J

    2015-01-01

    Mitochondrial morphology was studied in cultivated myoblasts obtained from patients with mitochondrial disorders, including CPEO, MELAS and TMEM70 deficiency. Mitochondrial networks and ultrastructure were visualized by fluorescence microscopy and transmission electron microscopy, respectively. A heterogeneous picture of abnormally sized and shaped mitochondria with fragmentation, shortening, and aberrant cristae, lower density of mitochondria and an increased number of "megamitochondria" were found in patient myoblasts. Morphometric Fiji analyses revealed different mitochondrial network properties in myoblasts from patients and controls. The small number of cultivated myoblasts required for semiautomatic morphometric image analysis makes this tool useful for estimating mitochondrial disturbances in patients with mitochondrial disorders.

  13. FCCP releases Ca2+ from a non-mitochondrial store in an identified Helisoma neuron.

    Science.gov (United States)

    Jensen, J R; Rehder, V

    1991-06-14

    The proton ionophore FCCP was evaluated for use as a selective blocker of mitochondrial Ca2+ sequestration in identified Helisoma neurons in vitro. By use of the Ca2+ indicator fura-2, it was found that application of FCCP evoked a gradual increase in cell body [Ca2+]i that reached a level approximately 3-fold higher than baseline after 60 min. Moreover, FCCP released Ca2+ even when added after mitochondrial stores of Ca2+ had previously been emptied by an alternate method. From these and other experiments, it is concluded that FCCP, in addition to its recognized effect on mitochondrial Ca2+ sequestration, also releases Ca2+ from a non-mitochondrial store and is, therefore, unsuitable for use in an intact neuron to selectively inactivate mitochondrial Ca2+ uptake.

  14. Proteomic investigations of lysine acetylation identify diverse substrates of mitochondrial deacetylase sirt3

    DEFF Research Database (Denmark)

    Sol, E-ri Maria; Wagner, Sebastian A; Weinert, Brian T;

    2012-01-01

    of KDACs and pinpointing the regulated acetylation sites on target proteins may provide important information about the molecular basis of their functions. Here we apply quantitative proteomics to identify endogenous substrates of the mitochondrial deacetylase Sirtuin 3 (Sirt3) by comparing site......-specific acetylation in wild-type murine embryonic fibroblasts to Sirt3 knockout cells. We confirm Sirt3-regulated acetylation of several mitochondrial proteins in human cells by comparing acetylation in U2OS cells overexpressing Sirt3 to U2OS cells in which Sirt3 expression was reduced by shRNA. Our data demonstrate...... that ablation of Sirt3 significantly increases acetylation at dozens of sites on mitochondrial proteins. Substrates of Sirt3 are implicated in various metabolic pathways, including fatty acid metabolism and the tricarboxylic acid cycle. These results imply broader regulatory roles of Sirt3 in the mitochondria...

  15. Mitochondrial DNA analysis in Parkinson's disease.

    Science.gov (United States)

    Schapira, A H; Holt, I J; Sweeney, M; Harding, A E; Jenner, P; Marsden, C D

    1990-01-01

    The reduced form of nicotinamide adenine dinucleotide coenzyme Q reductase (complex I) activity has recently been shown to be deficient in the substantia nigra of patients dying with Parkinson's disease. This biochemical defect is identical to that produced by the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which also produces parkinsonism in humans. Complex I comprises 25 polypeptides, seven of which are encoded by mitochondrial DNA. Restriction fragment analysis of substantia nigra DNA from six patients with Parkinson's disease did not show any major deletion. In two cases, there were different novel polymorphisms that were not observed in control brain (n = 6) or blood (n = 34) samples.

  16. Proteomic investigations of lysine acetylation identify diverse substrates of mitochondrial deacetylase sirt3.

    Directory of Open Access Journals (Sweden)

    Eri Maria Sol

    Full Text Available Lysine acetylation is a posttranslational modification that is dynamically regulated by the activity of acetyltransferases and deacetylases. The human and mouse genomes encode 18 different lysine deacetylases (KDACs which are key regulators of many cellular processes. Identifying substrates of KDACs and pinpointing the regulated acetylation sites on target proteins may provide important information about the molecular basis of their functions. Here we apply quantitative proteomics to identify endogenous substrates of the mitochondrial deacetylase Sirtuin 3 (Sirt3 by comparing site-specific acetylation in wild-type murine embryonic fibroblasts to Sirt3 knockout cells. We confirm Sirt3-regulated acetylation of several mitochondrial proteins in human cells by comparing acetylation in U2OS cells overexpressing Sirt3 to U2OS cells in which Sirt3 expression was reduced by shRNA. Our data demonstrate that ablation of Sirt3 significantly increases acetylation at dozens of sites on mitochondrial proteins. Substrates of Sirt3 are implicated in various metabolic pathways, including fatty acid metabolism and the tricarboxylic acid cycle. These results imply broader regulatory roles of Sirt3 in the mitochondria by modulating acetylation on diverse substrates. The experimental strategy described here is generic and can be applied to identify endogenous substrates of other lysine deacetylases.

  17. Application of the phylogenetic analysis in mitochondrial disease study

    Institute of Scientific and Technical Information of China (English)

    WANG ChengYe; KONG QingPeng; ZHANG YaPing

    2008-01-01

    Mitochondrial disease currently received an increasing concern. However, the case-control design commonly adopted in this field is vulnerable to genetic background, population stratification and poor data quality. Although the phylogenetic analysis could help solve part of these problems, it has not received adequate attention. This paper is a review of this method as well as its application in mito-chondrial disease study.

  18. A Spatio-Temporal Analysis of Mitochondrial DNA Haplogroup I

    Directory of Open Access Journals (Sweden)

    Revesz Peter Z.

    2016-01-01

    Full Text Available The recent recovery of ancient DNA from a growing number of human samples shows that mitochondrial DNA haplogroup I was introduced to Europe after the end of the Last Glacial Maximum. This paper provides a spatio-temporal analysis of the various subhaplogroups of mitochondrial DNA I. The study suggests that haplogroup I diversified into haplogroups I1, I2’3, I4 and I5 at specific regions in Eurasia and then spread southward to Crete and Egypt.

  19. Use of a mitochondrial COI sequence to identify species of the subtribe Aphidina (Hemiptera, Aphididae

    Directory of Open Access Journals (Sweden)

    Jianfeng WANG

    2011-08-01

    Full Text Available Aphids of the subtribe Aphidina are found mainly in the North Temperate Zone. The relative lack of diagnostic morphological characteristics has obscured the identification of species in this group. However, DNA-based taxonomic methods can clarify species relationships within this group. Sequence variation in a partial segment of the mitochondrial COI gene was highly effective for resolving species relationships within Aphidina. Forty-five species were correctly identified in a neighbor-joining tree. Mean intraspecific sequence divergence was 0.17%, with a range of 0.00% to 1.54%. Mean interspecific divergence within previously recognized genera or morphologically similar species groups was 4.54%, with variation mainly in the range of 3.50% to 8.00%. Possible reasons for anomalous levels of mean nucleotide divergence within or between some taxa are discussed.

  20. Genetic characterization of Phytophthora nicotianae by the analysis of polymorphic regions of the mitochondrial DNA.

    Science.gov (United States)

    A new method based on the analysis of mitochondrial intergenic regions characterized by intraspecific variation in DNA sequences was developed and applied to the study of the plant pathogen Phytophthora nicotianae. Two regions flanked by genes trny and rns and trnw and cox2 were identified by compa...

  1. Mitochondrial DNA polymorphisms in Phytophthora infestans: new haplotypes are identified and re-defined by PCR.

    Science.gov (United States)

    Yang, Zhi-Hui; Qi, Ming-Xing; Qin, Yu-Xuan; Zhu, Jie-Hua; Gui, Xiu-Mei; Tao, Bu; Xu, Xiao-Hu; Zhang, Fu-Guang

    2013-11-01

    Polymorphisms of mitochondrial DNA (mt-DNA) are particularly useful for monitoring specific pathogen populations like Phytophthora infestans. Basically type I and II of P. infestans mt-DNA were categorized by means of polymorphism lengths caused by an ~2 kb insertion, which can be detected via restriction enzyme digestion. In addition genome sequencing of haplotype Ib has been used as a simple Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method to indirectly identify type I and II alterations through EcoR I restriction enzyme DNA fragment patterns of the genomic P4 area. However, with the common method, wrong mt-DNA typing occurs due to an EcoR I recognition site mutation in the P4 genomic area. Genome sequencing of the four haplotypes (Ia, Ib, IIa, and IIb) allowed us to thoroughly examine mt-DNA polymorphisms and we indentified two hypervariable regions (HVRs) named HVRi and HVRii. The HVRi length polymorphism caused by a 2 kb insertion/deletion was utilized to identify mt-DNA types I and II, while another length polymorphism in the HVRii region is caused by a variable number of tandem repeats (n = 1, 2, or 3) of a 36 bp sized DNA stretch and was further used to determine mt-DNA sub-types, which were described as R(n = 1, 2, or 3). Finally, the P. infestans mt-DNA haplotypes were re-defined as IR(1) or IIR(2) according to PCR derived HVRi and HVRii length polymorphisms. Twenty-three isolates were chosen to verify the feasibility of our new approach for identifying mt-DNA haplotypes and a total of five haplotypes (IR(1), IR(2), IR(3), IIR(2) and IIR(3)) were identified. Additionally, we found that six isolates determined as type I by our method were mistakenly identified as type II by the PCR-RFLP technique. In conclusion, we propose a simple and rapid PCR method for identification of mt-DNA haplotypes based on sequence analyses of the mitochondrial P. infestans genome.

  2. Screen for abnormal mitochondrial phenotypes in mouse embryonic stem cells identifies a model for succinyl-CoA ligase deficiency and mtDNA depletion

    Directory of Open Access Journals (Sweden)

    Taraka R. Donti

    2014-02-01

    Full Text Available Mutations in subunits of succinyl-CoA synthetase/ligase (SCS, a component of the citric acid cycle, are associated with mitochondrial encephalomyopathy, elevation of methylmalonic acid (MMA, and mitochondrial DNA (mtDNA depletion. A FACS-based retroviral-mediated gene trap mutagenesis screen in mouse embryonic stem (ES cells for abnormal mitochondrial phenotypes identified a gene trap allele of Sucla2 (Sucla2SAβgeo, which was used to generate transgenic mice. Sucla2 encodes the ADP-specific β-subunit isoform of SCS. Sucla2SAβgeo homozygotes exhibited recessive lethality, with most mutants dying late in gestation (e18.5. Mutant placenta and embryonic (e17.5 brain, heart and muscle showed varying degrees of mtDNA depletion (20–60%. However, there was no mtDNA depletion in mutant liver, where the gene is not normally expressed. Elevated levels of MMA were observed in embryonic brain. SCS-deficient mouse embryonic fibroblasts (MEFs demonstrated a 50% reduction in mtDNA content compared with wild-type MEFs. The mtDNA depletion resulted in reduced steady state levels of mtDNA encoded proteins and multiple respiratory chain deficiencies. mtDNA content could be restored by reintroduction of Sucla2. This mouse model of SCS deficiency and mtDNA depletion promises to provide insights into the pathogenesis of mitochondrial diseases with mtDNA depletion and into the biology of mtDNA maintenance. In addition, this report demonstrates the power of a genetic screen that combines gene trap mutagenesis and FACS analysis in mouse ES cells to identify mitochondrial phenotypes and to develop animal models of mitochondrial dysfunction.

  3. Proteomic analysis of pRb loss highlights a signature of decreased mitochondrial oxidative phosphorylation.

    Science.gov (United States)

    Nicolay, Brandon N; Danielian, Paul S; Kottakis, Filippos; Lapek, John D; Sanidas, Ioannis; Miles, Wayne O; Dehnad, Mantre; Tschöp, Katrin; Gierut, Jessica J; Manning, Amity L; Morris, Robert; Haigis, Kevin; Bardeesy, Nabeel; Lees, Jacqueline A; Haas, Wilhelm; Dyson, Nicholas J

    2015-09-01

    The retinoblastoma tumor suppressor (pRb) protein associates with chromatin and regulates gene expression. Numerous studies have identified Rb-dependent RNA signatures, but the proteomic effects of Rb loss are largely unexplored. We acutely ablated Rb in adult mice and conducted a quantitative analysis of RNA and proteomic changes in the colon and lungs, where Rb(KO) was sufficient or insufficient to induce ectopic proliferation, respectively. As expected, Rb(KO) caused similar increases in classic pRb/E2F-regulated transcripts in both tissues, but, unexpectedly, their protein products increased only in the colon, consistent with its increased proliferative index. Thus, these protein changes induced by Rb loss are coupled with proliferation but uncoupled from transcription. The proteomic changes in common between Rb(KO) tissues showed a striking decrease in proteins with mitochondrial functions. Accordingly, RB1 inactivation in human cells decreased both mitochondrial mass and oxidative phosphorylation (OXPHOS) function. RB(KO) cells showed decreased mitochondrial respiratory capacity and the accumulation of hypopolarized mitochondria. Additionally, RB/Rb loss altered mitochondrial pyruvate oxidation from (13)C-glucose through the TCA cycle in mouse tissues and cultured cells. Consequently, RB(KO) cells have an enhanced sensitivity to mitochondrial stress conditions. In summary, proteomic analyses provide a new perspective on Rb/RB1 mutation, highlighting the importance of pRb for mitochondrial function and suggesting vulnerabilities for treatment.

  4. High-Content Imaging Assays for Identifying Compounds that Generate Superoxide and Impair Mitochondrial Membrane Potential in Adherent Eukaryotic Cells.

    Science.gov (United States)

    Billis, Puja; Will, Yvonne; Nadanaciva, Sashi

    2014-02-19

    Reactive oxygen species (ROS) are constantly produced in cells as a result of aerobic metabolism. When there is an excessive production of ROS and the cell's antioxidant defenses are overwhelmed, oxidative stress occurs. The superoxide anion is a type of ROS that is produced primarily in mitochondria but is also generated in other regions of the cell including peroxisomes, endoplasmic reticulum, plasma membrane, and cytosol. Here, a high-content imaging assay using the dye dihydroethidium is described for identifying compounds that generate superoxide in eukaryotic cells. A high-content imaging assay using the fluorescent dye tetramethylrhodamine methyl ester is also described to identify compounds that impair mitochondrial membrane potential in eukaryotic cells. The purpose of performing both assays is to identify compounds that (1) generate superoxide at lower concentrations than they impair mitochondrial membrane potential, (2) impair mitochondrial membrane potential at lower concentrations than they generate superoxide, (3) generate superoxide and impair mitochondrial function at similar concentrations, and (4) do not generate superoxide or impair mitochondrial membrane potential during the duration of the assays.

  5. Prolonged Fasting Identifies Skeletal Muscle Mitochondrial Dysfunction as Consequence Rather Than Cause of Human Insulin Resistance

    NARCIS (Netherlands)

    Hoeks, J.; Herpen, N.A.; Mensink, M.R.; Moonen-Kornips, E.; Beurden, van D.; Hesselink, M.K.C.; Schrauwen, P.

    2010-01-01

    OBJECTIVE-Type 2 diabetes and insulin resistance have been associated with mitochondrial dysfunction, but it is debated whether this is a primary factor in the pathogenesis of the disease. To test the concept that mitochondrial dysfunction is secondary to the development of insulin resistance, we em

  6. Whole mitochondrial genome analysis in South Indian patients with Leber's hereditary optic neuropathy.

    Science.gov (United States)

    Saikia, Bibhuti Ballav; Dubey, Sushil Kumar; Shanmugam, Mahesh Kumar; Sundaresan, Periasamy

    2016-10-28

    Leber's hereditary optic neuropathy (LHON) is a mitochondrial DNA (mtDNA) associated neurodegenerative disorder of retinal ganglion cells. In this study, whole mitochondrial genome sequencing of 75 LHON patients and 40 controls was performed to identify the mutation frequency and haplogroup background of South Indian population. Analysis of mtDNA revealed 559 different variants in LHON patients, including 7 pathogenic mutations, 30 private, and 22 other disease associated variants. A significantly higher (p=0.0008) overall variation load per individual was noted among LHON patients versus controls. We reported for the first time, the association of M haplogroup (p=0.028) with LHON in this cohort.

  7. Mitochondrial DNA depletion analysis by pseudogene ratioing.

    Science.gov (United States)

    Swerdlow, Russell H; Redpath, Gerard T; Binder, Daniel R; Davis, John N; VandenBerg, Scott R

    2006-01-30

    The mitochondrial DNA (mtDNA) depletion status of rho(0) cell lines is typically assessed by hybridization or polymerase chain reaction (PCR) experiments, in which the failure to hybridize mtDNA or amplify mtDNA using mtDNA-directed primers suggests thorough mitochondrial genome removal. Here, we report the use of an mtDNA pseudogene ratioing technique for the additional confirmation of rho0 status. Total genomic DNA from a U251 human glioma cell line treated with ethidium bromide was amplified using primers designed to anneal either mtDNA or a previously described nuclear DNA-embedded mtDNA pseudogene (mtDNApsi). The resultant PCR product was used to generate plasmid clones. Sixty-two plasmid clones were genotyped, and all arose from mtDNApsi template. These data allowed us to determine with 95% confidence that the resultant mtDNA-depleted cell line contains less than one copy of mtDNA per 10 cells. Unlike previous hybridization or PCR-based analyses of mtDNA depletion, this mtDNApsi ratioing technique does not rely on interpretation of a negative result, and may prove useful as an adjunct for the determination of rho0 status or mtDNA copy number.

  8. Newly identified protein Imi1 affects mitochondrial integrity and glutathione homeostasis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kowalec, Piotr; Grynberg, Marcin; Pająk, Beata; Socha, Anna; Winiarska, Katarzyna; Fronk, Jan; Kurlandzka, Anna

    2015-09-01

    Glutathione homeostasis is crucial for cell functioning. We describe a novel Imi1 protein of Saccharomyces cerevisiae affecting mitochondrial integrity and involved in controlling glutathione level. Imi1 is cytoplasmic and, except for its N-terminal Flo11 domain, has a distinct solenoid structure. A lack of Imi1 leads to mitochondrial lesions comprising aberrant morphology of cristae and multifarious mtDNA rearrangements and impaired respiration. The mitochondrial malfunctioning is coupled to significantly decrease the level of intracellular reduced glutathione without affecting oxidized glutathione, which decreases the reduced/oxidized glutathione ratio. These defects are accompanied by decreased cadmium sensitivity and increased phytochelatin-2 level.

  9. Identification of mitochondrial proteins of malaria parasite using analysis of variance.

    Science.gov (United States)

    Ding, Hui; Li, Dongmei

    2015-02-01

    As a parasitic protozoan, Plasmodium falciparum (P. falciparum) can cause malaria. The mitochondrial proteins of malaria parasite play important roles in the discovery of anti-malarial drug targets. Thus, accurate identification of mitochondrial proteins of malaria parasite is a key step for understanding their functions and finding potential drug targets. In this work, we developed a sequence-based method to identify the mitochondrial proteins of malaria parasite. At first, we extended adjoining dipeptide composition to g-gap dipeptide composition for discretely formulating the protein sequences. Subsequently, the analysis of variance (ANOVA) combined with incremental feature selection (IFS) was used to pick out the optimal features. Finally, the jackknife cross-validation was used to evaluate the performance of the proposed model. Evaluation results showed that the maximum accuracy of 97.1% could be achieved by using 101 optimal 5-gap dipeptides. The comparison with previous methods demonstrated that our method was accurate and efficient.

  10. Cytoplasmic male sterility-associated chimeric open reading frames identified by mitochondrial genome sequencing of four Cajanus genotypes.

    Science.gov (United States)

    Tuteja, Reetu; Saxena, Rachit K; Davila, Jaime; Shah, Trushar; Chen, Wenbin; Xiao, Yong-Li; Fan, Guangyi; Saxena, K B; Alverson, Andrew J; Spillane, Charles; Town, Christopher; Varshney, Rajeev K

    2013-10-01

    The hybrid pigeonpea (Cajanus cajan) breeding technology based on cytoplasmic male sterility (CMS) is currently unique among legumes and displays major potential for yield increase. CMS is defined as a condition in which a plant is unable to produce functional pollen grains. The novel chimeric open reading frames (ORFs) produced as a results of mitochondrial genome rearrangements are considered to be the main cause of CMS. To identify these CMS-related ORFs in pigeonpea, we sequenced the mitochondrial genomes of three C. cajan lines (the male-sterile line ICPA 2039, the maintainer line ICPB 2039, and the hybrid line ICPH 2433) and of the wild relative (Cajanus cajanifolius ICPW 29). A single, circular-mapping molecule of length 545.7 kb was assembled and annotated for the ICPA 2039 line. Sequence annotation predicted 51 genes, including 34 protein-coding and 17 RNA genes. Comparison of the mitochondrial genomes from different Cajanus genotypes identified 31 ORFs, which differ between lines within which CMS is present or absent. Among these chimeric ORFs, 13 were identified by comparison of the related male-sterile and maintainer lines. These ORFs display features that are known to trigger CMS in other plant species and to represent the most promising candidates for CMS-related mitochondrial rearrangements in pigeonpea.

  11. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    Directory of Open Access Journals (Sweden)

    Guozheng Liu

    Full Text Available BACKGROUND: Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L. is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt genome could be helpful for the evolution research of plant mt genomes. METHODOLOGY/PRINCIPAL FINDINGS: We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. CONCLUSION: The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  12. Biochemical and structural characterization of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV

    Energy Technology Data Exchange (ETDEWEB)

    Han, Q.; Robinson, H.; Cai, T.; Tagle, D. A.; Li, J.

    2011-10-01

    Mammalian mAspAT (mitochondrial aspartate aminotransferase) is recently reported to have KAT (kynurenine aminotransferase) activity and plays a role in the biosynthesis of KYNA (kynurenic acid) in rat, mouse and human brains. This study concerns the biochemical and structural characterization of mouse mAspAT. In this study, mouse mAspAT cDNA was amplified from mouse brain first stand cDNA and its recombinant protein was expressed in an Escherichia coli expression system. Sixteen oxo acids were tested for the co-substrate specificity of mouse mAspAT and 14 of them were shown to be capable of serving as co-substrates for the enzyme. Structural analysis of mAspAT by macromolecular crystallography revealed that the cofactor-binding residues of mAspAT are similar to those of other KATs. The substrate-binding residues of mAspAT are slightly different from those of other KATs. Our results provide a biochemical and structural basis towards understanding the overall physiological role of mAspAT in vivo and insight into controlling the levels of endogenous KYNA through modulation of the enzyme in the mouse brain.

  13. Biochemical and structural characterization of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV.

    Science.gov (United States)

    Han, Qian; Robinson, Howard; Cai, Tao; Tagle, Danilo A; Li, Jianyong

    2011-10-01

    Mammalian mAspAT (mitochondrial aspartate aminotransferase) is recently reported to have KAT (kynurenine aminotransferase) activity and plays a role in the biosynthesis of KYNA (kynurenic acid) in rat, mouse and human brains. This study concerns the biochemical and structural characterization of mouse mAspAT. In this study, mouse mAspAT cDNA was amplified from mouse brain first stand cDNA and its recombinant protein was expressed in an Escherichia coli expression system. Sixteen oxo acids were tested for the co-substrate specificity of mouse mAspAT and 14 of them were shown to be capable of serving as co-substrates for the enzyme. Structural analysis of mAspAT by macromolecular crystallography revealed that the cofactor-binding residues of mAspAT are similar to those of other KATs. The substrate-binding residues of mAspAT are slightly different from those of other KATs. Our results provide a biochemical and structural basis towards understanding the overall physiological role of mAspAT in vivo and insight into controlling the levels of endogenous KYNA through modulation of the enzyme in the mouse brain.

  14. Variation in Mitochondrial Cytochrome c Oxidase I DNA Can Successfully Identify Culex (Melanoconion) pedroi (Diptera: Culicidae) and Culex (Melanoconion) ribeirensis (Diptera: Culicidae).

    Science.gov (United States)

    Araki, A S; Maia, D A; Gil-Santana, H R; de Mello, C F; Martins, A de J; Alencar, J

    2016-12-22

    Culex (Melanoconion) pedroi Sirivanakarn & Belkin 1980 and Culex (Melanoconion) ribeirensis Forattini & Sallum 1985 are two morphologically very similar species of the Pedroi subgroup of mosquitoes in the Spissipes section of the subgenus Melanoconion of the genus Culex L. 1758. We carried out an analysis of the mitochondrial cytochrome c oxidase I (COI) DNA variation between these two species. The recent observation of sympatric coexistence in a forested area of Rio de Janeiro State (Brazil) triggered the need to validate these two species previously identified based on morphology. We concluded that the COI is a useful tool for identification of Cx. pedroi and Cx. ribeirensis.

  15. Targeted siRNA Screens Identify ER-to-Mitochondrial Calcium Exchange in Autophagy and Mitophagy Responses in RPE1 Cells.

    Science.gov (United States)

    MacVicar, Thomas D B; Mannack, Lilith V J C; Lees, Robert M; Lane, Jon D

    2015-06-11

    Autophagy is an important stress response pathway responsible for the removal and recycling of damaged or redundant cytosolic constituents. Mitochondrial damage triggers selective mitochondrial autophagy (mitophagy), mediated by a variety of response factors including the Pink1/Parkin system. Using human retinal pigment epithelial cells stably expressing autophagy and mitophagy reporters, we have conducted parallel screens of regulators of endoplasmic reticulum (ER) and mitochondrial morphology and function contributing to starvation-induced autophagy and damage-induced mitophagy. These screens identified the ER chaperone and Ca2+ flux modulator, sigma non-opioid intracellular receptor 1 (SIGMAR1), as a regulator of autophagosome expansion during starvation. Screens also identified phosphatidyl ethanolamine methyl transferase (PEMT) and the IP3-receptors (IP3Rs) as mediators of Parkin-induced mitophagy. Further experiments suggested that IP3R-mediated transfer of Ca2+ from the ER lumen to the mitochondrial matrix via the mitochondrial Ca2+ uniporter (MCU) primes mitochondria for mitophagy. Importantly, recruitment of Parkin to damaged mitochondria did not require IP3R-mediated ER-to-mitochondrial Ca2+ transfer, but mitochondrial clustering downstream of Parkin recruitment was impaired, suggesting involvement of regulators of mitochondrial dynamics and/or transport. Our data suggest that Ca2+ flux between ER and mitochondria at presumed ER/mitochondrial contact sites is needed both for starvation-induced autophagy and for Parkin-mediated mitophagy, further highlighting the importance of inter-organellar communication for effective cellular homeostasis.

  16. Targeted siRNA Screens Identify ER-to-Mitochondrial Calcium Exchange in Autophagy and Mitophagy Responses in RPE1 Cells

    Directory of Open Access Journals (Sweden)

    Thomas D. B. MacVicar

    2015-06-01

    Full Text Available Autophagy is an important stress response pathway responsible for the removal and recycling of damaged or redundant cytosolic constituents. Mitochondrial damage triggers selective mitochondrial autophagy (mitophagy, mediated by a variety of response factors including the Pink1/Parkin system. Using human retinal pigment epithelial cells stably expressing autophagy and mitophagy reporters, we have conducted parallel screens of regulators of endoplasmic reticulum (ER and mitochondrial morphology and function contributing to starvation-induced autophagy and damage-induced mitophagy. These screens identified the ER chaperone and Ca2+ flux modulator, sigma non-opioid intracellular receptor 1 (SIGMAR1, as a regulator of autophagosome expansion during starvation. Screens also identified phosphatidyl ethanolamine methyl transferase (PEMT and the IP3-receptors (IP3Rs as mediators of Parkin-induced mitophagy. Further experiments suggested that IP3R-mediated transfer of Ca2+ from the ER lumen to the mitochondrial matrix via the mitochondrial Ca2+ uniporter (MCU primes mitochondria for mitophagy. Importantly, recruitment of Parkin to damaged mitochondria did not require IP3R-mediated ER-to-mitochondrial Ca2+ transfer, but mitochondrial clustering downstream of Parkin recruitment was impaired, suggesting involvement of regulators of mitochondrial dynamics and/or transport. Our data suggest that Ca2+ flux between ER and mitochondria at presumed ER/mitochondrial contact sites is needed both for starvation-induced autophagy and for Parkin-mediated mitophagy, further highlighting the importance of inter-organellar communication for effective cellular homeostasis.

  17. Mitochondrial disease in autism spectrum disorder patients: a cohort analysis.

    Directory of Open Access Journals (Sweden)

    Jacqueline R Weissman

    Full Text Available BACKGROUND: Previous reports indicate an association between autism spectrum disorders (ASD and disorders of mitochondrial oxidative phosphorylation. One study suggested that children with both diagnoses are clinically indistinguishable from children with idiopathic autism. There are, however, no detailed analyses of the clinical and laboratory findings in a large cohort of these children. Therefore, we undertook a comprehensive review of patients with ASD and a mitochondrial disorder. METHODOLOGY/PRINCIPAL FINDINGS: We reviewed medical records of 25 patients with a primary diagnosis of ASD by DSM-IV-TR criteria, later determined to have enzyme- or mutation-defined mitochondrial electron transport chain (ETC dysfunction. Twenty-four of 25 patients had one or more major clinical abnormalities uncommon in idiopathic autism. Twenty-one patients had histories of significant non-neurological medical problems. Nineteen patients exhibited constitutional symptoms, especially excessive fatigability. Fifteen patients had abnormal neurological findings. Unusual developmental phenotypes included marked delay in early gross motor milestones (32% and unusual patterns of regression (40%. Levels of blood lactate, plasma alanine, and serum ALT and/or AST were increased at least once in 76%, 36%, and 52% of patients, respectively. The most common ETC disorders were deficiencies of complex I (64% and complex III (20%. Two patients had rare mtDNA mutations of likely pathogenicity. CONCLUSIONS/SIGNIFICANCE: Although all patients' initial diagnosis was idiopathic autism, careful clinical and biochemical assessment identified clinical findings that differentiated them from children with idiopathic autism. These and prior data suggest a disturbance of mitochondrial energy production as an underlying pathophysiological mechanism in a subset of individuals with autism.

  18. Hydrogen peroxide acts on sensitive mitochondrial proteins to induce death of a fungal pathogen revealed by proteomic analysis.

    Directory of Open Access Journals (Sweden)

    Guozheng Qin

    Full Text Available How the host cells of plants and animals protect themselves against fungal invasion is a biologically interesting and economically important problem. Here we investigate the mechanistic process that leads to death of Penicillium expansum, a widespread phytopathogenic fungus, by identifying the cellular compounds affected by hydrogen peroxide (H(2O(2 that is frequently produced as a response of the host cells. We show that plasma membrane damage was not the main reason for H(2O(2-induced death of the fungal pathogen. Proteomic analysis of the changes of total cellular proteins in P. expansum showed that a large proportion of the differentially expressed proteins appeared to be of mitochondrial origin, implying that mitochondria may be involved in this process. We then performed mitochondrial sub-proteomic analysis to seek the H(2O(2-sensitive proteins in P. expansum. A set of mitochondrial proteins were identified, including respiratory chain complexes I and III, F(1F(0 ATP synthase, and mitochondrial phosphate carrier protein. The functions of several proteins were further investigated to determine their effects on the H(2O(2-induced fungal death. Through fluorescent co-localization and the use of specific inhibitor, we provide evidence that complex III of the mitochondrial respiratory chain contributes to ROS generation in fungal mitochondria under H(2O(2 stress. The undesirable accumulation of ROS caused oxidative damage of mitochondrial proteins and led to the collapse of mitochondrial membrane potential. Meanwhile, we demonstrate that ATP synthase is involved in the response of fungal pathogen to oxidative stress, because inhibition of ATP synthase by oligomycin decreases survival. Our data suggest that mitochondrial impairment due to functional alteration of oxidative stress-sensitive proteins is associated with fungal death caused by H(2O(2.

  19. Multi-parametric analysis and modeling of relationships between mitochondrial morphology and apoptosis.

    Directory of Open Access Journals (Sweden)

    Yara Reis

    Full Text Available Mitochondria exist as a network of interconnected organelles undergoing constant fission and fusion. Current approaches to study mitochondrial morphology are limited by low data sampling coupled with manual identification and classification of complex morphological phenotypes. Here we propose an integrated mechanistic and data-driven modeling approach to analyze heterogeneous, quantified datasets and infer relations between mitochondrial morphology and apoptotic events. We initially performed high-content, multi-parametric measurements of mitochondrial morphological, apoptotic, and energetic states by high-resolution imaging of human breast carcinoma MCF-7 cells. Subsequently, decision tree-based analysis was used to automatically classify networked, fragmented, and swollen mitochondrial subpopulations, at the single-cell level and within cell populations. Our results revealed subtle but significant differences in morphology class distributions in response to various apoptotic stimuli. Furthermore, key mitochondrial functional parameters including mitochondrial membrane potential and Bax activation, were measured under matched conditions. Data-driven fuzzy logic modeling was used to explore the non-linear relationships between mitochondrial morphology and apoptotic signaling, combining morphological and functional data as a single model. Modeling results are in accordance with previous studies, where Bax regulates mitochondrial fragmentation, and mitochondrial morphology influences mitochondrial membrane potential. In summary, we established and validated a platform for mitochondrial morphological and functional analysis that can be readily extended with additional datasets. We further discuss the benefits of a flexible systematic approach for elucidating specific and general relationships between mitochondrial morphology and apoptosis.

  20. Multi-parametric analysis and modeling of relationships between mitochondrial morphology and apoptosis.

    Science.gov (United States)

    Reis, Yara; Bernardo-Faura, Marti; Richter, Daniela; Wolf, Thomas; Brors, Benedikt; Hamacher-Brady, Anne; Eils, Roland; Brady, Nathan R

    2012-01-01

    Mitochondria exist as a network of interconnected organelles undergoing constant fission and fusion. Current approaches to study mitochondrial morphology are limited by low data sampling coupled with manual identification and classification of complex morphological phenotypes. Here we propose an integrated mechanistic and data-driven modeling approach to analyze heterogeneous, quantified datasets and infer relations between mitochondrial morphology and apoptotic events. We initially performed high-content, multi-parametric measurements of mitochondrial morphological, apoptotic, and energetic states by high-resolution imaging of human breast carcinoma MCF-7 cells. Subsequently, decision tree-based analysis was used to automatically classify networked, fragmented, and swollen mitochondrial subpopulations, at the single-cell level and within cell populations. Our results revealed subtle but significant differences in morphology class distributions in response to various apoptotic stimuli. Furthermore, key mitochondrial functional parameters including mitochondrial membrane potential and Bax activation, were measured under matched conditions. Data-driven fuzzy logic modeling was used to explore the non-linear relationships between mitochondrial morphology and apoptotic signaling, combining morphological and functional data as a single model. Modeling results are in accordance with previous studies, where Bax regulates mitochondrial fragmentation, and mitochondrial morphology influences mitochondrial membrane potential. In summary, we established and validated a platform for mitochondrial morphological and functional analysis that can be readily extended with additional datasets. We further discuss the benefits of a flexible systematic approach for elucidating specific and general relationships between mitochondrial morphology and apoptosis.

  1. Chemical screening identifies ROCK as a target for recovering mitochondrial function in Hutchinson-Gilford progeria syndrome.

    Science.gov (United States)

    Kang, Hyun Tae; Park, Joon Tae; Choi, Kobong; Choi, Hyo Jei Claudia; Jung, Chul Won; Kim, Gyu Ree; Lee, Young-Sam; Park, Sang Chul

    2017-03-19

    Hutchinson-Gilford progeria syndrome (HGPS) constitutes a genetic disease wherein an aging phenotype manifests in childhood. Recent studies indicate that reactive oxygen species (ROS) play important roles in HGPS phenotype progression. Thus, pharmacological reduction in ROS levels has been proposed as a potentially effective treatment for patient with this disorder. In this study, we performed high-throughput screening to find compounds that could reduce ROS levels in HGPS fibroblasts and identified rho-associated protein kinase (ROCK) inhibitor (Y-27632) as an effective agent. To elucidate the underlying mechanism of ROCK in regulating ROS levels, we performed a yeast two-hybrid screen and discovered that ROCK1 interacts with Rac1b. ROCK activation phosphorylated Rac1b at Ser71 and increased ROS levels by facilitating the interaction between Rac1b and cytochrome c. Conversely, ROCK inactivation with Y-27632 abolished their interaction, concomitant with ROS reduction. Additionally, ROCK activation resulted in mitochondrial dysfunction, whereas ROCK inactivation with Y-27632 induced the recovery of mitochondrial function. Furthermore, a reduction in the frequency of abnormal nuclear morphology and DNA double-strand breaks was observed along with decreased ROS levels. Thus, our study reveals a novel mechanism through which alleviation of the HGPS phenotype is mediated by the recovery of mitochondrial function upon ROCK inactivation.

  2. Intraspecific phylogenetic analysis of Siberian woolly mammoths using complete mitochondrial genomes

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Drautz, Daniela I; Lesk, Arthur M;

    2008-01-01

    We report five new complete mitochondrial DNA (mtDNA) genomes of Siberian woolly mammoth (Mammuthus primigenius), sequenced with up to 73-fold coverage from DNA extracted from hair shaft material. Three of the sequences present the first complete mtDNA genomes of mammoth clade II. Analysis...... 1-2 million years, depending on the calibration technique. Furthermore, statistical analysis of the temporal distribution of the (14)C ages of these and previously identified members of the two mammoth clades suggests that clade II went extinct before clade I. Modeling of protein structures failed...

  3. The complete nucleotide sequence and multipartite organization of the tobacco mitochondrial genome: comparative analysis of mitochondrial genomes in higher plants.

    Science.gov (United States)

    Sugiyama, Y; Watase, Y; Nagase, M; Makita, N; Yagura, S; Hirai, A; Sugiura, M

    2005-02-01

    Tobacco is a valuable model system for investigating the origin of mitochondrial DNA (mtDNA) in amphidiploid plants and studying the genetic interaction between mitochondria and chloroplasts in the various functions of the plant cell. As a first step, we have determined the complete mtDNA sequence of Nicotiana tabacum. The mtDNA of N. tabacum can be assumed to be a master circle (MC) of 430,597 bp. Sequence comparison of a large number of clones revealed that there are four classes of boundaries derived from homologous recombination, which leads to a multipartite organization with two MCs and six subgenomic circles. The mtDNA of N. tabacum contains 36 protein-coding genes, three ribosomal RNA genes and 21 tRNA genes. Among the first class, we identified the genes rps1 and psirps14, which had previously been thought to be absent in tobacco mtDNA on the basis of Southern analysis. Tobacco mtDNA was compared with those of Arabidopsis thaliana, Beta vulgaris, Oryza sativa and Brassica napus. Since repeated sequences show no homology to each other among the five angiosperms, it can be supposed that these were independently acquired by each species during the evolution of angiosperms. The gene order and the sequences of intergenic spacers in mtDNA also differ widely among the five angiosperms, indicating multiple reorganizations of genome structure during the evolution of higher plants. Among the conserved genes, the same potential conserved nonanucleotide-motif-type promoter could only be postulated for rrn18-rrn5 in four of the dicotyledonous plants, suggesting that a coding sequence does not necessarily move with the promoter upon reorganization of the mitochondrial genome.

  4. Mitochondrial DNA analysis of ancient Sampula population in Xinjiang

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The archaeological site of Sampula cemetery was located about 14 km to the southwest of the Luo County in Xinjiang Khotan, China, belonging to the ancient Yutian kingdom. 14C analysis showed that this cemetery was used from 217 B.C. to 283 A.D.Ancient DNA was analyzed by 364 bp of the mitochondrial DNA hypervariable region Ⅰ (mtDNA HVR-Ⅰ), and by six restriction fragment length polymorphism (RFLP) sites of mtDNA coding region. We successfully extracted and sequenced intact stretches of maternally inherited mtDNA from 13 out of 16 ancient Sampula samples. The analysis of mtDNA haplogroup distribution showed that the ancient Sampula was a complex population with both European and Asian characteristics. Median joining network of U3 sub-haplogroup and multi-dimensional scaling analysis all showed that the ancient Sampula had maternal relationship with Ossetian and Iranian.

  5. Differentiation state-specific mitochondrial dynamic regulatory networks are revealed by global transcriptional analysis of the developing chicken lens.

    Science.gov (United States)

    Chauss, Daniel; Basu, Subhasree; Rajakaruna, Suren; Ma, Zhiwei; Gau, Victoria; Anastas, Sara; Brennan, Lisa A; Hejtmancik, J Fielding; Menko, A Sue; Kantorow, Marc

    2014-06-13

    The mature eye lens contains a surface layer of epithelial cells called the lens epithelium that requires a functional mitochondrial population to maintain the homeostasis and transparency of the entire lens. The lens epithelium overlies a core of terminally differentiated fiber cells that must degrade their mitochondria to achieve lens transparency. These distinct mitochondrial populations make the lens a useful model system to identify those genes that regulate the balance between mitochondrial homeostasis and elimination. Here we used an RNA sequencing and bioinformatics approach to identify the transcript levels of all genes expressed by distinct regions of the lens epithelium and maturing fiber cells of the embryonic Gallus gallus (chicken) lens. Our analysis detected more than 15,000 unique transcripts expressed by the embryonic chicken lens. Of these, more than 3000 transcripts exhibited significant differences in expression between lens epithelial cells and fiber cells. Multiple transcripts coding for separate mitochondrial homeostatic and degradation mechanisms were identified to exhibit preferred patterns of expression in lens epithelial cells that require mitochondria relative to lens fiber cells that require mitochondrial elimination. These included differences in the expression levels of metabolic (DUT, PDK1, SNPH), autophagy (ATG3, ATG4B, BECN1, FYCO1, WIPI1), and mitophagy (BNIP3L/NIX, BNIP3, PARK2, p62/SQSTM1) transcripts between lens epithelial cells and lens fiber cells. These data provide a comprehensive window into all genes transcribed by the lens and those mitochondrial regulatory and degradation pathways that function to maintain mitochondrial populations in the lens epithelium and to eliminate mitochondria in maturing lens fiber cells.

  6. Factor analysis identifies subgroups of constipation

    Institute of Scientific and Technical Information of China (English)

    Philip G Dinning; Mike Jones; Linda Hunt; Sergio E Fuentealba; Jamshid Kalanter; Denis W King; David Z Lubowski; Nicholas J Talley; Ian J Cook

    2011-01-01

    AIM: To determine whether distinct symptom groupings exist in a constipated population and whether such grouping might correlate with quantifiable pathophysiological measures of colonic dysfunction. METHODS: One hundred and ninety-one patients presenting to a Gastroenterology clinic with constipation and 32 constipated patients responding to a newspaper advertisement completed a 53-item, wide-ranging selfreport questionnaire. One hundred of these patients had colonic transit measured scintigraphically. Factor analysis determined whether constipation-related symptoms grouped into distinct aspects of symptomatology. Cluster analysis was used to determine whether individual patients naturally group into distinct subtypes. RESULTS: Cluster analysis yielded a 4 cluster solution with the presence or absence of pain and laxative unresponsiveness providing the main descriptors. Amongst all clusters there was a considerable proportion of patients with demonstrable delayed colon transit, irritable bowel syndrome positive criteria and regular stool frequency. The majority of patients with these characteristics also reported regular laxative use. CONCLUSION: Factor analysis identified four constipation subgroups, based on severity and laxative unresponsiveness, in a constipated population. However, clear stratification into clinically identifiable groups remains imprecise.

  7. Mitochondrial fusion and inheritance of the mitochondrial genome.

    Science.gov (United States)

    Takano, Hiroyoshi; Onoue, Kenta; Kawano, Shigeyuki

    2010-03-01

    Although maternal or uniparental inheritance of mitochondrial genomes is a general rule, biparental inheritance is sometimes observed in protists and fungi,including yeasts. In yeast, recombination occurs between the mitochondrial genomes inherited from both parents.Mitochondrial fusion observed in yeast zygotes is thought to set up a space for DNA recombination. In the last decade,a universal mitochondrial fusion mechanism has been uncovered, using yeast as a model. On the other hand, an alternative mitochondrial fusion mechanism has been identified in the true slime mold Physarum polycephalum.A specific mitochondrial plasmid, mF, has been detected as the genetic material that causes mitochondrial fusion in P. polycephalum. Without mF, fusion of the mitochondria is not observed throughout the life cycle, suggesting that Physarum has no constitutive mitochondrial fusion mechanism.Conversely, mitochondria fuse in zygotes and during sporulation with mF. The complete mF sequence suggests that one gene, ORF640, encodes a fusogen for Physarum mitochondria. Although in general, mitochondria are inherited uniparentally, biparental inheritance occurs with specific sexual crossing in P. polycephalum.An analysis of the transmission of mitochondrial genomes has shown that recombinations between two parental mitochondrial genomes require mitochondrial fusion,mediated by mF. Physarum is a unique organism for studying mitochondrial fusion.

  8. Automated quantification and integrative analysis of 2D and 3D mitochondrial shape and network properties.

    Directory of Open Access Journals (Sweden)

    Julie Nikolaisen

    Full Text Available Mitochondrial morphology and function are coupled in healthy cells, during pathological conditions and (adaptation to endogenous and exogenous stress. In this sense mitochondrial shape can range from small globular compartments to complex filamentous networks, even within the same cell. Understanding how mitochondrial morphological changes (i.e. "mitochondrial dynamics" are linked to cellular (patho physiology is currently the subject of intense study and requires detailed quantitative information. During the last decade, various computational approaches have been developed for automated 2-dimensional (2D analysis of mitochondrial morphology and number in microscopy images. Although these strategies are well suited for analysis of adhering cells with a flat morphology they are not applicable for thicker cells, which require a three-dimensional (3D image acquisition and analysis procedure. Here we developed and validated an automated image analysis algorithm allowing simultaneous 3D quantification of mitochondrial morphology and network properties in human endothelial cells (HUVECs. Cells expressing a mitochondria-targeted green fluorescence protein (mitoGFP were visualized by 3D confocal microscopy and mitochondrial morphology was quantified using both the established 2D method and the new 3D strategy. We demonstrate that both analyses can be used to characterize and discriminate between various mitochondrial morphologies and network properties. However, the results from 2D and 3D analysis were not equivalent when filamentous mitochondria in normal HUVECs were compared with circular/spherical mitochondria in metabolically stressed HUVECs treated with rotenone (ROT. 2D quantification suggested that metabolic stress induced mitochondrial fragmentation and loss of biomass. In contrast, 3D analysis revealed that the mitochondrial network structure was dissolved without affecting the amount and size of the organelles. Thus, our results demonstrate

  9. High resolution respirometry analysis of polyethylenimine-mediated mitochondrial energy crisis and cellular stress

    DEFF Research Database (Denmark)

    Hall, Arnaldur; Larsen, Anna Karina; Parhamifar, Ladan

    2013-01-01

    of PEI-mediated plasma membrane damage and subsequent ATP leakage to the extracellular medium. Studies with freshly isolated mouse liver mitochondria corroborated with bioenergetic findings and demonstrated parallel polycation concentration- and time-dependent changes in state 2 and state 4o oxygen flux...... and spectrophotometry analysis of cytochrome c oxidase activity we were able to identify complex IV (cytochrome c oxidase) as a likely specific site of PEI mediated inhibition within the electron transport system. Unraveling the mechanisms of PEI-mediated mitochondrial energy crisis is central for combinatorial design...

  10. A proteomic screen with Drosophila Opa1-like identifies Hsc70-5/Mortalin as a regulator of mitochondrial morphology and cellular homeostasis.

    Science.gov (United States)

    Banerjee, Shamik; Chinthapalli, Balaji

    2014-09-01

    Mitochondrial morphology is regulated by conserved proteins involved in fusion and fission processes. The mammalian Optic atrophy 1 (OPA1) that functions in mitochondrial fusion is associated with Optic Atrophy and has been implicated in inner membrane cristae remodeling during cell death. Here, we show Drosophila Optic atrophy 1-like (Opa1-like) influences mitochondrial morphology through interaction with 'mitochondria-shaping' proteins like Mitochondrial assembly regulatory factor (Marf) and Drosophila Mitofilin (dMitofilin). To gain an insight into Opa1-like's network, we delineated bonafide interactors like dMitofilin, Marf, Serine protease High temperature requirement protein A2 (HTRA2), Rhomboid-7 (Rho-7) along with novel interactors such as Mortalin ortholog (Hsc70-5) from Drosophila mitochondrial extract. Interestingly, RNAi mediated down-regulation of hsc70-5 in Drosophila wing imaginal disc's peripodial cells resulted in fragmented mitochondria with reduced membrane potential leading to proteolysis of Opa1-like. Increased ecdysone activity induced dysfunctional fragmented mitochondria for clearance through lysosomes, an effect enhanced in hsc70-5 RNAi leading to increased cell death. Over-expression of Opa1-like rescues mitochondrial morphology and cell death in prepupal tissues expressing hsc70-5 RNAi. Taken together, we have identified a novel interaction between Hsc70-5/Mortalin and Opa1-like that influences cellular homeostasis through mitochondrial fusion.

  11. A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies.

    Directory of Open Access Journals (Sweden)

    Masakazu Kohda

    2016-01-01

    Full Text Available Mitochondrial disorders have the highest incidence among congenital metabolic disorders characterized by biochemical respiratory chain complex deficiencies. It occurs at a rate of 1 in 5,000 births, and has phenotypic and genetic heterogeneity. Mutations in about 1,500 nuclear encoded mitochondrial proteins may cause mitochondrial dysfunction of energy production and mitochondrial disorders. More than 250 genes that cause mitochondrial disorders have been reported to date. However exact genetic diagnosis for patients still remained largely unknown. To reveal this heterogeneity, we performed comprehensive genomic analyses for 142 patients with childhood-onset mitochondrial respiratory chain complex deficiencies. The approach includes whole mtDNA and exome analyses using high-throughput sequencing, and chromosomal aberration analyses using high-density oligonucleotide arrays. We identified 37 novel mutations in known mitochondrial disease genes and 3 mitochondria-related genes (MRPS23, QRSL1, and PNPLA4 as novel causative genes. We also identified 2 genes known to cause monogenic diseases (MECP2 and TNNI3 and 3 chromosomal aberrations (6q24.3-q25.1, 17p12, and 22q11.21 as causes in this cohort. Our approaches enhance the ability to identify pathogenic gene mutations in patients with biochemically defined mitochondrial respiratory chain complex deficiencies in clinical settings. They also underscore clinical and genetic heterogeneity and will improve patient care of this complex disorder.

  12. Functional Genomic Analysis of Human Mitochondrial RNA Processing

    Directory of Open Access Journals (Sweden)

    Ashley R. Wolf

    2014-05-01

    Full Text Available Both strands of human mtDNA are transcribed in continuous, multigenic units that are cleaved into the mature rRNAs, tRNAs, and mRNAs required for respiratory chain biogenesis. We sought to systematically identify nuclear-encoded proteins that contribute to processing of mtRNAs within the organelle. First, we devised and validated a multiplex MitoString assay that quantitates 27 mature and precursor mtDNA transcripts. Second, we applied MitoString profiling to evaluate the impact of silencing each of 107 mitochondrial-localized, predicted RNA-binding proteins. With the resulting data set, we rediscovered the roles of recently identified RNA-processing enzymes, detected unanticipated roles of known disease genes in RNA processing, and identified new regulatory factors. We demonstrate that one such factor, FASTKD4, modulates the half-lives of a subset of mt-mRNAs and associates with mtRNAs in vivo. MitoString profiling may be useful for diagnosing and deciphering the pathogenesis of mtDNA disorders.

  13. Genome-wide and functional annotation of human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the organelle's dynamics and signaling.

    Directory of Open Access Journals (Sweden)

    Wei Li

    Full Text Available Specificity of protein ubiquitylation is conferred by E3 ubiquitin (Ub ligases. We have annotated approximately 617 putative E3s and substrate-recognition subunits of E3 complexes encoded in the human genome. The limited knowledge of the function of members of the large E3 superfamily prompted us to generate genome-wide E3 cDNA and RNAi expression libraries designed for functional screening. An imaging-based screen using these libraries to identify E3s that regulate mitochondrial dynamics uncovered MULAN/FLJ12875, a RING finger protein whose ectopic expression and knockdown both interfered with mitochondrial trafficking and morphology. We found that MULAN is a mitochondrial protein - two transmembrane domains mediate its localization to the organelle's outer membrane. MULAN is oriented such that its E3-active, C-terminal RING finger is exposed to the cytosol, where it has access to other components of the Ub system. Both an intact RING finger and the correct subcellular localization were required for regulation of mitochondrial dynamics, suggesting that MULAN's downstream effectors are proteins that are either integral to, or associated with, mitochondria and that become modified with Ub. Interestingly, MULAN had previously been identified as an activator of NF-kappaB, thus providing a link between mitochondrial dynamics and mitochondria-to-nucleus signaling. These findings suggest the existence of a new, Ub-mediated mechanism responsible for integration of mitochondria into the cellular environment.

  14. Exploring mitochondrial evolution and metabolism organization principles by comparative analysis of metabolic networks.

    Science.gov (United States)

    Chang, Xiao; Wang, Zhuo; Hao, Pei; Li, Yuan-Yuan; Li, Yi-Xue

    2010-06-01

    The endosymbiotic theory proposed that mitochondrial genomes are derived from an alpha-proteobacterium-like endosymbiont, which was concluded from sequence analysis. We rebuilt the metabolic networks of mitochondria and 22 relative species, and studied the evolution of mitochondrial metabolism at the level of enzyme content and network topology. Our phylogenetic results based on network alignment and motif identification supported the endosymbiotic theory from the point of view of systems biology for the first time. It was found that the mitochondrial metabolic network were much more compact than the relative species, probably related to the higher efficiency of oxidative phosphorylation of the specialized organelle, and the network is highly clustered around the TCA cycle. Moreover, the mitochondrial metabolic network exhibited high functional specificity to the modules. This work provided insight to the understanding of mitochondria evolution, and the organization principle of mitochondrial metabolic network at the network level.

  15. Complete sequence of the mitochondrial genome of a diatom alga Synedra acus and comparative analysis of diatom mitochondrial genomes.

    Science.gov (United States)

    Ravin, Nikolai V; Galachyants, Yuri P; Mardanov, Andrey V; Beletsky, Alexey V; Petrova, Darya P; Sherbakova, Tatyana A; Zakharova, Yuliya R; Likhoshway, Yelena V; Skryabin, Konstantin G; Grachev, Mikhail A

    2010-06-01

    The first two mitochondrial genomes of marine diatoms were previously reported for the centric Thalassiosira pseudonana and the raphid pennate Phaeodactylum tricornutum. As part of a genomic project, we sequenced the complete mitochondrial genome of the freshwater araphid pennate diatom Synedra acus. This 46,657 bp mtDNA encodes 2 rRNAs, 24 tRNAs, and 33 proteins. The mtDNA of S. acus contains three group II introns, two inserted into the cox1 gene and containing ORFs, and one inserted into the rnl gene and lacking an ORF. The compact gene organization contrasts with the presence of a 4.9-kb-long intergenic region, which contains repeat sequences. Comparison of the three sequenced mtDNAs showed that these three genomes carry similar gene pools, but the positions of some genes are rearranged. Phylogenetic analysis performed with a fragment of the cox1 gene of diatoms and other heterokonts produced a tree that is similar to that derived from 18S RNA genes. The introns of mtDNA in the diatoms seem to be polyphyletic. This study demonstrates that pyrosequencing is an efficient method for complete sequencing of mitochondrial genomes from diatoms, and may soon give valuable information about the molecular phylogeny of this outstanding group of unicellular organisms.

  16. Integrative Genomic Analysis of Cholangiocarcinoma Identifies Distinct IDH-Mutant Molecular Profiles

    Directory of Open Access Journals (Sweden)

    Farshad Farshidfar

    2017-03-01

    Full Text Available Cholangiocarcinoma (CCA is an aggressive malignancy of the bile ducts, with poor prognosis and limited treatment options. Here, we describe the integrated analysis of somatic mutations, RNA expression, copy number, and DNA methylation by The Cancer Genome Atlas of a set of predominantly intrahepatic CCA cases and propose a molecular classification scheme. We identified an IDH mutant-enriched subtype with distinct molecular features including low expression of chromatin modifiers, elevated expression of mitochondrial genes, and increased mitochondrial DNA copy number. Leveraging the multi-platform data, we observed that ARID1A exhibited DNA hypermethylation and decreased expression in the IDH mutant subtype. More broadly, we found that IDH mutations are associated with an expanded histological spectrum of liver tumors with molecular features that stratify with CCA. Our studies reveal insights into the molecular pathogenesis and heterogeneity of cholangiocarcinoma and provide classification information of potential therapeutic significance.

  17. Hepatic mitochondrial function analysis using needle liver biopsy samples.

    Directory of Open Access Journals (Sweden)

    Michael J J Chu

    Full Text Available BACKGROUNDS AND AIM: Current assessment of pre-operative liver function relies upon biochemical blood tests and histology but these only indirectly measure liver function. Mitochondrial function (MF analysis allows direct measurement of cellular metabolic function and may provide an additional index of hepatic health. Conventional MF analysis requires substantial tissue samples (>100 mg obtained at open surgery. Here we report a method to assess MF using <3 mg of tissue obtained by a Tru-cut® biopsy needle making it suitable for percutaneous application. METHODS: An 18G Bard® Max-core® biopsy instrument was used to collect samples. The optimal Tru-cut® sample weight, stability in ice-cold University of Wisconsin solution, reproducibility and protocol utility was initially evaluated in Wistar rat livers then confirmed in human samples. MF was measured in saponin-permeabilized samples using high-resolution respirometry. RESULTS: The average mass of a single rat and human liver Tru-cut® biopsy was 5.60±0.30 and 5.16±0.15 mg, respectively (mean; standard error of mean. Two milligram of sample was found the lowest feasible mass for the MF assay. Tissue MF declined after 1 hour of cold storage. Six replicate measurements within rats and humans (n = 6 each showed low coefficient of variation (<10% in measurements of State-III respiration, electron transport chain (ETC capacity and respiratory control ratio (RCR. Ischemic rat and human liver samples consistently showed lower State-III respiration, ETC capacity and RCR, compared to normal perfused liver samples. CONCLUSION: Consistent measurement of liver MF and detection of derangement in a disease state was successfully demonstrated using less than half the tissue from a single Tru-cut® biopsy. Using this technique outpatient assessment of liver MF is now feasible, providing a new assay for the evaluation of hepatic function.

  18. Identifiable Data Files - Medicare Provider Analysis and ...

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Medicare Provider Analysis and Review (MEDPAR) File contains data from claims for services provided to beneficiaries admitted to Medicare certified inpatient...

  19. Identifying Proper Names Based on Association Analysis

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The issue of proper names recognition in Chinese text was discussed. An automatic approach based on association analysis to extract rules from corpus was presented. The method tries to discover rules relevant to external evidence by association analysis, without additional manual effort. These rules can be used to recognize the proper nouns in Chinese texts. The experimental result shows that our method is practical in some applications.Moreover, the method is language independent.

  20. Complete Sequence and Analysis of Coconut Palm (Cocos nucifera) Mitochondrial Genome

    Science.gov (United States)

    Zhao, Yuhui; Zeng, Jingyao; Alamer, Ali; Alanazi, Ibrahim O.; Alawad, Abdullah O.; Al-Sadi, Abdullah M.; Hu, Songnian; Yu, Jun

    2016-01-01

    Coconut (Cocos nucifera L.), a member of the palm family (Arecaceae), is one of the most economically important crops in tropics, serving as an important source of food, drink, fuel, medicine, and construction material. Here we report an assembly of the coconut (C. nucifera, Oman local Tall cultivar) mitochondrial (mt) genome based on next-generation sequencing data. This genome, 678,653bp in length and 45.5% in GC content, encodes 72 proteins, 9 pseudogenes, 23 tRNAs, and 3 ribosomal RNAs. Within the assembly, we find that the chloroplast (cp) derived regions account for 5.07% of the total assembly length, including 13 proteins, 2 pseudogenes, and 11 tRNAs. The mt genome has a relatively large fraction of repeat content (17.26%), including both forward (tandem) and inverted (palindromic) repeats. Sequence variation analysis shows that the Ti/Tv ratio of the mt genome is lower as compared to that of the nuclear genome and neutral expectation. By combining public RNA-Seq data for coconut, we identify 734 RNA editing sites supported by at least two datasets. In summary, our data provides the second complete mt genome sequence in the family Arecaceae, essential for further investigations on mitochondrial biology of seed plants. PMID:27736909

  1. Complete Sequence and Analysis of Coconut Palm (Cocos nucifera) Mitochondrial Genome.

    Science.gov (United States)

    Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Zhao, Yuhui; Zeng, Jingyao; Alamer, Ali; Alanazi, Ibrahim O; Alawad, Abdullah O; Al-Sadi, Abdullah M; Hu, Songnian; Yu, Jun

    2016-01-01

    Coconut (Cocos nucifera L.), a member of the palm family (Arecaceae), is one of the most economically important crops in tropics, serving as an important source of food, drink, fuel, medicine, and construction material. Here we report an assembly of the coconut (C. nucifera, Oman local Tall cultivar) mitochondrial (mt) genome based on next-generation sequencing data. This genome, 678,653bp in length and 45.5% in GC content, encodes 72 proteins, 9 pseudogenes, 23 tRNAs, and 3 ribosomal RNAs. Within the assembly, we find that the chloroplast (cp) derived regions account for 5.07% of the total assembly length, including 13 proteins, 2 pseudogenes, and 11 tRNAs. The mt genome has a relatively large fraction of repeat content (17.26%), including both forward (tandem) and inverted (palindromic) repeats. Sequence variation analysis shows that the Ti/Tv ratio of the mt genome is lower as compared to that of the nuclear genome and neutral expectation. By combining public RNA-Seq data for coconut, we identify 734 RNA editing sites supported by at least two datasets. In summary, our data provides the second complete mt genome sequence in the family Arecaceae, essential for further investigations on mitochondrial biology of seed plants.

  2. A cardiac-specific robotized cellular assay identified families of human ligands as inducers of PGC-1α expression and mitochondrial biogenesis.

    Directory of Open Access Journals (Sweden)

    Matthieu Ruiz

    Full Text Available BACKGROUND: Mitochondrial function is dramatically altered in heart failure (HF. This is associated with a decrease in the expression of the transcriptional coactivator PGC-1α, which plays a key role in the coordination of energy metabolism. Identification of compounds able to activate PGC-1α transcription could be of future therapeutic significance. METHODOLOGY/PRINCIPAL FINDINGS: We thus developed a robotized cellular assay to screen molecules in order to identify new activators of PGC-1α in a cardiac-like cell line. This screening assay was based on both the assessment of activity and gene expression of a secreted luciferase under the control of the human PGC-1α promoter, stably expressed in H9c2 cells. We screened part of a library of human endogenous ligands and steroid hormones, B vitamins and fatty acids were identified as activators of PGC-1α expression. The most responsive compounds of these families were then tested for PGC-1α gene expression in adult rat cardiomyocytes. These data highly confirmed the primary screening, and the increase in PGC-1α mRNA correlated with an increase in several downstream markers of mitochondrial biogenesis. Moreover, respiration rates of H9c2 cells treated with these compounds were increased evidencing their effectiveness on mitochondrial biogenesis. CONCLUSIONS/SIGNIFICANCE: Using our cellular reporter assay we could identify three original families, able to activate mitochondrial biogenesis both in cell line and adult cardiomyocytes. This first screening can be extended to chemical libraries in order to increase our knowledge on PGC-1α regulation in the heart and to identify potential therapeutic compounds able to improve mitochondrial function in HF.

  3. Identifying MMORPG Bots: A Traffic Analysis Approach

    Directory of Open Access Journals (Sweden)

    Wen-Chin Chen

    2008-11-01

    Full Text Available Massively multiplayer online role playing games (MMORPGs have become extremely popular among network gamers. Despite their success, one of MMORPG's greatest challenges is the increasing use of game bots, that is, autoplaying game clients. The use of game bots is considered unsportsmanlike and is therefore forbidden. To keep games in order, game police, played by actual human players, often patrol game zones and question suspicious players. This practice, however, is labor-intensive and ineffective. To address this problem, we analyze the traffic generated by human players versus game bots and propose general solutions to identify game bots. Taking Ragnarok Online as our subject, we study the traffic generated by human players and game bots. We find that their traffic is distinguishable by 1 the regularity in the release time of client commands, 2 the trend and magnitude of traffic burstiness in multiple time scales, and 3 the sensitivity to different network conditions. Based on these findings, we propose four strategies and two ensemble schemes to identify bots. Finally, we discuss the robustness of the proposed methods against countermeasures of bot developers, and consider a number of possible ways to manage the increasingly serious bot problem.

  4. Identifying MMORPG Bots: A Traffic Analysis Approach

    Science.gov (United States)

    Chen, Kuan-Ta; Jiang, Jhih-Wei; Huang, Polly; Chu, Hao-Hua; Lei, Chin-Laung; Chen, Wen-Chin

    2008-12-01

    Massively multiplayer online role playing games (MMORPGs) have become extremely popular among network gamers. Despite their success, one of MMORPG's greatest challenges is the increasing use of game bots, that is, autoplaying game clients. The use of game bots is considered unsportsmanlike and is therefore forbidden. To keep games in order, game police, played by actual human players, often patrol game zones and question suspicious players. This practice, however, is labor-intensive and ineffective. To address this problem, we analyze the traffic generated by human players versus game bots and propose general solutions to identify game bots. Taking Ragnarok Online as our subject, we study the traffic generated by human players and game bots. We find that their traffic is distinguishable by 1) the regularity in the release time of client commands, 2) the trend and magnitude of traffic burstiness in multiple time scales, and 3) the sensitivity to different network conditions. Based on these findings, we propose four strategies and two ensemble schemes to identify bots. Finally, we discuss the robustness of the proposed methods against countermeasures of bot developers, and consider a number of possible ways to manage the increasingly serious bot problem.

  5. Identifying nonlinear biomechanical models by multicriteria analysis

    Science.gov (United States)

    Srdjevic, Zorica; Cveticanin, Livija

    2012-02-01

    In this study, the methodology developed by Srdjevic and Cveticanin (International Journal of Industrial Ergonomics 34 (2004) 307-318) for the nonbiased (objective) parameter identification of the linear biomechanical model exposed to vertical vibrations is extended to the identification of n-degree of freedom (DOF) nonlinear biomechanical models. The dynamic performance of the n-DOF nonlinear model is described in terms of response functions in the frequency domain, such as the driving-point mechanical impedance and seat-to-head transmissibility function. For randomly generated parameters of the model, nonlinear equations of motion are solved using the Runge-Kutta method. The appropriate data transformation from the time-to-frequency domain is performed by a discrete Fourier transformation. Squared deviations of the response functions from the target values are used as the model performance evaluation criteria, thus shifting the problem into the multicriteria framework. The objective weights of criteria are obtained by applying the Shannon entropy concept. The suggested methodology is programmed in Pascal and tested on a 4-DOF nonlinear lumped parameter biomechanical model. The identification process over the 2000 generated sets of parameters lasts less than 20 s. The model response obtained with the imbedded identified parameters correlates well with the target values, therefore, justifying the use of the underlying concept and the mathematical instruments and numerical tools applied. It should be noted that the identified nonlinear model has an improved accuracy of the biomechanical response compared to the accuracy of a linear model.

  6. Sequence Analysis of the Mitochondrial Genomes from Dutch Pedigrees with Leber Hereditary Optic Neuropathy

    Science.gov (United States)

    Howell, Neil; Oostra, Roelof-Jan; Bolhuis, Piet A.; Spruijt, Liesbeth; Clarke, Lorne A.; Mackey, David A.; Preston, Gwen; Herrnstadt, Corinna

    2003-01-01

    The complete mitochondrial DNA (mtDNA) sequences for 63 Dutch pedigrees with Leber hereditary optic neuropathy (LHON) were determined, 56 of which carried one of the classic LHON mutations at nucleotide (nt) 3460, 11778, or 14484. Analysis of these sequences indicated that there were several instances in which the mtDNAs were either identical or related by descent. The most striking example was a haplogroup J mtDNA that carried the 14484 LHON mutation. Four different but related mitochondrial genotypes were identified in seven of the Dutch pedigrees with LHON, including six of those described by van Senus. The control region of the founder sequence for these Dutch pedigrees with LHON matches the control-region sequence that Macmillan and colleagues identified in the founder mtDNA of French Canadian pedigrees with LHON. In addition, we obtained a perfect match between the Dutch 14484 founder sequence and the complete mtDNA sequences of two Canadian pedigrees with LHON. Those results indicate that these Dutch and French Canadian 14484 pedigrees with LHON share a common ancestor, that the single origin of the 14484 mutation in this megalineage occurred before the year 1600, and that there is a 14484/haplogroup J founder effect. We estimate that this lineage—including the 14484 LHON mutation—arose 900–1,800 years ago. Overall, the phylogenetic analyses of these mtDNA sequences conservatively indicate that a LHON mutation has arisen at least 42 times in the Dutch population. Finally, analysis of the mtDNA sequences from those pedigrees that did not carry classic LHON mutations suggested candidate pathogenic mutations at nts 9804, 13051, and 14325. PMID:12736867

  7. Mitochondrial DNA sequence analysis of two mouse hepatocarcinoma cell lines

    Institute of Scientific and Technical Information of China (English)

    Ji-Gang Dai; Xia Lei; Jia-Xin Min; Guo-Qiang Zhang; Hong Wei

    2005-01-01

    AIM: To study genetic difference of mitochondrial DNA (mtDNA)between two hepatocarcinoma cell lines (Hca-F and Hca-P)with diverse metastatic characteristics and the relationship between mtDNA changes in cancer cells and their oncogenic phenotype.METHODS: Mitochondrial DNA D-loop, tRNAMet+Glu+Ile and ND3gene fragments from the hepatocarcinoma cell lines with 1100, 1126 and 534 bp in length respectively were analysed by PCR amplification and restriction fragment length polymorphism techniques. The D-loop 3' end sequence of the hepatocarcinoma cell lines was determined by sequencing.RESULTS: No amplification fragment length polymorphism and restriction fragment length polymorphism were observed in tRNAMet+Glu+Ile,ND3 and D-loop of mitochondrial DNA of the hepatocarcinoma cells. Sequence differences between Hca-F and Hca-P were found in mtDNA D-loop.CONCLUSION: Deletion mutations of mitochondrial DNA restriction fragment may not play a significant role in carcinogenesis. Genetic difference of mtDNA D-loop between Hca-F and Hca-P, which may reflect the environmental and genetic influences during tumor progression, could be linked to their tumorigenic phenotypes.

  8. Mitochondrial DNA sequence analysis of patients with 'atypical psychosis'.

    Science.gov (United States)

    Kazuno, An-A; Munakata, Kae; Mori, Kanako; Tanaka, Masashi; Nanko, Shinichiro; Kunugi, Hiroshi; Umekage, Tadashi; Tochigi, Mamoru; Kohda, Kazuhisa; Sasaki, Tsukasa; Akiyama, Tsuyoshi; Washizuka, Shinsuke; Kato, Nobumasa; Kato, Tadafumi

    2005-08-01

    Although classical psychopathological studies have shown the presence of an independent diagnostic category, 'atypical psychosis', most psychotic patients are currently classified into two major diagnostic categories, schizophrenia and bipolar disorder, by the Diagnostic and Statistical Manual of Mental Disorders (4th edn; DSM-IV) criteria. 'Atypical psychosis' is characterized by acute confusion without systematic delusion, emotional instability, and psychomotor excitement or stupor. Such clinical features resemble those seen in organic mental syndrome, and differential diagnosis is often difficult. Because patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) sometimes show organic mental disorder, 'atypical psychosis' may be caused by mutations of mitochondrial DNA (mtDNA) in some patients. In the present study whole mtDNA was sequenced for seven patients with various psychotic disorders, who could be categorized as 'atypical psychosis'. None of them had known mtDNA mutations pathogenic for mitochondrial encephalopathy. Two of seven patients belonged to a subhaplogroup F1b1a with low frequency. These results did not support the hypothesis that clinical presentation of some patients with 'atypical psychosis' is a reflection of subclinical mitochondrial encephalopathy. However, the subhaplogroup F1b1a may be a good target for association study of 'atypical psychosis'.

  9. Automated DNA extraction of single dog hairs without roots for mitochondrial DNA analysis.

    Science.gov (United States)

    Bekaert, Bram; Larmuseau, Maarten H D; Vanhove, Maarten P M; Opdekamp, Anouschka; Decorte, Ronny

    2012-03-01

    Dogs are intensely integrated in human social life and their shed hairs can play a major role in forensic investigations. The overall aim of this study was to validate a semi-automated extraction method for mitochondrial DNA analysis of telogenic dog hairs. Extracted DNA was amplified with a 95% success rate from 43 samples using two new experimental designs in which the mitochondrial control region was amplified as a single large (± 1260 bp) amplicon or as two individual amplicons (HV1 and HV2; ± 650 and 350 bp) with tailed-primers. The results prove that the extraction of dog hair mitochondrial DNA can easily be automated to provide sufficient DNA yield for the amplification of a forensically useful long mitochondrial DNA fragment or alternatively two short fragments with minimal loss of sequence in case of degraded samples.

  10. The enzymology of mitochondrial fatty acid beta-oxidation and its application to follow-up analysis of positive neonatal screening results.

    Science.gov (United States)

    Wanders, Ronald J A; Ruiter, Jos P N; IJLst, Lodewijk; Waterham, Hans R; Houten, Sander M

    2010-10-01

    Oxidation of fatty acids in mitochondria is a key physiological process in higher eukaryotes including humans. The importance of the mitochondrial beta-oxidation system in humans is exemplified by the existence of a group of genetic diseases in man caused by an impairment in the mitochondrial oxidation of fatty acids. Identification of patients with a defect in mitochondrial beta-oxidation has long remained notoriously difficult, but the introduction of tandem-mass spectrometry in laboratories for genetic metabolic diseases has revolutionalized the field by allowing the rapid and sensitive analysis of acylcarnitines. Equally important is that much progress has been made with respect to the development of specific enzyme assays to identify the enzyme defect in patients subsequently followed by genetic analysis. In this review, we will describe the current state of knowledge in the field of fatty acid oxidation enzymology and its application to the follow-up analysis of positive neonatal screening results.

  11. Whole exome sequencing identifies a homozygous POLG2 missense variant in an infant with fulminant hepatic failure and mitochondrial DNA depletion.

    Science.gov (United States)

    Varma, Hemant; Faust, Phyllis L; Iglesias, Alejandro D; Lagana, Stephen M; Wou, Karen; Hirano, Michio; DiMauro, Salvatore; Mansukani, Mahesh M; Hoff, Kirsten E; Nagy, Peter L; Copeland, William C; Naini, Ali B

    2016-10-01

    Mitochondrial DNA (mtDNA) depletion syndrome manifests as diverse early-onset diseases that affect skeletal muscle, brain and liver function. Mutations in several nuclear DNA-encoded genes cause mtDNA depletion. We report on a patient, a 3-month-old boy who presented with hepatic failure, and was found to have severe mtDNA depletion in liver and muscle. Whole-exome sequencing identified a homozygous missense variant (c.544C > T, p.R182W) in the accessory subunit of mitochondrial DNA polymerase gamma (POLG2), which is required for mitochondrial DNA replication. This variant is predicted to disrupt a critical region needed for homodimerization of the POLG2 protein and cause loss of processive DNA synthesis. Both parents were phenotypically normal and heterozygous for this variant. Heterozygous mutations in POLG2 were previously associated with progressive external ophthalmoplegia and mtDNA deletions. This is the first report of a patient with a homozygous mutation in POLG2 and with a clinical presentation of severe hepatic failure and mitochondrial depletion.

  12. mitoSAVE: mitochondrial sequence analysis of variants in Excel.

    Science.gov (United States)

    King, Jonathan L; Sajantila, Antti; Budowle, Bruce

    2014-09-01

    The mitochondrial genome (mtGenome) contains genetic information amenable to numerous applications such as medical research, population and evolutionary studies, and human identity testing. However, inconsistent nomenclature assignment makes haplotype comparison difficult and can lead to false exclusion of potentially useful profiles. Massively Parallel Sequencing (MPS) is a platform for sequencing large datasets and potentially whole populations with relative ease. However, the data generated are not easily parsed and interpreted. With this in mind, mitoSAVE has been developed to enable fast conversion of Variant Call Format (VCF) files. mitoSAVE is an Excel-based workbook that converts data within the VCF into mtDNA haplotypes using phylogenetically-established nomenclature as well as rule-based alignments consistent with current forensic standards. mitoSAVE is formatted for human mitochondrial genome; however, it can easily be adapted to support other reasonably small genomes.

  13. The first case of mitochondrial acetoacetyl-CoA thiolase deficiency identified by expanded newborn metabolic screening in Italy: the importance of an integrated diagnostic approach

    OpenAIRE

    Catanzano, Francesca; Ombrone, Daniela; Di Stefano, Cristina; Rossi, Anna; Nosari, Norberto; Scolamiero, Emanuela; Tandurella, Igor; Frisso, Giulia; Parenti, Giancarlo; Ruoppolo, Margherita; Andria, Generoso; Salvatore, Francesco

    2010-01-01

    A pilot expanded newborn screening programme to detect inherited metabolic disorders by means of liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) began in the Campania region, southern Italy, in 2007. By October 2009, >8,800 dried blood samples on filter paper from 11 hospitals had been screened. Within this screening programme, we identified a case of mitochondrial acetoacetyl-coenzyme A (CoA) thiolase deficiency [β-ketothiolase (β-KT) deficiency] by analysing the acylc...

  14. A common mutation, R208X, identified in Vietnamese patients with mitochondrial acetoacetyl-CoA thiolase (T2) deficiency

    NARCIS (Netherlands)

    Fukao, Toshiyuki; Hoan Thi Nguyen, [No Value; Nhan Thu Nguyen, [No Value; Dung Chi Vu, [No Value; Ngoc Thi Bich Can, [No Value; Anh Thi Van Pham, [No Value; Khanh Ngoc Nguyen, [No Value; Kobayashi, Hironori; Hasegawa, Yuki; Thao Phuong Bui, [No Value; Niezen-Koning, Kary E.; Wanders, Ronald J. A.; de Koning, Tom; Liem Thanh Nguyen, [No Value; Yamaguchi, Seiji; Kondo, Naomi

    2010-01-01

    Mitochondrial acetoacetyl-CoA thiolase (12) deficiency is an inborn error of metabolism affecting isoleucine catabolism and ketone body utilization. This disorder is clinically characterized by intermittent keto-acidotic episodes with no clinical symptoms between episodes. In general, 12 gene mutati

  15. Implementation of dna mitochondrial analysis in rhinoclemmys nasuta (testudines: geoemydidae)

    OpenAIRE

    Yherson Franchesco Molina Henao; Guillermo Barreto; Alan Giraldo

    2014-01-01

    Rhinoclemmys nasuta (Testudines:Geoemydidae) is considered an almost endemic specie to Colombia and the most primitive species of Rhynoclemmys. However, it is classified data deficient by IUCN because the available information is not enough to make a direct or indirect assessment of its extinction risk. Here, we describe the implementation of the method to analyze the mitochondrial DNA control sequence (mtDNA) of R. nasuta in order to generate tools for future studies in systematics and popul...

  16. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability

    Directory of Open Access Journals (Sweden)

    Joardar Vinita

    2012-12-01

    Full Text Available Abstract Background The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Results Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus, A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum. The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25–36 Kb among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus, contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. Conclusions The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent

  17. Comparative analysis of mitochondrial fragments transferred to the nucleus in vertebrate

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Mitochondfial DNA sequences transferred to the nucleus give rise to the so-called nuclear mitochondrial DNA (numt). In the GenBank database, 244 numts have been found in six orders of birds (Anseriformes, Columbiformes, Falconiformes, Charadriiformes, Galliformes and Passeriformes). Sequences alignment (NCBI-BLASTN) was carried out with mitochondrial and corresponding nuclear genome sequences in nine vertebrate species. The sequences with high homology were considered as numts. The number of numts ranged from 15 in chicken to 159 in chimpanzee. The sequences of numts in macaque, chimpanzee, and human spanned 100% of the entire mammalian mitochondrial genome. The reconstructed frequency of the mitochondrial gene transferred to the nucleus demonstrated that the rRNA genes had high frequencies than other mitochondrial genes. Using the RepeatMasker program, the transposable elements were detected in the flanking regions of each numt. The results showed that less than 5% of the flanking sequences were made up of repetitive elements in chicken. The GC content of 5′- and 3′-flanking regions of numts in nine species was less than 44%. The analysis of the flanking sequences provided a valuable understanding for future study on mechanism of mitochondrial gene transfer to the nucleus and the site of numt integration.

  18. Mitochondrial respiratory chain enzyme assay and DNA analysis in peripheral blood leukocytes for the etiological study of Chinese children with Leigh syndrome due to complex I deficiency.

    Science.gov (United States)

    Ma, Yan Yan; Wu, Tong Fei; Liu, Yu Peng; Wang, Qiao; Li, Xi Yuan; Zhang, Yao; Song, Jin Qing; Wang, Yu Jie; Yang, Yan Ling

    2013-02-01

    Mitochondrial respiratory chain complex I enzyme deficiency is the most commonly seen mitochondrial respiratory chain disorder. Although screening and diagnostic methods are available overseas, clinically feasible diagnostic methods have not yet been established in China. In this study, four Chinese boys with Leigh syndrome due to complex I deficiency were diagnosed by mitochondrial respiratory chain enzyme assay and DNA analysis using peripheral blood leukocytes. Four patients were admitted at the age of 5-14 years because of unexplained progressive neuromuscular symptoms, including motor developmental delay or regression, weakness, and seizures. Their cranial magnetic resonance imaging revealed typical finding as Leigh syndrome. Peripheral leukocyte mitochondrial respiratory chain complex I activities were found decreased to 9.6-33.1 nmol/min/mg mitochondrial protein(control 44.0 ± 5.4 nmol/min/mg). The ratios of complex I to citrate synthase activity were also decreased (8.9-19.8% in patients vs. control 48 ± 11%). Three mtDNA mutations were identified from three out of four patients, supporting the diagnosis of complex I deficiency. Point mutations m.10191T>C in mitochondrial ND3 gene, m.13513G>A in ND5 gene and m.14,453G>A in ND6 gene were detected in three patients.

  19. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene sequen

  20. Organization and comparative analysis of the mitochondrial genomes of bioluminescent Elateroidea (Coleoptera: Polyphaga).

    Science.gov (United States)

    Amaral, Danilo T; Mitani, Yasuo; Ohmiya, Yoshihiro; Viviani, Vadim R

    2016-07-25

    Mitochondrial genome organization in the Elateroidea superfamily (Coleoptera), which include the main families of bioluminescent beetles, has been poorly studied and lacking information about Phengodidae family. We sequenced the mitochondrial genomes of Neotropical Lampyridae (Bicellonycha lividipennis), Phengodidae (Brasilocerus sp.2 and Phrixothrix hirtus) and Elateridae (Pyrearinus termitilluminans, Hapsodrilus ignifer and Teslasena femoralis). All species had a typical insect mitochondrial genome except for the following: in the elaterid T. femoralis genome there is a non-coding region between NADH2 and tRNA-Trp; in the phengodids Brasilocerus sp.2 and P. hirtus genomes we did not find the tRNA-Ile and tRNA-Gln. The P. hirtus genome showed a ~1.6kb non-coding region, the rearrangement of tRNA-Tyr, a new tRNA-Leu copy, and several regions with higher AT contents. Phylogenetics analysis using Bayesian and ML models indicated that the Phengodidae+Rhagophthalmidae are closely related to Lampyridae family, and included Drilus flavescens (Drilidae) as an internal clade within Elateridae. This is the first report that compares the mitochondrial genomes organization of the three main families of bioluminescent Elateroidea, including the first Neotropical Lampyridae and Phengodidae. The losses of tRNAs, and translocation and duplication events found in Phengodidae mt genomes, mainly in P. hirtus, may indicate different evolutionary rates in these mitochondrial genomes. The mitophylogenomics analysis indicates the monophyly of the three bioluminescent families and a closer relationship between Lampyridae and Phengodidae/Rhagophthalmidae, in contrast with previous molecular analysis.

  1. Quantitative analysis of somatic mitochondrial DNA mutations by single-cell single-molecule PCR.

    Science.gov (United States)

    Kraytsberg, Yevgenya; Bodyak, Natalya; Myerow, Susan; Nicholas, Alexander; Ebralidze, Konstantin; Khrapko, Konstantin

    2009-01-01

    Mitochondrial genome integrity is an important issue in somatic mitochondrial genetics. Development of quantitative methods is indispensable to somatic mitochondrial genetics as quantitative studies are required to characterize heteroplasmy and mutation processes, as well as their effects on phenotypic developments. Quantitative studies include the identification and measurement of the load of pathogenic and non-pathogenic clonal mutations, screening mitochondrial genomes for mutations in order to determine the mutation spectra and characterize an ongoing mutation process. Single-molecule PCR (smPCR) has been shown to be an effective method that can be applied to all areas of quantitative studies. It has distinct advantages over conventional vector-based cloning techniques avoiding the well-known PCR-related artifacts such as the introduction of artificial mutations, preferential allelic amplifications, and "jumping" PCR. smPCR is a straightforward and robust method, which can be effectively used for molecule-by-molecule mutational analysis, even when mitochondrial whole genome (mtWG) analysis is involved. This chapter describes the key features of the smPCR method and provides three examples of its applications in single-cell analysis: di-plex smPCR for deletion quantification, smPCR cloning for clonal point mutation quantification, and smPCR cloning for whole genome sequencing (mtWGS).

  2. The exome sequencing identified the mutation in YARS2 encoding the mitochondrial tyrosyl-tRNA synthetase as a nuclear modifier for the phenotypic manifestation of Leber's hereditary optic neuropathy-associated mitochondrial DNA mutation.

    Science.gov (United States)

    Jiang, Pingping; Jin, Xiaofen; Peng, Yanyan; Wang, Meng; Liu, Hao; Liu, Xiaoling; Zhang, Zengjun; Ji, Yanchun; Zhang, Juanjuan; Liang, Min; Zhao, Fuxin; Sun, Yan-Hong; Zhang, Minglian; Zhou, Xiangtian; Chen, Ye; Mo, Jun Qin; Huang, Taosheng; Qu, Jia; Guan, Min-Xin

    2016-02-01

    Leber's hereditary optic neuropathy (LHON) is the most common mitochondrial disorder. Nuclear modifier genes are proposed to modify the phenotypic expression of LHON-associated mitochondrial DNA (mtDNA) mutations. By using an exome sequencing approach, we identified a LHON susceptibility allele (c.572G>T, p.191Gly>Val) in YARS2 gene encoding mitochondrial tyrosyl-tRNA synthetase, which interacts with m.11778G>A mutation to cause visual failure. We performed functional assays by using lymphoblastoid cell lines derived from members of Chinese families (asymptomatic individuals carrying m.11778G>A mutation, or both m.11778G>A and heterozygous p.191Gly>Val mutations and symptomatic subjects harboring m.11778G>A and homozygous p.191Gly>Val mutations) and controls lacking these mutations. The 191Gly>Val mutation reduced the YARS2 protein level in the mutant cells. The aminoacylated efficiency and steady-state level of tRNA(Tyr) were markedly decreased in the cell lines derived from patients both carrying homozygous YARS2 p.191Gly>Val and m.11778G>A mutations. The failure in tRNA(Tyr) metabolism impaired mitochondrial translation, especially for polypeptides with high content of tyrosine codon such as ND4, ND5, ND6 and COX2 in cells lines carrying homozygous YARS2 p.191Gly>Val and m.11778G>A mutations. The YARS2 p.191Gly>Val mutation worsened the respiratory phenotypes associated with m.11778G>A mutation, especially reducing activities of complexes I and IV. The respiratory deficiency altered the efficiency of mitochondrial ATP synthesis and increased the production of reactive oxygen species. Thus, mutated YARS2 aggravates mitochondrial dysfunctions associated with the m.11778G>A mutation, exceeding the threshold for the expression of blindness phenotype. Our findings provided new insights into the pathophysiology of LHON that were manifested by interaction between mtDNA mutation and mutated nuclear-modifier YARS2.

  3. Analysis of mitochondrial DNA sequences in patients with isolated or combined oxidative phosphorylation system deficiency.

    NARCIS (Netherlands)

    Hinttala, R.; Smeets, R.; Moilanen, J.S.; Ugalde, C.; Uusimaa, J.; Smeitink, J.A.M.; Majamaa, K.

    2006-01-01

    BACKGROUND: Enzyme deficiencies of the oxidative phosphorylation (OXPHOS) system may be caused by mutations in the mitochondrial DNA (mtDNA) or in the nuclear DNA. OBJECTIVE: To analyse the sequences of the mtDNA coding region in 25 patients with OXPHOS system deficiency to identify the underlying g

  4. Morphometric Analysis of Larval Rostellar Hooks in Taenia multiceps of Sheep in Iran and Its Association with Mitochondrial Gene Variability.

    Directory of Open Access Journals (Sweden)

    Sima Rostami

    2013-12-01

    Full Text Available The purposes of the present study were morphometric characterization of rostellar hooks of Taenia multiceps and to investigate the association of hook length variation and the variability within two mitochondrial genes of sheep isolates of the parasite.Up to 4500 sheep brains were examined for the presence of C. cerebralis. Biometric characters based on the larval rostellar hook size were measured for each individual isolate. Representative mitochondrial CO1 and 12S rRNA gene sequences for each of the isolates were obtained from NCBI GenBank. Morphometric and genetic data were analyzed using cluster analysis, Interclass Correlation Coefficient (ICC and random effects model.One hundred and fourteen sheep (2.5% were found infected with the coenuri. The minimum and maximum number of scoleces per cyst was 40 and 550 respectively. Each scolex contained 22-27 hooks arranged in two rows of large and small hooks. The average total length of the large and small hooks was 158.9 and 112.1 μm, respectively. Using ICC, statistically significant clusters of different hook sizes were identified within the isolates. The length of the large and small hooks was significantly associated with the variability in mitochondrial 12S rRNA gene.Taenia multiceps, is a relatively important zoonotic infection in Iranian sheep with the prevalence rate of 2.5%. Hook length analysis revealed statistically significant difference among individual isolates. Associations between the rostellar hook length and variability in the mitochondrial 12S rRNA was documented.

  5. Quantitative assessment of in-solution digestion efficiency identifies optimal protocols for unbiased protein analysis

    DEFF Research Database (Denmark)

    Leon, Ileana R; Schwämmle, Veit; Jensen, Ole N;

    2013-01-01

    a combination of qualitative and quantitative LC-MS/MS methods and statistical data analysis. In contrast to previous studies we employed both standard qualitative as well as data-independent quantitative workflows to systematically assess trypsin digestion efficiency and bias using mitochondrial protein...... conditions (buffer, RapiGest, deoxycholate, urea), and two methods for removal of detergents prior to analysis of peptides (acid precipitation or phase separation with ethyl acetate). Our data-independent quantitative LC-MS/MS workflow quantified over 3700 distinct peptides with 96% completeness between all...... protocols and replicates, with an average 40% protein sequence coverage and an average of 11 peptides identified per protein. Systematic quantitative and statistical analysis of physicochemical parameters demonstrated that deoxycholate-assisted in-solution digestion combined with phase transfer allows...

  6. Analysis of mitochondrial DNA sequences in childhood encephalomyopathies reveals new disease-associated variants.

    Directory of Open Access Journals (Sweden)

    Aijaz A Wani

    Full Text Available BACKGROUND: Mitochondrial encephalomyopathies are a heterogeneous group of clinical disorders generally caused due to mutations in either mitochondrial DNA (mtDNA or nuclear genes encoding oxidative phosphorylation (OXPHOS. We analyzed the mtDNA sequences from a group of 23 pediatric patients with clinical and morphological features of mitochondrial encephalopathies and tried to establish a relationship of identified variants with the disease. METHODOLOGY/PRINCIPLE FINDINGS: Complete mitochondrial genomes were amplified by PCR and sequenced by automated DNA sequencing. Sequencing data was analyzed by SeqScape software and also confirmed by BLASTn program. Nucleotide sequences were compared with the revised Cambridge reference sequence (CRS and sequences present in mitochondrial databases. The data obtained shows that a number of known and novel mtDNA variants were associated with the disease. Most of the non-synonymous variants were heteroplasmic (A4136G, A9194G and T11916A suggesting their possibility of being pathogenic in nature. Some of the missense variants although homoplasmic were showing changes in highly conserved amino acids (T3394C, T3866C, and G9804A and were previously identified with diseased conditions. Similarly, two other variants found in tRNA genes (G5783A and C8309T could alter the secondary structure of Cys-tRNA and Lys-tRNA. Most of the variants occurred in single cases; however, a few occurred in more than one case (e.g. G5783A and A10149T. CONCLUSIONS AND SIGNIFICANCE: The mtDNA variants identified in this study could be the possible cause of mitochondrial encephalomyopathies with childhood onset in the patient group. Our study further strengthens the pathogenic score of known variants previously reported as provisionally pathogenic in mitochondrial diseases. The novel variants found in the present study can be potential candidates for further investigations to establish the relationship between their incidence and role

  7. Phylogenetic analysis of Tibetan mastiffs based on mitochondrial hypervariable region I

    Indian Academy of Sciences (India)

    ZHANJUN REN; HUILING CHEN; XUEJIAO YANG; CHENGDONG ZHANG

    2017-03-01

    Recently, the number of Tibetan mastiffs, which is a precious germplasm resource and cultural heritage, is decreasing sharply. Therefore, the genetic diversity of Tibetan mastiffs needs to be studied to clarify its phylogenetics relationships and lay the foundation for resource protection, rational development and utilization of Tibetan mastiffs. We sequenced hypervariable region I of mitochondrial DNA (mtDNA) of 110 individuals from Tibet region and Gansu province. A total of 12 polymorphic sites were identified which defined eight haplotypes of which H4 and H8 were unique to Tibetan population with H8 being identified first. The haplotype diversity (Hd: 0.808), nucleotide diversity (Pi: 0.603%), the average number of nucleotide difference (K: 3.917) of Tibetan mastiffs from Gansu were higher than those from Tibet region (Hd: 0.794; Pi: 0.589%; K: 3.831), which revealed higher genetic diversity in Gansu. In terms of total population, the genetic variation was low. The median-joining network and phylogenetic tree based on the mtDNA hypervariable region I showed that Tibetan mastiffs originated from grey wolves, as the other domestic dogs and had different history of maternal origin. The mismatch distribution analysis and neutrality tests indicated that Tibetan mastiffs were in genetic equilibrium or in a population decline.

  8. Mitochondrial and nuclear DNA analysis revealed a cryptic species and genetic introgression in Littorina sitkana (Mollusca, Gastropoda).

    Science.gov (United States)

    Azuma, Noriko; Yamazaki, Tomoyasu; Chiba, Susumu

    2011-12-01

    We investigated mitochondrial and nuclear DNA genotypes in nominal Littorina sitkana samples from 2 localities in Eastern Hokkaido, northern Japan. Our results indicated the existence of cryptic species. In the analysis of partial mitochondrial Cytchrome b gene sequences, haplotypes of L. sitkana samples were monophyletic in a phylogenetic tree with orthologous sequences from other Littorina species, but were apparently separated in 2 clades. One included typical L. sitkana (CBa clade) samples, which formed a clade with an allopatric species, L. horikawai. The other, CBb, was independent from CBa and L. horikawai. Haplotypes of the mitochondrial 16S rRNA gene also separated into 2 clades. We additionally examined intron sequence of the heat shock cognate 70 (HSC70) nuclear gene and identified 17 haplotypes. These were also separated into 2 clades, HSCa and HSCb. Among the examined Hokkaido samples, 60% of individuals were heterozygotes. However, each heterozygote consisted of haplotypes from the same clade, HSCa or HSCb, and no admixture of HSCa and HSCb haplotypes was observed. These results indicate reproductive isolation between the 2 clades. Among the genotyped Hokkaido samples, 93% of individuals had CBa + HSCa or CBb + HSCb genotypes, and 7% had CBb + HSCa genotypes. The discrepancy between the mtDNA and nuclear DNA haplotypes in a few individuals may have been caused by genetic introgression due to past hybridization.

  9. AB036. Analysis of human mitochondrial genome mutations of Vietnamese patients tentatively diagnosed with encephalomyopathy

    Science.gov (United States)

    Nghia, Phan Tuan; Thai, Trinh Hong; Hue, Truong Thi; Van Minh, Nguyen; Khanh, Phung Bao; Hiep, Tran Duc; Anh, Tran Kieu; Loan, Nguyen Thi Hong; Van, Nguyen Thi Hong; Anh, Pham Van; Hung, Cao Vu; Anh, Le Ngoc

    2015-01-01

    Human mitochondrial genome consists of 16,569 bp, and replicates independently from the nuclear genome. Mutations in mitochondrial genome are usually causative factors of various metabolic disorders, especially those of encephalomyopathy. DNA analysis is the most reliable method for detection of mitochondrial genome mutations, and accordingly an excellent diagnostic tool for mitochondrial mutation-related diseases. In this study, 19 different mitochondrial genome mutations including A3243G, A3251G, T3271C and T3291C (MELAS); A8344G, T8356C and G8363A (MERRF); G3460A, G11778A and T14484C (LHON); T8993G/C and T9176G (Leigh); A1555G (deafness) and A4225G, G4298A, T10010C, T14727C, T14728C, T14709C (encephalomyopathy in general) were analyzed using PCR-RFLP in combination with DNA sequencing. In addition, a real-time PCR method using locked nucleic acid (LNA) Taqman probe was set up for heteroplasmy determination. Screening of 283 tentatively diagnosed encephalomyopathy patients revealed 7 cases of A3243G, 1 case of G11778A, 1 case of A1555G, 1 case of A4225G, 1 case G4298A, and 1 case of 6 bp (ACTCCT/CTCCTA) deletion. Using the LNA Taqman probe real-time PCR, the heteroplasmy of some point mutations was determined and the results support a potential relationship between heteroplasmy level and severity of the disease.

  10. Statistical analysis of post mortem DNA damage-derived miscoding lesions in Neandertal mitochondrial DNA

    NARCIS (Netherlands)

    S. Vives (Sergi); M.T. Gilbert (Thomas); C. Arenas (Conchita); E. Gigli (Elena); O. Lao Grueso (Oscar); C. Lalueza-Fox (Carles)

    2008-01-01

    textabstractBackground. We have analysed the distribution of post mortem DNA damage derived miscoding lesions from the datasets of seven published Neandertal specimens that have extensive cloned sequence coverage over the mitochondrial DNA (mtDNA) hypervariable region 1 (HVS1). The analysis was rest

  11. Mitochondrial DNA analysis of two southern African elephant populations

    Directory of Open Access Journals (Sweden)

    M.F. Essop

    1996-01-01

    Full Text Available The modern view is that there are at most only two valid forms of the African elephant namely Loxodonta qfricana africana, the bush elephant, and L.a. cyclotis, the forest elephant (Ansell 1974; Meester et al. 1986. The Knysna elephant which was also described as a separate sub-species is now almost extinct. Plans to augment the remnant population by introducing other animals must take into account the taxonomic questions and issue of conserving elephant gene pools (Greig 1982a. Mitochondrial DNA (mtDNA restriction fragment-size comparisons were performed on specimens from the Kruger National Park and the Addo Elephant National Park. If the Addo population's results are extrapolated to the Knysna population, it may be concluded that there is no genetic evidence for the Kruger and Knysna elephant populations to be considered as different sub-species.

  12. The role of mitochondrial proteomic analysis in radiological accidents and terrorism.

    Science.gov (United States)

    Maguire, David; Zhang, Bingrong; Zhang, Amy; Zhang, Lurong; Okunieff, Paul

    2013-01-01

    In the wake of the 9/11 terrorist attacks and the recent Level 7 nuclear event at the Fukushima Daiichi plant, there has been heightened awareness of the possibility of radiological terrorism and accidents and the need for techniques to estimate radiation levels after such events. A number of approaches to monitoring radiation using biological markers have been published, including physical techniques, cytogenetic approaches, and direct, DNA-analysis approaches. Each approach has the potential to provide information that may be applied to the triage of an exposed population, but problems with development and application of devices or lengthy analyses limit their potential for widespread application. We present a post-irradiation observation with the potential for development into a rapid point-of-care device. Using simple mitochondrial proteomic analysis, we investigated irradiated and nonirradiated murine mitochondria and identified a protein mobility shift occurring at 2-3 Gy. We discuss the implications of this finding both in terms of possible mechanisms and potential applications in bio-radiation monitoring.

  13. Mitochondrial disorders.

    Science.gov (United States)

    Zeviani, M; Tiranti, V; Piantadosi, C

    1998-01-01

    Mitochondrial respiration, the most efficient metabolic pathway devoted to energy production, is at the crosspoint of 2 quite different genetic systems, the nuclear genome and the mitochondrial genome (mitochondrial DNA, mtDNA). The latter encodes a few essential components of the mitochondrial respiratory chain and has unique molecular and genetic properties that account for some of the peculiar features of mitochondrial disorders. However, the perpetuation, propagation, and expression of mtDNA, the majority of the subunits of the respiratory complexes, as well as a number of genes involved in their assembly and turnover, are contained in the nuclear genome. Although mitochondrial disorders have been known for more than 30 years, a major breakthrough in their understanding has come much later, with the discovery of an impressive, ever-increasing number of mutations of mitochondrial DNA. Partial deletions or duplications of mtDNA, or maternally inherited point mutations, have been associated with well-defined clinical syndromes. However, phenotypes transmitted as mendelian traits have also been identified. These include clinical entities defined on the basis of specific biochemical defects, and also a few autosomal dominant or recessive syndromes associated with multiple deletions or tissue-specific depletion of mtDNA. Given the complexity of mitochondrial genetics and biochemistry, the clinical manifestations of mitochondrial disorders are extremely heterogenous. They range from lesions of single tissues or structures, such as the optic nerve in Leber hereditary optic neuropathy or the cochlea in maternally inherited nonsyndromic deafness, to more widespread lesions including myopathies, encephalomyopathies, cardiopathies, or complex multisystem syndromes. The recent advances in genetic studies provide both diagnostic tools and new pathogenetic insights in this rapidly expanding area of human pathology.

  14. Identification of a new hominin bone from Denisova Cave, Siberia using collagen fingerprinting and mitochondrial DNA analysis

    Science.gov (United States)

    Brown, Samantha; Higham, Thomas; Slon, Viviane; Pääbo, Svante; Meyer, Matthias; Douka, Katerina; Brock, Fiona; Comeskey, Daniel; Procopio, Noemi; Shunkov, Michael; Derevianko, Anatoly; Buckley, Michael

    2016-03-01

    DNA sequencing has revolutionised our understanding of archaic humans during the Middle and Upper Palaeolithic. Unfortunately, while many Palaeolithic sites contain large numbers of bones, the majority of these lack the diagnostic features necessary for traditional morphological identification. As a result the recovery of Pleistocene-age human remains is extremely rare. To circumvent this problem we have applied a method of collagen fingerprinting to more than 2000 fragmented bones from the site of Denisova Cave, Russia, in order to facilitate the discovery of human remains. As a result of our analysis a single hominin bone (Denisova 11) was identified, supported through in-depth peptide sequencing analysis, and found to carry mitochondrial DNA of the Neandertal type. Subsequent radiocarbon dating revealed the bone to be >50,000 years old. Here we demonstrate the huge potential collagen fingerprinting has for identifying hominin remains in highly fragmentary archaeological assemblages, improving the resources available for wider studies into human evolution.

  15. Comparative analysis of single nucleotide polymorphisms in the nuclear, chloroplast, and mitochondrial genomes in identification of phylogenetic association among seven melon (Cucumis melo L.) cultivars.

    Science.gov (United States)

    Zhu, Qianglong; Gao, Peng; Liu, Shi; Amanullah, Sikandar; Luan, Feishi

    2016-12-01

    A variety of melons are cultivated worldwide, and their specific biological properties make them an attractive model for molecular studies. This study aimed to investigate the single nucleotide polymorphisms (SNPs) from the mitochondrial, chloroplast, and nuclear genomes of seven melon accessions (Cucumis melo L.) to identify the phylogenetic relationships among melon cultivars with the Illumina HiSeq 2000 platform and bioinformatical analyses. The data showed that there were a total of 658 mitochondrial SNPs (207-295 in each), while there were 0-60 chloroplast SNPs among these seven melon cultivars, compared to the reference genome. Bioinformatical analysis showed that the mitochondrial tree topology was unable to separate the melon features, whereas the maximum parsimony/neighbor joining (MP/NJ) tree of the chloroplast SNPs could define melon features such as seed length, width, thickness, 100-seed weight, and type. SNPs of the nuclear genome were better than the mitochondrial and chloroplast SNPs in the identification of melon features. The data demonstrated the usefulness of mitochondrial, chloroplast, and nuclear SNPs in identification of phylogenetic associations among these seven melon cultivars.

  16. Identifying clinical course patterns in SMS data using cluster analysis

    DEFF Research Database (Denmark)

    Kent, Peter; Kongsted, Alice

    2012-01-01

    ABSTRACT: BACKGROUND: Recently, there has been interest in using the short message service (SMS or text messaging), to gather frequent information on the clinical course of individual patients. One possible role for identifying clinical course patterns is to assist in exploring clinically importa...... of cluster analysis. More research is needed, especially head-to-head studies, to identify which technique is best to use under what circumstances.......ABSTRACT: BACKGROUND: Recently, there has been interest in using the short message service (SMS or text messaging), to gather frequent information on the clinical course of individual patients. One possible role for identifying clinical course patterns is to assist in exploring clinically important...... by spline analysis. However, cluster analysis of SMS data in its original untransformed form may be simpler and offer other advantages. Therefore, the aim of this study was to determine whether cluster analysis could be used for identifying clinical course patterns distinct from the pattern of the whole...

  17. Quantitative analysis of tumor mitochondrial RNA using microarray

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Xiao-Yun Mao; Yan Xin; Shao-Cheng Wang; Jia-Ming Ma; Yu-Jie Zhao

    2005-01-01

    AIM: To design a novel method to rapidly detect the quantitative alteration of mtRNA in patients with tumors.METHODS: Oligo 6.22 and Primer Premier 5.0 bio-soft were used to design 15 pairs of primers of mtRNA cDNA probes in light of the functional and structural property of mtDNA, and then RT-PCR amplification was used to produce 15 probes of mtRNA from one normal gastric mucosal tissue. Total RNA extracted from 9 gastric cancers and corresponding normal gastric mucosal tissues was reverse transcribed into cDNA labeled with fluorescein. The spotted mtDNA microarrays were made and hybridized. Finally,the microarrays were scanned with a GeneTACTM laser scanner to get the hybridized results. Northern blot was used to confirm the microarray results.RESULTS: The hybridized spots were distinct with clear and consistent backgrounds. After data was standardized according to the housekeeping genes, the results showed that the expression levels of some mitochondrial genes in gastric carcinoma were different from those in the corresponding non-cancerous regions.CONCLUSION: The mtDNA expression microarray can rapidly, massively and exactly detect the quantity of mtRNA in tissues and cells. In addition, the whole expressive information of mtRNA from a tumor patient on just one slide can be obtained using this method, providing an effective method to investigate the relationship between mtDNA expression and tumorigenesis.

  18. Cerebrospinal fluid metabolomics identifies a key role of isocitrate dehydrogenase in bipolar disorder: evidence in support of mitochondrial dysfunction hypothesis

    Science.gov (United States)

    Yoshimi, N; Futamura, T; Bergen, S E; Iwayama, Y; Ishima, T; Sellgren, C; Ekman, C J; Jakobsson, J; Pålsson, E; Kakumoto, K; Ohgi, Y; Yoshikawa, T; Landén, M; Hashimoto, K

    2016-01-01

    Although evidence for mitochondrial dysfunction in the pathogenesis of bipolar disorder (BD) has been reported, the precise biological basis remains unknown, hampering the search for novel biomarkers. In this study, we performed metabolomics of cerebrospinal fluid (CSF) from male BD patients (n=54) and age-matched male healthy controls (n=40). Subsequently, post-mortem brain analyses, genetic analyses, metabolomics of CSF samples from rats treated with lithium or valproic acid were also performed. After multivariate logistic regression, isocitric acid (isocitrate) levels were significantly higher in the CSF from BD patients than healthy controls. Furthermore, gene expression of two subtypes (IDH3A and IDH3B) of isocitrate dehydrogenase (IDH) in the dorsolateral prefrontal cortex from BD patients was significantly lower than that of controls, although the expression of other genes including, aconitase (ACO1, ACO2), IDH1, IDH2 and IDH3G, were not altered. Moreover, protein expression of IDH3A in the cerebellum from BD patients was higher than that of controls. Genetic analyses showed that IDH genes (IDH1, IDH2, IDH3A, IDH3B) and ACO genes (ACO1, ACO2) were not associated with BD. Chronic (4 weeks) treatment with lithium or valproic acid in rats did not alter CSF levels of isocitrate, and mRNA levels of Idh3a, Idh3b, Aco1 and Aco2 genes in the rat brain. These findings suggest that abnormality in the metabolism of isocitrate by IDH3A in the mitochondria plays a key role in the pathogenesis of BD, supporting the mitochondrial dysfunction hypothesis of BD. Therefore, IDH3 in the citric acid cycle could potentially be a novel therapeutic target for BD. PMID:26782057

  19. Mitochondrial DNA analysis of Sporothrix schenckii in India, Thailand, Brazil, Colombia, Guatemala and Mexico.

    Science.gov (United States)

    Ishizaki, Hiroshi; Kawasaki, Masako; Anzawa, Kazushi; Mochizuki, Takashi; Chakrabarti, Arunaloke; Ungpakorn, Rataporn; Torres Guererro, Haydee; Toriello, Conchita; Arenas, Robert

    2009-01-01

    Up to now, 30 mitochondrial DNA(mtDNA)and 4 rDNA types of Sporothrix schenckii strains have been identified. Here, seventy-six isolates of S. schenckii from Mexico, Guatemala, Brazil, Thailand and India were genotyped and studied epidemiologically by mtDNA restriction fragment length polymorphisms(RFLP)and internal transcribed spacer region(ITS)-RFLP analysis and two new mtDNA types, Type 31 and Type 32, were found. Type 30, previously reported by Mora-Cabrera et al. was confirmed to be Type 3 and designated as blank. Of 48 isolates from Mexico, 41 belonged to Group A wherein Type 2(13 isolates), Type 3(10)and Type 28(7)were dominant. All ten isolates from India and Thailand belonged to Group B. The 52 Group A and 24 Group B isolates corresponded to rDNA Type I and Type IV , respectively, reported by Watanabe et al.(Nippon Ishinkin Gakkai Zasshi 45: 165-175, 2004).

  20. Tracing the biological origin of animal glues used in paintings through mitochondrial DNA analysis.

    Science.gov (United States)

    Albertini, Emidio; Raggi, Lorenzo; Vagnini, Manuela; Sassolini, Alessandro; Achilli, Alessandro; Marconi, Gianpiero; Cartechini, Laura; Veronesi, Fabio; Falcinelli, Mario; Brunetti, Brunetto Giovanni; Miliani, Costanza

    2011-03-01

    We report the development of a suitable protocol for the identification of the biological origin of binding media on tiny samples from ancient paintings, by exploitation of the high specificity and high sensitivity offered by the state-of-the art DNA analysis. In particular, our aim was to molecularly characterize mitochondrial regions of the animal species traditionally employed for obtaining glues. The model has been developed using aged painting models and then tested to analyze the organic components in samples from the polychrome terracotta Madonna of Citerna by Donatello (1415-1420), where, by GC-MS and FTIR spectroscopy, animal glues and siccative oils were identified. The results obtained are good in terms of both sensibility and specificity of the method. First of all, it was possible to confirm that Donatello used animal glue for the preparation of the painted layers of the Madonna of Citerna and, specifically, glue derived from Bos taurus. Data obtained from sequencing confirm that each sample contains animal glue, revealing that it was mostly prepared from two common European taurine lineages called T2 and T3. There is one remarkable exception represented by one sample which falls into a surviving lineage of the now extinct European aurochs.

  1. Analysis of Mitochondrial Function and Localisation during Human Embryonic Stem Cell Differentiation In Vitro

    Science.gov (United States)

    Prowse, Andrew B. J.; Chong, Fenny; Elliott, David A.; Elefanty, Andrew G.; Stanley, Edouard G.; Gray, Peter P.; Munro, Trent P.; Osborne, Geoffrey W.

    2012-01-01

    Human embryonic stem cell (hESC) derivatives show promise as viable cell therapy options for multiple disorders in different tissues. Recent advances in stem cell biology have lead to the reliable production and detailed molecular characterisation of a range of cell-types. However, the role of mitochondria during differentiation has yet to be fully elucidated. Mitochondria mediate a cells response to altered energy requirements (e.g. cardiomyocyte contraction) and, as such, the mitochondrial phenotype is likely to change during the dynamic process of hESC differentiation. We demonstrate that manipulating mitochondrial biogenesis alters mesendoderm commitment. To investigate mitochondrial localisation during early lineage specification of hESCs we developed a mitochondrial reporter line, KMEL2, in which sequences encoding the green fluorescent protein (GFP) are targeted to the mitochondria. Differentiation of KMEL2 lines into the three germ layers showed that the mitochondria in these differentiated progeny are GFP positive. Therefore, KMEL2 hESCs facilitate the study of mitochondria in a range of cell types and, importantly, permit real-time analysis of mitochondria via the GFP tag. PMID:23284940

  2. Analysis of mitochondrial function and localisation during human embryonic stem cell differentiation in vitro.

    Directory of Open Access Journals (Sweden)

    Andrew B J Prowse

    Full Text Available Human embryonic stem cell (hESC derivatives show promise as viable cell therapy options for multiple disorders in different tissues. Recent advances in stem cell biology have lead to the reliable production and detailed molecular characterisation of a range of cell-types. However, the role of mitochondria during differentiation has yet to be fully elucidated. Mitochondria mediate a cells response to altered energy requirements (e.g. cardiomyocyte contraction and, as such, the mitochondrial phenotype is likely to change during the dynamic process of hESC differentiation. We demonstrate that manipulating mitochondrial biogenesis alters mesendoderm commitment. To investigate mitochondrial localisation during early lineage specification of hESCs we developed a mitochondrial reporter line, KMEL2, in which sequences encoding the green fluorescent protein (GFP are targeted to the mitochondria. Differentiation of KMEL2 lines into the three germ layers showed that the mitochondria in these differentiated progeny are GFP positive. Therefore, KMEL2 hESCs facilitate the study of mitochondria in a range of cell types and, importantly, permit real-time analysis of mitochondria via the GFP tag.

  3. Analysis of sequence variation in Gnathostoma spinigerum mitochondrial DNA by single-strand conformation polymorphism analysis and DNA sequence.

    Science.gov (United States)

    Ngarmamonpirat, Charinthon; Waikagul, Jitra; Petmitr, Songsak; Dekumyoy, Paron; Rojekittikhun, Wichit; Anantapruti, Malinee T

    2005-03-01

    Morphological variations were observed in the advance third stage larvae of Gnathostoma spinigerum collected from swamp eel (Fluta alba), the second intermediate host. Larvae with typical and three atypical types were chosen for partial cytochrome c oxidase subunit I (COI) gene sequence analysis. A 450 bp polymerase chain reaction product of the COI gene was amplified from mitochondrial DNA. The variations were analyzed by single-strand conformation polymorphism and DNA sequencing. The nucleotide variations of the COI gene in the four types of larvae indicated the presence of an intra-specific variation of mitochondrial DNA in the G. spinigerum population.

  4. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.

    Directory of Open Access Journals (Sweden)

    Tyler Mark Pierson

    2011-10-01

    Full Text Available We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7. Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28, a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  5. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.

    Science.gov (United States)

    Pierson, Tyler Mark; Adams, David; Bonn, Florian; Martinelli, Paola; Cherukuri, Praveen F; Teer, Jamie K; Hansen, Nancy F; Cruz, Pedro; Mullikin For The Nisc Comparative Sequencing Program, James C; Blakesley, Robert W; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I; Langer, Thomas; Gahl, William A; Toro, Camilo

    2011-10-01

    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C) gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C) complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  6. The mitochondrial genome of the legume Vigna radiata and the analysis of recombination across short mitochondrial repeats.

    Directory of Open Access Journals (Sweden)

    Andrew J Alverson

    Full Text Available The mitochondrial genomes of seed plants are exceptionally fluid in size, structure, and sequence content, with the accumulation and activity of repetitive sequences underlying much of this variation. We report the first fully sequenced mitochondrial genome of a legume, Vigna radiata (mung bean, and show that despite its unexceptional size (401,262 nt, the genome is unusually depauperate in repetitive DNA and "promiscuous" sequences from the chloroplast and nuclear genomes. Although Vigna lacks the large, recombinationally active repeats typical of most other seed plants, a PCR survey of its modest repertoire of short (38-297 nt repeats nevertheless revealed evidence for recombination across all of them. A set of novel control assays showed, however, that these results could instead reflect, in part or entirely, artifacts of PCR-mediated recombination. Consequently, we recommend that other methods, especially high-depth genome sequencing, be used instead of PCR to infer patterns of plant mitochondrial recombination. The average-sized but repeat- and feature-poor mitochondrial genome of Vigna makes it ever more difficult to generalize about the factors shaping the size and sequence content of plant mitochondrial genomes.

  7. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ

    Science.gov (United States)

    Copeland, William C.; Kasiviswanathan, Rajesh; Longley, Matthew J.

    2016-01-01

    Summary Mitochondrial DNA is replicated by the nuclear encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand crosslinks from chemotherapy agents. Although many of these lesions block DNA replication, Pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by Pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  8. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    Science.gov (United States)

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis.

  9. Characteristics of mitochondrial calpains.

    Science.gov (United States)

    Ozaki, Taku; Tomita, Hiroshi; Tamai, Makoto; Ishiguro, Sei-Ichi

    2007-09-01

    Calpains are considered to be cytoplasmic enzymes, although several studies have shown that calpain-like protease activities also exist in mitochondria. We partially purified mitochondrial calpain from swine liver mitochondria and characterized. Only one type of mitochondrial calpain was detected by the column chromatographies. The mitochondrial calpain was stained with anti-mu-calpain and calpain small subunit antibodies. The susceptibility of mitochondrial calpain to calpain inhibitors and the optimum pH differ from those of cytosolic mu- and m-calpains. The Ca(2+)-dependency of mitochondrial calpain was similar to that of cytosolic mu-calpain. Therefore, we named the protease mitochondrial mu-like calpain. In zymogram analysis, two types of caseinolytic enzymes existed in mitochondria and showed different mobilities from cytosolic mu- and m-calpains. The upper major band was stained with anti-mu-calpain and calpain small subunit antibodies (mitochondrial calpain I, mitochondrial mu-like calpain). The lower band was stained only with anti-calpain small subunit antibody (mitochondrial calpain II, unknown mitochondrial calpain). Calpastatin was not detected in mitochondrial compartments. The mitochondrial calpain processed apoptosis-inducing factor (AIF) to truncated AIF (tAIF), releasing tAIF into the intermembrane space. These results indicate that mitochondrial calpain, which differs from mu- and m-calpains, seems to be a ubiquitous calpain and may play a role in mitochondrial apoptotic signalling.

  10. Mitochondrial DNA analysis of the putative heart of Louis XVII, son of Louis XVI and Marie-Antoinette.

    Science.gov (United States)

    Jehaes, E; Pfeiffer, H; Toprak, K; Decorte, R; Brinkmann, B; Cassiman, J J

    2001-03-01

    According to official historiography, the 10-year-old Louis XVII died in the Temple of Paris on June 8, 1795. However, public rumour spread the theory that Louis XVII escaped and that his descendants would be alive today. One such putative 'Louis XVII' was Carl Wilhelm Naundorff, who died in 1845 in Delft (the Netherlands). Comparative mitochondrial DNA (mtDNA) analysis gave evidence that his remains could not be identified as those of Louis XVII. In the present study, mtDNA analysis was performed on the heart of the young boy who died in the prison of Paris in 1795. In order to obtain the strongest evidence possible, two laboratories independently analysed the heart. The results showed that the consensus mtDNA sequence of the heart was identical to that of the maternal relatives of Louis XVII.

  11. Implementation of DNA Mitochondrial Analysis in Rhinoclemmys nasuta (Testudines: Geoemydidae

    Directory of Open Access Journals (Sweden)

    Yherson Franchesco Molina Henao

    2014-05-01

    Full Text Available Rhinoclemmys nasuta (Testudines:Geoemydidae is considered an almost endemic specie to Colombia and the most primitive species of Rhynoclemmys. However, it is classified data deficient by IUCN because the available information is not enough to make a direct or indirect assessment of its extinction risk. Here, we describe the implementation of the method to analyze the mitochondrial DNA control sequence (mtDNA of R. nasuta in order to generate tools for future studies in systematics and population conservation. Genomic mtDNA was extracted by salting-out from blood samples from Isla Palma and Playa Chucheros (Bahía Málaga - Colombian Pacific Coast. The polymerase reaction chain (PCR was performed using a pair of degenerate primers (reported for Chrysemys picta, Testudines:Emydidae in polyacrylamide gel stained with silver nitrate. Fragments of 800pb were obtained and the sequencing reaction was effective.High homology percentage (> 92 % was established between the obtained sequences with mtDNA sequences from two species of Geoemydidae, Sacalia quadriocellata and Cuora aurocapitata which are deposited in the GenBank. This demonstrate an effective sequencing ofthe mtDNA control region of R. nasuta.IMPLEMENTACIÓN DE LA METODOLOGÍA DE ANÁLISIS DE ADN MITOCONDRIAL EN Rhinoclemmys nasuta (TESTUDINES:GEOEMYDIDAERhinoclemmys nasuta (Testudines: Geoemydidae es considerada una especie casi endémica de Colombia y la más primitiva del género, sin embargo, se encuentra clasificada por la IUCN como deficiente de datos, ya que la información disponible no es suficiente para hacer una evaluación directa o indirecta de su riesgo de extinción. Con el propósito de generar herramientas de análisis poblacional se describe la metodología de secuenciación de la región control del ADN mitocondrial (ADNmt para el análisis genético de poblaciones de Rhinoclemmys nasuta, que permita establecer bases para futuros estudios evolutivos y de conservación. Se

  12. Analysis of regulatory protease sequences identified through bioinformatic data mining of the Schistosoma mansoni genome

    Directory of Open Access Journals (Sweden)

    Minchella Dennis J

    2009-10-01

    Full Text Available Abstract Background New chemotherapeutic agents against Schistosoma mansoni, an etiological agent of human schistosomiasis, are a priority due to the emerging drug resistance and the inability of current drug treatments to prevent reinfection. Proteases have been under scrutiny as targets of immunological or chemotherapeutic anti-Schistosoma agents because of their vital role in many stages of the parasitic life cycle. Function has been established for only a handful of identified S. mansoni proteases, and the vast majority of these are the digestive proteases; very few of the conserved classes of regulatory proteases have been identified from Schistosoma species, despite their vital role in numerous cellular processes. To that end, we identified protease protein coding genes from the S. mansoni genome project and EST library. Results We identified 255 protease sequences from five catalytic classes using predicted proteins of the S. mansoni genome. The vast majority of these show significant similarity to proteins in KEGG and the Conserved Domain Database. Proteases include calpains, caspases, cytosolic and mitochondrial signal peptidases, proteases that interact with ubiquitin and ubiquitin-like molecules, and proteases that perform regulated intramembrane proteolysis. Comparative analysis of classes of important regulatory proteases find conserved active site domains, and where appropriate, signal peptides and transmembrane helices. Phylogenetic analysis provides support for inferring functional divergence among regulatory aspartic, cysteine, and serine proteases. Conclusion Numerous proteases are identified for the first time in S. mansoni. We characterized important regulatory proteases and focus analysis on these proteases to complement the growing knowledge base of digestive proteases. This work provides a foundation for expanding knowledge of proteases in Schistosoma species and examining their diverse function and potential as targets

  13. BIOELECTRICAL IMPEDANCE VECTOR ANALYSIS IDENTIFIES SARCOPENIA IN NURSING HOME RESIDENTS

    Science.gov (United States)

    Loss of muscle mass and water shifts between body compartments are contributing factors to frailty in the elderly. The body composition changes are especially pronounced in institutionalized elderly. We investigated the ability of single-frequency bioelectrical impedance analysis (BIA) to identify b...

  14. Identifying subgroups of patients using latent class analysis

    DEFF Research Database (Denmark)

    Nielsen, Anne Mølgaard; Kent, Peter; Hestbæk, Lise

    2017-01-01

    BACKGROUND: Heterogeneity in patients with low back pain (LBP) is well recognised and different approaches to subgrouping have been proposed. Latent Class Analysis (LCA) is a statistical technique that is increasingly being used to identify subgroups based on patient characteristics. However, as ...

  15. Comparative analysis of mitochondrial genomes of five aphid species (Hemiptera: Aphididae and phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    Full Text Available Insect mitochondrial genomes (mitogenomes are of great interest in exploring molecular evolution, phylogenetics and population genetics. Only two mitogenomes have been previously released in the insect group Aphididae, which consists of about 5,000 known species including some agricultural, forestry and horticultural pests. Here we report the complete 16,317 bp mitogenome of Cavariella salicicola and two nearly complete mitogenomes of Aphis glycines and Pterocomma pilosum. We also present a first comparative analysis of mitochondrial genomes of aphids. Results showed that aphid mitogenomes share conserved genomic organization, nucleotide and amino acid composition, and codon usage features. All 37 genes usually present in animal mitogenomes were sequenced and annotated. The analysis of gene evolutionary rate revealed the lowest and highest rates for COI and ATP8, respectively. A unique repeat region exclusively in aphid mitogenomes, which included variable numbers of tandem repeats in a lineage-specific manner, was highlighted for the first time. This region may have a function as another origin of replication. Phylogenetic reconstructions based on protein-coding genes and the stem-loop structures of control regions confirmed a sister relationship between Cavariella and pterocommatines. Current evidence suggest that pterocommatines could be formally transferred into Macrosiphini. Our paper also offers methodological instructions for obtaining other Aphididae mitochondrial genomes.

  16. [Chronic progressive external ophthalmoplegia with mitochondrial anomalies. Clinical, histological, biochemical and genetic analysis (9 cases)].

    Science.gov (United States)

    Drouet, A

    1996-01-01

    We report the clinical signs and histological findings in nine patients with mitochondrial ocular myopathies. There were four males and five females. Of age ranging from 47 to 82 years. A more often asymetrical ptosis was in all cases of chronic progressive external ophtalmoplegia (CPEO), but muscle weakness in limbs was not usual. The prognosis in this group was good, but ubidecarenone (150 mg/d) used for two cases, did not improve ophtalmoplegia. The serum creatine kinase was normal in eight of nine cases and electromyography showed myopathic changes in three cases. Histoenzymatic analysis of the muscle biopsy and biochemical studies of mitochondria isolated from the muscle sample demonstrated mitochondrial myopathy associated with partial deficiency of complexes I and/or IV of the electron transfer chain. One of seven patients studied had single deletion by Southern blot analysis, in a heteroplasmic state and another an A-->G transition at position 3243 within the mitochondrial tRNA leu (UUR) gene. Chronic progressive external ophtalmoplegia, without large deletion, may have abnormality in other coding regions of mt DNA such as tRNA, rRNA or protein genes.

  17. Meta-Analysis of Mitochondrial DNA Variation in the Iberian Peninsula

    Science.gov (United States)

    Barral-Arca, Ruth; Pischedda, Sara; Gómez-Carballa, Alberto; Pastoriza, Ana; Mosquera-Miguel, Ana; López-Soto, Manuel; Martinón-Torres, Federico; Álvarez-Iglesias, Vanesa; Salas, Antonio

    2016-01-01

    The Iberian Peninsula has been the focus of attention of numerous studies dealing with mitochondrial DNA (mtDNA) variation, most of them targeting the control region segment. In the present study we sequenced the control region of 3,024 Spanish individuals from areas where available data were still limited. We also compiled mtDNA haplotypes from the literature involving 4,588 sequences and 28 population groups or small regions. We meta-analyzed all these data in order to shed further light on patterns of geographic variation, taking advantage of the large sample size and geographic coverage, in contrast with the atomized sampling strategy of previous work. The results indicate that the main mtDNA haplogroups show primarily clinal geographic patterns across the Iberian geography, roughly along a North-South axis. Haplogroup HV0 (where haplogroup U is nested) is more prevalent in the Franco Cantabrian region, in good agreement with previous findings that identified this area as a climate refuge during the Last Glacial Maximum (LGM), prior to a subsequent demographic re-expansion towards Central Europe and the Mediterranean. Typical sub-Saharan and North African lineages are slightly more prevalent in South Iberia, although at low frequencies; this pattern has been shaped mainly by the transatlantic slave trade and the Arab invasion of the Iberian Peninsula. The results also indicate that summary statistics that aim to measure molecular variation, or AMOVA, have limited sensitivity to detect population substructure, in contrast to patterns revealed by phylogeographic analysis. Overall, the results suggest that mtDNA variation in Iberia is substantially stratified. These patterns might be relevant in biomedical studies given that stratification is a common cause of false positives in case-control mtDNA association studies, and should be also considered when weighting the DNA evidence in forensic casework, which is strongly dependent on haplotype frequencies. PMID

  18. Identifying glioblastoma gene networks based on hypergeometric test analysis.

    Directory of Open Access Journals (Sweden)

    Vasileios Stathias

    Full Text Available Patient specific therapy is emerging as an important possibility for many cancer patients. However, to identify such therapies it is essential to determine the genomic and transcriptional alterations present in one tumor relative to control samples. This presents a challenge since use of a single sample precludes many standard statistical analysis techniques. We reasoned that one means of addressing this issue is by comparing transcriptional changes in one tumor with those observed in a large cohort of patients analyzed by The Cancer Genome Atlas (TCGA. To test this directly, we devised a bioinformatics pipeline to identify differentially expressed genes in tumors resected from patients suffering from the most common malignant adult brain tumor, glioblastoma (GBM. We performed RNA sequencing on tumors from individual GBM patients and filtered the results through the TCGA database in order to identify possible gene networks that are overrepresented in GBM samples relative to controls. Importantly, we demonstrate that hypergeometric-based analysis of gene pairs identifies gene networks that validate experimentally. These studies identify a putative workflow for uncovering differentially expressed patient specific genes and gene networks for GBM and other cancers.

  19. Strokes in mitochondrial diseases

    Directory of Open Access Journals (Sweden)

    N V Pizova

    2012-01-01

    Full Text Available It is suggested that mitochondrial diseases might be identified in 22—33% of cryptogenic stroke cases in young subjects. The incidence of mitochondrial disorders in patients with stroke is unknown; it is 0.8 to 7.2% according to the data of some authors. The paper gives data on the prevalence, pathogenesis, and clinical manifestations of mitochondrial diseases, such as mitochondrial encephalopathy, lactic acidosis, and stroke-like syndrome (MELAS and insulin-like episodes; myoclonic epilepsy and ragged-red fibers (MERRF syndrome, and Kearns-Sayre syndrome (sporadic multisystem mitochondrial pathology.

  20. Analysis of Mitochondrial DNA from the Ancient Tombs of Turfan

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    MtDNA was successfully extracted from ten individual bones (femurs) in the tombs of ancient Jushi in Turfan basin, dated back to the year about 3 000-2 500 years ago. By means of four overlapping primers, we got nucleotide sequence of the 218bp length. Ancient mtDNA was analyzed by the sequencing of hypervariable region Ⅰ of the mtDNA control region. The result shows that 9 haplotypes with 24 polymorphic sites were obtained. The phylogenetic analysis indicated that Mongolians and Altai are the population genetically closest to the Jushi groups and Jushi mtDNA pool being an admixture of eastern Asian and European lineages. So our preliminary data imply that an ancient mingling of Euro-Asian population had existed in Turfan basin prior to the early Iron Age.

  1. [Mitochondrial genome analysis in the probands of six Chinese families with MELAS].

    Science.gov (United States)

    Liu, Li; Yuquan, Shao; Baorong, Zhang; Pingping, Jiang; Ailian, Du; Minxin, Guan

    2014-11-01

    Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS) is a genetically heterogeneous disorder. The most prevalent mitochondrial DNA (mtDNA) mutation associated with MELAS is the m.3243A>G transition in the mitochondrial tRNA(Leu(UUR)) gene. Here, we report the clinical, genetic and molecular characterization of six probands from Han Chinese families with MELAS. Four of six probands carried the heteroplasmic m.3243A>G mutation. The levels of mutation load ranged from 29% to 59%, which were correlated with the severity of the clinical phenotypes. Two probands with MELAS/Leigh overlap were 3243 A>G negative, whose severity and relapse were greater than the other 4 probands. One proband with MELAS/Leigh harbored the known ND5 m.13094T>C mutation, which is related to MELAS/Leigh overlap and cerebella ataxia. Sequence analysis of entire mtDNA showed the distinct sets of variants including some variants that may be associated with diabetes, hearing loss, seizures, cardiomyopathy, and Leigh syndrome. Our data suggested that the phenotype and severity of MELAS mainly depend on the mutation load, and some variants may partially contribute to the phenotype and diversity. Our finding also highlighted the complexity of the relationship between genotype and phenotype in MELAS.

  2. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  3. Large-scale mitochondrial DNA analysis of the domestic goat reveals six haplogroups with high diversity.

    Directory of Open Access Journals (Sweden)

    Saeid Naderi

    Full Text Available BACKGROUND: From the beginning of domestication, the transportation of domestic animals resulted in genetic and demographic processes that explain their present distribution and genetic structure. Thus studying the present genetic diversity helps to better understand the history of domestic species. METHODOLOGY/PRINCIPAL FINDINGS: The genetic diversity of domestic goats has been characterized with 2430 individuals from all over the old world, including 946 new individuals from regions poorly studied until now (mainly the Fertile Crescent. These individuals represented 1540 haplotypes for the HVI segment of the mitochondrial DNA (mtDNA control region. This large-scale study allowed the establishment of a clear nomenclature of the goat maternal haplogroups. Only five of the six previously defined groups of haplotypes were divergent enough to be considered as different haplogroups. Moreover a new mitochondrial group has been localized around the Fertile Crescent. All groups showed very high haplotype diversity. Most of this diversity was distributed among groups and within geographic regions. The weak geographic structure may result from the worldwide distribution of the dominant A haplogroup (more than 90% of the individuals. The large-scale distribution of other haplogroups (except one, may be related to human migration. The recent fragmentation of local goat populations into discrete breeds is not detectable with mitochondrial markers. The estimation of demographic parameters from mismatch analyses showed that all groups had a recent demographic expansion corresponding roughly to the period when domestication took place. But even with a large data set it remains difficult to give relative dates of expansion for different haplogroups because of large confidence intervals. CONCLUSIONS/SIGNIFICANCE: We propose standard criteria for the definition of the different haplogroups based on the result of mismatch analysis and on the use of sequences of

  4. Altered expression of mitochondrial related genes in the native Tibetan placents by mitochondrial cDNA array analysis

    Institute of Scientific and Technical Information of China (English)

    Luo Yongjun; Gao Wenxiang; Zhao Xiuxin; Suo Lang; Chen Li; Liu Fuyu; Song Tonglin; Chen Jian; Gao Yuqi

    2009-01-01

    Objective: To explore the mechanism of native Tibetan fetuses adaptation to hypoxia, we tried to find the different expression genes about mitochondrial function in the native Tibetan placents. Methods: In this study, the placents of native Tibetan and the high-altitude Han (ha-Han) were collected. After the total RNA extraction, the finally synthesized cDNAs were hybridized to mitochondrial array to find the altered expression genes between them. Then, the cytochrome c oxidase 17 (Coxl7), dynactin 2 (DCTN2, also known as p50), and vascular endothelial growth factor receptor (VEGFR, also known as KDR) were chosen from the altered expression genes to further verify the array results using the SYBR Green real-time PCR. Because the altered expression genes (such as Cybb and Coxl 7) in the array results related to the activities of COXI and COXIV, the placental mitochondria activities of COXI and COXIV were measured to find their changes in the hypoxia. Results: By a standard of >1.5 or <0.67, there were 24 different expressed genes between the native Tibetan and the ha-Han placents, including 3 up-regulated genes and 21 down-regulated genes. These genes were related to energy metabolism, signal transduction, cell proliferation, electron transport, cell adhesion, nucleotide-excision repair. The array results of Coxl7, DCTN2 and KDR were further verified by the real-time RT-PCR. Through the mitochondria respiration measurements, the activity of COXI in the native Tibetan placents were higher than that of ha-Han, there was no difference in COXIV activity between them. Conclusion: The altered mitochondrial related genes in the native Tibetan placents may have a role in the high altitude adaptation for fetuses through changing the activity of mitochondrial COX.

  5. Identifying influential factors of business process performance using dependency analysis

    Science.gov (United States)

    Wetzstein, Branimir; Leitner, Philipp; Rosenberg, Florian; Dustdar, Schahram; Leymann, Frank

    2011-02-01

    We present a comprehensive framework for identifying influential factors of business process performance. In particular, our approach combines monitoring of process events and Quality of Service (QoS) measurements with dependency analysis to effectively identify influential factors. The framework uses data mining techniques to construct tree structures to represent dependencies of a key performance indicator (KPI) on process and QoS metrics. These dependency trees allow business analysts to determine how process KPIs depend on lower-level process metrics and QoS characteristics of the IT infrastructure. The structure of the dependencies enables a drill-down analysis of single factors of influence to gain a deeper knowledge why certain KPI targets are not met.

  6. Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.

    Directory of Open Access Journals (Sweden)

    Jeban Ganesalingam

    Full Text Available BACKGROUND: Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes. METHODS: Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method. RESULTS: The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001. CONCLUSION: The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.

  7. Assessing Mitochondrial DNA Variation and Copy Number in Lymphocytes of ~2,000 Sardinians Using Tailored Sequencing Analysis Tools.

    Directory of Open Access Journals (Sweden)

    Jun Ding

    2015-07-01

    Full Text Available DNA sequencing identifies common and rare genetic variants for association studies, but studies typically focus on variants in nuclear DNA and ignore the mitochondrial genome. In fact, analyzing variants in mitochondrial DNA (mtDNA sequences presents special problems, which we resolve here with a general solution for the analysis of mtDNA in next-generation sequencing studies. The new program package comprises 1 an algorithm designed to identify mtDNA variants (i.e., homoplasmies and heteroplasmies, incorporating sequencing error rates at each base in a likelihood calculation and allowing allele fractions at a variant site to differ across individuals; and 2 an estimation of mtDNA copy number in a cell directly from whole-genome sequencing data. We also apply the methods to DNA sequence from lymphocytes of ~2,000 SardiNIA Project participants. As expected, mothers and offspring share all homoplasmies but a lesser proportion of heteroplasmies. Both homoplasmies and heteroplasmies show 5-fold higher transition/transversion ratios than variants in nuclear DNA. Also, heteroplasmy increases with age, though on average only ~1 heteroplasmy reaches the 4% level between ages 20 and 90. In addition, we find that mtDNA copy number averages ~110 copies/lymphocyte and is ~54% heritable, implying substantial genetic regulation of the level of mtDNA. Copy numbers also decrease modestly but significantly with age, and females on average have significantly more copies than males. The mtDNA copy numbers are significantly associated with waist circumference (p-value = 0.0031 and waist-hip ratio (p-value = 2.4×10-5, but not with body mass index, indicating an association with central fat distribution. To our knowledge, this is the largest population analysis to date of mtDNA dynamics, revealing the age-imposed increase in heteroplasmy, the relatively high heritability of copy number, and the association of copy number with metabolic traits.

  8. The recovery and analysis of mitochondrial DNA from exploded pipe bombs.

    Science.gov (United States)

    Foran, David R; Gehring, Michael E; Stallworth, Shawn E

    2009-01-01

    Improvised explosive devices (IEDs) represent one of the most common modes of arbitrarily injuring or killing human beings. Because of the heat generated by, and destruction to, an IED postconflagration, most methods for identifying who assembled the device are ineffective. In the research presented, steel pipe bombs were mock-assembled by volunteers, and the bombs detonated under controlled conditions. The resultant shrapnel was collected and swabbed for residual cellular material. Mitochondrial DNA profiles were generated and compared blind to the pool of individuals who assembled the bombs. Assemblers were correctly identified 50% of the time, while another 19% could be placed into a group of three individuals with shared haplotypes. Only one bomb was assigned incorrectly. In some instances a contaminating profile (mixture) was also observed. Taken together, the results speak to the extreme sensitivity the methods have for identifying those who assemble IEDs, along with precautions needed when collecting and processing such evidence.

  9. Unraveling Biochemical Pathways Affected by Mitochondrial Dysfunctions Using Metabolomic Approaches

    Science.gov (United States)

    Demine, Stéphane; Reddy, Nagabushana; Renard, Patricia; Raes, Martine; Arnould, Thierry

    2014-01-01

    Mitochondrial dysfunction(s) (MDs) can be defined as alterations in the mitochondria, including mitochondrial uncoupling, mitochondrial depolarization, inhibition of the mitochondrial respiratory chain, mitochondrial network fragmentation, mitochondrial or nuclear DNA mutations and the mitochondrial accumulation of protein aggregates. All these MDs are known to alter the capacity of ATP production and are observed in several pathological states/diseases, including cancer, obesity, muscle and neurological disorders. The induction of MDs can also alter the secretion of several metabolites, reactive oxygen species production and modify several cell-signalling pathways to resolve the mitochondrial dysfunction or ultimately trigger cell death. Many metabolites, such as fatty acids and derived compounds, could be secreted into the blood stream by cells suffering from mitochondrial alterations. In this review, we summarize how a mitochondrial uncoupling can modify metabolites, the signalling pathways and transcription factors involved in this process. We describe how to identify the causes or consequences of mitochondrial dysfunction using metabolomics (liquid and gas chromatography associated with mass spectrometry analysis, NMR spectroscopy) in the obesity and insulin resistance thematic. PMID:25257998

  10. Unraveling Biochemical Pathways Affected by Mitochondrial Dysfunctions Using Metabolomic Approaches

    Directory of Open Access Journals (Sweden)

    Stéphane Demine

    2014-09-01

    Full Text Available Mitochondrial dysfunction(s (MDs can be defined as alterations in the mitochondria, including mitochondrial uncoupling, mitochondrial depolarization, inhibition of the mitochondrial respiratory chain, mitochondrial network fragmentation, mitochondrial or nuclear DNA mutations and the mitochondrial accumulation of protein aggregates. All these MDs are known to alter the capacity of ATP production and are observed in several pathological states/diseases, including cancer, obesity, muscle and neurological disorders. The induction of MDs can also alter the secretion of several metabolites, reactive oxygen species production and modify several cell-signalling pathways to resolve the mitochondrial dysfunction or ultimately trigger cell death. Many metabolites, such as fatty acids and derived compounds, could be secreted into the blood stream by cells suffering from mitochondrial alterations. In this review, we summarize how a mitochondrial uncoupling can modify metabolites, the signalling pathways and transcription factors involved in this process. We describe how to identify the causes or consequences of mitochondrial dysfunction using metabolomics (liquid and gas chromatography associated with mass spectrometry analysis, NMR spectroscopy in the obesity and insulin resistance thematic.

  11. Analysis of the mitochondrial genome of cheetahs (Acinonyx jubatus) with neurodegenerative disease.

    Science.gov (United States)

    Burger, Pamela A; Steinborn, Ralf; Walzer, Christian; Petit, Thierry; Mueller, Mathias; Schwarzenberger, Franz

    2004-08-18

    The complete mitochondrial genome of Acinonyx jubatus was sequenced and mitochondrial DNA (mtDNA) regions were screened for polymorphisms as candidates for the cause of a neurodegenerative demyelinating disease affecting captive cheetahs. The mtDNA reference sequences were established on the basis of the complete sequences of two diseased and two nondiseased animals as well as partial sequences of 26 further individuals. The A. jubatus mitochondrial genome is 17,047-bp long and shows a high sequence similarity (91%) to the domestic cat. Based on single nucleotide polymorphisms (SNPs) in the control region (CR) and pedigree information, the 18 myelopathic and 12 non-myelopathic cheetahs included in this study were classified into haplotypes I, II and III. In view of the phenotypic comparability of the neurodegenerative disease observed in cheetahs and human mtDNA-associated diseases, specific coding regions including the tRNAs leucine UUR, lysine, serine UCN, and partial complex I and V sequences were screened. We identified a heteroplasmic and a homoplasmic SNP at codon 507 in the subunit 5 (MTND5) of complex I. The heteroplasmic haplotype I-specific valine to methionine substitution represents a nonconservative amino acid change and was found in 11 myelopathic and eight non-myelopathic cheetahs with levels ranging from 29% to 79%. The homoplasmic conservative amino acid substitution valine to alanine was identified in two myelopathic animals of haplotype II. In addition, a synonymous SNP in the codon 76 of the MTND4L gene was found in the single haplotype III animal. The amino acid exchanges in the MTND5 gene were not associated with the occurrence of neurodegenerative disease in captive cheetahs.

  12. Identifying Organizational Inefficiencies with Pictorial Process Analysis (PPA

    Directory of Open Access Journals (Sweden)

    David John Patrishkoff

    2013-11-01

    Full Text Available Pictorial Process Analysis (PPA was created by the author in 2004. PPA is a unique methodology which offers ten layers of additional analysis when compared to standard process mapping techniques.  The goal of PPA is to identify and eliminate waste, inefficiencies and risk in manufacturing or transactional business processes at 5 levels in an organization. The highest level being assessed is the process management, followed by the process work environment, detailed work habits, process performance metrics and general attitudes towards the process. This detailed process assessment and analysis is carried out during process improvement brainstorming efforts and Kaizen events. PPA creates a detailed visual efficiency rating for each step of the process under review.  A selection of 54 pictorial Inefficiency Icons (cards are available for use to highlight major inefficiencies and risks that are present in the business process under review. These inefficiency icons were identified during the author's independent research on the topic of why things go wrong in business. This paper will highlight how PPA was developed and show the steps required to conduct Pictorial Process Analysis on a sample manufacturing process. The author has successfully used PPA to dramatically improve business processes in over 55 different industries since 2004.  

  13. Phylogenetics and Srf Analysis of Mitochondrial DNA COII Gene in Anopheles Species (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Monika Sharma

    2011-07-01

    Full Text Available Mitochondrial DNA COII gene was used to study the interspecific variation and molecular analysis among six species of genus Anopheles belonging to subgenus Cellia i.e. An. stephensi, An. culicifacies, An. maculatus, An. subpictus, An. annularis and An. splendidus. The sequence was found to be AT rich with maximum of 75.07% in An. culicifacies. The sequence analysis revealed the number of transversions to be more than transitions which is opposite of the general contention with transitions being more frequent than transversions in mitochondrial genes. However, among the Anopheles species, the maximum number of substitutions was found in An. maculatus. The phylogenetic analysis using the three methods MP, ML and NJ methods was also carried out for which Cx. quinquefasciatus was taken as outgroup. Analysis showed that An. stephensi and An. culicifacies shared a close genetic homology while An. annularis and An. splendidus made another group with identical genetic qualities. To the contrary, An. subpictus and An. maculatus had hypervariable non-homologous genomic qualities. Short tandem as well as nontandem repeats were also studied using SRF (Spectral Repeat Finder programme. The repeats were conserved in all the species except certain polymorphic repeats such as TAT and TTTAT were present in An. stephensi whereas no polymorphic repeats were present in An. subpictus. Identification of repeats is crucial to shed light on the function and structure of proteins, and explain their evolutionary past.

  14. Phylogenetic relationships of some Microsporum and Arthroderma species inferred from mitochondrial DNA analysis.

    Science.gov (United States)

    Kawasaki, M; Aoki, M; Ishizaki, H

    1995-01-01

    Thirty-eight strains of 12 Microsporum and 10 Arthroderma (Nannizzia) species were investigated by analysis of mitochondrial DNA with 6 restriction enzymes, and classified into 13 genetic groups. The phylogenetic tree of the 13 groups thus established was constructed. On the tree, M. audouinii, M. langeronii, M. rivalieri, M. distortum, M. equinum, M. ferrugineum and A. otae comprise one genetic group and are suggested to be the same species. A. gypseum, A. fulvum, M. duboisii, M. ripariae, A. incurvatum, A. persicolor and A. obtusum are clustered on one of five boughs of the tree indicating their close relation. A. racemosum and A. cajetani are also closely related.

  15. Statistical analysis of post mortem DNA damage-derived miscoding lesions in Neandertal mitochondrial DNA

    OpenAIRE

    Vives, Sergi; Gilbert, Thomas; Arenas, Conchita; Gigli, Elena, 1978-; Lao Grueso, Oscar; Lalueza-Fox, Carles

    2008-01-01

    textabstractBackground. We have analysed the distribution of post mortem DNA damage derived miscoding lesions from the datasets of seven published Neandertal specimens that have extensive cloned sequence coverage over the mitochondrial DNA (mtDNA) hypervariable region 1 (HVS1). The analysis was restricted to C → T and G → A miscoding lesions (the predominant manifestation of post mortem damage) that are seen at a frequency of more than one clone among sequences from a single PCR, but do not r...

  16. The complete mitochondrial genome of the Senegal sole, Solea senegalensis Kaup. Comparative analysis of tandem repeats in the control region among soles.

    Science.gov (United States)

    Manchado, Manuel; Catanese, Gaetano; Ponce, Marian; Funes, Victoria; Infante, Carlos

    2007-06-01

    The complete nucleotide sequence of the mitochondrial genome for the Senegal sole Solea senegalensis Kaup was determined. The mitochondrial DNA was 16,659 base pairs (bp) in length. Sequence features of the 13 protein-coding genes, two ribosomal RNAs and 22 transfer RNAs are described. The non-coding control region (1017 bp) was compared with those of the closely related soles Solea solea and Solea lascaris. The typical conservative blocks were identified. A cluster of 42 and 22 tandemly arrayed repeats was detected near the 3' end of control region in S. solea and S. lascaris, respectively. On the contrary, only two (93.8% of haplotypes) or three copies (6.2%) of an 8-bp repeated sequence motif was found in S. senegalensis. Phylogenetic analysis showed that 7 out of 9 of haplotypes bearing three copies grouped in a separate cluster. Possible mechanisms influencing the evolution of control region among soles are discussed.

  17. Mitochondrial genome organization and phylogeny of two vespid wasps.

    Science.gov (United States)

    Cameron, Stephen L; Dowton, Mark; Castro, Lyda R; Ruberu, Kalani; Whiting, Michael F; Austin, Andy D; Diement, Kieren; Stevens, Julia

    2008-10-01

    We sequenced the entire mitochondrial genome of Abispa ephippium (Hymenoptera: Vespoidea: Vespidae: Eumeninae) and most of the mitochondrial genome of Polistes humilis synoecus (Hymenoptera: Vespoidea: Vespidae: Polistinae). The arrangement of genes differed between the two genomes and also differed slightly from that inferred to be ancestral for the Hymenoptera. The genome organization for both vespids is different from that of all other mitochondrial genomes previously reported. A number of tRNA gene rearrangements were identified that represent potential synapomorphies for a subset of the Vespidae. Analysis of all available hymenopteran mitochondrial genome sequences recovered an uncontroversial phylogeny, one consistent with analyses of other types of data.

  18. Comparative analysis of human mitochondrial DNA from World War I bone samples by DNA sequencing and ESI-TOF mass spectrometry.

    Science.gov (United States)

    Howard, Rebecca; Encheva, Vesela; Thomson, Jim; Bache, Katherine; Chan, Yuen-Ting; Cowen, Simon; Debenham, Paul; Dixon, Alan; Krause, Jens-Uwe; Krishan, Elaina; Moore, Daniel; Moore, Victoria; Ojo, Michael; Rodrigues, Sid; Stokes, Peter; Walker, James; Zimmermann, Wolfgang; Barallon, Rita

    2013-01-01

    Mitochondrial DNA is commonly used in identity testing for the analysis of old or degraded samples or to give evidence of familial links. The Abbott T5000 mass spectrometry platform provides an alternative to the more commonly used Sanger sequencing for the analysis of human mitochondrial DNA. The robustness of the T5000 system has previously been demonstrated using DNA extracted from volunteer buccal swabs but the system has not been tested using more challenging sample types. For mass spectrometry to be considered as a valid alternative to Sanger sequencing it must also be demonstrated to be suitable for use with more limiting sample types such as old teeth, bone fragments, and hair shafts. In 2009 the Commonwealth War Graves Commission launched a project to identify the remains of 250 World War I soldiers discovered in a mass grave in Fromelles, France. This study characterises the performance of both Sanger sequencing and the T5000 platform for the analysis of the mitochondrial DNA extracted from 225 of these remains, both in terms of the ability to amplify and characterise DNA regions of interest and the relative information content and ease-of-use associated with each method.

  19. Rice Transcriptome Analysis to Identify Possible Herbicide Quinclorac Detoxification Genes

    Directory of Open Access Journals (Sweden)

    Wenying eXu

    2015-09-01

    Full Text Available Quinclorac is a highly selective auxin-type herbicide, and is widely used in the effective control of barnyard grass in paddy rice fields, improving the world’s rice yield. The herbicide mode of action of quinclorac has been proposed and hormone interactions affect quinclorac signaling. Because of widespread use, quinclorac may be transported outside rice fields with the drainage waters, leading to soil and water pollution and environmental health problems.In this study, we used 57K Affymetrix rice whole-genome array to identify quinclorac signaling response genes to study the molecular mechanisms of action and detoxification of quinclorac in rice plants. Overall, 637 probe sets were identified with differential expression levels under either 6 or 24 h of quinclorac treatment. Auxin-related genes such as GH3 and OsIAAs responded to quinclorac treatment. Gene Ontology analysis showed that genes of detoxification-related family genes were significantly enriched, including cytochrome P450, GST, UGT, and ABC and drug transporter genes. Moreover, real-time RT-PCR analysis showed that top candidate P450 families such as CYP81, CYP709C and CYP72A genes were universally induced by different herbicides. Some Arabidopsis genes for the same P450 family were up-regulated under quinclorac treatment.We conduct rice whole-genome GeneChip analysis and the first global identification of quinclorac response genes. This work may provide potential markers for detoxification of quinclorac and biomonitors of environmental chemical pollution.

  20. Identifying Sources of Difference in Reliability in Content Analysis

    Directory of Open Access Journals (Sweden)

    Elizabeth Murphy

    2005-07-01

    Full Text Available This paper reports on a case study which identifies and illustrates sources of difference in agreement in relation to reliability in a context of quantitative content analysis of a transcript of an online asynchronous discussion (OAD. Transcripts of 10 students in a month-long online asynchronous discussion were coded by two coders using an instrument with two categories, five processes, and 19 indicators of Problem Formulation and Resolution (PFR. Sources of difference were identified in relation to: coders; tasks; and students. Reliability values were calculated at the levels of categories, processes, and indicators. At the most detailed level of coding on the basis of the indicator, findings revealed that the overall level of reliability between coders was .591 when measured with Cohen’s kappa. The difference between tasks at the same level ranged from .349 to .664, and the difference between participants ranged from .390 to .907. Implications for training and research are discussed.

  1. Proteogenomic Analysis Identifies a Novel Human SHANK3 Isoform

    Directory of Open Access Journals (Sweden)

    Fahad Benthani

    2015-05-01

    Full Text Available Mutations of the SHANK3 gene have been associated with autism spectrum disorder. Individuals harboring different SHANK3 mutations display considerable heterogeneity in their cognitive impairment, likely due to the high SHANK3 transcriptional diversity. In this study, we report a novel interaction between the Mutated in colorectal cancer (MCC protein and a newly identified SHANK3 protein isoform in human colon cancer cells and mouse brain tissue. Hence, our proteogenomic analysis identifies a new human long isoform of the key synaptic protein SHANK3 that was not predicted by the human reference genome. Taken together, our findings describe a potential new role for MCC in neurons, a new human SHANK3 long isoform and, importantly, highlight the use of proteomic data towards the re-annotation of GC-rich genomic regions.

  2. Mutational analysis of the human mitochondrial genome branches into the realm of bacterial genetics

    Energy Technology Data Exchange (ETDEWEB)

    Howell, N. [Univ. of Texas Medical Branch, Galveston, TX (United States)

    1996-10-01

    This is shaping up as a vintage year for studies of the genetics and evolution of the human mitochondrial genome (mtDNA). In a theoretical and experimental tour de force, Shenkar et al. (1996), on pages 772-780 of this issue, derive the mutation rate of the 4,977-bp (or {open_quotes}common{close_quotes}) deletion in the human mtDNA through refinement and extension of fluctuation analysis, a technique that was first used >50 years ago. Shenkar et al., in essence, have solved or bypassed many of the difficulties that are inherent in the application of fluctuation analysis to human mitochondrial gene mutations. Their study is important for two principal reasons. In the first place, high levels of this deletion cause a variety of pathological disorders, including Kearns-Sayre syndrome and chronic progressive external ophthalmoplegia. Their current report, therefore, is a major step in the elucidation of the molecular genetic pathogenesis of this group of mitochondrial disorders. For example, it now may be feasible to analyze the effects of selection on transmission and segregation of this deletion and, perhaps, other mtDNA mutations as well. Second, and at a broader level, the approach of Shenkar et al. should find widespread applicability to the study of other mtDNA mutations. It has been recognized for several years that mammalian mtDNA mutates much more rapidly than nuclear DNA, a phenomenon with potentially profound evolutionary implications. It is exciting and useful, both experimentally and theoretically, that this {open_quotes}old{close_quotes} approach can be used for {open_quotes}new{close_quotes} applications. 56 refs.

  3. Complete sequence analysis of mitochondrial DNA and telomere length in aplastic anemia.

    Science.gov (United States)

    Cui, Xing; Wang, Junqiang; Cai, Zhiguo; Wang, Jingyi; Liu, Kui; Cui, Siyuan; Zhang, Jie; Luo, Yaqin; Wang, Xin; Li, Weiwei; Jing, Jingyan

    2014-11-01

    The present study was primarily undertaken to examine the hypothesis that mitochondrial DNA (mtDNA) mutations and telomere length may be associated with aplastic anemia (AA). Our study included a single institution analysis of 40 patients presenting with AA first diagnosed at the Affiliated Hospital of Shandong, University of Traditional Chinese Medicine between 2010 and 2013. Bone marrow and oral epithelial samples were collected from patients with AA (n=40) for mtDNA mutation and telomere length determinations. Bone marrow specimens were collected from 40 healthy volunteers as controls for the examination of telomere length. The mitochondrial genome was amplified by polymerase chain reaction (PCR), and the products were used for sequencing and analysis. We detected 146 heteroplasmic mutations in 18 genes from 40 patients with AA, including 39 silent mutations and 28 frameshift mutations. We used the gamma globin gene (HBG) as the control gene in real-time PCR to survey the relative telomere length measurements of the patients with AA and the healthy volunteers. Telomere length was expressed as the relative T/S value. We observed a negative correlation between the mtDNA non-silent mutation and the white blood cell (WBC) count, hemoglobin and platelet count. Of note, there was a positive correlation between the relative T/S value and WBC count, hemoglobin and platelet count, and a negative correlation between the non-silent mutation and the relative T/S value. We conclude that the functional impairment of the mitochondrial respiratory chain induced by mutation and telomere length shortening may play an important role in the process of hematopoietic failure in patients with AA. Additionally, mtDNA mutations and telomere length shortening influenced each other.

  4. Lidar point density analysis: implications for identifying water bodies

    Science.gov (United States)

    Worstell, Bruce B.; Poppenga, Sandra; Evans, Gayla A.; Prince, Sandra

    2014-01-01

    Most airborne topographic light detection and ranging (lidar) systems operate within the near-infrared spectrum. Laser pulses from these systems frequently are absorbed by water and therefore do not generate reflected returns on water bodies in the resulting void regions within the lidar point cloud. Thus, an analysis of lidar voids has implications for identifying water bodies. Data analysis techniques to detect reduced lidar return densities were evaluated for test sites in Blackhawk County, Iowa, and Beltrami County, Minnesota, to delineate contiguous areas that have few or no lidar returns. Results from this study indicated a 5-meter radius moving window with fewer than 23 returns (28 percent of the moving window) was sufficient for delineating void regions. Techniques to provide elevation values for void regions to flatten water features and to force channel flow in the downstream direction also are presented.

  5. Automated quantification and integrative analysis of 2D and 3D mitochondrial shape and network properties

    NARCIS (Netherlands)

    Nikolaisen, J.; Nilsson, L.I.; Pettersen, I.K.; Willems, P.H.G.M.; Lorens, J.B.; Koopman, W.J.H.; Tronstad, K.J.

    2014-01-01

    Mitochondrial morphology and function are coupled in healthy cells, during pathological conditions and (adaptation to) endogenous and exogenous stress. In this sense mitochondrial shape can range from small globular compartments to complex filamentous networks, even within the same cell. Understandi

  6. Mitochondrial genomes of the hoverflies Episyrphus balteatus and Eupeodes corollae (Diptera: Syrphidae), with a phylogenetic analysis of Muscomorpha

    Science.gov (United States)

    Pu, De-qiang; Liu, Hong-ling; Gong, Yi-yun; Ji, Pei-cheng; Li, Yue-jian; Mou, Fang-sheng; Wei, Shu-jun

    2017-01-01

    The hoverflies Episyrphus balteatus and Eupeodes corollae (Diptera: Muscomorpha: Syrphidae) are important natural aphid predators. We obtained mitochondrial genome sequences from these two species using methods of PCR amplification and sequencing. The complete Episyrphus mitochondrial genome is 16,175 bp long while the incomplete one of Eupeodes is 15,326 bp long. All 37 typical mitochondrial genes are present in both species and arranged in ancestral positions and directions. The two mitochondrial genomes showed a biased A/T usage versus G/C. The cox1, cox2, cox3, cob and nad1 showed relatively low level of nucleotide diversity among protein-coding genes, while the trnM was the most conserved one without any nucleotide variation in stem regions within Muscomorpha. Phylogenetic relationships among the major lineages of Muscomorpha were reconstructed using a complete set of mitochondrial genes. Bayesian and maximum likelihood analyses generated congruent topologies. Our results supported the monophyly of five species within the Syrphidae (Syrphoidea). The Platypezoidea was sister to all other species of Muscomorpha in our phylogeny. Our study demonstrated the power of the complete mitochondrial gene set for phylogenetic analysis in Muscomorpha. PMID:28276531

  7. Cluster analysis of clinical data identifies fibromyalgia subgroups.

    Directory of Open Access Journals (Sweden)

    Elisa Docampo

    Full Text Available INTRODUCTION: Fibromyalgia (FM is mainly characterized by widespread pain and multiple accompanying symptoms, which hinder FM assessment and management. In order to reduce FM heterogeneity we classified clinical data into simplified dimensions that were used to define FM subgroups. MATERIAL AND METHODS: 48 variables were evaluated in 1,446 Spanish FM cases fulfilling 1990 ACR FM criteria. A partitioning analysis was performed to find groups of variables similar to each other. Similarities between variables were identified and the variables were grouped into dimensions. This was performed in a subset of 559 patients, and cross-validated in the remaining 887 patients. For each sample and dimension, a composite index was obtained based on the weights of the variables included in the dimension. Finally, a clustering procedure was applied to the indexes, resulting in FM subgroups. RESULTS: VARIABLES CLUSTERED INTO THREE INDEPENDENT DIMENSIONS: "symptomatology", "comorbidities" and "clinical scales". Only the two first dimensions were considered for the construction of FM subgroups. Resulting scores classified FM samples into three subgroups: low symptomatology and comorbidities (Cluster 1, high symptomatology and comorbidities (Cluster 2, and high symptomatology but low comorbidities (Cluster 3, showing differences in measures of disease severity. CONCLUSIONS: We have identified three subgroups of FM samples in a large cohort of FM by clustering clinical data. Our analysis stresses the importance of family and personal history of FM comorbidities. Also, the resulting patient clusters could indicate different forms of the disease, relevant to future research, and might have an impact on clinical assessment.

  8. Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS line and its maintainer line

    Directory of Open Access Journals (Sweden)

    Liu Dongcheng

    2011-03-01

    Full Text Available Abstract Background Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS, a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA, and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. Results The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi CMS line, Ks3, was assembled into a master circle (MC molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs, and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38% and repeats (> 100 bp, 29 units as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. Conclusion The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of

  9. Phylogenetic analysis of 16S mitochondrial DNA data in sloths and anteaters

    Directory of Open Access Journals (Sweden)

    Maria Claudene Barros

    2003-01-01

    Full Text Available We sequenced part of the 16S rRNA mitochondrial gene in 17 extant taxa of Pilosa (sloths and anteaters and used these sequences along with GenBank sequences of both extant and extinct sloths to perform phylogenetic analysis based on parsimony, maximum-likelihood and Bayesian methods. By increasing the taxa density for anteaters and sloths we were able to clarify some points of the Pilosa phylogenetic tree. Our mitochondrial 16S results show Bradypodidae as a monophyletic and robustly supported clade in all the analysis. However, the Pleistocene fossil Mylodon darwinii does not group significantly to either Bradypodidae or Megalonychidae which indicates that trichotomy best represents the relationship between the families Mylodontidae, Bradypodidae and Megalonychidae. Divergence times also allowed us to discuss the taxonomic status of Cyclopes and the three species of three-toed sloths, Bradypus tridactylus, Bradypus variegatus and Bradypus torquatus. In the Bradypodidae the split between Bradypus torquatus and the proto-Bradypus tridactylus / B. variegatus was estimated as about 7.7 million years ago (MYA, while in the Myrmecophagidae the first offshoot was Cyclopes at about 31.8 MYA followed by the split between Myrmecophaga and Tamandua at 12.9 MYA. We estimate the split between sloths and anteaters to have occurred at about 37 MYA.

  10. Genome-wide analysis reveals coating of the mitochondrial genome by TFAM.

    Directory of Open Access Journals (Sweden)

    Yun E Wang

    Full Text Available Mitochondria contain a 16.6 kb circular genome encoding 13 proteins as well as mitochondrial tRNAs and rRNAs. Copies of the genome are organized into nucleoids containing both DNA and proteins, including the machinery required for mtDNA replication and transcription. The transcription factor TFAM is critical for initiation of transcription and replication of the genome, and is also thought to perform a packaging function. Although specific binding sites required for initiation of transcription have been identified in the D-loop, little is known about the characteristics of TFAM binding in its nonspecific packaging state. In addition, it is unclear whether TFAM also plays a role in the regulation of nuclear gene expression. Here we investigate these questions by using ChIP-seq to directly localize TFAM binding to DNA in human cells. Our results demonstrate that TFAM uniformly coats the whole mitochondrial genome, with no evidence of robust TFAM binding to the nuclear genome. Our study represents the first high-resolution assessment of TFAM binding on a genome-wide scale in human cells.

  11. Characterization of complete mitochondrial genome of Dezhou donkey (Equus asinus) and evolutionary analysis.

    Science.gov (United States)

    Sun, Yan; Jiang, Qiang; Yang, Chunhong; Wang, Xiuge; Tian, Fang; Wang, Yinchao; Ma, Yong; Ju, Zhihua; Huang, Jinming; Zhou, Xiangshan; Zhong, Jifeng; Wang, Changfa

    2016-05-01

    Mitochondrial DNA (mtDNA) has been widely used in species identification and genetic diversification. Comparisons among mtDNAs of closely related species are valuable for phylogenetic studies. However, only the partial mtDNA Cytb gene and the D-loop sequences were used to analysis the phylogenetic relationship between donkey breeds due to lack of complete mitochondrial genome. Dezhou donkey, as a bigger somatotype ass, is one of Chinese domestic donkey breeds, and used by many places as breeding stock. To further investigate the phylogenetic relationship of Dezhou donkey with other breeds, the complete mtDNA was firstly sequenced and de novo assembled using next generation sequence data from total genomic DNA. The genome was 16,813 bp in length (NCBI submission number: KT182635) and contained 13 protein coding genes, 2 ribosomal RNA genes, 25 transfer RNA genes, and 1 control region. Based on the novel complete mtDNA sequence, the sequences of 13 protein coding genes and 2 ribosomal RNA genes were amplifying in other 2 Dezhou donkeys and 3 Yunnan donkeys, respectively. The pattern of genetic variation in horse, wild ass and domestic donkeys among these 15 genes indicated the sequence polymorphisms. The more accurate phylogenetic relationships of donkey species (Dezhou donkey, Yunnan donkey and previously published donkeys) were first obtained using the combined sequences of 12S rRNA+16S rRNA+13 protein-coding genes. Molecular-based phylogeny supported the hypothesis that Chinese domestic donkey breeds may have originated from Somali wild ass, not from Asian wild ass by analyzing mitochondrial genomes.

  12. Phylogenetic approaches for the analysis of mitochondrial genome sequence data in the Hymenoptera--a lineage with both rapidly and slowly evolving mitochondrial genomes.

    Science.gov (United States)

    Dowton, Mark; Cameron, Stephen L; Austin, Andy D; Whiting, Michael F

    2009-08-01

    We entirely sequenced two new hymenopteran mitochondrial genomes (Cephus cinctus and Orussus occidentalis), and a substantial portion of another three hymenopterans (Schlettererius cinctipes, Venturia canescens, and Enicospilus). We analyze them together with nine others reported in the literature. We establish that the rate of genetic divergence is two to three times higher among some Hymenoptera when compared with others, making this a group with both long and short phylogenetic branches. We then assessed the ability of a range of phylogenetic approaches to recover seven uncontroversial relationships, when lineages show markedly different rates of molecular evolution. This range encompassed maximum parsimony and Bayesian analysis of (i) amino acid data, (ii) nucleotide data, and (iii) nucleotide data excluding third codon positions. Unpartitioned analyses were compared with partitioned analyses, with the data partitioned by codon position (ribosomal genes were placed in a separate partition). These analyses indicated that partitioned, Bayesian analysis of nucleotide data, excluding 3rd codon positions, recovered more of the uncontroversial relationships than any other approach. These results suggest that the analysis of complete mitochondrial genome sequences holds promise for the resolution of hymenopteran superfamily relationships.

  13. Analysis of an Image Secret Sharing Scheme to Identify Cheaters

    Directory of Open Access Journals (Sweden)

    Jung-San LEe

    2010-09-01

    Full Text Available Secret image sharing mechanisms have been widely applied to the military, e-commerce, and communications fields. Zhao et al. introduced the concept of cheater detection into image sharing schemes recently. This functionality enables the image owner and authorized members to identify the cheater in reconstructing the secret image. Here, we provide an analysis of Zhao et al.¡¦s method: an authorized participant is able to restore the secret image by him/herself. This contradicts the requirement of secret image sharing schemes. The authorized participant utilizes an exhaustive search to achieve the attempt, though, simulation results show that it can be done within a reasonable time period.

  14. Identifying avian sources of faecal contamination using sterol analysis.

    Science.gov (United States)

    Devane, Megan L; Wood, David; Chappell, Andrew; Robson, Beth; Webster-Brown, Jenny; Gilpin, Brent J

    2015-10-01

    Discrimination of the source of faecal pollution in water bodies is an important step in the assessment and mitigation of public health risk. One tool for faecal source tracking is the analysis of faecal sterols which are present in faeces of animals in a range of distinctive ratios. Published ratios are able to discriminate between human and herbivore mammal faecal inputs but are of less value for identifying pollution from wildfowl, which can be a common cause of elevated bacterial indicators in rivers and streams. In this study, the sterol profiles of 50 avian-derived faecal specimens (seagulls, ducks and chickens) were examined alongside those of 57 ruminant faeces and previously published sterol profiles of human wastewater, chicken effluent and animal meatwork effluent. Two novel sterol ratios were identified as specific to avian faecal scats, which, when incorporated into a decision tree with human and herbivore mammal indicative ratios, were able to identify sterols from avian-polluted waterways. For samples where the sterol profile was not consistent with herbivore mammal or human pollution, avian pollution is indicated when the ratio of 24-ethylcholestanol/(24-ethylcholestanol + 24-ethylcoprostanol + 24-ethylepicoprostanol) is ≥0.4 (avian ratio 1) and the ratio of cholestanol/(cholestanol + coprostanol + epicoprostanol) is ≥0.5 (avian ratio 2). When avian pollution is indicated, further confirmation by targeted PCR specific markers can be employed if greater confidence in the pollution source is required. A 66% concordance between sterol ratios and current avian PCR markers was achieved when 56 water samples from polluted waterways were analysed.

  15. Cluster Analysis of Clinical Data Identifies Fibromyalgia Subgroups

    Science.gov (United States)

    Docampo, Elisa; Collado, Antonio; Escaramís, Geòrgia; Carbonell, Jordi; Rivera, Javier; Vidal, Javier; Alegre, José

    2013-01-01

    Introduction Fibromyalgia (FM) is mainly characterized by widespread pain and multiple accompanying symptoms, which hinder FM assessment and management. In order to reduce FM heterogeneity we classified clinical data into simplified dimensions that were used to define FM subgroups. Material and Methods 48 variables were evaluated in 1,446 Spanish FM cases fulfilling 1990 ACR FM criteria. A partitioning analysis was performed to find groups of variables similar to each other. Similarities between variables were identified and the variables were grouped into dimensions. This was performed in a subset of 559 patients, and cross-validated in the remaining 887 patients. For each sample and dimension, a composite index was obtained based on the weights of the variables included in the dimension. Finally, a clustering procedure was applied to the indexes, resulting in FM subgroups. Results Variables clustered into three independent dimensions: “symptomatology”, “comorbidities” and “clinical scales”. Only the two first dimensions were considered for the construction of FM subgroups. Resulting scores classified FM samples into three subgroups: low symptomatology and comorbidities (Cluster 1), high symptomatology and comorbidities (Cluster 2), and high symptomatology but low comorbidities (Cluster 3), showing differences in measures of disease severity. Conclusions We have identified three subgroups of FM samples in a large cohort of FM by clustering clinical data. Our analysis stresses the importance of family and personal history of FM comorbidities. Also, the resulting patient clusters could indicate different forms of the disease, relevant to future research, and might have an impact on clinical assessment. PMID:24098674

  16. Archetypal TRMM Radar Profiles Identified Through Cluster Analysis

    Science.gov (United States)

    Boccippio, Dennis J.

    2003-01-01

    It is widely held that identifiable 'convective regimes' exist in nature, although precise definitions of these are elusive. Examples include land / Ocean distinctions, break / monsoon beahvior, seasonal differences in the Amazon (SON vs DJF), etc. These regimes are often described by differences in the realized local convective spectra, and measured by various metrics of convective intensity, depth, areal coverage and rainfall amount. Objective regime identification may be valuable in several ways: regimes may serve as natural 'branch points' in satellite retrieval algorithms or data assimilation efforts; one example might be objective identification of regions that 'should' share a similar 2-R relationship. Similarly, objectively defined regimes may provide guidance on optimal siting of ground validation efforts. Objectively defined regimes could also serve as natural (rather than arbitrary geographic) domain 'controls' in studies of convective response to environmental forcing. Quantification of convective vertical structure has traditionally involved parametric study of prescribed quantities thought to be important to convective dynamics: maximum radar reflectivity, cloud top height, 30-35 dBZ echo top height, rain rate, etc. Individually, these parameters are somewhat deficient as their interpretation is often nonunique (the same metric value may signify different physics in different storm realizations). Individual metrics also fail to capture the coherence and interrelationships between vertical levels available in full 3-D radar datasets. An alternative approach is discovery of natural partitions of vertical structure in a globally representative dataset, or 'archetypal' reflectivity profiles. In this study, this is accomplished through cluster analysis of a very large sample (0[107) of TRMM-PR reflectivity columns. Once achieved, the rainconditional and unconditional 'mix' of archetypal profile types in a given location and/or season provides a description

  17. Network Analysis Identifies Disease-Specific Pathways for Parkinson's Disease.

    Science.gov (United States)

    Monti, Chiara; Colugnat, Ilaria; Lopiano, Leonardo; Chiò, Adriano; Alberio, Tiziana

    2016-12-21

    Neurodegenerative diseases are characterized by the progressive loss of specific neurons in selected regions of the central nervous system. The main clinical manifestation (movement disorders, cognitive impairment, and/or psychiatric disturbances) depends on the neuron population being primarily affected. Parkinson's disease is a common movement disorder, whose etiology remains mostly unknown. Progressive loss of dopaminergic neurons in the substantia nigra causes an impairment of the motor control. Some of the pathogenetic mechanisms causing the progressive deterioration of these neurons are not specific for Parkinson's disease but are shared by other neurodegenerative diseases, like Alzheimer's disease and amyotrophic lateral sclerosis. Here, we performed a meta-analysis of the literature of all the quantitative proteomic investigations of neuronal alterations in different models of Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis to distinguish between general and Parkinson's disease-specific pattern of neurodegeneration. Then, we merged proteomics data with genetics information from the DisGeNET database. The comparison of gene and protein information allowed us to identify 25 proteins involved uniquely in Parkinson's disease and we verified the alteration of one of them, i.e., transaldolase 1 (TALDO1), in the substantia nigra of 5 patients. By using open-source bioinformatics tools, we identified the biological processes specifically affected in Parkinson's disease, i.e., proteolysis, mitochondrion organization, and mitophagy. Eventually, we highlighted four cellular component complexes mostly involved in the pathogenesis: the proteasome complex, the protein phosphatase 2A, the chaperonins CCT complex, and the complex III of the respiratory chain.

  18. Social network analysis in identifying influential webloggers: A preliminary study

    Science.gov (United States)

    Hasmuni, Noraini; Sulaiman, Nor Intan Saniah; Zaibidi, Nerda Zura

    2014-12-01

    In recent years, second generation of internet-based services such as weblog has become an effective communication tool to publish information on the Web. Weblogs have unique characteristics that deserve users' attention. Some of webloggers have seen weblogs as appropriate medium to initiate and expand business. These webloggers or also known as direct profit-oriented webloggers (DPOWs) communicate and share knowledge with each other through social interaction. However, survivability is the main issue among DPOW. Frequent communication with influential webloggers is one of the way to keep survive as DPOW. This paper aims to understand the network structure and identify influential webloggers within the network. Proper understanding of the network structure can assist us in knowing how the information is exchanged among members and enhance survivability among DPOW. 30 DPOW were involved in this study. Degree centrality and betweenness centrality measurement in Social Network Analysis (SNA) were used to examine the strength relation and identify influential webloggers within the network. Thus, webloggers with the highest value of these measurements are considered as the most influential webloggers in the network.

  19. Mitochondrial DNA analysis of eneolithic trypillians from Ukraine reveals neolithic farming genetic roots

    Science.gov (United States)

    Potekhina, Inna; Rohland, Nadin; Mallick, Swapan; Reich, David; Lillie, Malcolm

    2017-01-01

    The agricultural revolution in Eastern Europe began in the Eneolithic with the Cucuteni-Trypillia culture complex. In Ukraine, the Trypillian culture (TC) existed for over two millennia (ca. 5,400–2,700 BCE) and left a wealth of artifacts. Yet, their burial rituals remain a mystery and to date almost nothing is known about the genetic composition of the TC population. One of the very few TC sites where human remains can be found is a cave called Verteba in western Ukraine. This report presents four partial and four complete mitochondrial genomes from nine TC individuals uncovered in the cave. The results of this analysis, combined with the data from previous reports, indicate that the Trypillian population at Verteba carried, for the most part, a typical Neolithic farmer package of mitochondrial DNA (mtDNA) lineages traced to Anatolian farmers and Neolithic farming groups of central Europe. At the same time, the find of two specimens belonging to haplogroup U8b1 at Verteba can be viewed as a connection of TC with the Upper Paleolithic European populations. At the level of mtDNA haplogroup frequencies, the TC population from Verteba demonstrates a close genetic relationship with population groups of the Funnel Beaker/ Trichterbecker cultural complex from central and northern Europe (ca. 3,950–2,500 BCE). PMID:28235025

  20. Mitochondrial Genome Analysis of Wild Rice (Oryza minuta) and Its Comparison with Other Related Species

    Science.gov (United States)

    Asaf, Sajjad; Khan, Abdul Latif; Khan, Abdur Rahim; Waqas, Muhammad; Kang, Sang-Mo; Khan, Muhammad Aaqil; Shahzad, Raheem; Seo, Chang-Woo; Shin, Jae-Ho; Lee, In-Jung

    2016-01-01

    Oryza minuta (Poaceae family) is a tetraploid wild relative of cultivated rice with a BBCC genome. O. minuta has the potential to resist against various pathogenic diseases such as bacterial blight (BB), white backed planthopper (WBPH) and brown plant hopper (BPH). Here, we sequenced and annotated the complete mitochondrial genome of O. minuta. The mtDNA genome is 515,022 bp, containing 60 protein coding genes, 31 tRNA genes and two rRNA genes. The mitochondrial genome organization and the gene content at the nucleotide level are highly similar (89%) to that of O. rufipogon. Comparison with other related species revealed that most of the genes with known function are conserved among the Poaceae members. Similarly, O. minuta mt genome shared 24 protein-coding genes, 15 tRNA genes and 1 ribosomal RNA gene with other rice species (indica and japonica). The evolutionary relationship and phylogenetic analysis revealed that O. minuta is more closely related to O. rufipogon than to any other related species. Such studies are essential to understand the evolutionary divergence among species and analyze common gene pools to combat risks in the current scenario of a changing environment. PMID:27045847

  1. Complete mitochondrial genome and phylogenic analysis of the mudskipper Scartelaos gigas (Perciformes, Gobiidae).

    Science.gov (United States)

    Li, Zhe; Zhang, Yuting; Chen, Shixi; Chen, Wei; Hong, Wanshu

    2016-09-01

    In this paper, the complete mitochondrial genome sequence of Scartelaos gigas was firstly determined. The circular genome (16 717 bp) comprises 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region. The overall base composition of S. gigas is 28.9% for C, 28.3% for A, 26.4% for T, 16.4% for G, with a slight A + T bias of 54.7%. In the control region, the termination-associated sequence and conserved sequence block domains were found, but the tandem repeat structure was not found. It has the typical vertebrate mitochondrial gene arrangement. The phylogenic analysis using the Neighbor-Joining method showed that the fishes belonging to Gobiidae, Odontoburidae, and Eleotridae formed three branches grouped with other fishes into one clade which separated from the mammals. We hope that the results from the present study will provide useful molecular information for the further studies on genetic structure and demographic history of S. gigas.

  2. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  3. Discrimination of Anemonefish Species by PCR-RFLP Analysis of Mitochondrial Gene Fragments

    Directory of Open Access Journals (Sweden)

    Chuta Boonphakdee

    2008-01-01

    Full Text Available A means of discriminating among species of clown anemonefishes, based on restriction enzyme analysis of partial mitochondrial DNA sequences, was investigated. Mitochondrial 16S rRNA and cytochrome b genes from 6 species (7 strains of anemonefish (Premnas biculeatus, Amphiprion polymnus, A. sandaracinos, A. perideraion, A. ocellaris, A. ocellaris var. and A. percula were PCR-amplified. A 623-bp portion of 16S rRNA gene was obtained from different fishes using the same pair of primers. Further investigation of this 16S rRNA fragment, by restriction endonuclease digestion with BfuCI and RsaI, was not able to distinguish all fishes studied, but did yield 3 different digestion patterns. The first was specific to P. biculaetus, the sole member of the genus Premnas, while the remaining two separated the Amphiprion species into 2 groups: 1 A. polymnas, A. sandaracinos and A. perideraion, and 2 A. ocellaris, A. ocellaris var. and A. percula. In contrast to this, restriction endonuclease digestion of a 786-bp fragment of the cytochrome b gene with HinfI and RsaI, was able to differentiate different 7 anemonefishes. This utility marker is valuable for unambiguous species/strain identification of juvenile anemonefishes.

  4. Analysis of the Mitochondrial DNA and Its Replicative Capacity in Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Cagnone, Gael; Vaghjiani, Vijesh; Lee, William; Sun, Claire; Johnson, Jacqueline; Yeung, Ka-Yu; St John, Justin C

    2016-01-01

    The mitochondrial genome resides in the mitochondrion of nearly all mammalian cells. It is important for energy production as it encodes 13 of the key subunits of the electron transfer chain, which generates the vast majority of cellular ATP through the process of oxidative phosphorylation. As cells establish pluripotency, they regulate their mtDNA copy number so that they possess few copies but sufficient that they can be replicated to match the differentiated cell-specific requirements for ATP derived through oxidative phosphorylation. However, the failure to strictly regulate this process prevents pluripotent cells from differentiating. We describe a series of protocols that analyze mtDNA copy number, DNA methylation within the nuclear-encoded mtDNA-specific polymerase, and gene expression of the other factors that drive replication of the mitochondrial genome. We demonstrate how to measure ATP-generating capacity through oxygen respiratory capacity and total cellular ATP and lactate levels. Finally, we also describe how to detect mtDNA variants in pluripotent and differentiating cells using next-generation sequencing protocols and how the variants can be confirmed by high-resolution melt analysis.

  5. The complete mitochondrial genome of Microtus fortis calamorum (Arvicolinae, Rodentia) and its phylogenetic analysis.

    Science.gov (United States)

    Jiang, Xianhuan; Gao, Jun; Ni, Liju; Hu, Jianhua; Li, Kai; Sun, Fengping; Xie, Jianyun; Bo, Xiong; Gao, Chen; Xiao, Junhua; Zhou, Yuxun

    2012-05-01

    Microtus fortis is a special resource of rodent in China. It is a promising experimental animal model for the study on the mechanism of Schistosome japonicum resistance. The first complete mitochondrial genome sequence for Microtus fortis calamorum, a subspecies of M. fortis (Arvicolinae, Rodentia), was reported in this study. The mitochondrial genome sequence of M. f. calamorum (Genbank: JF261175) showed a typical vertebrate pattern with 13 protein coding genes, 2 ribosomal RNAs, 22 transfer RNAs and one major noncoding region (CR region).The extended termination associated sequences (ETAS-1 and ETAS-2) and conserved sequence block 1 (CSB-1) were found in the CR region. The putative origin of replication for the light strand (O(L)) of M. f. calamorum was 35bp long and showed high conservation in stem and adjacent sequences, but the difference existed in the loop region among three species of genus Microtus. In order to investigate the phylogenetic position of M. f. calamorum, the phylogenetic trees (Maximum likelihood and Bayesian methods) were constructed based on 12 protein-coding genes (except for ND6 gene) on H strand from 16 rodent species. M. f. calamorum was classified into genus Microtus, Arvcicolinae for the highly phylogenetic relationship with Microtus kikuchii (Taiwan vole). Further phylogenetic analysis results based on the cytochrome b gene ranged from M. f. calamorum to one of the subspecies of M. fortis, which formed a sister group of Microtus middendorfii in the genus Microtus.

  6. Mitochondrial Dynamics in Mitochondrial Diseases

    Directory of Open Access Journals (Sweden)

    Juan M. Suárez-Rivero

    2016-12-01

    Full Text Available Mitochondria are very versatile organelles in continuous fusion and fission processes in response to various cellular signals. Mitochondrial dynamics, including mitochondrial fission/fusion, movements and turnover, are essential for the mitochondrial network quality control. Alterations in mitochondrial dynamics can cause neuropathies such as Charcot-Marie-Tooth disease in which mitochondrial fusion and transport are impaired, or dominant optic atrophy which is caused by a reduced mitochondrial fusion. On the other hand, mitochondrial dysfunction in primary mitochondrial diseases promotes reactive oxygen species production that impairs its own function and dynamics, causing a continuous vicious cycle that aggravates the pathological phenotype. Mitochondrial dynamics provides a new way to understand the pathophysiology of mitochondrial disorders and other diseases related to mitochondria dysfunction such as diabetes, heart failure, or Hungtinton’s disease. The knowledge about mitochondrial dynamics also offers new therapeutics targets in mitochondrial diseases.

  7. Peripheral neuropathy in mitochondrial disorders.

    Science.gov (United States)

    Pareyson, Davide; Piscosquito, Giuseppe; Moroni, Isabella; Salsano, Ettore; Zeviani, Massimo

    2013-10-01

    Why is peripheral neuropathy common but mild in many mitochondrial disorders, and why is it, in some cases, the predominant or only manifestation? Although this question remains largely unanswered, recent advances in cellular and molecular biology have begun to clarify the importance of mitochondrial functioning and distribution in the peripheral nerve. Mutations in proteins involved in mitochondrial dynamics (ie, fusion and fission) frequently result in a Charcot-Marie-Tooth phenotype. Peripheral neuropathies with different phenotypic presentations occur in mitochondrial diseases associated with abnormalities in mitochondrial DNA replication and maintenance, or associated with defects in mitochondrial respiratory chain complex V. Our knowledge of mitochondrial disorders is rapidly growing as new nuclear genes are identified and new phenotypes described. Early diagnosis of mitochondrial disorders, essential to provide appropriate genetic counselling, has become crucial in a few treatable conditions. Recognising and diagnosing an underlying mitochondrial defect in patients presenting with peripheral neuropathy is therefore of paramount importance.

  8. Mitochondrial genome analysis of the predatory mite Phytoseiulus persimilis and a revisit of the Metaseiulus occidentalis mitochondrial genome.

    Science.gov (United States)

    Dermauw, Wannes; Vanholme, Bartel; Tirry, Luc; Van Leeuwen, Thomas

    2010-04-01

    In this study we sequenced and analysed the complete mitochondrial (mt) genome of the Chilean predatory mite Phytoseiulus persimilis Athias-Henriot (Chelicerata: Acari: Mesostigmata: Phytoseiidae: Amblyseiinae). The 16 199 bp genome (79.8% AT) contains the standard set of 13 protein-coding and 24 RNA genes. Compared with the ancestral arthropod mtDNA pattern, the gene order is extremely reshuffled (35 genes changed position) and represents a novel arrangement within the arthropods. This is probably related to the presence of several large noncoding regions in the genome. In contrast with the mt genome of the closely related species Metaseiulus occidentalis (Phytoseiidae: Typhlodrominae) - which was reported to be unusually large (24 961 bp), to lack nad6 and nad3 protein-coding genes, and to contain 22 tRNAs without T-arms - the genome of P. persimilis has all the features of a standard metazoan mt genome. Consequently, we performed additional experiments on the M. occidentalis mt genome. Our preliminary restriction digests and Southern hybridization data revealed that this genome is smaller than previously reported. In addition, we cloned nad3 in M. occidentalis and positioned this gene between nad4L and 12S-rRNA on the mt genome. Finally, we report that at least 15 of the 22 tRNAs in the M. occidentalis mt genome can be folded into canonical cloverleaf structures similar to their counterparts in P. persimilis.

  9. Performance Analysis: Work Control Events Identified January - August 2010

    Energy Technology Data Exchange (ETDEWEB)

    De Grange, C E; Freeman, J W; Kerr, C E; Holman, G; Marsh, K; Beach, R

    2011-01-14

    This performance analysis evaluated 24 events that occurred at LLNL from January through August 2010. The analysis identified areas of potential work control process and/or implementation weaknesses and several common underlying causes. Human performance improvement and safety culture factors were part of the causal analysis of each event and were analyzed. The collective significance of all events in 2010, as measured by the occurrence reporting significance category and by the proportion of events that have been reported to the DOE ORPS under the ''management concerns'' reporting criteria, does not appear to have increased in 2010. The frequency of reporting in each of the significance categories has not changed in 2010 compared to the previous four years. There is no change indicating a trend in the significance category and there has been no increase in the proportion of occurrences reported in the higher significance category. Also, the frequency of events, 42 events reported through August 2010, is not greater than in previous years and is below the average of 63 occurrences per year at LLNL since 2006. Over the previous four years, an average of 43% of the LLNL's reported occurrences have been reported as either ''management concerns'' or ''near misses.'' In 2010, 29% of the occurrences have been reported as ''management concerns'' or ''near misses.'' This rate indicates that LLNL is now reporting fewer ''management concern'' and ''near miss'' occurrences compared to the previous four years. From 2008 to the present, LLNL senior management has undertaken a series of initiatives to strengthen the work planning and control system with the primary objective to improve worker safety. In 2008, the LLNL Deputy Director established the Work Control Integrated Project Team to develop the core requirements and graded

  10. Limited diagnostic value of enzyme analysis in patients with mitochondrial tRNA mutations

    DEFF Research Database (Denmark)

    Wibrand, Flemming; Jeppesen, Tina Dysgaard; Frederiksen, Anja L

    2010-01-01

    We evaluated the diagnostic value of respiratory chain (RC) enzyme analysis of muscle in adult patients with mitochondrial myopathy (MM). RC enzyme activity was measured in muscle biopsies from 39 patients who carry either the 3243A>G mutation, other tRNA point mutations, or single, large....... Only 10% of patients with the 3243A>G point mutation had decreased enzyme activity of one or more RC complexes, whereas this was the case for 83% of patients with other point mutations and 62% of patients with deletions. Abnormal muscle histochemistry was found in 65%, 100%, and 85% of patients......-scale deletions of mtDNA. Findings were compared with those obtained from asymptomatic relatives with the 3243A>G mutation, myotonic dystrophy patients, and healthy subjects. Plasma lactate concentration, maximal oxygen uptake, and ragged-red fibers/cytochrome c-negative fibers in muscle were also determined...

  11. Statistical analysis of post mortem DNA damage-derived miscoding lesions in Neandertal mitochondrial DNA

    DEFF Research Database (Denmark)

    Vives, Sergi; Gilbert, M Thomas; Arenas, Conchita

    2008-01-01

    ABSTRACT: BACKGROUND: We have analysed the distribution of post mortem DNA damage derived miscoding lesions from the datasets of seven published Neandertal specimens that have extensive cloned sequence coverage over the mitochondrial DNA (mtDNA) hypervariable region 1 (HVS1). The analysis...... was restricted to C-->T and G-->A miscoding lesions (the predominant manifestation of post mortem damage) that are seen at a frequency of more than one clone among sequences from a single PCR, but do not represent the true endogenous sequence. FINDINGS: The data indicates an extreme bias towards C-->T over G......-->A miscoding lesions (observed ratio of 67:2 compared to an expected ratio of 7:2), implying that the mtDNA Light strand molecule suffers proportionally more damage-derived miscoding lesions than the Heavy strand. CONCLUSION: The clustering of Cs in the Light strand as opposed to the singleton pattern of Cs...

  12. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

    Directory of Open Access Journals (Sweden)

    Changwei Bi

    2016-01-01

    Full Text Available Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

  13. Global secretome analysis identifies novel mediators of bone metastasis

    Institute of Scientific and Technical Information of China (English)

    Mario Andres Blanco; Gary LeRoy; Zia Khan; Ma(s)a Ale(c)kovi(c); Barry M Zee; Benjamin A Garcia; Yibin Kang

    2012-01-01

    Bone is the one of the most common sites of distant metastasis of solid tumors.Secreted proteins are known to influence pathological interactions between metastatic cancer cells and the bone stroma.To comprehensively profile secreted proteins associated with bone metastasis,we used quantitative and non-quantitative mass spectrometry to globally analyze the secretomes of nine cell lines of varying bone metastatic ability from multiple species and cancer types.By comparing the secretomes of parental cells and their bone metastatic derivatives,we identified the secreted proteins that were uniquely associated with bone metastasis in these cell lines.We then incorporated bioinformatic analyses of large clinical metastasis datasets to obtain a list of candidate novel bone metastasis proteins of several functional classes that were strongly associated with both clinical and experimental bone metastasis.Functional validation of selected proteins indicated that in vivo bone metastasis can be promoted by high expression of (1) the salivary cystatins CST1,CST2,and CST4; (2) the plasminogen activators PLAT and PLAU; or (3) the collagen functionality proteins PLOD2 and COL6A1.Overall,our study has uncovered several new secreted mediators of bone metastasis and therefore demonstrated that secretome analysis is a powerful method for identification of novel biomarkers and candidate therapeutic targets.

  14. Identifying redundancy and exposing provenance in crowdsourced data analysis.

    Science.gov (United States)

    Willett, Wesley; Ginosar, Shiry; Steinitz, Avital; Hartmann, Björn; Agrawala, Maneesh

    2013-12-01

    We present a system that lets analysts use paid crowd workers to explore data sets and helps analysts interactively examine and build upon workers' insights. We take advantage of the fact that, for many types of data, independent crowd workers can readily perform basic analysis tasks like examining views and generating explanations for trends and patterns. However, workers operating in parallel can often generate redundant explanations. Moreover, because workers have different competencies and domain knowledge, some responses are likely to be more plausible than others. To efficiently utilize the crowd's work, analysts must be able to quickly identify and consolidate redundant responses and determine which explanations are the most plausible. In this paper, we demonstrate several crowd-assisted techniques to help analysts make better use of crowdsourced explanations: (1) We explore crowd-assisted strategies that utilize multiple workers to detect redundant explanations. We introduce color clustering with representative selection--a strategy in which multiple workers cluster explanations and we automatically select the most-representative result--and show that it generates clusterings that are as good as those produced by experts. (2) We capture explanation provenance by introducing highlighting tasks and capturing workers' browsing behavior via an embedded web browser, and refine that provenance information via source-review tasks. We expose this information in an explanation-management interface that allows analysts to interactively filter and sort responses, select the most plausible explanations, and decide which to explore further.

  15. A Sensitivity Analysis Approach to Identify Key Environmental Performance Factors

    Directory of Open Access Journals (Sweden)

    Xi Yu

    2014-01-01

    Full Text Available Life cycle assessment (LCA is widely used in design phase to reduce the product’s environmental impacts through the whole product life cycle (PLC during the last two decades. The traditional LCA is restricted to assessing the environmental impacts of a product and the results cannot reflect the effects of changes within the life cycle. In order to improve the quality of ecodesign, it is a growing need to develop an approach which can reflect the changes between the design parameters and product’s environmental impacts. A sensitivity analysis approach based on LCA and ecodesign is proposed in this paper. The key environmental performance factors which have significant influence on the products’ environmental impacts can be identified by analyzing the relationship between environmental impacts and the design parameters. Users without much environmental knowledge can use this approach to determine which design parameter should be first considered when (redesigning a product. A printed circuit board (PCB case study is conducted; eight design parameters are chosen to be analyzed by our approach. The result shows that the carbon dioxide emission during the PCB manufacture is highly sensitive to the area of PCB panel.

  16. Mitochondrial helicases and mitochondrial genome maintenance

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; de Souza-Pinto, Nadja C; Kulikowicz, Tomasz;

    2010-01-01

    Helicases are essential enzymes that utilize the energy of nucleotide hydrolysis to drive unwinding of nucleic acid duplexes. Helicases play roles in all aspects of DNA metabolism including DNA repair, DNA replication and transcription. The subcellular locations and functions of several helicases...... have been studied in detail; however, the roles of specific helicases in mitochondrial biology remain poorly characterized. This review presents important recent advances in identifying and characterizing mitochondrial helicases, some of which also operate in the nucleus....

  17. Performance Analysis: Work Control Events Identified January - August 2010

    Energy Technology Data Exchange (ETDEWEB)

    De Grange, C E; Freeman, J W; Kerr, C E; Holman, G; Marsh, K; Beach, R

    2011-01-14

    This performance analysis evaluated 24 events that occurred at LLNL from January through August 2010. The analysis identified areas of potential work control process and/or implementation weaknesses and several common underlying causes. Human performance improvement and safety culture factors were part of the causal analysis of each event and were analyzed. The collective significance of all events in 2010, as measured by the occurrence reporting significance category and by the proportion of events that have been reported to the DOE ORPS under the ''management concerns'' reporting criteria, does not appear to have increased in 2010. The frequency of reporting in each of the significance categories has not changed in 2010 compared to the previous four years. There is no change indicating a trend in the significance category and there has been no increase in the proportion of occurrences reported in the higher significance category. Also, the frequency of events, 42 events reported through August 2010, is not greater than in previous years and is below the average of 63 occurrences per year at LLNL since 2006. Over the previous four years, an average of 43% of the LLNL's reported occurrences have been reported as either ''management concerns'' or ''near misses.'' In 2010, 29% of the occurrences have been reported as ''management concerns'' or ''near misses.'' This rate indicates that LLNL is now reporting fewer ''management concern'' and ''near miss'' occurrences compared to the previous four years. From 2008 to the present, LLNL senior management has undertaken a series of initiatives to strengthen the work planning and control system with the primary objective to improve worker safety. In 2008, the LLNL Deputy Director established the Work Control Integrated Project Team to develop the core requirements and graded

  18. Evaluating the Phylogenetic Status of the Extinct Japanese Otter on the Basis of Mitochondrial Genome Analysis.

    Directory of Open Access Journals (Sweden)

    Daisuke Waku

    Full Text Available The Japanese otter lived throughout four main Japanese islands, but it has not been observed in the wild since 1979 and was declared extinct in 2012. Although recent taxonomic and molecular phylogenetic studies suggest that it should be treated as an independent species, International Union for Conservation of Nature Red List considers it as subspecies of Lutra lutra. Therefore, the taxonomic status of this species needs to be resolved. Here we determined the complete mitochondrial genome of two Japanese otters caught in Kanagawa and Kochi prefectures and five Eurasian otters (L. lutra. We reconstructed a molecular phylogenetic tree to estimate the phylogenetic position of the Japanese otter in Lutrinae using the Japanese otters and the other 11 Lutrinae species on the basis of ND5 (692 bp and cytochrome b (1,140 bp sequences. We observed that the two Japanese otters had close relationships with Eurasian otters, forming a monophyletic group (100% bootstrap probability. To elucidate detailed phylogenetic relationships among the Japanese and Eurasian otters, we reconstructed a maximum likelihood tree according to mitochondrial genome sequences (14,740 bp. The Japanese otter (JO1 collected in Kanagawa was deeply nested in the Eurasian otter clade, whereas the Japanese otter (JO2 collected in Kochi formed a distinct independent lineage in the Lutra clade. The estimated molecular divergences time for the ancestral lineages of the Japanese otters was 0.10 Ma (95%: 0.06-0.16 Ma and 1.27 Ma (95%: 0.98-1.59 Ma for JO1 and JO2 lineages, respectively. Thus, JO1 was identified as a member of L. lutra; JO2 represented the old Japanese otter lineage, which may be a distinct new species or subspecies of Lutra. We suggest that the ancestral population of the JO2 lineage migrated to Japan via the land bridge that existed between western Japanese islands and Asian continent at 1.27 Ma.

  19. Advances in Human Mitochondrial Diseases Molecular Genetic Analysis of Pathogenic mtDNA Mutations.

    Science.gov (United States)

    Davidson, E; King, M P

    1997-01-01

    The mitochondrial diseases are a heterogeneous group of disorders that have been defined by specific morphological alterations in muscle and by deficits of the mitochondrial respiratory chain. The morphological hallmarks of these diseases include ragged-red fibers (an extensive proliferation of mitochondria in muscle fibers) and abnormal paracrystalline inclusions and membrane structures in mitochondria. The identification of pathogenic mutations in mitochondrial DNA (mtDNA) has resulted in a genetic classification of mitochondrial diseases. Investigations are being conducted to understand the molecular basis for the biochemical and morphological alterations of mitochondria associated with mtDNA mutations. © 1997, Elsevier Science Inc. (Trends Cardiovasc Med 1997;7:16-24).

  20. Genotyping of velvet antlers for identification of country of origin using mitochondrial DNA and fluorescence melting curve analysis with locked nucleic acid probes.

    Science.gov (United States)

    Ahn, Jeong Jin; Kim, Youngjoo; Hong, Ji Young; Kim, Gi Won; Hwang, Seung Yong

    2016-07-01

    Velvet antlers are used medicinally in Asia and possess various therapeutic effects. Prices are set according to the country of origin, which is unidentifiable to the naked eye, and therefore counterfeiting is prevalent. Additionally, antlers of the Canadian elk, which can generate chronic wasting disease, are prevalently smuggled and distributed in the market. Thus, a method for identifying the country of origin of velvet antlers was developed, using polymorphisms in mitochondrial DNA, fluorescence melting curve analysis and analysis of locked nucleic acids (LNA). This combined method is capable of identifying five genotypes of velvet antlers in a single experiment using two probes. It also has advantages in multiplexing, simplicity and efficiency in genotyping, when compared to real-time PCR or microarrays. The developed method can be used to improve identification rates in the velvet antler market and, by extension, research based on polymorphisms in DNA sequences.

  1. An in silico analysis of the mitochondrial protein import apparatus of plants

    Directory of Open Access Journals (Sweden)

    Whelan James

    2010-11-01

    Full Text Available Abstract Background An in silico analysis of the mitochondrial protein import apparatus from a variety of species; including Chlamydomonas reinhardtii, Chlorella variabilis, Ectocarpus siliculosus, Cyanidioschyzon merolae, Physcomitrella patens, Selaginella moellendorffii, Picea glauca, Oryza sativa and Arabidopsis thaliana was undertaken to determine if components differed within and between plant and non-plant species. Results The channel forming subunits of the outer membrane components Tom40 and Sam50 are conserved between plant groups and other eukaryotes. In contrast, the receptor component(s in green plants, particularly Tom20, (C. reinhardtii, C. variabilis, P. patens, S. moellendorffii, P. glauca, O. sativa and A. thaliana are specific to this lineage. Red algae contain a Tom22 receptor that is orthologous to yeast Tom22. Furthermore, plant mitochondrial receptors display differences between various plant lineages. These are evidenced by distinctive motifs in all plant Metaxins, which are absent in red algae, and the presence of the outer membrane receptor OM64 in Angiosperms (rice and Arabidopsis, but not in lycophytes (S. moellendorffii and gymnosperms (P. glauca. Furthermore, although the intermembrane space receptor Mia40 is conserved across a wide phylogenetic range, its function differs between lineages. In all plant lineages, Tim17 contains a C-terminal extension, which may act as a receptor component for the import of nucleic acids into plant mitochondria. Conclusions It is proposed that the observed functional divergences are due to the selective pressure to sort proteins between mitochondria and chloroplasts, resulting in differences in protein receptor components between plant groups and other organisms. Additionally, diversity of receptor components is observed within the plant kingdom. Even when receptor components are orthologous across plant and non-plant species, it appears that the functions of these have expanded or

  2. Maternal inheritance in polyploid fish inferred from mitochondrial ATPase genes analysis

    Institute of Scientific and Technical Information of China (English)

    Jinpeng Yan; Xinhong Guo; Shaojun Liu; Jun Xiao; Zhen Liu; Yubao Chen; Yun Liu

    2009-01-01

    The sequences of the ATPase8/6 genes for the triploid, tetraploid and pentaploid hybrids as well as for their male parent blunt snout bream were determined. In order to examine mitochondrial maternal inheritance, the sequences were subjected to a comparative sequence analysis with the homologous sequences of red crucian carp, their female parent, and zebrafish as the outgroup. Base compo-sition and variation as well as the divergences based on nucleotide sequences and deduced amino acid sequences were calculated. Phy-logenetic trees were also constructed with maximum parsimony (MP), minimum evolution (ME), neighbor joining (NJ) and the unweighted pair group method with arithmetic mean (UPGMA) algorithms in MEGA 3.1. The results showed that most nucleotide sub-stitutions occurred at the third codon position of the two genes and thus represented synonymous mutations. The nucleotide sequence divergences of the ATPase8/6 genes ranged from 0.0% to 21.6% among ingroup samples (three types of polyploids and their parents), and 27.0-28.2% between their ingroup and the outgroup samples. All the polyploids were considerably closer in sequence relationship to the female parent red crucian carp (0.0-3.3%) compared to their male parent blunt snout bream (21.0-21.6%). The phylogenetic trees also showed a similar result. In conclusion, the mitochondrial ATPase8/6 genes of artificial polyploid fish stringently indicated maternal inheritance. Our results also suggested that the ATPase8/6 genes are valuable genetic markers to track genealogies and variations in the progenies of the hybrids.

  3. Quantitative analysis of mitochondrial RNA in goat-sheep cloned embryos.

    Science.gov (United States)

    Ma, Li-Bing; Yang, Li; Zhang, Yong; Cao, Jun-Wei; Hua, Song; Li, Ji-Xia

    2008-01-01

    Mitochondria are the key generators of cellular ATP, and contain extranuclear genome-mitochondrial DNA (mtDNA). In the process of nuclear transfer (NT), heteroplasmic sources of mtDNA from a donor cell and a recipient oocyte are mixed in the cytoplasm of the reconstituted embryo. Previous studies showed inconsistent patterns of mtDNA inheritance in offspring and early fetuses generated through interspecies NT. The quantitative analysis of mitochondrial RNA (mtRNA) in interspecies cloned embryos is useful for better understanding the fate of two types of mitochondria. The components of nicotinamide adenine dinucleotide (NADH) dehydrogenase were coded by both nuclear DNA (nDNA) and mtDNA. The Subunit 1 (ND-1) is one of seven NADH dehydrogenase subunits coded by mtDNA. In present study, using real-time and reverse-transcription PCR, the copy number of species-specific ND-1 mRNA was examined in goat-sheep cloned embryos of various developmental stages, and was applied to evaluate the expression pattern of species-specific mtDNA. The results of showed that (1) the expression of mtDNA derived from goat fetal fibroblast (GFF) decreased from 1-cell stage (immediately after fused) to 2-cell stage, and could not be detected from 4-cell stage onward to blastocyst stage; (2) the expression of mtDNA derived from sheep oocyte was roughly constant from 1-cell stage to the 8-cell stage, increased gradually from 16-cell stage, and sharply at morula and blastocyst stage. Moreover, we strongly argued a mechanism, that is GFF-derived mitochondria were degraded for the depression of bioenergetic functions, and then selectively eliminated during the embryogenesis of goat-sheep cloned embryos.

  4. Identification and evolutionary analysis of tissue-specific isoforms of mitochondrial complex I subunit NDUFV3.

    Science.gov (United States)

    Guerrero-Castillo, Sergio; Cabrera-Orefice, Alfredo; Huynen, Martijn A; Arnold, Susanne

    2017-03-01

    Mitochondrial complex I is the largest respiratory chain complex. Despite the enormous progress made studying its structure and function in recent years, potential regulatory roles of its accessory subunits remained largely unresolved. Complex I gene NDUFV3, which occurs in metazoa, contains an extra exon that is only present in vertebrates and thereby evolutionary even younger than the rest of the gene. Alternative splicing of this extra exon gives rise to a short NDUFV3-S and a long NDUFV3-L protein isoform. Complexome profiling revealed that the two NDUFV3 isoforms are constituents of the multi-subunit complex I. Further mass spectrometric analyses of complex I from different murine and bovine tissues showed a tissue-specific expression pattern of NDUFV3-S and NDUFV3-L. Hence, NDUFV3-S was identified as the only isoform in heart and skeletal muscle, whereas in liver, brain, and lung NDUFV3-L was expressed as the dominant isoform, together with NDUFV3-S present in all tissues analyzed. Thus, we identified NDUFV3 as the first out of 30 accessory subunits of complex I present in vertebrate- and tissue-specific isoforms. Interestingly, the tissue-specific expression pattern of NDUFV3-S and NDUFV3-L isoforms was paralleled by changes in kinetic parameters, especially the substrate affinity of complex I. This may indicate a regulatory role of the NDUFV3 isoforms in different vertebrate tissues.

  5. The determination and analysis of site-specific rates of mitochondrial reactive oxygen species production

    DEFF Research Database (Denmark)

    Quinlan, Casey L; Perevoschikova, Irina V; Goncalves, Renata L S;

    2013-01-01

    Mitochondrial reactive oxygen species (ROS) are widely implicated in physiological and pathological pathways. We propose that it is critical to understand the specific sites of mitochondrial ROS production and their mechanisms of action. Mitochondria possess at least eight distinct sites of ROS p...

  6. Characterization of mitochondrial DNA in various Candida species: isolation, restriction endonuclease analysis, size, and base composition.

    Science.gov (United States)

    Su, C S; Meyer, S A

    1991-01-01

    A practical and effective method for the extraction of mitochondrial DNA from Candida species was developed. Zymolyase was used to induce yeast protoplasts, and mitochondrial DNA was extracted from DNase I-treated mitochondrial preparations. Restriction endonuclease analyses of mitochondrial DNAs from 19 isolates representing seven species of Candida (C. albicans, C. kefyr, C. lusitaniae, C. maltosa, C. parapsilosis, C. shehatae, and C. tropicalis) and Lodderomyces elongisporus revealed different cleavage patterns that appeared to be specific for the species. Few common restriction fragments were evident. The genome sizes of the mitochondrial DNAs ranged from 26.4 to 51.4 kilobase pairs, and the guanine-plus-cytosine contents ranged from 20.7 to 36.8 mol%. There was no correlation between the base compositions of nuclear and mitochondrial DNAs. Eight isolates of C. parapsilosis, including the type culture, and an ascosporogenous strain of L. elongisporus, which was once proposed as the teleomorph of C. parapsilosis, had similar mitochondrial DNA molecular sizes (30.2 and 28.8 kilobase pairs); however, restriction endonuclease patterns of these organisms were distinct. These data provide additional support for discrimination of these two species. The results of our experiments demonstrate that mitochondrial DNA analyses may provide useful criteria for the differentiation of yeast species.

  7. Identifying Ecosystem Services of Rivers and Streams Through Content Analysis

    Science.gov (United States)

    While much ecosystem services research focuses on analysis such as mapping and/or valuation, fewer research efforts are directed toward in-depth understanding of the specific ecological quantities people value. Ecosystem service monitoring and analysis efforts and communications ...

  8. Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

    Directory of Open Access Journals (Sweden)

    Hou-min YIN

    2014-06-01

    Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

  9. Proteomic analysis indicates that mitochondrial energy metabolism in skeletal muscle tissue is negatively correlated with feed efficiency in pigs

    Science.gov (United States)

    Fu, Liangliang; Xu, Yueyuan; Hou, Ye; Qi, Xiaolong; Zhou, Lian; Liu, Huiying; Luan, Yu; Jing, Lu; Miao, Yuanxin; Zhao, Shuhong; Liu, Huazhen; Li, Xinyun

    2017-01-01

    Feed efficiency (FE) is a highly important economic trait in pig production. Investigating the molecular mechanisms of FE is essential for trait improvement. In this study, the skeletal muscle proteome of high-FE and low-FE pigs were investigated by the iTRAQ approach. A total of 1780 proteins were identified, among which 124 proteins were differentially expressed between the high- and low-FE pigs, with 74 up-regulated and 50 down-regulated in the high-FE pigs. Ten randomly selected differentially expressed proteins (DEPs) were validated by Western blotting and quantitative PCR (qPCR). Gene ontology (GO) analysis showed that all the 25 DEPs located in mitochondria were down-regulated in the high-FE pigs. Furthermore, the glucose-pyruvate-tricarboxylic acid (TCA)-oxidative phosphorylation energy metabolism signaling pathway was found to differ between high- and low-FE pigs. The key enzymes involved in the conversion of glucose to pyruvate were up-regulated in the high-FE pigs. Thus, our results suggested mitochondrial energy metabolism in the skeletal muscle tissue was negatively correlated with FE in pigs, and glucose utilization to generate ATP was more efficient in the skeletal muscle tissue of high-FE pigs. This study offered new targets and pathways for improvement of FE in pigs. PMID:28345649

  10. Analysis of differentially expressed mitochondrial proteins in chromophobe renal cell carcinomas and renal oncocytomas by 2-D gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Maria V. Yusenko, Thomas Ruppert, Gyula Kovacs

    2010-01-01

    Full Text Available Renal oncocytomas (RO and chromophobe renal cell carcinomas (RCC display morphological and functional alterations of the mitochondria. Previous studies showed that accumulation of mitochondria in ROs is associated with somatic mutations of mitochondrial DNA (mtDNA resulting in decreased activity of the respiratory chain complex I, whereas in chromophobe RCC only heteroplasmic mtDNA mutations were found. To identify proteins associated with these changes, for the first time we have compared the mitochondrial proteomes of mitochondria isolated from ROs and chromophobe RCCs as well as from normal kidney tissues by two-dimensional polyacrylamide gel electrophoresis. The proteome profiles were reproducible within the same group of tissues in subsequent experiments. The expression patterns within each group of samples were compared and 81 in-gel digested spots were subjected to nanoLC-MS/MS-based identification of proteins. Although the list of mitochondrial proteins identified in this study is incomplete, we identified the downregulation of NDUFS3 from complex I of the respiratory chain and upregulation of COX5A, COX5B, and ATP5H from complex IV and V in ROs. In chromophobe RCCs downregulation of ATP5A1, the alpha subunit of complex V, has been observed, but no changes in expression of other complexes of the respiratory chain were detected. To confirm the role of respiratory chain complex alterations in the morphological and/or functional changes in chromophobe RCCs and ROs, further studies will be necessary.

  11. Multiplexed high-content analysis of mitochondrial morphofunction using live-cell microscopy.

    Science.gov (United States)

    Iannetti, Eligio F; Smeitink, Jan A M; Beyrath, Julien; Willems, Peter H G M; Koopman, Werner J H

    2016-09-01

    Mitochondria have a central role in cellular (patho)physiology, and they display a highly variable morphology that is probably coupled to their functional state. Here we present a protocol that allows unbiased and automated quantification of mitochondrial 'morphofunction' (i.e., morphology and membrane potential), cellular parameters (size, confluence) and nuclear parameters (number, morphology) in intact living primary human skin fibroblasts (PHSFs). Cells are cultured in 96-well plates and stained with tetramethyl rhodamine methyl ester (TMRM), calcein-AM (acetoxy-methyl ester) and Hoechst 33258. Next, multispectral fluorescence images are acquired using automated microscopy and processed to extract 44 descriptors. Subsequently, the descriptor data are subjected to a quality control (QC) algorithm based upon principal component analysis (PCA) and interpreted using univariate, bivariate and multivariate analysis. The protocol requires a time investment of ∼4 h distributed over 2 d. Although it is specifically developed for PHSFs, which are widely used in preclinical research, the protocol is portable to other cell types and can be scaled up for implementation in high-content screening.

  12. Mitochondrial DNA analysis of Bronze Age horses recovered from Chifeng region, Inner Mongolia, China

    Institute of Scientific and Technical Information of China (English)

    Cai Dawei; Han Lu; Xie Chengzhi; Li Shengnan; Zhou Hui; Zhu Hong

    2007-01-01

    In this study, mitochondrial DNA (mtDNA) analysis was carried out on 9 Bronze Age horses recovered from Dashanqian and Jinggouzi archaeological sites in Chifeng region, Inner Mongolia, China to explore the origin of Chinese domestic horses. Both mtDNA 16S rRNA gene and control region (D-loop) fragments of ancient horses were amplified and sequenced. The analysis of the highly conservative 16S rRNA gene sequences indicated that the burial environment of Chifeng region is suitable for the preservation of ancient DNA (aDNA). Combing 465 mtDNA D-loop sequences representing different breeds from East Asia, Central Asia, Near East and Europe, we constructed a phylogenetic network to investigate the relationship between ancient and modern horses. The phylogenetic network showed that the 9 horses were distributed into different modem horse clusters which were closely related to them representing a certain ge-ographical distribution. Our results showed that the maternal genetic line of the ancient horses in Chifeng region was highly diversified,which contributed to the gene pool of modern domestic horses and suggested a complex origin of domestic horses in China.

  13. The first complete mitochondrial genome from Bostrychus genus (Bostrychus sinensis) and partitioned Bayesian analysis of Eleotridae fish phylogeny

    Indian Academy of Sciences (India)

    Tao Wei; Xiao Xiao Jin; Tian Jun Xu

    2013-08-01

    To understand the phylogenetic position of Bostrychus sinensis in Eleotridae and the phylogenetic relationships of the family, we determined the nucleotide sequence of the mitochondrial (mt) genome of Bostrychus sinensis. It is the first complete mitochondrial genome sequence of Bostrychus genus. The entire mtDNA sequence was 16508 bp in length with a standard set of 13 protein-coding genes, 22 transfer RNA genes (tRNAs), two ribosomal RNA genes (rRNAs) and a noncoding control region. The mitochondrial genome of B. sinensis had common features with those of other bony fishes with respect to gene arrangement, base composition, and tRNA structures. Phylogenetic hypotheses within Eleotridae fish have been controversial at the genus level. We used the mitochondrial cytochrome b (cytb) gene sequence to examine phylogenetic relationships of Eleotridae by using partitioned Bayesian method. When the specific models and parameter estimates were presumed for partitioning the total data, the harmonic mean –lnL was improved. The phylogenetic analysis supported the monophyly of Hypseleotris and Gobiomorphs. In addition, the Bostrychus were most closely related to Ophiocara, and the Philypnodon is also the sister to Microphlypnus, based on the current datasets. Further, extensive taxonomic sampling and more molecular information are needed to confirm the phylogenetic relationships in Eleotridae.

  14. Mitochondrial Diseases

    Science.gov (United States)

    ... disorder, something goes wrong with this process. Mitochondrial diseases are a group of metabolic disorders. Mitochondria are ... cells and cause damage. The symptoms of mitochondrial disease can vary. It depends on how many mitochondria ...

  15. Mitochondrial Myopathies

    Science.gov (United States)

    ... which stimulates normal beating of the heart. Cardiac muscle damage also may occur. People with mitochondrial disorders may need to have regular examina- tions by a cardiologist. Other potential health issues Some people with mitochondrial disease experience ...

  16. Mitochondrial haplogroups

    DEFF Research Database (Denmark)

    Benn, Marianne; Schwartz, Marianne; Nordestgaard, Børge G;

    2008-01-01

    Rare mutations in the mitochondrial genome may cause disease. Mitochondrial haplogroups defined by common polymorphisms have been associated with risk of disease and longevity. We tested the hypothesis that common haplogroups predict risk of ischemic cardiovascular disease, morbidity from other...

  17. Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients

    Energy Technology Data Exchange (ETDEWEB)

    Brown, M.D.; Shoffner, J.M.; Wallace, D.C. [Emory Univ. School of Medicine, Atlanta, GA (United States)] [and others

    1996-01-22

    The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients or 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.

  18. Use of Photogrammetry and Biomechanical Gait analysis to Identify Individuals

    DEFF Research Database (Denmark)

    Larsen, Peter Kastmand; Simonsen, Erik Bruun; Lynnerup, Niels

    Photogrammetry and recognition of gait patterns are valuable tools to help identify perpetrators based on surveillance recordings. We have found that stature but only few other measures have a satisfying reproducibility for use in forensics. Several gait variables with high recognition rates were...

  19. Similarity transformation approach to identifiability analysis of nonlinear compartmental models.

    Science.gov (United States)

    Vajda, S; Godfrey, K R; Rabitz, H

    1989-04-01

    Through use of the local state isomorphism theorem instead of the algebraic equivalence theorem of linear systems theory, the similarity transformation approach is extended to nonlinear models, resulting in finitely verifiable sufficient and necessary conditions for global and local identifiability. The approach requires testing of certain controllability and observability conditions, but in many practical examples these conditions prove very easy to verify. In principle the method also involves nonlinear state variable transformations, but in all of the examples presented in the paper the transformations turn out to be linear. The method is applied to an unidentifiable nonlinear model and a locally identifiable nonlinear model, and these are the first nonlinear models other than bilinear models where the reason for lack of global identifiability is nontrivial. The method is also applied to two models with Michaelis-Menten elimination kinetics, both of considerable importance in pharmacokinetics, and for both of which the complicated nature of the algebraic equations arising from the Taylor series approach has hitherto defeated attempts to establish identifiability results for specific input functions.

  20. Identifying failure mechanisms in LDMOS transistors by analytical stability analysis

    NARCIS (Netherlands)

    Ferrara, A.; Steeneken, P.G.; Boksteen, B.K.; Heringa, A.; Scholten, A.J.; Schmitz, J.; Hueting, R.J.E.

    2014-01-01

    In this work, analytical stability equations are derived and combined with a physics-based model of an LDMOS transistor in order to identify the primary cause of failure in different operating and bias conditions. It is found that there is a gradual boundary between an electrical failure region at h

  1. Mitochondrial genetics

    OpenAIRE

    Chinnery, Patrick Francis; Hudson, Gavin

    2013-01-01

    Introduction In the last 10 years the field of mitochondrial genetics has widened, shifting the focus from rare sporadic, metabolic disease to the effects of mitochondrial DNA (mtDNA) variation in a growing spectrum of human disease. The aim of this review is to guide the reader through some key concepts regarding mitochondria before introducing both classic and emerging mitochondrial disorders. Sources of data In this article, a review of the current mitochondrial genetics literature was con...

  2. Isolated respiratory chain enzyme deficiency in patients with a mitochondrial (encephalo-) myopathy: Sequence analysis of the mitochondrial complex and IV genes

    Energy Technology Data Exchange (ETDEWEB)

    Vries, D. de; Coo, I. de; Buddiger, P. [University Hospital Nijmegen (Netherlands)] [and others

    1994-09-01

    The mitochondrial respiratory chain consists of four enzyme complexes. Deficiencies of complex I (NADH dehydrogenase) and complex IV (cytochrome c oxidase) are frequently found in muscle biopsies from patients with a mitochondrial (encephalo-)myopathy. Mutations in the mitochondrial-encoded subunits have been observed in a number of different mitochondrial (encephalo-)myophathies. We screened eight mitochondrial (encephalo-)myopathy patients with an isolated complex I deficiency for mutations in the ND genes by direct sequencing. No abnormality was detected. We also studied 9 mitochondrial (encephalo-)myopathy patients and an isolated complex IV deficiency. In the muscle biopsy of one patient a novel heteroplasmic mutation (T {r_arrow} C) at nucleotide position 6681 was found in the mitochondrial COX I gene. This mutation led to the substitution of a conserved Tyr for His. As this mutation changed the secondary structure of the protein and was not found in the healthy mother, we consider it likely that this mutation is pathological. In the other patients no abnormality was detected. Therefore, mutations in the mitochondrially-encoded subunits are not a frequent cause of isolated respiratory chain enzyme deficiency.

  3. Identifying news clusters using Q-analysis and modularity

    OpenAIRE

    2013-01-01

    With online publication and social media taking the main role in dissemination of news, and with the decline of traditional printed media, it has become necessary to devise ways to automatically extract meaningful information from the plethora of sources available and to make that information readily available to interested parties. In this paper we present a method of automated analysis of the underlying structure of online newspapers based on Q-analysis and modularity. We show how the combi...

  4. A multiway analysis for identifying high integrity bovine BACs

    OpenAIRE

    McEwan John C; Brauning Rudiger; McWilliam Sean; Barris Wesley; Ratnakumar Abhirami; Snelling Warren M; Dalrymple Brian P

    2009-01-01

    Abstract Background In large genomics projects involving many different types of analyses of bacterial artificial chromosomes (BACs), such as fingerprinting, end sequencing (BES) and full BAC sequencing there are many opportunities for the identities of BACs to become confused. However, by comparing the results from the different analyses, inconsistencies can be identified and a set of high integrity BACs preferred for future research can be defined. Results The location of each bovine BAC in...

  5. Identifiability analysis of the CSTR river water quality model.

    Science.gov (United States)

    Chen, J; Deng, Y

    2006-01-01

    Conceptual river water quality models are widely known to lack identifiability. The causes for that can be due to model structure errors, observational errors and less frequent samplings. Although significant efforts have been directed towards better identification of river water quality models, it is not clear whether a given model is structurally identifiable. Information is also limited regarding the contribution of different unidentifiability sources. Taking the widely applied CSTR river water quality model as an example, this paper presents a theoretical proof that the CSTR model is indeed structurally identifiable. Its uncertainty is thus dominantly from observational errors and less frequent samplings. Given the current monitoring accuracy and sampling frequency, the unidentifiability from sampling frequency is found to be more significant than that from observational errors. It is also noted that there is a crucial sampling frequency between 0.1 and 1 day, over which the simulated river system could be represented by different illusions and the model application could be far less reliable.

  6. The complete mitochondrial genome of the Yorkshire pig (Sus scrofa).

    Science.gov (United States)

    Xu, Dong; Yang, Hu; Ma, Haiming

    2016-01-01

    This study aims to identify the complete nucleotide sequence of mitochondrial genome in the Yorkshire pig. Sequence analysis indicates that the genome structure is in accordance with other pig breeds, and it contains 22 tRNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and 1 control region (D-loop region). The complete mitochondrial genome sequence of the Yorkshire pig provides an important record set for further study on genetic mechanism.

  7. Evolution of mitochondrial gene orders in echinoderms.

    Science.gov (United States)

    Perseke, Marleen; Fritzsch, Guido; Ramsch, Kai; Bernt, Matthias; Merkle, Daniel; Middendorf, Martin; Bernhard, Detlef; Stadler, Peter F; Schlegel, Martin

    2008-05-01

    A comprehensive analysis of the mitochondrial gene orders of all previously published and two novel Antedon mediterranea (Crinoidea) and Ophiura albida (Ophiuroidea) complete echinoderm mitochondrial genomes shows that all major types of rearrangement operations are necessary to explain the evolution of mitochondrial genomes. In addition to protein coding genes we include all tRNA genes as well as the control region in our analysis. Surprisingly, 7 of the 16 genomes published in the GenBank database contain misannotations, mostly unannotated tRNAs and/or mistakes in the orientation of tRNAs, which we have corrected here. Although the gene orders of mt genomes appear very different, only 8 events are necessary to explain the evolutionary history of echinoderms with the exception of the ophiuroids. Only two of these rearrangements are inversions, while we identify three tandem-duplication-random-loss events and three transpositions.

  8. Subunit analysis of mitochondrial cytochrome c oxidase and cytochrome bc1 by reversed-phase high-performance liquid chromatography.

    Science.gov (United States)

    Kesa, Peter; Bhide, Mangesh; Lysakova, Veronika; Musatov, Andrey

    2017-01-01

    A rapid separation of the ten nuclearly-encoded subunits of mitochondrial cytochrome c oxidase, and ten out of the eleven subunits of cytochrome bc1, was achieved using a short, 50 mm C18-reversed-phase column. The short column decreased the elution time 4-7 fold while maintaining the same resolution quality. Elution was similar to a previously published protocol, i.e., a water/acetonitrile elution gradient containing trifluoroacetic acid. Isolated subunits were identified by MALDI-TOF. The rapidity of the described method makes it extremely useful for determining the subunit composition of isolated mitochondrial complexes. The method can be used for both analytical and micro-preparative purposes.

  9. Mitochondrial ascorbate-glutathione cycle and proteomic analysis of carbonylated proteins during tomato (Solanum lycopersicum) fruit ripening.

    Science.gov (United States)

    López-Vidal, O; Camejo, D; Rivera-Cabrera, F; Konigsberg, M; Villa-Hernández, J M; Mendoza-Espinoza, J A; Pérez-Flores, L J; Sevilla, F; Jiménez, A; Díaz de León-Sánchez, F

    2016-03-01

    In non-photosynthetic tissues, mitochondria are the main source of energy and of reactive oxygen species. Accumulation of high levels of these species in the cell causes damage to macromolecules including several proteins and induces changes in different metabolic processes. Fruit ripening has been characterized as an oxidative phenomenon; therefore, control of reactive oxygen species levels by mitochondrial antioxidants plays a crucial role on this process. In this work, ascorbate-glutathione cycle components, hydrogen peroxide levels and the proteomic profile of carbonylated proteins were analyzed in mitochondria isolated from tomato (Solanum lycopersicum) fruit at two ripening stages. A significant increase on most ascorbate-glutathione cycle components and on carbonylated proteins was observed in mitochondria from breaker to light red stage. Enzymes and proteins involved in diverse cellular and mitochondrial metabolic pathways were identified among the carbonylated proteins. These results suggest that protein carbonylation is a post-translational modification involved in tomato fruit ripening regulation.

  10. Using Factor Analysis to Identify Topic Preferences Within MBA Courses

    Directory of Open Access Journals (Sweden)

    Earl Chrysler

    2003-02-01

    Full Text Available This study demonstrates the role of a principal components factor analysis in conducting a gap analysis as to the desired characteristics of business alumni. Typically, gap analyses merely compare the emphases that should be given to areas of inquiry with perceptions of actual emphases. As a result, the focus is upon depth of coverage. A neglected area in need of investigation is the breadth of topic dimensions and their differences between the normative (should offer and the descriptive (actually offer. The implications of factor structures, as well as traditional gap analyses, are developed and discussed in the context of outcomes assessment.

  11. A phylogenetic analysis of the emberizid sparrows based on three mitochondrial genes.

    Science.gov (United States)

    Carson, Rebecca J; Spicer, Greg S

    2003-10-01

    Previous molecular phylogenetic studies have examined the taxonomic relationships among a number of typical emberizid sparrow genera. To help clarify these relationships, we sequenced a 1673 base pair fragment for the complete sequence of three mitochondrial genes: adenosine triphosphatase (Atp8 and Atp6) and cytochrome oxidase subunit III (COIII) for 38 sparrow species, along with Passerina amoena (Cardinalidae) and Piranga ludoviciana (Thraupidae) which were selected as the outgroups. Our analysis confirms the monophyly of traditional genera such as Junco, Melospiza, and Zonotrichia. Although Calcarius and Plectrophenax are often thought to be putative emberizids, all our analyses placed these genera basal to all other sparrows examined. As observed with Calcarius, Spizella did not form a monophyletic group, with S. arborea being the sister-taxon to Passerella iliaca. Our analyses also suggest that Aimophila ruficeps is probably more closely related to the "brown towhees" (Pipilo aberti, P. crissalis, and P. fuscus) than its putative congeners. The genus Ammodramus was also not monophyletic, since it appears that Passerculus sandwichensis is more closely related to A. henslowii and A. leconteii then either one is related to its congener A. savannarum. Finally, our analyses exhibited other unsuspected associations, such as the sister-taxon relationships between Amphispiza bilineata and the Chondestes grammacus/Calamospiza melanocorys clade, and Amphispiza belli and Pooecetes gramineus.

  12. Assembly and comparative analysis of complete mitochondrial genome sequence of an economic plant Salix suchowensis

    Directory of Open Access Journals (Sweden)

    Ning Ye

    2017-03-01

    Full Text Available Willow is a widely used dioecious woody plant of Salicaceae family in China. Due to their high biomass yields, willows are promising sources for bioenergy crops. In this study, we assembled the complete mitochondrial (mt genome sequence of S. suchowensis with the length of 644,437 bp using Roche-454 GS FLX Titanium sequencing technologies. Base composition of the S. suchowensis mt genome is A (27.43%, T (27.59%, C (22.34%, and G (22.64%, which shows a prevalent GC content with that of other angiosperms. This long circular mt genome encodes 58 unique genes (32 protein-coding genes, 23 tRNA genes and 3 rRNA genes, and 9 of the 32 protein-coding genes contain 17 introns. Through the phylogenetic analysis of 35 species based on 23 protein-coding genes, it is supported that Salix as a sister to Populus. With the detailed phylogenetic information and the identification of phylogenetic position, some ribosomal protein genes and succinate dehydrogenase genes are found usually lost during evolution. As a native shrub willow species, this worthwhile research of S. suchowensis mt genome will provide more desirable information for better understanding the genomic breeding and missing pieces of sex determination evolution in the future.

  13. Statistical analysis of post mortem DNA damage-derived miscoding lesions in Neandertal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Gigli Elena

    2008-07-01

    Full Text Available Abstract Background We have analysed the distribution of post mortem DNA damage derived miscoding lesions from the datasets of seven published Neandertal specimens that have extensive cloned sequence coverage over the mitochondrial DNA (mtDNA hypervariable region 1 (HVS1. The analysis was restricted to C→T and G→A miscoding lesions (the predominant manifestation of post mortem damage that are seen at a frequency of more than one clone among sequences from a single PCR, but do not represent the true endogenous sequence. Findings The data indicates an extreme bias towards C→T over G→A miscoding lesions (observed ratio of 67:2 compared to an expected ratio of 7:2, implying that the mtDNA Light strand molecule suffers proportionally more damage-derived miscoding lesions than the Heavy strand. Conclusion The clustering of Cs in the Light strand as opposed to the singleton pattern of Cs in the Heavy strand could explain the observed bias, a phenomenon that could be further tested with non-PCR based approaches. The characterization of the HVS1 hotspots will be of use to future Neandertal mtDNA studies, with specific regards to assessing the authenticity of new positions previously unknown to be polymorphic.

  14. Sequence and analysis of the mitochondrial DNA control region in the sugarcane borer Diatraea saccharalis (Lepidoptera: Crambidae

    Directory of Open Access Journals (Sweden)

    Juliana Pereira Bravo

    2008-08-01

    Full Text Available This study aimed at the sequence and analysis of the mtDNA control region (CR of the Diatraea saccharalis. The genome PCR amplification was performed using the complementary primers to the flanking regions of Bombyx mori CR mitochondrial segment. The sequencing revealed that the amplified product was 568 bp long, which was smaller than that observed for B. mori (725 bp. Within the amplified segment, a sequence with 338 nucleotides was identified as the control region, which displayed a high AT content (93.5%. The D. saccharalis mtDNA CR multiple sequence alignment analysis showed that this region had high similarity with the Lepidoptera Cydia pomonella.A broca da cana, Diatraea saccharalis pertence à família dos lepidópteros. A presença da larva pode ser extremamente destrutiva, chegando a inviabilizar a atividade canavieira, causando prejuízos consideráveis à agroindústria sucro-alcooleira. Atualmente a broca da cana vem sendo extinta da plantação por métodos de controle biológico, entretanto a evolução desses programas depende de maiores conhecimentos básicos da biologia molecular deste inseto. O estudo do segmento do genoma mitocondrial denominado região controle é amplamente utilizado em análises genéticas e filogenéticas em insetos. O objetivo desse trabalho foi sequenciar e analisar a região controle do genoma mitocondrial de Diatraea saccharalis. Esse segmento apresentou 338 nucleotídeos, menor que o observado em Bombyx mori, com conteúdo de 93,5% de A/T. As analises realizadas mostraram que Diatraea saccharalis apresenta 76% de similaridade com Cydia pomonella.

  15. Identifying Effective Psychological Treatments of Insomnia: A Meta-Analysis.

    Science.gov (United States)

    Murtagh, Douglas R. R.; Greenwood, Kenneth M.

    1995-01-01

    Clarified efficacy of psychological treatments for insomnia through a meta-analysis of 66 outcome studies representing 139 treatment groups. Psychological treatments produced considerable enhancement of both sleep patterns and the subjective experience of sleep. Participants who were clinically referred and who did not regularly use sedatives…

  16. Using Rasch Analysis to Identify Uncharacteristic Responses to Undergraduate Assessments

    Science.gov (United States)

    Edwards, Antony; Alcock, Lara

    2010-01-01

    Rasch Analysis is a statistical technique that is commonly used to analyse both test data and Likert survey data, to construct and evaluate question item banks, and to evaluate change in longitudinal studies. In this article, we introduce the dichotomous Rasch model, briefly discussing its assumptions. Then, using data collected in an…

  17. Temperature-based Instanton Analysis: Identifying Vulnerability in Transmission Networks

    Energy Technology Data Exchange (ETDEWEB)

    Kersulis, Jonas [Univ. of Michigan, Ann Arbor, MI (United States); Hiskens, Ian [Univ. of Michigan, Ann Arbor, MI (United States); Chertkov, Michael [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Backhaus, Scott N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bienstock, Daniel [Columbia Univ., New York, NY (United States)

    2015-04-08

    A time-coupled instanton method for characterizing transmission network vulnerability to wind generation fluctuation is presented. To extend prior instanton work to multiple-time-step analysis, line constraints are specified in terms of temperature rather than current. An optimization formulation is developed to express the minimum wind forecast deviation such that at least one line is driven to its thermal limit. Results are shown for an IEEE RTS-96 system with several wind-farms.

  18. Mitochondrial DNA analysis of 114 hairs measuring less than 1 cm from a 19-year-old homicide

    Directory of Open Access Journals (Sweden)

    Melton Terry

    2012-07-01

    Full Text Available Abstract Background Mitochondrial DNA analysis is typically applied to degraded skeletal remains and telogen or rootless hairs. Data on the application of the method to very small hairs less than 0.5 cm from an age-matched and -challenged sample set are lacking. Methods One hundred fourteen hairs sized less than 1 cm from a 1993 case were analyzed for mitochondrial DNA according to laboratory standard operating procedures. For some hairs, a screening approach was applied, which permitted some samples, such as victim hairs on victim clothing, to be eliminated from the process quickly. Degraded samples were amplified with “mini-primers,” and 12S species testing was applied when non-human hairs were encountered. Results Partial to full control region human mitochondrial DNA profiles or species identifications (non-human species were obtained from 93% of hairs under 1 cm, 92% of hairs under 5 mm, and 90% of hairs under 3.5 mm. Nineteen of 21 hairs 2 mm or less gave full or partial profiles. Among 128 hairs of all sizes tested in the case, 9 gave no results, 3 were canine in origin, and 73 did not exclude six known individuals tested in the case. Twenty-two hairs had nine additional profiles that were observed two or more times each. Twenty-one hairs showed singleton types not matching each other or any individual. Conclusions Crime scene hairs that are both aged and small are often judged to be unsuitable for either hair microscopy or DNA analysis. This study of age-matched challenged small hairs indicates that even the smallest probative crime scene hairs are suitable for mitochondrial DNA analysis and can provide useful data.

  19. Compartmental analysis of dynamic nuclear medicine data: models and identifiability

    Science.gov (United States)

    Delbary, Fabrice; Garbarino, Sara; Vivaldi, Valentina

    2016-12-01

    Compartmental models based on tracer mass balance are extensively used in clinical and pre-clinical nuclear medicine in order to obtain quantitative information on tracer metabolism in the biological tissue. This paper is the first of a series of two that deal with the problem of tracer coefficient estimation via compartmental modelling in an inverse problem framework. Specifically, here we discuss the identifiability problem for a general n-dimension compartmental system and provide uniqueness results in the case of two-compartment and three-compartment compartmental models. The second paper will utilize this framework in order to show how nonlinear regularization schemes can be applied to obtain numerical estimates of the tracer coefficients in the case of nuclear medicine data corresponding to brain, liver and kidney physiology.

  20. Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J

    2012-07-01

    Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.

  1. Quantitative analysis of mitochondrial morphology and membrane potential in living cells using high-content imaging, machine learning, and morphological binning.

    Science.gov (United States)

    Leonard, Anthony P; Cameron, Robert B; Speiser, Jaime L; Wolf, Bethany J; Peterson, Yuri K; Schnellmann, Rick G; Beeson, Craig C; Rohrer, Bärbel

    2015-02-01

    Understanding the processes of mitochondrial dynamics (fission, fusion, biogenesis, and mitophagy) has been hampered by the lack of automated, deterministic methods to measure mitochondrial morphology from microscopic images. A method to quantify mitochondrial morphology and function is presented here using a commercially available automated high-content wide-field fluorescent microscopy platform and R programming-language-based semi-automated data analysis to achieve high throughput morphological categorization (puncta, rod, network, and large & round) and quantification of mitochondrial membrane potential. In conjunction with cellular respirometry to measure mitochondrial respiratory capacity, this method detected that increasing concentrations of toxicants known to directly or indirectly affect mitochondria (t-butyl hydroperoxide [TBHP], rotenone, antimycin A, oligomycin, ouabain, and carbonyl cyanide-p-trifluoromethoxyphenylhydrazone [FCCP]), decreased mitochondrial networked areas in cultured 661w cells to 0.60-0.80 at concentrations that inhibited respiratory capacity to 0.20-0.70 (fold change compared to vehicle). Concomitantly, mitochondrial swelling was increased from 1.4- to 2.3-fold of vehicle as indicated by changes in large & round areas in response to TBHP, oligomycin, or ouabain. Finally, the automated identification of mitochondrial location enabled accurate quantification of mitochondrial membrane potential by measuring intramitochondrial tetramethylrhodamine methyl ester (TMRM) fluorescence intensity. Administration of FCCP depolarized and administration of oligomycin hyperpolarized mitochondria, as evidenced by changes in intramitochondrial TMRM fluorescence intensities to 0.33- or 5.25-fold of vehicle control values, respectively. In summary, this high-content imaging method accurately quantified mitochondrial morphology and membrane potential in hundreds of thousands of cells on a per-cell basis, with sufficient throughput for pharmacological

  2. Mitochondrial vasculopathy

    Institute of Scientific and Technical Information of China (English)

    Josef Finsterer; Sinda Zarrouk-Mahjoub

    2016-01-01

    Mitochondrial disorders(MIDs)are usually multisystem disorders(mitochondrial multiorgan disorder syndrome)either on from onset or starting at a point during the disease course.Most frequently affected tissues are those with a high oxygen demand such as the central nervous system,the muscle,endocrine glands,or the myocardium.Recently,it has been shown that rarely alsothe arteries may be affected(mitochondrial arteriopathy).This review focuses on the type,diagnosis,and treat-ment of mitochondrial vasculopathy in MID patients.A literature search using appropriate search terms was carried out.Mitochondrial vasculopathy manifests as either microangiopathy or macroangiopathy.Clinical manifestations of mitochondrial microangiopathy include leukoencephalopathy,migraine-like headache,stroke-like episodes,or peripheral retinopathy.Mitochondrial macroangiopathy manifests as atherosclerosis,ectasia of arteries,aneurysm formation,dissection,or spontan-eous rupture of arteries.The diagnosis relies on the documentation and confirmation of the mitochondrial metabolic defect or the genetic cause after exclusion of non-MID causes.Treatment is not at variance compared to treatment of vasculopathy due to non-MID causes.Mitochondrial vasculopathy exists and manifests as micro-or macroangiopathy.Diagnosing mitochondrial vasculopathy is crucial since appropriate treatment may prevent from severe complications.

  3. Genome analysis reveals interplay between 5'UTR introns and nuclear mRNA export for secretory and mitochondrial genes.

    Directory of Open Access Journals (Sweden)

    Can Cenik

    2011-04-01

    Full Text Available In higher eukaryotes, messenger RNAs (mRNAs are exported from the nucleus to the cytoplasm via factors deposited near the 5' end of the transcript during splicing. The signal sequence coding region (SSCR can support an alternative mRNA export (ALREX pathway that does not require splicing. However, most SSCR-containing genes also have introns, so the interplay between these export mechanisms remains unclear. Here we support a model in which the furthest upstream element in a given transcript, be it an intron or an ALREX-promoting SSCR, dictates the mRNA export pathway used. We also experimentally demonstrate that nuclear-encoded mitochondrial genes can use the ALREX pathway. Thus, ALREX can also be supported by nucleotide signals within mitochondrial-targeting sequence coding regions (MSCRs. Finally, we identified and experimentally verified novel motifs associated with the ALREX pathway that are shared by both SSCRs and MSCRs. Our results show strong correlation between 5' untranslated region (5'UTR intron presence/absence and sequence features at the beginning of the coding region. They also suggest that genes encoding secretory and mitochondrial proteins share a common regulatory mechanism at the level of mRNA export.

  4. Meconium microbiome analysis identifies bacteria correlated with premature birth.

    Directory of Open Access Journals (Sweden)

    Alexandria N Ardissone

    Full Text Available Preterm birth is the second leading cause of death in children under the age of five years worldwide, but the etiology of many cases remains enigmatic. The dogma that the fetus resides in a sterile environment is being challenged by recent findings and the question has arisen whether microbes that colonize the fetus may be related to preterm birth. It has been posited that meconium reflects the in-utero microbial environment. In this study, correlations between fetal intestinal bacteria from meconium and gestational age were examined in order to suggest underlying mechanisms that may contribute to preterm birth.Meconium from 52 infants ranging in gestational age from 23 to 41 weeks was collected, the DNA extracted, and 16S rRNA analysis performed. Resulting taxa of microbes were correlated to clinical variables and also compared to previous studies of amniotic fluid and other human microbiome niches.Increased detection of bacterial 16S rRNA in meconium of infants of <33 weeks gestational age was observed. Approximately 61·1% of reads sequenced were classified to genera that have been reported in amniotic fluid. Gestational age had the largest influence on microbial community structure (R = 0·161; p = 0·029, while mode of delivery (C-section versus vaginal delivery had an effect as well (R = 0·100; p = 0·044. Enterobacter, Enterococcus, Lactobacillus, Photorhabdus, and Tannerella, were negatively correlated with gestational age and have been reported to incite inflammatory responses, suggesting a causative role in premature birth.This provides the first evidence to support the hypothesis that the fetal intestinal microbiome derived from swallowed amniotic fluid may be involved in the inflammatory response that leads to premature birth.

  5. Yeast mitochondrial protein-protein interactions reveal diverse complexes and disease-relevant functional relationships.

    Science.gov (United States)

    Jin, Ke; Musso, Gabriel; Vlasblom, James; Jessulat, Matthew; Deineko, Viktor; Negroni, Jacopo; Mosca, Roberto; Malty, Ramy; Nguyen-Tran, Diem-Hang; Aoki, Hiroyuki; Minic, Zoran; Freywald, Tanya; Phanse, Sadhna; Xiang, Qian; Freywald, Andrew; Aloy, Patrick; Zhang, Zhaolei; Babu, Mohan

    2015-02-06

    Although detailed, focused, and mechanistic analyses of associations among mitochondrial proteins (MPs) have identified their importance in varied biological processes, a systematic understanding of how MPs function in concert both with one another and with extra-mitochondrial proteins remains incomplete. Consequently, many questions regarding the role of mitochondrial dysfunction in the development of human disease remain unanswered. To address this, we compiled all existing mitochondrial physical interaction data for over 1200 experimentally defined yeast MPs and, through bioinformatic analysis, identified hundreds of heteromeric MP complexes having extensive associations both within and outside the mitochondria. We provide support for these complexes through structure prediction analysis, morphological comparisons of deletion strains, and protein co-immunoprecipitation. The integration of these MP complexes with reported genetic interaction data reveals substantial crosstalk between MPs and non-MPs and identifies novel factors in endoplasmic reticulum-mitochondrial organization, membrane structure, and mitochondrial lipid homeostasis. More than one-third of these MP complexes are conserved in humans, with many containing members linked to clinical pathologies, enabling us to identify genes with putative disease function through guilt-by-association. Although still remaining incomplete, existing mitochondrial interaction data suggests that the relevant molecular machinery is modular, yet highly integrated with non-mitochondrial processes.

  6. Phylogenetic Analysis of Cynoglossidae in the Yangtze Estuary Based on Partial Sequence of Mitochondrial COⅠ

    Institute of Scientific and Technical Information of China (English)

    Song Chao; Yu Yanan; Zhang Tao; Yang Gang; Zhang Longzhen

    2015-01-01

    To determine the role of mitochondrial COⅠgene in classification and identification of species,a total of 39 single individuals from nine species pertaining to two genera of Cynoglossidae in the Yangtze Estuary were barcoded by COⅠ,sequenced and compared with that of other Cynoglossidae species recorded in the Gen Bank. Total genomic DNA was extracted from each scale sample using the classic phenol / chloroform extraction method. Six hundred and fifty base pairs( bp)COⅠfragments were amplified using the primers ’i. e. ’ F1: 5’- TCA ACC AAC CAC AAA GAC ATT GGC AC- 3’,R1: 5’- TAG ACT TCT GGG TGG CCA AAG AAT CA- 3’. Every PCR amplification was performed in a total volume of 50 μL of PCR mixture. PCR products were purified and then sequenced in both forward and reverse directions using an ABI PRISMTM 3730 XL Automated Sequencer. DNA sequences were aligned with clustal W using default parameters. Base composition,variable and parsimony informative sites were determined using MEGA 5. 0. Neighbor- joining( NJ) and Maximum parsimony( MP) phylogenetic trees were constructed for COⅠhaplotypes( Kimura 2 Parameter substitution model,K2P; 1 000 bootstraps pseudoreplications) using MEGA 5. 0. Using the MEGA5. 0 software for statistical analysis,the averaged AT content was greater than the GC content( Tab. 2). The GC content of codon position 1 averaged 53. 8%( 51. 8%-57. 3%),which of position 2 for 42. 0%,and that of position 3 ranged from 28. 1% to 37. 8% in average of 32. 4%( Tab. 4). The transitional pairs( si) was slightly more than the transversional pairs( sv),and the ratio( R = si/sv) was 1. 45( Tab. 3). Analysis of the frequency of amino acids in COⅠgene encoding protein showed that the highest frequency of amino acid was leucine,and the lowest frequency of amino acid was tryptophan( Tab. 5). The average K2 P distances pairwise-species and within-species were 0. 191 and 0. 003,respectively( Tab. 6). The K2 P distance pairwise-species was 63. 7

  7. Complete mitochondrial genome phylogeographic analysis of killer whales (Orcinus orca) indicates multiple species

    DEFF Research Database (Denmark)

    Morin, Phillip A; Archer, Frederick I.; Foote, Andrew David

    2010-01-01

    Killer whales (Orcinus orca) currently comprise a single, cosmopolitan species with a diverse diet. However, studies over the last 30 yr have revealed populations of sympatric "ecotypes" with discrete prey preferences, morphology, and behaviors. Although these ecotypes avoid social interactions...... and are not known to interbreed, genetic studies to date have found extremely low levels of diversity in the mitochondrial control region, and few clear phylogeographic patterns worldwide. This low level of diversity is likely due to low mitochondrial mutation rates that are common to cetaceans. Using killer whales...... as a case study, we have developed a method to readily sequence, assemble, and analyze complete mitochondrial genomes from large numbers of samples to more accurately assess phylogeography and estimate divergence times. This represents an important tool for wildlife management, not only for killer whales...

  8. Determination and analysis of the complete mitochondrial genome sequence of Taoyuan chicken.

    Science.gov (United States)

    Liu, Li-Li; Xie, Hong-Bing; Yu, Qi-Fang; He, Shao-Ping; He, Jian-Hua

    2016-01-01

    Taoyuan chicken is excellent native breeds in China. This study firstly determined the complete mitochondrial genome sequence of Taoyuan chicken using PCR-based amplification and Sanger sequencing. The characteristic of the entire mitochondrial genome was analyzed in detail, with the base composition of 30.26% A, 23.79% T, 32.44% C, 13.50% G in the Taoyuan chicken (16,784 bp in length). It contained 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and a major non-coding control region (D-loop region). The complete mitochondrial genome sequence of Taoyuan chicken will be useful for the phylogenetics of poultry, and be available as basic data for the genetics and breeding.

  9. Genetic diversity analysis of Arius manillensis (Siluriformes: Ariidae) using the mitochondrial control region.

    Science.gov (United States)

    Santos, Brian S; Quilang, Jonas P

    2012-04-01

    Arius manillensis is a Philippine endemic species and is an economically important fishery resource in Laguna de Bay, the largest lake in the country. Drastic reduction in population sizes of A. manillensis has been recorded in the past, which may have resulted in genetic bottleneck. In this study, the genetic diversity and population structure of A. manillensis in Laguna de Bay were assessed using the mitochondrial DNA control region. Specimens were obtained from three localities along Laguna de Bay, namely Binangonan (n = 27), Tanay (n = 29), and Calamba (n = 30). Of the 86 DNA sequences generated, 22 distinct haplotypes were observed. There were four unique haplotypes for Binangonan, six for Calamba, and five for Tanay. There were two haplotypes common to the three sites. The maximum likelihood tree and median-joining network showed little geographic separation among the haplotypes. Chi-square test showed no significant differentiation in A. manillensis from the three sites. The overall computed F(ST) was 0.0144, indicating small genetic differentiation in A. manillensis from the three localities sampled. Likewise, analysis of molecular variance showed a greater percentage of variation within population (98.62%) than variation among populations (1.38%; P = 0.21). Total haplotype diversity and nucleotide diversity among the specimens from the three sites were 0.775 and 0.013, respectively. The high haplotype diversity coupled with low nucleotide diversity observed in this study confirms that genetic bottleneck occurred in A. manillensis which was followed by population expansion. This is also supported by the non-significant values for both Tajima's D and Fu's F. Furthermore, multimodal mismatch distribution plots were generated, which is consistent with the model of spatial range expansion followed by demographic expansion.

  10. RAPD and mitochondrial DNA analysis of the soybean stalk weevil, Sternechus subsignatus (Coleoptera: Curculionidae).

    Science.gov (United States)

    Sosa-Gomez, D R; Coronel, N; Binneck, E; Zucchi, M I; Rosado-Neto, G

    2008-10-01

    Sternechus subsignatus Boheman (Curculionidae: Sternechini) is one of the primary Curculionidae species that reduces soybean yield in Brazil. Initially, outbreaks were reported in southern Brazil in 1973; but, more recent, outbreaks were reported in Bahia (summer 1997-1998) and Maranhão (summer 2003-2004), two states in northeastern Brazil. A putative related species, S. pinguis (Fabricius), was first detected in Salta Province, Argentina. The objective of this study was to evaluate intraspecific molecular polymorphisms of geographically distinct Sternechus populations. Randomly amplified polymorphic DNA (RAPD) profiles and partial mitochondrial cytochrome B (CytB) gene sequences were used to determine whether individual soybean stalk weevils were one of two different species and to infer pest invasion pattern. Putative S. pinguis and S. subsignatus populations were collected in San Agustin (Cruz Alta, Tucumán Province, Argentina) and different sampling sites in the Brazilian states of Paraná, Bahia and Maranhão. Polymorphic bands were obtained by RAPD and analyzed by Dice coefficients. Populations from southern Brazil were more closely related genetically to an Argentinean group than the populations sampled in northeastern Brazil. The Londrina Co., Brazil population displayed the highest intra-population genetic similarity. Most of the soybean stalk weevils collected from San Agustin, Tucumán, Argentina were divergent from those collected in Brazil. Sequencing and parsimony analysis of CytB did not differentiate specimens collected in Argentina and Brazil. Thus, our data show that soybean stalk weevil outbreaks and population increases in northeastern Brazil involved local genotypes.

  11. Phylogenetic analysis of mitochondrial DNA in a patient with Kearns-Sayre syndrome containing a novel 7629-bp deletion.

    Science.gov (United States)

    Montiel-Sosa, Jose Francisco; Herrero, María Dolores; Munoz, Maria de Lourdes; Aguirre-Campa, Luis Enrique; Pérez-Ramírez, Gerardo; García-Ramírez, Rubén; Ruiz-Pesini, Eduardo; Montoya, Julio

    2013-08-01

    Mitochondrial DNA mutations have been associated with different illnesses in humans, such as Kearns-Sayre syndrome (KSS), which is related to deletions of different sizes and positions among patients. Here, we report a Mexican patient with typical features of KSS containing a novel deletion of 7629 bp in size with 85% heteroplasmy, which has not been previously reported. Sequence analysis revealed 3-bp perfect short direct repeats flanking the deletion region, in addition to 7-bp imperfect direct repeats within 9-10 bp. Furthermore, sequencing, alignment and phylogenetic analysis of the hypervariable region revealed that the patient may belong to a founder Native American haplogroup C4c.

  12. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  13. A comparative analysis of mitochondrial ORFans: new clues on their origin and role in species with doubly uniparental inheritance of mitochondria.

    Science.gov (United States)

    Milani, Liliana; Ghiselli, Fabrizio; Guerra, Davide; Breton, Sophie; Passamonti, Marco

    2013-01-01

    Despite numerous comparative mitochondrial genomics studies revealing that animal mitochondrial genomes are highly conserved in terms of gene content, supplementary genes are sometimes found, often arising from gene duplication. Mitochondrial ORFans (ORFs having no detectable homology and unknown function) were found in bivalve molluscs with Doubly Uniparental Inheritance (DUI) of mitochondria. In DUI animals, two mitochondrial lineages are present: one transmitted through females (F-type) and the other through males (M-type), each showing a specific and conserved ORF. The analysis of 34 mitochondrial major Unassigned Regions of Musculista senhousia F- and M-mtDNA allowed us to verify the presence of novel mitochondrial ORFs in this species and to compare them with ORFs from other species with ascertained DUI, with other bivalves and with animals showing new mitochondrial elements. Overall, 17 ORFans from nine species were analyzed for structure and function. Many clues suggest that the analyzed ORFans arose from endogenization of viral genes. The co-option of such novel genes by viral hosts may have determined some evolutionary aspects of host life cycle, possibly involving mitochondria. The structure similarity of DUI ORFans within evolutionary lineages may also indicate that they originated from independent events. If these novel ORFs are in some way linked to DUI establishment, a multiple origin of DUI has to be considered. These putative proteins may have a role in the maintenance of sperm mitochondria during embryo development, possibly masking them from the degradation processes that normally affect sperm mitochondria in species with strictly maternal inheritance.

  14. Quantifying small molecule phenotypic effects using mitochondrial morpho-functional fingerprinting and machine learning

    Science.gov (United States)

    Blanchet, Lionel; Smeitink, Jan A. M.; van Emst-de Vries, Sjenet E.; Vogels, Caroline; Pellegrini, Mina; Jonckheere, An I.; Rodenburg, Richard J. T.; Buydens, Lutgarde M. C.; Beyrath, Julien; Willems, Peter H. G. M.; Koopman, Werner J. H.

    2015-01-01

    In primary fibroblasts from Leigh Syndrome (LS) patients, isolated mitochondrial complex I deficiency is associated with increased reactive oxygen species levels and mitochondrial morpho-functional changes. Empirical evidence suggests these aberrations constitute linked therapeutic targets for small chemical molecules. However, the latter generally induce multiple subtle effects, meaning that in vitro potency analysis or single-parameter high-throughput cell screening are of limited use to identify these molecules. We combine automated image quantification and artificial intelligence to discriminate between primary fibroblasts of a healthy individual and a LS patient based upon their mitochondrial morpho-functional phenotype. We then evaluate the effects of newly developed Trolox variants in LS patient cells. This revealed that Trolox ornithylamide hydrochloride best counterbalanced mitochondrial morpho-functional aberrations, effectively scavenged ROS and increased the maximal activity of mitochondrial complexes I, IV and citrate synthase. Our results suggest that Trolox-derived antioxidants are promising candidates in therapy development for human mitochondrial disorders.

  15. Comprehensive approach to the quantitative analysis of mitochondrial phospholipids by HPLC-MS.

    Science.gov (United States)

    Kim, Junhwan; Hoppel, Charles L

    2013-01-01

    A normal-phase HPLC-MS method was established to analyze mitochondrial phospholipids quantitatively as well as qualitatively. An efficient extraction procedure and chromatographic conditions were developed using twelve standardized phospholipids and lysophospholipids. The chromatographic conditions provided physical separation of phospholipids by class, and efficient ionization allowed detection of low abundance phospholipids such as phosphatidylglycerol and monolysocardiolipin. The chromatographic separation of each class of phospholipid permitted qualitative identification of molecular species without interference from other classes. This is advantageous for mitochondrial lipidomics because the composition of mitochondrial phospholipids varies depending on tissue source, pathological condition, and nutrition. Using the method, seven classes of phospholipids (phosphatidylethanolamine, phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, cardiolipin, and monolysocardiolipin) were detected in rat heart and skeletal muscle mitochondria and all but phosphatidylserine were quantified. The concentration was calculated using standard curves with an internal standard generated for each class of phospholipid. The method was validated for intraday and interday variation and showed excellent reproducibility and accuracy. This new method, with each step documented, provides a powerful tool for accurate quantitation of phospholipids, a basic structural component of mitochondrial membranes.

  16. Detailed analysis of the human mitochondrial contact site complex indicate a hierarchy of subunits.

    Science.gov (United States)

    Ott, Christine; Dorsch, Eva; Fraunholz, Martin; Straub, Sebastian; Kozjak-Pavlovic, Vera

    2015-01-01

    Mitochondrial inner membrane folds into cristae, which significantly increase its surface and are important for mitochondrial function. The stability of cristae depends on the mitochondrial contact site (MICOS) complex. In human mitochondria, the inner membrane MICOS complex interacts with the outer membrane sorting and assembly machinery (SAM) complex, to form the mitochondrial intermembrane space bridging complex (MIB). We have created knockdown cell lines of most of the MICOS and MIB components and have used them to study the importance of the individual subunits for the cristae formation and complex stability. We show that the most important subunits of the MIB complex in human mitochondria are Mic60/Mitofilin, Mic19/CHCHD3 and an outer membrane component Sam50. We provide additional proof that ApoO indeed is a subunit of the MICOS and MIB complexes and propose the name Mic23 for this protein. According to our results, Mic25/CHCHD6, Mic27/ApoOL and Mic23/ApoO appear to be periphery subunits of the MICOS complex, because their depletion does not affect cristae morphology or stability of other components.

  17. Meta-Analysis of mitochondrial DNA reveals several population bottlenecks during worldwide migrations of cattle

    NARCIS (Netherlands)

    Lenstra, Johannes A.; Ajmone-Marsan, Paolo; Beja-Pereira, Albano; Bollongino, Ruth; Bradley, Daniel G.; Colli, Licia; De Gaetano, Anna; Edwards, Ceiridwen J.; Felius, Marleen; Ferretti, Luca; Ginja, Catarina; Hristov, Peter; Kantanen, Juha; Lirón, Juan Pedro; Magee, David A.; Negrini, Riccardo; Radoslavov, Georgi A.

    2014-01-01

    Several studies have investigated the differentiation of mitochondrial DNA in Eurasian, African and American cattle as well as archaeological bovine material. A global survey of these studies shows that haplogroup distributions are more stable in time than in space. All major migrations of cattle ha

  18. Mutations in the SPG7 gene cause chronic progressive external ophthalmoplegia through disordered mitochondrial DNA maintenance.

    Science.gov (United States)

    Pfeffer, Gerald; Gorman, Gráinne S; Griffin, Helen; Kurzawa-Akanbi, Marzena; Blakely, Emma L; Wilson, Ian; Sitarz, Kamil; Moore, David; Murphy, Julie L; Alston, Charlotte L; Pyle, Angela; Coxhead, Jon; Payne, Brendan; Gorrie, George H; Longman, Cheryl; Hadjivassiliou, Marios; McConville, John; Dick, David; Imam, Ibrahim; Hilton, David; Norwood, Fiona; Baker, Mark R; Jaiser, Stephan R; Yu-Wai-Man, Patrick; Farrell, Michael; McCarthy, Allan; Lynch, Timothy; McFarland, Robert; Schaefer, Andrew M; Turnbull, Douglass M; Horvath, Rita; Taylor, Robert W; Chinnery, Patrick F

    2014-05-01

    Despite being a canonical presenting feature of mitochondrial disease, the genetic basis of progressive external ophthalmoplegia remains unknown in a large proportion of patients. Here we show that mutations in SPG7 are a novel cause of progressive external ophthalmoplegia associated with multiple mitochondrial DNA deletions. After excluding known causes, whole exome sequencing, targeted Sanger sequencing and multiplex ligation-dependent probe amplification analysis were used to study 68 adult patients with progressive external ophthalmoplegia either with or without multiple mitochondrial DNA deletions in skeletal muscle. Nine patients (eight probands) were found to carry compound heterozygous SPG7 mutations, including three novel mutations: two missense mutations c.2221G>A; p.(Glu741Lys), c.2224G>A; p.(Asp742Asn), a truncating mutation c.861dupT; p.Asn288*, and seven previously reported mutations. We identified a further six patients with single heterozygous mutations in SPG7, including two further novel mutations: c.184-3C>T (predicted to remove a splice site before exon 2) and c.1067C>T; p.(Thr356Met). The clinical phenotype typically developed in mid-adult life with either progressive external ophthalmoplegia/ptosis and spastic ataxia, or a progressive ataxic disorder. Dysphagia and proximal myopathy were common, but urinary symptoms were rare, despite the spasticity. Functional studies included transcript analysis, proteomics, mitochondrial network analysis, single fibre mitochondrial DNA analysis and deep re-sequencing of mitochondrial DNA. SPG7 mutations caused increased mitochondrial biogenesis in patient muscle, and mitochondrial fusion in patient fibroblasts associated with the clonal expansion of mitochondrial DNA mutations. In conclusion, the SPG7 gene should be screened in patients in whom a disorder of mitochondrial DNA maintenance is suspected when spastic ataxia is prominent. The complex neurological phenotype is likely a result of the clonal

  19. Expression studies and promoter analysis of the nuclear gene for mitochondrial transcription factor 1 (MTF1) in yeast.

    Science.gov (United States)

    Jan, P S; Stein, T; Hehl, S; Lisowsky, T

    1999-08-01

    The basal mitochondrial transcription apparatus of Saccharomyces cerevisiae consists of the core enzyme for mitochondrial RNA polymerase and the specificity factor. The core enzyme is homologous to those of bacteriophages T3, T7 and SP6 whereas the specificity factor shows similarities with bacterial sigma factors. Recently it was shown that the bacteriophage-type core enzyme is widespread among the eukaryotic lineage and a common picture for the mitochondrial transcription apparatus in eukaryotic cells is now emerging. In contrast to the situation for the core enzyme, the gene for the specificity factor has only been identified from S. cerevisiae and more recently from two other yeast species. As the specificity factor is the key component for initiation of transcription at the mitochondrial promoter we wanted to study in more detail gene expression, regulation, and the function of the promoter of the nuclear MTF1 gene. For this purpose the messenger RNA level for scMTF1 was investigated under a large number of different growth conditions and thereby exhibited a very low, but regulated and carbon source-dependent, expression. Deletion experiments identify the minimal promoter for functional complementation in yeast. To evaluate the functional conservation of the promoter elements the homologous MTF1 gene from the closely related yeast Saccharomyces douglasii was isolated and tested in heterologous complementation experiments. In spite of a highly conserved protein sequence these studies demonstrate that at low-copy number sdMTF1 is not able to substitute for scMTF1 in S. cerevisiae. Promoter exchange experiments with MTF1 from S. cerevisiae and S. douglasii demonstrate that differences in gene expression are responsible for the failure in heterologous complementation. This finding prompted us to compare the promoter regions of MTF1 from four different yeast species. For this purpose the sequences of the 5' regions from S. douglasii, S. kluyveri and Kluyveromyces

  20. Phylogenetic analysis of the true water bugs (Insecta: Hemiptera: Heteroptera: Nepomorpha: evidence from mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Xie Qiang

    2009-06-01

    Full Text Available Abstract Background The true water bugs are grouped in infraorder Nepomorpha (Insecta: Hemiptera: Heteroptera and are of great economic importance. The phylogenetic relationships within Nepomorpha and the taxonomic hierarchies of Pleoidea and Aphelocheiroidea are uncertain. Most of the previous studies were based on morphological characters without algorithmic assessment. In the latest study, the molecular markers employed in phylogenetic analyses were partial sequences of 16S rDNA and 18S rDNA with a total length about 1 kb. Up to now, no mitochondrial genome of the true water bugs has been sequenced, which is one of the largest data sets that could be compared across animal taxa. In this study we analyzed the unresolved problems in Nepomorpha using evidence from mitochondrial genomes. Results Nine mitochondrial genomes of Nepomorpha and five of other hemipterans were sequenced. These mitochondrial genomes contain the commonly found 37 genes without gene rearrangements. Based on the nucleotide sequences of mt-genomes, Pleoidea is not a member of the Nepomorpha and Aphelocheiroidea should be grouped back into Naucoroidea. Phylogenetic relationships among the superfamilies of Nepomorpha were resolved robustly. Conclusion The mt-genome is an effective data source for resolving intraordinal phylogenetic problems at the superfamily level within Heteroptera. The mitochondrial genomes of the true water bugs are typical insect mt-genomes. Based on the nucleotide sequences of the mt-genomes, we propose the Pleoidea to be a separate heteropteran infraorder. The infraorder Nepomorpha consists of five superfamilies with the relationships (Corixoidea + ((Naucoroidea + Notonectoidea + (Ochteroidea + Nepoidea.

  1. Evolution of gastropod mitochondrial genome arrangements

    Directory of Open Access Journals (Sweden)

    Zardoya Rafael

    2008-02-01

    Full Text Available Abstract Background Gastropod mitochondrial genomes exhibit an unusually great variety of gene orders compared to other metazoan mitochondrial genome such as e.g those of vertebrates. Hence, gastropod mitochondrial genomes constitute a good model system to study patterns, rates, and mechanisms of mitochondrial genome rearrangement. However, this kind of evolutionary comparative analysis requires a robust phylogenetic framework of the group under study, which has been elusive so far for gastropods in spite of the efforts carried out during the last two decades. Here, we report the complete nucleotide sequence of five mitochondrial genomes of gastropods (Pyramidella dolabrata, Ascobulla fragilis, Siphonaria pectinata, Onchidella celtica, and Myosotella myosotis, and we analyze them together with another ten complete mitochondrial genomes of gastropods currently available in molecular databases in order to reconstruct the phylogenetic relationships among the main lineages of gastropods. Results Comparative analyses with other mollusk mitochondrial genomes allowed us to describe molecular features and general trends in the evolution of mitochondrial genome organization in gastropods. Phylogenetic reconstruction with commonly used methods of phylogenetic inference (ME, MP, ML, BI arrived at a single topology, which was used to reconstruct the evolution of mitochondrial gene rearrangements in the group. Conclusion Four main lineages were identified within gastropods: Caenogastropoda, Vetigastropoda, Patellogastropoda, and Heterobranchia. Caenogastropoda and Vetigastropoda are sister taxa, as well as, Patellogastropoda and Heterobranchia. This result rejects the validity of the derived clade Apogastropoda (Caenogastropoda + Heterobranchia. The position of Patellogastropoda remains unclear likely due to long-branch attraction biases. Within Heterobranchia, the most heterogeneous group of gastropods, neither Euthyneura (because of the inclusion of P

  2. Analysis of Maize Crop Leaf using Multivariate Image Analysis for Identifying Soil Deficiency

    Directory of Open Access Journals (Sweden)

    S. Sridevy

    2014-11-01

    Full Text Available Image processing analysis for the soil deficiency identification has become an active area of research in this study. The changes in the color of the leaves are used to analyze and identify the deficiency of soil nutrients such as Nitrogen (N, Phosphorus (P and potassium (K by digital color image analysis. This research study focuses on the image analysis of the maize crop leaf using multivariate image analysis. In this proposed novel approach, initially, a color transformation for the input RGB image is formed and this RGB is converted to HSV because RGB is ideal for color generation but HSV is very suitable for color perception. Then green pixels are masked and removed using specific threshold value by applying histogram equalization. This masking approach is done through specific customized filtering approach which exclusively filters the green color of the leaf. After the filtering step, only the deficiency part of the leaf is taken for consideration. Then, a histogram generation is carried out for the deficiency part of the leaf. Then, Multivariate Image Analysis approach using Independent Component Analysis (ICA is carried out to extract a reference eigenspace from a matrix built by unfolding color data from the deficiency part. Test images are also unfolded and projected onto the reference eigenspace and the result is a score matrix which is used to compute nutrient deficiency based on the T2 statistic. In addition, a multi-resolution scheme by scaling down process is carried out to speed up the process. Finally, based on the training samples, the soil deficiency is identified based on the color of the maize crop leaf.

  3. Whole mitochondrial and plastid genome SNP analysis of nine date palm cultivars reveals plastid heteroplasmy and close phylogenetic relationships among cultivars.

    Directory of Open Access Journals (Sweden)

    Jamal S M Sabir

    Full Text Available Date palm is a very important crop in western Asia and northern Africa, and it is the oldest domesticated fruit tree with archaeological records dating back 5000 years. The huge economic value of this crop has generated considerable interest in breeding programs to enhance production of dates. One of the major limitations of these efforts is the uncertainty regarding the number of date palm cultivars, which are currently based on fruit shape, size, color, and taste. Whole mitochondrial and plastid genome sequences were utilized to examine single nucleotide polymorphisms (SNPs of date palms to evaluate the efficacy of this approach for molecular characterization of cultivars. Mitochondrial and plastid genomes of nine Saudi Arabian cultivars were sequenced. For each species about 60 million 100 bp paired-end reads were generated from total genomic DNA using the Illumina HiSeq 2000 platform. For each cultivar, sequences were aligned separately to the published date palm plastid and mitochondrial reference genomes, and SNPs were identified. The results identified cultivar-specific SNPs for eight of the nine cultivars. Two previous SNP analyses of mitochondrial and plastid genomes identified substantial intra-cultivar ( = intra-varietal polymorphisms in organellar genomes but these studies did not properly take into account the fact that nearly half of the plastid genome has been integrated into the mitochondrial genome. Filtering all sequencing reads that mapped to both organellar genomes nearly eliminated mitochondrial heteroplasmy but all plastid SNPs remained heteroplasmic. This investigation provides valuable insights into how to deal with interorganellar DNA transfer in performing SNP analyses from total genomic DNA. The results confirm recent suggestions that plastid heteroplasmy is much more common than previously thought. Finally, low levels of sequence variation in plastid and mitochondrial genomes argue for using nuclear SNPs for

  4. The Potato Tuber Mitochondrial Proteome

    DEFF Research Database (Denmark)

    Salvato, Fernanda; Havelund, Jesper F; Chen, Mingjie;

    2014-01-01

    manner using normalized spectral counts including as many as 5-fold more “extreme” proteins (low mass, high isoelectric point, hydrophobic) than previous mitochondrial proteome studies. We estimate that this compendium of proteins represents a high coverage of the potato tuber mitochondrial proteome...... that more than 50% of the identified proteins harbor at least one modification. The most prominently observed class of posttranslational modifications was oxidative modifications. This study reveals approximately 500 new or previously unconfirmed plant mitochondrial proteins and outlines a facile strategy...... for unbiased, near-comprehensive identification of mitochondrial proteins and their modified forms....

  5. Effect of rhTNF-α on Mitochondrial Transmembrane Potential and Motility of Human Sperm in vitro by Flow Cytometry and Computer Aided of Semen Analysis

    Institute of Scientific and Technical Information of China (English)

    Jiang BIAN; Wei CHEN; Xian-kun GUO; Cheng-liang XIONG; Yan ZHANG; Yong NEI

    2005-01-01

    Objective To evaluate effect of recombined human tumor necrosis factor (rhTNF-α)on mitochondrial transmembrane potential and motility of human sperm in vitro Methods Semen samples for study were obtained from 40 health men (average age 26± 1.2 years) with normal semen analysis. Sperm suspension with computer aided of semen analysis (CASA) technique; 2) were stained in the presence of 10 μg/ml Rh123and PI, mitochondrial transmembrane potential of those was analyzed by flow cytometry(FCM).Results Significant differences were found between experimental groups and control groups on viability, straight line velocity, curvilinear velocity, average path velocity,progressive motility of human sperm and number of sperm with normal mitochondrial transmembrane potential (P<0. 01) expect final concentration 30 pg/ml group (P>0.05). Sperm motility lowed with increasing rhTNF-α concentration and incubating time (P<0.01). Number of sperm with normal mitochondrial transmembrane potential decreased with increasing rh TNF-a concentration and incubating time (P<0.01).Conclusion rhTNF-α can decrease human sperm motility function in vitro, which can interfere the function of human sperm mitochondrial transmembrane potential and may inhibit sperm mitochondrial enzymatic activities.

  6. Mitochondrial drug targets in neurodegenerative diseases.

    Science.gov (United States)

    Lee, Jiyoun

    2016-02-01

    Growing evidence suggests that mitochondrial dysfunction is the main culprit in neurodegenerative diseases. Given the fact that mitochondria participate in diverse cellular processes, including energetics, metabolism, and death, the consequences of mitochondrial dysfunction in neuronal cells are inevitable. In fact, new strategies targeting mitochondrial dysfunction are emerging as potential alternatives to current treatment options for neurodegenerative diseases. In this review, we focus on mitochondrial proteins that are directly associated with mitochondrial dysfunction. We also examine recently identified small molecule modulators of these mitochondrial targets and assess their potential in research and therapeutic applications.

  7. Genetic diversity and population genetic structure analysis of Echinococcus granulosus sensu stricto complex based on mitochondrial DNA signature.

    Directory of Open Access Journals (Sweden)

    Monika Sharma

    Full Text Available The genetic diversity and population genetics of the Echinococcus granulosus sensu stricto complex were investigated based on sequencing of mitochondrial DNA (mtDNA. Total 81 isolates of hydatid cyst collected from ungulate animals from different geographical areas of North India were identified by sequencing of cytochrome c oxidase subunit1 (coxi gene. Three genotypes belonging to E. granulosus sensu stricto complex were identified (G1, G2 and G3 genotypes. Further the nucleotide sequences (retrieved from GenBank for the coxi gene from seven populations of E. granulosus sensu stricto complex covering 6 continents, were compared with sequences of isolates analysed in this study. Molecular diversity indices represent overall high mitochondrial DNA diversity for these populations, but low nucleotide diversity between haplotypes. The neutrality tests were used to analyze signatures of historical demographic events. The Tajima's D test and Fu's FS test showed negative value, indicating deviations from neutrality and both suggested recent population expansion for the populations. Pairwise fixation index was significant for pairwise comparison of different populations (except between South America and East Asia, Middle East and Europe, South America and Europe, Africa and Australia, indicating genetic differentiation among populations. Based on the findings of the present study and those from earlier studies, we hypothesize that demographic expansion occurred in E. granulosus after the introduction of founder haplotype particular by anthropogenic movements.

  8. Points to consider in the clinical use of NGS panels for mitochondrial disease: an analysis of gene inclusion and consent forms.

    Science.gov (United States)

    Platt, Julia; Cox, Rachel; Enns, Gregory M

    2014-08-01

    Mitochondrial next generation sequencing (NGS) panels offer single-step analysis of the numerous nuclear genes involved in the structure, function, and maintenance of mitochondria. However, the complexities of mitochondrial biology and genetics raise points for consideration in clinical use of these tests. To understand the current status of mitochondrial genetic testing, we assessed the gene offerings and consent forms of mitochondrial NGS panels available from seven US-based clinical laboratories. The NGS panels varied markedly in number of genes (101-1204 genes), and the proportion of genes causing "classic" mitochondrial diseases and their phenocopies ranged widely between labs (18 %-94 % of panel contents). All panels included genes not associated with classic mitochondrial diseases (6 %-28 % of panel contents), including genes causing adult-onset neurodegenerative disorders, cancer predisposition, and other genetic syndromes or inborn errors of metabolism. Five of the panels included genes that are not listed in OMIM to be associated with a disease phenotype (5 %-49 % of panel contents). None of the consent documents reviewed had options for patient preference regarding receipt of incidental findings. These findings raise points of discussion applicable to mitochondrial diagnostics, but also to the larger arenas of exome and genome sequencing, including the need to consider the boundaries between clinical and research testing, the necessity of appropriate informed consent, and the responsibilities of clinical laboratories and clinicians. Based on these findings, we recommend careful evaluation by laboratories of the genes offered on NGS panels, clear communication of the predicted phenotypes, and revised consent forms to allow patients to make choices about receiving incidental findings. We hope that our analysis and recommendations will help to maximize the considerable clinical utility of NGS panels for the diagnosis of mitochondrial disease.

  9. Mitochondrial proteome analysis reveals depression of the Ndufs3 subunit and activity of complex I in diabetic rat brain.

    Science.gov (United States)

    Taurino, Federica; Stanca, Eleonora; Siculella, Luisa; Trentadue, Raffaella; Papa, Sergio; Zanotti, Franco; Gnoni, Antonio

    2012-04-18

    Type-1 diabetes resulting from defective insulin secretion and consequent hyperglycemia, is associated with "diabetic encephalopathy." This is characterized by brain neurophysiological and structural changes resulting in impairment of cognitive function. The present proteomic analysis of brain mitochondrial proteins from streptozotocin-induced type-1 diabetic rats, shows a large decrement of the Ndufs3 protein subunit of complex I, decreased level of the mRNA and impaired catalytic activity of the complex in the diabetic rats as compared to controls. The severe depression of the expression and enzymatic activity of complex I can represent a critical contributing factor to the onset of the diabetic encephalopathy in type-1 diabetes.

  10. Purification and kinetic analysis of cytosolic and mitochondrial thioredoxin glutathione reductase extracted from Taenia solium cysticerci.

    Science.gov (United States)

    Plancarte, Agustin; Nava, Gabriela

    2015-02-01

    Thioredoxin glutathione reductases (TGRs) (EC 1.8.1.9) were purified to homogeneity from the cytosolic (cTsTGR) and mitochondrial (mTsTGR) fractions of Taenia solium, the agent responsible for neurocysticercosis, one of the major central nervous system parasitic diseases in humans. TsTGRs had a relative molecular weight of 132,000, while the corresponding value per subunit obtained under denaturing conditions, was of 62,000. Specific activities for thioredoxin reductase and glutathione reductase substrates for both TGRs explored were in the range or lower than values obtained for other platyhelminths and mammalian TGRs. cTsTGR and mTsTGR also showed hydroperoxide reductase activity using hydroperoxide as substrate. Km(DTNB) and Kcat(DTNB) values for cTsTGR and mTsTGR (88 µM and 1.9 s(-1); 45 µM and 12.6 s(-1), respectively) and Km(GSSG) and Kcat(GSSG) values for cTsTGR and mTsTGR (6.3 µM and 0.96 s(-1); 4 µM and 1.62 s(-1), respectively) were similar to or lower than those reported for mammalian TGRs. Mass spectrometry analysis showed that 12 peptides from cTsTGR and seven from mTsTGR were a match for gi|29825896 thioredoxin glutathione reductase [Echinococcus granulosus], confirming that both enzymes are TGRs. Both T. solium TGRs were inhibited by the gold compound auranofin, a selective inhibitor of thiol-dependent flavoreductases (I₅₀ = 3.25, 2.29 nM for DTNB and GSSG substrates, respectively for cTsTGR; I₅₀ = 5.6, 25.4 nM for mTsTGR toward the same substrates in the described order). Glutathione reductase activity of cTsTGR and mTsTGR exhibited hysteretic behavior with moderate to high concentrations of GSSG; this result was not observed either with thioredoxin, DTNB or NADPH. However, the observed hysteretic kinetics was suppressed with increasing amounts of both parasitic TGRs. These data suggest the existence of an effective substitute which may account for the lack of the detoxification enzymes glutathione reductase

  11. Genetic analysis of the Saimiri breeding colony of the Pasteur Institute (French Guiana): development of a molecular typing method using a combination of nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Lavergne, Anne; Catzeflis, François; Lacôte, Sandra; Barnaud, Antoine; Bordier, Marion; Mercereau-Puijalon, Odile; Contamin, Hugues

    2003-12-01

    Saimiri (Cebidae) groups a complex of species and subspecies, which present a large morphological plasticity. Genetic analysis is complicated by the absence of consensus on classification criteria and the paucity of molecular tools available for the genus. As the squirrel monkey is widely used in biomedical research, breeding centers have been established, but the genetic make up and diversity of many of the existing colonies is unknown precluding a rationale breeding policy. To develop a genetic typing strategy for the Saimiri breeding colony of Pasteur Institute of French Guiana, we have used Cytochrome b, a mitochondrial marker, and nuclear microsatellites. Cytochrome b sequences from wild-caught Saimiri boliviensis, Saimiri sciureus sciureus and S. s. collinsi reference specimens and captive animals identified 11 haplotypes, grouped into three distinct clades. An estimate of genetic variability within each captive morphotype, and of the extent of molecular divergence between the Bolivian, Guyanese and Brazilian breeds was obtained from the analysis of three nuclear microsatellites. Taxon-specific microsatellites enabled typing of F0-F3 animals, but did not differentiate Brazilian from Guyanese animals. Three locus microsatellite analysis of a representative sample from each generation showed no trend for loss of heterozygosity, and identified hybrid animals between Bolivian and the two others sub-species. These data provide novel evidence for taxonomic classification and a rationale strategy to further type the whole colony.

  12. Analysis of Mitochondrial Gene Mutations in Chinese Pedigrees of Leber's Hereditary Optic Neuropathy

    Institute of Scientific and Technical Information of China (English)

    Ling Lin; Yikai Chen; Yi Tong; Zhihong Zheng; Jianyin Lin

    2002-01-01

    Purpose: To investigate the frequency of common pathogenic primary mitochondrial DNA mutations in Leber's hereditary optic neuropathy (LHON) families.Methods: Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and DNA sequencing were used to detect mitochondrial DNA mutations.Sixty-six Chinese examiners from 15 families, including 22 visual affected and their 44 unaffected maternal relatives, underwent molecular genetic evaluation. Eleven normal individuals underwent evaluation as contrl.Results: Of the 15 families with suspicion of LHON, 13 had nucleotide position (nt) Gl1778A mutations, 2 had nt T14484C mutations. All examiners had nt G11719A mutations.Conclusions: The mutations at nucleotides 11778 and 14484 are primary LHON mutations. Molecular genetic findings suggest that the silent mutation at nt G11719A may be a common genetic polymorphism in Chinese.

  13. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  14. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Tanaka Yoshiyuki

    2012-07-01

    Full Text Available Abstract Background Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Results Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%. It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size that are non-syntenic to normal-type genome, and the gene orf138

  15. Genome-Wide Analysis Reveals Coating of the Mitochondrial Genome by TFAM

    OpenAIRE

    Wang, Yun E.; Marinov, Georgi K.; Wold, Barbara J.; Chan, David C.

    2013-01-01

    Mitochondria contain a 16.6 kb circular genome encoding 13 proteins as well as mitochondrial tRNAs and rRNAs. Copies of the genome are organized into nucleoids containing both DNA and proteins, including the machinery required for mtDNA replication and transcription. The transcription factor TFAM is critical for initiation of transcription and replication of the genome, and is also thought to perform a packaging function. Although specific binding sites required for initiation of transcriptio...

  16. Comparative Analysis of Gender-Associated Complete Mitochondrial Genomes in Marine Mussels (Mytilus spp.)

    OpenAIRE

    Breton, Sophie; Burger, Gertraud; Stewart, Donald T.; Blier, Pierre U.

    2006-01-01

    Marine mussels of the genus Mytilus have an unusual mode of mitochondrial DNA (mtDNA) transmission termed doubly uniparental inheritance (DUI). Female mussels are homoplasmic for the F mitotype, which is inherited maternally, while males are usually heteroplasmic, carrying a mixture of the maternal F mitotype and the paternally inherited M genome. Two classes of M genomes have been observed: “standard” M genomes and “recently masculinized” M genomes. The latter are more similar to F genomes a...

  17. Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis.

    Science.gov (United States)

    Liu, Tianxing; Jin, Xiaoxiao; Wang, Rixin; Xu, Tianjun

    2013-12-01

    Odontamblyopus rubicundus is a species of gobiid fishes, inhabits muddy-bottomed coastal waters. In this paper, the first complete mitochondrial genome sequence of O. rubicundus is reported. The complete mitochondrial genome sequence is 17119 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a control region and an L-strand origin as in other teleosts. Most mitochondrial genes are encoded on H-strand except for ND6 and seven tRNA genes. Some overlaps occur in protein-coding genes and tRNAs ranging from 1 to 7 bp. The possibly nonfunctional L-strand origin folded into a typical stem-loop secondary structure and a conserved motif (5'-GCCGG-3') was found at the base of the stem within the tRNACys gene. The TAS, CSB-2 and CSB-3 could be detected in the control region. However, in contrast to most of other fishes, the central conserved sequence block domain and the CSB-1 could not be recognized in O. rubicundus, which is consistent with Acanthogobius hasta (Gobiidae). In addition, phylogenetic analyses based on different sequences of species of Gobiidae and different methods showed that the classification of O. rubicundus into Odontamblyopus due to morphology is debatable.

  18. Analysis of mitochondrial mechanical dynamics using a confocal fluorescence microscope with a bent optical fibre.

    Science.gov (United States)

    Li, Yongbo; Honda, Satoshi; Iwami, Kentaro; Ohta, Yoshihiro; Umeda, Norihiro

    2015-11-01

    The cells in the cardiovascular system are constantly subjected to mechanical forces created by blood flow and the beating heart. The effect of forces on cells has been extensively investigated, but their effect on cellular organelles such as mitochondria remains unclear. We examined the impact of nano-Newton forces on mitochondria using a bent optical fibre (BOF) with a flat-ended tip (diameter exceeding 2 μm) and a confocal fluorescence microscope. By indenting a single mitochondrion with the BOF tip, we found that the mitochondrial elastic modulus was proportional to the (-1/2) power of the mitochondrial radius in the 9.6-115 kPa range. We stained the mitochondria with a potential-metric dye (TMRE) and measured the changes in TMRE fluorescence intensity. We confirmed that more active mitochondria exhibit a higher frequency of repetitive transient depolarization. The same trend was observed at forces lower than 50 nN. We further showed that the depolarization frequency of mitochondria decreases under an extremely large force (nearly 100 nN). We conclude that mitochondrial function is affected by physical environmental factors, such as external forces at the nano-Newton level.

  19. Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis

    Indian Academy of Sciences (India)

    Tianxing Liu; Xiaoxiao Jin; Rixin Wang; Tianjun Xu

    2013-12-01

    Odontamblyopus rubicundus is a species of gobiid fishes, inhabits muddy-bottomed coastal waters. In this paper, the first complete mitochondrial genome sequence of O. rubicundus is reported. The complete mitochondrial genome sequence is 17119 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a control region and an L-strand origin as in other teleosts. Most mitochondrial genes are encoded on H-strand except for ND6 and seven tRNA genes. Some overlaps occur in protein-coding genes and tRNAs ranging from 1 to 7 bp. The possibly nonfunctional L-strand origin folded into a typical stem-loop secondary structure and a conserved motif (5′-GCCGG-3′) was found at the base of the stem within the $tRNA^{Cys}$ gene. The TAS, CSB-2 and CSB-3 could be detected in the control region. However, in contrast to most of other fishes, the central conserved sequence block domain and the CSB-1 could not be recognized in O. rubicundus, which is consistent with Acanthogobius hasta (Gobiidae). In addition, phylogenetic analyses based on different sequences of species of Gobiidae and different methods showed that the classification of O. rubicundus into Odontamblyopus due to morphology is debatable.

  20. Amla Enhances Mitochondrial Spare Respiratory Capacity by Increasing Mitochondrial Biogenesis and Antioxidant Systems in a Murine Skeletal Muscle Cell Line

    Directory of Open Access Journals (Sweden)

    Hirotaka Yamamoto

    2016-01-01

    Full Text Available Amla is one of the most important plants in Indian traditional medicine and has been shown to improve various age-related disorders while decreasing oxidative stress. Mitochondrial dysfunction is a proposed cause of aging through elevated oxidative stress. In this study, we investigated the effects of Amla on mitochondrial function in C2C12 myotubes, a murine skeletal muscle cell model with abundant mitochondria. Based on cell flux analysis, treatment with an extract of Amla fruit enhanced mitochondrial spare respiratory capacity, which enables cells to overcome various stresses. To further explore the mechanisms underlying these effects on mitochondrial function, we analyzed mitochondrial biogenesis and antioxidant systems, both proposed regulators of mitochondrial spare respiratory capacity. We found that Amla treatment stimulated both systems accompanied by AMPK and Nrf2 activation. Furthermore, we found that Amla treatment exhibited cytoprotective effects and lowered reactive oxygen species (ROS levels in cells subjected to t-BHP-induced oxidative stress. These effects were accompanied by increased oxygen consumption, suggesting that Amla protected cells against oxidative stress by using enhanced spare respiratory capacity to produce more energy. Thus we identified protective effects of Amla, involving activation of mitochondrial function, which potentially explain its various effects on age-related disorders.

  1. Amla Enhances Mitochondrial Spare Respiratory Capacity by Increasing Mitochondrial Biogenesis and Antioxidant Systems in a Murine Skeletal Muscle Cell Line

    Science.gov (United States)

    Yamamoto, Hirotaka; Morino, Katsutaro; Mengistu, Lemecha; Ishibashi, Taishi; Kiriyama, Kohei; Ikami, Takao; Maegawa, Hiroshi

    2016-01-01

    Amla is one of the most important plants in Indian traditional medicine and has been shown to improve various age-related disorders while decreasing oxidative stress. Mitochondrial dysfunction is a proposed cause of aging through elevated oxidative stress. In this study, we investigated the effects of Amla on mitochondrial function in C2C12 myotubes, a murine skeletal muscle cell model with abundant mitochondria. Based on cell flux analysis, treatment with an extract of Amla fruit enhanced mitochondrial spare respiratory capacity, which enables cells to overcome various stresses. To further explore the mechanisms underlying these effects on mitochondrial function, we analyzed mitochondrial biogenesis and antioxidant systems, both proposed regulators of mitochondrial spare respiratory capacity. We found that Amla treatment stimulated both systems accompanied by AMPK and Nrf2 activation. Furthermore, we found that Amla treatment exhibited cytoprotective effects and lowered reactive oxygen species (ROS) levels in cells subjected to t-BHP-induced oxidative stress. These effects were accompanied by increased oxygen consumption, suggesting that Amla protected cells against oxidative stress by using enhanced spare respiratory capacity to produce more energy. Thus we identified protective effects of Amla, involving activation of mitochondrial function, which potentially explain its various effects on age-related disorders. PMID:27340504

  2. Simultaneous quantitative measurement and automated analysis of mitochondrial morphology, mass, potential, and motility in living human skin fibroblasts.

    NARCIS (Netherlands)

    Koopman, W.J.H.; Visch, H.J.; Smeitink, J.A.M.; Willems, P.H.G.M.

    2006-01-01

    BACKGROUND: Understanding the interdependence of mitochondrial and cellular functioning in health and disease requires detailed knowledge about the coupling between mitochondrial structure, motility, and function. Currently, no rapid approach is available for simultaneous quantification of these par

  3. Mitochondrial transcription termination factor 2 binds to entire mitochondrial DNA and negatively regulates mitochondrial gene expression

    Institute of Scientific and Technical Information of China (English)

    Weiwei Huang; Min Yu; Yang Jiao; Jie Ma; Mingxing Ma; Zehua Wang; Hong Wu; Deyong Tan

    2011-01-01

    Mitochondrial transcription termination factor 2 (mTERF2) is a mitochondriai matrix protein that binds to the mitochondriai DNA.Previous studies have shown that overexpression of mTERF2 can inhibit cell proliferation, but the mechanism has not been well defined so far.This study aimed to present the binding pattern of mTERF2 to the mitochondrial DNA (mtDNA) in vivo, and investigated the biological function of mTERF2 on the replication of mtDNA, mRNA transcription, and protein translation.The mTERF2 binding to entire mtDNA was identified via the chromatin immunoprecipitation analysis.The mtDNA replication efficiency and expression levels of mitochondria genes were significantly inhibited when the mTERF2 was overexpressed in HeLa cells.The inhibition level of mtDNA content was the same with the decreased levels of mRNA and mitochondrial protein expression.Overall, the mTERF2 might be a cell growth inhibitor based on its negative effect on mtDNA replication, which eventually own-regulated all of the oxidative phosphorylation components in the mitochondria that were essential for the cell's energy metabolism.

  4. Complete Sequence and Analysis of the Mitochondrial Genome of Hemiselmis andersenii CCMP644 (Cryptophyceae

    Directory of Open Access Journals (Sweden)

    Bowman Sharen

    2008-05-01

    Full Text Available Abstract Background Cryptophytes are an enigmatic group of unicellular eukaryotes with plastids derived by secondary (i.e., eukaryote-eukaryote endosymbiosis. Cryptophytes are unusual in that they possess four genomes–a host cell-derived nuclear and mitochondrial genome and an endosymbiont-derived plastid and 'nucleomorph' genome. The evolutionary origins of the host and endosymbiont components of cryptophyte algae are at present poorly understood. Thus far, a single complete mitochondrial genome sequence has been determined for the cryptophyte Rhodomonas salina. Here, the second complete mitochondrial genome of the cryptophyte alga Hemiselmis andersenii CCMP644 is presented. Results The H. andersenii mtDNA is 60,553 bp in size and encodes 30 structural RNAs and 36 protein-coding genes, all located on the same strand. A prominent feature of the genome is the presence of a ~20 Kbp long intergenic region comprised of numerous tandem and dispersed repeat units of between 22–336 bp. Adjacent to these repeats are 27 copies of palindromic sequences predicted to form stable DNA stem-loop structures. One such stem-loop is located near a GC-rich and GC-poor region and may have a regulatory function in replication or transcription. The H. andersenii mtDNA shares a number of features in common with the genome of the cryptophyte Rhodomonas salina, including general architecture, gene content, and the presence of a large repeat region. However, the H. andersenii mtDNA is devoid of inverted repeats and introns, which are present in R. salina. Comparative analyses of the suite of tRNAs encoded in the two genomes reveal that the H. andersenii mtDNA has lost or converted its original trnK(uuu gene and possesses a trnS-derived 'trnK(uuu', which appears unable to produce a functional tRNA. Mitochondrial protein coding gene phylogenies strongly support a variety of previously established eukaryotic groups, but fail to resolve the relationships among higher

  5. Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae, a mammalian family that experienced rapid speciation

    Directory of Open Access Journals (Sweden)

    Ryder Oliver A

    2007-10-01

    Full Text Available Abstract Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other

  6. Multistationary and oscillatory modes of free radicals generation by the mitochondrial respiratory chain revealed by a bifurcation analysis.

    Directory of Open Access Journals (Sweden)

    Vitaly A Selivanov

    Full Text Available The mitochondrial electron transport chain transforms energy satisfying cellular demand and generates reactive oxygen species (ROS that act as metabolic signals or destructive factors. Therefore, knowledge of the possible modes and bifurcations of electron transport that affect ROS signaling provides insight into the interrelationship of mitochondrial respiration with cellular metabolism. Here, a bifurcation analysis of a sequence of the electron transport chain models of increasing complexity was used to analyze the contribution of individual components to the modes of respiratory chain behavior. Our algorithm constructed models as large systems of ordinary differential equations describing the time evolution of the distribution of redox states of the respiratory complexes. The most complete model of the respiratory chain and linked metabolic reactions predicted that condensed mitochondria produce more ROS at low succinate concentration and less ROS at high succinate levels than swelled mitochondria. This prediction was validated by measuring ROS production under various swelling conditions. A numerical bifurcation analysis revealed qualitatively different types of multistationary behavior and sustained oscillations in the parameter space near a region that was previously found to describe the behavior of isolated mitochondria. The oscillations in transmembrane potential and ROS generation, observed in living cells were reproduced in the model that includes interaction of respiratory complexes with the reactions of TCA cycle. Whereas multistationarity is an internal characteristic of the respiratory chain, the functional link of respiration with central metabolism creates oscillations, which can be understood as a means of auto-regulation of cell metabolism.

  7. Mechanism of 3,4-methylenedioxymethamphetamine (MDMA, ecstasy)-mediated mitochondrial dysfunction in rat liver.

    Science.gov (United States)

    Moon, Kwan-Hoon; Upreti, Vijay V; Yu, Li-Rong; Lee, Insong J; Ye, Xiaoying; Eddington, Natalie D; Veenstra, Timothy D; Song, Byoung-Joon

    2008-09-01

    Despite numerous reports citing the acute hepatotoxicity caused by 3,4-methylenedioxymethamphetamine (MDMA) (ecstasy), the underlying mechanism of organ damage is poorly understood. We hypothesized that key mitochondrial proteins are oxidatively modified and inactivated in MDMA-exposed tissues. The aim of this study was to identify and investigate the mechanism of inactivation of oxidatively modified mitochondrial proteins, prior to the extensive mitochondrial dysfunction and liver damage following MDMA exposure. MDMA-treated rats showed abnormal liver histology with significant elevation in plasma transaminases, nitric oxide synthase, and the level of hydrogen peroxide. Oxidatively modified mitochondrial proteins in control and MDMA-exposed rats were labeled with biotin-N-maleimide (biotin-NM) as a sensitive probe for oxidized proteins, purified with streptavidin-agarose, and resolved using 2-DE. Comparative 2-DE analysis of biotin-NM-labeled proteins revealed markedly increased levels of oxidatively modified proteins following MDMA exposure. Mass spectrometric analysis identified oxidatively modified mitochondrial proteins involved in energy supply, fat metabolism, antioxidant defense, and chaperone activities. Among these, the activities of mitochondrial aldehyde dehydrogenase, 3-ketoacyl-CoA thiolases, and ATP synthase were significantly inhibited following MDMA exposure. Our data show for the first time that MDMA causes the oxidative inactivation of key mitochondrial enzymes which most likely contributes to mitochondrial dysfunction and subsequent liver damage in MDMA-exposed animals.

  8. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes.

    Science.gov (United States)

    Feng, Yanwei; Li, Qi; Kong, Lingfeng; Zheng, Xiaodong

    2011-01-01

    DNA sequence data enable not only the inference of phylogenetic relationships but also provide an efficient method for species-level identifications under the terms DNA barcoding or DNA taxonomy. In this study, we have sequenced partial sequences of mitochondrial COI and 16S rRNA genes from 63 specimens of 8 species of Pectinidae to assess whether DNA barcodes can efficiently distinguish these species. Sequences from homologous regions of four other species of this family were gathered from GenBank. Comparisons of within and between species levels of sequence divergence showed that genetic variation between species exceeds variation within species. When using neighbour-joining clustering based on COI and 16S genes, all species fell into reciprocally monophyletic clades with high bootstrap values. These evidenced that these scallop species can be efficiently identified by DNA barcoding. Evolutionary relationships of Pectinidae were also examined using the two mitochondrial genes. The results are almost consistent with Waller's classification, which was proposed on the basis of shell microstructure and the morphological characteristics of juveniles.

  9. Identifying coordinative structure using principal component analysis based on coherence derived from linear systems analysis.

    Science.gov (United States)

    Wang, Xinguang; O'Dwyer, Nicholas; Halaki, Mark; Smith, Richard

    2013-01-01

    Principal component analysis is a powerful and popular technique for capturing redundancy in muscle activity and kinematic patterns. A primary limitation of the correlations or covariances between signals on which this analysis is based is that they do not account for dynamic relations between signals, yet such relations-such as that between neural drive and muscle tension-are widespread in the sensorimotor system. Low correlations may thus be obtained and signals may appear independent despite a dynamic linear relation between them. To address this limitation, linear systems analysis can be used to calculate the matrix of overall coherences between signals, which measures the strength of the relation between signals taking dynamic relations into account. Using ankle, knee, and hip sagittal-plane angles from 6 healthy subjects during ~50% of total variance in the data set, while with overall coherence matrices the first component accounted for > 95% of total variance. The results demonstrate that the dimensionality of the coordinative structure can be overestimated using conventional correlation, whereas a more parsimonious structure is identified with overall coherence.

  10. Proteomic analysis of human substantia nigra identifies novel candidates involved in Parkinson's disease pathogenesis.

    Science.gov (United States)

    Licker, Virginie; Turck, Natacha; Kövari, Enikö; Burkhardt, Karim; Côte, Mélanie; Surini-Demiri, Maria; Lobrinus, Johannes A; Sanchez, Jean-Charles; Burkhard, Pierre R

    2014-03-01

    Parkinson's disease (PD) pathology spreads throughout the brain following a region-specific process predominantly affecting the substantia nigra (SN) pars compacta. SN exhibits a progressive loss of dopaminergic neurons responsible for the major cardinal motor symptoms, along with the occurrence of Lewy bodies in the surviving neurons. To gain new insights into the underlying pathogenic mechanisms in PD, we studied postmortem nigral tissues dissected from pathologically confirmed PD cases (n = 5) and neurologically intact controls (n = 8). Using a high-throughput shotgun proteomic strategy, we simultaneously identified 1795 proteins with concomitant quantitative data. To date, this represents the most extensive catalog of nigral proteins. Of them, 204 proteins displayed significant expression level changes in PD patients versus controls. These were involved in novel or known pathogenic processes including mitochondrial dysfunction, oxidative stress, or cytoskeleton impairment. We further characterized four candidates that might be relevant to PD pathogenesis. We confirmed the differential expression of ferritin-L and seipin by Western blot and demonstrated the neuronal localization of gamma glutamyl hydrolase and nebulette by immunohistochemistry. Our preliminary findings suggest a role for nebulette overexpression in PD neurodegeneration, through mechanisms that may involve cytoskeleton dynamics disruption. All MS data have been deposited in the ProteomeXchange with identifier PXD000427 (http://proteomecentral.proteomexchange.org/dataset/PXD000427).

  11. DNA analysis of ancient dogs of the Americas: identifying possible founding haplotypes and reconstructing population histories.

    Science.gov (United States)

    Witt, Kelsey E; Judd, Kathleen; Kitchen, Andrew; Grier, Colin; Kohler, Timothy A; Ortman, Scott G; Kemp, Brian M; Malhi, Ripan S

    2015-02-01

    As dogs have traveled with humans to every continent, they can potentially serve as an excellent proxy when studying human migration history. Past genetic studies into the origins of Native American dogs have used portions of the hypervariable region (HVR) of mitochondrial DNA (mtDNA) to indicate that prior to European contact the dogs of Native Americans originated in Eurasia. In this study, we summarize past DNA studies of both humans and dogs to discuss their population histories in the Americas. We then sequenced a portion of the mtDNA HVR of 42 pre-Columbian dogs from three sites located in Illinois, coastal British Columbia, and Colorado, and identify four novel dog mtDNA haplotypes. Next, we analyzed a dataset comprised of all available ancient dog sequences from the Americas to infer the pre-Columbian population history of dogs in the Americas. Interestingly, we found low levels of genetic diversity for some populations consistent with the possibility of deliberate breeding practices. Furthermore, we identified multiple putative founding haplotypes in addition to dog haplotypes that closely resemble those of wolves, suggesting admixture with North American wolves or perhaps a second domestication of canids in the Americas. Notably, initial effective population size estimates suggest at least 1000 female dogs likely existed in the Americas at the time of the first known canid burial, and that population size increased gradually over time before stabilizing roughly 1200 years before present.

  12. Mitochondrial outer membrane proteome of Trypanosoma brucei reveals novel factors required to maintain mitochondrial morphology.

    Science.gov (United States)

    Niemann, Moritz; Wiese, Sebastian; Mani, Jan; Chanfon, Astrid; Jackson, Christopher; Meisinger, Chris; Warscheid, Bettina; Schneider, André

    2013-02-01

    Trypanosoma brucei is a unicellular parasite that causes devastating diseases in humans and animals. It diverged from most other eukaryotes very early in evolution and, as a consequence, has an unusual mitochondrial biology. Moreover, mitochondrial functions and morphology are highly regulated throughout the life cycle of the parasite. The outer mitochondrial membrane defines the boundary of the organelle. Its properties are therefore key for understanding how the cytosol and mitochondria communicate and how the organelle is integrated into the metabolism of the whole cell. We have purified the mitochondrial outer membrane of T. brucei and characterized its proteome using label-free quantitative mass spectrometry for protein abundance profiling in combination with statistical analysis. Our results show that the trypanosomal outer membrane proteome consists of 82 proteins, two-thirds of which have never been associated with mitochondria before. 40 proteins share homology with proteins of known functions. The function of 42 proteins, 33 of which are specific to trypanosomatids, remains unknown. 11 proteins are essential for the disease-causing bloodstream form of T. brucei and therefore may be exploited as novel drug targets. A comparison with the outer membrane proteome of yeast defines a set of 17 common proteins that are likely present in the mitochondrial outer membrane of all eukaryotes. Known factors involved in the regulation of mitochondrial morphology are virtually absent in T. brucei. Interestingly, RNAi-mediated ablation of three outer membrane proteins of unknown function resulted in a collapse of the network-like mitochondrion of procyclic cells and for the first time identified factors that control mitochondrial shape in T. brucei.

  13. Water-Soluble Coenzyme Q10 Reduces Rotenone-Induced Mitochondrial Fission.

    Science.gov (United States)

    Li, Hai-Ning; Zimmerman, Mary; Milledge, Gaolin Z; Hou, Xiao-Lin; Cheng, Jiang; Wang, Zhen-Hai; Li, P Andy

    2017-02-11

    Parkinson's disease is a neurodegenerative disorder characterized by mitochondrial dysfunction and oxidative stress. It is usually accompanied by an imbalance in mitochondrial dynamics and changes in mitochondrial morphology that are associated with impaired function. The objectives of this study were to identify the effects of rotenone, a drug known to mimic the pathophysiology of Parkinson's disease, on mitochondrial dynamics. Additionally, this study explored the protective effects of water-soluble Coenzyme Q10 (CoQ10) against rotenone-induced cytotoxicity in murine neuronal HT22 cells. Our results demonstrate that rotenone elevates protein expression of mitochondrial fission markers, Drp1 and Fis1, and causes an increase in mitochondrial fragmentation as evidenced through mitochondrial staining and morphological analysis. Water-soluble CoQ10 prevented mitochondrial dynamic imbalance by reducing Drp1 and Fis1 protein expression to pre-rotenone levels, as well as reducing rotenone treatment-associated mitochondrial fragmentation. Hence, water-soluble CoQ10 may have therapeutic potential in treating patients with Parkinson's disease.

  14. Phylogenetic analysis of higher-level relationships within Hydroidolina (Cnidaria: Hydrozoa using mitochondrial genome data and insight into their mitochondrial transcription

    Directory of Open Access Journals (Sweden)

    Ehsan Kayal

    2015-11-01

    Full Text Available Hydrozoans display the most morphological diversity within the phylum Cnidaria. While recent molecular studies have provided some insights into their evolutionary history, sister group relationships remain mostly unresolved, particularly at mid-taxonomic levels. Specifically, within Hydroidolina, the most speciose hydrozoan subclass, the relationships and sometimes integrity of orders are highly unsettled. Here we obtained the near complete mitochondrial sequence of twenty-six hydroidolinan hydrozoan species from a range of sources (DNA and RNA-seq data, long-range PCR. Our analyses confirm previous inference of the evolution of mtDNA in Hydrozoa while introducing a novel genome organization. Using RNA-seq data, we propose a mechanism for the expression of mitochondrial mRNA in Hydroidolina that can be extrapolated to the other medusozoan taxa. Phylogenetic analyses using the full set of mitochondrial gene sequences provide some insights into the order-level relationships within Hydroidolina, including siphonophores as the first diverging clade, a well-supported clade comprised of Leptothecata-Filifera III–IV, and a second clade comprised of Aplanulata-Capitata s.s.-Filifera I–II. Finally, we describe our relatively inexpensive and accessible multiplexing strategy to sequence long-range PCR amplicons that can be adapted to most high-throughput sequencing platforms.

  15. Hsp90 inhibition decreases mitochondrial protein turnover.

    Directory of Open Access Journals (Sweden)

    Daciana H Margineantu

    Full Text Available BACKGROUND: Cells treated with hsp90 inhibitors exhibit pleiotropic changes, including an expansion of the mitochondrial compartment, accompanied by mitochondrial fragmentation and condensed mitochondrial morphology, with ultimate compromise of mitochondrial integrity and apoptosis. FINDINGS: We identified several mitochondrial oxidative phosphorylation complex subunits, including several encoded by mtDNA, that are upregulated by hsp90 inhibitors, without corresponding changes in mRNA abundance. Post-transcriptional accumulation of mitochondrial proteins observed with hsp90 inhibitors is also seen in cells treated with proteasome inhibitors. Detailed studies of the OSCP subunit of mitochondrial F1F0-ATPase revealed the presence of mono- and polyubiquitinated OSCP in mitochondrial fractions. We demonstrate that processed OSCP undergoes retrotranslocation to a trypsin-sensitive form associated with the outer mitochondrial membrane. Inhibition of proteasome or hsp90 function results in accumulation of both correctly targeted and retrotranslocated mitochondrial OSCP. CONCLUSIONS: Cytosolic turnover of mitochondrial proteins demonstrates a novel connection between mitochondrial and cytosolic compartments through the ubiquitin-proteasome system. Analogous to defective protein folding in the endoplasmic reticulum, a mitochondrial unfolded protein response may play a role in the apoptotic effects of hsp90 and proteasome inhibitors.

  16. Genetic identification of istiophorid larvae from the Gulf of Mexico based on the analysis of mitochondrial DNA control region sequences.

    Science.gov (United States)

    McKenzie, J L; Alvarado Bremer, J R

    2017-03-01

    Assigning relative importance of spawning and nursery habitats for threatened and endangered teleosts, such as those seen in the Gulf of Mexico (GoM), relies on the proper identification of the early life-history stages of the species of concern. Here, sequencing a portion of the mitochondrial DNA (mtDNA) control region (CR) I as barcodes is recommended to identify istiophorid (billfish) larvae in the Atlantic Ocean because of its high resolution and the intrinsic value of the levels of genetic variation that can be extracted from these data. The universality of the primers employed here demonstrates their utility for not only the positive identification of istiophorids in the GoM, but for any larval teleost occurring in areas recognized as larval hotspots worldwide.

  17. Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

    Science.gov (United States)

    Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

    2014-01-01

    A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays.

  18. Mitochondrial calcium ion and membrane potential transients follow the pattern of epileptiform discharges in hippocampal slice cultures.

    Science.gov (United States)

    Kovács, Richard; Kardos, Julianna; Heinemann, Uwe; Kann, Oliver

    2005-04-27

    Emerging evidence suggests that mitochondrial dysfunction contributes to the pathophysiology of epilepsy. Recurrent mitochondrial Ca2+ ion load during seizures might act on mitochondrial membrane potential (DeltaPsim) and proton motive force. By using electrophysiology and confocal laser-scanning microscopy, we investigated the effects of epileptiform activity, as induced by low-Mg2+ ion perfusion in hippocampal slice cultures, on changes in DeltaPsim and in mitochondrial Ca2+ ion concentration ([Ca2+]m). The mitochondrial compartment was identified by monitoring DeltaPsim in the soma and dendrites of patched CA3 pyramidal cells using the mitochondria-specific voltage-sensitive dye rhodamine-123 (Rh-123). Interictal activity was accompanied by localized mitochondrial depolarization that was restricted to a few mitochondria in small dendrites. In contrast, robust Rh-123 release into the cytosol was observed during seizure-like events (SLEs), indicating simultaneous depolarization of mitochondria. This was critically dependent on Ca2+ ion uptake and extrusion, because inhibition of the mitochondrial Ca2+ ion uniporter by Ru360 and the mitochondrial Na+/Ca2+ ion exchanger by 7-chloro-5-(2-chlorophenyl)-1,5-dihydro-4,1-benzothiazepin-2(3H)-one but not the inhibitor of mitochondrial permeability transition pore, cyclosporin A, decreased the SLE-associated mitochondrial depolarization. The Ca2+ ion dependence of simultaneous mitochondrial depolarization suggested enhanced Ca2+ ion cycling across mitochondrial membranes during epileptiform activity. Indeed, [Ca2+]m fluctuated during interictal activity in single dendrites, and these fluctuations spread over the entire mitochondrial compartment during SLEs, as revealed using mitochondria-specific dyes (rhod-2 and rhod-ff) and spatial frequency-based image analysis. These findings strengthen the hypothesis that epileptic activity results in Ca2+ ion-dependent changes in mitochondrial function that might contribute to the

  19. QPCR: a tool for analysis of mitochondrial and nuclear DNA damage in ecotoxicology.

    Science.gov (United States)

    Meyer, Joel N

    2010-04-01

    The quantitative PCR (QPCR) assay for DNA damage and repair has been used extensively in laboratory species. More recently, it has been adapted to ecological settings. The purpose of this article is to provide a detailed methodological guide that will facilitate its adaptation to additional species, highlight its potential for ecotoxicological and biomonitoring work, and critically review the strengths and limitations of this assay. Major strengths of the assay include very low (nanogram to picogram) amounts of input DNA; direct comparison of damage and repair in the nuclear and mitochondrial genomes, and different parts of the nuclear genome; detection of a wide range of types of DNA damage; very good reproducibility and quantification; applicability to properly preserved frozen samples; simultaneous monitoring of relative mitochondrial genome copy number; and easy adaptation to most species. Potential limitations include the limit of detection (approximately 1 lesion per 10(5) bases); the inability to distinguish different types of DNA damage; and the need to base quantification of damage on a control or reference sample. I suggest that the QPCR assay is particularly powerful for some ecotoxicological studies.

  20. Unbiased gene expression analysis implicates the huntingtin polyglutamine tract in extra-mitochondrial energy metabolism.

    Directory of Open Access Journals (Sweden)

    Jong-Min Lee

    2007-08-01

    Full Text Available The Huntington's disease (HD CAG repeat, encoding a polymorphic glutamine tract in huntingtin, is inversely correlated with cellular energy level, with alleles over approximately 37 repeats leading to the loss of striatal neurons. This early HD neuronal specificity can be modeled by respiratory chain inhibitor 3-nitropropionic acid (3-NP and, like 3-NP, mutant huntingtin has been proposed to directly influence the mitochondrion, via interaction or decreased PGC-1alpha expression. We have tested this hypothesis by comparing the gene expression changes due to mutant huntingtin accurately expressed in STHdh(Q111/Q111 cells with the changes produced by 3-NP treatment of wild-type striatal cells. In general, the HD mutation did not mimic 3-NP, although both produced a state of energy collapse that was mildly alleviated by the PGC-1alpha-coregulated nuclear respiratory factor 1 (Nrf-1. Moreover, unlike 3-NP, the HD CAG repeat did not significantly alter mitochondrial pathways in STHdh(Q111/Q111 cells, despite decreased Ppargc1a expression. Instead, the HD mutation enriched for processes linked to huntingtin normal function and Nf-kappaB signaling. Thus, rather than a direct impact on the mitochondrion, the polyglutamine tract may modulate some aspect of huntingtin's activity in extra-mitochondrial energy metabolism. Elucidation of this HD CAG-dependent pathway would spur efforts to achieve energy-based therapeutics in HD.

  1. Feline mitochondrial DNA sampling for forensic analysis: When enough is enough!

    Science.gov (United States)

    Grahn, Robert A.; Alhaddad, Hasan; Alves, Paulo C.; Randi, Ettore; Waly, Nashwa E.; Lyons, Leslie A.

    2015-01-01

    Pet hair has a demonstrated value in resolving legal issues. Cat hair is chronically shed and it is difficult to leave a home with cats without some level of secondary transfer. The power of cat hair as an evidentiary resource may be underused because representative genetic databases are not available for exclusionary purposes. Mitochondrial control region databases are highly valuable for hair analyses and have been developed for the cat. In a representative worldwide data set, 83% of domestic cat mitotypes belong to one of twelve major types. Of the remaining 17%, 7.5% are unique within the published 1394 sample database. The current research evaluates the sample size necessary to establish a representative population for forensic comparison of the mitochondrial control region for the domestic cat. For most worldwide populations, randomly sampling 50 unrelated local individuals will achieve saturation at 95%. The 99% saturation is achieved by randomly sampling 60–170 cats, depending on the numbers of mitotypes available in the population at large. Likely due to the recent domestication of the cat and minimal localized population substructure, fewer cats are needed to meet mitochondria DNA control region database practical saturation than for humans or dogs. Coupled with the available worldwide feline control region database of nearly 1400 cats, minimal local sampling will be required to establish an appropriate comparative representative database and achieve significant exclusionary power. PMID:25531059

  2. Sequence Analysis of Mitochondrial DNA D-loop Region in Xinjiang Goose

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    [Objective] The sequences of mitochondrial DNA D-loop region of Xinjiang Goose with three different colors of plumage were analyzed in order to study the genetic diversity of Xinjiang Goose, as well as the phylogeny and evolution. [Method] Ten geese were selected randomly from the core populations of grey-, mosaic- and white-plumaged Xinjiang Goose respectively with a total number of thirty as experi- mental materials, of which the blood samples were collected from the largest vein under the wing (brachial vein) for DNA extraction. Sequences of mitochondrial DNA D-loop regions were determined using DNA sequencing technology to analyze the polymorphism. In addition, the genetic distances among different populations were estimated through the comparison with the reference sequences. [Resull] The con- tents of A, G, C and T nucleotides in the D-loop region of Xinjiang Goose were 28.85%, 17.05%, 25.38% and 28.72%, respectively. The average haplotype diversity and nucleotide diversity of Xinjiang Goose were 0.583 and 0.056. Xinjiang Goose and Greylag Goose were clustered into the same group. [Conclusion] The results showed that Xinjiang Geese with three different colors of plumage all descend from Greylag Goose (Anser anser).

  3. The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.

    Science.gov (United States)

    Bo, Zhang; Wenping, Song; Kefeng, Liu; Debin, Zheng; Chao, Ma; Guangxia, Xiao

    2016-09-01

    The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. ( 2009 ). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found ( Table 1 ). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes ( Table 1 ). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.

  4. Evidence for mitochondrial genetic control of autosomal gene expression.

    Science.gov (United States)

    Kassam, Irfahan; Qi, Tuan; Lloyd-Jones, Luke; Holloway, Alexander; Jan Bonder, Marc; Henders, Anjali K; Martin, Nicholas G; Powell, Joseph E; Franke, Lude; Montgomery, Grant W; Visscher, Peter M; McRae, Allan F

    2016-10-18

    The mitochondrial and nuclear genomes coordinate and co-evolve in eukaryotes in order to adapt to environmental changes. Variation in the mitochondrial genome is capable of affecting expression of genes on the nuclear genome. Sex-specific mitochondrial genetic control of gene expression has been demonstrated in Drosophila melanogaster, where males were found to drive most of the total variation in gene expression. This has potential implications for male-related health and disease resulting from variation in mtDNA solely inherited from the mother. We used a family-based study comprised of 47,323 gene expression probes and 78 mitochondrial SNPs (mtSNPs) from n = 846 individuals to examine the extent of mitochondrial genetic control of gene expression in humans. This identified 15 significant probe-mtSNP associations (P[Formula: see text]) corresponding to 5 unique genes on the mitochondrial and nuclear genomes, with three of these genes corresponding to mitochondrial genetic control of gene expression in the nuclear genome. The associated mtSNPs for three genes (one cis and two trans associations) were replicated (P expression in any of these five probes. Sex-specific effects were examined by applying our analysis to males and females separately and testing for differences in effect size. The MEST gene was identified as having the most significantly different effect sizes across the sexes (P [Formula: see text]). MEST was similarly expressed in males and females with the G allele; however, males with the C allele are highly expressed for MEST, while females show no expression of the gene. This study provides evidence for the mitochondrial genetic control of expression of several genes in humans, with little evidence found for sex-specific effects.

  5. Integrated compound profiling screens identify the mitochondrial electron transport chain as the molecular target of the natural products manassantin, sesquicillin, and arctigenin.

    Science.gov (United States)

    Lai, Kevin; Selinger, Douglas W; Solomon, Jonathan M; Wu, Hua; Schmitt, Esther; Serluca, Fabrizio C; Curtis, Daniel; Benson, John D

    2013-01-18

    Phenotypic compound screens can be used to identify novel targets in signaling pathways and disease processes, but the usefulness of these screens depends on the ability to quickly determine the target and mechanism of action of the molecules identified as hits. One fast route to discovering the mechanism of action of a compound is to profile its properties and to match this profile with those of compounds of known mechanism of action. In this work, the Novartis collection of over 12,000 pure natural products was screened for effects on early zebrafish development. The largest phenotypic class of hits, which caused developmental arrest without necrosis, contained known electron transport chain inhibitors and many compounds of unknown mechanism of action. High-throughput transcriptional profiling revealed that these compounds are mechanistically related to one another. Metabolic and biochemical assays confirmed that all of the molecules that induced developmental arrest without necrosis inhibited the electron transport chain. These experiments demonstrate that the electron transport chain is the target of the natural products manassantin, sesquicillin, and arctigenin. The overlap between the zebrafish and transcriptional profiling screens was not perfect, indicating that multiple profiling screens are necessary to fully characterize molecules of unknown function. Together, zebrafish screening and transcriptional profiling represent sensitive and scalable approaches for identifying bioactive compounds and elucidating their mechanism of action.

  6. Mitochondrial dynamics and peripheral neuropathy.

    Science.gov (United States)

    Baloh, Robert H

    2008-02-01

    Peripheral neuropathy is perhaps the archetypal disease of axonal degeneration, characteristically involving degeneration of the longest axons in the body. Evidence from both inherited and acquired forms of peripheral neuropathy strongly supports that the primary pathology is in the axons themselves and points to disruption of axonal transport as an important disease mechanism. Recent studies in human genetics have further identified abnormalities in mitochondrial dynamics--the fusion, fission, and movement of mitochondria--as a player in the pathogenesis of inherited peripheral neuropathy. This review provides an update on the mechanisms of mitochondrial trafficking in axons and the emerging relationship between the disruption of mitochondrial dynamics and axonal degeneration. Evidence suggests mitochondria are a "critical cargo" whose transport is necessary for proper axonal and synaptic function. Importantly, understanding the regulation of mitochondrial movement and the consequences of decreased axonal mitochondrial function may define new paths for therapeutic agents in peripheral neuropathy and other neurodegenerative diseases.

  7. Identifying At-Risk Students in General Chemistry via Cluster Analysis of Affective Characteristics

    Science.gov (United States)

    Chan, Julia Y. K.; Bauer, Christopher F.

    2014-01-01

    The purpose of this study is to identify academically at-risk students in first-semester general chemistry using affective characteristics via cluster analysis. Through the clustering of six preselected affective variables, three distinct affective groups were identified: low (at-risk), medium, and high. Students in the low affective group…

  8. Comparative genomic analysis reveals a novel mitochondrial isoform of human rTS protein and unusual phylogenetic distribution of the rTS gene

    Directory of Open Access Journals (Sweden)

    McGuire John J

    2005-09-01

    Full Text Available Abstract Background The rTS gene (ENOSF1, first identified in Homo sapiens as a gene complementary to the thymidylate synthase (TYMS mRNA, is known to encode two protein isoforms, rTSα and rTSβ. The rTSβ isoform appears to be an enzyme responsible for the synthesis of signaling molecules involved in the down-regulation of thymidylate synthase, but the exact cellular functions of rTS genes are largely unknown. Results Through comparative genomic sequence analysis, we predicted the existence of a novel protein isoform, rTS, which has a 27 residue longer N-terminus by virtue of utilizing an alternative start codon located upstream of the start codon in rTSβ. We observed that a similar extended N-terminus could be predicted in all rTS genes for which genomic sequences are available and the extended regions are conserved from bacteria to human. Therefore, we reasoned that the protein with the extended N-terminus might represent an ancestral form of the rTS protein. Sequence analysis strongly predicts a mitochondrial signal sequence in the extended N-terminal of human rTSγ, which is absent in rTSβ. We confirmed the existence of rTS in human mitochondria experimentally by demonstrating the presence of both rTSγ and rTSβ proteins in mitochondria isolated by subcellular fractionation. In addition, our comprehensive analysis of rTS orthologous sequences reveals an unusual phylogenetic distribution of this gene, which suggests the occurrence of one or more horizontal gene transfer events. Conclusion The presence of two rTS isoforms in mitochondria suggests that the rTS signaling pathway may be active within mitochondria. Our report also presents an example of identifying novel protein isoforms and for improving gene annotation through comparative genomic analysis.

  9. Complete DNA sequences of the mitochondrial genomes of the pathogenic yeasts Candida orthopsilosis and Candida metapsilosis: insight into the evolution of linear DNA genomes from mitochondrial telomere mutants.

    Science.gov (United States)

    Kosa, Peter; Valach, Matus; Tomaska, Lubomir; Wolfe, Kenneth H; Nosek, Jozef

    2006-01-01

    We determined complete mitochondrial DNA sequences of the two yeast species, Candida orthopsilosis and Candida metapsilosis, and compared them with the linear mitochondrial genome of their close relative, C.parapsilosis. Mitochondria of all the three species harbor compact genomes encoding the same set of genes arranged in the identical order. Differences in the length of these genomes result mainly from the presence/absence of introns. Multiple alterations were identified also in the sequences of the ribosomal and transfer RNAs, and proteins. However, the most striking feature of C.orthopsilosis and C.metapsilosis is the existence of strains differing in the molecular form of the mitochondrial genome (circular-mapping versus linear). Their analysis opens a unique window for understanding the role of mitochondrial telomeres in the stability and evolution of molecular architecture of the genome. Our results indicate that the circular-mapping mitochondrial genome derived from the linear form by intramolecular end-to-end fusions. Moreover, we suggest that the linear mitochondrial genome evolved from a circular-mapping form present in a common ancestor of the three species and, at the same time, the emergence of mitochondrial telomeres enabled the formation of linear monomeric DNA forms. In addition, comparison of isogenic C.metapsilosis strains differing in the form of the organellar genome suggests a possibility that, under some circumstances, the linearity and/or the presence of telomeres provide a competitive advantage over a circular-mapping mitochondrial genome.

  10. Mitogenomic analysis of a 50-generation chicken pedigree reveals a rapid rate of mitochondrial evolution and evidence for paternal mtDNA inheritance.

    Science.gov (United States)

    Alexander, Michelle; Ho, Simon Y W; Molak, Martyna; Barnett, Ross; Carlborg, Örjan; Dorshorst, Ben; Honaker, Christa; Besnier, Francois; Wahlberg, Per; Dobney, Keith; Siegel, Paul; Andersson, Leif; Larson, Greger

    2015-10-01

    Mitochondrial genomes represent a valuable source of data for evolutionary research, but studies of their short-term evolution have typically been limited to invertebrates, humans and laboratory organisms. Here we present a detailed study of 12 mitochondrial genomes that span a total of 385 transmissions in a well-documented 50-generation pedigree in which two lineages of chickens were selected for low and high juvenile body weight. These data allowed us to test the hypothesis of time-dependent evolutionary rates and the assumption of strict maternal mitochondrial transmission, and to investigate the role of mitochondrial mutations in determining phenotype. The identification of a non-synonymous mutation in ND4L and a synonymous mutation in CYTB, both novel mutations in Gallus, allowed us to estimate a molecular rate of 3.13 × 10(-7) mutations/site/year (95% confidence interval 3.75 × 10(-8)-1.12 × 10(-6)). This is substantially higher than avian rate estimates based upon fossil calibrations. Ascertaining which of the two novel mutations was present in an additional 49 individuals also revealed an instance of paternal inheritance of mtDNA. Lastly, an association analysis demonstrated that neither of the point mutations was strongly associated with the phenotypic differences between the two selection lines. Together, these observations reveal the highly dynamic nature of mitochondrial evolution over short time periods.

  11. Comparative mitochondrial genomics toward exploring molecular markers in the medicinal fungus Cordyceps militaris.

    Science.gov (United States)

    Zhang, Shu; Hao, Ai-Jing; Zhao, Yu-Xiang; Zhang, Xiao-Yu; Zhang, Yong-Jie

    2017-01-10

    Cordyceps militaris is a fungus used for developing health food, but knowledge about its intraspecific differentiation is limited due to lack of efficient markers. Herein, we assembled the mitochondrial genomes of eight C. militaris strains and performed a comparative mitochondrial genomic analysis together with three previously reported mitochondrial genomes of the fungus. Sizes of the 11 mitochondrial genomes varied from 26.5 to 33.9 kb mainly due to variable intron contents (from two to eight introns per strain). Nucleotide variability varied according to different regions with non-coding regions showing higher variation frequency than coding regions. Recombination events were identified between some locus pairs but seemed not to contribute greatly to genetic variations of the fungus. Based on nucleotide diversity fluctuations across the alignment of all mitochondrial genomes, molecular markers with the potential to be used for future typing studies were determined.

  12. LRPPRC is a mitochondrial matrix protein that is conserved in metazoans

    Energy Technology Data Exchange (ETDEWEB)

    Sterky, Fredrik H. [Department of Laboratory Medicine, Karolinska Institutet, Retzius vaeg 8, SE-171 77 Stockholm (Sweden); Ruzzenente, Benedetta [Max-Planck-Institut fuer Biologie des Alterns, Gleueler Str. 50a, D-50931 Cologne (Germany); Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35127 Padova (Italy); Gustafsson, Claes M. [Max-Planck-Institut fuer Biologie des Alterns, Gleueler Str. 50a, D-50931 Cologne (Germany); Department of Biochemistry and Cell Biology, University of Gothenburg, P.O. Box 440, SE-405 30 Gothenburg (Sweden); Samuelsson, Tore [Department of Biochemistry and Cell Biology, University of Gothenburg, P.O. Box 440, SE-405 30 Gothenburg (Sweden); Larsson, Nils-Goeran, E-mail: larsson@age.mpg.de [Max-Planck-Institut fuer Biologie des Alterns, Gleueler Str. 50a, D-50931 Cologne (Germany)

    2010-08-06

    Research highlights: {yields} LRPPRC orthologs are restricted to metazoans. {yields} LRPPRC is imported to the mitochondrial matrix. {yields} No evidence of nuclear isoform. -- Abstract: LRPPRC (also called LRP130) is an RNA-binding pentatricopeptide repeat protein. LRPPRC has been recognized as a mitochondrial protein, but has also been shown to regulate nuclear gene transcription and to bind specific RNA molecules in both the nucleus and the cytoplasm. We here present a bioinformatic analysis of the LRPPRC primary sequence, which reveals that orthologs to the LRPPRC gene are restricted to metazoan cells and that all of the corresponding proteins contain mitochondrial targeting signals. To address the subcellular localization further, we have carefully analyzed LRPPRC in mammalian cells and identified a single isoform that is exclusively localized to mitochondria. The LRPPRC protein is imported to the mitochondrial matrix and its mitochondrial targeting sequence is cleaved upon entry.

  13. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Casaregola, S.; Ussery, David;

    2003-01-01

    mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S. servazzii contain, in total, five + 1 frameshifts. mtDNAs of S. castellii, S. servazzii and S. cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order......The complete sequences of mitochondrial DNA ( mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among...... Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S. cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S. cerevisiae...

  14. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia

    Science.gov (United States)

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W.; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-01-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks). PMID:25051224

  15. Sequencing and analysis of the complete mitochondrial DNA of Russell's snapper (L.russellii)

    Institute of Scientific and Technical Information of China (English)

    Yusong Guo; Zhongduo Wang; Chuwu Liu; Yun Liu

    2008-01-01

    The entire mitochondrial DNA sequence (mitogenome) of Russell's snapper (Lutjanus russellii) was determined using long PCR and primer-walking methodology,representing the first complete mitogenome accessioned for Lutjanid fishes (16,505 bp,GenBank Accession No.EF514208).The mitogenome was similar in gene composition and order to those of other vertebrates,having 37 structural genes,i.e.,two ribosomal RNAs,22 transfer RNAs,and 13 protein-coding genes.Phylogenetic analyses based on the mtDNA sequence of Russell's snapper supported a close relationship between Lutjaninae and Caesioninae,consistent with taxonomic hypotheses based on morphology.More studies utilizing mitogenomes are needed to resolve high-level relationships among snappers.

  16. Genetic diversity analysis of mitochondrial DNA control region in artificially propagated Chinese sucker Myxocyprinus asiaticus.

    Science.gov (United States)

    Wan, Yuan; Zhou, Chun-Hua; Ouyang, Shan; Huang, Xiao-Chen; Zhan, Yang; Zhou, Ping; Rong, Jun; Wu, Xiao-Ping

    2015-08-01

    The genetic diversity of the three major artificially propagated populations of Chinese sucker, an endangered freshwater fish species, was investigated using the sequences of mitochondrial DNA (mtDNA) control regions. Among the 89 individuals tested, 66 variable sites (7.26%) and 10 haplotypes were detected (Haplotype diversity Hd = 0.805, Nucleotide diversity π = 0.0287). In general, genetic diversity was lower in artificially propagated populations than in wild populations. This reduction in genetic diversity may be due to population bottlenecks, genetic drift and human selection. A stepping-stone pattern of gene flow was detected in the populations studied, showing much higher gene flow between neighbouring populations. To increase the genetic diversity, wild lineages should be introduced, and more lineages should be shared among artificially propagated populations.

  17. Meta-Analysis of Mitochondrial DNA Reveals Several Population Bottlenecks during Worldwide Migrations of Cattle

    Directory of Open Access Journals (Sweden)

    Johannes A. Lenstra

    2014-03-01

    Full Text Available Several studies have investigated the differentiation of mitochondrial DNA in Eurasian, African and American cattle as well as archaeological bovine material. A global survey of these studies shows that haplogroup distributions are more stable in time than in space. All major migrations of cattle have shifted the haplogroup distributions considerably with a reduction of the number of haplogroups and/or an expansion of haplotypes that are rare or absent in the ancestral populations. The most extreme case is the almost exclusive colonization of Africa by the T1 haplogroup, which is rare in Southwest Asian cattle. In contrast, ancient samples invariably show continuity with present-day cattle from the same location. These findings indicate strong maternal founder effects followed by limited maternal gene flow when new territories are colonized. However, effects of adaptation to new environments may also play a role.

  18. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia.

    Science.gov (United States)

    Jankova-Ajanovska, Renata; Zimmermann, Bettina; Huber, Gabriela; Röck, Alexander W; Bodner, Martin; Jakovski, Zlatko; Janeska, Biljana; Duma, Aleksej; Parson, Walther

    2014-11-01

    A total of 444 individuals representing three ethnic groups (Albanians, Turks and Romanies) in the Republic of Macedonia were sequenced in the mitochondrial control region. The mtDNA haplogroup composition differed between the three groups. Our results showed relatively high frequencies of haplogroup H12 in Albanians (8.8%) and less in Turks (3.3%), while haplogroups M5a1 and H7a1a were dominant in Romanies (13.7% and 10.3%, respectively) but rare in the former two. This highlights the importance of regional sampling for forensic mtDNA databasing purposes. These population data will be available on EMPOP under accession numbers EMP00644 (Albanians), EMP00645 (Romanies) and EMP00646 (Turks).

  19. Genetic Differences of Mitten Crabs Based on RFLP Analysis on Mitochondrial Cytochrome Oxidase Subunit I (COI) Gene

    Institute of Scientific and Technical Information of China (English)

    HU Pengfei; WANG Qian; DAI Wei; WANG Xiaomei

    2008-01-01

    The genetic differences of 15 mitten crab populations from 6 river systems in mainland China and 1 population from Russia were studied based on RFLP analysis of mitochondrial cytochrome oxidase subunit I (COI).The results showed that Tas I-RFLP pattern could be used as a genetic marker to distinguish Eriocheir hepuensis from Eriocheir sinensis, Eriocheirjaponica and Eriocheir leptognathus;genetic distances among 13 populations ofEriocheir sinensis range from 0 to 0.015, indicating that they were different geographic strains;the subspecies status ofEriocheir sinensis and Eriocheir hepuensis (population from Nanliujiang) were considered owning to their genetic distances of 0.02-0.044,indicating that genetic divergence between them was low; Eriocheir leptognathus (population from Nanpaihe, Tianjin) was the most distant taxon with genetic distances value of 0.147-0.195,which could be defined as genetic distances between species in genus Eriocheir.

  20. Origin and phylogenetic analysis of Tibetan Mastiff based on the mitochondrial DNA sequence

    Institute of Scientific and Technical Information of China (English)

    Qifa Li; Zhuang Xie; Zhenshan Liu; Yinxia Li; Xingbo Zhao; Liyan Dong; Zengxiang Pan; Yuanrong Sun; Ning Li; Yinxue Xu

    2008-01-01

    At present, the Tibetan Mastiff is the oldest and most ferocious dog in the world. However, the origin of the Tibetan Mastiff and its Phylogenetic relationship with other large breed dogs such as Saint Bernard are unclear. In this study, the primers were designed according to the mitochondrial genome sequence of the domestic dog, and the 2,525 bp mitochondrial sequence, containing the whole sequence of Cytochrome b, tRNA-Thr, tRNA-Pro, and control region of the Tibetan Mastiff, was obtained. Using grey wolves and coyotes as outgroups, the Tibetan Mastiff and 12 breeds of domestic dogs were analyzed in phylogenesis. Tibetan Mastiff, domestic dog breeds, and grey wolves were clustered into a group and coyotes were clustered in a group separately. This indicated that the Tibetan Mastiff and the other domestic dogs originated from the grey wolf, and the Tibetan Mastiff belonged to Carnivora, Canidae, Canis, Canis lupus, Canis lupus familiaris on the animal taxonomy. In domestic dogs, the middle and small breed dogs were clustered at first; German Sheepdog, Swedish Elkhound, and Black Russian Terrier were clustered into one group, and the Tibetan Mastiff, Old English Sheepdog, Leonberger, and Saint Bernard were clustered in another group. This confirmed the viewpoint that many of the famous large breed dogs worldwide Such as Saint Bernard possibly had the blood lineage of the Tibetan Mastiff, based on the molecular data. According to the substitution rate, we concluded that the approximate divergence time between Tibetan Mastiff and grey wolf was 58,000 years before the present (YBP), and the approximate divergence time between other domestic dogs and grey wolf was 42,000 YBP, demonstrating that the time of origin of the Tibetan Mastiff was earlier than that of the other domestic dogs.

  1. Comparative analysis of mitochondrial genomes in Diplura (hexapoda, arthropoda): taxon sampling is crucial for phylogenetic inferences.

    Science.gov (United States)

    Chen, Wan-Jun; Koch, Markus; Mallatt, Jon M; Luan, Yun-Xia

    2014-01-01

    Two-pronged bristletails (Diplura) are traditionally classified into three major superfamilies: Campodeoidea, Projapygoidea, and Japygoidea. The interrelationships of these three superfamilies and the monophyly of Diplura have been much debated. Few previous studies included Projapygoidea in their phylogenetic considerations, and its position within Diplura still is a puzzle from both morphological and molecular points of view. Until now, no mitochondrial genome has been sequenced for any projapygoid species. To fill in this gap, we determined and annotated the complete mitochondrial genome of Octostigma sinensis (Octostigmatidae, Projapygoidea), and of three more dipluran species, one each from the Campodeidae, Parajapygidae, and Japygidae. All four newly sequenced dipluran mtDNAs encode the same set of genes in the same gene order as shared by most crustaceans and hexapods. Secondary structure truncations have occurred in trnR, trnC, trnS1, and trnS2, and the reduction of transfer RNA D-arms was found to be taxonomically correlated, with Campodeoidea having experienced the most reduction. Partitioned phylogenetic analyses, based on both amino acids and nucleotides of the protein-coding genes plus the ribosomal RNA genes, retrieve significant support for a monophyletic Diplura within Pancrustacea, with Projapygoidea more closely related to Campodeoidea than to Japygoidea. Another key finding is that monophyly of Diplura cannot be recovered unless Projapygoidea is included in the phylogenetic analyses; this explains the dipluran polyphyly found by past mitogenomic studies. Including Projapygoidea increased the sampling density within Diplura and probably helped by breaking up a long-branch-attraction artifact. This finding provides an example of how proper sampling is significant for phylogenetic inference.

  2. Assessing Reliability of Cellulose Hydrolysis Models to Support Biofuel Process Design – Identifiability and Uncertainty Analysis

    DEFF Research Database (Denmark)

    Sin, Gürkan; Meyer, Anne S.; Gernaey, Krist

    2010-01-01

    The reliability of cellulose hydrolysis models is studied using the NREL model. An identifiability analysis revealed that only 6 out of 26 parameters are identifiable from the available data (typical hydrolysis experiments). Attempting to identify a higher number of parameters (as done in the ori...... to analyze the uncertainty of model predictions. This allows judging the fitness of the model to the purpose under uncertainty. Hence we recommend uncertainty analysis as a proactive solution when faced with model uncertainty, which is the case for biofuel process development research....

  3. Automated Measurement of Fast Mitochondrial Transport in Neurons

    Directory of Open Access Journals (Sweden)

    Kyle eMiller

    2015-11-01

    Full Text Available There is a growing recognition that fast mitochondrial transport in neurons is disrupted in multiple neurological diseases and psychiatric disorders. However a major constraint in identifying novel therapeutics based on mitochondrial transport is that the large-scale analysis of fast transport is time consuming. Here we describe methodologies for the automated analysis of fast mitochondrial transport from data acquired using a robotic microscope. We focused on addressing questions of measurement precision, speed, reliably, workflow ease, statistical processing and presentation. We used optical flow and particle tracking algorithms, implemented in ImageJ, to measure mitochondrial movement in primary cultured cortical and hippocampal neurons. With it, we are able to generate complete descriptions of movement profiles in an automated fashion of hundred of thousands of mitochondria with a processing time of approximately one hour. We describe the calibration of the parameters of the tracking algorithms and demonstrate that they are capable of measuring the fast transport of a single mitochondrion. We then show that the methods are capable of reliably measuring the inhibition of fast mitochondria transport induced by the disruption of microtubules with the drug nocodazole in both hippocampal and cortical neurons. This work lays the foundation for future large-scale screens designed to identify compounds that modulate mitochondrial motility.

  4. Automated measurement of fast mitochondrial transport in neurons.

    Science.gov (United States)

    Miller, Kyle E; Liu, Xin-An; Puthanveettil, Sathyanarayanan V

    2015-01-01

    There is growing recognition that fast mitochondrial transport in neurons is disrupted in multiple neurological diseases and psychiatric disorders. However, a major constraint in identifying novel therapeutics based on mitochondrial transport is that the large-scale analysis of fast transport is time consuming. Here we describe methodologies for the automated analysis of fast mitochondrial transport from data acquired using a robotic microscope. We focused on addressing questions of measurement precision, speed, reliably, workflow ease, statistical processing, and presentation. We used optical flow and particle tracking algorithms, implemented in ImageJ, to measure mitochondrial movement in primary cultured cortical and hippocampal neurons. With it, we are able to generate complete descriptions of movement profiles in an automated fashion of hundreds of thousands of mitochondria with a processing time of approximately one hour. We describe the calibration of the parameters of the tracking algorithms and demonstrate that they are capable of measuring the fast transport of a single mitochondrion. We then show that the methods are capable of reliably measuring the inhibition of fast mitochondria transport induced by the disruption of microtubules with the drug nocodazole in both hippocampal and cortical neurons. This work lays the foundation for future large-scale screens designed to identify compounds that modulate mitochondrial motility.

  5. Computationally driven, quantitative experiments discover genes required for mitochondrial biogenesis.

    Directory of Open Access Journals (Sweden)

    David C Hess

    2009-03-01

    Full Text Available Mitochondria are central to many cellular processes including respiration, ion homeostasis, and apoptosis. Using computational predictions combined with traditional quantitative experiments, we have identified 100 proteins whose deficiency alters mitochondrial biogenesis and inheritance in Saccharomyces cerevisiae. In addition, we used computational predictions to perform targeted double-mutant analysis detecting another nine genes with synthetic defects in mitochondrial biogenesis. This represents an increase of about 25% over previously known participants. Nearly half of these newly characterized proteins are conserved in mammals, including several orthologs known to be involved in human disease. Mutations in many of these genes demonstrate statistically significant mitochondrial transmission phenotypes more subtle than could be detected by traditional genetic screens or high-throughput techniques, and 47 have not been previously localized to mitochondria. We further characterized a subset of these genes using growth profiling and dual immunofluorescence, which identified genes specifically required for aerobic respiration and an uncharacterized cytoplasmic protein required for normal mitochondrial motility. Our results demonstrate that by leveraging computational analysis to direct quantitative experimental assays, we have characterized mutants with subtle mitochondrial defects whose phenotypes were undetected by high-throughput methods.

  6. An original phylogenetic approach identified mitochondrial haplogroup T1a1 as inversely associated with breast cancer risk in BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Blein, Sophie; Bardel, Claire; Danjean, Vincent

    2015-01-01

    or unaffected individuals. RESULTS: We discovered that subclade T1a1 was depleted in affected BRCA2 mutation carriers compared with the rest of clade T (hazard ratio (HR) = 0.55; 95% confidence interval (CI), 0.34 to 0.88; P = 0.01). Compared with the most frequent haplogroup in the general population (that is......, H and T clades), the T1a1 haplogroup has a HR of 0.62 (95% CI, 0.40 to 0.95; P = 0.03). We also identified three potential susceptibility loci, including G13708A/rs28359178, which has demonstrated an inverse association with familial breast cancer risk. CONCLUSIONS: This study illustrates how...

  7. Mitochondrial calcium uptake.

    Science.gov (United States)

    Williams, George S B; Boyman, Liron; Chikando, Aristide C; Khairallah, Ramzi J; Lederer, W J

    2013-06-25

    Calcium (Ca(2+)) uptake into the mitochondrial matrix is critically important to cellular function. As a regulator of matrix Ca(2+) levels, this flux influences energy production and can initiate cell death. If large, this flux could potentially alter intracellular Ca(2+) ([Ca(2+)]i) signals. Despite years of study, fundamental disagreements on the extent and speed of mitochondrial Ca(2+) uptake still exist. Here, we review and quantitatively analyze mitochondrial Ca(2+) uptake fluxes from different tissues and interpret the results with respect to the recently proposed mitochondrial Ca(2+) uniporter (MCU) candidate. This quantitative analysis yields four clear results: (i) under physiological conditions, Ca(2+) influx into the mitochondria via the MCU is small relative to other cytosolic Ca(2+) extrusion pathways; (ii) single MCU conductance is ∼6-7 pS (105 mM [Ca(2+)]), and MCU flux appears to be modulated by [Ca(2+)]i, suggesting Ca(2+) regulation of MCU open probability (P(O)); (iii) in the heart, two features are clear: the number of MCU channels per mitochondrion can be calculated, and MCU probability is low under normal conditions; and (iv) in skeletal muscle and liver cells, uptake per mitochondrion varies in magnitude but total uptake per cell still appears to be modest. Based on our analysis of available quantitative data, we conclude that although Ca(2+) critically regulates mitochondrial function, the mitochondria do not act as a significant dynamic buffer of cytosolic Ca(2+) under physiological conditions. Nevertheless, with prolonged (superphysiological) elevations of [Ca(2+)]i, mitochondrial Ca(2+) uptake can increase 10- to 1,000-fold and begin to shape [Ca(2+)]i dynamics.

  8. Complete mitochondrial genome of the medicinal mushroom Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Jianqin Li

    Full Text Available Ganoderma lucidum is one of the well-known medicinal basidiomycetes worldwide. The mitochondrion, referred to as the second genome, is an organelle found in most eukaryotic cells and participates in critical cellular functions. Elucidating the structure and function of this genome is important to understand completely the genetic contents of G. lucidum. In this study, we assembled the mitochondrial genome of G. lucidum and analyzed the differential expressions of its encoded genes across three developmental stages. The mitochondrial genome is a typical circular DNA molecule of 60,630 bp with a GC content of 26.67%. Genome annotation identified genes that encode 15 conserved proteins, 27 tRNAs, small and large rRNAs, four homing endonucleases, and two hypothetical proteins. Except for genes encoding trnW and two hypothetical proteins, all genes were located on the positive strand. For the repeat structure analysis, eight forward, two inverted, and three tandem repeats were detected. A pair of fragments with a total length around 5.5 kb was found in both the nuclear and mitochondrial genomes, which suggests the possible transfer of DNA sequences between two genomes. RNA-Seq data for samples derived from three stages, namely, mycelia, primordia, and fruiting bodies, were mapped to the mitochondrial genome and qualified. The protein-coding genes were expressed higher in mycelia or primordial stages compared with those in the fruiting bodies. The rRNA abundances were significantly higher in all three stages. Two regions were transcribed but did not contain any identified protein or tRNA genes. Furthermore, three RNA-editing sites were detected. Genome synteny analysis showed that significant genome rearrangements occurred in the mitochondrial genomes. This study provides valuable information on the gene contents of the mitochondrial genome and their differential expressions at various developmental stages of G. lucidum. The results contribute to the

  9. Alternative to Ritt's Pseudodivision for finding the input-output equations in algebraic structural identifiability analysis

    CERN Document Server

    Meshkat, Nicolette; DiStefano, Joseph J

    2012-01-01

    Differential algebra approaches to structural identifiability analysis of a dynamic system model in many instances heavily depend upon Ritt's pseudodivision at an early step in analysis. The pseudodivision algorithm is used to find the characteristic set, of which a subset, the input-output equations, is used for identifiability analysis. A simpler algorithm is proposed for this step, using Gr\\"obner Bases, along with a proof of the method that includes a reduced upper bound on derivative requirements. Efficacy of the new algorithm is illustrated with two biosystem model examples.

  10. Geographical origin of Plasmodium vivax in the Republic of Korea: haplotype network analysis based on the parasite's mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Iwagami Moritoshi

    2010-06-01

    Full Text Available Abstract Background The Republic of Korea (South Korea is one of the countries where vivax malaria had been successfully eradicated by the late 1970s. However, re-emergence of vivax malaria in South Korea was reported in 1993. Several epidemiological studies and some genetic studies using antigenic molecules of Plasmodium vivax in the country have been reported, but the evolutionary history of P. vivax has not been fully understood. In this study, the origin of the South Korean P. vivax population was estimated by molecular phylogeographic analysis. Methods A haplotype network analysis based on P. vivax mitochondrial (mt DNA sequences was conducted on 11 P. vivax isolates from South Korea and another 282 P. vivax isolates collected worldwide. Results The network analysis of P. vivax mtDNA sequences showed that the coexistence of two different groups (A and B in South Korea. Groups A and B were identical or close to two different populations in southern China. Conclusions Although the direct introduction of the two P. vivax populations in South Korea were thought to have been from North Korea, the results of this analysis suggest the genealogical origin to be the two different populations in southern China.

  11. Mitochondrial Myopathy

    Science.gov (United States)

    ... diseases are caused by CoQ10 deficiency, and CoQ10 supplementation is clearly beneficial in these cases. It might provide some relief from other mitochondrial diseases. Creatine, L-carnitine, and CoQ10 supplements often are combined into a “ ...

  12. A novel mitochondrial tRNA gene mutation in a chinese family with dilated cardiomyopathy and sensorineural deafness

    Institute of Scientific and Technical Information of China (English)

    Xianghong Wu; Xiumei Xie; Guotian Ma; Guoju Sun; Xiaobin Chen

    2006-01-01

    Objective: To determine whether a mutation of mitochondrial DNA induces familial dilated cardiomyopathy in Chinese families with cardiomyopathy, and analyzed the correlation between the genotype and phenotype. Methods: Affected members in three Chinese families of the familial dilated cardiomyopathy underwent clinical evaluation and DNA analysis. Polymerase chain reaction and direct DNA sequencing were used to screen for mitochondrial DNA mutation. The type of mtDNA vairations and clinical situation were analysed on the patients with mitochondrial DNA mutation. Results: The mitochondrial A3434G mutation was identified in one of the three families,the 3434 th nucleotide A was replaced by G, which led to change of amino acid. No mutations were identified in the clinically unaffected members of the family and all members of the other two families.Conclusion: This study indicates that the mitochondrial A3434G mutation maybe related with familial dilated cardiomyopathy and deafness.

  13. Delaunay algorithm and principal component analysis for 3D visualization of mitochondrial DNA nucleoids by Biplane FPALM/dSTORM.

    Science.gov (United States)

    Alán, Lukáš; Špaček, Tomáš; Ježek, Petr

    2016-07-01

    Data segmentation and object rendering is required for localization super-resolution microscopy, fluorescent photoactivation localization microscopy (FPALM), and direct stochastic optical reconstruction microscopy (dSTORM). We developed and validated methods for segmenting objects based on Delaunay triangulation in 3D space, followed by facet culling. We applied them to visualize mitochondrial nucleoids, which confine DNA in complexes with mitochondrial (mt) transcription factor A (TFAM) and gene expression machinery proteins, such as mt single-stranded-DNA-binding protein (mtSSB). Eos2-conjugated TFAM visualized nucleoids in HepG2 cells, which was compared with dSTORM 3D-immunocytochemistry of TFAM, mtSSB, or DNA. The localized fluorophores of FPALM/dSTORM data were segmented using Delaunay triangulation into polyhedron models and by principal component analysis (PCA) into general PCA ellipsoids. The PCA ellipsoids were normalized to the smoothed volume of polyhedrons or by the net unsmoothed Delaunay volume and remodeled into rotational ellipsoids to obtain models, termed DVRE. The most frequent size of ellipsoid nucleoid model imaged via TFAM was 35 × 45 × 95 nm; or 35 × 45 × 75 nm for mtDNA cores; and 25 × 45 × 100 nm for nucleoids imaged via mtSSB. Nucleoids encompassed different point density and wide size ranges, speculatively due to different activity stemming from different TFAM/mtDNA stoichiometry/density. Considering twofold lower axial vs. lateral resolution, only bulky DVRE models with an aspect ratio >3 and tilted toward the xy-plane were considered as two proximal nucleoids, suspicious occurring after division following mtDNA replication. The existence of proximal nucleoids in mtDNA-dSTORM 3D images of mtDNA "doubling"-supported possible direct observations of mt nucleoid division after mtDNA replication.

  14. Complex interactions of the Eastern and Western Slavic populations with other European groups as revealed by mitochondrial DNA analysis.

    Science.gov (United States)

    Grzybowski, Tomasz; Malyarchuk, Boris A; Derenko, Miroslava V; Perkova, Maria A; Bednarek, Jarosław; Woźniak, Marcin

    2007-06-01

    Mitochondrial DNA sequence variation was examined by the control region sequencing (HVS I and HVS II) and RFLP analysis of haplogroup-diagnostic coding region sites in 570 individuals from four regional populations of Poles and two Russian groups from northwestern part of the country. Additionally, sequences of complete mitochondrial genomes representing K1a1b1a subclade in Polish and Polish Roma populations have been determined. Haplogroup frequency patterns revealed in Poles and Russians are similar to those characteristic of other Europeans. However, there are several features of Slavic mtDNA pools seen on the level of regional populations which are helpful in the understanding of complex interactions of the Eastern and Western Slavic populations with other European groups. One of the most important is the presence of subhaplogroups U5b1b1, D5, Z1 and U8a with simultaneous scarcity of haplogroup K in populations of northwestern Russia suggesting the participation of Finno-Ugrian tribes in the formation of mtDNA pools of Russians from this region. The results of genetic structure analyses suggest that Russians from Velikii Novgorod area (northwestern Russia) and Poles from Suwalszczyzna (northeastern Poland) differ from all remaining Polish and Russian samples. Simultaneously, northwestern Russians and northeastern Poles bear some similarities to Baltic (Latvians) and Finno-Ugrian groups (Estonians) of northeastern Europe, especially on the level of U5 haplogroup frequencies. The occurrence of K1a1b1a subcluster in Poles and Polish Roma is one of the first direct proofs of the presence of Ashkenazi-specific mtDNA lineages in non-Jewish European populations.

  15. Analysis of mitochondrial control region nucleotide sequences from Baffin Bay beluga, (Delphinapterus leucas: detecting pods or sub-populations?

    Directory of Open Access Journals (Sweden)

    Per Jakob Palsbøll

    2002-07-01

    Full Text Available We report the results of an analysis of the variation in the nucleotide sequence of the mitochondrial control region obtained in 218 samples collected from belugas, Delphinapterus leucas, around the Baffin Bay. We detected multiple instances of significant heterogeneity in the distribution of genetic variation among the analyzed mitochondrial control region sequences on a spatial as well as temporal scale indicating a high degree of maternal population structure. The detection of significant levels of heterogeneity between samples collected in different years but within the same area and season was unexpected. Re-examination of earlier results presented by Brown Gladden and coworkers also revealed temporal genetic heterogeneity within the one area where sufficient (n>15 samples were collected in multiple years. These findings suggest that non-random breeding and maternally directed site-fidelity are not the sole causes of genetic heterogeneity among belugas but that a matrilineal pod structure might cause significant levels of genetic heterogeneity as well, even within the same area. We propose that a maternal pod structure, which has been shown to be the cause of significant genetic heterogeneity in other odontocetes, may add to the overall level of heterogeneity in the maternally inherited DNA and hence that much of the spatial heterogeneity observed in this and previous studies might be attributed to pod rather than population structure. Our findings suggest that it is important to estimate the contribution of pod structure to overall heterogeneity before defining populations or management units in order to avoid interpreting heterogeneity due to sampling of different pods as different populations/management units.

  16. Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger

    Science.gov (United States)

    Li, Kangxin; Yang, Fang; Abdullahi, A. Y.; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

    2016-01-01

    Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina. This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts. PMID:28095667

  17. RESTRICTION ENDONUCLEASE ANALYSIS OF MITOCHONDRIAL DNA FROM HUMAN LUNG ADENOCARCINOMA CELL LINE SPC-A-1

    Institute of Scientific and Technical Information of China (English)

    HU Yide; QIAN Guisheng; CHEN Weizhong; LI Shuping; WANG Guansong; MAO Baoling

    1999-01-01

    Objective: To understand the role of mitochondrial DNA (mtDNA) in carcinogenesis. Methods: single-step method was used to isolate the mtDNA from human lung adenocarcinoma cell line SPC-A-1. The mtDNA was analyzed by restriction fragment length polymorphism (RFLP) with 11 kinds of restriction endonuclease, which were Pvu Ⅱ, Xho Ⅰ, Pst Ⅰ, EcoR Ⅰ,BstE Ⅱ, Hind Ⅲ, Hpa Ⅰ, Bcl Ⅰ, EcoR Ⅴ, Sca Ⅰ and Xba Ⅰ.Restriction map of mtDNA from SPC-A-1 cell was obtained by the single and double-digestion method.Results: It was found that no variation at 32 restrictionsites could be detected in the coding region of mtDNA from SPC-A-1 cell line. But a new site was found at nucleotide 16276 (EcoR Ⅴ) within the noncoding region.Conclusion: These results indicate that the primary structure of gene coding region of mtDNA isolated from SPC-A-1 cell is highly stable. While the major variation of nucleotide is probably located in the noncoding region.

  18. Analysis on the Complete Mitochondrial Genome of Andraca theae (Lepidoptera: Bombycoidea)

    Science.gov (United States)

    Gu, Xing-Shi; Ma, Li; Wang, Xing; Huang, Guo-Hua

    2016-01-01

    The bombycid moth, Andraca theae (Matsumura) (Lepidoptera: Bombycoidea) is an important pest of tea in southeastern China. In the present study, the mitochondrial genome (mitogenome) of A. theae was amplified by polymerase chain reaction and sequenced. The complete mitogenome of A. theae, encoding 37 genes, was 15,737 bp in length (Genbank no. KX365419), and consisted of 13 protein-coding genes (PCGs), 22 tRNA genes, 2 ribosomal RNA genes and an adenine (A) + thymine (T)-rich region (AT-rich region). The gene order of A. theae mitogenome was typical for Lepidoptera mitogenomes. Except for cox1, which started with CGA, all other 12 PCGs started with ATN. Eleven of the 13 PCGs ended with TAA, expect for cox1 and cox2, which ended with a single T. The maximum likelihood method and the Bayesian method were used to analyze the phylogenetic relationship among 22 representative bombycoid species with a matrix consisting of the 13 PCGs of the mitogenomes of the 22 species. The topological structures of the two phylogenetic trees we constructed were almost identical, with the results indicating that the bombycid species, including A. theae, clustered into a single clade with a bootstrap value of 58% and a posterior probability of 0.98. The phylogenetic relationship among the Bombycoidea species analyzed was Lasiocampidae + (Bombycidae + (Saturniidae + Sphingidae)) which was supported by a high bootstrap value of 100% and a posterior probability of 1.00.

  19. Using machine vision and data mining techniques to identify cell properties via microfluidic flow analysis

    Science.gov (United States)

    Horowitz, Geoffrey; Bowie, Samuel; Liu, Anna; Stone, Nicholas; Sulchek, Todd; Alexeev, Alexander

    2016-11-01

    In order to quickly identify the wide range of mechanistic properties that are seen in cell populations, a coupled machine vision and data mining analysis is developed to examine high speed videos of cells flowing through a microfluidic device. The microfluidic device contains a microchannel decorated with a periodical array of diagonal ridges. The ridges compress flowing cells that results in complex cell trajectory and induces cell cross-channel drift, both depend on the cell intrinsic mechanical properties that can be used to characterize specific cell lines. Thus, the cell trajectory analysis can yield a parameter set that can serve as a unique identifier of a cell's membership to a specific cell population. By using the correlations between the cell populations and measured cell trajectories in the ridged microchannel, mechanical properties of individual cells and their specific populations can be identified via only information captured using video analysis. Financial support provided by National Science Foundation (NSF) Grant No. CMMI 1538161.

  20. Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci

    OpenAIRE

    Stahl, Eli A; Raychaudhuri, Soumya; Remmers, Elaine F.; Xie, Gang; Eyre, Stephen; Thomson, Brian P.; Li, Yonghong; Kurreeman, Fina A. S.; Zhernakova, Alexandra; Hinks, Anne; Guiducci, Candace; Chen, Robert; Alfredsson, Lars; Amos, Christopher I.; Ardlie, Kristin G.

    2010-01-01

    To identify novel genetic risk factors for rheumatoid arthritis (RA), we conducted a genome-wide association study (GWAS) meta-analysis of 5,539 autoantibody positive RA cases and 20,169 controls of European descent, followed by replication in an independent set of 6,768 RA cases and 8,806 controls. Of 34 SNPs selected for replication, 7 novel RA risk alleles were identified at genome-wide significance (P

  1. Cluster analysis application identifies muscle characteristics of importance for beef tenderness

    Directory of Open Access Journals (Sweden)

    Chriki Sghaier

    2012-12-01

    Full Text Available Abstract Background An important controversy in the relationship between beef tenderness and muscle characteristics including biochemical traits exists among meat researchers. The aim of this study is to explain variability in meat tenderness using muscle characteristics and biochemical traits available in the Integrated and Functional Biology of Beef (BIF-Beef database. The BIF-Beef data warehouse contains characteristic measurements from animal, muscle, carcass, and meat quality derived from numerous experiments. We created three classes for tenderness (high, medium, and low based on trained taste panel tenderness scores of all meat samples consumed (4,366 observations from 40 different experiments. For each tenderness class, the corresponding means for the mechanical characteristics, muscle fibre type, collagen content, and biochemical traits which may influence tenderness of the muscles were calculated. Results Our results indicated that lower shear force values were associated with more tender meat. In addition, muscles in the highest tenderness cluster had the lowest total and insoluble collagen contents, the highest mitochondrial enzyme activity (isocitrate dehydrogenase, the highest proportion of slow oxidative muscle fibres, the lowest proportion of fast-glycolytic muscle fibres, and the lowest average muscle fibre cross-sectional area. Results were confirmed by correlation analyses, and differences between muscle types in terms of biochemical characteristics and tenderness score were evidenced by Principal Component Analysis (PCA. When the cluster analysis was repeated using only muscle samples from m. Longissimus thoracis (LT, the results were similar; only contrasting previous results by maintaining a relatively constant fibre-type composition between all three tenderness classes. Conclusion Our results show that increased meat tenderness is related to lower shear forces, lower insoluble collagen and total collagen content, lower

  2. Melatonin mitigates mitochondrial malfunction.

    Science.gov (United States)

    León, Josefa; Acuña-Castroviejo, Darío; Escames, Germane; Tan, Dun-Xian; Reiter, Russel J

    2005-01-01

    Melatonin, or N-acetyl-5-methoxytryptamine, is a compound derived from tryptophan that is found in all organisms from unicells to vertebrates. This indoleamine may act as a protective agent in disease conditions such as Parkinson's, Alzheimer's, aging, sepsis and other disorders including ischemia/reperfusion. In addition, melatonin has been proposed as a drug for the treatment of cancer. These disorders have in common a dysfunction of the apoptotic program. Thus, while defects which reduce apoptotic processes can exaggerate cancer, neurodegenerative disorders and ischemic conditions are made worse by enhanced apoptosis. The mechanism by which melatonin controls cell death is not entirely known. Recently, mitochondria, which are implicated in the intrinsic pathway of apoptosis, have been identified as a target for melatonin actions. It is known that melatonin scavenges oxygen and nitrogen-based reactants generated in mitochondria. This limits the loss of the intramitochondrial glutathione and lowers mitochondrial protein damage, improving electron transport chain (ETC) activity and reducing mtDNA damage. Melatonin also increases the activity of the complex I and complex IV of the ETC, thereby improving mitochondrial respiration and increasing ATP synthesis under normal and stressful conditions. These effects reflect the ability of melatonin to reduce the harmful reduction in the mitochondrial membrane potential that may trigger mitochondrial transition pore (MTP) opening and the apoptotic cascade. In addition, a reported direct action of melatonin in the control of currents through the MTP opens a new perspective in the understanding of the regulation of apoptotic cell death by the indoleamine.

  3. Comparative analysis of Salmonella genomes identifies a metabolic network for escalating growth in the inflamed gut.

    Science.gov (United States)

    Nuccio, Sean-Paul; Bäumler, Andreas J

    2014-03-18

    The Salmonella genus comprises a group of pathogens associated with illnesses ranging from gastroenteritis to typhoid fever. We performed an in silico analysis of comparatively reannotated Salmonella genomes to identify genomic signatures indicative of disease potential. By removing numerous annotation inconsistencies and inaccuracies, the process of reannotation identified a network of 469 genes involved in central anaerobic metabolism, which was intact in genomes of gastrointestinal pathogens but degrading in genomes of extraintestinal pathogens. This large network contained pathways that enable gastrointestinal pathogens to utilize inflammation-derived nutrients as well as many of the biochemical reactions used for the enrichment and biochemical discrimination of Salmonella serovars. Thus, comparative genome analysis identifies a metabolic network that provides clues about the strategies for nutrient acquisition and utilization that are characteristic of gastrointestinal pathogens. IMPORTANCE While some Salmonella serovars cause infections that remain localized to the gut, others disseminate throughout the body. Here, we compared Salmonella genomes to identify characteristics that distinguish gastrointestinal from extraintestinal pathogens. We identified a large metabolic network that is functional in gastrointestinal pathogens but decaying in extraintestinal pathogens. While taxonomists have used traits from this network empirically for many decades for the enrichment and biochemical discrimination of Salmonella serovars, our findings suggest that it is part of a "business plan" for growth in the inflamed gastrointestinal tract. By identifying a large metabolic network characteristic of Salmonella serovars associated with gastroenteritis, our in silico analysis provides a blueprint for potential strategies to utilize inflammation-derived nutrients and edge out competing gut microbes.

  4. Toward a DNA taxonomy of Alpine Rhithrogena (Ephemeroptera: Heptageniidae) using a mixed Yule-coalescent analysis of mitochondrial and nuclear DNA.

    Science.gov (United States)

    Vuataz, Laurent; Sartori, Michel; Wagner, André; Monaghan, Michael T

    2011-01-01

    Aquatic larvae of many Rhithrogena mayflies (Ephemeroptera) inhabit sensitive Alpine environments. A number of species are on the IUCN Red List and many recognized species have restricted distributions and are of conservation interest. Despite their ecological and conservation importance, ambiguous morphological differences among closely related species suggest that the current taxonomy may not accurately reflect the evolutionary diversity of the group. Here we examined the species status of nearly 50% of European Rhithrogena diversity using a widespread sampling scheme of Alpine species that included 22 type localities, general mixed Yule-coalescent (GMYC) model analysis of one standard mtDNA marker and one newly developed nDNA marker, and morphological identification where possible. Using sequences from 533 individuals from 144 sampling localities, we observed significant clustering of the mitochondrial (cox1) marker into 31 GMYC species. Twenty-one of these could be identified based on the presence of topotypes (expertly identified specimens from the species' type locality) or unambiguous morphology. These results strongly suggest the presence of both cryptic diversity and taxonomic oversplitting in Rhithrogena. Significant clustering was not detected with protein-coding nuclear PEPCK, although nine GMYC species were congruent with well supported terminal clusters of nDNA. Lack of greater congruence in the two data sets may be the result of incomplete sorting of ancestral polymorphism. Bayesian phylogenetic analyses of both gene regions recovered four of the six recognized Rhithrogena species groups in our samples as monophyletic. Future development of more nuclear markers would facilitate multi-locus analysis of unresolved, closely related species pairs. The DNA taxonomy developed here lays the groundwork for a future revision of the important but cryptic Rhithrogena genus in Europe.

  5. Toward a DNA taxonomy of Alpine Rhithrogena (Ephemeroptera: Heptageniidae using a mixed Yule-coalescent analysis of mitochondrial and nuclear DNA.

    Directory of Open Access Journals (Sweden)

    Laurent Vuataz

    Full Text Available Aquatic larvae of many Rhithrogena mayflies (Ephemeroptera inhabit sensitive Alpine environments. A number of species are on the IUCN Red List and many recognized species have restricted distributions and are of conservation interest. Despite their ecological and conservation importance, ambiguous morphological differences among closely related species suggest that the current taxonomy may not accurately reflect the evolutionary diversity of the group. Here we examined the species status of nearly 50% of European Rhithrogena diversity using a widespread sampling scheme of Alpine species that included 22 type localities, general mixed Yule-coalescent (GMYC model analysis of one standard mtDNA marker and one newly developed nDNA marker, and morphological identification where possible. Using sequences from 533 individuals from 144 sampling localities, we observed significant clustering of the mitochondrial (cox1 marker into 31 GMYC species. Twenty-one of these could be identified based on the presence of topotypes (expertly identified specimens from the species' type locality or unambiguous morphology. These results strongly suggest the presence of both cryptic diversity and taxonomic oversplitting in Rhithrogena. Significant clustering was not detected with protein-coding nuclear PEPCK, although nine GMYC species were congruent with well supported terminal clusters of nDNA. Lack of greater congruence in the two data sets may be the result of incomplete sorting of ancestral polymorphism. Bayesian phylogenetic analyses of both gene regions recovered four of the six recognized Rhithrogena species groups in our samples as monophyletic. Future development of more nuclear markers would facilitate multi-locus analysis of unresolved, closely related species pairs. The DNA taxonomy developed here lays the groundwork for a future revision of the important but cryptic Rhithrogena genus in Europe.

  6. Genetic status of the wood stork (Mycteria americana) from the southeastern United States and the Brazilian Pantanal as revealed by mitochondrial DNA analysis.

    Science.gov (United States)

    Lopes, I F; Tomasulo-Seccomandi, A M; Bryan, A L; Brisbin, I L; Glenn, T C; Del Lama, S N

    2011-08-30

    The wood stork (Mycteria americana) is a colonial wading bird that inhabits the Neotropical region from the southeastern United States (US) to northern Argentina. The species is considered to be endangered in the US due to degradation of its foraging and breeding habitat. In other parts of its range, such as in the Brazilian Pantanal region, breeding populations of this species appear to be stable. We compared the levels of genetic variability and population structuring of the US and the Pantanal breeding populations using mitochondrial DNA (mtDNA) control region sequences. Twenty-seven haplotypes were identified among 88 wood stork samples collected from eight breeding colonies in the US and eight in the Pantanal. Patterns indicative of heteroplasmy were observed in 35.3% of the mtDNA sequences that were examined. Significantly higher levels of haplotype diversity were observed in the Pantanal samples compared to those from the US, suggesting that during the last century, demographic declines or a recent evolutionary bottleneck reduced the levels of mtDNA variability of the US population. Analyses of genetic structuring revealed non-significant genetic differentiation between these regions, indicating that either the populations were only recently separated or that gene flow continues to occur at low levels. Haplotype network analysis indicated low current levels of gene flow between populations that were closely related in the past.

  7. An operational modal analysis approach based on parametrically identified multivariable transmissibilities

    Science.gov (United States)

    Devriendt, Christof; De Sitter, Gert; Guillaume, Patrick

    2010-07-01

    In this contribution the approach to identify modal parameters from output-only (scalar) transmissibility measurements [C. Devriendt, P. Guillaume, The use of transmissibility measurements in output-only modal analysis, Mechanical Systems and Signal Processing 21 (7) (2007) 2689-2696] is generalized to multivariable transmissibilities. In general, the poles that are identified from (scalar as well as multivariable) transmissibility measurements do not correspond with the system's poles. However, by combining transmissibility measurements under different loading conditions, it is shown in this paper how model parameters can be identified from multivariable transmissibility measurements.

  8. Mitochondrial DNA plasticity is an essential inducer of tumorigenesis.

    Science.gov (United States)

    Lee, W T Y; Cain, J E; Cuddihy, A; Johnson, J; Dickinson, A; Yeung, K-Y; Kumar, B; Johns, T G; Watkins, D N; Spencer, A; St John, J C

    2016-01-01

    Although mitochondrial DNA has been implicated in diseases such as cancer, its role remains to be defined. Using three models of tumorigenesis, namely glioblastoma multiforme, multiple myeloma and osteosarcoma, we show that mitochondrial DNA plays defining roles at early and late tumour progression. Specifically, tumour cells partially or completely depleted of mitochondrial DNA either restored their mitochondrial DNA content or actively recruited mitochondrial DNA, which affected the rate of tumorigenesis. Nevertheless, non-depleted tumour cells modulated mitochondrial DNA copy number at early and late progression in a mitochondrial DNA genotype-specific manner. In glioblastoma multiforme and osteosarcoma, this was coupled with loss and gain of mitochondrial DNA variants. Changes in mitochondrial DNA genotype affected tumour morphology and gene expression patterns at early and late progression. Importantly, this identified a subset of genes that are essential to early progression. Consequently, mitochondrial DNA and commonly expressed early tumour-specific genes provide novel targets against tumorigenesis.

  9. Cryptic intercontinental colonization in water fleas Daphnia pulicaria inferred from phylogenetic analysis of mitochondrial DNA variation.

    Science.gov (United States)

    Marková, Silvia; Dufresne, France; Rees, David J; Cerný, Martin; Kotlík, Petr

    2007-07-01

    The water fleas of the Daphnia pulex complex play a key role in freshwater ecosystems throughout the northern hemisphere. Despite the fact that they have been the subject of study for numerous biological disciplines, their phylogeny and species delimitation remain controversial. We used DNA sequence variation of the mitochondrial ND5 gene to reconstruct the phylogenetic relationships of D. pulicaria Forbes, a widespread member of this complex from North America and Europe. Populations from the two continents respectively split into two evolutionary lineages, Eastern Nearctic and European, which each belong to another main clade within the D. pulex complex (the pulicaria and tenebrosa groups, respectively). Unexpectedly, melanin and carotenoid pigmented D. pulicaria populations from European high-mountain lakes were not allied with the transparent populations inhabiting the same lakes and the lowland ponds and reservoirs throughout Europe, but were included with the samples from Canada and Greenland in the Eastern Nearctic lineage. Until now populations belonging to this lineage were known only from Canada and North Atlantic islands, but not from mainland Europe. Independent data from microsatellite markers supported the genetic distinctiveness of the sympatric carotenoid pigmented and transparent populations and suggested that they may have undergone transition to obligate parthenogenesis, possibly as a consequence of past introgressive hybridization. Two different taxa are therefore confused under the name D. pulicaria in Europe. The close phylogenetic relationships of European populations with those from Canada and Greenland suggest that the Nearctic lineage is of recent origin in Europe via intercontinental dispersal from the North America. It has evolved melanin and carotenoid pigmentation as adaptations against the UV light stress, which enable it to share habitat occupied by the transparent European species. The Nearctic D. pulicaria thus provides a new model

  10. Different Evolutionary History for Basque Diaspora Populations in USA and Argentina Unveiled by Mitochondrial DNA Analysis.

    Science.gov (United States)

    Baeta, Miriam; Núñez, Carolina; Cardoso, Sergio; Palencia-Madrid, Leire; Piñeiro-Hermida, Sergio; Arriba-Barredo, Miren; Villanueva-Millán, María Jesús; M de Pancorbo, Marian

    2015-01-01

    The Basque Diaspora in Western USA and Argentina represents two populations which have maintained strong Basque cultural and social roots in a completely different geographic context. Hence, they provide an exceptional opportunity to study the maternal genetic legacy from the ancestral Basque population and assess the degree of genetic introgression from the host populations in two of the largest Basque communities outside the Basque Country. For this purpose, we analyzed the complete mitochondrial DNA control region of Basque descendants living in Western USA (n = 175) and in Argentina (n = 194). The Diaspora populations studied here displayed a genetic diversity in their European maternal input which was similar to that of the Basque source populations, indicating that not important founder effects would have occurred. Actually, the genetic legacy of the Basque population still prevailed in their present-day maternal pools, by means of a haplogroup distribution similar to the source population characterized by the presence of autochthonous Basque lineages, such as U5b1f1a and J1c5c1. However, introgression of non-Basque lineages, mostly Native American, has been observed in the Diaspora populations, particularly in Argentina, where the quick assimilation of the newcomers would have favored a wider admixture with host populations. In contrast, a longer isolation of the Diaspora groups in USA, because of language and cultural differences, would have limited the introgression of local lineages. This study reveals important differences in the maternal evolutionary histories of these Basque Diaspora populations, which have to be taken into consideration in forensic and medical genetic studies.

  11. Identification of novel mutations in five patients with mitochondrial encephalomyopathy.

    Science.gov (United States)

    Valente, Lucia; Piga, Daniela; Lamantea, Eleonora; Carrara, Franco; Uziel, Graziella; Cudia, Paola; Zani, Anna; Farina, Laura; Morandi, Lucia; Mora, Marina; Spinazzola, Antonella; Zeviani, Massimo; Tiranti, Valeria

    2009-05-01

    MELAS, MERRF, LHON and NARP, are well-established mitochondrial syndromes associated with specific point mutations of mitochondrial DNA (mtDNA). However, these recurrent mtDNA mutations account for only a minority of mitochondrial disease cases. To evaluate the impact of novel mtDNA mutations, we performed mtDNA sequence analysis in muscle and other tissues of 240 patients with different mitochondrial neuromuscular syndromes. We identified a total of 33 subjects with novel, private or uncommon mutations. Among these, five novel mutations were found in both paediatric and adult cases. We here report on the clinical description of these patients, as well as the biochemical and molecular genetic characterization of the corresponding mutations. Patients 1 and 2 showed changes in ND genes, patient 3 carried a heteroplasmic deletion in the COI gene, patients 4 and 5 carried heteroplasmic mutations in tRNA(Trp) and tRNA(Phe), respectively. Altogether, these data indicate that mtDNA analysis must become part of the routine screening for mitochondrial disorders.

  12. Sparse canonical correlation analysis for identifying, connecting and completing gene-expression networks

    Directory of Open Access Journals (Sweden)

    Zwinderman Aeilko H

    2009-09-01

    Full Text Available Abstract Background We generalized penalized canonical correlation analysis for analyzing microarray gene-expression measurements for checking completeness of known metabolic pathways and identifying candidate genes for incorporation in the pathway. We used Wold's method for calculation of the canonical variates, and we applied ridge penalization to the regression of pathway genes on canonical variates of the non-pathway genes, and the elastic net to the regression of non-pathway genes on the canonical variates of the pathway genes. Results We performed a small simulation to illustrate the model's capability to identify new candidate genes to incorporate in the pathway: in our simulations it appeared that a gene was correctly identified if the correlation with the pathway genes was 0.3 or more. We applied the methods to a gene-expression microarray data set of 12, 209 genes measured in 45 patients with glioblastoma, and we considered genes to incorporate in the glioma-pathway: we identified more than 25 genes that correlated > 0.9 with canonical variates of the pathway genes. Conclusion We concluded that penalized canonical correlation analysis is a powerful tool to identify candidate genes in pathway analysis.

  13. Identifying Effective Spelling Interventions Using a Brief Experimental Analysis and Extended Analysis

    Science.gov (United States)

    McCurdy, Merilee; Clure, Lynne F.; Bleck, Amanda A.; Schmitz, Stephanie L.

    2016-01-01

    Spelling is an important skill that is crucial to effective written communication. In this study, brief experimental analysis procedures were used to examine spelling instruction strategies (e.g., whole word correction; word study strategy; positive practice; and cover, copy, and compare) for four students. In addition, an extended analysis was…

  14. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis.

    Science.gov (United States)

    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha

    2015-10-01

    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples.

  15. Evolutionary history of continental southeast Asians: "early train" hypothesis based on genetic analysis of mitochondrial and autosomal DNA data.

    Science.gov (United States)

    Jinam, Timothy A; Hong, Lih-Chun; Phipps, Maude E; Stoneking, Mark; Ameen, Mahmood; Edo, Juli; Saitou, Naruya

    2012-11-01

    The population history of the indigenous populations in island Southeast Asia is generally accepted to have been shaped by two major migrations: the ancient "Out of Africa" migration ∼50,000 years before present (YBP) and the relatively recent "Out of Taiwan" expansion of Austronesian agriculturalists approximately 5,000 YBP. The Negritos are believed to have originated from the ancient migration, whereas the majority of island Southeast Asians are associated with the Austronesian expansion. We determined 86 mitochondrial DNA (mtDNA) complete genome sequences in four indigenous Malaysian populations, together with a reanalysis of published autosomal single-nucleotide polymorphism (SNP) data of Southeast Asians to test the plausibility and impact of those migration models. The three Austronesian groups (Bidayuh, Selatar, and Temuan) showed high frequencies of mtDNA haplogroups, which originated from the Asian mainland ∼30,000-10,000 YBP, but low frequencies of "Out of Taiwan" markers. Principal component analysis and phylogenetic analysis using autosomal SNP data indicate a dichotomy between continental and island Austronesian groups. We argue that both the mtDNA and autosomal data suggest an "Early Train" migration originating from Indochina or South China around the late-Pleistocene to early-Holocene period, which predates, but may not necessarily exclude, the Austronesian expansion.

  16. Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis

    NARCIS (Netherlands)

    B.F. Voight (Benjamin); L.J. Scott (Laura); V. Steinthorsdottir (Valgerdur); A.D. Morris (Andrew); C. Dina (Christian); R.P. Welch (Ryan); E. Zeggini (Eleftheria); C. Huth (Cornelia); Y.S. Aulchenko (Yurii); G. Thorleifsson (Gudmar); L.J. McCulloch (Laura); T. Ferreira (Teresa); H. Grallert (Harald); N. Amin (Najaf); G. Wu (Guanming); C.J. Willer (Cristen); S. Raychaudhuri (Soumya); S.A. McCarroll (Steven); C. Langenberg (Claudia); O.M. Hofmann (Oliver); J. Dupuis (Josée); L. Qi (Lu); A.V. Segrè (Ayellet); M. van Hoek (Mandy); P. Navarro (Pau); K.G. Ardlie (Kristin); B. Balkau (Beverley); R. Benediktsson (Rafn); A.J. Bennett (Amanda); R. Blagieva (Roza); E.A. Boerwinkle (Eric); L.L. Bonnycastle (Lori); K.B. Boström (Kristina Bengtsson); B. Bravenboer (Bert); S. Bumpstead (Suzannah); N.P. Burtt (Noël); G. Charpentier (Guillaume); P.S. Chines (Peter); M. Cornelis (Marilyn); D.J. Couper (David); G. Crawford (Gabe); A.S.F. Doney (Alex); K.S. Elliott (Katherine); M.R. Erdos (Michael); C.S. Fox (Caroline); C.S. Franklin (Christopher); M. Ganser (Martha); C. Gieger (Christian); N. Grarup (Niels); T. Green (Todd); S. Griffin (Simon); C.J. Groves (Christopher); C. Guiducci (Candace); S. Hadjadj (Samy); N. Hassanali (Neelam); C. Herder (Christian); B. Isomaa (Bo); A.U. Jackson (Anne); P.R.V. Johnson (Paul); T. Jørgensen (Torben); W.H.L. Kao (Wen); N. Klopp (Norman); A. Kong (Augustine); P. Kraft (Peter); J. Kuusisto (Johanna); T. Lauritzen (Torsten); M. Li (Man); A. Lieverse (Aloysius); C.M. Lindgren (Cecilia); V. Lyssenko (Valeriya); M. Marre (Michel); T. Meitinger (Thomas); K. Midthjell (Kristian); M.A. Morken (Mario); N. Narisu (Narisu); P. Nilsson (Peter); K.R. Owen (Katharine); F. Payne (Felicity); J.R.B. Perry (John); A.K. Petersen; C. Platou (Carl); C. Proença (Christine); I. Prokopenko (Inga); W. Rathmann (Wolfgang); N.W. Rayner (Nigel William); N.R. Robertson (Neil); G. Rocheleau (Ghislain); M. Roden (Michael); M.J. Sampson (Michael); R. Saxena (Richa); B.M. Shields (Beverley); P. Shrader (Peter); G. Sigurdsson (Gunnar); T. Sparsø (Thomas); K. Strassburger (Klaus); H.M. Stringham (Heather); Q. Sun (Qi); A.J. Swift (Amy); B. Thorand (Barbara); J. Tichet (Jean); T. Tuomi (Tiinamaija); R.M. van Dam (Rob); T.W. van Haeften (Timon); T.W. van Herpt (Thijs); J.V. van Vliet-Ostaptchouk (Jana); G.B. Walters (Bragi); M.N. Weedon (Michael); C. Wijmenga (Cisca); J.C.M. Witteman (Jacqueline); R.N. Bergman (Richard); S. Cauchi (Stephane); F.S. Collins (Francis); A.L. Gloyn (Anna); U. Gyllensten (Ulf); T. Hansen (Torben); W.A. Hide (Winston); G.A. Hitman (Graham); A. Hofman (Albert); D. Hunter (David); K. Hveem (Kristian); M. Laakso (Markku); K.L. Mohlke (Karen); C.N.A. Palmer (Colin); P.P. Pramstaller (Peter Paul); I. Rudan (Igor); E.J.G. Sijbrands (Eric); L.D. Stein (Lincoln); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); M. Walker (Mark); N.J. Wareham (Nick); G.R. Abecasis (Gonçalo); B.O. Boehm (Bernhard); H. Campbell (Harry); M.J. Daly (Mark); A.T. Hattersley (Andrew); F.B. Hu (Frank); J.B. Meigs (James); J.S. Pankow (James); O. Pedersen (Oluf); H.E. Wichmann (Erich); I. Barroso (Inês); J.C. Florez (Jose); T.M. Frayling (Timothy); L. Groop (Leif); R. Sladek (Rob); U. Thorsteinsdottir (Unnur); J.F. Wilson (James); T. Illig (Thomas); P. Froguel (Philippe); P. Tikka-Kleemola (Päivi); J-A. Zwart (John-Anker); D. Altshuler (David); M. Boehnke (Michael); M.I. McCarthy (Mark); R.M. Watanabe (Richard)

    2010-01-01

    textabstractBy combining genome-wide association data from 8,130 individuals with type 2 diabetes (T2D) and 38,987 controls of European descent and following up previously unidentified meta-analysis signals in a further 34,412 cases and 59,925 controls, we identified 12 new T2D association signals w

  17. Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis

    NARCIS (Netherlands)

    Voight, Benjamin F.; Scott, Laura J.; Steinthorsdottir, Valgerdur; Morris, Andrew P.; Dina, Christian; Welch, Ryan P.; Zeggini, Eleftheria; Huth, Cornelia; Aulchenko, Yurii S.; Thorleifsson, Gudmar; McCulloch, Laura J.; Ferreira, Teresa; Grallert, Harald; Amin, Najaf; Wu, Guanming; Willer, Cristen J.; Raychaudhuri, Soumya; McCarroll, Steve A.; Langenberg, Claudia; Hofmann, Oliver M.; Dupuis, Josee; Qi, Lu; Segre, Ayellet V.; van Hoek, Mandy; Navarro, Pau; Ardlie, Kristin; Balkau, Beverley; Benediktsson, Rafn; Bennett, Amanda J.; Blagieva, Roza; Boerwinkle, Eric; Bonnycastle, Lori L.; Bostrom, Kristina Bengtsson; Bravenboer, Bert; Bumpstead, Suzannah; Burtt, Noisel P.; Charpentier, Guillaume; Chines, Peter S.; Cornelis, Marilyn; Couper, David J.; Crawford, Gabe; Doney, Alex S. F.; Elliott, Katherine S.; Elliott, Amanda L.; Erdos, Michael R.; Fox, Caroline S.; Franklin, Christopher S.; Ganser, Martha; Gieger, Christian; Grarup, Niels; Green, Todd; Griffin, Simon; Groves, Christopher J.; Guiducci, Candace; Hadjadj, Samy; Hassanali, Neelam; Herder, Christian; Isomaa, Bo; Jackson, Anne U.; Johnson, Paul R. V.; Jorgensen, Torben; Kao, Wen H. L.; Klopp, Norman; Kong, Augustine; Kraft, Peter; Kuusisto, Johanna; Lauritzen, Torsten; Li, Man; Lieverse, Aloysius; Lindgren, Cecilia M.; Lyssenko, Valeriya; Marre, Michel; Meitinger, Thomas; Midthjell, Kristian; Morken, Mario A.; Narisu, Narisu; Nilsson, Peter; Owen, Katharine R.; Payne, Felicity; Perry, John R. B.; Petersen, Ann-Kristin; Platou, Carl; Proenca, Christine; Prokopenko, Inga; Rathmann, Wolfgang; Rayner, N. William; Robertson, Neil R.; Rocheleau, Ghislain; Roden, Michael; Sampson, Michael J.; Saxena, Richa; Shields, Beverley M.; Shrader, Peter; Sigurdsson, Gunnar; Sparso, Thomas; Strassburger, Klaus; Stringham, Heather M.; Sun, Qi; Swift, Amy J.; Thorand, Barbara; Tichet, Jean; Tuomi, Tiinamaija; van Dam, Rob M.; van Haeften, Timon W.; van Herpt, Thijs; van Vliet-Ostaptchouk, Jana V.; Walters, G. Bragi; Weedon, Michael N.; Wijmenga, Cisca; Witteman, Jacqueline; Bergman, Richard N.; Cauchi, Stephane; Collins, Francis S.; Gloyn, Anna L.; Gyllensten, Ulf; Hansen, Torben; Hide, Winston A.; Hitman, Graham A.; Hofman, Albert; Hunter, David J.; Hveem, Kristian; Laakso, Markku; Mohlke, Karen L.; Morris, Andrew D.; Palmer, Colin N. A.; Pramstaller, Peter P.; Rudan, Igor; Sijbrands, Eric; Stein, Lincoln D.; Tuomilehto, Jaakko; Uitterlinden, Andre; Walker, Mark; Wareham, Nicholas J.; Watanabe, Richard M.; Abecasis, Goncalo R.; Boehm, Bernhard O.; Campbell, Harry; Daly, Mark J.; Hattersley, Andrew T.; Hu, Frank B.; Meigs, James B.; Pankow, James S.; Pedersen, Oluf; Wichmann, H-Erich; Barroso, Ines; Florez, Jose C.; Frayling, Timothy M.; Groop, Leif; Sladek, Rob; Thorsteinsdottir, Unnur; Wilson, James F.; Illig, Thomas; Froguel, Philippe; van Duijn, Cornelia M.; Stefansson, Kari; Altshuler, David; Boehnke, Michael; McCarthy, Mark I.

    2010-01-01

    By combining genome-wide association data from 8,130 individuals with type 2 diabetes (T2D) and 38,987 controls of European descent and following up previously unidentified meta-analysis signals in a further 34,412 cases and 59,925 controls, we identified 12 new T2D association signals with combined

  18. Using Work Action Analysis to Identify Web-Portal Requirements for a Professional Development Program

    Science.gov (United States)

    Nickles, George

    2007-01-01

    This article describes using Work Action Analysis (WAA) as a method for identifying requirements for a web-based portal that supports a professional development program. WAA is a cognitive systems engineering method for modeling multi-agent systems to support design and evaluation. A WAA model of the professional development program of the…

  19. Genome-wide association scan meta-analysis identifies three loci influencing adiposity and fat distribution

    NARCIS (Netherlands)

    C.M. Lindgren (Cecilia); I.M. Heid (Iris); J.C. Randall (Joshua); C. Lamina (Claudia); V. Steinthorsdottir (Valgerdur); L. Qi (Lu); E.K. Speliotes (Elizabeth); G. Thorleifsson (Gudmar); C.J. Willer (Cristen); B.M. Herrera (Blanca); A.U. Jackson (Anne); N. Lim (Noha); P. Scheet (Paul); N. Soranzo (Nicole); N. Amin (Najaf); Y.S. Aulchenko (Yurii); J.C. Chambers (John); A. Drong (Alexander); J. Luan; H.N. Lyon (Helen); F. Rivadeneira Ramirez (Fernando); S. Sanna (Serena); N. Timpson (Nicholas); M.C. Zillikens (Carola); H.Z. Jing; P. Almgren (Peter); S. Bandinelli (Stefania); A.J. Bennett (Amanda); R.N. Bergman (Richard); L.L. Bonnycastle (Lori); S. Bumpstead (Suzannah); S.J. Chanock (Stephen); L. Cherkas (Lynn); P.S. Chines (Peter); L. Coin (Lachlan); C. Cooper (Charles); G. Crawford (Gabe); A. Doering (Angela); A. Dominiczak (Anna); A.S.F. Doney (Alex); S. Ebrahim (Shanil); P. Elliott (Paul); M.R. Erdos (Michael); K. Estrada Gil (Karol); L. Ferrucci (Luigi); G. Fischer (Guido); N.G. Forouhi (Nita); C. Gieger (Christian); H. Grallert (Harald); C.J. Groves (Christopher); S.M. Grundy (Scott); C. Guiducci (Candace); D. Hadley (David); A. Hamsten (Anders); A.S. Havulinna (Aki); A. Hofman (Albert); R. Holle (Rolf); J.W. Holloway (John); T. Illig (Thomas); B. Isomaa (Bo); L.C. Jacobs (Leonie); K. Jameson (Karen); P. Jousilahti (Pekka); F. Karpe (Fredrik); J. Kuusisto (Johanna); J. Laitinen (Jaana); G.M. Lathrop (Mark); D.A. Lawlor (Debbie); M. Mangino (Massimo); W.L. McArdle (Wendy); T. Meitinger (Thomas); M.A. Morken (Mario); A.P. Morris (Andrew); P. Munroe (Patricia); N. Narisu (Narisu); A. Nordström (Anna); B.A. Oostra (Ben); C.N.A. Palmer (Colin); F. Payne (Felicity); J. Peden (John); I. Prokopenko (Inga); F. Renström (Frida); A. Ruokonen (Aimo); V. Salomaa (Veikko); M.S. Sandhu (Manjinder); L.J. Scott (Laura); A. Scuteri (Angelo); K. Silander (Kaisa); K. Song (Kijoung); X. Yuan (Xin); H.M. Stringham (Heather); A.J. Swift (Amy); T. Tuomi (Tiinamaija); M. Uda (Manuela); P. Vollenweider (Peter); G. Waeber (Gérard); C. Wallace (Chris); G.B. Walters (Bragi); M.N. Weedon (Michael); J.C.M. Witteman (Jacqueline); C. Zhang (Cuilin); M. Caulfield (Mark); F.S. Collins (Francis); G.D. Smith; I.N.M. Day (Ian); P.W. Franks (Paul); A.T. Hattersley (Andrew); F.B. Hu (Frank); M.-R. Jarvelin (Marjo-Riitta); A. Kong (Augustine); J.S. Kooner (Jaspal); M. Laakso (Markku); E. Lakatta (Edward); V. Mooser (Vincent); L. Peltonen (Leena Johanna); N.J. Samani (Nilesh); T.D. Spector (Timothy); D.P. Strachan (David); T. Tanaka (Toshiko); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); P. Tikka-Kleemola (Päivi); N.J. Wareham (Nick); H. Watkins (Hugh); D. Waterworth (Dawn); M. Boehnke (Michael); P. Deloukas (Panagiotis); L. Groop (Leif); D.J. Hunter (David); U. Thorsteinsdottir (Unnur); D. Schlessinger (David); H.E. Wichmann (Erich); T.M. Frayling (Timothy); G.R. Abecasis (Gonçalo); J.N. Hirschhorn (Joel); R.J.F. Loos (Ruth); J-A. Zwart (John-Anker); K.L. Mohlke (Karen); I. Barroso (Inês); M.I. McCarthy (Mark)

    2009-01-01

    textabstractTo identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580) informative for adult waist circumference (WC) and waist-hip ratio (WHR). We selected 26 SNPs for follow-up, for which the evid

  20. Examination of a One-Trial Brief Experimental Analysis to Identify Reading Fluency Interventions

    Science.gov (United States)

    Andersen, Melissa N.; Daly, Edward J., III; Young, Nicholas D.

    2013-01-01

    This study sought to evaluate whether a one-trial brief experimental analysis (OTBEA) would reliably and validly identify effective treatments to improve oral reading fluency for 6 elementary school students referred for reading problems. An OTBEA was conducted with each participant to assess the effects of skill- and performance-based treatment…

  1. Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis

    DEFF Research Database (Denmark)

    Voight, Benjamin F; Scott, Laura J; Steinthorsdottir, Valgerdur;

    2010-01-01

    By combining genome-wide association data from 8,130 individuals with type 2 diabetes (T2D) and 38,987 controls of European descent and following up previously unidentified meta-analysis signals in a further 34,412 cases and 59,925 controls, we identified 12 new T2D association signals...

  2. Identifying Barriers in Implementing Outcomes-Based Assessment Program Review: A Grounded Theory Analysis

    Science.gov (United States)

    Bresciani, Marilee J.

    2011-01-01

    The purpose of this grounded theory study was to identify the typical barriers encountered by faculty and administrators when implementing outcomes-based assessment program review. An analysis of interviews with faculty and administrators at nine institutions revealed a theory that faculty and administrators' promotion, tenure (if applicable),…

  3. Bioinformatics analysis identifies several intrinsically disordered human E3 ubiquitin-protein ligases

    DEFF Research Database (Denmark)

    Boomsma, Wouter Krogh; Nielsen, Sofie Vincents; Lindorff-Larsen, Kresten;

    2016-01-01

    conduct a bioinformatics analysis to examine >600 human and S. cerevisiae E3 ligases to identify enzymes that are similar to San1 in terms of function and/or mechanism of substrate recognition. An initial sequence-based database search was found to detect candidates primarily based on the homology...

  4. Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci

    NARCIS (Netherlands)

    Stahl, Eli A.; Raychaudhuri, Soumya; Remmers, Elaine F.; Xie, Gang; Eyre, Stephen; Thomson, Brian P.; Li, Yonghong; Kurreeman, Fina A. S.; Zhernakova, Alexandra; Hinks, Anne; Guiducci, Candace; Chen, Robert; Alfredsson, Lars; Amos, Christopher I.; Ardlie, Kristin G.; Barton, Anne; Bowes, John; Brouwer, Elisabeth; Burtt, Noel P.; Catanese, Joseph J.; Coblyn, Jonathan; Coenen, Marieke J. H.; Costenbader, Karen H.; Criswell, Lindsey A.; Crusius, J. Bart A.; Cui, Jing; de Bakker, Paul I. W.; De Jager, Philip L.; Ding, Bo; Emery, Paul; Flynn, Edward; Harrison, Pille; Hocking, Lynne J.; Huizinga, Tom W. J.; Kastner, Daniel L.; Ke, Xiayi; Lee, Annette T.; Liu, Xiangdong; Martin, Paul; Morgan, Ann W.; Padyukov, Leonid; Posthumus, Marcel D.; Radstake, Timothy R. D. J.; Reid, David M.; Seielstad, Mark; Seldin, Michael F.; Shadick, Nancy A.; Steer, Sophia; Tak, Paul P.; Thomson, Wendy; van der Helm-van Mil, Annette H. M.; van der Horst-Bruinsma, Irene E.; van der Schoot, C. Ellen; van Riel, Piet L. C. M.; Weinblatt, Michael E.; Wilson, Anthony G.; Wolbink, Gert Jan; Wordsworth, B. Paul; Wijmenga, Cisca; Karlson, Elizabeth W.; Toes, Rene E. M.; de Vries, Niek; Begovich, Ann B.; Worthington, Jane; Siminovitch, Katherine A.; Gregersen, Peter K.; Klareskog, Lars; Plenge, Robert M.

    2010-01-01

    To identify new genetic risk factors for rheumatoid arthritis, we conducted a genome-wide association study meta-analysis of 5,539 autoantibody-positive individuals with rheumatoid arthritis (cases) and 20,169 controls of European descent, followed by replication in an independent set of 6,768 rheum

  5. Identifying Skill Requirements for GIS Positions: A Content Analysis of Job Advertisements

    Science.gov (United States)

    Hong, Jung Eun

    2016-01-01

    This study identifies the skill requirements for geographic information system (GIS) positions, including GIS analysts, programmers/developers/engineers, specialists, and technicians, through a content analysis of 946 GIS job advertisements from 2007-2014. The results indicated that GIS job applicants need to possess high levels of GIS analysis…

  6. Clinical Trial Registries Are of Minimal Use for Identifying Selective Outcome and Analysis Reporting

    Science.gov (United States)

    Norris, Susan L.; Holmer, Haley K.; Fu, Rongwei; Ogden, Lauren A.; Viswanathan, Meera S.; Abou-Setta, Ahmed M.

    2014-01-01

    Objective: This study aimed to examine selective outcome reporting (SOR) and selective analysis reporting (SAR) in randomized controlled trials (RCTs) and to explore the usefulness of trial registries for identifying SOR and SAR. Study Design and Setting: We selected one "index outcome" for each of three comparative effectiveness reviews…

  7. When noisy neighbors are a blessing: analysis of gene expression noise identifies coregulated genes

    NARCIS (Netherlands)

    Junker, J.P.; van Oudenaarden, A.

    2012-01-01

    In this issue of Molecular Cell, Stewart-Ornstein et al. (2012) use systematic pair-wise correlation analysis of expression noise in a large number of yeast genes to identify clusters of functionally related genes and signaling pathways responsible for elevated noise.

  8. Identifying sustainability issues using participatory SWOT analysis - A case study of egg production in the Netherlands

    NARCIS (Netherlands)

    Mollenhorst, H.; Boer, de I.J.M.

    2004-01-01

    The aim of this paper was to demonstrate how participatory strengths, weaknesses, opportunities and threats (SWOT) analysis can be used to identify relevant economic, ecological and societal (EES) issues for the assessment of sustainable development. This is illustrated by the case of egg production

  9. The mitochondrial genome of the multicolored Asian lady beetle Harmonia axyridis (Pallas) and a phylogenetic analysis of the Polyphaga (Insecta: Coleoptera).

    Science.gov (United States)

    Niu, Fang-Fang; Zhu, Liang; Wang, Su; Wei, Shu-Jun

    2016-07-01

    Here, we report the mitochondrial genome sequence of the multicolored Asian lady beetle Harmonia axyridis (Pallas, 1773) (Coleoptera: Coccinellidae) (GenBank accession No. KR108208). This is the first species with sequenced mitochondrial genome from the genus Harmonia. The current length with partitial A + T-rich region of this mitochondrial genome is 16,387 bp. All the typical genes were sequenced except the trnI and trnQ. As in most other sequenced mitochondrial genomes of Coleoptera, there is no re-arrangement in the sequenced region compared with the pupative ancestral arrangement of insects. All protein-coding genes start with ATN codons. Five, five and three protein-coding genes stop with termination codon TAA, TA and T, respectively. Phylogenetic analysis using Bayesian method based on the first and second codon positions of the protein-coding genes supported that the Scirtidae is a basal lineage of Polyphaga. The Harmonia and the Coccinella form a sister lineage. The monophyly of Staphyliniformia, Scarabaeiformia and Cucujiformia was supported. The Buprestidae was found to be a sister group to the Bostrichiformia.

  10. X chromosome-linked and mitochondrial gene control of Leber hereditary optic neuropathy: Evidence from segregation analysis for dependence on X chromosome inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Xiangdong Bu; Rotter, J.I. (Cedars-Sinai Medical Center, Los Angeles, CA (United States) Univ. of California, Los Angeles (United States))

    1991-09-15

    Leber hereditary optic neuropathy (LHON) has been shown to involve mutation(s) of mitochondrial DNA, yet there remain several confusing aspects of its inheritance not explained by mitochondrial inheritance alone, including male predominance, reduced penetrance, and a later age of onset in females. By extending segregation analysis methods to disorders that involve both a mitochondrial and a nuclear gene locus, the authors show that the available pedigree data for LHON are most consistent with a two-locus disorder, with one responsible gene being mitochondrial and the other nuclear and X chromosome-linked. Furthermore, they have been able to extend the two-locus analytic method and demonstrate that a proportion of affected females are likely heterozygous at the X chromosome-linked locus and are affected due to unfortunate X chromosome inactivation, thus providing an explanation for the later age of onset in females. The estimated penetrance for a heterozygous female is 0.11{plus minus}0.02. The calculated frequency of the X chromosome-linked gene for LHON is 0.l08. Among affected females, 60% are expected to be heterozygous, and the remainder are expected to be homozygous at the responsible X chromosome-linked locus.

  11. Gene expression meta-analysis identifies chromosomal regions involved in ovarian cancer survival

    DEFF Research Database (Denmark)

    Thomassen, Mads; Jochumsen, Kirsten M; Mogensen, Ole;

    2009-01-01

    the relation of gene expression and chromosomal position to identify chromosomal regions of importance for early recurrence of ovarian cancer. By use of *Gene Set Enrichment Analysis*, we have ranked chromosomal regions according to their association to survival. Over-representation analysis including 1......Ovarian cancer cells exhibit complex karyotypic alterations causing deregulation of numerous genes. Some of these genes are probably causal for cancer formation and local growth, whereas others are causal for metastasis and recurrence. By using publicly available data sets, we have investigated......-4 consecutive cytogenetic bands identified regions with increased expression for chromosome 5q12-14, and a very large region of chromosome 7 with the strongest signal at 7p15-13 among tumors from short-living patients. Reduced gene expression was identified at 4q26-32, 6p12-q15, 9p21-q32, and 11p14-11. We...

  12. Hyperglycemia alters the schwann cell mitochondrial proteome and decreases coupled respiration in the absence of superoxide production.

    Science.gov (United States)

    Zhang, Liang; Yu, Cuijuan; Vasquez, Francisco E; Galeva, Nadya; Onyango, Isaac; Swerdlow, Russell H; Dobrowsky, Rick T

    2010-01-01

    Hyperglycemia-induced mitochondrial dysfunction contributes to sensory neuron pathology in diabetic neuropathy. Although Schwann cells (SCs) also undergo substantial degeneration in diabetic neuropathy, the effect of hyperglycemia on the SC mitochondrial proteome and mitochondrial function has not been examined. Stable isotope labeling with amino acids in cell culture (SILAC) was used to quantify the temporal effect of hyperglycemia on the mitochondrial proteome of primary SCs isolated from neonatal rats. Of 317 mitochondrial proteins identified, about 78% were quantified and detected at multiple time points. Pathway analysis indicated that proteins associated with mitochondrial dysfunction, oxidative phosphorylation, the TCA cycle, and detoxification were significantly increased in expression and over-represented. Assessing mitochondrial respiration in intact SCs indicated that hyperglycemia increased the overall rate of oxygen consumption but decreased the efficiency of coupled respiration. Although a glucose-dependent increase in superoxide production occurs in embryonic sensory neurons, hyperglycemia did not induce a substantial change in superoxide levels in SCs. This correlated with a 1.9-fold increase in Mn superoxide dismutase expression, which was confirmed by immunoblot and enzymatic activity assays. These data support that hyperglycemia alters mitochondrial respiration and can cause remodeling of the SC mitochondrial proteome independent of significant contributions from glucose-induced superoxide production.

  13. The goat domestication process inferred from large-scale mitochondrial DNA analysis of wild and domestic individuals.

    Science.gov (United States)

    Naderi, Saeid; Rezaei, Hamid-Reza; Pompanon, François; Blum, Michael G B; Negrini, Riccardo; Naghash, Hamid-Reza; Balkiz, Ozge; Mashkour, Marjan; Gaggiotti, Oscar E; Ajmone-Marsan, Paolo; Kence, Aykut; Vigne, Jean-Denis; Taberlet, Pierre

    2008-11-18

    The emergence of farming during the Neolithic transition, including the domestication of livestock, was a critical point in the evolution of human kind. The goat (Capra hircus) was one of the first domesticated ungulates. In this study, we compared the genetic diversity of domestic goats to that of the modern representatives of their wild ancestor, the bezoar, by analyzing 473 samples collected over the whole distribution range of the latter species. This partly confirms and significantly clarifies the goat domestication scenario already proposed by archaeological evidence. All of the mitochondrial DNA haplogroups found in current domestic goats have also been found in the bezoar. The geographic distribution of these haplogroups in the wild ancestor allowed the localization of the main domestication centers. We found no haplotype that could have been domesticated in the eastern half of the Iranian Plateau, nor further to the east. A signature of population expansion in bezoars of the C haplogroup suggests an early domestication center on the Central Iranian Plateau (Yazd and Kerman Provinces) and in the Southern Zagros (Fars Province), possibly corresponding to the management of wild flocks. However, the contribution of this center to the current domestic goat population is rather low (1.4%). We also found a second domestication center covering a large area in Eastern Anatolia, and possibly in Northern and Central Zagros. This last domestication center is the likely origin of almost all domestic goats today. This finding is consistent with archaeological data identifying Eastern Anatolia as an important domestication center.

  14. Genetic variability in tench (Tinca tinca L. as revealed by PCR-RFLP analysis of mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Liliana Di Stasio

    2012-01-01

    Full Text Available Four mitochondrial DNA segments, ND1, ND6, cyt b and D-loop, were analysed by polymerase chain reaction-restriction fragment lenght polymorphism (PCR-RFLP in 14 tench (Tinca tinca L. populations located in Europe and Asia; also data on five Italian populations previously analysed for the same mtDNA segments were included in the study. All the considered segments were polymorphic and originated a total of 9 composite haplotypes, which were clustered into two haplogroups, A and B, possibly corresponding to the Western and Eastern phylogroups previously described in tench. Nine out of 19 populations showed polymorphism, with haplotype diversity ranging from 0.246 to 0.643 and nucleotide diversity from 0.009 to 0.078. Seventy-five percent of the pairwise comparisons were significant, indicating a high between-population variability. The Neighbour-Joining tree revealed the presence of three clusters, including purepopulations, with only A or B haplogroup, and mixedpopulations, with both haplogroups. The possibility of identifying populations with different haplotypes has practical implications for both conservation and supportive stocking.

  15. Research fronts analysis : A bibliometric to identify emerging fields of research

    Science.gov (United States)

    Miwa, Sayaka; Ando, Satoko

    Research fronts analysis identifies emerging areas of research through observing co-clustering in highly-cited papers. This article introduces the concept of research fronts analysis, explains its methodology and provides case examples. It also demonstrates developing research fronts in Japan by looking at the past winners of Thomson Reuters Research Fronts Awards. Research front analysis is currently being used by the Japanese government to determine new trends in science and technology. Information professionals can also utilize this bibliometric as a research evaluation tool.

  16. PCR-RFLP analysis of mitochondrial DNA in tench Tinca tinca.

    Science.gov (United States)

    Lo Presti, R; Gasco, L; Lisa, C; Zoccarato, I; Di Stasio, L

    2010-02-01

    Polymorphism was detected at ND1, ND6, D-loop and cyt b segments of mtDNA in 105 tench (Tinca tinca L.), using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique and five composite haplotypes were identified. The diversity indices and the results of the population comparisons revealed that the identified markers provide a powerful tool for further studies on this species.

  17. Molecular characterization of Fasciola hepatica from Sardinia based on sequence analysis of genomic and mitochondrial gene markers.

    Science.gov (United States)

    Farjallah, Sarra; Ben Slimane, Badreddine; Piras, Cristina Maria; Amor, Nabil; Garippa, Giovanni; Merella, Paolo

    2013-11-01

    The aim of the present study is to investigate for the first time the genetic diversity of samples identified morphologically as Fasciola hepatica (Platyhelminthes: Trematoda: Digenea) (n=66) from sheep and cattle from two localities of Sardinia and to compare them with available data from other localities by partial sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes, the mitochondrial cytochrome c oxidase subunit I (COI), and nicotinamide adenine dinucleotide dehydrogenase subunit I (ND1) genes. Comparison of the sequences from Sardinia with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. hepatica. The nucleotide sequencing of ITS rDNA showed no nucleotide variation in the ITS-1, 5.8S and ITS-2 rDNA sequences among all Sardinian samples, comparing with two ITS-2 haplotypes in standard F. hepatica, showing a substitution C/T in 20 position 859, reported previously from Tunisia, Algeria, Australia, Uruguay and Spain. The present study shows that in Sardinian sheep and cattle there is the most frequent haplotype (FhITS-H1) of F. hepatica species from South Europe. Considering NDI sequences, the phylogenetic trees showed reliable grouping among the haplotypes of F. hepatica from Sardinia and the mitochondrial lineage I, including the main N1 haplotype, observed previously from Europe (Russia, Belarus, Ukraine and Bulgaria), Armenia, West Africa (Nigeria), America (Uruguay and USA), Asia (Turkey, Japan, and China), Georgia, Turkmenistan, Azerbaijan and Australia. Furthermore, common haplotypes FhCOI-H1 and FhCOI-H2 of F. hepatica from Sardinia also corresponded mostly to the first lineage including the main C1 haplotype reported previously from Eastern European and Western Asian populations, they belonged just to a phylogenically distinguishable clade, as F. hepatica from Australia, France, Turkey, Uruguay, Russia, Armenia, Ukraine, Belarus

  18. A cross-species genetic analysis identifies candidate genes for mouse anxiety and human bipolar disorder

    Directory of Open Access Journals (Sweden)

    David G Ashbrook

    2015-07-01

    Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.

  19. Altered mitochondrial DNA copy number contributes to human cancer risk: evidence from an updated meta-analysis

    Science.gov (United States)

    Hu, Liwen; Yao, Xinyue; Shen, Yi

    2016-01-01

    Accumulating epidemiological evidence indicates that the quantitative changes in human mitochondrial DNA (mtDNA) copy number could affect the genetic susceptibility of malignancies in a tumor-specific manner, but the results are still elusive. To provide a more precise estimation on the association between mtDNA copy number and risk of diverse malignancies, a meta-analysis was conducted by calculating the pooled odds ratios (OR) and the 95% confidence intervals (95% CI). A total of 36 case-control studies involving 11,847 cases and 15,438 controls were finally included in the meta-analysis. Overall analysis of all studies suggested no significant association between mtDNA content and cancer risk (OR = 1.044, 95% CI = 0.866–1.260, P = 0.651). Subgroup analyses by cancer types showed an obvious positive association between mtDNA content and lymphoma and breast cancer (OR = 1.645, 95% CI = 1.117–2.421, P = 0.012; OR = 1.721, 95% CI = 1.130–2.622, P = 0.011, respectively), and a negative association for hepatic carcinoma. Stratified analyses by other confounding factors also found increased cancer risk in people with drinking addiction. Further analysis using studies of quartiles found that populations with the highest mtDNA content may be under more obvious risk of melanoma and that Western populations were more susceptible than Asians. PMID:27775013

  20. Restoration of normal embryogenesis by mitochondrial supplementation in pig oocytes exhibiting mitochondrial DNA deficiency.

    Science.gov (United States)

    Cagnone, Gael L M; Tsai, Te-Sha; Makanji, Yogeshwar; Matthews, Pamela; Gould, Jodee; Bonkowski, Michael S; Elgass, Kirstin D; Wong, Ashley S A; Wu, Lindsay E; McKenzie, Matthew; Sinclair, David A; St John, Justin C

    2016-03-18

    An increasing number of women fail to achieve pregnancy due to either failed fertilization or embryo arrest during preimplantation development. This often results from decreased oocyte quality. Indeed, reduced mitochondrial DNA copy number (mitochondrial DNA deficiency) may disrupt oocyte quality in some women. To overcome mitochondrial DNA deficiency, whilst maintaining genetic identity, we supplemented pig oocytes selected for mitochondrial DNA deficiency, reduced cytoplasmic maturation and lower developmental competence, with autologous populations of mitochondrial isolate at fertilization. Supplementation increased development to blastocyst, the final stage of preimplantation development, and promoted mitochondrial DNA replication prior to embryonic genome activation in mitochondrial DNA deficient oocytes but not in oocytes with normal levels of mitochondrial DNA. Blastocysts exhibited transcriptome profiles more closely resembling those of blastocysts from developmentally competent oocytes. Furthermore, mitochondrial supplementation reduced gene expression patterns associated with metabolic disorders that were identified in blastocysts from mitochondrial DNA deficient oocytes. These results demonstrate the importance of the oocyte's mitochondrial DNA investment in fertilization outcome and subsequent embryo development to mitochondrial DNA deficient oocytes.

  1. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  2. Cluster analysis of spontaneous preterm birth phenotypes identifies potential associations among preterm birth mechanisms

    Science.gov (United States)

    Esplin, M Sean; Manuck, Tracy A.; Varner, Michael W.; Christensen, Bryce; Biggio, Joseph; Bukowski, Radek; Parry, Samuel; Zhang, Heping; Huang, Hao; Andrews, William; Saade, George; Sadovsky, Yoel; Reddy, Uma M.; Ilekis, John

    2015-01-01

    Objective We sought to employ an innovative tool based on common biological pathways to identify specific phenotypes among women with spontaneous preterm birth (SPTB), in order to enhance investigators' ability to identify to highlight common mechanisms and underlying genetic factors responsible for SPTB. Study Design A secondary analysis of a prospective case-control multicenter study of SPTB. All cases delivered a preterm singleton at SPTB ≤34.0 weeks gestation. Each woman was assessed for the presence of underlying SPTB etiologies. A hierarchical cluster analysis was used to identify groups of women with homogeneous phenotypic profiles. One of the phenotypic clusters was selected for candidate gene association analysis using VEGAS software. Results 1028 women with SPTB were assigned phenotypes. Hierarchical clustering of the phenotypes revealed five major clusters. Cluster 1 (N=445) was characterized by maternal stress, cluster 2 (N=294) by premature membrane rupture, cluster 3 (N=120) by familial factors, and cluster 4 (N=63) by maternal comorbidities. Cluster 5 (N=106) was multifactorial, characterized by infection (INF), decidual hemorrhage (DH) and placental dysfunction (PD). These three phenotypes were highly correlated by Chi-square analysis [PD and DH (p<2.2e-6); PD and INF (p=6.2e-10); INF and DH (p=0.0036)]. Gene-based testing identified the INS (insulin) gene as significantly associated with cluster 3 of SPTB. Conclusion We identified 5 major clusters of SPTB based on a phenotype tool and hierarchal clustering. There was significant correlation between several of the phenotypes. The INS gene was associated with familial factors underlying SPTB. PMID:26070700

  3. [The analysis of Leber's hereditary optic neuropathy associated with mitochondrial tRNAAla C5601T mutation in seven Han Chinese families].

    Science.gov (United States)

    Zhou, Hui-Hui; Dai, Xian-Ning; Lin, Bei; Mi, Hui; Liu, Xiao-Ling; Zhao, Fu-Xin; Zhang, Juan-Juan; Zhou, Xiang-Tian; Sun, Yan-Hong; Wei, Qi-Ping; Qu, Jia; Guan, Min-Xin

    2012-08-01

    We reported here the clinical, genetic, and molecular characterization of Leber's hereditary optic neuropathy (LHON) with C5601T mutation in seven Chinese families. The ophthalmologic examinations of seven Chinese families who were clinically diagnosed LHON were conducted. Strikingly, these families exhibited very low penetrance of visual impairment, and the penetrance was 9.5%, 14.3%, 4.5%, 8.3%, 10.0%, 22.2% and 25.0%. Meanwhile, entire mitochondrial genome of seven probands was amplified by PCR using 24 pairs of oligonucleotide primers with overlapping fragments. Molecular analysis of mitochondrial DNA (mtDNA) in these pedigrees revealed the absence of three common LHON associated G11778A, G3460A and T14484C mutations but the presence of homoplastic LHON associated tRNAAla C5601T mutation in probands and other matrilineal relatives. These mtDNA polymorphism sites belongs to the Asian haplogroups G2, G2a1, G2a1, G2, G2b, G2a1 and G2. By analyzing mitochondrial genome, seven LHON families all carry the C5601T mutation. The C5601T mutation occurs at the highly conserved nucleotide (conventional position 59) of tRNAAla, thereby contributing to the structural formation and stabilization of functional tRNAs and leading to mitochondrial dysfunction involved in visual impairment. The incomplete penetrance of visual loss in these seven Chinese pedigrees strongly indicates that the tRNAAla C5601T mutation was itself insufficient to produce a clinical phenotype. The lack of functional mtDNA variants in these pedigrees ruled out the role of mitochondrial background in the phenotypic expression of visual loss. Therefore, nuclear backgrounds and environmental factors seem to be modifying factors for the phenotypic manifestation of the tRNAAla C5601T mutation in the seven Chinese families.

  4. [The analysis of mitochondrial DNA haplogroups and variants for Leber's hereditary optic neuropathy in Chinese families carrying the m.14484T >C mutation].

    Science.gov (United States)

    Meng, Xiangjuan; Zhu, Jinping; Gao, Min; Zhang, Sai; Zhao, Fuxin; Zhang, Juanjuan; Liu, Xiaoling; Wei, Qiping; Tong, Yi; Zhang, Minglian; Qu, Jia; Guan, Minxin

    2014-04-01

    The m.14484T>C mutation in mitochondrial ND6 gene (MT-ND6) is a primary mutation underlying the development of Leber's hereditary optic neuropathy (LHON) , but by itself not enough to cause visual loss. To explore the role of mitochondrial haplogroups on the expression of LHON for the people carrying the m.14484T>C mutation, we performed systematic and extended mutational screening of MT-ND6 gene in a cohort of 1177 Han Chinese patients with LHON. A total of 67 affected subjects carried the homoplasmic m.14484T>C mutation, accounting for 5.7% of this LHON population. The penetrances of optic neuropathy among 51 pedigrees carrying the m.14484T>C mutation ranged from 5.6% to 100.0%, with the average of 21.5%. The sequence analysis of entire mitochondrial genomes of 51 probands exhibited distinct sets of polymorphisms belonging to 18 Eastern Asian haplogroups. The frequencies of haplogroup A and haplogroup F were sig-nificantly less in the LHON mtDNA samples than those in 106 Chinese controls. On the other hand, the haplogroup M10a accounted for 9.8% of the patient's mtDNA samples but was absent in 106 Chinese controls. Strikingly, the average pene-trance (46.13%) of optic neuropathy for the pedigrees carrying mitochondrial haplogroup M10a was higher than those car-rying other mtDNA haplogroups. These observations indicated that mitochondrial haplogroup M10a may increase the risk of visual loss.

  5. Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    Menezes, M.R.; Kumar, G.; Kunal, S.P.

    ; population expansion. INTRODUCTION The tunas, belonging to the family Scombridae, comprise a highly valued group of fishes which are marketed fresh, frozen and canned. They are tropical and subtrop- ical in their distribution in the world oceans (Collette... of urea. Fisheries Science 62, 727–730. Chow, S. & Ushiama, H. (1995). Global population structure of albacore (Thunnus alalunga) inferred by RFLP analysis of the mitochondrial ATPase gene. Marine Biology 123, 39–45. doi: 10.1007/BF00350321 Chow, S...

  6. Mitochondrial dysfunction in myofibrillar myopathy.

    Science.gov (United States)

    Vincent, Amy E; Grady, John P; Rocha, Mariana C; Alston, Charlotte L; Rygiel, Karolina A; Barresi, Rita; Taylor, Robert W; Turnbull, Doug M

    2016-10-01

    Myofibrillar myopathies (MFM) are characterised by focal myofibrillar destruction and accumulation of myofibrillar elements as protein aggregates. They are caused by mutations in the DES, MYOT, CRYAB, FLNC, BAG3, DNAJB6 and ZASP genes as well as other as yet unidentified genes. Previous studies have reported changes in mitochondrial morphology and cellular positioning, as well as clonally-expanded, large-scale mitochondrial DNA (mtDNA) deletions and focal respiratory chain deficiency in muscle of MFM patients. Here we examine skeletal muscle from patients with desmin (n = 6), ZASP (n = 1) and myotilin (n = 2) mutations and MFM protein aggregates, to understand how mitochondrial dysfunction may contribute to the underlying mechanisms causing disease pathology. We have used a validated quantitative immunofluorescent assay to study respiratory chain protein levels, together with oxidative enzyme histochemistry and single cell mitochondrial DNA analysis, to examine mitochondrial changes. Results demonstrate a small number of clonally-expanded mitochondrial DNA deletions, which we conclude are due to both ageing and disease pathology. Further to this we report higher levels of respiratory chain complex I and IV deficiency compared to age matched controls, although overall levels of respiratory deficient muscle fibres in patient biopsies are low. More strikingly, a significantly higher percentage of myofibrillar myopathy patient muscle fibres have a low mitochondrial mass compared to controls. We concluded this is mechanistically unrelated to desmin and myotilin protein aggregates; however, correlation between mitochondrial mass and muscle fibre area is found. We suggest this may be due to reduced mitochondrial biogenesis in combination with muscle fibre hypertrophy.

  7. mtDNA-Server: next-generation sequencing data analysis of human mitochondrial DNA in the cloud.

    Science.gov (United States)

    Weissensteiner, Hansi; Forer, Lukas; Fuchsberger, Christian; Schöpf, Bernd; Kloss-Brandstätter, Anita; Specht, Günther; Kronenberg, Florian; Schönherr, Sebastian

    2016-07-08

    Next generation sequencing (NGS) allows investigating mitochondrial DNA (mtDNA) characteristics such as heteroplasmy (i.e. intra-individual sequence variation) to a higher level of detail. While several pipelines for analyzing heteroplasmies exist, issues in usability, accuracy of results and interpreting final data limit their usage. Here we present mtDNA-Server, a scalable web server for the analysis of mtDNA studies of any size with a special focus on usability as well as reliable identification and quantification of heteroplasmic variants. The mtDNA-Server workflow includes parallel read alignment, heteroplasmy detection, artefact or contamination identification, variant annotation as well as several quality control metrics, often neglected in current mtDNA NGS studies. All computational steps are parallelized with Hadoop MapReduce and executed graphically with Cloudgene. We validated the underlying heteroplasmy and contamination detection model by generating four artificial sample mix-ups on two different NGS devices. Our evaluation data shows that mtDNA-Server detects heteroplasmies and artificial recombinations down to the 1% level with perfect specificity and outperforms existing approaches regarding sensitivity. mtDNA-Server is currently able to analyze the 1000G Phase 3 data (n = 2,504) in less than 5 h and is freely accessible at https://mtdna-server.uibk.ac.at.

  8. On the origin of Iberomaurusians: new data based on ancient mitochondrial DNA and phylogenetic analysis of Afalou and Taforalt populations.

    Science.gov (United States)

    Kefi, Rym; Hechmi, Meriem; Naouali, Chokri; Jmel, Haifa; Hsouna, Sana; Bouzaid, Eric; Abdelhak, Sonia; Beraud-Colomb, Eliane; Stevanovitch, Alain

    2016-12-30

    The Western North African population was characterized by the presence of Iberomaurusian civilization at the Epiplaeolithic period (around 20,000 years before present (YBP) to 10,000 YBP). The origin of this population is still not clear: they may come from Europe, Near East, sub-Saharan Africa or they could have evolved in situ in North Africa. With the aim to contribute to a better knowledge of the settlement of North Africa we analysed the mitochondrial DNA extracted from Iberomaurusian skeletons exhumed from the archaeological site of Afalou (AFA) (15,000-11,000 YBP) in Algeria and from the archaeological site of Taforalt (TAF) (23,000-10,800 YBP) in Morocco. Then, we carried out a phylogenetic analysis relating these Iberomaurusians to 61 current Mediterranean populations. The genetic structure of TAF and AFA specimens contains only North African and Eurasian maternal lineages. These finding demonstrate the presence of these haplotypes in North Africa from at least 20,000 YBP. The very low contribution of a Sub-Saharan African haplotype in the Iberomaurusian samples is confirmed. We also highlighted the existence of genetic flows between Southern and Northern coast of the Mediterranean.

  9. The Complete Sequence of Mitochondrial COⅡ Gene of Fenneropenaeus chinensis and Its Applicability as a Marker for Phylogenetic Analysis

    Institute of Scientific and Technical Information of China (English)

    YU Shanshan; KONG Xiaoyu; LI Yulong; XU Hui

    2007-01-01

    The complete mitochondrial cytochrome oxidase subunit Ⅱ (COⅡ) gene of Penaeinae shrimp Fenneropenaeus chinensis was cloned and sequenced. The gene is 688 bp in length and codes for 229 amino acids. It shows 83.2%, 87.0% and 83.8% sequence similarity to Marsupenaeus Japonicus, Penaeus monodon and Farfantepenaeus notialis, respectively. The A+T content of the whole gene and that at the third position of codons are 64.7% and 78.2%, respectively. The phylogenetic relationship between F. chinensis and three other species representing genera Farfanatepenaeus, Marsupenaeus and Penaeus was analyzed. Results showed that the genetic distances among the four taxa ranged from 0.144 0 to 0.200 5, exceeding those estimated with COⅠ and partial 16S rRNA gene sequences among Marsupenaeus, Litopenaeus and Melicertus, and being therefore larger than the value among subgenera. It has been suggested that the COⅡ gene has a faster evolutionary rate than that of the COⅠ gene and partial 16S rRNA gene and could be used for phylogenetic analysis at genus or species level. The results of the present study indicated that Farfantepenaeus, Fenneropenaeus, Marsupenaeus and Penaeus are at a higher phylogenetic level than subgenus, which supports the opinion of the elevation of phylogenetic status of the four subgenera to genus level.

  10. Molecular characterization and mutational analysis of the human B17 subunit of the mitochondrial respiratory chain complex I.

    Science.gov (United States)

    Smeitink, J; Loeffen, J; Smeets, R; Triepels, R; Ruitenbeek, W; Trijbels, F; van den Heuvel, L

    1998-08-01

    Bovine NADH:ubiquinone oxidoreductase (complex 1) of the mitochondrial respiratory chain consists of about 36 nuclear-encoded subunits. We review the current knowledge of the 15 human complex I subunits cloned so far, and report the 598-bp cDNA sequence, the chromosomal localization and the tissue expression of an additional subunit, the B17 subunit. The cDNA open reading frame of B17 comprises 387 bp and encodes a protein of 128 amino acids (calculated Mr 15.5 kDa). There is 82.7% and 78.1% homology, respectively, at the cDNA and amino acid level with the bovine counterpart. The gene of the B17 subunit has been mapped to chromosome 2. Multiple-tissue dot-blots showed ubiquitous expression of the mRNA with relatively higher expression in tissues known for their high energy demand. Of these, kidney showed the highest expression. Mutational analysis of the subunit revealed no mutations or polymorphisms in 20 patients with isolated enzymatic complex I deficiency in cultured skin fibroblasts.

  11. mtDNA-Server: next-generation sequencing data analysis of human mitochondrial DNA in the cloud

    Science.gov (United States)

    Weissensteiner, Hansi; Forer, Lukas; Fuchsberger, Christian; Schöpf, Bernd; Kloss-Brandstätter, Anita; Specht, Günther; Kronenberg, Florian; Schönherr, Sebastian

    2016-01-01

    Next generation sequencing (NGS) allows investigating mitochondrial DNA (mtDNA) characteristics such as heteroplasmy (i.e. intra-individual sequence variation) to a higher level of detail. While several pipelines for analyzing heteroplasmies exist, issues in usability, accuracy of results and interpreting final data limit their usage. Here we present mtDNA-Server, a scalable web server for the analysis of mtDNA studies of any size with a special focus on usability as well as reliable identification and quantification of heteroplasmic variants. The mtDNA-Server workflow includes parallel read alignment, heteroplasmy detection, artefact or contamination identification, variant annotation as well as several quality control metrics, often neglected in current mtDNA NGS studies. All computational steps are parallelized with Hadoop MapReduce and executed graphically with Cloudgene. We validated the underlying heteroplasmy and contamination detection model by generating four artificial sample mix-ups on two different NGS devices. Our evaluation data shows that mtDNA-Server detects heteroplasmies and artificial recombinations down to the 1% level with perfect specificity and outperforms existing approaches regarding sensitivity. mtDNA-Server is currently able to analyze the 1000G Phase 3 data (n = 2,504) in less than 5 h and is freely accessible at https://mtdna-server.uibk.ac.at. PMID:27084948

  12. Nuclear and mitochondrial DNA analysis reveals that hybridization between Fasciola hepatica and Fasciola gigantica occurred in China.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Peng, Mao; Hayashi, Kei; Shoriki, Takuya; Mohanta, Uday Kumar; Shibahara, Toshiyuki; Itagaki, Tadashi

    2017-02-01

    The well-known pathogens of fasciolosis, Fasciola hepatica (Fh) and Fasciola Gigantica (Fg), possess abundant mature sperms in their seminal vesicles, and thus, they reproduce bisexually. On the other hand, aspermic Fasciola flukes reported from Asian countries, which have no sperm in their seminal vesicles, probably reproduce parthenogenetically. The aim of this study was to reveal the origin of aspermic Fasciola flukes. The nuclear single copy markers, phosphoenolpyruvate carboxykinase and DNA polymerase delta, were employed for analysis of Fasciola species from China. The hybrid origin of aspermic Fasciola flukes was strongly suggested by the presence of the Fh/Fg type, which includes DNA fragments of both F. hepatica and F. gigantica. China can be regarded as the cradle of the interspecific hybridization because F. hepatica and F. gigantica were detected in the northern and southern parts of China, respectively, and hybrids flukes were distributed between the habitats of the two species. The Chinese origin was supported by the fact that a larger number of mitochondrial NADH dehydrogenase subunit 1 (nad1) haplotypes was detected in Chinese aspermic Fasciola populations than in aspermic populations from the neighbouring countries. Hereafter, 'aspermic' Fasciola flukes should be termed as 'hybrid' Fasciola flukes.

  13. Comparative analysis of mitochondrial control region in polyploid hybrids of red crucian carp (Carassius auratus) x blunt snout bream (Megalobrama amblycephala).

    Science.gov (United States)

    Yan, Jinpeng; Liu, Liangguo; Liu, Shaojun; Guo, Xinhong; Liu, Yun

    2010-06-01

    The entire sequences of the mitochondrial (mt)DNA control region (CR) and portions of its flanking genes in the red crucian carp (RC) and blunt snout bream (BSB) as well as their polyploid hybrids (3nRB, 4nRB and 5nRB) were determined and subjected to a comparative analysis. The mtDNA-CRs of these five fish species ranged from 923 to 937 bp in length, they had the same flanking gene arrangement as other vertebrates and the pattern of nucleotide substitution bias was also similar to that in other vertebrates. Our data are consistent with the viewpoint of three domains [extended terminal associated sequence (ETAS domain), central conserved sequence block domain and conserved sequence block (CSB) domain] within the mtDNA-CR of mammals. On the basis our comparative analysis of the mtDNA-CRs of these five fish species, we were able to identify the consensus sequences of functional conserved units, including the ETAS, CSB-F, CSB-D, CSB-E, CSB1, CSB2 and CSB3 and putative promoter. The percentage of variable nucleotide positions (41.98%) in the central domain was lower than those in the ETAS and conserved domain (71.70 and 47.12%, respectively), suggesting that the central domain was the most conserved part of the mtDNA-CR. These results provide useful and important information for the further study of mtDNA-CR structure in fish. The sequence similarities of mtDNA-CR among the 3nRB, 4nRB, 5nRB hybrids and their respective female parents were higher than those among the 3nRB, 4nRB, 5nRB hybrids and their respective male parents, providing the direct evidence of stringent maternal inheritance of mtDNA-CR in the 3nRB, 4nRB and 5nRB hybrids.

  14. Identification of Potential Calorie Restriction-Mimicking Yeast Mutants with Increased Mitochondrial Respiratory Chain and Nitric Oxide Levels

    Directory of Open Access Journals (Sweden)

    Bin Li

    2011-01-01

    Full Text Available Calorie restriction (CR induces a metabolic shift towards mitochondrial respiration; however, molecular mechanisms underlying CR remain unclear. Recent studies suggest that CR-induced mitochondrial activity is associated with nitric oxide (NO production. To understand the role of mitochondria in CR, we identify and study Saccharomyces cerevisiae mutants with increased NO levels as potential CR mimics. Analysis of the top 17 mutants demonstrates a correlation between increased NO, mitochondrial respiration, and longevity. Interestingly, treating yeast with NO donors such as GSNO (S-nitrosoglutathione is sufficient to partially mimic CR to extend lifespan. CR-increased NO is largely dependent on mitochondrial electron transport and cytochrome c oxidase (COX. Although COX normally produces NO under hypoxic conditions, CR-treated yeast cells are able to produce NO under normoxic conditions. Our results suggest that CR may derepress some hypoxic genes for mitochondrial proteins that function to promote the production of NO and the extension of lifespan.

  15. Mitochondrial DNA as a potential tool for early cancer detection

    Directory of Open Access Journals (Sweden)

    Parr Ryan L

    2006-01-01

    Full Text Available Abstract The recent surge in mitochondrial research has been driven by the identification of mitochondria-associated diseases and the role of mitochondria in apoptosis. Both of these aspects have identified mitochondrial analysis as a vital component of medical research. Moreover, mitochondria have been implicated in the process of carcinogenesis because of their vital role in energy production, nuclear-cytoplasmic signal integration and control of metabolic pathways. Interestingly, at some point during neoplastic transformation, there is an increase in reactive oxygen species, which damage the mitochondrial genome. This accelerates the somatic mutation rate of mitochondrial DNA. It has been proposed that these mutations may serve as an early indication of potential cancer development and may represent a means for tracking tumour progression. The purpose of this review is to explore the potential utility that these mutations may afford for the identification and monitoring of neoplasia and malignant transformation where appropriate body fluids or non-invasive tissue access is available for mitochondrial DNA recovery. Specifically, prostate, breast, colorectal, skin and lung cancers are discussed.

  16. Genome-wide interaction-based association analysis identified multiple new susceptibility Loci for common diseases.

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2011-03-01

    Full Text Available Genome-wide interaction-based association (GWIBA analysis has the potential to identify novel susceptibility loci. These interaction effects could be missed with the prevailing approaches in genome-wide association studies (GWAS. However, no convincing loci have been discovered exclusively from GWIBA methods, and the intensive computation involved is a major barrier for application. Here, we developed a fast, multi-thread/parallel program named "pair-wise interaction-based association mapping" (PIAM for exhaustive two-locus searches. With this program, we performed a complete GWIBA analysis on seven diseases with stringent control for false positives, and we validated the results for three of these diseases. We identified one pair-wise interaction between a previously identified locus, C1orf106, and one new locus, TEC, that was specific for Crohn's disease, with a Bonferroni corrected P < 0.05 (P = 0.039. This interaction was replicated with a pair of proxy linked loci (P = 0.013 on an independent dataset. Five other interactions had corrected P < 0.5. We identified the allelic effect of a locus close to SLC7A13 for coronary artery disease. This was replicated with a linked locus on an independent dataset (P = 1.09 × 10⁻⁷. Through a local validation analysis that evaluated association signals, rather than locus-based associations, we found that several other regions showed association/interaction signals with nominal P < 0.05. In conclusion, this study demonstrated that the GWIBA approach was successful for identifying novel loci, and the results provide new insights into the genetic architecture of common diseases. In addition, our PIAM program was capable of handling very large GWAS datasets that are likely to be produced in the future.

  17. Patent Network Analysis and Quadratic Assignment Procedures to Identify the Convergence of Robot Technologies

    Science.gov (United States)

    Lee, Woo Jin; Lee, Won Kyung

    2016-01-01

    Because of the remarkable developments in robotics in recent years, technological convergence has been active in this area. We focused on finding patterns of convergence within robot technology using network analysis of patents in both the USPTO and KIPO. To identify the variables that affect convergence, we used quadratic assignment procedures (QAP). From our analysis, we observed the patent network ecology related to convergence and found technologies that have great potential to converge with other robotics technologies. The results of our study are expected to contribute to setting up convergence based R&D policies for robotics, which can lead new innovation. PMID:27764196

  18. Identifying barriers to patient acceptance of active surveillance: content analysis of online patient communications.

    Directory of Open Access Journals (Sweden)

    Mark V Mishra

    Full Text Available OBJECTIVES: Qualitative research aimed at identifying patient acceptance of active surveillance (AS has been identified as a public health research priority. The primary objective of this study was to determine if analysis of a large-sample of anonymous internet conversations (ICs could be utilized to identify unmet public needs regarding AS. METHODS: English-language ICs regarding prostate cancer (PC treatment with AS from 2002-12 were identified using a novel internet search methodology. Web spiders were developed to mine, aggregate, and analyze content from the world-wide-web for ICs centered on AS. Collection of ICs was not restricted to any specific geographic region of origin. NLP was used to evaluate content and perform a sentiment analysis. Conversations were scored as positive, negative, or neutral. A sentiment index (SI was subsequently calculated according to the following formula to compare temporal trends in public sentiment towards AS: [(# Positive IC/#Total IC-(#Negative IC/#Total IC x 100]. RESULTS: A total of 464 ICs were identified. Sentiment increased from -13 to +2 over the study period. The increase sentiment has been driven by increased patient emphasis on quality-of-life factors and endorsement of AS by national medical organizations. Unmet needs identified in these ICs include: a gap between quantitative data regarding long-term outcomes with AS vs. conventional treatments, desire for treatment information from an unbiased specialist, and absence of public role models managed with AS. CONCLUSIONS: This study demonstrates the potential utility of online patient communications to provide insight into patient preferences and decision-making. Based on our findings, we recommend that multidisciplinary clinics consider including an unbiased specialist to present treatment options and that future decision tools for AS include quantitative data regarding outcomes after AS.

  19. Factor Analysis of the DePaul Symptom Questionnaire: Identifying Core Domains

    OpenAIRE

    Jason, Leonard A.; Sunnquist, Madison; Brown, Abigail; Furst, Jacob; Cid, Marjoe; Farietta, Jillianna; Kot, Bobby; Bloomer, Craig; Nicholson, Laura; Williams, Yolonda; Jantke, Rachel; Newton, Julia L.; Strand, Elin Bolle

    2015-01-01

    The present study attempted to identify critical symptom domains of individuals with Myalgic Encephalomyelitis (ME) and chronic fatigue syndrome (CFS). Using patient and control samples collected in the United States, Great Britain, and Norway, exploratory factor analysis (EFA) was used to establish the underlying factor structure of ME and CFS symptoms. The EFA suggested a four-factor solution: post-exertional malaise, cognitive dysfunction, sleep difficulties, and a combined factor consisti...

  20. Emergent team roles in organizational meetings: Identifying communication patterns via cluster analysis.

    OpenAIRE

    Lehmann-Willenbrock, N.K.; Beck, S.J.; Kauffeld, S.

    2016-01-01

    Previous team role taxonomies have largely relied on self-report data, focused on functional roles, and described individual predispositions or personality traits. Instead, this study takes a communicative approach and proposes that team roles are produced, shaped, and sustained in communicative behaviors. To identify team roles communicatively, 59 regular organizational meetings were videotaped and analyzed. Cluster analysis revealed five emergent roles: the solution seeker, the problem anal...

  1. Integrated Analysis for Identifying Radix Astragali and Its Adulterants Based on DNA Barcoding

    OpenAIRE

    Sihao Zheng; Dewang Liu; Weiguang Ren; Juan Fu; Linfang Huang; Shilin Chen

    2014-01-01

    Radix Astragali is a popular herb used in traditional Chinese medicine for its proimmune and antidiabetic properties. However, methods are needed to help distinguish Radix Astragali from its varied adulterants. DNA barcoding is a widely applicable molecular method used to identify medicinal plants. Yet, its use has been hampered by genetic distance, base variation, and limitations of the bio-NJ tree. Herein, we report the validation of an integrated analysis method for plant species identific...

  2. Genome-wide meta-analysis identifies new susceptibility loci for migraine

    DEFF Research Database (Denmark)

    Anttila, Verneri; Winsvold, Bendik S; Gormley, Padhraig

    2013-01-01

    Migraine is the most common brain disorder, affecting approximately 14% of the adult population, but its molecular mechanisms are poorly understood. We report the results of a meta-analysis across 29 genome-wide association studies, including a total of 23,285 individuals with migraine (cases......) and 95,425 population-matched controls. We identified 12 loci associated with migraine susceptibility (P

  3. Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models

    OpenAIRE

    Baker Syed; Poskar C; Junker Björn

    2011-01-01

    Abstract In systems biology, experimentally measured parameters are not always available, necessitating the use of computationally based parameter estimation. In order to rely on estimated parameters, it is critical to first determine which parameters can be estimated for a given model and measurement set. This is done with parameter identifiability analysis. A kinetic model of the sucrose accumulation in the sugar cane culm tissue developed by Rohwer et al. was taken as a test case model. Wh...

  4. Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

    Science.gov (United States)

    Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

    2003-07-30

    Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation.

  5. Hot spot analysis applied to identify ecosystem services potential in Lithuania

    Science.gov (United States)

    Pereira, Paulo; Depellegrin, Daniel; Misiune, Ieva

    2016-04-01

    Hot spot analysis are very useful to identify areas with similar characteristics. This is important for a sustainable use of the territory, since we can identify areas that need to be protected, or restored. This is a great advantage in terms of land use planning and management, since we can allocate resources, reduce the economical costs and do a better intervention in the landscape. Ecosystem services (ES) are different according land use. Since landscape is very heterogeneous, it is of major importance understand their spatial pattern and where are located the areas that provide better ES and the others that provide less services. The objective of this work is to use hot-spot analysis to identify areas with the most valuable ES in Lithuania. CORINE land-cover (CLC) of 2006 was used as the main spatial information. This classification uses a grid of 100 m resolution and extracted a total of 31 land use types. ES ranking was carried out based on expert knowledge. They were asked to evaluate the ES potential of each different CLC from 0 (no potential) to 5 (very high potential). Hot spot analysis were evaluated using the Getis-ord test, which identifies cluster analysis available in ArcGIS toolbox. This tool identifies areas with significantly high low values and significant high values at a p level of 0.05. In this work we used hot spot analysis to assess the distribution of providing, regulating cultural and total (sum of the previous 3) ES. The Z value calculated from Getis-ord was used to statistical analysis to access the clusters of providing, regulating cultural and total ES. ES with high Z value show that they have a high number of cluster areas with high potential of ES. The results showed that the Z-score was significantly different among services (Kruskal Wallis ANOVA =834. 607, pcultural (0.080±1.979) and regulating (0.076±1.961). These results suggested that providing services are more clustered than the remaining. Ecosystem Services Z score were

  6. Sephardic signature in haplogroup T mitochondrial DNA

    OpenAIRE

    Bedford, Felice L

    2011-01-01

    A rare combination of mutations within mitochondrial DNA subhaplogroup T2e is identified as affiliated with Sephardic Jews, a group that has received relatively little attention. Four investigations were pursued: Search of the motif in 250 000 control region records across 8 databases, comparison of frequencies of T subhaplogroups (T1, T2b, T2c, T2e, T4, T*) across 11 diverse populations, creation of a phylogenic median-joining network from public T2e control region entries, and analysis of o...

  7. Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis.

    Science.gov (United States)

    Hawkes, Corinna

    2009-07-01

    The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating.

  8. Combination of meta-analysis and graph clustering to identify prognostic markers of ESCC

    Directory of Open Access Journals (Sweden)

    Hongyun Gao

    2012-01-01

    Full Text Available Esophageal squamous cell carcinoma (ESCC is one of the most malignant gastrointestinal cancers and occurs at a high frequency rate in China and other Asian countries. Recently, several molecular markers were identified for predicting ESCC. Notwithstanding, additional prognostic markers, with a clear understanding of their underlying roles, are still required. Through bioinformatics, a graph-clustering method by DPClus was used to detect co-expressed modules. The aim was to identify a set of discriminating genes that could be used for predicting ESCC through graph-clustering and GO-term analysis. The results showed that CXCL12, CYP2C9, TGM3, MAL, S100A9, EMP-1 and SPRR3 were highly associated with ESCC development. In our study, all their predicted roles were in line with previous reports, whereby the assumption that a combination of meta-analysis, graph-clustering and GO-term analysis is effective for both identifying differentially expressed genes, and reflecting on their functions in ESCC.

  9. Combination of meta-analysis and graph clustering to identify prognostic markers of ESCC.

    Science.gov (United States)

    Gao, Hongyun; Wang, Lishan; Cui, Shitao; Wang, Mingsong

    2012-04-01

    Esophageal squamous cell carcinoma (ESCC) is one of the most malignant gastrointestinal cancers and occurs at a high frequency rate in China and other Asian countries. Recently, several molecular markers were identified for predicting ESCC. Notwithstanding, additional prognostic markers, with a clear understanding of their underlying roles, are still required. Through bioinformatics, a graph-clustering method by DPClus was used to detect co-expressed modules. The aim was to identify a set of discriminating genes that could be used for predicting ESCC through graph-clustering and GO-term analysis. The results showed that CXCL12, CYP2C9, TGM3, MAL, S100A9, EMP-1 and SPRR3 were highly associated with ESCC development. In our study, all their predicted roles were in line with previous reports, whereby the assumption that a combination of meta-analysis, graph-clustering and GO-term analysis is effective for both identifying differentially expressed genes, and reflecting on their functions in ESCC.

  10. Data for mitochondrial proteomic alterations in the aging mouse brain

    Directory of Open Access Journals (Sweden)

    Kelly L. Stauch

    2015-09-01

    Full Text Available Mitochondria are dynamic organelles critical for many cellular processes, including energy generation. Thus, mitochondrial dysfunction likely plays a role in the observed alterations in brain glucose metabolism during aging. Despite implications of mitochondrial alterations during brain aging, comprehensive quantitative proteomic studies remain limited. Therefore, to characterize the global age-associated mitochondrial proteomic changes in the brain, we analyzed mitochondria isolated from the brain of 5-, 12-, and 24-month old mice using quantitative mass spectrometry. We identified changes in the expression of proteins important for biological processes involved in the generation of precursor metabolites and energy through the breakdown of carbohydrates, lipids, and proteins. These results are significant because we identified age-associated proteomic changes suggestive of altered mitochondrial catabolic reactions during brain aging. The proteomic data described here can be found in the PRIDE Archive using the reference number PXD001370. A more comprehensive analysis of this data may be obtained from the article “Proteomic analysis and functional characterization of mouse brain mitochondria during aging reveal alterations in energy metabolism” in PROTEOMICS.

  11. The ins and outs of mitochondrial calcium.

    Science.gov (United States)

    Finkel, Toren; Menazza, Sara; Holmström, Kira M; Parks, Randi J; Liu, Julia; Sun, Junhui; Liu, Jie; Pan, Xin; Murphy, Elizabeth

    2015-05-22

    Calcium is thought to play an important role in regulating mitochondrial function. Evidence suggests that an increase in mitochondrial calcium can augment ATP production by altering the activity of calcium-sensitive mitochondrial matrix enzymes. In contrast, the entry of large amounts of mitochondrial calcium in the setting of ischemia-reperfusion injury is thought to be a critical event in triggering cellular necrosis. For many decades, the details of how calcium entered the mitochondria remained a biological mystery. In the past few years, significant progress has been made in identifying the molecular components of the mitochondrial calcium uniporter complex. Here, we review how calcium enters and leaves the mitochondria, the growing insight into the topology, stoichiometry and function of the uniporter complex, and the early lessons learned from some initial mouse models that genetically perturb mitochondrial calcium homeostasis.

  12. Effective Boolean dynamics analysis to identify functionally important genes in large-scale signaling networks.

    Science.gov (United States)

    Trinh, Hung-Cuong; Kwon, Yung-Keun

    2015-11-01

    Efficiently identifying functionally important genes in order to understand the minimal requirements of normal cellular development is challenging. To this end, a variety of structural measures have been proposed and their effectiveness has been investigated in recent literature; however, few studies have shown the effectiveness of dynamics-based measures. This led us to investigate a dynamic measure to identify functionally important genes, and the effectiveness of which was verified through application on two large-scale human signaling networks. We specifically consider Boolean sensitivity-based dynamics against an update-rule perturbation (BSU) as a dynamic measure. Through investigations on two large-scale human signaling networks, we found that genes with relatively high BSU values show slower evolutionary rate and higher proportions of essential genes and drug targets than other genes. Gene-ontology analysis showed clear differences between the former and latter groups of genes. Furthermore, we compare the identification accuracies of essential genes and drug targets via BSU and five well-known structural measures. Although BSU did not always show the best performance, it effectively identified the putative set of genes, which is significantly different from the results obtained via the structural measures. Most interestingly, BSU showed the highest synergy effect in identifying the functionally important genes in conjunction with other measures. Our results imply that Boolean-sensitive dynamics can be used as a measure to effectively identify functionally important genes in signaling networks.

  13. Mitochondrial diseases: advances and issues

    Science.gov (United States)

    Scarpelli, Mauro; Todeschini, Alice; Volonghi, Irene; Padovani, Alessandro; Filosto, Massimiliano

    2017-01-01

    Mitochondrial diseases (MDs) are a clinically heterogeneous group of disorders caused by a dysfunction of the mitochondrial respiratory chain. They can be related to mutation of genes encoded using either nuclear DNA or mitochondrial DNA. The advent of next generation sequencing and whole exome sequencing in studying the molecular bases of MDs will bring about a revolution in the field of mitochondrial medicine, also opening the possibility of better defining pathogenic mechanisms and developing novel therapeutic approaches for these devastating disorders. The canonical rules of mitochondrial medicine remain milestones, but novel issues have been raised following the use of advanced diagnostic technologies. Rigorous validation of the novel mutations detected using deep sequencing in patients with suspected MD, and a clear definition of the natural history, outcome measures, and biomarkers that could be usefully adopted in clinical trials, are mandatory goals for the scientific community. Today, therapy is often inadequate and mostly palliative. However, important advances have been made in treating some clinical entities, eg, mitochondrial neuro-gastrointestinal encephalomyopathy, for which approaches using allogeneic hematopoietic stem cell transplantation, orthotopic liver transplantation, and carrier erythrocyte entrapped thymidine phosphorylase enzyme therapy have recently been developed. Promising new treatment methods are being identified so that researchers, clinicians, and patients can join forces to change the history of these untreatable disorders. PMID:28243136

  14. [Phylogeography of southern Asian Dolly Varden char Salvelinus malma krascheninnikovi: genealogical analysis of mitochondrial DNA].

    Science.gov (United States)

    Oleĭnik, A G; Skurikhina, L A; Chukova, E I

    2010-02-01

    Phylogeography of southern Asian Dolly Varden char was studied using the data on mtDNA variation (regions ND1/ND2, ND5/ND6, and Cytb/D loop) obtained using PCR-RFLP analysis. Analysis of contemporary population genetic structure showed that S. m. krascheninnikovi throughout the whole species range was characterized by high population differentiation in combination with rather small differences between the populations from remote regions. The genealogy of mtDNA haplotypes was reconstructed and nested clade analysis of geographical distances was performed. Geographical distribution of mtDNA haplotypes of S. m. krascheninnikovi was explained by population genetic processes (restricted gene flow), as well as by historical demographic events (range expansion and fragmentation). It was demonstrated that the main demographic events were associated with cyclic processes of the geological formation of the Sea of Japan and adjacent territories. Furthermore, genealogical tree of S. m. krascheninnikovi contained the traces of secondary contact between isolated phylogeographical lineages.

  15. Maternal inheritance of mitochondrial DNA (mtDNA) in the Pacific oyster (Crassostrea gigas): a preliminary study using mtDNA sequence analysis with evidence of random distribution of MitoTracker-stained sperm mitochondria in fertilized eggs.

    Science.gov (United States)

    Obata, Mayu; Shimizu, Michiyo; Sano, Natsumi; Komaru, Akira

    2008-03-01

    In many bivalve species, paternal and maternal mitochondrial DNA (mtDNA) from sperm and eggs is transmitted to the offspring. This phenomenon is known as doubly uniparental inheritance (DUI). In these species, sperm mtDNA (M type) is inherited by the male gonad of the offspring. Egg mtDNA (F type) is inherited by both male and female somatic cells and female gonadal cells. In Mytilidae, sperm mitochondria are distributed in the cytoplasm of differentiating male germ cells because they are transmitted to the male gonad. In the present study, we investigated maternal inheritance of mtDNA in the Pacific oyster, Crassostrea gigas. Sequence analysis of two mitochondrial non-coding regions revealed an identical sequence pattern in the gametes and adductor muscle samples taken from six males and five females. To observe whether sperm mitochondria were specifically located in the cytoplasm of differentiating germ cells, their distribution was recorded in C. gigas fertilized eggs by vital staining with MitoTracker Green. Although the 1D blastomere was identified in the cytoplasm of differentiating germ cells, sperm mitochondria were located at the 1D blastomere in only 32% of eggs during the 8-cell stage. Thus, in C. gigas, sperm mitochondria do not specifically locate in the germ cell region at the 1D blastomere. We suggest that the distribution of sperm mitochondria is not associated with germ cell formation in C. gigas. Furthermore, as evidenced by the mtDNA sequences of two non-coding regions, we conclude that mitochondrial DNA is maternally inherited in this species.

  16. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  17. Morphological, molecular and cross-breeding analysis of geographic populations of coconut-mite associated predatory mites identified as Neoseiulus baraki: evidence for cryptic species?

    Science.gov (United States)

    Famah Sourassou, Nazer; Hanna, Rachid; Zannou, Ignace; Breeuwer, Johannes A J; de Moraes, Gilberto; Sabelis, Maurice W

    2012-05-01

    Surveys were conducted in Brazil, Benin and Tanzania to collect predatory mites as candidates for control of the coconut mite Aceria guerreronis Keifer, a serious pest of coconut fruits. At all locations surveyed, one of the most dominant predators on infested coconut fruits was identified as Neoseiulus baraki Athias-Henriot, based on morphological similarity with regard to taxonomically relevant characters. However, scrutiny of our own and published descriptions suggests that consistent morphological differences may exist between the Benin population and those from the other geographic origins. In this study, we combined three methods to assess whether these populations belong to one species or a few distinct, yet closely related species. First, multivariate analysis of 32 morphological characters showed that the Benin population differed from the other three populations. Second, DNA sequence analysis based on the mitochondrial cytochrome oxidase subunit I (COI) showed the same difference between these populations. Third, cross-breeding between populations was unsuccessful in all combinations. These data provide evidence for the existence of cryptic species. Subsequent morphological research showed that the Benin population can be distinguished from the others by a new character (not included in the multivariate analysis), viz. the number of teeth on the fixed digit of the female chelicera.

  18. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    Institute of Scientific and Technical Information of China (English)

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  19. Mitochondrial DNA STR analysis as a tool for studying the green sea turtle (Chelonia mydas) populations: the Mediterranean Sea case study.

    Science.gov (United States)

    Tikochinski, Y; Bendelac, R; Barash, A; Daya, A; Levy, Y; Friedmann, A

    2012-06-01

    The Mediterranean population of the green sea turtle Chelonia mydas is critically endangered. Genetic analysis of this population using the ordinary haplotyping system, based on sequence analysis of a segment of the mitochondrial DNA (mtDNA) D-loop (control region), revealed very little variation. The most common haplotype, CM-A13, was observed in all but three individuals in hundreds of samples in previous studies. In search for a more informative marker we sequenced the 3' of the mitochondrial control region which contains an AT-rich microsatellite. We found a unique pattern that consists of four AT short tandem repeats (STRs) with varying copy numbers. This allowed us to construct a new haplotyping system composed of four different STR sizes for each mtDNA sequence. Our new mitochondrial STR (mtSTR) haplotyping approach revealed 33 different haplotypes within the nesting and stranded sea turtles along the Mediterranean Israeli seashore. The Israeli coast nesting females had 10 different haplotypes that can be used for monitoring and conservation purposes. The mtSTR haplotyping system can clearly assist in fingerprinting of individual turtles. Moreover, it can be used for estimating phylogenetic distances within populations. This case study shows that the mtSTR haplotyping is applicable for the study of global green sea turtle populations and could also be considered as markers of genetic variability in other species.

  20. Real-time and high-throughput analysis of mitochondrial metabolic states in living cells using genetically encoded NAD(+)/NADH sensors.

    Science.gov (United States)

    Zhao, Yuzheng; Yang, Yi

    2016-11-01

    Mitochondria are central organelles that regulate cellular bioenergetics, biosynthesis, and signaling processes. NADH, a key player in cell metabolism, is often considered as a marker of mitochondrial function. However, traditional methods for NADH measurements are either destructive or unable to distinguish between NADH and NADPH. In contrast to traditional methods, genetically encoded NADH sensors can be used for the real-time tracking and quantitative measurement of subcellular NADH levels in living cells. Therefore, these sensors provide innovative tools and address the limitations of current techniques. We herein summarize the properties of different types of recently developed NADH biosensors, discuss their advantages and disadvantages, and focus on the high-throughput analysis of mitochondrial function by using highly responsive NAD(+)/NADH sensors.

  1. The mitochondrial genome of the fission yeast Schizosaccharomyces pombe : 5. Characterization of mitochondrial deletion mutants.

    Science.gov (United States)

    Ahne, F; Merlos-Lange, A M; Lang, B F; Wolf, K

    1984-09-01

    The three mutator strains ana (r)-8, ana (r)-14, and diu (r)-301 were shown to produce respiratory deficient mutants at different rates. The frequency of respiratory deficient mutants in a culture could be increased by adding ethidium bromide. According to their cytochrome spectra and enzymatic activities they form three classes, namely mutants defective in cytochrome oxidase, in cytochrome b, and in both cytochromes. By restriction enzyme analysis of mitochondrial DNA from about 100 mutants, 22 deletion mutants were identified. The deletions, ranging from 50 to 1,500 base pairs were physically mapped. Deletions were localized in the genes coding for subunit 1 of cytochrome oxidase with its two introns, within the cytochrome b gene and its intron, and within the genes for subunits 2 and 3 of cytochrome oxidase. In several cases, where the physical mapping yielded ambiguous results, pairwise genetic crosses ruled out an overlap between two neighbouring deletions.Using these mitochondrial deletion mutants as tester strains, it was shown that only tetrad analysis and chemical haploidization, but not mitotic segregation analysis, allows a decision between chromosomal and mitochondrial inheritance of respiratory deficiency in Schizosaccharomyces pombe.

  2. Identifying key parameters to differentiate groundwater flow systems using multifactorial analysis

    Science.gov (United States)

    Menció, Anna; Folch, Albert; Mas-Pla, Josep

    2012-11-01

    SummaryMultivariate techniques are useful in hydrogeological studies to reduce the complexity of large-scale data sets, and provide more understandable insight into the system hydrology. In this study, principal component analysis (PCA) has been used as an exploratory method to identify the key parameters that define distinct flow systems in the Selva basin (NE Spain). In this statistical analysis, all the information obtained in hydrogeological studies (that is, hydrochemical and isotopic data, but also potentiometric data) is used. Additionally, cluster analysis, based on PCA results, allows the associations between samples to be identified, and thus, corroborates the occurrence of different groundwater fluxes. PCA and cluster analysis reveal that two main groundwater flow systems exist in the Selva basin, each with distinct hydrochemical, isotopic, and potentiometric features. Regional groundwater fluxes are associated with high F- contents, and confined aquifer layers; while local fluxes are linked to nitrate polluted unconfined aquifers with a different recharge rates. In agreement with previous hydrogeological studies, these statistical methods stand as valid screening tools to highlight the fingerprint variables that can be used as indicators to facilitate further, more arduous, analytical approaches and a feasible interpretation of the whole data set.

  3. Efficient behavior of photosynthetic organelles via Pareto optimality, identifiability, and sensitivity analysis.

    Science.gov (United States)

    Carapezza, Giovanni; Umeton, Renato; Costanza, Jole; Angione, Claudio; Stracquadanio, Giovanni; Papini, Alessio; Lió, Pietro; Nicosia, Giuseppe

    2013-05-17

    In this work, we develop methodologies for analyzing and cross comparing metabolic models. We investigate three important metabolic networks to discuss the complexity of biological organization of organisms, modeling, and system properties. In particular, we analyze these metabolic networks because of their biotechnological and basic science importance: the photosynthetic carbon metabolism in a general leaf, the Rhodobacter spheroides bacterium, and the Chlamydomonas reinhardtii alga. We adopt single- and multi-objective optimization algorithms to maximize the CO 2 uptake rate and the production of metabolites of industrial interest or for ecological purposes. We focus both on the level of genes (e.g., finding genetic manipulations to increase the production of one or more metabolites) and on finding concentration enzymes for improving the CO 2 consumption. We find that R. spheroides is able to absorb an amount of CO 2 until 57.452 mmol h (-1) gDW (-1) , while C. reinhardtii obtains a maximum of 6.7331. We report that the Pareto front analysis proves extremely useful to compare different organisms, as well as providing the possibility to investigate them with the same framework. By using the sensitivity and robustness analysis, our framework identifies the most sensitive and fragile components of the biological systems we take into account, allowing us to compare their models. We adopt the identifiability analysis to detect functional relations among enzymes; we observe that RuBisCO, GAPDH, and FBPase belong to the same functional group, as suggested also by the sensitivity analysis.

  4. Gene expression signature analysis identifies vorinostat as a candidate therapy for gastric cancer.

    Directory of Open Access Journals (Sweden)

    Sofie Claerhout

    Full Text Available BACKGROUND: Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future. METHODOLOGY/PRINCIPAL FINDINGS: Using microarray technology, we generated a gene expression profile of human gastric cancer-specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern. CONCLUSIONS/SIGNIFICANCE: We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment.

  5. Data showing the compositional complexity of the mitochondrial proteome of a unicellular eukaryote (Acanthamoeba castellanii, supergroup Amoebozoa

    Directory of Open Access Journals (Sweden)

    Ryan M.R. Gawryluk

    2014-12-01

    Full Text Available This article describes and directly links to 1033 Acanthamoeba castellanii mitochondrial protein sequences. Of these, 709 are supported by Mass Spectrometry (MS data (676 nucleus-encoded and 33 mitochondrion-encoded. Two of these entries are previously unannotated mtDNA-encoded proteins, which we identify as highly divergent mitochondrial ribosomal proteins. Our analysis corrects many A. castellanii protein sequences that were incorrectly inferred previously from genomic data deposited in NCBI.

  6. Identifying training deficiencies in military pilots by applying the human factors analysis and classification system.

    Science.gov (United States)

    Li, Wen-Chin; Harris, Don

    2013-01-01

    Without accurate analysis, it is difficult to identify training needs and develop the content of training programs required for preventing aviation accidents. The human factors analysis and classification system (HFACS) is based on Reason's system-wide model of human error. In this study, 523 accidents from the Republic of China Air Force were analyzed in which 1762 human errors were categorized. The results of the analysis showed that errors of judgment and poor decision-making were commonly reported amongst pilots. As a result, it was concluded that there was a need for military pilots to be trained specifically in making decisions in tactical environments. However, application of HFACS also allowed the identification of systemic training deficiencies within the organization further contributing to the accidents observed.

  7. The Pseudouridine Synthase RPUSD4 Is an Essential Component of Mitochondrial RNA Granules*

    Science.gov (United States)

    Zaganelli, Sofia; Rebelo-Guiomar, Pedro; Maundrell, Kinsey; Rozanska, Agata; Pierredon, Sandra; Powell, Christopher A.; Martinou, Jean-Claude

    2017-01-01

    Mitochondrial gene expression is a fundamental process that is largely dependent on nuclear-encoded proteins. Several steps of mitochondrial RNA processing and maturation, including RNA post-transcriptional modification, appear to be spatially organized into distinct foci, which we have previously termed mitochondrial RNA granules (MRGs). Although an increasing number of proteins have been localized to MRGs, a comprehensive analysis of the proteome of these structures is still lacking. Here, we have applied a microscopy-based approach that has allowed us to identify novel components of the MRG proteome. Among these, we have focused our attention on RPUSD4, an uncharacterized mitochondrial putative pseudouridine synthase. We show that RPUSD4 depletion leads to a severe reduction of the steady-state level of the 16S mitochondrial (mt) rRNA with defects in the biogenesis of the mitoribosome large subunit and consequently in mitochondrial translation. We report that RPUSD4 binds 16S mt-rRNA, mt-tRNAMet, and mt-tRNAPhe, and we demonstrate that it is responsible for pseudouridylation of the latter. These data provide new insights into the relevance of RNA pseudouridylation in mitochondrial gene expression. PMID:28082677

  8. Evidence for Amino Acid Snorkeling from a High-Resolution, In Vivo Analysis of Fis1 Tail-Anchor Insertion at the Mitochondrial Outer Membrane.

    Science.gov (United States)

    Keskin, Abdurrahman; Akdoğan, Emel; Dunn, Cory D

    2017-02-01

    Proteins localized to mitochondria by a carboxyl-terminal tail anchor (TA) play roles in apoptosis, mitochondrial dynamics, and mitochondrial protein import. To reveal characteristics of TAs that may be important for mitochondrial targeting, we focused our attention upon the TA of the Saccharomyces cerevisiae Fis1 protein. Specifically, we generated a library of Fis1p TA variants fused to the Gal4 transcription factor, then, using next-generation sequencing, revealed which Fis1p TA mutations inhibited membrane insertion and allowed Gal4p activity in the nucleus. Prompted by our global analysis, we subsequently analyzed the ability of individual Fis1p TA mutants to localize to mitochondria. Our findings suggest that the membrane-associated domain of the Fis1p TA may be bipartite in nature, and we encountered evidence that the positively charged patch at the carboxyl terminus of Fis1p is required for both membrane insertion and organelle specificity. Furthermore, lengthening or shortening of the Fis1p TA by up to three amino acids did not inhibit mitochondrial targeting, arguing against a model in which TA length directs insertion of TAs to distinct organelles. Most importantly, positively charged residues were more acceptable at several positions within the membrane-associated domain of the Fis1p TA than negatively charged residues. These findings, emerging from the first high-resolution analysis of an organelle targeting sequence by deep mutational scanning, provide strong, in vivo evidence that lysine and arginine can "snorkel," or become stably incorporated within a lipid bilayer by placing terminal charges of their side chains at the membrane interface.

  9. Mammalian mitochondrial intermediate peptidase: Structure/function analysis of a new homologue from Schizophyllum commune and relationship to thimet oligopeptidases

    Energy Technology Data Exchange (ETDEWEB)

    Isaya, G.; Sakati, W.R.; Rollins, R.A. [Yale Univ. School of Medicine, New Haven, CT (United States)] [and others

    1995-08-10

    Mitochondrial intermediate peptidase (MIP) is a component of the mitochondrial protein import machinery required for maturation of nuclear-encoded precursor proteins targeted to the mitochondrial matrix or inner membrane. We previously characterized this enzyme in rat (RMIP) and Saccharomyces cerevisiae (YMIP) and showed that MIP activity is essential for mitochondrial function in yeast. We have now defined the structure of a new MIP homologue (SMIP) from the basidiomycete fungus Schizophyllum commune. SMIP includes 4 exons of 523, 486, 660, and 629 bp separated by 3 short introns. The predicted SMIP, YMIP, and RMIP sequences share 31-37% identity and 54-57% similarity over 700 amino acids. When SMIP and RMIP were expressed in a yeast mip1{Delta} mutant, they were both able to rescue the respiratory-deficient phenotype caused by genetic inactivation of YMIP, indicating that the function of this enzyme is conserved in eukaryotes. Moreover, the MIP sequences show 20-24% identity and 40-47% similarity to a family of oligopeptidases from bacteria, yeast, and mammals. MIP and these proteins are characterized by a highly conserved motif, F-H-E-X-G-H-(X){sub 12}-G-(X){sub 5}-D-(X){sub 2}-E-X-P-S-(X){sub 3}-E-X, centered around a zinc-binding site and appear to represent a new family of genes associated with proteolytic processing in the mitochondrial and cytosolic compartments. 48 refs., 8 figs.

  10. Mammalian mitochondrial intermediate peptidase: structure/function analysis of a new homologue from Schizophyllum commune and relationship to thimet oligopeptidases.

    Science.gov (United States)

    Isaya, G; Sakati, W R; Rollins, R A; Shen, G P; Hanson, L C; Ullrich, R C; Novotny, C P

    1995-08-10

    Mitochondrial intermediate peptidase (MIP) is a component of the mitochondrial protein import machinery required for maturation of nuclear-encoded precursor proteins targeted to the mitochondrial matrix or inner membrane. We previously characterized this enzyme in rat (RMIP) and Saccharomyces cerevisiae (YMIP) and showed that MIP activity is essential for mitochondrial function in yeast. We have now defined the structure of a new MIP homologue (SMIP) from the basidiomycete fungus Schizophyllum commune. SMIP includes 4 exons of 523, 486, 660, and 629 bp separated by 3 short introns. The predicted SMIP, YMIP, and RMIP sequences share 31-37% identity and 54-57% similarity over 700 amino acids. When SMIP and RMIP were expressed in a yeast mip1 delta mutant, they were both able to rescue the respiratory-deficient phenotype caused by genetic inactivation of YMIP, indicating that the function of this enzyme is conserved in eukaryotes. Moreover, the MIP sequences show 20-24% identity and 40-47% similarity to a family of oligopeptidases from bacteria, yeast, and mammals. MIP and these proteins are characterized by a highly conserved motif, F-H-E-X-G-H-(X)2-H-(X)12-G-(X)5-D-(X)2-E-X-P-S-(X)3-E-X, centered around a zinc-binding site and appear to represent a new family of genes associated with proteolytic processing in the mitochondrial and cytosolic compartments.

  11. A Comprehensive Gene Expression Meta-analysis Identifies Novel Immune Signatures in Rheumatoid Arthritis Patients

    Science.gov (United States)

    Afroz, Sumbul; Giddaluru, Jeevan; Vishwakarma, Sandeep; Naz, Saima; Khan, Aleem Ahmed; Khan, Nooruddin

    2017-01-01

    Rheumatoid arthritis (RA), a symmetric polyarticular arthritis, has long been feared as one of the most disabling forms of arthritis. Identification of gene signatures associated with RA onset and progression would lead toward development of novel diagnostics and therapeutic interventions. This study was undertaken to identify unique gene signatures of RA patients through large-scale meta-profiling of a diverse collection of gene expression data sets. We carried out a meta-analysis of 8 publicly available RA patients’ (107 RA patients and 76 healthy controls) gene expression data sets and further validated a few meta-signatures in RA patients through quantitative real-time PCR (RT-qPCR). We identified a robust meta-profile comprising 33 differentially expressed genes, which were consistently and significantly expressed across all the data sets. Our meta-analysis unearthed upregulation of a few novel gene signatures including PLCG2, HLA-DOB, HLA-F, EIF4E2, and CYFIP2, which were validated in peripheral blood mononuclear cell samples of RA patients. Further, functional and pathway enrichment analysis reveals perturbation of several meta-genes involved in signaling pathways pertaining to inflammation, antigen presentation, hypoxia, and apoptosis during RA. Additionally, PLCG2 (phospholipase Cγ2) popped out as a novel meta-gene involved in most of the pathways relevant to RA including inflammasome activation, platelet aggregation, and activation, thereby suggesting PLCG2 as a potential therapeutic target for controlling excessive inflammation during RA. In conclusion, these findings highlight the utility of meta-analysis approach in identifying novel gene signatures that might provide mechanistic insights into disease onset, progression and possibly lead toward the development of better diagnostic and therapeutic interventions against RA. PMID:28210261

  12. A Comprehensive Gene Expression Meta-analysis Identifies Novel Immune Signatures in Rheumatoid Arthritis Patients.

    Science.gov (United States)

    Afroz, Sumbul; Giddaluru, Jeevan; Vishwakarma, Sandeep; Naz, Saima; Khan, Aleem Ahmed; Khan, Nooruddin

    2017-01-01

    Rheumatoid arthritis (RA), a symmetric polyarticular arthritis, has long been feared as one of the most disabling forms of arthritis. Identification of gene signatures associated with RA onset and progression would lead toward development of novel diagnostics and therapeutic interventions. This study was undertaken to identify unique gene signatures of RA patients through large-scale meta-profiling of a diverse collection of gene expression data sets. We carried out a meta-analysis of 8 publicly available RA patients' (107 RA patients and 76 healthy controls) gene expression data sets and further validated a few meta-signatures in RA patients through quantitative real-time PCR (RT-qPCR). We identified a robust meta-profile comprising 33 differentially expressed genes, which were consistently and significantly expressed across all the data sets. Our meta-analysis unearthed upregulation of a few novel gene signatures including PLCG2, HLA-DOB, HLA-F, EIF4E2, and CYFIP2, which were validated in peripheral blood mononuclear cell samples of RA patients. Further, functional and pathway enrichment analysis reveals perturbation of several meta-genes involved in signaling pathways pertaining to inflammation, antigen presentation, hypoxia, and apoptosis during RA. Additionally, PLCG2 (phospholipase Cγ2) popped out as a novel meta-gene involved in most of the pathways relevant to RA including inflammasome activation, platelet aggregation, and activation, thereby suggesting PLCG2 as a potential therapeutic target for controlling excessive inflammation during RA. In conclusion, these findings highlight the utility of meta-analysis approach in identifying novel gene signatures that might provide mechanistic insights into disease onset, progression and possibly lead toward the development of better diagnostic and therapeutic interventions against RA.

  13. Mitochondrial DNA analysis of human remains from the Yuansha site in Xinjiang, China

    Institute of Scientific and Technical Information of China (English)

    Idelisi; ABUDURESULE; Victor; H.; MAIR

    2008-01-01

    The Yuansha site is located in the center of the Taklimakan Desert of Xinjiang, in the southern Silk Road region. MtDNA was extracted from fifteen human remains excavated from the Yuansha site, dating back 2,000―2,500 years. Analysis of the phylogenetic tree and the multidimensional scaling (MDS) reveals that the Yuansha population has relatively close relationships with the modern populations of South Central Asia and Indus Valley, as well as with the ancient population of Chawuhu.

  14. Shortest-path network analysis is a useful approach toward identifying genetic determinants of longevity.

    Directory of Open Access Journals (Sweden)

    J R Managbanag

    Full Text Available BACKGROUND: Identification of genes that modulate longevity is a major focus of aging-related research and an area of intense public interest. In addition to facilitating an improved understanding of the basic mechanisms of aging, such genes represent potential targets for therapeutic intervention in multiple age-associated diseases, including cancer, heart disease, diabetes, and neurodegenerative disorders. To date, however, targeted efforts at identifying longevity-associated genes have been limited by a lack of predictive power, and useful algorithms for candidate gene-identification have also been lacking. METHODOLOGY/PRINCIPAL FINDINGS: We have utilized a shortest-path network analysis to identify novel genes that modulate longevity in Saccharomyces cerevisiae. Based on a set of previously reported genes associated with increased life span, we applied a shortest-path network algorithm to a pre-existing protein-protein interaction dataset in order to construct a shortest-path longevity network. To validate this network, the replicative aging potential of 88 single-gene deletion strains corresponding to predicted components of the shortest-path longevity network was determined. Here we report that the single-gene deletion strains identified by our shortest-path longevity analysis are significantly enriched for mutations conferring either increased or decreased replicative life span, relative to a randomly selected set of 564 single-gene deletion strains or to the current data set available for the entire haploid deletion collection. Further, we report the identification of previously unknown longevity genes, several of which function in a conserved longevity pathway believed to mediate life span extension in response to dietary restriction. CONCLUSIONS/SIGNIFICANCE: This work demonstrates that shortest-path network analysis is a useful approach toward identifying genetic determinants of longevity and represents the first application of

  15. Integrated Analysis for Identifying Radix Astragali and Its Adulterants Based on DNA Barcoding

    Directory of Open Access Journals (Sweden)

    Sihao Zheng

    2014-01-01

    Full Text Available Radix Astragali is a popular herb used in traditional Chinese medicine for its proimmune and antidiabetic properties. However, methods are needed to help distinguish Radix Astragali from its varied adulterants. DNA barcoding is a widely applicable molecular method used to identify medicinal plants. Yet, its use has been hampered by genetic distance, base variation, and limitations of the bio-NJ tree. Herein, we report the validation of an integrated analysis method for plant species identification using DNA barcoding that focuses on genetic distance, identification efficiency, inter- and intraspecific variation, and barcoding gap. We collected 478 sequences from six candidate DNA barcodes (ITS2, ITS, psbA-trnH, rbcL, matK, and COI from 29 species of Radix Astragali and adulterants. The internal transcribed spacer (ITS sequence was demonstrated as the optimal barcode for identifying Radix Astragali and its adulterants. This new analysis method is helpful in identifying Radix Astragali and expedites the utilization and data mining of DNA barcoding.

  16. Messina: a novel analysis tool to identify biologically relevant molecules in disease.

    Directory of Open Access Journals (Sweden)

    Mark Pinese

    Full Text Available BACKGROUND: Morphologically similar cancers display heterogeneous patterns of molecular aberrations and follow substantially different clinical courses. This diversity has become the basis for the definition of molecular phenotypes, with significant implications for therapy. Microarray or proteomic expression profiling is conventionally employed to identify disease-associated genes, however, traditional approaches for the analysis of profiling experiments may miss molecular aberrations which define biologically relevant subtypes. METHODOLOGY/PRINCIPAL FINDINGS: Here we present Messina, a method that can identify those genes that only sometimes show aberrant expression in cancer. We demonstrate with simulated data that Messina is highly sensitive and specific when used to identify genes which are aberrantly expressed in only a proportion of cancers, and compare Messina to contemporary analysis techniques. We illustrate Messina by using it to detect the aberrant expression of a gene that may play an important role in pancreatic cancer. CONCLUSIONS/SIGNIFICANCE: Messina allows the detection of genes with profiles typical of markers of molecular subtype, and complements existing methods to assist the identification of such markers. Messina is applicable to any global expression profiling data, and to allow its easy application has been packaged into a freely-available stand-alone software package.

  17. Design Analysis Rules to Identify Proper Noun from Bengali Sentence for Universal Networking language

    Directory of Open Access Journals (Sweden)

    Md. Syeful Islam

    2014-08-01

    Full Text Available Now-a-days hundreds of millions of people of almost all levels of education and attitudes from different country communicate with each other for different purposes and perform their jobs on internet or other communication medium using various languages. Not all people know all language; therefore it is very difficult to communicate or works on various languages. In this situation the computer scientist introduce various inter language translation program (Machine translation. UNL is such kind of inter language translation program. One of the major problem of UNL is identified a name from a sentence, which is relatively simple in English language, because such entities start with a capital letter. In Bangla we do not have concept of small or capital letters. Thus we find difficulties in understanding whether a word is a proper noun or not. Here we have proposed analysis rules to identify proper noun from a sentence and established post converter which translate the name entity from Bangla to UNL. The goal is to make possible Bangla sentence conversion to UNL and vice versa. UNL system prove that the theoretical analysis of our proposed system able to identify proper noun from Bangla sentence and produce relative Universal word for UNL.

  18. Mitochondrial DNA Alterations and Reduced Mitochondrial Function in Aging

    OpenAIRE

    Hebert, Sadie L.; Lanza, Ian R.; Nair, K. Sreekumaran

    2010-01-01

    Oxidative damage to mitochondrial DNA increases with aging. This damage has the potential to affect mitochondrial DNA replication and transcription which could alter the abundance or functionality of mitochondrial proteins. This review describes mitochondrial DNA alterations and changes in mitochondrial function that occur with aging. Age-related alterations in mitochondrial DNA as a possible contributor to the reduction in mitochondrial function are discussed.

  19. A meta-analysis of 120 246 individuals identifies 18 new loci for fibrinogen concentration.

    Science.gov (United States)

    de Vries, Paul S; Chasman, Daniel I; Sabater-Lleal, Maria; Chen, Ming-Huei; Huffman, Jennifer E; Steri, Maristella; Tang, Weihong; Teumer, Alexander; Marioni, Riccardo E; Grossmann, Vera; Hottenga, Jouke J; Trompet, Stella; Müller-Nurasyid, Martina; Zhao, Jing Hua; Brody, Jennifer A; Kleber, Marcus E; Guo, Xiuqing; Wang, Jie Jin; Auer, Paul L; Attia, John R; Yanek, Lisa R; Ahluwalia, Tarunveer S; Lahti, Jari; Venturini, Cristina; Tanaka, Toshiko; Bielak, Lawrence F; Joshi, Peter K; Rocanin-Arjo, Ares; Kolcic, Ivana; Navarro, Pau; Rose, Lynda M; Oldmeadow, Christopher; Riess, Helene; Mazur, Johanna; Basu, Saonli; Goel, Anuj; Yang, Qiong; Ghanbari, Mohsen; Willemsen, Gonneke; Rumley, Ann; Fiorillo, Edoardo; de Craen, Anton J M; Grotevendt, Anne; Scott, Robert; Taylor, Kent D; Delgado, Graciela E; Yao, Jie; Kifley, Annette; Kooperberg, Charles; Qayyum, Rehan; Lopez, Lorna M; Berentzen, Tina L; Räikkönen, Katri; Mangino, Massimo; Bandinelli, Stefania; Peyser, Patricia A; Wild, Sarah; Trégouët, David-Alexandre; Wright, Alan F; Marten, Jonathan; Zemunik, Tatijana; Morrison, Alanna C; Sennblad, Bengt; Tofler, Geoffrey; de Maat, Moniek P M; de Geus, Eco J C; Lowe, Gordon D; Zoledziewska, Magdalena; Sattar, Naveed; Binder, Harald; Völker, Uwe; Waldenberger, Melanie; Khaw, Kay-Tee; Mcknight, Barbara; Huang, Jie; Jenny, Nancy S; Holliday, Elizabeth G; Qi, Lihong; Mcevoy, Mark G; Becker, Diane M; Starr, John M; Sarin, Antti-Pekka; Hysi, Pirro G; Hernandez, Dena G; Jhun, Min A; Campbell, Harry; Hamsten, Anders; Rivadeneira, Fernando; Mcardle, Wendy L; Slagboom, P Eline; Zeller, Tanja; Koenig, Wolfgang; Psaty, Bruce M; Haritunians, Talin; Liu, Jingmin; Palotie, Aarno; Uitterlinden, André G; Stott, David J; Hofman, Albert; Franco, Oscar H; Polasek, Ozren; Rudan, Igor; Morange, Pierre-Emmanuel; Wilson, James F; Kardia, Sharon L R; Ferrucci, Luigi; Spector, Tim D; Eriksson, Johan G; Hansen, Torben; Deary, Ian J; Becker, Lewis C; Scott, Rodney J; Mitchell, Paul; März, Winfried; Wareham, Nick J; Peters, Annette; Greinacher, Andreas; Wild, Philipp S; Jukema, J Wouter; Boomsma, Dorret I; Hayward, Caroline; Cucca, Francesco; Tracy, Russell; Watkins, Hugh; Reiner, Alex P; Folsom, Aaron R; Ridker, Paul M; O'Donnell, Christopher J; Smith, Nicholas L; Strachan, David P; Dehghan, Abbas

    2016-01-15

    Genome-wide association studies have previously identified 23 genetic loci associated with circulating fibrinogen concentration. These studies used HapMap imputation and did not examine the X-chromosome. 1000 Genomes imputation provides better coverage of uncommon variants, and includes indels. We conducted a genome-wide association analysis of 34 studies imputed to the 1000 Genomes Project reference panel and including ∼120 000 participants of European ancestry (95 806 participants with data on the X-chromosome). Approximately 10.7 million single-nucleotide polymorphisms and 1.2 million indels were examined. We identified 41 genome-wide significant fibrinogen loci; of which, 18 were newly identified. There were no genome-wide significant signals on the X-chromosome. The lead variants of five significant loci were indels. We further identified six additional independent signals, including three rare variants, at two previously characterized loci: FGB and IRF1. Together the 41 loci explain 3% of the variance in plasma fibrinogen concentration.

  20. The systematic functional analysis of plasmodium protein kinases identifies essential regulators of mosquito transmission

    KAUST Repository

    Tewari, Rita

    2010-10-21

    Although eukaryotic protein kinases (ePKs) contribute to many cellular processes, only three Plasmodium falciparum ePKs have thus far been identified as essential for parasite asexual blood stage development. To identify pathways essential for parasite transmission between their mammalian host and mosquito vector, we undertook a systematic functional analysis of ePKs in the genetically tractable rodent parasite Plasmodium berghei. Modeling domain signatures of conventional ePKs identified 66 putative Plasmodium ePKs. Kinomes are highly conserved between Plasmodium species. Using reverse genetics, we show that 23 ePKs are redundant for asexual erythrocytic parasite development in mice. Phenotyping mutants at four life cycle stages in Anopheles stephensi mosquitoes revealed functional clusters of kinases required for sexual development and sporogony. Roles for a putative SR protein kinase (SRPK) in microgamete formation, a conserved regulator of clathrin uncoating (GAK) in ookinete formation, and a likely regulator of energy metabolism (SNF1/KIN) in sporozoite development were identified. 2010 Elsevier Inc.

  1. A study on using texture analysis methods for identifying lobar fissure regions in isotropic CT images.

    Science.gov (United States)

    Wei, Q; Hu, Y

    2009-01-01

    The major hurdle for segmenting lung lobes in computed tomographic (CT) images is to identify fissure regions, which encase lobar fissures. Accurate identification of these regions is difficult due to the variable shape and appearance of the fissures, along with the low contrast and high noise associated with CT images. This paper studies the effectiveness of two texture analysis methods - the gray level co-occurrence matrix (GLCM) and the gray level run length matrix (GLRLM) - in identifying fissure regions from isotropic CT image stacks. To classify GLCM and GLRLM texture features, we applied a feed-forward back-propagation neural network and achieved the best classification accuracy utilizing 16 quantized levels for computing the GLCM and GLRLM texture features and 64 neurons in the input/hidden layers of the neural network. Tested on isotropic CT image stacks of 24 patients with the pathologic lungs, we obtained accuracies of 86% and 87% for identifying fissure regions using the GLCM and GLRLM methods, respectively. These accuracies compare favorably with surgeons/radiologists' accuracy of 80% for identifying fissure regions in clinical settings. This shows promising potential for segmenting lung lobes using the GLCM and GLRLM methods.

  2. Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models

    Directory of Open Access Journals (Sweden)

    Baker Syed

    2011-01-01

    Full Text Available Abstract In systems biology, experimentally measured parameters are not always available, necessitating the use of computationally based parameter estimation. In order to rely on estimated parameters, it is critical to first determine which parameters can be estimated for a given model and measurement set. This is done with parameter identifiability analysis. A kinetic model of the sucrose accumulation in the sugar cane culm tissue developed by Rohwer et al. was taken as a test case model. What differentiates this approach is the integration of an orthogonal-based local identifiability method into the unscented Kalman filter (UKF, rather than using the more common observability-based method which has inherent limitations. It also introduces a variable step size based on the system uncertainty of the UKF during the sensitivity calculation. This method identified 10 out of 12 parameters as identifiable. These ten parameters were estimated using the UKF, which was run 97 times. Throughout the repetitions the UKF proved to be more consistent than the estimation algorithms used for comparison.

  3. Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models.

    Science.gov (United States)

    Baker, Syed Murtuza; Poskar, C Hart; Junker, Björn H

    2011-10-11

    In systems biology, experimentally measured parameters are not always available, necessitating the use of computationally based parameter estimation. In order to rely on estimated parameters, it is critical to first determine which parameters can be estimated for a given model and measurement set. This is done with parameter identifiability analysis. A kinetic model of the sucrose accumulation in the sugar cane culm tissue developed by Rohwer et al. was taken as a test case model. What differentiates this approach is the integration of an orthogonal-based local identifiability method into the unscented Kalman filter (UKF), rather than using the more common observability-based method which has inherent limitations. It also introduces a variable step size based on the system uncertainty of the UKF during the sensitivity calculation. This method identified 10 out of 12 parameters as identifiable. These ten parameters were estimated using the UKF, which was run 97 times. Throughout the repetitions the UKF proved to be more consistent than the estimation algorithms used for comparison.

  4. ANÁLISIS COMPARATIVO DEL GENOMA MITOCONDRIAL EN GASTRÓPODOS Comparative Analysis of the Mitochondrial Genomes in Gastropods

    Directory of Open Access Journals (Sweden)

    MOISES ARQUEZ

    2012-05-01

    Full Text Available En este trabajo presentamos un análisis comparativo de los genomas mitocondriales en gastrópodos. Se calculó la composición de nucleótidos y de aminoácidos de todas las secuencias y se hizo un análisis visual comparativo de los codones de inicio y de parada. La organización del genoma se comparó calculando el número de secuencias intergénicas, la ubicación de los genes y el número de reorganizaciones génicas (breakpoints en comparación con la secuencia que se presume ancestral para el grupo. Para calcular si existen variaciones en las tasas de evolución molecular en el grupo, estas últimas se calcularon utilizando el relative rate test. A pesar de las diferencias en el tamaño de los genomas, el número de aminoácidos es más conservado. La composicion nucleotídica y aminoacídica es similar entre los Vetigastropoda, Ceanogastropoda y Neritimorpha en comparacion con Heterobranchia y Patellogastropoda. Los genomas mitocondriales para el grupo son muy compactos con pocas secuencias intergenicas, la unica excepción es el genoma de Patellogastropoda con 26.828 pb. Existe una alta variabilidad en cuanto a codones de inicio para los grupos Heterobranchia y Patellogastropoda y un aumento en el número de genes reorganizados con respecto a la secuencia de O. vulgaris también para estos dos grupos. En general, se rechaza la hipótesis de tasas de evolución molecular constante entre los grupos, excepto cuando se comparan los genomas de Caenogastropoda y Vetigastropoda.In this work we presented a comparative analysis of the mitochondrial genomes in gastropods. Nucleotide and amino acids composition was calculated and a comparative visual analysis of the start and termination codons was performed. The organization of the genome was compared calculating the number of intergenic sequences, the location of the genes and the number of reorganized genes (breakpoints in comparison with the sequence that is presumed to be ancestral for the

  5. Practical In-Depth Analysis of IDS Alerts for Tracing and Identifying Potential Attackers on Darknet

    Directory of Open Access Journals (Sweden)

    Jungsuk Song

    2017-02-01

    Full Text Available The darknet (i.e., a set of unused IP addresses is a very useful solution for observing the global trends of cyber threats and analyzing attack activities on the Internet. Since the darknet is not connected with real systems, in most cases, the incoming packets on the darknet (‘the darknet traffic’ do not contain a payload. This means that we are unable to get real malware from the darknet traffic. This situation makes it difficult for security experts (e.g., academic researchers, engineers, operators, etc. to identify whether the source hosts of the darknet traffic are infected by real malware or not. In this paper, we present the overall procedure of the in-depth analysis between the darknet traffic and IDS alerts using real data collected at the Science and Technology Cyber Security Center (S&T CSC in Korea and provide the detailed in-depth analysis results. The ultimate goal of this paper is to provide practical experience, insight and know-how to security experts so that they are able to identify and trace the root cause of the darknet traffic. The experimental results show that correlation analysis between the darknet traffic and IDS alerts is very useful to discover potential attack hosts, especially internal hosts, and to find out what kinds of malware infected them.

  6. Comparative proteomic analysis of horseweed (Conyza canadensis) biotypes identifies candidate proteins for glyphosate resistance

    Science.gov (United States)

    González-Torralva, Fidel; Brown, Adrian P.; Chivasa, Stephen

    2017-01-01

    Emergence of glyphosate-resistant horseweed (Conyza canadensis) biotypes is an example of how unrelenting use of a single mode of action herbicide in agricultural weed control drives genetic adaptation in targeted species. While in other weeds glyphosate resistance arose from target site mutation or target gene amplification, the resistance mechanism in horseweed uses neither of these, being instead linked to reduced herbicide uptake and/or translocation. The molecular components underpinning horseweed glyphosate-resistance remain unknown. Here, we used an in vitro leaf disc system for comparative analysis of proteins extracted from control and glyphosate-treated tissues of glyphosate-resistant and glyphosate-susceptible biotypes. Analysis of shikimic acid accumulation, ABC-transporter gene expression, and cell death were used to select a suitable glyphosate concentration and sampling time for enriching proteins pivotal to glyphosate resistance. Protein gel analysis and mass spectrometry identified mainly chloroplast proteins differentially expressed between the biotypes before and after glyphosate treatment. Chloroplasts are the organelles in which the shikimate pathway, which is targeted by glyphosate, is located. Calvin cycle enzymes and proteins of unknown function were among the proteins identified. Our study provides candidate proteins that could be pivotal in engendering resistance and implicates chloroplasts as the primary sites driving glyphosate-resistance in horseweed. PMID:28198407

  7. Meta-CART: A tool to identify interactions between moderators in meta-analysis.

    Science.gov (United States)

    Li, Xinru; Dusseldorp, Elise; Meulman, Jacqueline J

    2017-02-01

    In the framework of meta-analysis, moderator analysis is usually performed only univariately. When several study characteristics are available that may account for treatment effect, standard meta-regression has difficulties in identifying interactions between them. To overcome this problem, meta-CART has been proposed: an approach that applies classification and regression trees (CART) to identify interactions, and then subgroup meta-analysis to test the significance of moderator effects. The previous version of meta-CART has its shortcomings: when applying CART, the sample sizes of studies are not taken into account, and the effect sizes are dichotomized around the median value. Therefore, this article proposes new meta-CART extensions, weighting study effect sizes by their accuracy, and using a regression tree to avoid dichotomization. In addition, new pruning rules are proposed. The performance of all versions of meta-CART was evaluated via a Monte Carlo simulation study. The simulation results revealed that meta-regression trees with random-effects weights and a 0.5-standard-error pruning rule perform best. The required sample size for meta-CART to achieve satisfactory performance depends on the number of study characteristics, the magnitude of the interactions, and the residual heterogeneity.

  8. Results of Mitochondrial DNA Sequence Analysis in Patients with Clinically Diagnosed Leber’s Hereditary Optic Neuropathy

    Directory of Open Access Journals (Sweden)

    Haluk Esgin

    2012-09-01

    Full Text Available Objective: To investigate possible mitochondrial DNA (mtDNA mutations in patients with Leber’s hereditary optic neuropathy (LHON in order to provide a precise diagnosis and genetic counseling.Material and Methods: Between 1982 and 2007, ten patients were clinically diagnosed with LHON and six of these patients agreed to be involved in this study. Six healthy individuals were also included as a control group. mtDNA was isolated from peripheral blood samples and polymerase chain reaction and mtDNA sequence analysis were performed. Results: In one of the six patients, a homoplasmic mutant m.11778G>A mutation was detected. All of the clinically diagnosed LHON patients and the control groups had the m.14212C>T and m.14580G>A single nucleotide polymorphisms (SNPs. The m.11719A>G SNP was detected in three of six patients and four of the controls. Two of the six patients had the m.3197T>C SNP and, in addition, the m.14258G>A SNP was found in one of these two patients, while neither of these mutations were present in the control group.Conclusion: The clinical diagnosis of LHON could be supported by molecular genetics only in one patient by the detection of one mutation. The m.3197T>C and m.14258G>A SNPs should be considered as potential mtDNA mutations due to the fact that they were detected in the patient group. These mutations should be investigated further in large case groups for suspected gene loci that could lead to optic neuropathy.

  9. Genetic variability among Hymenolepis nana isolates from different geographical regions in China revealed by sequence analysis of three mitochondrial genes.

    Science.gov (United States)

    Cheng, Tian; Gao, De-Zhen; Zhu, Wei-Ning; Fang, Su-Fang; Chen, Ning; Zhu, Xing-Quan; Liu, Guo-Hua; Lin, Rui-Qing

    2016-11-01

    Hymenolepis nana is a common tapeworm that parasitizes in the small intestine of rodent animals and humans. The present study examined the sequence diversity of three mitochondrial (mt) genes namely NADH dehydrogenase subunits 5 (nad5), small subunit ribosomal RNA (rrnS), and ATPase subunit 6 (atp6) of H. nana from mice in different geographical regions of China. A part of the nad5 (pnad5), complete rrnS and atp6 genes were amplified separately from individual H. nana isolates using polymerase chain reaction (PCR) and then sequenced. The sequences of pnad5, rrnS, and atp6 were 710 bp, 704-711 bp, and 516 bp in length, respectively. The A + T contents of the sequences were 70.1-73.5% (pnad5), 70.1-71.7% (rrnS), and 76.6-77.9% (atp6). Sequence variation within H. nana was 0-1.4% for atp6, 0-1.7% for rrnS, and 0-0.7% for pnad5. The inter-specific sequence differences between H. nana and Hymenolepis diminuta were significantly higher, which was 31.6-31.7% (pnad5), 16.1-17.6% (rrnS), and 26.5-27.1% (atp6). Phylogenetic analysis based on the combined three sequences using the maximum parsimony (MP) method supported that H. nana is a species complex or "cryptic" species. These findings demonstrated clearly the usefulness of the three mtDNA sequences for population genetics and systematic studies of H. nana of human and animal health significance.

  10. Identifying patients with therapy-resistant depression by using factor analysis

    DEFF Research Database (Denmark)

    Andreasson, K; Liest, V; Lunde, M;

    2010-01-01

    INTRODUCTION: Attempts to identify the factor structure in patients with treatment-resistant depression have been very limited. METHODS: Principal component analysis was performed using the baseline datasets from 3 add-on studies [2 with repetitive transcranial magnetic stimulation and one...... with transcranial pulsed electromagnetic fields (T-PEMF)], in which the relative effect as percentage of improvement during the treatment period was analysed. RESULTS: We identified 2 major factors, the first of which was a general factor. The second was a dual factor consisting of a depression subscale comprising...... the negatively loaded items (covering the pure depression items) and a treatment resistant subscale comprising the positively loaded items (covering lassitude, concentration difficulties and sleep problems). These 2 dual subscales were used as outcome measures. Improvement on the treatment resistant subscale...

  11. Systematic analysis of public domain compound potency data identifies selective molecular scaffolds across druggable target families.

    Science.gov (United States)

    Hu, Ye; Wassermann, Anne Mai; Lounkine, Eugen; Bajorath, Jürgen

    2010-01-28

    Molecular scaffolds that yield target family-selective compounds are of high interest in pharmaceutical research. There continues to be considerable debate in the field as to whether chemotypes with a priori selectivity for given target families and/or targets exist and how they might be identified. What do currently available data tell us? We present a systematic and comprehensive selectivity-centric analysis of public domain target-ligand interactions. More than 200 molecular scaffolds are identified in currently available active compounds that are selective for established target families. A subset of these scaffolds is found to produce compounds with high selectivity for individual targets among closely related ones. These scaffolds are currently underrepresented in approved drugs.

  12. Identifying E-Business Model:A Value Chain-Based Analysis

    Institute of Scientific and Technical Information of China (English)

    ZENG Qingfeng; HUANG Lihua

    2004-01-01

    E-business will change the ways that all companies do business, and most traditional businesses will evolve from their current business model to a combination of place and space via e-business model To choose the proper e-business model becomes the important strategic concern for company to succeed The main objective of this paper is to investigate the analysis framework for identifying e-business model Based on the e-business process, from the value chain to the value net perspective. This paper provides a theoretical framework for identifying e-business models, and results in 11 e-business models. The strategic intend of every e-business model is discussed in the end of this paper. An enterprise e-business model design and implementation can be specified by the combination of one or more among 11 e-business models.

  13. Proteomic analysis of cell lines to identify the irinotecan resistance proteins

    Indian Academy of Sciences (India)

    Xing-Chen Peng; Feng-Ming Gong; Meng Wei; X I Chen; Y E Chen; K E Cheng; Feng Gao; Feng Xu; FENG Bi; Ji-Yan Liu

    2010-12-01

    Chemotherapeutic drug resistance is a frequent cause of treatment failure in colon cancer patients. Several mechanisms have been implicated in drug resistance. However, they are not sufficient to exhaustively account for this resistance emergence. In this study, two-dimensional gel electrophoresis (2-DE) and the PDQuest software analysis were applied to compare the differential expression of irinotecan-resistance-associated protein in human colon adenocarcinoma LoVo cells and irinotecan-resistant LoVo cells (LoVo/irinotecan). The differential protein dots were excised and analysed by ESI-Q-TOF mass spectrometry (MS). Fifteen proteins were identified, including eight proteins with decreased expression and seven proteins with increased expression. The identified known proteins included those that function in diverse biological processes such as cellular transcription, cell apoptosis, electron transport/redox regulation, cell proliferation/differentiation and retinol metabolism pathways. Identification of such proteins could allow improved understanding of the mechanisms leading to the acquisition of chemoresistance.

  14. Qualitative Comparative Analysis: A Hybrid Method for Identifying Factors Associated with Program Effectiveness.

    Science.gov (United States)

    Cragun, Deborah; Pal, Tuya; Vadaparampil, Susan T; Baldwin, Julie; Hampel, Heather; DeBate, Rita D

    2016-07-01

    Qualitative comparative analysis (QCA) was developed over 25 years ago to bridge the qualitative and quantitative research gap. Upon searching PubMed and the Journal of Mixed Methods Research, this review identified 30 original research studies that utilized QCA. Perceptions that QCA is complex and provides few relative advantages over other methods may be limiting QCA adoption. Thus, to overcome these perceptions, this article demonstrates how to perform QCA using data from fifteen institutions that implemented universal tumor screening (UTS) programs to identify patients at high risk for hereditary colorectal cancer. In this example, QCA revealed a combination of conditions unique to effective UTS programs. Results informed additional research and provided a model for improving patient follow-through after a positive screen.

  15. Gastric Cancer Associated Genes Identified by an Integrative Analysis of Gene Expression Data

    Science.gov (United States)

    Jiang, Bing; Li, Shuwen; Jiang, Zhi

    2017-01-01

    Gastric cancer is one of the most severe complex diseases with high morbidity and mortality in the world. The molecular mechanisms and risk factors for this disease are still not clear since the cancer heterogeneity caused by different genetic and environmental factors. With more and more expression data accumulated nowadays, we can perform integrative analysis for these data to understand the complexity of gastric cancer and to identify consensus players for the heterogeneous cancer. In the present work, we screened the published gene expression data and analyzed them with integrative tool, combined with pathway and gene ontology enrichment investigation. We identified several consensus differentially expressed genes and these genes were further confirmed with literature mining; at last, two genes, that is, immunoglobulin J chain and C-X-C motif chemokine ligand 17, were screened as novel gastric cancer associated genes. Experimental validation is proposed to further confirm this finding. PMID:28232943

  16. Daidzin: a potent, selective inhibitor of human mitochondrial aldehyde dehydrogenase.

    OpenAIRE

    Keung, W M; Vallee, B L

    1993-01-01

    Human mitochondrial aldehyde dehydrogenase (ALDH-I) is potently, reversibly, and selectively inhibited by an isoflavone isolated from Radix puerariae and identified as daidzin, the 7-glucoside of 4',7-dihydroxyisoflavone. Kinetic analysis with formaldehyde as substrate reveals that daidzin inhibits ALDH-I competitively with respect to formaldehyde with a Ki of 40 nM, and uncompetitively with respect to the coenzyme NAD+. The human cytosolic aldehyde dehydrogenase isozyme (ALDH-II) is nearly 3...

  17. Gene-network analysis identifies susceptibility genes related to glycobiology in autism.

    Directory of Open Access Journals (Sweden)

    Bert van der Zwaag

    Full Text Available The recent identification of copy-number variation in the human genome has opened up new avenues for the discovery of positional candidate genes underlying complex genetic disorders, especially in the field of psychiatric disease. One major challenge that remains is pinpointing the susceptibility genes in the multitude of disease-associated loci. This challenge may be tackled by reconstruction of functional gene-networks from the genes residing in these loci. We applied this approach to autism spectrum disorder (ASD, and identified the copy-number changes in the DNA of 105 ASD patients and 267 healthy individuals with Illumina Humanhap300 Beadchips. Subsequently, we used a human reconstructed gene-network, Prioritizer, to rank candidate genes in the segmental gains and losses in our autism cohort. This analysis highlighted several candidate genes already known to be mutated in cognitive and neuropsychiatric disorders, including RAI1, BRD1, and LARGE. In addition, the LARGE gene was part of a sub-network of seven genes functioning in glycobiology, present in seven copy-number changes specifically identified in autism patients with limited co-morbidity. Three of these seven copy-number changes were de novo in the patients. In autism patients with a complex phenotype and healthy controls no such sub-network was identified. An independent systematic analysis of 13 published autism susceptibility loci supports the involvement of genes related to glycobiology as we also identified the same or similar genes from those loci. Our findings suggest that the occurrence of genomic gains and losses of genes associated with glycobiology are important contributors to the development of ASD.

  18. Finite Element Creep-Fatigue Analysis of a Welded Furnace Roll for Identifying Failure Root Cause

    Science.gov (United States)

    Yang, Y. P.; Mohr, W. C.

    2015-11-01

    Creep-fatigue induced failures are often observed in engineering components operating under high temperature and cyclic loading. Understanding the creep-fatigue damage process and identifying failure root cause are very important for preventing such failures and improving the lifetime of engineering components. Finite element analyses including a heat transfer analysis and a creep-fatigue analysis were conducted to model the cyclic thermal and mechanical process of a furnace roll in a continuous hot-dip coating line. Typically, the roll has a short life, heat transfer analysis was conducted to predict the temperature history of the roll by modeling heat convection from hot air inside the furnace. The creep-fatigue analysis was performed by inputting the predicted temperature history and applying mechanical loads. The analysis results showed that the failure was resulted from a creep-fatigue mechanism rather than a creep mechanism. The difference of material properties between the filler metal and the base metal is the root cause for the roll failure, which induces higher creep strain and stress in the interface between the weld and the HAZ.

  19. Systematic enrichment analysis of gene expression profiling studies identifies consensus pathways implicated in colorectal cancer development

    Directory of Open Access Journals (Sweden)

    Jesús Lascorz

    2011-01-01

    Full Text Available Background: A large number of gene expression profiling (GEP studies on colorectal carcinogenesis have been performed but no reliable gene signature has been identified so far due to the lack of reproducibility in the reported genes. There is growing evidence that functionally related genes, rather than individual genes, contribute to the etiology of complex traits. We used, as a novel approach, pathway enrichment tools to define functionally related genes that are consistently up- or down-regulated in colorectal carcinogenesis. Materials and Methods: We started the analysis with 242 unique annotated genes that had been reported by any of three recent meta-analyses covering GEP studies on genes differentially expressed in carcinoma vs normal mucosa. Most of these genes (218, 91.9% had been reported in at least three GEP studies. These 242 genes were submitted to bioinformatic analysis using a total of nine tools to detect enrichment of Gene Ontology (GO categories or Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. As a final consistency criterion the pathway categories had to be enriched by several tools to be taken into consideration. Results: Our pathway-based enrichment analysis identified the categories of ribosomal protein constituents, extracellular matrix receptor interaction, carbonic anhydrase isozymes, and a general category related to inflammation and cellular response as significantly and consistently overrepresented entities. Conclusions: We triaged the genes covered by the published GEP literature on colorectal carcinogenesis and subjected them to multiple enrichment tools in order to identify the consistently enriched gene categories. These turned out to have known functional relationships to cancer development and thus deserve further investigation.

  20. A sequence-based approach to identify reference genes for gene expression analysis

    Directory of Open Access Journals (Sweden)

    Chari Raj

    2010-08-01

    Full Text Available Abstract Background An important consideration when analyzing both microarray and quantitative PCR expression data is the selection of appropriate genes as endogenous controls or reference genes. This step is especially critical when identifying genes differentially expressed between datasets. Moreover, reference genes suitable in one context (e.g. lung cancer may not be suitable in another (e.g. breast cancer. Currently, the main approach to identify reference genes involves the mining of expression microarray data for highly expressed and relatively constant transcripts across a sample set. A caveat here is the requirement for transcript normalization prior to analysis, and measurements obtained are relative, not absolute. Alternatively, as sequencing-based technologies provide digital quantitative output, absolute quantification ensues, and reference gene identification becomes more accurate. Methods Serial analysis of gene expression (SAGE profiles of non-malignant and malignant lung samples were compared using a permutation test to identify the most stably expressed genes across all samples. Subsequently, the specificity of the reference genes was evaluated across multiple tissue types, their constancy of expression was assessed using quantitative RT-PCR (qPCR, and their impact on differential expression analysis of microarray data was evaluated. Results We show that (i conventional references genes such as ACTB and GAPDH are highly variable between cancerous and non-cancerous samples, (ii reference genes identified for lung cancer do not perform well for other cancer types (breast and brain, (iii reference genes identified through SAGE show low variability using qPCR in a different cohort of samples, and (iv normalization of a lung cancer gene expression microarray dataset with or without our reference genes, yields different results for differential gene expression and subsequent analyses. Specifically, key established pathways in lung

  1. Automated identification of mitochondrial regions in complex intracellular space by texture analysis

    Science.gov (United States)

    Pham, Tuan D.

    2014-01-01

    Automated processing and quantification of biological images have been rapidly increasing the attention of researchers in image processing and pattern recognition because the roles of computerized image and pattern analyses are critical for new biological findings and drug discovery based on modern high-throughput and highcontent image screening. This paper presents a study of the automated detection of regions of mitochondria, which are a subcellular structure of eukaryotic cells, in microscopy images. The automated identification of mitochondria in intracellular space that is captured by the state-of-the-art combination of focused ion beam and scanning electron microscope imaging reported here is the first of its type. Existing methods and a proposed algorithm for texture analysis were tested with the real intracellular images. The high correction rate of detecting the locations of the mitochondria in a complex environment suggests the effectiveness of the proposed study.

  2. Cluster analysis for identifying sub-groups and selecting potential discriminatory variables in human encephalitis

    Directory of Open Access Journals (Sweden)

    Crowcroft Natasha S

    2010-12-01

    Full Text Available Abstract Background Encephalitis is an acute clinical syndrome of the central nervous system (CNS, often associated with fatal outcome or permanent damage, including cognitive and behavioural impairment, affective disorders and epileptic seizures. Infection of the central nervous system is considered to be a major cause of encephalitis and more than 100 different pathogens have been recognized as causative agents. However, a large proportion of cases have unknown disease etiology. Methods We perform hierarchical cluster analysis on a multicenter England encephalitis data set with the aim of identifying sub-groups in human encephalitis. We use the simple matching similarity measure which is appropriate for binary data sets and performed variable selection using cluster heatmaps. We also use heatmaps to visually assess underlying patterns in the data, identify the main clinical and laboratory features and identify potential risk factors associated with encephalitis. Results Our results identified fever, personality and behavioural change, headache and lethargy as the main characteristics of encephalitis. Diagnostic variables such as brain scan and measurements from cerebrospinal fluids are also identified as main indicators of encephalitis. Our analysis revealed six major clusters in the England encephalitis data set. However, marked within-cluster heterogeneity is observed in some of the big clusters indicating possible sub-groups. Overall, the results show that patients are clustered according to symptom and diagnostic variables rather than causal agents. Exposure variables such as recent infection, sick person contact and animal contact have been identified as potential risk factors. Conclusions It is in general assumed and is a common practice to group encephalitis cases according to disease etiology. However, our results indicate that patients are clustered with respect to mainly symptom and diagnostic variables rather than causal agents

  3. Factor Analysis of the DePaul Symptom Questionnaire: Identifying Core Domains.

    Science.gov (United States)

    Jason, Leonard A; Sunnquist, Madison; Brown, Abigail; Furst, Jacob; Cid, Marjoe; Farietta, Jillianna; Kot, Bobby; Bloomer, Craig; Nicholson, Laura; Williams, Yolonda; Jantke, Rachel; Newton, Julia L; Strand, Elin Bolle

    2015-09-01

    The present study attempted to identify critical symptom domains of individuals with Myalgic Encephalomyelitis (ME) and chronic fatigue syndrome (CFS). Using patient and control samples collected in the United States, Great Britain, and Norway, exploratory factor analysis (EFA) was used to establish the underlying factor structure of ME and CFS symptoms. The EFA suggested a four-factor solution: post-exertional malaise, cognitive dysfunction, sleep difficulties, and a combined factor consisting of neuroendocrine, autonomic, and immune dysfunction symptoms. The use of empirical methods could help better understand the fundamental symptom domains of this illness.

  4. Genetic differentiation and phylogenetic relationships among greek silurus glanis and silurus aristotelis (Pisces, siluridae) populations, assessed by PCR-RFLP analysis of mitochondrial DNA segments

    Science.gov (United States)

    Triantafyllidis; Abatzopoulos; Economidis

    1999-05-01

    Mitochondrial DNA diversity of seven Silurus glanis populations (six from Greece and one from the Danube Delta) and three populations of the endemic Greek Silurus aristotelis was investigated. RFLP analysis of four regions of mitochondrial DNA (cytochrome b, D-loop, ND-5/6) amplified by PCR was used. Ten and nine haplotypes were found in S. glanis and S. aristotelis, respectively. No haplotype was shared between the two species. Significant geographical substructuring was observed in the distribution of haplotypes, with most populations possessing private haplotypes. These haplotypes can serve as genetic 'tags' and therefore warrant protection. Haplotype diversity was very low for all Greek S. glanis populations, possibly because the small size and large annual fluctuations of Greek inland waters do not support large fish populations. Nucleotide divergence was in the range of 0.00-0.52% among S. glanis populations, and 0. 00-0.11% among S. aristotelis populations. Historical factors such as glaciations could account for these low values. The value of 6. 75% sequence divergence of the two species refutes the classification of the two species in different genera, as proposed by some authors. This study constitutes the first attempt, based on mitochondrial molecular data, to address the complicated evolutionary history of the two species which belong to the widely distributed and economically important Siluridae family.

  5. The mitochondrial genome of the red alga Kappaphycus striatus ("Green Sacol" variety): complete nucleotide sequence, genome structure and organization, and comparative analysis.

    Science.gov (United States)

    Tablizo, Francis A; Lluisma, Arturo O

    2014-12-01

    The complete mitochondrial (mt) DNA sequence of the rhodophyte Kappaphycus striatus ("Green Sacol" variety) was determined. The mtDNA is circular, 25,242 bases long (A+T content: 69.94%), and contains 50 densely packed genes comprising 93.22% of the mitochondrial genome, with genes encoded on both strands. Through comparative analysis, the overall sequence, genome structure, and organization of K. striatus mtDNA were seen to be highly similar with other fully sequenced mitochondrial genomes of the class Florideophyceae. On the other hand, certain degrees of genome rearrangements and greater sequence dissimilarities were observed for the mtDNAs of other evolutionarily distant red algae, such as those from the class Bangiophyceae and Cyanidiophyceae, compared to that of K. striatus. Furthermore, a trend was observed wherein the red algal mtDNAs tend to encode lesser number of protein-coding genes, albeit not necessarily shorter, as the organism becomes more morphologically complex. This trend is supported by the phylogenetic tree inferred from the concatenated amino acid sequences of the deduced protein products of cytochrome c oxidase subunit genes (cox1, 2, and 3).

  6. Whole Genome Analysis of Injectional Anthrax Identifies Two Disease Clusters Spanning More Than 13 Years

    Directory of Open Access Journals (Sweden)

    Paul Keim

    2015-11-01

    Lay Person Interpretation: Injectional anthrax has been plaguing heroin drug users across Europe for more than 10 years. In order to better understand this outbreak, we assessed genomic relationships of all available injectional anthrax strains from four countries spanning a >12 year period. Very few differences were identified using genome-based analysis, but these differentiated the isolates into two distinct clusters. This strongly supports a hypothesis of at least two separate anthrax spore contamination events perhaps during the drug production processes. Identification of two events would not have been possible from standard epidemiological analysis. These comprehensive data will be invaluable for classifying future injectional anthrax isolates and for future geographic attribution.

  7. Identifying Chemistry Prospective Teachers' Difficulties Encountered in Practice of The Subject Area Textbook Analysis Course

    Directory of Open Access Journals (Sweden)

    Zeynep Bak Kibar

    2010-12-01

    Full Text Available Prospective teachers should already be aware of possible mistakes in the textbooks and have knowledge of textbooks selection procedure and criteria. These knowledge is tried to being gained to prospective teachers at the Subject Area Textbook Analysis Course. It is important to identify the difficulties they encountered and the skills they gained from the point of implementing effectively this lesson. To research these problems, a case study was realized with 38 student teachers from Department of Secondary Science and Mathematics Education Chemistry Teaching Program at the Karadeniz Technical University Faculty of Fatih Education. Results suggest that prospective teachers gained the knowledge of research, teaching life, writing report, and analyzing textbook. Also, it was determined that they had difficulties in group working, literature reviewing, report writing, analyzing textbook, and critical analysis.

  8. Identifying energy saving opportunities in buildings by the analysis of time series data

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Vasco [ENERGAIA- Energy Management Agency of Gaia, Vila Nova de Gaia (Portugal); Fleming, Paul; Ajiboye, Paul [De Montfort Univ., Leicester (United Kingdom). Inst. of Energy and Sustainable Development

    2003-07-01

    This paper describes how the analysis of time series energy data can be used to identify energy saving opportunities in buildings. Using readily available historic records of energy consumption, particularly quarter-hourly and half-hourly electricity time-series data, and with basic knowledge of the building, potential energy saving opportunities can be highlighted. A review of energy monitoring and targeting (MandT) procedures and techniques of analysing time series data have been carried out. The analysis of electricity time series data has been reviewed in the UK. This has involved analysing demand for power in 8 office buildings. Three different analytical approaches have been applied, simple visualisation and interpretation of energy use patterns, contour mapping and recurrent cumulative sum deviation (CUSUM). This paper concludes that such approaches to analyse electrical power demand could increase the cost-effectiveness and reliability of energy audits and surveys.

  9. Gene expression meta-analysis identifies metastatic pathways and transcription factors in breast cancer

    DEFF Research Database (Denmark)

    Thomassen, Mads; Tan, Qihua; Kruse, Torben

    2008-01-01

    tumors compared to non-metastasizing tumors. Meta-analysis has been used to determine overrepresentation of pathways and transcription factors targets, concordant deregulated in metastasizing breast tumors, in several data sets. RESULTS: The major findings are upregulation of cell cycle pathways...... system, angiogenesis, DNA repair and several signal transduction pathways are associated to metastasis. Finally several transcription factors e.g. E2F, NFY, and YY1 are identified as being involved in metastasis. CONCLUSIONS: By pathway meta-analysis many biological mechanisms beyond major...... studies. Besides classification of outcome, these global expression patterns may reflect biological mechanisms involved in metastasis of breast cancer. Our purpose has been to investigate pathways and transcription factors involved in metastasis by use of gene expression data sets. METHODS: We have...

  10. Towards a typology of business process management professionals: identifying patterns of competences through latent semantic analysis

    Science.gov (United States)

    Müller, Oliver; Schmiedel, Theresa; Gorbacheva, Elena; vom Brocke, Jan

    2016-01-01

    While researchers have analysed the organisational competences that are required for successful Business Process Management (BPM) initiatives, individual BPM competences have not yet been studied in detail. In this study, latent semantic analysis is used to examine a collection of 1507 BPM-related job advertisements in order to develop a typology of BPM professionals. This empirical analysis reveals distinct ideal types and profiles of BPM professionals on several levels of abstraction. A closer look at these ideal types and profiles confirms that BPM is a boundary-spanning field that requires interdisciplinary sets of competence that range from technical competences to business and systems competences. Based on the study's findings, it is posited that individual and organisational alignment with the identified ideal types and profiles is likely to result in high employability and organisational BPM success.

  11. Mitochondrial dysfunction and Huntington disease

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Huntington disease (HD) is a chronic autosomal-dominant neurodegenerative disease. The gene coding Huntingtin has been identified, but the pathogenic mechanisms of the disease are still not fully understood. This paper reviews the involvement of mitochondrial dysfunction in pathogenesis of HD.

  12. Multicomponent statistical analysis to identify flow and transport processes in a highly-complex environment

    Science.gov (United States)

    Moeck, Christian; Radny, Dirk; Borer, Paul; Rothardt, Judith; Auckenthaler, Adrian; Berg, Michael; Schirmer, Mario

    2016-11-01

    A combined approach of multivariate statistical analysis, namely factor analysis (FA) and hierarchical cluster analysis (HCA), interpretation of geochemical processes, stable water isotope data and organic micropollutants enabling to assess spatial patterns of water types was performed for a study area in Switzerland, where drinking water production is close to different potential input pathways for contamination. To avoid drinking water contamination, artificial groundwater recharge with surface water into an aquifer is used to create a hydraulic barrier between potential intake pathways for contamination and drinking water extraction wells. Inter-aquifer mixing in the subsurface is identified, where a high amount of artificial infiltrated surface water is mixed with a lesser amount of water originating from the regional flow pathway in the vicinity of drinking water extraction wells. The spatial distribution of different water types can be estimated and a conceptual system understanding is developed. Results of the multivariate statistical analysis are comparable with gained information from isotopic data and organic micropollutants analyses. The integrated approach using different kinds of observations can be easily transferred to a variety of hydrological settings to synthesise and evaluate large hydrochemical datasets. The combination of additional data with different information content is conceivable and enabled effective interpretation of hydrological processes. Using the applied approach leads to more sound conceptual system understanding acting as the very basis to develop improved water resources management practices in a sustainable way.

  13. Identifying changes in the support networks of end-of-life carers using social network analysis.

    Science.gov (United States)

    Leonard, Rosemary; Horsfall, Debbie; Noonan, Kerrie

    2015-06-01

    End-of-life caring is often associated with reduced social networks for both the dying person and for the carer. However, those adopting a community participation and development approach, see the potential for the expansion and strengthening of networks. This paper uses Knox, Savage and Harvey's definitions of three generations social network analysis to analyse the caring networks of people with a terminal illness who are being cared for at home and identifies changes in these caring networks that occurred over the period of caring. Participatory network mapping of initial and current networks was used in nine focus groups. The analysis used key concepts from social network analysis (size, density, transitivity, betweenness and local clustering) together with qualitative analyses of the group's reflections on the maps. The results showed an increase in the size of the networks and that ties between the original members of the network strengthened. The qualitative data revealed the importance between core and peripheral network members and the diverse contributions of the network members. The research supports the value of third generation social network analysis and the potential for end-of-life caring to build social capital.

  14. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  15. Comprehensive genomic analysis of malignant pleural mesothelioma identifies recurrent mutations, gene fusions and splicing alterations.

    Science.gov (United States)

    Bueno, Raphael; Stawiski, Eric W; Goldstein, Leonard D; Durinck, Steffen; De Rienzo, Assunta; Modrusan, Zora; Gnad, Florian; Nguyen, Thong T; Jaiswal, Bijay S; Chirieac, Lucian R; Sciaranghella, Daniele; Dao, Nhien; Gustafson, Corinne E; Munir, Kiara J; Hackney, Jason A; Chaudhuri, Amitabha; Gupta, Ravi; Guillory, Joseph; Toy, Karen; Ha, Connie; Chen, Ying-Jiun; Stinson, Jeremy; Chaudhuri, Subhra; Zhang, Na; Wu, Thomas D; Sugarbaker, David J; de Sauvage, Frederic J; Richards, William G; Seshagiri, Somasekar

    2016-04-01

    We analyzed transcriptomes (n = 211), whole exomes (n = 99) and targeted exomes (n = 103) from 216 malignant pleural mesothelioma (MPM) tumors. Using RNA-seq data, we identified four distinct molecular subtypes: sarcomatoid, epithelioid, biphasic-epithelioid (biphasic-E) and biphasic-sarcomatoid (biphasic-S). Through exome analysis, we found BAP1, NF2, TP53, SETD2, DDX3X, ULK2, RYR2, CFAP45, SETDB1 and DDX51 to be significantly mutated (q-score ≥ 0.8) in MPMs. We identified recurrent mutations in several genes, including SF3B1 (∼2%; 4/216) and TRAF7 (∼2%; 5/216). SF3B1-mutant samples showed a splicing profile distinct from that of wild-type tumors. TRAF7 alterations occurred primarily in the WD40 domain and were, except in one case, mutually exclusive with NF2 alterations. We found recurrent gene fusions and splice alterations to be frequent mechanisms for inactivation of NF2, BAP1 and SETD2. Through integrated analyses, we identified alterations in Hippo, mTOR, histone methylation, RNA helicase and p53 signaling pathways in MPMs.

  16. Gene network analysis in a pediatric cohort identifies novel lung function genes.

    Directory of Open Access Journals (Sweden)

    Bruce A Ong

    Full Text Available Lung function is a heritable trait and serves as an important clinical predictor of morbidity and mortality for pulmonary conditions in adults, however, despite its importance, no studies have focused on uncovering pediatric-specific loci influencing lung function. To identify novel genetic determinants of pediatric lung function, we conducted a genome-wide association study (GWAS of four pulmonary function traits, including FVC, FEV1, FEV1/FVC and FEF25-75% in 1556 children. Further, we carried out gene network analyses for each trait including all SNPs with a P-value of <1.0 × 10(-3 from the individual GWAS. The GWAS identified SNPs with notable trends towards association with the pulmonary function measures, including the previously described INTS12 locus association with FEV1 (pmeta=1.41 × 10(-7. The gene network analyses identified 34 networks of genes associated with pulmonary function variables in Caucasians. Of those, the glycoprotein gene network reached genome-wide significance for all four variables. P-value range pmeta=6.29 × 10(-4 - 2.80 × 10(-8 on meta-analysis. In this study, we report on specific pathways that are significantly associated with pediatric lung function at genome-wide significance. In addition, we report the first loci associated with lung function in both pediatric Caucasian and African American populations.

  17. Genome-wide association scan meta-analysis identifies three Loci influencing adiposity and fat distribution.

    Directory of Open Access Journals (Sweden)

    Cecilia M Lindgren

    2009-06-01

    Full Text Available To identify genetic loci influencing central obesity and fat distribution, we performed a meta-analysis of 16 genome-wide association studies (GWAS, N = 38,580 informative for adult waist circumference (WC and waist-hip ratio (WHR. We selected 26 SNPs for follow-up, for which the evidence of association with measures of central adiposity (WC and/or WHR was strong and disproportionate to that for overall adiposity or height. Follow-up studies in a maximum of 70,689 individuals identified two loci strongly associated with measures of central adiposity; these map near TFAP2B (WC, P = 1.9x10(-11 and MSRA (WC, P = 8.9x10(-9. A third locus, near LYPLAL1, was associated with WHR in women only (P = 2.6x10(-8. The variants near TFAP2B appear to influence central adiposity through an effect on overall obesity/fat-mass, whereas LYPLAL1 displays a strong female-only association with fat distribution. By focusing on anthropometric measures of central obesity and fat distribution, we have identified three loci implicated in the regulation of human adiposity.

  18. Quantitative bioassay to identify antimicrobial drugs through drug interaction fingerprint analysis.

    Science.gov (United States)

    Weinstein, Zohar B; Zaman, Muhammad H

    2017-02-16

    Drug interaction analysis, which reports the extent to which the presence of one drug affects the efficacy of another, is a powerful tool to select potent combinatorial therapies and predict connectivity between cellular components. Combinatorial effects of drug pairs often vary even for drugs with similar mechanism of actions. Therefore, drug interaction fingerprinting may be harnessed to differentiate drug identities. We developed a method to analyze drug interactions for the application of identifying active pharmaceutical ingredients, an essential step to assess drug quality. We developed a novel approach towards the identification of active pharmaceutical ingredients by comparing drug interaction fingerprint similarity metrics such as correlation and Euclidean distance. To expedite this method, we used bioluminescent E. coli in a simplified checkerboard assay to generate unique drug interaction fingerprints of antimicrobial drugs. Of 30 antibiotics studied, 29 could be identified based on their drug interaction fingerprints. We present drug interaction fingerprint analysis as a cheap, sensitive and quantitative method towards substandard and counterfeit drug detection.

  19. Pathway analysis of smoking quantity in multiple GWAS identifies cholinergic and sensory pathways.

    Directory of Open Access Journals (Sweden)

    Oscar Harari

    Full Text Available Cigarette smoking is a common addiction that increases the risk for many diseases, including lung cancer and chronic obstructive pulmonary disease. Genome-wide association studies (GWAS have successfully identified and validated several susceptibility loci for nicotine consumption and dependence. However, the trait variance explained by these genes is only a small fraction of the estimated genetic risk. Pathway analysis complements single marker methods by including biological knowledge into the evaluation of GWAS, under the assumption that causal variants lie in functionally related genes, enabling the evaluation of a broad range of signals. Our approach to the identification of pathways enriched for multiple genes associated with smoking quantity includes the analysis of two studies and the replication of common findings in a third dataset. This study identified pathways for the cholinergic receptors, which included SNPs known to be genome-wide significant; as well as novel pathways, such as genes involved in the sensory perception of smell, that do not contain any single SNP that achieves that stringent threshold.

  20. Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci

    Science.gov (United States)

    Stahl, Eli A.; Raychaudhuri, Soumya; Remmers, Elaine F.; Xie, Gang; Eyre, Stephen; Thomson, Brian P.; Li, Yonghong; Kurreeman, Fina A. S.; Zhernakova, Alexandra; Hinks, Anne; Guiducci, Candace; Chen, Robert; Alfredsson, Lars; Amos, Christopher I.; Ardlie, Kristin G.; Barton, Anne; Bowes, John; Brouwer, Elisabeth; Burtt, Noel P.; Catanese, Joseph J.; Coblyn, Jonathan; Coenen, Marieke JH; Costenbader, Karen H.; Criswell, Lindsey A.; Crusius, J. Bart A.; Cui, Jing; de Bakker, Paul I.W.; De Jager, Phillip L.; Ding, Bo; Emery, Paul; Flynn, Edward; Harrison, Pille; Hocking, Lynne J.; Huizinga, Tom W. J.; Kastner, Daniel L.; Ke, Xiayi; Lee, Annette T.; Liu, Xiangdong; Martin, Paul; Morgan, Ann W.; Padyukov, Leonid; Posthumus, Marcel D.; Radstake, Timothy RDJ; Reid, David M.; Seielstad, Mark; Seldin, Michael F.; Shadick, Nancy A.; Steer, Sophia; Tak, Paul P.; Thomson, Wendy; van der Helm-van Mil, Annette H. M.; van der Horst-Bruinsma, Irene E.; van der Schoot, C. Ellen; van Riel, Piet LCM; Weinblatt, Michael E.; Wilson, Anthony G.; Wolbink, Gert Jan; Wordsworth, Paul; Wijmenga, Cisca; Karlson, Elizabeth W.; Toes, Rene E. M.; de Vries, Niek; Begovich, Ann B.; Worthington, Jane; Siminovitch, Katherine A.; Gregersen, Peter K.; Klareskog, Lars; Plenge, Robert M.

    2014-01-01

    To identify novel genetic risk factors for rheumatoid arthritis (RA), we conducted a genome-wide association study (GWAS) meta-analysis of 5,539 autoantibody positive RA cases and 20,169 controls of European descent, followed by replication in an independent set of 6,768 RA cases and 8,806 controls. Of 34 SNPs selected for replication, 7 novel RA risk alleles were identified at genome-wide significance (P<5×10−8) in analysis of all 41,282 samples. The associated SNPs are near genes of known immune function, including IL6ST, SPRED2, RBPJ, CCR6, IRF5, and PXK. We also refined the risk alleles at two established RA risk loci (IL2RA and CCL21) and confirmed the association at AFF3. These new associations bring the total number of confirmed RA risk loci to 31 among individuals of European ancestry. An additional 11 SNPs replicated at P<0.05, many of which are validated autoimmune risk alleles, suggesting that most represent bona fide RA risk alleles. PMID:20453842

  1. Proteomic analysis identifies interleukin 11 regulated plasma membrane proteins in human endometrial epithelial cells in vitro

    Directory of Open Access Journals (Sweden)

    Stanton Peter G

    2011-05-01

    Full Text Available Abstract Background During the peri-implantation period, the embryo adheres to an adequately prepared or receptive endometrial surface epithelium. Abnormal embryo adhesion to the endometrium results in embryo implantation failure and infertility. Endometrial epithelial cell plasma membrane proteins critical in regulating adhesion may potentially be infertility biomarkers or targets for treating infertility. Interleukin (IL 11 regulates human endometrial epithelial cells (hEEC adhesion. Its production is abnormal in women with infertility. The objective of the study was to identify IL11 regulated plasma membrane proteins in hEEC in vitro using a proteomic approach. Methods Using a 2D-differential in-gel electrophoresis (DIGE electrophoresis combined with LCMS/MS mass spectrometry approach, we identified 20 unique plasma membrane proteins differentially regulated by IL11 in ECC-1 cells, a hEEC derived cell line. Two IL11 regulated proteins with known roles in cell adhesion, annexin A2 (ANXA2 and flotillin-1 (FLOT1, were validated by Western blot and immunocytochemistry in hEEC lines (ECC-1 and an additional cell line, Ishikawa and primary hEEC. Flotilin-1 was further validated by immunohistochemistry in human endometrium throughout the menstrual cycle (n = 6-8/cycle. Results 2D-DIGE analysis identified 4 spots that were significantly different between control and IL11 treated group. Of these 4 spots, there were 20 proteins that were identified with LCMS/MS. Two proteins; ANXA2 and FLOT1 were chosen for further analyses and have found to be significantly up-regulated following IL11 treatment. Western blot analysis showed a 2-fold and a 2.5-fold increase of ANXA2 in hEEC membrane fraction of ECC-1 and Ishikawa cells respectively. Similarly, a 1.8-fold and a 2.3/2.4-fold increase was also observed for FLOT1 in hEEC membrane fraction of ECC-1 and Ishikawa cells respectively. In vitro, IL11 induced stronger ANXA2 expression on cell surface of primary h

  2. Phylogenetic analysis of the complete mitochondrial genome of Madurella mycetomatis confirms its taxonomic position within the order Sordariales.

    Directory of Open Access Journals (Sweden)

    Wendy W J van de Sande

    Full Text Available BACKGROUND: Madurella mycetomatis is the most common cause of human eumycetoma. The genus Madurella has been characterized by overall sterility on mycological media. Due to this sterility and the absence of other reliable morphological and ultrastructural characters, the taxonomic classification of Madurella has long been a challenge. Mitochondria are of monophyletic origin and mitochondrial genomes have been proven to be useful in phylogenetic analyses. RESULTS: The first complete mitochondrial DNA genome of a mycetoma-causative agent was sequenced using 454 sequencing. The mitochondrial genome of M. mycetomatis is a circular DNA molecule with a size of 45,590 bp, encoding for the small and the large subunit rRNAs, 27 tRNAs, 11 genes encoding subunits of respiratory chain complexes, 2 ATP synthase subunits, 5 hypothetical proteins, 6 intronic proteins including the ribosomal protein rps3. In phylogenetic analyses using amino acid sequences of the proteins involved in respiratory chain complexes and the 2 ATP synthases it appeared that M. mycetomatis clustered together with members of the order Sordariales and that it was most closely related to Chaetomium thermophilum. Analyses of the gene order showed that within the order Sordariales a similar gene order is found. Furthermore also the tRNA order seemed mostly conserved. CONCLUSION: Phylogenetic analyses of fungal mitochondrial genomes confirmed that M. mycetomatis belongs to the order of Sordariales and that it was most closely related to Chaetomium thermophilum, with which it also shared a comparable gene and tRNA order.

  3. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik;

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  4. Simultaneous analysis of mitochondrial activity and DNA content in Ehrlich ascites tumor cells by dual parameter flow cytometry.

    Science.gov (United States)

    Hämmerle, T; Löffler, M

    1989-01-01

    Ehrlich ascites tumor cells were permeabilized using low concentrations of digitonin, 8 micrograms/10(6) cells. Permeabilization was monitored by the assay of lactate dehydrogenase released into the incubation medium and of hexokinase partially bound to mitochondria. Integrity of the cellular organelles was unaffected as determined by assay of the mitochondrial enzyme glutamate dehydrogenase. Cells were stained with rhodamine 123 as a mitochondrial specific dye and propidium iodide/mithramycin as DNA specific dyes. The green fluorescence of bound rhodamine 123 versus red fluorescence of DNA in individual cells was analysed by dual parameter flow cytometry. Incubation of cells with inhibitors of mitochondrial energy metabolism, such as, potassium cyanide and carbonyl cyanide m-chlorophenylhydrazone abolished binding of rhodamine 123. Flow cytometric data allowed a correlation between cell position in the mitotic cycle with total mitochondrial activity. In addition, comparison of the characteristics of propidium iodide and ethidium bromide staining further elucidated the molecular basis of the staining with the positively-charged fluorescent dye rhodamine 123.

  5. Methylation Linear Discriminant Analysis (MLDA for identifying differentially methylated CpG islands

    Directory of Open Access Journals (Sweden)

    Vass J Keith

    2008-08-01

    Full Text Available Abstract Background Hypermethylation of promoter CpG islands is strongly correlated to transcriptional gene silencing and epigenetic maintenance of the silenced state. As well as its role in tumor development, CpG island methylation contributes to the acquisition of resistance to chemotherapy. Differential Methylation Hybridisation (DMH is one technique used for genome-wide DNA methylation analysis. The study of such microarray data sets should ideally account for the specific biological features of DNA methylation and the non-symmetrical distribution of the ratios of unmethylated and methylated sequences hybridised on the array. We have therefore developed a novel algorithm tailored to this type of data, Methylation Linear Discriminant Analysis (MLDA. Results MLDA was programmed in R (version 2.7.0 and the package is available at CRAN 1. This approach utilizes linear regression models of non-normalised hybridisation data to define methylation status. Log-transformed signal intensities of unmethylated controls on the microarray are used as a reference. The signal intensities of DNA samples digested with methylation sensitive restriction enzymes and mock digested are then transformed to the likelihood of a locus being methylated using this reference. We tested the ability of MLDA to identify loci differentially methylated as analysed by DMH between cisplatin sensitive and resistant ovarian cancer cell lines. MLDA identified 115 differentially methylated loci and 23 out of 26 of these loci have been independently validated by Methylation Specific PCR and/or bisulphite pyrosequencing. Conclusion MLDA has advantages for analyzing methylation data from CpG island microarrays, since there is a clear rational for the definition of methylation status, it uses DMH data without between-group normalisation and is less influenced by cross-hybridisation of loci. The MLDA algorithm successfully identified differentially methylated loci between two classes of

  6. Mitochondrial diseases: advances and issues

    Directory of Open Access Journals (Sweden)

    Scarpelli M

    2017-02-01

    Full Text Available Mauro Scarpelli,1 Alice Todeschini,2 Irene Volonghi,2 Alessandro Padovani,2 Massimiliano Filosto2 1Department of Neuroscience, Unit of Neurology, Azienda Ospedaliera Universitaria Integrata Verona, Verona, Italy; 2Center for Neuromuscular Diseases and Neuropathies, Unit of Neurology, ASST “Spedali Civili”, University of Brescia, Brescia, Italy Abstract: Mitochondrial diseases (MDs are a clinically heterogeneous group of disorders caused by a dysfunction of the mitochondrial respiratory chain. They can be related to mutation of genes encoded using either nuclear DNA or mitochondrial DNA. The advent of next generation sequencing and whole exome sequencing in studying the molecular bases of MDs will bring about a revolution in the field of mitochondrial medicine, also opening the possibility of better defining pathogenic mechanisms and developing novel therapeutic approaches for these devastating disorders. The canonical rules of mitochondrial medicine remain milestones, but novel issues have been raised following the use of advanced diagnostic technologies. Rigorous validation of the novel mutations detected using deep sequencing in patients with suspected MD, and a clear definition of the natural history, outcome measures, and biomarkers that could be usefully adopted in clinical trials, are mandatory goals for the scientific community. Today, therapy is often inadequate and mostly palliative. However, important advances have been made in treating some clinical entities, eg, mitochondrial neuro-gastrointestinal encephalomyopathy, for which approaches using allogeneic hematopoietic stem cell transplantation, orthotopic liver transplantation, and carrier erythrocyte entrapped thymidine phosphorylase enzyme therapy have recently been developed. Promising new treatment methods are being identified so that researchers, clinicians, and patients can join forces to change the history of these untreatable disorders. Keywords: mitochondrial diseases

  7. Real-time analysis application for identifying bursty local areas related to emergency topics.

    Science.gov (United States)

    Sakai, Tatsuhiro; Tamura, Keiichi

    2015-01-01

    Since social media started getting more attention from users on the Internet, social media has been one of the most important information source in the world. Especially, with the increasing popularity of social media, data posted on social media sites are rapidly becoming collective intelligence, which is a term used to refer to new media that is displacing traditional media. In this paper, we focus on geotagged tweets on the Twitter site. These geotagged tweets are referred to as georeferenced documents because they include not only a short text message, but also the documents' posting time and location. Many researchers have been tackling the development of new data mining techniques for georeferenced documents to identify and analyze emergency topics, such as natural disasters, weather, diseases, and other incidents. In particular, the utilization of geotagged tweets to identify and analyze natural disasters has received much attention from administrative agencies recently because some case studies have achieved compelling results. In this paper, we propose a novel real-time analysis application for identifying bursty local areas related to emergency topics. The aim of our new application is to provide new platforms that can identify and analyze the localities of emergency topics. The proposed application is composed of three core computational intelligence techniques: the Naive Bayes classifier technique, the spatiotemporal clustering technique, and the burst detection technique. Moreover, we have implemented two types of application interface: a Web application interface and an android application interface. To evaluate the proposed application, we have implemented a real-time weather observation system embedded the proposed application. we used actual crawling geotagged tweets posted on the Twitter site. The weather observation system successfully detected bursty local areas related to observed emergency weather topics.

  8. Transcriptomic analysis using olive varieties and breeding progenies identify candidate genes involved in plant architecture

    Directory of Open Access Journals (Sweden)

    Juan José eGonzález Plaza

    2016-03-01

    Full Text Available Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2,252 differentially expressed genes associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  9. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  10. Platelet-Related Variants Identified by Exomechip Meta-analysis in 157,293 Individuals.

    Science.gov (United States)

    Eicher, John D; Chami, Nathalie; Kacprowski, Tim; Nomura, Akihiro; Chen, Ming-Huei; Yanek, Lisa R; Tajuddin, Salman M; Schick, Ursula M; Slater, Andrew J; Pankratz, Nathan; Polfus, Linda; Schurmann, Claudia; Giri, Ayush; Brody, Jennifer A; Lange, Leslie A; Manichaikul, Ani; Hill, W David; Pazoki, Raha; Elliot, Paul; Evangelou, Evangelos; Tzoulaki, Ioanna; Gao, He; Vergnaud, Anne-Claire; Mathias, Rasika A; Becker, Diane M; Becker, Lewis C; Burt, Amber; Crosslin, David R; Lyytikäinen, Leo-Pekka; Nikus, Kjell; Hernesniemi, Jussi; Kähönen, Mika; Raitoharju, Emma; Mononen, Nina; Raitakari, Olli T; Lehtimäki, Terho; Cushman, Mary; Zakai, Neil A; Nickerson, Deborah A; Raffield, Laura M; Quarells, Rakale; Willer, Cristen J; Peloso, Gina M; Abecasis, Goncalo R; Liu, Dajiang J; Deloukas, Panos; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; Fornage, Myriam; Richard, Melissa; Tardif, Jean-Claude; Rioux, John D; Dube, Marie-Pierre; de Denus, Simon; Lu, Yingchang; Bottinger, Erwin P; Loos, Ruth J F; Smith, Albert Vernon; Harris, Tamara B; Launer, Lenore J; Gudnason, Vilmundur; Velez Edwards, Digna R; Torstenson, Eric S; Liu, Yongmei; Tracy, Russell P; Rotter, Jerome I; Rich, Stephen S; Highland, Heather M; Boerwinkle, Eric; Li, Jin; Lange, Ethan; Wilson, James G; Mihailov, Evelin; Mägi, Reedik; Hirschhorn, Joel; Metspalu, Andres; Esko, Tõnu; Vacchi-Suzzi, Caterina; Nalls, Mike A; Zonderman, Alan B; Evans, Michele K; Engström, Gunnar; Orho-Melander, Marju; Melander, Olle; O'Donoghue, Michelle L; Waterworth, Dawn M; Wallentin, Lars; White, Harvey D; Floyd, James S; Bartz, Traci M; Rice, Kenneth M; Psaty, Bruce M; Starr, J M; Liewald, David C M; Hayward, Caroline; Deary, Ian J; Greinacher, Andreas; Völker, Uwe; Thiele, Thomas; Völzke, Henry; van Rooij, Frank J A; Uitterlinden, André G; Franco, Oscar H; Dehghan, Abbas; Edwards, Todd L; Ganesh, Santhi K; Kathiresan, Sekar; Faraday, Nauder; Auer, Paul L; Reiner, Alex P; Lettre, Guillaume; Johnson, Andrew D

    2016-07-01

    Platelet production, maintenance, and clearance are tightly controlled processes indicative of platelets' important roles in hemostasis and thrombosis. Platelets are common targets for primary and secondary prevention of several conditions. They are monitored clinically by complete blood counts, specifically with measurements of platelet count (PLT) and mean platelet volume (MPV). Identifying genetic effects on PLT and MPV can provide mechanistic insights into platelet biology and their role in disease. Therefore, we formed the Blood Cell Consortium (BCX) to perform a large-scale meta-analysis of Exomechip association results for PLT and MPV in 157,293 and 57,617 individuals, respectively. Using the low-frequency/rare coding variant-enriched Exomechip genotyping array, we sought to identify genetic variants associated with PLT and MPV. In addition to confirming 47 known PLT and 20 known MPV associations, we identified 32 PLT and 18 MPV associations not previously observed in the literature across the allele frequency spectrum, including rare large effect (FCER1A), low-frequency (IQGAP2, MAP1A, LY75), and common (ZMIZ2, SMG6, PEAR1, ARFGAP3/PACSIN2) variants. Several variants associated with PLT/MPV (PEAR1, MRVI1, PTGES3) were also associated with platelet reactivity. In concurrent BCX analyses, there was overlap of platelet-associated variants with red (MAP1A, TMPRSS6, ZMIZ2) and white (PEAR1, ZMIZ2, LY75) blood cell traits, suggesting common regulatory pathways with shared genetic architecture among these hematopoietic lineages. Our large-scale Exomechip analyses identified previously undocumented associations with platelet traits and further indicate that several complex quantitative hematological, lipid, and cardiovascular traits share genetic factors.

  11. Co-expression Analysis Identifies CRC and AP1 the Regulator of Arabidopsis Fatty Acid Biosynthesis

    Institute of Scientific and Technical Information of China (English)

    Xinxin Han; Linlin Yin; Hongwei Xue

    2012-01-01

    Fatty acids (FAs) play crucial rules in signal transduction and plant development,however,the regulation of FA metabolism is still poorly understood.To study the relevant regulatory network,fifty-eight FA biosynthesis genes including de novo synthases,desaturases and elongases were selected as "guide genes" to construct the co-expression network.Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT)identifies 797 candidate FA-correlated genes.Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism,and function in many processes.Interestingly,63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched.Two TF genes,CRC and AP1,both correlating with 8 FA guide genes,were further characterized.Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds.The contents of palmitoleic acid,stearic acid,arachidic acid and eicosadienoic acid are decreased,whereas that of oleic acid is increased in ap1 and crc seeds,which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes.In addition,yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15,indicating that CRC may directly regulate FA biosynthesis.

  12. Identifying and Tracking Individual Updraft Cores using Cluster Analysis: A TWP-ICE case study

    Science.gov (United States)

    Li, X.; Tao, W.; Collis, S. M.; Varble, A.

    2013-12-01

    Cumulus parameterizations in GCMs depend strongly on the vertical velocity structures of convective updraft cores, or plumes. There hasn't been an accurate way of identifying these cores. The majority of previous studies treat the updraft as a single grid column entity, thus missing many intrinsic characteristics, e.g., the size, strength and spatial orientation of an individual core, its life cycle, and the time variations of the entrainment/detrainment rates associated with its life cycle. In this study, we attempt to apply an innovative algorithm based on the centroid-based k-means cluster analysis to improve our understanding of convection and its associated updraft cores. Both 3-D Doppler radar retrievals and cloud-resolving model simulations of a TWP-ICE campaign case during the monsoon period will be used to test and improve this algorithm. This will provide for more in-depth comparisons between CRM simulations and observations that were not possible previously using the traditional piecewise analysis with each updraft column. The first step is to identify the strongest cores (maximum velocity >10 m/s), since they are well defined and produce definite answers when the cluster analysis algorithm is applied. The preliminary results show that the radar retrieved updraft cores are smaller in size and with the maximum velocity located uniformly at higher levels compared with model simulations. Overall, the model simulations produce much stronger cores compared with the radar retrievals. Within the model simulations, the bulk microphysical scheme simulation produces stronger cores than the spectral bin microphysical scheme. Planned researches include using high temporal-resolution simulations to further track the life cycle of individual updraft cores and study their characteristics.

  13. Utilizing a Photo-Analysis Software for Content Identifying Method (CIM

    Directory of Open Access Journals (Sweden)

    Nejad Nasim Sahraei

    2015-01-01

    Full Text Available Content Identifying Methodology or (CIM was developed to measure public preferences in order to reveal the common characteristics of landscapes and aspects of underlying perceptions including the individual's reactions to content and spatial configuration, therefore, it can assist with the identification of factors that influenced preference. Regarding the analysis of landscape photographs through CIM, there are several studies utilizing image analysis software, such as Adobe Photoshop, in order to identify the physical contents in the scenes. This study attempts to evaluate public’s ‘preferences for aesthetic qualities of pedestrian bridges in urban areas through a photo-questionnaire survey, in which respondents evaluated images of pedestrian bridges in urban areas. Two groups of images were evaluated as the most and least preferred scenes that concern the highest and lowest mean scores respectively. These two groups were analyzed by CIM and also evaluated based on the respondent’s description of each group to reveal the pattern of preferences and the factors that may affect them. Digimizer Software was employed to triangulate the two approaches and to determine the role of these factors on people’s preferences. This study attempts to introduce the useful software for image analysis which can measure the physical contents and also their spatial organization in the scenes. According to the findings, it is revealed that Digimizer could be a useful tool in CIM approaches through preference studies that utilizes photographs in place of the actual landscape in order to determine the most important factors in public preferences for pedestrian bridges in urban areas.