WorldWideScience

Sample records for amplified polymorphic dna-polymerase

  1. Randomly amplified polymorphic DNA-polymerase chain reaction analysis of two different populations of cultured Korean catfish Silurus asotus

    Indian Academy of Sciences (India)

    Jong-Man Yoon; Gye-Woong Kim

    2001-12-01

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic bands per primer. The polymorphic bands in these populations ranged from 56.4% to 59.6%. Polymorphic bands per lane within populations ranged from 4.9% to 5.3%. The similarity within the Kunsan population varied from 0.39 to 0.82 with a mean (± SD) of 0.56 ± 0.08. The level of bandsharing values was 0.59 ± 0.07 within the catfish population from Yesan. The genetic similarity in cultured catfish populations may have been caused because individuals from two populations were reared in the same environmental conditions or by inbreeding during several generations. However, in view of bandsharing values, polymorphic bands and also the specific major bands that were inter-population-specific, significant genetic differentiation between these populations were present even if bandsharing (BS) values were somewhat numerically different. Therefore, the number of RAPD polymorphisms identified in this study may be sufficient to permit estimating genetic similarity and diversity. However, in future, additional populations, sampling sites and individuals will be necessary to make up for these weak points.

  2. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  3. Genetic Differentiation of Archachatina marginata Populations from Three Vegetation Zones Using Radom Amplified Polymorphic DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Comfort O. AFOLAYAN

    2015-09-01

    Full Text Available The genetic differentiation of Archachatina marginata populations from three different zones of Nigeria was studied with a view to delimiting them into sub-species. One hundred and nineteen (119 snail specimens were collected, comprising of forty (40 specimens from Yenagoa (Mangrove forest and from Kabba (Guinea Savanna and thirty nine (39 specimens were from Ile-Ife (Rainforest. Eight parameters of the shell specimens of A. marginata which included height of shell, width of shell, aperture height, aperture width, spire length, spire width, penultimate whorl length and first whorl length were subjected to Principal Component Analysis (PCA and Canonical Variates Analysis (CVA to delimit the populations into sub-species. DNA of the various populations was extracted from the foot muscle using CTAB (Cetyl Trimethyl Ammonium Bromide method, which was subjected to RAPD analysis. The RAPD studies employed five (5 oligonucleotide primers (OPB – 17, OPH – 12, OPH – 17, OPI – 06 and OPU – 14 to amplify DNA from 27 samples of A. marginata selected. All five primers produced different band patterns, and the number of fragments amplified per primer varied. Among them, OPB- 17 gave DNA profiles with more numerous bands than the others primers. Both PCA and CVA produced overlapped clusters of A. marginata specimens from the three vegetation zones. The height of shell was observed to be the most variable feature and preferably the most suitable parameter for population grouping. Analysis of the proportions of polymorphic loci and band sharing based on similarity indices for A. marginata samples indicated a relatively high level of genetic variation in the populations from the three areas.

  4. Differentiation by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) of Candida albicans isolated from upper respiratory tract in patients with non-small cell lung cancer.

    Science.gov (United States)

    Biernasiuk, Anna; Korona-Głowniak, Izabela; Grzegorczyk, Agnieszka; Malm, Anna

    2014-01-01

    Cancer patients are predisposed to fungal infections caused by Candida albicans, especially to oral or respiratory tract candidiasis. The aim of this study was to estimate genetic diversity by RAPD-PCR (random amplified polymorphic DNA-polymerase chain reaction) of C. albicans isolated from upper respiratory tract of 100 patients with non-small cell lung cancer. Among 52 strains, 34 genotypes were defined. 10 clusters comprising 28 (53.85%) isolates with similarity coefficient ≥ 80% were formed. The remaining 24 (46.15%) isolates represented individual genotypes. The RAPD-PCR technique revealed genomic variability within C. albicans isolated from upper respiratory tract of the cancer patients. PMID:25371918

  5. "Use of Random Amplified Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR and ITS2 PCR assays for differentiation of populations and putative sibling species of Anopheles fluviatilis (Diptera: Culicidae in Iran"

    Directory of Open Access Journals (Sweden)

    SR Naddaf Dezfouli

    2002-09-01

    Full Text Available Anopheles fluviatilis complex is known to be a vector of malaria in Iran. Since mosquitoes of this species cover a wide geographical range in Iran, they might have evolved into different separated populations. Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR assay was used to differentiate geographic populations of this species. DNA was extracted from individual mosquitoes from 8 localities in 4 south and southeast provinces and amplified in PCR reactions using 18 single primers of arbitrary nucleotide sequence. Results of RAPD-PCR showed that Kazeroun populations could simply be differentiated from other populations using a diagnostic fragment amplified with primer UBC-306. But other populations could not be differentiated either visually or by means of statistical analysis. Moreover ITS2 fragments of some selected specimens were amplified using a pair of universal primer and sequenced as a key standard for detection of putative sibling species. Sequence analysis of the ITS2 fragments revealed a very high (100% homology among the populations. These findings are crucial in epidemiological studies concerning relatedness of geographic populations and vector movement in the region. Results of RAPD-PCR and ITS2 analysis suggest that this taxon in Iran comprises of only one species with a low genetic variation among geographic populations.

  6. Searching for association of the CAG repeat polymorphism in the mitochondrial DNA polymerase gamma gene (POLG) with colorectal cancer.

    Science.gov (United States)

    Linkowska, Katarzyna; Jawień, Arkadiusz; Marszałek, Andrzej; Skonieczna, Katarzyna; Grzybowski, Tomasz

    2015-01-01

    Mitochondrial DNA polymerase gamma (POLG) is the only DNA polymerase involved in maintaining the mitochondrial genome. Recent studies demonstrated an association of CAG repeat polymorphism in the second exon of POLG gene with the risk of cancer. We investigated the CAG repeat variability in the POLG gene in tumor and non-tumor tissues from colorectal cancer patients and in DNA samples isolated from blood obtained from age-matched healthy persons. Somatically occuring CAG-repeat alterations in cancer tissues have been observed in 10% of patients, but no association has been found between the CAG repeat variants in the POLG gene and colorectal cancer risk. PMID:26317126

  7. A germline polymorphism of DNA polymerase beta induces genomic instability and cellular transformation.

    Directory of Open Access Journals (Sweden)

    Jennifer Yamtich

    Full Text Available Several germline single nucleotide polymorphisms (SNPs have been identified in the POLB gene, but little is known about their cellular and biochemical impact. DNA Polymerase β (Pol β, encoded by the POLB gene, is the main gap-filling polymerase involved in base excision repair (BER, a pathway that protects the genome from the consequences of oxidative DNA damage. In this study we tested the hypothesis that expression of the POLB germline coding SNP (rs3136797 in mammalian cells could induce a cancerous phenotype. Expression of this SNP in both human and mouse cells induced double-strand breaks, chromosomal aberrations, and cellular transformation. Following treatment with an alkylating agent, cells expressing this coding SNP accumulated BER intermediate substrates, including single-strand and double-strand breaks. The rs3136797 SNP encodes the P242R variant Pol β protein and biochemical analysis showed that P242R protein had a slower catalytic rate than WT, although P242R binds DNA similarly to WT. Our results suggest that people who carry the rs3136797 germline SNP may be at an increased risk for cancer susceptibility.

  8. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  9. DIFFERENT RESULTS BY DIFFERENT COMMERCIAL TAQ DNA POLYMERASE IN RAPD

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    @@ RAPD (Random Amplified Polymorphic DNA) technique has been widely used in animal, plant, human and microorganism research since it was first established by Williams in 1990[1-3]. But, because of low annealed temperature and short 10-nt primers, the resolution and repetition is low in RAPD. The stability of RAPD is influenced by many factors such as the concentration of template, primers, dNTP, Mg++,and Taq DNA polymerase[4-6]. The influence on amplified products of different commercial Taq DNA polymerase in RAPD was studied in this paper.

  10. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  11. Genotypic Characterization of UL23 Thymidine Kinase and UL30 DNA Polymerase of Clinical Isolates of Herpes Simplex Virus: Natural Polymorphism and Mutations Associated with Resistance to Antivirals▿

    OpenAIRE

    Burrel, Sonia; Deback, Claire; Agut, Henri; Boutolleau, David

    2010-01-01

    The molecular mechanisms of herpes simplex virus (HSV) resistance to antiviral drugs interfering with viral DNA synthesis reported so far rely on the presence of mutations within UL23 (thymidine kinase [TK]) and UL30 (DNA polymerase) genes. The interpretation of genotypic antiviral resistance assay results requires the clear distinction between resistance mutations and natural interstrain sequence variations. The objectives of this work were to describe extensively the natural polymorphism of...

  12. Association Between Single Nucleotide Polymorphisms in DNA Polymerase Kappa Gene and Breast Cancer Risk in Chinese Han Population: A STROBE-Compliant Observational Study.

    Science.gov (United States)

    Dai, Zhi-Jun; Liu, Xing-Han; Ma, Yun-Feng; Kang, Hua-Feng; Jin, Tian-Bo; Dai, Zhi-Ming; Guan, Hai-Tao; Wang, Meng; Liu, Kang; Dai, Cong; Yang, Xue-Wen; Wang, Xi-Jing

    2016-01-01

    DNA polymerases are responsible for ensuring stability of the genome and avoiding genotoxicity caused by a variety of factors during DNA replication. Consequently, these proteins have been associated with an increased cancer risk. DNA polymerase kappa (POLK) is a specialized DNA polymerase involved in translesion DNA synthesis (TLS) that allows DNA synthesis over the damaged DNA. Recently, some studies investigated relationships between POLK polymorphisms and cancer risk, but the role of POLK genetic variants in breast cancer (BC) remains to be defined. In this study, we aimed to evaluate the effects of POLK polymorphisms on BC risk.We used the Sequenom MassARRAY method to genotype 3 single nucleotide polymorphisms (SNPs) in POLK (rs3213801, rs10077427, and rs5744533), in order to determine the genotypes of 560 BC patients and 583 controls. The association of genotypes and BC was assessed by computing the odds ratio (OR) and 95% confidence intervals (95% CIs) from logistic regression analyses.We found a statistically significant difference between patient and control groups in the POLK rs10077427 genotypic groups, excluding the recessive model. A positive correlation was also found between positive progesterone receptor (PR) status, higher Ki67 index, and rs10077427 polymorphism. For rs5744533 polymorphism, the codominant, dominant, and allele models frequencies were significantly higher in BC patients compared to healthy controls. Furthermore, our results indicated that rs5744533 SNP has a protective role in the postmenopausal women. However, we failed to find any associations between rs3213801 polymorphism and susceptibility to BC.Our results indicate that POLK polymorphisms may influence the risk of developing BC, and, because of this, may serve as a prognostic biomarker among Chinese women. PMID:26765445

  13. Optimization of randomly amplified polymorphic DNA-polymerase chain reaction for molecular typing of Salmonella enterica serovar Typhi Otimização da reação de amplificação aleatória do DNA polimórfico - reação em cadeia da polimerase para tipagem molecular de Salmonella enterica sorovar Typhi

    Directory of Open Access Journals (Sweden)

    Bianca Ramalho Quintaes

    2004-03-01

    Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e

  14. Shotgun metagenomics indicates novel family A DNA polymerases predominate within marine virioplankton.

    Science.gov (United States)

    Schmidt, Helen F; Sakowski, Eric G; Williamson, Shannon J; Polson, Shawn W; Wommack, K Eric

    2014-01-01

    Virioplankton have a significant role in marine ecosystems, yet we know little of the predominant biological characteristics of aquatic viruses that influence the flow of nutrients and energy through microbial communities. Family A DNA polymerases, critical to DNA replication and repair in prokaryotes, are found in many tailed bacteriophages. The essential role of DNA polymerase in viral replication makes it a useful target for connecting viral diversity with an important biological feature of viruses. Capturing the full diversity of this polymorphic gene by targeted approaches has been difficult; thus, full-length DNA polymerase genes were assembled out of virioplankton shotgun metagenomic sequence libraries (viromes). Within the viromes novel DNA polymerases were common and found in both double-stranded (ds) DNA and single-stranded (ss) DNA libraries. Finding DNA polymerase genes in ssDNA viral libraries was unexpected, as no such genes have been previously reported from ssDNA phage. Surprisingly, the most common virioplankton DNA polymerases were related to a siphovirus infecting an α-proteobacterial symbiont of a marine sponge and not the podoviral T7-like polymerases seen in many other studies. Amino acids predictive of catalytic efficiency and fidelity linked perfectly to the environmental clades, indicating that most DNA polymerase-carrying virioplankton utilize a lower efficiency, higher fidelity enzyme. Comparisons with previously reported, PCR-amplified DNA polymerase sequences indicated that the most common virioplankton metagenomic DNA polymerases formed a new group that included siphoviruses. These data indicate that slower-replicating, lytic or lysogenic phage populations rather than fast-replicating, highly lytic phages may predominate within the virioplankton. PMID:23985748

  15. φ29 DNA polymerase

    OpenAIRE

    Blanco, Luis; Bernad, Antonio; Salas, Margarita

    1996-01-01

    An improved method for determining the nucleotide base sequence of a DNA molecule employs a φ-29 type DNA polymerase modified to have reduced or no exonuclease activity. The method includes annealing the DNA molecule with a primer molecule able to hybridize to the DNA molecule; incubating the annealed mixture in a vessel containing four different deoxynucleoside triphosphates, a DNA polymerase, and one or more DNA synthesis terminating agents which terminate DNA synthesis at a specific nucleo...

  16. Development and Clinical Application of a Single-tube Nested PCR Method to Amplify the DNA Polymerase I Gene of Treponema Pallidum

    Institute of Scientific and Technical Information of China (English)

    曾铁兵; 吴移谋; 黄澍杰; 吴志周

    2004-01-01

    Objective: To develop a sensitive, specific and simple method for detection of extremely low numbers of T. pallidum in clinical specimens, as a significant addition to the serologic tests for syphilis diagnosis. Methods: Double-tube nested PCR(DN-PCR) and single-tube nested PCR(SN-PCR) assays were performed to amplify specific fragments of the DNA polymerase I gene(polA) of T. pallidum. Sensitivity and specificity of the two PCR assays were tested. Eightysix whole blood specimens from persons with suspected syphilis were detected by the two nested PCR methods. The TPPA test was used as a comparison for detecting syphilis in sera from corresponding patients. Results: Only specific amplicons could be obtained during amplification of the T. pallidum polA gene and the detection limit was approximately 1 organism when analyzed on gel by the two PCR methods. Of 86 clinical specimens, 62 were positive by TPPA. Of these, 54 and 51 were positive by the DN-PCR and SN-PCR, respectively, which does not represent a statistically significant difference between the two PCR tests. Of 24 TPPA-negative specimens, 5 were positive by both DN-PCR assay and SN-PCR assay. Conclusion: The SN-polA PCR method is extremely sensitive, specific and easy to perform for detecting low numbers of T. pallidum in clinical blood specimens as a complementary to serology for syphilis diagnosis.

  17. Guanine-rich sequences inhibit proofreading DNA polymerases

    Science.gov (United States)

    Zhu, Xiao-Jing; Sun, Shuhui; Xie, Binghua; Hu, Xuemei; Zhang, Zunyi; Qiu, Mengsheng; Dai, Zhong-Min

    2016-01-01

    DNA polymerases with proofreading activity are important for accurate amplification of target DNA. Despite numerous efforts have been made to improve the proofreading DNA polymerases, they are more susceptible to be failed in PCR than non-proofreading DNA polymerases. Here we showed that proofreading DNA polymerases can be inhibited by certain primers. Further analysis showed that G-rich sequences such as GGGGG and GGGGHGG can cause PCR failure using proofreading DNA polymerases but not Taq DNA polymerase. The inhibitory effect of these G-rich sequences is caused by G-quadruplex and is dose dependent. G-rich inhibitory sequence-containing primers can be used in PCR at a lower concentration to amplify its target DNA fragment. PMID:27349576

  18. Engineered DNA Polymerases in Biotechnology

    OpenAIRE

    Kranaster, Ramon; Marx, Andreas

    2010-01-01

    DNA polymerases are the enzymes that catalyse all DNA synthesis in Nature often with astounding speed and accuracy. Consequently, their features as molecular machines are exploited in a wide range of biotechnological applications. Some features are highlighted in the following. For example, DNA polymerases are useful enzymes to detect genomic alterations that can lead to the development of certain diseases such as cancer or to promote toxic side effects of drugs. Methods for the detection of ...

  19. DNA Polymerase-Catalyzed DNA Network Growth

    OpenAIRE

    Keller, Sascha; Wang, Jie; Chandra, Madhaviah; Berger, Rüdiger; Marx, Andreas

    2008-01-01

    The distinct base pairing property of DNA is an advantageous phenomenon that has been exploited in the usage of DNA as scaffold for directed self-organization to form nanometer-sized objects in a desirable fashion. Herein we report the construction of three-dimensional DNA-based networks that can be generated and amplified by the DNA polymerase chain reaction (PCR). The approach is flexible allowing tuning of the meshes of the network by variation of the size of the template. Additionally, fu...

  20. Comparison of six commercially-available DNA polymerases for direct PCR.

    Science.gov (United States)

    Miura, Masashi; Tanigawa, Chihiro; Fujii, Yoshito; Kaneko, Satoshi

    2013-01-01

    The use of a "direct PCR" DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens. PMID:24213192

  1. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    Directory of Open Access Journals (Sweden)

    Masashi Miura

    2013-12-01

    Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

  2. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    OpenAIRE

    Iñiguez Alena M; Araújo Adauto; Ferreira Luiz Fernando; Vicente Ana Carolina P

    2003-01-01

    The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA) present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pre...

  3. Amplified fragment length polymorphism and virulence polymorphism in Puccinia hordei

    Science.gov (United States)

    Puccinia hordei is the causal agent of barley leaf rust. To study the genetic diversity in P. hordei, 45 isolates with diverse virulence patterns and geographical origins were analyzed using amplified fragment length polymorphism markers. Two pathotypes of Puccinia graminis f. sp. tritici and one is...

  4. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  5. Association of the polymorphism of the CAG repeat in the mitochondrial DNA polymerase gamma gene (POLG) with testicular germ-cell cancer

    DEFF Research Database (Denmark)

    Blomberg Jensen, M; Leffers, H; Petersen, J H;

    2008-01-01

    of the common 10-CAG-long POLG allele with testicular cancer as well as previously reported in some European populations' association with male subfertility, which is a condition carrying an increased risk of TGCT. PATIENTS AND METHODS: The number of CAG repeats in both POLG alleles was established in 243...... patients with TGCT and in 869 controls by the analysis of the genomic DNA fragment. RESULTS: A significantly higher proportion of men homozygous allele of other than the common 10 CAG repeats was found among the patients with TGCT in comparison to the controls (4.9% versus 1.3%, respectively, P = 0.......001). The vast majority of the homozygous patients had a seminoma (11 of 12; 97%), despite that only about half (55%) of the studied patients had this tumour type. CONCLUSIONS: The findings indicate that the POLG polymorphism may be a contributing factor in the pathogenesis of TGCT particularly in seminoma...

  6. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    International Nuclear Information System (INIS)

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  7. DNA polymerase beta can substitute for DNA polymerase I in the initiation of plasmid DNA replication.

    OpenAIRE

    Sweasy, J B; Chen, M.; Loeb, L A

    1995-01-01

    We previously demonstrated that mammalian DNA polymerase beta can substitute for DNA polymerase I of Escherichia coli in DNA replication and in base excision repair. We have now obtained genetic evidence suggesting that DNA polymerase beta can substitute for E. coli DNA polymerase I in the initiation of replication of a plasmid containing a pMB1 origin of DNA replication. Specifically, we demonstrate that a plasmid with a pMB1 origin of replication can be maintained in an E. coli polA mutant ...

  8. Structure and function of DNA polymerase μ

    International Nuclear Information System (INIS)

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  9. Sexing birds using random amplified polymorphic DNA (RAPD) markers

    NARCIS (Netherlands)

    Lessells, C.M.; Mateman, A.C.

    1998-01-01

    We used random amplified polymorphic DNA (RAPD) markers to sex birds from small tissue (usually blood) samples. Arbitrarily chosen 10-mer PCR primers were screened with DNA from known-sex individuals for the production of a bright female-specific band. Suitable primers were found for seven bird spec

  10. Cloning of Thermostable DNA Polymerase Gene from a Thermophilic Brevibacillus sp. Isolated from Sikidang Crater, Dieng Plateu, Central Java

    Directory of Open Access Journals (Sweden)

    Lucia Dhiantika Witasari

    2015-11-01

    Full Text Available Thermostable DNA polymerase has an important role for amplifying small amount of DNA through polymerase chain reaction (PCR. Thermophillic bacteria Brevibacillus sp. was isolated from Sikidang Crater, Dieng Plateu, Central Java. Previous study showed that crude protein of the isolate could be used in PCR. Unfortunately, like most native thermostable enzymes, the thermostable DNA polymerase of the isolate is synthesized in a very low level and therefore is cumbersome to purify. The purpose of this research is to clone thermostable DNA polymerase gene of the isolate. The DNA polymerase gene was amplified by means of PCR using spesific primers. The amplified fragment was then isolated, purified, and ligated into the pGEM-T cloning vector. The recombinant plasmid was then transformed to competent E. coli JM109 cells using heat shock method. The cloned thermostable DNA polymerase gene from the thermophilic isolate was then characterized for its nucleotide base sequence. The result showed that the DNA Pol I gene was successfully be amplified from the isolate DNA genom, resulting in ± 2,7 kb DNA fragment in length. Sequence analysis of segment of targeted gene showed high similarity to that of thermostable DNA polymerase genes from other Bacillus.Key words : Thermostable DNA Pol I, Brevibacillus sp., PCR, cloning

  11. Functional roles of DNA polymerases β and γ

    International Nuclear Information System (INIS)

    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  12. Radioimmunological comparison of the DNA polymerases of avian retroviruses.

    OpenAIRE

    Bauer, G.; Temin, H M

    1980-01-01

    125I-labeled DNA polymerases of avian myeloblastosis virus and spleen necrosis virus were used in a radioimmunological characterization of avian retrovirus DNA polymerases. It was shown that avian leukosis virus and reticuloendotheliosis virus DNA polymerases do not cross-react in radioimmunoassays. Within the avian leukosis virus species, species-specific and type-specific antigenic determinants of the DNA polymerase were defined. The previous finding of genus-specific antigenic determinants...

  13. Chromosomal location of the human gene for DNA polymerase β

    International Nuclear Information System (INIS)

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  14. Fidelity of DNA polymerases in DNA amplification.

    OpenAIRE

    Keohavong, P; Thilly, W G

    1989-01-01

    Denaturing gradient gel electrophoresis (DGGE) was used to separate and isolate the products of DNA amplification by polymerase chain reaction (PCR). The strategy permitted direct enumeration and identification of point mutations created by T4, modified T7, Klenow fragment of polymerase I, and Thermus aquaticus (Taq) DNA polymerases. Incorrectly synthesized sequences were separated from the wild type by DGGE as mutant/wild-type heteroduplexes and the heteroduplex fraction was used to calculat...

  15. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    OpenAIRE

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  16. The primary structure of Plasmodium falciparum DNA polymerase delta is similar to drug sensitive delta-like viral DNA polymerases.

    Science.gov (United States)

    Fox, B A; Bzik, D J

    1991-12-01

    We report the isolation and sequencing of genomic DNA clones that encode the 1094-amino acid catalytic subunit of DNA polymerase delta from the human malaria parasite Plasmodium falciparum. Protein sequence comparison to other DNA polymerases revealed the presence of six highly conserved regions found in alpha-like DNA polymerases from different prokaryotic, viral, and eukaryotic sources. Five additional regions of amino acid sequence similarity that are only conserved in delta and delta-like DNA polymerases, so far, were present in P. falciparum DNA polymerase delta. P. falciparum DNA polymerase delta was highly similar to both Saccharomyces cerevisiae DNA polymerase delta (DNA polymerase III; CDC2) and Epstein-Barr virus DNA polymerase at the amino acid sequence, and the predicted protein secondary structure levels. The gene that encodes DNA polymerase delta resides as a single copy on chromosome 10, and is expressed as a 4.5-kb mRNA during the trophozoite and schizont stages when parasite chromosomal DNA synthesis is active. PMID:1775172

  17. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    OpenAIRE

    Tom eKillelea; Celine eRalec; Audrey eBosse; Ghislaine eHenneke

    2014-01-01

    International audience DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased perfor...

  18. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.;

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able to...

  19. Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification

    OpenAIRE

    Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.

    2001-01-01

    We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified ...

  20. Role of DNA Polymerases in Repeat-Mediated Genome Instability

    Directory of Open Access Journals (Sweden)

    Kartik A. Shah

    2012-11-01

    Full Text Available Expansions of simple DNA repeats cause numerous hereditary diseases in humans. We analyzed the role of DNA polymerases in the instability of Friedreich’s ataxia (GAAn repeats in a yeast experimental system. The elementary step of expansion corresponded to ∼160 bp in the wild-type strain, matching the size of Okazaki fragments in yeast. This step increased when DNA polymerase α was mutated, suggesting a link between the scale of expansions and Okazaki fragment size. Expandable repeats strongly elevated the rate of mutations at substantial distances around them, a phenomenon we call repeat-induced mutagenesis (RIM. Notably, defects in the replicative DNA polymerases δ and ∊ strongly increased rates for both repeat expansions and RIM. The increases in repeat-mediated instability observed in DNA polymerase δ mutants depended on translesion DNA polymerases. We conclude that repeat expansions and RIM are two sides of the same replicative mechanism.

  1. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.; Ahrens, Peter

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  2. Characterization of a stable, major DNA polymerase alpha species devoid of DNA primase activity.

    OpenAIRE

    Kaiserman, H B; Benbow, R. M.

    1987-01-01

    We have purified from Xenopus laevis ovaries a major DNA polymerase alpha species that lacked DNA primase activity. This primase-devoid DNA polymerase alpha species exhibited the same sensitivity as the DNA polymerase DNA primase alpha to BuAdATP and BuPdGTP, nucleotide analogs capable of distinguishing between DNA polymerase delta and DNA polymerase DNA primase alpha. The primase-devoid DNA polymerase alpha species also lacked significant nuclease activity indicative of the alpha-like (rathe...

  3. Identification of a New Motif in Family B DNA Polymerases by Mutational Analyses of the Bacteriophage T4 DNA Polymerase

    OpenAIRE

    Li, Vincent; Hogg, Matthew; Reha-Krantz, Linda J.

    2010-01-01

    Structure-based protein sequence alignments of family B DNA polymerases revealed a conserved motif that is formed from interacting residues between loops from the N-terminal and palm domains and between the N-terminal loop and a conserved proline residue. The importance of the motif for function of the bacteriophage T4 DNA polymerase was revealed by suppressor analysis. T4 DNA polymerases that form weak replicating complexes cannot replicate DNA when the dGTP pool is reduced. The conditional ...

  4. Engineering processive DNA polymerases with maximum benefit and minimum cost

    Directory of Open Access Journals (Sweden)

    LindaJ.Reha-Krantz

    2014-08-01

    Full Text Available DNA polymerases need to be engineered to achieve optimal performance for biotechnological applications, which often require high fidelity replication when using modified nucleotides and when replicating difficult DNA sequences. These tasks are achieved for the bacteriophage T4 DNA polymerase by replacing leucine with methionine in the highly conserved Motif A sequence (L412M. The costs are minimal. Although base substitution errors increase moderately, accuracy is maintained for templates with mono- and dinucleotide repeats and replication efficiency is enhanced . The L412M substitution increases intrinsic processivity and the additions of phage T4 clamp and single-stranded DNA binding proteins further strengthen the ability of the phage T4 L412M-DNA polymerase to replicate all types of difficult DNA sequences. Increased pyrophosphorolysis is a drawback of increased processivity, but pyrophosphorolysis is curbed by adding an inorganic pyrophosphatase or divalent metal cations, Mn2+ or Ca2+. In the absence of pyrophosphorolysis inhibitors, the T4 L412M-DNA polymerase catalyzed sequence-dependent pyrophosphorolysis under DNA sequencing conditions. These pyrophosphorolysis-sensitive DNA sequences provide insights into how the T4 DNA polymerase switches between nucleotide incorporation, pyrophosphorolysis and proofreading pathways. The L-to-M substitution was also tested in the yeast DNA polymerases delta and alpha. Because the mutant DNA polymerases displayed similar characteristics, we propose that amino acid substitutions in Motif A have the potential to increase processivity and to enhance performance in biotechnological applications. An underlying theme in this chapter is the use of genetic methods to identify mutant DNA polymerases with potential for use in current and future biotechnological applications.

  5. Kinetics and thermodynamics of DNA polymerases with exonuclease proofreading

    Science.gov (United States)

    Gaspard, Pierre

    2016-04-01

    Kinetic theory and thermodynamics are applied to DNA polymerases with exonuclease activity, taking into account the dependence of the rates on the previously incorporated nucleotide. The replication fidelity is shown to increase significantly thanks to this dependence at the basis of the mechanism of exonuclease proofreading. In particular, this dependence can provide up to a 100-fold lowering of the error probability under physiological conditions. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  6. Composting oily sludges: Characterizing microflora using randomly amplified polymorphic DNA

    International Nuclear Information System (INIS)

    Laboratory-scale composts in which oily sludge was composted under mesophilic conditions with amendments such as peat, bark, and fresh or decomposed horse manure, were studied with respect to basic parameters such as oil degradation, respirometry, and bacterial numbers. Further, an attempt was made to characterize a part of the bacterial flora using randomly amplified polymorphic DNA (RAPD). The compost based on decomposed horse manure showed the greatest reduction of oil (85%). Comparison with a killed control indicated that microbial degradation actually had occurred. However, a substantial part of the oil was stabilized rather than totally broken down. Volatiles, on the contrary, accounted for a rather small percentage (5%) of the observed reduction. RAPD indicated that a selection had taken place and that the dominating microbial flora during the active degradation of oil were not the same as the ones dominating the different basic materials. The stabilized compost, on the other hand, had bacterial flora with similarities to the ones found in peat and bark

  7. Measurement of kinetic parameters of human platelet DNA polymerase gamma.

    Science.gov (United States)

    Taanman, Jan-Willem; Heiske, Margit; Letellier, Thierry

    2010-08-01

    Synthesis of mitochondrial DNA is performed by DNA polymerase gamma. Mutations in POLG, the gene encoding the catalytic subunit of DNA polymerase gamma, are a major cause of neurological disease. A large proportion of patients carry rare nucleotide substitutions leading to single amino acid changes. Confirming that these replacements are pathogenic can be problematic without biochemical evidence. Here, we provide a hands-on protocol for an in vitro kinetic assay of DNA polymerase gamma which allows assessment of the K(m) and V(max) for the incoming nucleotide of the polymerization reaction. To avoid measurement of contaminating nuclear DNA polymerases, platelet extracts are used since platelets do not contain a nucleus. Moreover, platelets have the advantage of being obtainable relatively non-invasively. Polymerization activity is determined by measurement of the incorporation of radioactive thymidine 5'-triphosphate (dTTP) on the homopolymeric RNA substrate poly(rA).oligo(dT)(12-18). To further minimize nuclear DNA polymerase activity, aphidicolin, an inhibitor of most nuclear DNA polymerases, is included in the reaction. In addition, reactions are carried out in the absence and presence of the competitive inhibitor of DNA polymerase gamma, 2',3'-dideoxythymidine 5'-triphosphate (ddTTP), to allow calculation of the ddTTP-sensitive incorporation. With this method, platelets from healthy control subjects extracted with 3% Triton X-100 showed a K(m) for dTTP of 1.42 microM and a V(max) of 0.83 pmol min(-1)mg(-1). PMID:20227504

  8. Selection of unique Escherichia coli clones by random amplified polymorphic DNA (RAPD)

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Godfrey, Paul A; Stegger, Marc;

    2014-01-01

    Identifying and characterizing clonal diversity are important when analysing fecal flora. We evaluated random amplified polymorphic DNA (RAPD) PCR, applied for selection of Escherichia coli isolates, by whole genome sequencing. RAPD was fast, and reproducible as screening method for selection...

  9. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    OpenAIRE

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open readin...

  10. Differential effects of dimethylsulfoxide on the activities of human DNA polymerases alpha and delta.

    OpenAIRE

    Lee, M Y; Toomey, N L

    1986-01-01

    The effects of dimethylsulfoxide on the activities of purified human placental DNA polymerase alpha and DNA polymerase delta were examined. DNA polymerase alpha was inhibited by dimethylsulfoxide, whereas DNA polymerase delta was significantly activated, by as much as 6-fold. Kinetic data show that the effect of dimethylsulfoxide on DNA polymerase delta activity was due to a reduction in the apparent Km for its substrate, dTTP. This novel finding of the differential effects of dimethylsulfoxi...

  11. Comparative Analysis of Eubacterial DNA Polymerase Ⅲ Alpha Subunits

    Institute of Scientific and Technical Information of China (English)

    Xiao-Qian Zhao; Jian-Fei Hu; Jun Yu

    2006-01-01

    DNA polymerase Ⅲ is one of the five eubacterial DNA polymerases that is responsible for the replication of DNA duplex. Among the ten subunits of the DNA polymerase Ⅲ core enzyme, the alpha subunit catalyzes the reaction for polymerizing both DNA strands. In this study, we extracted genomic sequences of the alpha subunit from 159 sequenced eubacterial genomes, and carried out sequencebased phylogenetic and structural analyses. We found that all eubacterial genomes have one or more alpha subunits, which form either homodimers or heterodimers.Phylogenetic and domain structural analyses as well as copy number variations of the alpha subunit in each bacterium indicate the classification of alpha subunit into four basic groups: polC, dnaE1, dnaE2, and dnaE3. This classification is of essence in genome composition analysis. We also consolidated the naming convention to avoid further confusion in gene annotations.

  12. Phosphorylation of a high molecular weight DNA polymerase α

    International Nuclear Information System (INIS)

    Anti-human DNA polymerase α murine IgG SJK-287-38 neutralized DNA polymerase α activity from rat embryonic fibroblasts infected with a temperature-sensitive transformation mutant of Rous sarcoma virus (tsLA24). After centrifugation of a crude cytosol fraction from log-phase cells in a 5-20% linear sucrose gradient, polypeptides of M/sub r/ ∼ 185,000 and 220,000 were immunoprecipitated only from gradient fractions containing DNA polymerase α activity. When similar cultures were incubated in medium containing [32P]orthophosphate, it was found that the M/sub r/ 220,000 protein was phosphorylated but that the other peptides specific for polymerase α activity did not contain detectable amounts of phosphate. Phospho amino acid analysis of the high molecular weight immunoprecipitable proteins indicated that the labeled amino acid was phosphoserine. Incubation of 2.5 units of crude DNA polymerase α with 4 units of agarose-immobilized alkaline phosphatase resulted in a nearly complete inhibition of DNA polymerase α activity. Subsequent incubation of this preparation with 5 or 50 μM ATP, but not the nonhydrolyzable analog adenosine 5'-[γ-thio]triphosphate, restored the in vitro DNA polymerizing activity. These results demonstrate that a high molecular weight DNA polymerase α is phosphorylated in cultured cells and that this protein is a substrate for a serine kinase rather than the tyrosine-specific protein kinase of Rous sarcoma virus. The results suggest that phosphorylation/dephosphorylation reactions modulate the activity of this polymerase

  13. Kinetics and thermodynamics of exonuclease-deficient DNA polymerases

    Science.gov (United States)

    Gaspard, Pierre

    2016-04-01

    A kinetic theory is developed for exonuclease-deficient DNA polymerases, based on the experimental observation that the rates depend not only on the newly incorporated nucleotide, but also on the previous one, leading to the growth of Markovian DNA sequences from a Bernoullian template. The dependencies on nucleotide concentrations and template sequence are explicitly taken into account. In this framework, the kinetic and thermodynamic properties of DNA replication, in particular, the mean growth velocity, the error probability, and the entropy production are calculated analytically in terms of the rate constants and the concentrations. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  14. RNA aptamers selected against DNA polymerase β inhibit the polymerase activities of DNA polymerases β and κ

    OpenAIRE

    Gening, Leonid V.; Klincheva, Svetlana A.; Reshetnjak, Anastasia; Grollman, Arthur P; Miller, Holly

    2006-01-01

    DNA polymerase β (polβ), a member of the X family of DNA polymerases, is the major polymerase in the base excision repair pathway. Using in vitro selection, we obtained RNA aptamers for polβ from a variable pool of 8 × 1012 individual RNA sequences containing 30 random nucleotides. A total of 60 individual clones selected after seven rounds were screened for the ability to inhibit polβ activity. All of the inhibitory aptamers analyzed have a predicted tri-lobed structure. Gel mobility shift a...

  15. Reconsidering DNA Polymerases at the Replication Fork in Eukaryotes

    OpenAIRE

    Stillman, Bruce

    2015-01-01

    The distribution of DNA polymerase activities at the eukaryotic DNA replication fork was “established,” but recent genetic studies in this issue of Molecular Cell raise questions about which polymerases are copying the leading and lagging strand templates (Johnson et al, 2015).

  16. EBV DNA polymerase inhibition of tannins from Eugenia uniflora.

    Science.gov (United States)

    Lee, M H; Chiou, J F; Yen, K Y; Yang, L L

    2000-06-30

    Nasopharyngeal carcinoma (NPC) is one of the high population malignant tumors among Chinese in southern China and southeast Asia. Epstein-Barr virus (EBV) is a human B lymphotropic herpes virus which is known to be closely associated with NPC. EBV DNA polymerase is a key enzyme during EBV replication and is measured by its radioactivity. The addition of phorbol 12-myristate 13-acetate to Raji cell cultures led to a large increase in EBV DNA polymerase, which was purified by sequential DEAE-cellulose, phosphocellulose and DNA-cellulose column chromatography. Four tannins were isolated from the active fractions of Eugenia uniflora L., which were tested for the inhibition of EBV DNA polymerase. The results showed the 50% inhibitory concentration (IC(50)) values of gallocatechin, oenothein B, eugeniflorins D(1) and D(2) were 26.5 62.3, 3.0 and 3.5 microM, respectively. Furthermore, when compared with the positive control (phosphonoacetic acid), an inhibitor of EBV replication, the IC(50) value was 16.4 microM. In view of the results, eugeniflorins D(1) and D(2) are the potency principles in the inhibition of EBV DNA polymerase from E. uniflora. PMID:10806300

  17. DNA Polymerases Divide the Labor of Genome Replication.

    Science.gov (United States)

    Lujan, Scott A; Williams, Jessica S; Kunkel, Thomas A

    2016-09-01

    DNA polymerases synthesize DNA in only one direction, but large genomes require RNA priming and bidirectional replication from internal origins. We review here the physical, chemical, and evolutionary constraints underlying these requirements. We then consider the roles of the major eukaryotic replicases, DNA polymerases α, δ, and ɛ, in replicating the nuclear genome. Pol α has long been known to extend RNA primers at origins and on Okazaki fragments that give rise to the nascent lagging strand. Taken together, more recent results of mutation and ribonucleotide incorporation mapping, electron microscopy, and immunoprecipitation of nascent DNA now lead to a model wherein Pol ɛ and Pol δ, respectively, synthesize the majority of the nascent leading and lagging strands of undamaged DNA. PMID:27262731

  18. Engineered DNA Polymerase Improves PCR Results for Plastid DNA

    Directory of Open Access Journals (Sweden)

    Melanie Schori

    2013-02-01

    Full Text Available Premise of the study: Secondary metabolites often inhibit PCR and sequencing reactions in extractions from plant material, especially from silica-dried and herbarium material. A DNA polymerase that is tolerant to inhibitors improves PCR results. Methods and Results: A novel DNA amplification system, including a DNA polymerase engineered via directed evolution for improved tolerance to common plant-derived PCR inhibitors, was evaluated and PCR parameters optimized for three species. An additional 31 species were then tested with the engineered enzyme and optimized protocol, as well as with regular Taq polymerase. Conclusions: PCR products and high-quality sequence data were obtained for 96% of samples for rbcL and 79% for matK, compared to 29% and 21% with regular Taq polymerase.

  19. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    OpenAIRE

    Peter McInerney; Paul Adams; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differe...

  20. Plastid DNA polymerases from higher plants, Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Previously, we described a novel DNA polymerase, designated as OsPolI-like, from rice. The OsPolI-like showed a high degree of sequence homology with the DNA polymerase I of cyanobacteria and was localized in the plastid. Here, we describe two PolI-like polymerases, designated as AtPolI-like A and AtPolI-like B, from Arabidopsis thaliana. In situ hybridization analysis demonstrated expression of both mRNAs in proliferating tissues such as the shoot apical meristem. Analysis of the localizations of GFP fusion proteins showed that AtPolI-like A and AtPolI-like B were localized to plastids. AtPolI-like B expression could be induced by exposure to the mutagen H2O2. These results suggested that AtPolI-like B has a role in the repair of oxidation-induced DNA damage. Our data indicate that higher plants possess two plastid DNA polymerases that are not found in animals and yeasts

  1. Stability of randomly amplified polymorphic DNA fingerprinting in genotyping clinical isolates of Helicobacter pylori

    OpenAIRE

    Han, Feng-chan; Ng, Han-Chong; Ho, Bow

    2003-01-01

    AIM: H pylori genomes are highly diversified. This project was designed to genotype H pylori isolates by the polymerase chain reaction (PCR)-based randomly amplified polymorphic DNA (RAPD) fingerprinting technique and to verify its stability by Southern blotting and DNA sequencing.

  2. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette; Leser, T.D.; Ahrens, Peter

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due to the...

  3. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.;

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  4. Evaluation of Amplified Fragment Length Polymorphism for Differentiation of Avian Mycoplasma Species

    OpenAIRE

    Hong, Y; Garcia, M.; Levisohn, S; Lysnyansky, I.; Leiting, V.; Savelkoul, P. H. M.; Kleven, S. H.

    2005-01-01

    Amplified fragment length polymorphism (AFLP) was used for typing avian mycoplasma species. Forty-four avian mycoplasma strains were successfully typed into eight distinct groups, with each representing a different species. Homology of AFLP patterns of 35% or less was used as a cutoff value to differentiate avian mycoplasma strains into different species.

  5. An autoradiographic demonstration of nuclear DNA replication by DNA polymerase alpha and of mitochondrial DNA synthesis by DNA polymerase gamma.

    OpenAIRE

    Geuskens, M.; Hardt, N; Pedrali-Noy, G; Spadari, S

    1981-01-01

    The incorporation of thymidine into the DNA of eukaryotic cells is markedly depressed, but not completely inhibited, by aphidicolin, a highly specific inhibitor of DNA polymerase alpha. An electron microscope autoradiographic analysis of the synthesis of nuclear and mitochondrial DNA in vivo in Concanavalin A stimulated rabbit spleen lymphocytes and in Hamster cell cultures, in the absence and in the presence of aphidicolin, revealed that aphidicolin inhibits the nuclear but not the mitochond...

  6. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    OpenAIRE

    Diaz, R S; Sabino, E. C.

    1998-01-01

    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  7. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz

    1998-10-01

    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  8. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  9. Evidence implying DNA polymerase beta function in excision repair.

    OpenAIRE

    Siedlecki, J A; Szyszko, J.; Pietrzykowska, I; Zmudzka, B

    1980-01-01

    Comparison was made of the ability of calf thymus DNA polymerases alpha and beta to replicate the following templates: native E. coli CR-34 DNA (T-DNA), calf thymus DNA activated by DNase I (act.DNA), BU-DNA (from E. coli CR-34 cells cultured on BUdR-containing medium) with damages resulting from incomplete excision repair, as well as thermally denatured act.DNA and BU-DNA (s.s.act.DNA and s.s.BU-DNA). 3H-TTP incorporation during extensive replication of act.DNA was similar for both enzymes, ...

  10. Analysis of genetic diversity identified by amplified fragment length polymorphism marker in hybrid wheat.

    Science.gov (United States)

    Ejaz, M; Qidi, Z; Gaisheng, Z; Na, N; Huiyan, Z; Qunzhu, W

    2015-01-01

    Amplified fragment length polymorphism markers were used to assess genetic diversity in 10 male sterile wheat crop lines (hetero-cytoplasm with the same nucleus) in relation to a restorer wheat line. These male sterile lines were evaluated using 64 amplified fragment length polymorphism primer combinations, and 13 primers produced polymorphic bands, generating a total 682 fragments. Of the 682 fragments, 113 were polymorphic. The polymorphic information content and marker index values demonstrated the utility of the primer combinations used in the present study. Unweighted pair group method with arithmetic mean and principal coordinate analysis of the genotypic data revealed clustering of accessions based on genetic relationships, and accessions were separated into 2 groups with their restorer line. Jaccard's similarity coefficient values suggested good variability among the male sterile lines, indicating their utility in breeding programs. The fallouts of analysis of molecular variance showed large within-group population variation, accounting for 77% of variation, while among-group comparison accounted for 23% of the total molecular variation, which was statistically significant. The molecular diversity observed in this study will be useful for selecting appropriate accessions for plant improvement and hybridization through molecular-breeding approaches and for developing suitable conservation strategies. PMID:26345825

  11. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology. PMID:18979924

  12. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    Science.gov (United States)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  13. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Peter McInerney

    2014-01-01

    Full Text Available As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.

  14. Structure and mechanism of human DNA polymerase [eta

    Energy Technology Data Exchange (ETDEWEB)

    Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

    2010-11-03

    The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

  15. Taq DNA Polymerase Mutants and 2'-Modified Sugar Recognition.

    Science.gov (United States)

    Schultz, Hayley J; Gochi, Andrea M; Chia, Hannah E; Ogonowsky, Alexie L; Chiang, Sharon; Filipovic, Nedim; Weiden, Aurora G; Hadley, Emma E; Gabriel, Sara E; Leconte, Aaron M

    2015-09-29

    Chemical modifications to DNA, such as 2' modifications, are expected to increase the biotechnological utility of DNA; however, these modified forms of DNA are limited by their inability to be effectively synthesized by DNA polymerase enzymes. Previous efforts have identified mutant Thermus aquaticus DNA polymerase I (Taq) enzymes capable of recognizing 2'-modified DNA nucleotides. While these mutant enzymes recognize these modified nucleotides, they are not capable of synthesizing full length modified DNA; thus, further engineering is required for these enzymes. Here, we describe comparative biochemical studies that identify useful, but previously uncharacterized, properties of these enzymes; one enzyme, SFM19, is able to recognize a range of 2'-modified nucleotides much wider than that previously examined, including fluoro, azido, and amino modifications. To understand the molecular origins of these differences, we also identify specific amino acids and combinations of amino acids that contribute most to the previously evolved unnatural activity. Our data suggest that a negatively charged amino acid at 614 and mutation of the steric gate residue, E615, to glycine make up the optimal combination for modified oligonucleotide synthesis. These studies yield an improved understanding of the mutational origins of 2'-modified substrate recognition as well as identify SFM19 as the best candidate for further engineering, whether via rational design or directed evolution. PMID:26334839

  16. Genetic diversity in Capsicum germplasm based on microsatellite and random amplified microsatellite polymorphism markers

    OpenAIRE

    Rai, Ved Prakash; Kumar, Rajesh; Kumar, Sanjay; Rai, Ashutosh; Kumar, Sanjeet; Singh, Major; Singh, Sheo Pratap; Rai, Awadesh Bahadur; Paliwal, Rajneesh

    2013-01-01

    A sound knowledge of the genetic diversity among germplasm is vital for strategic germplasm collection, maintenance, conservation and utilisation. Genomic simple sequence repeats (SSRs) and random amplified microsatellite polymorphism (RAMPO) markers were used to analyse diversity and relationships among 48 pepper (Capsicum spp.) genotypes originating from nine countries. These genotypes covered 4 species including 13 germplasm accessions, 30 improved lines of 4 domesticated species and 5 lan...

  17. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  18. Rapid identification of some Leptospira isolates from cattle by random amplified polymorphic DNA fingerprinting.

    OpenAIRE

    Corney, B G; Colley, J; Djordjevic, S P; Whittington, R.; Graham, G C

    1993-01-01

    We compared random amplified polymorphic DNA (RAPD) fingerprinting with cross-absorption agglutination and restriction enzyme analysis for typing bovine leptospires. Using RAPD fingerprinting, we examined a number of Leptospira serovars, namely, hardjo genotypes bovis and prajitno, pomona, balcanica, tarassovi, swajizak, kremastos, australis, and zanoni, which are likely to be isolated from Australian cattle. Each serovar and genotype had a unique RAPD profile. Of 26 field isolates of Leptosp...

  19. GENETIC VARIATIONS AMONG AQUILARIA SPECIES AND GYRINOPS VERSTEEGII USING AMPLIFIED FRAGMENT LENGTH POLYMORPHISM MARKERS

    OpenAIRE

    NURITA TORUAN-MATHIUS; DEWI RAHMAWATI; ANIDAH

    2009-01-01

    Aquilaria sp. (Thymelaeaceae) is the most valuable non wood production of forestry plant in Indonesia. It produces a fragrant resin when subjected to fungal attack and has been traded internationally known as gaharu. Knowledge of genetic diversity and relationship among species and genus is important for breeding purposes and species conservation. In this study, genetic variabilityof six Aquilaria species were analyzed using the AmplifiedFragment Length Polymorphism (AFLP) markers. Ten ...

  20. Randomly Amplified Polymorphic DNA PCR as a Tool for Assessment of Marine Viral Richness▿ †

    OpenAIRE

    Winget, Danielle M.; Wommack, K Eric

    2008-01-01

    Recent discoveries have uncovered considerable genetic diversity among aquatic viruses and raised questions about the variability of this diversity within and between environments. Studies of the temporal and spatial dynamics of aquatic viral assemblages have been hindered by the lack of a common genetic marker among viruses for rapid diversity assessments. Randomly amplified polymorphic DNA (RAPD) PCR bypasses this obstacle by sampling at the genetic level without requiring viral isolation o...

  1. Fluorescent Amplified Fragment Length Polymorphism Probabilistic Database for Identification of Bacterial Isolates from Urinary Tract Infections

    OpenAIRE

    Kassama, Yankuba; Rooney, Paul J.; Goodacre, Royston

    2002-01-01

    The ability of the fluorescent amplified fragment length polymorphism (FAFLP) technique to identify bacterial isolates from urinary tract infections (UTIs) was investigated. FAFLP was carried out using the single primer combination MseI plus CT and EcoRI plus 0, and information-rich FAFLP profiles were generated from all 69 UTI isolates studied, which comprised both gram-negative and gram-positive bacteria encompassing eight genera. The genetic relatedness of these 69 bacteria was determined ...

  2. Fluorescent Amplified Fragment Length Polymorphism Analysis of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis Isolates

    OpenAIRE

    Hill, Karen K.; Ticknor, Lawrence O.; Okinaka, Richard T.; Asay, Michelle; Blair, Heather; Bliss, Katherine A.; Laker, Mariam; Pardington, Paige E.; Richardson, Amber P.; Tonks, Melinda; Beecher, Douglas J.; Kemp, John D.; Kolstø, Anne-Brit; Wong, Amy C. Lee; Keim, Paul

    2004-01-01

    DNA from over 300 Bacillus thuringiensis, Bacillus cereus, and Bacillus anthracis isolates was analyzed by fluorescent amplified fragment length polymorphism (AFLP). B. thuringiensis and B. cereus isolates were from diverse sources and locations, including soil, clinical isolates and food products causing diarrheal and emetic outbreaks, and type strains from the American Type Culture Collection, and over 200 B. thuringiensis isolates representing 36 serovars or subspecies were from the U.S. D...

  3. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter; Johansson, K.E.

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...... found by 16S rDNA analysis. The present data support previous observations regarding genetic homogeneity of M. capricolum subsp. capripneumoniae, and confirm the two evolutionary lines of descent found by analysis of 16S rRNA genes....

  4. Fluorescent Amplified Fragment Length Polymorphism Subtyping of Multiresistant Salmonella enterica Serovar Typhimurium DT104

    OpenAIRE

    Lawson, Andrew J.; Stanley, John; Threlfall, E. John; Desai, Meeta

    2004-01-01

    Fluorescent amplified fragment length polymorphism (FAFLP) subtyping analysis was used to genotype multiresistant Salmonella enterica serovar Typhimurium definitive phage type 104. Thirteen distinct FAFLP profiles were found among 85 isolates exhibiting identical pulsed-field gel electrophoresis (PFGE) profiles. A single FAFLP profile was shared by 93% of outbreak-associated isolates and 82% of sporadic isolates. This study demonstrates the value of FAFLP as a high-resolution tool for epidemi...

  5. Expression of adenovirus type 2 DNA polymerase in insect cells infected with a recombinant baculovirus.

    OpenAIRE

    Watson, C J; Hay, R T

    1990-01-01

    Sequences encoding adenovirus type 2 DNA polymerase were placed under control of the polyhedrin promoter and inserted into the baculovirus Autographa californica nuclear polyhedrosis virus by homologous recombination. Insect cells infected with the recombinant virus produced substantial amounts of the adenovirus type 2 DNA polymerase protein which was functional in both DNA polymerase and replication initiation reactions. Thus, the baculovirus expression system can provide active adenovirus t...

  6. Taking Fingerprints of DNA Polymerases : Multiplex Enzyme Profiling on DNA Arrays

    OpenAIRE

    Kranaster, Ramon; Marx, Andreas

    2009-01-01

    DNA polymerases are used in a plethora of biotechnical applications, especially in the polymerase chain reaction (PCR), genetic cloning procedures, genome sequencing, and diagnostic methods.[1] Highly processive and accurate DNA polymerases are desired for cloning procedures in order to give shorter extension times as well as more robust and highyield amplification. A higher DNA polymerase fidelity may increase the reliability of genome sequencing and diagnostic systems.[2] Amplification of a...

  7. The Use of Random Amplified Polymorphic DNA (RAPD) Markers in Sex Discrimination in Nile Tilapia, Oreochromis niloticus (Pisces: Cichlidae)

    OpenAIRE

    Bardakci, Fevzi

    2000-01-01

    Random amplified polymorphic DNA (RAPD) markers were successfully used in discrimination of sexes in Nile tilapia fish ( Oreochromis niloticus) using linear discriminant function analysis. The results provide support for the view that major genetical sex determining factors exist in tilapia.

  8. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko; Manning, G.; Cheasty, T.; Newell, D. G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according to th...

  9. A NEW APPROACH TO GENE DIAGNOSIS OF DUCHENNE/BECKER MUSCULAR DYSTROPHY AMPLIFIED FRAGMENT LENGTH POLYMORPHISMS

    Institute of Scientific and Technical Information of China (English)

    许顺斌; 黄尚志; 罗会元

    1994-01-01

    Four (CA), repeats, located in introns,44,45,49 and 50 of the dystrophin gene,were evaluated in Chinese.These loci are highly polymorphic,with polymorphism information contents of 0.872,0.772,0.870 and 0.718,respectively.All four loci can be easily amplified and labelled using two duplex PCR reactions with α-32P-dCTP and can be detected by denaturing polyacrylamide gel electrophoresis.Using these four loci and the two polymorphic(CA)n repeats located at the 5′ and 3′ ends of the dystrophin gene,we have developed a new PCR-based procedure-Amp-FLP( amplified fragment length polymorphism)linkage analysis for the gene diagnosis of DMD/BMD.This method can detect intragenic recombination rapidly and efficiently and greatly improves the success rate of carrier deterction and prenatal diagnosis in non-deletion DMD/BMD families.All of the loci used in this procedure are intragenic.In addition ,the loci in introns 44,45,49 and 50 are located in the deletion-prone region of the dystrophin gene,making them valuable and usefui in the identification of deletion mutations.Here we report one case of deletion detection using these four loci.

  10. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    OpenAIRE

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - base...

  11. DNA polymerase III requirement for repair of DNA damage caused by methyl methanesulfonate and hydrogen peroxide

    International Nuclear Information System (INIS)

    The pcbA1 mutation allows DNA replication dependent on DNA polymerase I at the restrictive temperature in polC(Ts) strains. Cells which carry pcbA1, a functional DNA polymerase I, and a temperature-sensitive DNA polymerase III gene were used to study the role of DNA polymerase III in DNA repair. At the restrictive temperature for DNA polymerase III, these strains were more sensitive to the alkylating agent methyl methanesulfonate (MMS) and hydrogen peroxide than normal cells. The same strains showed no increase in sensitivity to bleomycin, UV light, or psoralen at the restrictive temperature. The sensitivity of these strains to MMS and hydrogen peroxide was not due to the pcbAl allele, and normal sensitivity was restored by the introduction of a chromosomal or cloned DNA polymerase III gene, verifying that the sensitivity was due to loss of DNA polymerase III alpha-subunit activity. A functional DNA polymerase III is required for the reformation of high-molecular-weight DNA after treatment of cells with MMS or hydrogen peroxide, as demonstrated by alkaline sucrose sedimentation results. Thus, it appears that a functional DNA polymerase III is required for the optimal repair of DNA damage by MMS or hydrogen peroxide

  12. Effect of gamma-irradiated DNA on DNA polymerase activity: a possible mechanism for cell killing

    International Nuclear Information System (INIS)

    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. The mechanism for DNA polymerase inhibition was investigated. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme. The inhibition of DNA polymerase occurs prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation. As in vitro assay for DNA polymerase α and β in irradiated HeLa cells was developed. The activities of both polymerases decreased as the dose received by the cells increased. Both DNA polymerases were found to recover by 2 hr postirradiation. Since DNA repair capability is intimately connected with cell survival, the observed diminution in DNA polymerase activity, following low doses of radiation, could be highly significant

  13. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  14. Overproduction of DnaE protein (alpha subunit of DNA polymerase III) restores viability in a conditionally inviable Escherichia coli strain deficient in DNA polymerase I.

    OpenAIRE

    Witkin, E M; Roegner-Maniscalco, V

    1992-01-01

    A polA12 recA718 double mutant of Escherichia coli, in which DNA polymerase I is temperature sensitive, was unable to maintain normal DNA synthesis or to form colonies on rich media at 42 degrees C. Overproduction of DnaE protein, the polymerizing alpha subunit of DNA polymerase III, restored bacterial DNA replication and cell viability, as well as the PolI-dependent replication of the plasmid carrying dnaE.

  15. Estimation of genetic variability among elite wheat genotypes using random amplified polymorphic DNA (RAPD) analysis

    International Nuclear Information System (INIS)

    Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)

  16. Analysis of Genetic Diversity and Relationships in a Tunisian Fig (Ficus carica) Germplasm Collection by Random Amplified Microsatellite Polymorphisms

    Institute of Scientific and Technical Information of China (English)

    Khaled Chatti; Olfa Saddoud; Amel Salhi-Hannachi; Messaoud Mars; Mohamed Marrakchi; Mokhtar Trifi

    2007-01-01

    The random amplified mirosatellite polymorphism method was performed in a set of Tunisian fig landraces using eighteen primer combinations. Atotal of sixty three random amplified microsatellite polymorphism (RAMPO) markers were scored and used either to assess the genetic diversity in these cultivars or to detect cases of mislabeling. Opportunely, data proved that the designed procedure constitutes an attractive and fast method with low costs and prevents radio exposure. As a result, we have identified the primer combinations that are the most efficient to detect genetic polymorphism in this crop. Therefore, the derived unweighted pair-group method with arithmetic averages (UPGMA) dendrogram illustrates the genetic divergence among the landraces studied and exhibits a typically continuous variation. Moreover, no evident correlation between the sexes of trees was observed. In addition, using these markers, discrimination between landraces has been achieved. Thus, random amplified mirosatellite polymorphism is proved to be powerful for characterizing the local fig germplasm.

  17. Use of Random Amplified Polymorphic DNA Analysis for Economically Important Food Crops

    Institute of Scientific and Technical Information of China (English)

    Halima Hassan Salem; Bahy Ahmed Ali; Tian-Hua Huang; Da-Nian Qin; Xiao-Mei Wang; Qing-Dong Xie

    2007-01-01

    The objective of this review is to summarize numerous studies on the use of the random amplified polymorphic DNA (RAPD) technique on rice, corn, wheat, sorghum, barley, rye, and oats to examine its feasibility and validity for assessment of genetic variation, population genetics, mapping, linkage and marker assisted selection, phylogenetic analysis, and the detection of somaclonal variation.Also we discuss the advantages and limitations of RAPD.Molecular markers have entered the scene of genetic improvement in different fields of agricultural research.The simplicity of the RAPD technique made it ideal for genetic mapping, plant and animal breeding programs, and DNA fingerprinting, with particular utility in the field of population genetics.

  18. Genetic diversity in Capsicum germplasm based on microsatellite and random amplified microsatellite polymorphism markers.

    Science.gov (United States)

    Rai, Ved Prakash; Kumar, Rajesh; Kumar, Sanjay; Rai, Ashutosh; Kumar, Sanjeet; Singh, Major; Singh, Sheo Pratap; Rai, Awadesh Bahadur; Paliwal, Rajneesh

    2013-10-01

    A sound knowledge of the genetic diversity among germplasm is vital for strategic germplasm collection, maintenance, conservation and utilisation. Genomic simple sequence repeats (SSRs) and random amplified microsatellite polymorphism (RAMPO) markers were used to analyse diversity and relationships among 48 pepper (Capsicum spp.) genotypes originating from nine countries. These genotypes covered 4 species including 13 germplasm accessions, 30 improved lines of 4 domesticated species and 5 landraces derived from natural interspecific crosses. Out of 106 SSR markers, 25 polymorphic SSR markers (24 %) detected a total of 76 alleles (average, 3.04; range, 2-5). The average polymorphic information content (PIC) was 0.69 (range, 0.29-0.92). Seventeen RAMPO markers produced 87 polymorphic fragments with average PIC of 0.63 (range, 0.44-0.81). Dendrograms based on SSRs and RAMPOs generated two clusters. All 38 Capsicum annuum genotypes and an interspecific landrace clustered together, whereas nine non-annuum (three Capsicum frutescens, one Capsicum chinense, one Capsicum baccatum and four interspecific landraces) genotypes clustered separately. Genetic variation within non-annuum genotypes was greater than the C. annuum genotypes. Distinctness of interspecific derivative landraces grown in northeast India was validated; natural crossing between sympatric Capsicum species has been proposed as the mechanism of their origin. PMID:24431527

  19. Design and characterization of N2-arylaminopurines which selectively inhibit replicative DNA synthesis and replication-specific DNA polymerases: guanine derivatives active on mammalian DNA polymerase alpha and bacterial DNA polymerase III.

    OpenAIRE

    Wright, G E; Baril, E F; Brown, V M; Brown, N C

    1982-01-01

    The 2-amino substituted derivatives of guanine, N2-(p-n-butylphenyl)guanine (BuPG) and N2-(3',4'-trimethylenephenyl) guanine (TMPG), were synthesized and found to selectively inhibit, respectively, HeLa cell DNA polymerase alpha (po1 alpha) and B. subtilis DNA polymerase III (po1 III). Both purines, like their corresponding uracil analogs, BuAu and TMAU (2,9), were specifically competitive with dGTP in their inhibitory action on their target polymerases. BuPG, the pol alpha-specific purine, w...

  20. DNA polymerase zeta (polζ) in higher eukaryotes

    Institute of Scientific and Technical Information of China (English)

    Gregory N Gan; John P Wittschieben; Birgitte φ Wittschieben; Richard D Wood

    2008-01-01

    Most current knowledge about DNA polymerase zeta (pol ζ) comes from studies of the enzyme in the budding yeast Saccharomyces cerevisiae, where polζ consists of a complex of the catalytic subunit Rev3 with Rev7, which associates with Rev1. Most spontaneous and induced mutagenesis in yeast is dependent on these gene products, and yeast pol can mediate translesion DNA synthesis past some adducts in DNA templates. Study of the homologous gene products in higher eukaryotes is in a relatively early stage, but additional functions for the eukaryotic proteins are already appar-ent. Suppression of vertebrate REV3L function not only reduces induced point mutagenesis but also causes larger-scale genuine instability by raising the frequency of spontaneous chromosome translocations. Disruption of Rev3L function is tolerated in Drosophila, Arabidopsis, and in vertebrate cell lines under some conditions, but is incompatible with mouse embryonic development. Functions for REV3L and REV7(MAD2B) in higher eukaryotes have been suggested not only in translesion DNA synthesis but also in some forms of homologous recombination, repair ofinterstrand DNA erosslinks, somatic hypermutation of immunoglobulin genes and cell-cycle control. This review discusses recent devel-opments in these areas.

  1. Amethod for genotoxicity detection using random amplified polymorphism DNA with Danio rerio

    Institute of Scientific and Technical Information of China (English)

    RongZY; YinHW

    2002-01-01

    The increasing presence of genotoxic pollutants in the equatic environment has led to the development of quick monitoring methods.We have applied the random amplified polymorphism DNA(RKAPD) method to evaluate the toxic effects of genotoxic chemicals.In all 22 of normal wild type Danio rerio(zebrafish),78 amplified bands were obtained after PCR using primers set,in which the frequency of emergency above 60 percent is 21.There do exist 4 stable bands in the amplifed product,which appear in all normal test samples.The zebrafish RAPD fingerprinting database is set up on this base.The RAPD pattern from zebrafishes exposed to genotoxic chemicals such as cyclophosphamide 0.1-10mg·L-1 and dimethoate 10-100mg·L-1 displayed some changes in polymorphism of band pattern including the lost of stable bands.There also exists distinct distance between the band pattern of exposed zebrafishes and the control samples via the cluster method.In addition,the result derived from numeric analysis is more sensitive than the result obtained from stable band analysis because it can reveal the distance between the band pattern of 0.05mg·L-1 cyclophosphamide exposed zebrafish and the control sample.These results showed the accuracy and the sensitivity of the two analyses of genotoxicity based on the RAPD fingerprinting research.

  2. Physical mapping of drug resistance mutations defines an active center of the herpes simplex virus DNA polymerase enzyme.

    OpenAIRE

    Knopf, K W; Kaufman, E R; Crumpacker, C

    1981-01-01

    The genome structures of herpes simplex virus type 1 (HSV-1)/HSV-2 intertypic recombinants have been previously determined by restriction endonuclease analysis, and these recombinants and their parental strains have been employed to demonstrate that mutations within the HSV DNA polymerase locus induce an altered HSV DNA polymerase activity, exhibiting resistance to three inhibitors of DNA polymerase. The viral DNA polymerases induced by two recombinants and their parental strains were purifie...

  3. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M F; Bosio, C. F.; COTTON, J; W. Sweeney; Strand, M.R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  4. Characterization of novel hepadnaviral RNA species accumulated in hepatoma cells treated with viral DNA polymerase inhibitors.

    Science.gov (United States)

    Zhang, Pinghu; Liu, Fei; Guo, Fang; Zhao, Qiong; Chang, Jinhong; Guo, Ju-Tao

    2016-07-01

    Inhibitors of hepadnaviral DNA polymerases are predicted to inhibit both minus and plus strand of viral DNA synthesis and arrest viral DNA replication at the stage of pregenomic (pg) RNA-containing nucleocapsids. However, analyses of the RNA species of human and duck hepatitis B viruses (HBV and DHBV, respectively) in hepatoma cells treated with viral DNA polymerase inhibitors revealed the genesis of novel RNA species migrating slightly faster than the full-length pgRNA. The DNA polymerase inhibitor-induced accumulation of these RNA species were abolished in the presence of alpha-interferon or HBV nucleocapsid assembly inhibitors. Moreover, they were protected from microccocal nuclease digestion and devoid of a poly-A tail. These characteristics suggest that the novel RNA species are most likely generated from RNase H cleavage of encapsidated pgRNA, after primer translocation and synthesis of the 5' terminal portion of minus strand DNA. In support of this hypothesis, DNA polymerase inhibitor treatment of chicken hepatoma cells transfected with a DHBV genome encoding an RNase H inactive DNA polymerase (E696H) failed to produce such RNA species. Our results thus suggest that the currently available DNA polymerase inhibitors do not efficiently arrest minus strand DNA synthesis at the early stage in hepatocytes. Hence, development of novel antiviral agents that more potently suppress viral DNA synthesis or viral nucleocapsid assembly inhibitors that are mechanistically complementary to the currently available DNA polymerase inhibitors are warranted. PMID:27083116

  5. Mapping and mutation of the conserved DNA polymerase interaction motif (DPIM located in the C-terminal domain of fission yeast DNA polymerase δ subunit Cdc27

    Directory of Open Access Journals (Sweden)

    Warbrick Emma

    2004-12-01

    Full Text Available Abstract Background DNA polymerases α and δ play essential roles in the replication of chromosomal DNA in eukaryotic cells. DNA polymerase α (Pol α-primase is required to prime synthesis of the leading strand and each Okazaki fragment on the lagging strand, whereas DNA polymerase δ (Pol δ is required for the elongation stages of replication, a function it appears capable of performing on both leading and lagging strands, at least in the absence of DNA polymerase ε (Pol ε. Results Here it is shown that the catalytic subunit of Pol α, Pol1, interacts with Cdc27, one of three non-catalytic subunits of fission yeast Pol δ, both in vivo and in vitro. Pol1 interacts with the C-terminal domain of Cdc27, at a site distinct from the previously identified binding sites for Cdc1 and PCNA. Comparative protein sequence analysis identifies a protein sequence motif, called the DNA polymerase interaction motif (DPIM, in Cdc27 orthologues from a wide variety of eukaryotic species, including mammals. Mutational analysis shows that the DPIM in fission yeast Cdc27 is not required for effective DNA replication, repair or checkpoint function. Conclusions The absence of any detectable phenotypic consequences arising from mutation of the DPIM suggests that despite its evolutionary conservation, the interaction between the two polymerases mediated by this motif is a non-essential one.

  6. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    OpenAIRE

    Miura, Masashi; Tanigawa, Chihiro; Fujii, Yoshito; Kaneko, Satoshi

    2013-01-01

    The use of a "direct PCR" DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA poly...

  7. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    OpenAIRE

    Masashi Miura; Chihiro Tanigawa; Yoshito Fujii; Satoshi Kaneko

    2013-01-01

    SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard ...

  8. Meiosis in Coprinus: characterization and activities of two forms of DNA polymerase during meiotic stages.

    OpenAIRE

    K. Sakaguchi; Lu, B C

    1982-01-01

    Two forms of DNA polymerase have been studied in the basidiomycete Coprinus. DNA polymerase from basidiocarp tissues at zygotene-pachytene stage has been purified 3,500-fold and defined as DNA polymerase b by virtue of its insensitivity to N-ethylmaleimide and by its low molecular weight (76,000). This enzyme has optimal activity at pH 7.0 to 7.5, at 200 mM KCl, and at 25 degrees C incubation temperature. It can use polycytidylic acid-oligo(dG)12-18 as template primer in addition to homodeoxy...

  9. DNA synthesis on discontinuous templates by human DNA polymerases: implications for non-homologous DNA recombination.

    OpenAIRE

    Islas, L; Fairley, C F; Morgan, W. F.

    1998-01-01

    DNA polymerases catalyze the synthesis of DNA using a continuous uninterrupted template strand. However, it has been shown that a 3'-->5' exonuclease-deficient form of the Klenow fragment of Escherichia coli DNA polymerase I as well as DNA polymerase of Thermus aquaticus can synthesize DNA across two unlinked DNA templates. In this study, we used an oligonucleotide-based assay to show that discontinuous DNA synthesis was present in HeLa cell extracts. DNA synthesis inhibitor studies as well a...

  10. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.; Gram, Lone; Ahrens, Peter

    2004-01-01

    other methods. Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was...... different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included for...... virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  11. Genetic variation in Opisthorchis viverrini (Trematoda: Opisthorchiidae) from northeast Thailand and Laos PDR based on random amplified polymorphic DNA analyses

    OpenAIRE

    Sithithaworn, Paiboon; Nuchjungreed, Chadaporn; Srisawangwong, Tuanchai; Ando, Katsuhiko; Petney, Trevor N.; Chilton, Neil B.; Andrews, Ross H.

    2006-01-01

    Genetic variation in Opisthorchis viverrini adults originating from different locations in northeast Thailand and Laos, People’s Democratic Republic (PDR), was examined using random amplified polymorphic DNA (RAPD) analyses. In an initial analysis, the genomic DNA of one fluke from each of ten localities was amplified using 15 random primers (10-mers); however, genetic variation among O. viverrini specimens was detected reliably for only four primers. A more detailed RAPD analysis using these...

  12. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-01-01

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level. PMID:26782491

  13. Roles of DNA polymerase epsilon and TopBP1 in DNA replication and damage response

    OpenAIRE

    Hillukkala, T.

    2006-01-01

    Abstract During DNA replication cells accurately copy their DNA to transfer the genetic information to daughter cells. DNA polymerases synthesise the new DNA strand using the old strand as a template. Other functions of DNA polymerases are recombination linked and DNA iamage repair linked DNA synthesis, regulation of replication complex formation and regulation of transcription – a process in which the genetic information is transformed into an RNA sequence needed to guide protein synthesi...

  14. Single molecule measurement of the “speed limit” of DNA polymerase

    OpenAIRE

    Schwartz, Jerrod J.; Quake, Stephen R

    2009-01-01

    Although DNA replication is often imagined as a regular and continuous process, the DNA polymerase enzyme is a complicated machine and can pause upon encountering physical and chemical barriers. We used single molecule measurements to make a detailed characterization of this behavior as a function of the template's secondary structure and the sequence context. Strand displacement replication through a DNA hairpin by single DNA polymerase molecules was measured in real time with near single ba...

  15. Replacing 32 Proline Residues by a Noncanonical Amino Acid Results in a Highly Active DNA Polymerase

    OpenAIRE

    Holzberger, Bastian; Marx, Andreas

    2010-01-01

    Protein engineering may be achieved by rational design, directed evolution-based methods, or computational protein design. Mostly these methods make recourse to the restricted pool of the 20 natural amino acids. With the ability to introduce different new kinds of functionalities into proteins, the use of noncanonical amino acids became a promising new method in protein engineering. Here, we report on the generation of a multifluorinated DNA polymerase. DNA polymerases are highly dynamic enzy...

  16. Molecular Characterization of Some Turkish Olive Cultivars Using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    Ergün KAYA

    2015-03-01

    Full Text Available Olive (Olea europea L. is one of the oldest cultivated plants characteristic in the Mediterranean area, where it is the most important oilproducing crop. The cultivated olive (O. europaea L. var. europaea is propagated by cutting or grafting, whereas wild olive (O. europaea L. var. sylvestris is reproduced from seeds. These two olive types are interfertile and have led to a large number of varieties. Morphological descriptions are not entirely reliable, due to numerous synonyms and homonyms in designations, labelling mistakes, the presence of varietal clones, and the uncertain identification methods thus far applied. Molecular markers, as random amplified polymorphic DNA (RAPD markers, are environment-independent and efficient to identify olive varieties and to detect synonymous and homonymous. In this study, fifteen selected RAPD markers are used for determination of relationships among twenty individuals belonging to four important Turkish olive cultivars. Our results showed that RAPD markers can be used to differentiate olive cultivars

  17. Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera: Culicidae: Anopheles).

    Science.gov (United States)

    Wilkerson, R C; Parsons, T J; Albright, D G; Klein, T A; Braun, M J

    1993-01-01

    The usefulness of random amplified polymorphic DNA (RAPD) was examined as a potential tool to differentiate cryptic mosquito species. It proved to be a quick, effective means of finding genetic markers to separate two laboratory populations of morphologically indistinguishable African malaria vectors, Anopheles gambiae and An. arabiensis. In an initial screening of fifty-seven RAPD primers, 377 bands were produced, 295 of which differed between the two species. Based on criteria of interpretability, simplicity and reproducibility, thirteen primers were chosen for further screening using DNA from thirty individuals of each species. Seven primers produced diagnostic bands, five of which are described here. Some problematic characteristics of RAPD banding patterns are discussed and approaches to overcome these are suggested. PMID:8269099

  18. [Identification of Aloe species by random amplified polymorphic DNA (RAPD) analysis].

    Science.gov (United States)

    Shioda, Hiroko; Satoh, Kanako; Nagai, Fumiko; Okubo, Tomoko; Seto, Takako; Hamano, Tomoko; Kamimura, Hisashi; Kano, Itsu

    2003-08-01

    Juice and integument of leaves of 3 Aloe species, Aloe vera, A. ferox and A. africana, are not allowed to be used as food according to the Pharmaceutical Affairs Law in Japan. On the other hand, whole leaves of A. arborescens can be used as food. The present study was designed to distinguish Aloe species by random amplified polymorphic DNA (RAPD) analysis. DNA was isolated from fresh and dried leaves of the 4 Aloe species. Five out of 32 different 10-mer primers examined were useful for analysis. By comparison of the characteristic bands of PCR products on agarose gel, it was possible to distinguish the 4 species. Thus, the botanical species of Aloe in commercial food products can be identified by RAPD analysis. PMID:14606430

  19. Comparative Serological and Random Amplified Polymorphic DNA Typing for Bordetella avium Isolates in China

    Directory of Open Access Journals (Sweden)

    Ping-Ping Yang, Rong-De Ma1, Xue Zhao and Rui-Liang Zhu*

    2012-10-01

    Full Text Available To study the similarity among Bordetella avium isolates in China, antigens and diagnostic antiserum of 22 B. avium isolates were prepared for serotyping, and a set of 20 commercially available primers was screened out to identify suitable primers for random amplified polymorphic DNA fingerprinting (RAPD analysis in this study. Twenty-two B. avium isolates were divided into two serovars (A and B based on their reaction in the plate-agglutination test. Four primers R1, R2, R4 and R10 resulted in informative fingerprints and were used to evaluate the B. avium isolates. Based on their RAPD patterns, a dendrogram allowed the separation of the B. avium isolates into six genetic similarity clusters. However, no direct correlation was observed between serotypes and RAPD typing among the isolates.

  20. Random amplified polymorphic DNA analysis of Anopheles nuneztovari (Diptera: Culicidae from Western and Northeastern Colombia

    Directory of Open Access Journals (Sweden)

    Carmen Elisa Posso

    2003-06-01

    Full Text Available Random amplified polymorphic DNA (RAPD markers were used to analyze 119 DNA samples of three Colombian Anopheles nuneztovari populations to study genetic variation and structure. Genetic diversity, estimated from heterozygosity, averaged 0.34. Genetic flow was greater between the two populations located in Western Colombia (F ST: 0.035; Nm: 6.8 but lower between these two and the northeastern population (F ST: 0.08; Nm: 2.8. According to molecular variance analysis, the genetic distance between populations was significant (phiST 0.1131, P < 0.001. The variation among individuals within populations (phiST 0.8869, P < 0.001was also significant, suggesting a greater degree of population subdivision, not considered in this study. Both the parameters evaluated and the genetic flow suggest that Colombian An. nuneztovari populations are co-specific.

  1. Molecular diversity of Renibacterium salmoninarum isolates determined by randomly amplified polymorphic DNA analysis.

    Science.gov (United States)

    Grayson, T H; Atienzar, F A; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-01-01

    The molecular diversity among 60 isolates of Renibacterium salmoninarum which differ in place and date of isolation was investigated by using randomly amplified polymorphic DNA (RAPD) analysis. Isolates were grouped into 21 banding patterns which did not reflect the biological source. Four 16S-23S rRNA intergenic spacer (ITS1) sequence variations and two alleles of an exact tandem repeat locus, ETR-A, were the bases for formation of distinct groups within the RAPD clusters. This study provides evidence that the most common ITS1 sequence variant, SV1, possesses two copies of a 51-bp repeat unit at ETR-A and has been widely dispersed among countries which are associated with mainstream intensive salmonid culture. PMID:10618262

  2. Genetic variability analysis among clinical Candida spp. isolates using random amplified polymorphic DNA

    Directory of Open Access Journals (Sweden)

    Patrícia M Pinto

    2004-03-01

    Full Text Available The patterns of genetic variation of samples of Candida spp. isolated from patients infected with human immunodeficiency virus in Vitória, state of Espírito Santo, Brazil, were examined. Thirty-seven strains were isolated from different anatomical sites obtained from different infection episodes of 11 patients infected with the human immunodeficiency virus (HIV. These samples were subjected to randomly amplified polymorphic DNA (RAPD analysis using 9 different primers. Reproducible and complex DNA banding patterns were obtained. The experiments indicated evidence of dynamic process of yeast colonization in HIV-infected patients, and also that certain primers are efficient in the identification of species of the Candida genus. Thus, we conclude that RAPD analysis may be useful in providing genotypic characters for Candida species typing in epidemiological investigations, and also for the rapid identification of pathogenic fungi.

  3. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  4. Possible Role of DNA Polymerase beta in Protecting Human Bronchial Epithelial Cells Against Cytotoxicity of Hydroquinone

    Institute of Scientific and Technical Information of China (English)

    DA-LIN HU; JIAN-PING YANG; DAO-KUI FANG; YAN SHA; XIAO-ZHI TU; ZHI-XIONG ZHUANG; HUAN-WEN TANG; HAI-RONG LIANG; DONG-SHENG TANG; YI-MING LIU; WEI-DONG JI; JIAN-HUI YUAN; YUN HE; ZHENG-YU ZHU

    2007-01-01

    Objective To explore the toxicological mechanism of hydroquinone in human bronchial epithelial cells and to investigate whether DNA polymerase beta is involved in protecting cells from damage caused by hydroquinone. Methods DNA polymerase beta knock-down cell line was established via RNA interference as an experimental group. Normal human bronchial epithelial cells and cells transfected with the empty vector of pEGFP-Cl were used as controls. Cells were treated with different concentrations of hydroquinone (ranged from 10 μmol/L to 120 μmol/L) for 4 hours. MTT assay and Comet assay [single-cell gel electrophoresis (SCGE)] were performed respectively to detect the toxicity of hydroquinone. Results MTT assay showed that DNA polymerase beta knock-down cells treated with different concentrations of hydroquinone had a lower absorbance value at 490 nm than the control cells in a dose-dependant manner. Comet assay revealed that different concentrations of hydroquinone caused more severe DNA damage in DNA polymerase beta knock-down cell line than in control cells and there was no significant difference in the two control groups. Conclusions Hydroquinone has significant toxicity to human bronchial epithelial cells and causes DNA damage. DNA polymerase beta knock-down cell line appears more sensitive to hydroquinone than the control cells. The results suggest that DNA polymerase beta is involved in protecting cells from damage caused by hydroquinone.

  5. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Directory of Open Access Journals (Sweden)

    Cheng-Yao eChen

    2014-06-01

    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  6. Development of Random Amplified Polymorphism DNA Markers Linked to Powdery Mildew Resistance Gene in Melon

    Directory of Open Access Journals (Sweden)

    Budi Setiadi Daryono

    2015-11-01

    Full Text Available A random amplified polymorphic DNA (RAPD marker linked to powdery mildew resistance gene (Pm-I in melon PI 371795 was reported. However, the RAPD marker has problem in scoring. To detect powdery mildew resistance gene (Pm-I in melon accurately, the RAPD marker was cloned and sequenced to design sequence characterized amplified region (SCAR markers. SCAPMAR5 marker derived from pUBC411 primer yielded a single DNA band at 1061 bp. Segregation of SCAPMAR5 marker in bulk of F2 plants demonstrated that the marker was co-segregated with RAPD marker from which the SCAR marker was originated. Moreover, results of SCAR analysis in diverse melons showed SCAPMAR5 primers obtained a single 1061 bp linked to Pm-I in resistant melon PI 371795 and PMAR5. On the other hand, SCAPMAR5 failed to detect Pm-I in susceptible melons. Results of this study revealed that SCAR analysis not only confirmed melons that had been clearly scored for resistance to Pm-I evaluated by RAPD markers, but also clarified the ambiguous resistance results obtained by the RAPD markers.   Key words: Cucumis melo L., Pm-I, RAPD, SCAPMAR5

  7. Application of restriction site amplified polymorphism (RSAP) to genetic diversity in Saccharina japonica

    Science.gov (United States)

    Zhao, Cui; Liu, Cui; Li, Wei; Chi, Shan; Feng, Rongfang; Liu, Tao

    2013-07-01

    Restriction site amplified polymorphism (RSAP) was used, for the first time, to analyze the genetic structure and diversity of four, mainly cultivated, varieties of the brown alga, Saccharina japonica. Eighty-eight samples from varieties " Rongfu ", " Fujian ", " Ailunwan " and " Shengchanzhong " were used for the genetic analyses. One hundred and ninety-eight bands were obtained using eight combinations of primers. One hundred and ninety-one (96.46%) were polymorphic bands. Nei's genetic diversity was 0.360, and the coefficient of genetic differentiation was 0.357. No inbreeding-type recession was found in the four brown alga varieties and the results of the " Ailunwan " variety using samples from 2 years showed that the variety was becoming less diverse during the selection inherent in the breeding program. Genetic diversity and cluster analyses results were consistent with these genetic relationships. The results show the RSAP method is suitable for genetic analysis. Continuous inbreeding and selection could reduce the genetic diversity effectively; therefore periodical supervision is required.

  8. Application of restriction site amplified polymorphism (RSAP) to genetic diversity in Saccharina japonica

    Institute of Scientific and Technical Information of China (English)

    ZHAO Cui; LIU Cui; LI Wei; CHI Shan; FENG Rongfang; LIU Tao

    2013-01-01

    Restriction site amplified polymorphism (RSAP) was used,for the first time,to analyze the genetic structure and diversity of four,mainly cultivated,varieties of the brown alga,Saccharinajaponica.Eighty-eight samples from varieties "Rongfu","Fujian","Ailunwan" and "Shengchanzhong" were used for the genetic analyses.One hundred and ninety-eight bands were obtained using eight combinations of primers.One hundred and ninety-one (96.46%) were polymorphic bands.Nei's genetic diversity was 0.360,and the coefficient of genetic differentiation was 0.357.No inbreeding-type recession was found in the four brown alga varieties and the results of the "Ailunwan" variety using samples from 2 years showed that the variety was becoming less diverse during the selection inherent in the breeding program.Genetic diversity and cluster analyses results were consistent with these genetic relationships.The results show the RSAP method is suitable for genetic analysis.Continuous inbreeding and selection could reduce the genetic diversity effectively; therefore periodical supervision is required.

  9. Genetic Variability in Rhizoctonia solani Isolated from Vitis vinifera Based on Amplified Fragment Length Polymorphism

    Directory of Open Access Journals (Sweden)

    Amparo Meza-Moller

    2011-01-01

    Full Text Available Problem statement: Rhizoctonia solani is a potential grapevine pathogen. In order to develop effective methods of control, it is necessary to document its genetic diversity. Approach: The objective of this study was to analyze the genetic variability of R. solani isolated from the rhizosphere of ungrafted V. vinifera var. perlette seedless planted in Sonora, Mexico using Amplified Fragment Length Polymorphism (AFLP. Results: In the selective amplification using eight primer combinations we obtained a total of 446 AFLP markers with a 100% polymorphism. Out of 41 isolates, 36 different AFLP patterns were observed and five were replicates of the same pattern. The dendrogram shows inter- and intrapopulation similarity indexes of 0.26, 0.98 and 0.31, 0.98, respectively. Six groups emerged from the principal components analysis, five of which were clearly defined, while the other one was spread out. Conclusion: We conclude that R. solani growing in Sonoran vineyards shows a high degree of genetic variability, even under similar environmental conditions.

  10. Genetic diversity and relationship of chicory (Cichorium intybus L.) using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Liang, X Y; Zhang, X Q; Bai, S Q; Huang, L K; Luo, X M; Ji, Y; Jiang, L F

    2014-01-01

    Chicory is a crop with economically important roles and is cultivated worldwide. The genetic diversity and relationship of 80 accessions of chicories and endives were evaluated by sequence-related amplified polymorphism (SRAP) markers to provide a theoretical basis for future breeding programs in China. The polymorphic rate was 96.83%, and the average polymorphic information content was 0.323, suggesting the rich genetic diversity of chicory. The genetic diversity degree of chicory was higher (GS = 0.677) than that of endive (GS = 0.701). The accessions with the highest genetic diversity (effective number of alleles, NE = 1.609; Nei's genetic diversity, H = 0.372; Shannon information index, I = 0.556) were from Italy. The richest genetic diversity was revealed in a chicory line (NE = 1.478, H = 0.289, I = 0.443) among the 3 types (line, wild, and cultivar). The chicory genetic structure of 8 geographical groups showed that the genetic differentiation coefficient (GST) was 14.20% and the number of immigrants per generation (Nm) was 3.020. A GST of 6.80% and an Nm of 6.853 were obtained from different types. This observation suggests that these chicory lines, especially those from the Mediterranean region, have potential for providing rich genetic resources for further breeding programs, that the chicory genetic structure among different countries obviously differs with a certain amount of gene flow, and that SRAP markers could be applied to analyze genetic relationships and classifications of Cichorium intybus and C. endivia. PMID:25299087

  11. Randomly Amplified Polymorphic DNA of Trichoderma isolates and antagonism against Rhizoctonia solani

    Directory of Open Access Journals (Sweden)

    Larissa Brandão Góes

    2002-06-01

    Full Text Available Random Amplified Polymorphic DNA (RAPD procedure was used to examine the genetic variability among fourteen isolates of Trichoderma and their ability to antagonize Rhizoctonia solani using a dual-culture assay for correlation among RAPD products and their hardness to R. solani. Seven oligodeoxynucleotide primers were selected for the RAPD assays which resulted in 197 bands for 14 isolates of Trichoderma. The data were entered into a binary matrix and a similarity matrix was constructed using DICE similarity (SD index. A UPGMA cluster based on SD values was generated using NTSYS (Numerical Taxonomy System, Applied Biostatistics computer program. A mean coefficient of similarity obtained for pairwise comparisons among the most antagonics isolates was around 40%. The results presented here showed that the variability among the isolates of Trichoderma was very high. No relationship was found between the polymorphism showed by the isolates and their hardness, origin and substrata.A técnica de RAPD (Random Amplified Polymorphic DNA foi utilizada para examinar a variabilidade genética em quatorze isolados de Trichoderma além de sua capacidade de antagonizar o fungo fitopatogênico Rhizoctonia solani usando pareamento in vitro, e a possível relação entre perfís de RAPD e agressividade dos isolados de Trichoderma a R. solani. Foram selecionados sete primers para os ensaios de RAPD, os quais produziram 197 bandas. Os dados foram introduzidos no programa de computador NTSYS (Numerical Taxonomy System, Applied Biostatisticsna forma de uma matrix binária, sendo construída uma matriz de similaridade utilizando-se o coeficiente de similaridade de DICE (SD e baseado nos valores SD, pelo método de agrupamento UPGMA um dendrograma. Observou-se que o grau de similaridade das amostras que apresentaram melhor desempenho antagônico foi bastante baixo, em torno de 40%. Os resultados demonstraram que a variabilidade entre os isolados de Trichoderma é muito

  12. GENETIC VARIATIONS AMONG AQUILARIA SPECIES AND GYRINOPS VERSTEEGII USING AMPLIFIED FRAGMENT LENGTH POLYMORPHISM MARKERS

    Directory of Open Access Journals (Sweden)

    NURITA TORUAN-MATHIUS

    2009-01-01

    Full Text Available Aquilaria sp. (Thymelaeaceae is the most valuable non wood production of forestry plant in Indonesia. It produces a fragrant resin when subjected to fungal attack and has been traded internationally known as gaharu. Knowledge of genetic diversity and relationship among species and genus is important for breeding purposes and species conservation. In this study, genetic variabilityof six Aquilaria species were analyzed using the AmplifiedFragment Length Polymorphism (AFLP markers. Ten AFLP primercombinations amplified 1353 DNA fragments ranging in size from100 to 350 bp of which 1285 (95% of them were polymorphic. Genetic similarities among Aquilaria sp. consisted of A. malaccensis, A. beccariana, A. microcarpa, and A. crassna ranged from 63.90 to 72.00 % based on Dice coefficient. The dendrogram derivedby the unweighted pair group method with arithmetic mean of germplasm analysis were clustered into two main groups. Hence, a genetic variation among species is quiet high. Bootstrap valuesfor the groups supported 70% of the cluster using a linear relationship equation of (r = 0.724, P < 0.0001 was observedbetween known pedigrees and AFLP-derived genetic similarityfor 136 pairwise comparisons of Aquilaria species. For example, A. malacensis and A. microcarpa have the highest genetic similarity (72.00% compared with another Aquilaria species. Primer pairs E-ACG/M-CTA produced a specific fragment for A. beccariana (850 bp, A. crasna (550 bp, 180 bp, and 140 bp, A. malaccencis (1500 bp, A. microcarpa (250 bp and Gyrinops versteegii (150 bp. Primer pairs E-ACG/M-CAA produced a specific DNA fragment only for A. beccariana (1500 bp and 100 bp. Primer pairs E-ACC/M-CAC also produced only specific fragment for A. crassna (1500 bp. Study showed the usefulness of AFLPanalysis in Aquilaria sp. and its potential application for breedingand species conservation. Further, molecular diversity estimated in the present study combined with the datasets on other

  13. Coupling technique of random amplified polymorphic DNA and nanoelectrochemical sensor for mapping pancreatic cancer genetic fingerprint

    Directory of Open Access Journals (Sweden)

    Liu Q

    2011-11-01

    Full Text Available Qicai Liu1,2, Ailin Liu3,4, Feng Gao5, Shaohuang Weng3,4, Guangxian Zhong3,4, Jingfeng Liu6, Xinhua Lin3,4, Jian-hua Lin7, Xuhai Chen81Department of Laboratory Medicine, Fujian Medical University, Fuzhou, 2Department of Gene Diagnosis, Fujian Medical University, Fuzhou, 3Department of Nano-Biomedical Research Center, Fujian Medical University, Fuzhou, 4Department of Pharmaceutical Analysis, Fujian Medical University, Fuzhou, 5Department of Pathology, Fujian Medical University, Fuzhou, 6Department of Surgery, Fujian Medical University, Fuzhou, 7Department of Bone Oncology, First Affiliated Hospital, Fujian Medical University, Fuzhou, 8College of Electrical Engineering and Automation, Fuzhou University, Fuzhou, People's Republic of ChinaObjective: To review the feasibility of coupling the techniques of random amplified polymorphic DNA (RAPD with carbon nanotube-based modified electrode for guanine/deoxy-guanine triphosphate (dGTP electrochemical sensing for mapping of the pancreatic cancer genetic fingerprint and screening of genetic alterations.Methods: We developed a new method to study the electrochemical behavior of dGTP utilizing carbon multiwalled nanotube (MWNT-modified glassy carbon electrodes (GCEs. RAPD was applied for amplification of DNA samples from healthy controls and patients with pancreatic cancer under the same conditions to determine the different surplus quantity of dGTP in the polymerase chain reaction (PCR, thereby determining the difference/quantity of PCR products or template strands. Using this method we generated a genetic fingerprint map of pancreatic cancer through the combination of electrochemical sensors and gel electrophoresis to screen for genetic alterations. Cloning and sequencing were then performed to verify these gene alterations.Results: dGTP showed favorable electrochemical behavior on the MWNTs/GCE. The results indicated that the electrical signal and dGTP had a satisfactory linear relationship with the d

  14. Label-free molecular beacon for real-time monitoring of DNA polymerase activity.

    Science.gov (United States)

    Ma, Changbei; Liu, Haisheng; Wang, Jun; Jin, Shunxin; Wang, Kemin

    2016-05-01

    Traditional methods for assaying DNA polymerase activity are discontinuous, time consuming, and laborious. Here, we report a new approach for label-free and real-time monitoring of DNA polymerase activity using a Thioflavin T (ThT) probe. In the presence of DNA polymerase, the DNA primer could be elongated through polymerase reaction to open MB1, leading to the release of the G-quartets. These then bind to ThT to form ThT/G-quadruplexes with an obvious fluorescence generation. It exhibits a satisfying detection result for the activity of DNA polymerase with a low detection limit of 0.05 unit/ml. In addition, no labeling with a fluorophore or a fluorophore-quencher pair is required; this method is fairly simple, fast, and low cost. Furthermore, the proposed method was also applied to assay the inhibition of DNA polymerase activity. This approach may offer potential applications in drug screening, clinical diagnostics, and some other related biomedical research. PMID:26894757

  15. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  16. Analysis of DNA polymerase activity in Petunia protoplasts treated with clastogenic agents

    International Nuclear Information System (INIS)

    Clastogenic agents, i.e. agents that can induce chromosome or DNA breakage, have been shown to enhance the role of direct gene transfer to protoplasts. The effect was analysed at the enzymatic level using protoplast homogenates as well as intact protoplasts. For that purpose existing procedures were modified to enable measurement of DNA polymerase in vivo. In the system used, external DNA was able to enter the cells without the addition of membrane-permeabilizing compounds. When comparing total DNA polymerase activity of protoplasts irradiated with X-rays or UV-light with that of untreated cells we did not observe significant differences. Incubation of protoplasts with high doses of bleomycin affected total DNA polymerase activity negatively. but dideoxythymidine triphosphate-sensitive activity was not influenced. We conclude that the DNA strand-breaks induced by low doses of X-rays. UV-light or bleomycin do not increase the total or the repair-DNA polymerase activity and. therefore. that the increase in the transformation rates after DNA strand-breaking is not preceded by enhanced DNA polymerase activity. (author)

  17. Expression and Characterization of the RKOD DNA Polymerase in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Fei Wang

    Full Text Available The present study assessed high-level expression of the KOD DNA polymerase in Pichia pastoris. Thermococcus kodakaraensis KOD1 is a DNA polymerase that is widely used in PCR. The DNA coding sequence of KOD was optimized based on the codon usage bias of P. pastoris and synthesized by overlapping PCR, and the nonspecific DNA-binding protein Sso7d from the crenarchaeon Sulfolobus solfataricus was fused to the C-terminus of KOD. The resulting novel gene was cloned into a pHBM905A vector and introduced into P. pastoris GS115 for secretory expression. The yield of the target protein reached approximately 250 mg/l after a 6-d induction with 1% (v/v methanol in shake flasks. This yield is much higher than those of other DNA polymerases expressed heterologously in Escherichia coli. The recombinant enzyme was purified, and its enzymatic features were studied. Its specific activity was 19,384 U/mg. The recombinant KOD expressed in P. pastoris exhibited excellent thermostability, extension rate and fidelity. Thus, this report provides a simple, efficient and economic approach to realize the production of a high-performance thermostable DNA polymerase on a large scale. This is the first report of the expression in yeast of a DNA polymerase for use in PCR.

  18. Human placental DNA polymerase δ: identification of a 170-kilodalton polypeptide by activity staining and immunoblotting

    International Nuclear Information System (INIS)

    DNA polymerase δ was isolated from human placenta and identified as such on the basis of its association with a 3'- to 5'-exonuclease activity. The association of the polymerase and exonuclease activities was maintained throughout purification and attempted separations by physical or electrophoretic methods. Moreover, ratios of the two activities remained constant during the purification steps, and both activities were inhibited by aphidicolin, oxidized glutathione, and n-ethylmaleimide. The purified enzyme had an estimated molecular weight of 172,000, on the basis of a Stokes radius of 53.6 A and a sedimentation coefficient of 7.8 S. On sodium dodecyl sulfate (SDS) gel electrophoresis, polymerase δ preparations contained a band of ca. 170 kilodaltons (kDa) as well as several smaller polypeptides. The 170-kDa polypeptide was identified as the largest polypeptides component in the preparation possessing DNA polymerase activity by an activity staining procedure following gel electrophoresis in the presence of SDS. Western blotting of DNA polymerase δ with polyclonal antisera also revealed a single 170-kDa immunoreactive polypeptide. Monoclonal antibodies to KB cell polymerase α inhibited placental polymerase α but did not inhibit DNA polymerase δ, while the murine polyclonal antisera to polymerase δ inhibited δ but not α. These findings establish the existence of DNA polymerase δ in a human tissue and support the view that both its polymerase and its exonuclease activities may be associated with a single protein

  19. Effect of γ-irradiated DNA on the activity of DNA polymerase

    International Nuclear Information System (INIS)

    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

  20. Translesion DNA polymerases Pol , Pol , Pol , Pol and Rev1 are not essential for repeat-induced point mutation in Neurospora crassa

    Indian Academy of Sciences (India)

    Ranjan Tamuli; C Ravindran; Durgadas P Kasbekar

    2006-12-01

    Pol , Pol , Pol , Pol and Rev1 are specialized DNA polymerases that are able to synthesize DNA across a damaged template. DNA synthesis by such translesion polymerases can be mutagenic due to the miscoding nature of most damaged nucleotides. In fact, many mutational and hypermutational processes in systems ranging from yeast to mammals have been traced to the activity of such polymerases. We show however, that the translesion polymerases are dispensable for repeat-induced point mutation (RIP) in Neurospora crassa. Additionally, we demonstrate that the upr-1 gene, which encodes the catalytic subunit of Pol , is a highly polymorphic locus in Neurospora.

  1. Genetic variability of Amorphophallus muelleri Blume in Java based on Random Amplified Polymorphic DNA

    Directory of Open Access Journals (Sweden)

    DIYAH MARTANTI

    2008-10-01

    Full Text Available Amorphophallus muelleri Blume (Araceae is valued for its glucomanan content for use in food industry (healthy diet food, paper industry, pharmacy and cosmetics. The species is triploid (2n=3x=39 and the seed is developed apomictically. The present research is aimed to identify genetic variability of six population of A. muelleri from Java (consisted of 50 accessions using random amplified polymorphic DNA (RAPD. The six populations of the species are: East Java: (1 Silo-Jember, (2 Saradan-Madiun, (3 IPB (cultivated, from Saradan-Madiun, (4 Panti-Jember, (5 Probolinggo; and Central Java: (6 Cilacap. The results showed that five RAPD primers generated 42 scorable bands of which 29 (69.05% were polymorphic. Size of the bands varied from 300bp to 1.5kbp. The 50 accessions of A. muelleri were divided into two main clusters, some of them were grouped based on their populations, and some others were not. The range of individual genetic dissimilarity was from 0.02 to 0.36. The results showed that among six populations investigated, Saradan population showed the highest levels of genetic variation with mean values of na = 1.500+ 0.5061, ne = 1.3174 + 0.3841, PLP = 50% and He = 0, 0.1832+0.2054, whereas Silo-Jember population showed the lowest levels of genetic variation with mean values na = 1.2619+ 0.4450, ne = 1.1890 + 0.3507, PLP = 26.19% and He = 0.1048+0.1887. Efforts to conserve, domesticate, cultivate and improve genetically should be based on the genetic properties of each population and individual within population, especially Saradan population which has the highest levels of genetic variation, need more attention for its conservation.

  2. New insights into the QuikChange™ process guide the use of Phusion DNA polymerase for site-directed mutagenesis.

    Science.gov (United States)

    Xia, Yongzhen; Chu, Wenqiao; Qi, Qingsheng; Xun, Luying

    2015-01-01

    The QuikChange™ site-directed mutagenesis method is popular but imperfect. An improvement by using partially overlapping primers has been reported several times; however, it is incompatible with the proposed mechanism. The QuikChange™ method using complementary primers is proposed to linearly amplify a target plasmid with the products annealing to produce double-stranded DNA molecules with 5'-overhangs. The overhang annealing is supposed to form circular plasmids with staggered breaks, which can be repaired in Escherichia coli after transformation. Here, we demonstrated that the PCR enzyme fills the 5'-overhangs in the early cycles, and the product is then used as the template for exponential amplification. The linear DNA molecules with homologous ends are joined to generate the plasmid with the desired mutations through homologous recombination in E. coli. The correct understanding is important to method improvements, guiding us to use partially overlapping primers and Phusion DNA polymerase for site-directed mutagenesis. Phusion did not amplify a plasmid with complementary primers but used partially overlapping primers to amplify the plasmid, producing linear DNA molecules with homologous ends for site-directed mutagenesis. PMID:25399421

  3. Snapshots of DNA polymerase processing aberrant substrates : Structural insights into abasic site bypass and polymerization of 5-alkynylated nucleotide analogs

    OpenAIRE

    Obeid, Samra

    2011-01-01

    DNA polymerases are involved in all DNA synthesis events occurring in nature. Therefore, these enzymes are essential for the maintenance of the genetic information and its stability. Structural and functional studies have added significantly to our understanding of the basic mechanisms of DNA synthesis by DNA polymerases. Thereby, X-ray crystallography has become a powerful tool to gain further insights into structure-function relationships of DNA polymerases. Based on crystal structure analy...

  4. DNA polymerase beta reveals enhanced activity and processivity in reverse micelles.

    Science.gov (United States)

    Anarbaev, Rashid O; Rogozina, Anastasia L; Lavrik, Olga I

    2009-04-01

    Water is essential for the stability and functions of proteins and DNA. Reverse micelles are simple model systems where the structure and dynamics of water are controlled. We have estimated the size of complex reverse micelles by light scattering technique and examined the local microenvironment using fluorescein as molecular probe. The micelle size and water polarity inside reverse micelles depend on water volume fraction. We have investigated the different hydration and confinement effects on activity, processivity, and stability of mammalian DNA polymerase beta in reverse micelles. The enzyme displays high processivity on primed single-stranded M13mp19 DNA with maximal activity at 10% of water content. The processivity and activity of DNA polymerase strongly depend on the protein concentration. The enzyme reveals also the enhanced stability in the presence of template-primer and at high protein concentration. The data provide direct evidence for strong influence of microenvironment on DNA polymerase activity. PMID:19138815

  5. Structure and function of the translesion DNA polymerases and interactions with damaged DNA

    Directory of Open Access Journals (Sweden)

    F. Peter Guengerich

    2015-03-01

    Pre-steady-state kinetic analysis has been used to develop minimum kinetic models with rate constants of (the eight individual reaction steps in the catalytic cycle. The use of single-tryptophan mutants of Sulfolobus solfataricus Dpo4 and human (h pol κ has led to discernment of the steps for the conformation change (associated with dNTP binding and relocation and nucleotidyl transfer. X-ray crystal structures have been obtained for a number of the DNA adduct/DNA polymerase pairs in both binary and ternary complexes. Two isomeric etheno guanine adducts differ considerably in their interactions with DNA polymerases, explaining the base preferences. Further, even when several DNA polymerases cause the same mispairs with a single DNA adduct, the structural bases for this can differ considerably.

  6. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li;

    2014-01-01

    Replication factor C (RFC) is known to function in loading proliferating cell nuclear antigen (PCNA) onto primed DNA, allowing PCNA to tether DNA polymerase for highly processive DNA synthesis in eukaryotic and archaeal replication. In this report, we show that an RFC complex from the...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....... hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...

  7. Genetic Diversity of Eurycoma longifolia Jack Based on Random Amplified Polymorphic DNA Marker

    Directory of Open Access Journals (Sweden)

    Rosmaina Rosmaina

    2013-08-01

    Full Text Available Eurycoma longifolia Jack is one of the extensively exploited medicinal plants in Indonesia. The objectives of this study were to obtain information on genetic diversity and population genetic structure of E. longifolia to formulate effective conservation plan. RAPD marker was used to assess the genetic diversity of E. longifolia collected from 5 natural populations in Riau Province. A total of 25 plants were analyzed using 5 RAPD primers, which amplified produced 44 scored DNA bands. The mean observed number of alleles per locus (No, number of effective alleles (Ne, and percentage of polymorphic loci (PPL of E. longifolia were 1.57, 1.34, and 56.80%, respectively. The degree of differentiation among populations of E. longifolia was 0.31 (Ht = 0.29; Hs = 0.20.  The mean value of estimated gene flow among populations of E. longifolia was 1.11 individual per generation. The UPGMA dendogram formed 2 significant clusters. The first cluster consisted of Pelalawan and Kampar populations, while the second cluster was formed from Kuansing, Rohul, and Rohil population. The genetic diversity information in this study is very important to perform efficient conservation and effective future management of its genetic resources.Keywords: Eurycoma longifolia, RAPD marker, genetic variation, conservation DOI: 10.7226/jtfm.19.2.138

  8. Veronaea botryosa: molecular identification with amplified fragment length polymorphism (AFLP) and in vitro antifungal susceptibility.

    Science.gov (United States)

    Badali, Hamid; Yazdanparast, Seyed Amir; Bonifaz, Alexandro; Mousavi, Bita; de Hoog, G Sybren; Klaassen, Corné H W; Meis, Jacques F

    2013-06-01

    Inter- and intraspecific genomic variability of 18 isolates of Veronaea botryosa originating from clinical and environmental sources was studied using amplified fragment length polymorphism (AFLP). The species was originally described from the environment, but several severe cases of disseminated infection in apparently healthy individuals have been reported worldwide. All tested strains of V. botryosa, identified on the basis of sequencing and phenotypic and physiological criteria prior to our study, were confirmed by AFLP analysis, yielding a clear separation of V. botryosa as a rather homogeneous group from related species. In vitro antifungal susceptibility testing resulted in MIC90s across all strains in increasing order posaconazole (0.25 μg/ml), itraconazole (1 μg/ml), voriconazole (4 μg/ml), terbinafine (4 μg/ml), caspofungin (8 μg/ml), anidulafungin (8 μg/ml), isavuconazole (16 μg/ml), amphotericin B (16 μg/ml), and fluconazole (32 μg/ml). Overall, the isolates showed a uniform pattern of low MICs of itraconazole and posaconazole, but high MICs for remaining agents. The echinocandins (caspofungin and anidulafungin) had no activity against V. botryosa. There was no statistically significant difference between susceptibilities of environmental (n = 11) and clinical (n = 7) isolates of V. botryosa (P > 0.05). PMID:23463524

  9. Randomly amplified polymorphic DNA PCR as a tool for assessment of marine viral richness.

    Science.gov (United States)

    Winget, Danielle M; Wommack, K Eric

    2008-05-01

    Recent discoveries have uncovered considerable genetic diversity among aquatic viruses and raised questions about the variability of this diversity within and between environments. Studies of the temporal and spatial dynamics of aquatic viral assemblages have been hindered by the lack of a common genetic marker among viruses for rapid diversity assessments. Randomly amplified polymorphic DNA (RAPD) PCR bypasses this obstacle by sampling at the genetic level without requiring viral isolation or previous sequence knowledge. In this study, the utility of RAPD-PCR for assessing DNA viral richness within Chesapeake Bay water samples was evaluated. RAPD-PCR using single 10-mer oligonucleotide primers successfully produced amplicons from a variety of viral samples, and banding patterns were highly reproducible, indicating that each band likely represents a single amplicon originating from viral template DNA. In agreement with observations from other community profiling techniques, resulting RAPD-PCR banding patterns revealed more temporal than spatial variability in Chesapeake Bay virioplankton assemblages. High-quality hybridization probes and sequence information were also easily generated from single RAPD-PCR products or whole reactions. Thus, the RAPD-PCR technique appears to be practical and efficient for routine use in high-resolution viral diversity studies by providing assemblage comparisons through fingerprinting, probing, or sequence information. PMID:18344351

  10. Genotoxicity assessment of pesticides on terrestrial snail embryos by analysis of random amplified polymorphic DNA profiles.

    Science.gov (United States)

    Baurand, Pierre-Emmanuel; Capelli, Nicolas; de Vaufleury, Annette

    2015-11-15

    The study explores the relevance of coupling Random Amplified Polymorphic DNA (RAPD) and a High-Resolution capillary electrophoresis System (HRS) method for assessing the genotoxic potential of the wide variety commercial formulations of pesticides. Using this technique, the genotoxic potential of a glyphosate-based herbicide (Roundup Flash(®) (RU)) and two fungicide formulations based on tebuconazole and copper (Corail(®) and Bordeaux mixture (BM), respectively) was evaluated on terrestrial snail embryos. Clutches of Cantareus aspersus were exposed during their entire embryonic development to a range of concentration around the EC50 values (based on hatching success) for each compound tested. Three primers were used for the RAPD amplifications of pesticides samples. RAPD-HRS revealed concentration-dependent modifications in profiles generated with the three primers in RU(®)-exposed embryos from 30 mg/L glyphosate. For Corail(®)-exposed embryos, only two of the three primers were able to show alterations in profiles from 0.05 mg/L tebuconazole. For BM-exposed embryos, no signs of genotoxicity were observed. All changes observed in amplification profiles have been detected at concentrations lower than the recommended doses for vineyard field applications. Our study demonstrates the efficiency of coupling RAPD and HRS to efficiently screen the effect of pesticide formulations on DNA. PMID:26160746

  11. Intraspecific differentiation of Hancornia speciosa revealed by simple sequence repeat and random amplified polymorphic DNA markers.

    Science.gov (United States)

    Nogueira, C A; Stafuzza, N B; Ribeiro, T P; Prado, A D L; Menezes, I P P; Peixoto, N; Gonçalves, P J; Almeida, L M

    2015-01-01

    Hancornia speciosa, popularly known as mangabeira, is a fruit tree native to the Brazilian Cerrado that shows great economic potential, due to its multiple uses. Intraspecific classification of this species is difficult because it shows high morphological diversity. An early study of the species reported that there are six botanic varieties that differ morphologically mainly in the shapes of their leaves and flowers. Except to note the wide morphological variation and economic potential of this species, few studies have been published about the genetic diversity of mangabeira. Knowledge of the genetic variability of this species among populations would be useful for genetic conservation and breeding programs. Therefore, we tested the transferability of 12 simple sequence repeats from expressed sequence tags (EST-SSRs) from Catharanthus roseus to H. speciosa and used 10 random amplified polymorphic DNA markers to evaluate the genetic variability among botanical varieties of H. speciosa. We obtained a high transferability frequency of EST-SSR markers from C. roseus to H. speciosa (75%). However, EST-SSR markers showed low heterozygosity and locus variability (two or three alleles by locus), which suggest low genetic diversity in the mangabeira samples. The Jaccard dissimilarity index and an examination of geographic distances indicated a non-spatial structuring of the genetic variability. Our markers were unable to distinguish H. speciosa botanical varieties. PMID:26662392

  12. Paternity determination in the adder (Vipera berus)--DNA fingerprinting or random amplified polymorphic DNA?

    Science.gov (United States)

    Tegelström, H; Höggren, M

    1994-08-01

    We performed breeding experiments with adders (Vipera berus) to determine whether multiple matings may result in multiple paternity. DNA fingerprinting of mothers, their offspring, and possible fathers using a polydinucleotide probe [(TG)n] gave a low overall similarity between unrelated individuals (0.18 +/- 0.07; SD) and an average of 17 bands that were male-specific. In no cases were there fewer than seven paternal-specific bands present in the fingerprint of an offspring, enabling us unambiguously to identify the biological father among five males. Multiple paternity was detected in the investigated broods with offspring sired exclusively by the captive males. PCR amplification of random amplified polymorphic DNA (RAPD) using 16 decamer primers gave 76 bands and an average similarity of 0.95 (+/- 0.01) between the males, which were collected at different, geographically well-separated localities. Although there were on average 8.3 (+/- 1.9) bands that differ between males in pairwise comparisons, there were only 1.9 (+/- 1.1) bands per male that are specific for a particular individual. Thus, RAPDs are adequate for paternity determination only in experiments with a low number of males, whereas DNA fingerprinting offers sufficient information to discriminate between large numbers of putative fathers. PMID:7826312

  13. Optimization of a Reaction System of Sequence Related Amplified Polymorphism and Segregation of Polymorphic Loci in an F2 Population of Rice

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    An effective PCR protocol for detecting the sequence related amplified polymorphism (SRAP) in rice was developed.One hundred and ten pairs of SRAP primers were used for segregation analysis in an F2 population derived from a cross between Shennong 606 and Lijiangxintuanheigu.Among the 110 primer pairs,35 pairs generated 143 polymorphic bands with an average of 4.09 polymorphic bands per primer pair,and 24 pairs (16.78%) showed the genetic distortion (P<0.05).Of the 24 primer pairs,12 pairs deviated toward the male parent Shennong 606 and 11 pairs toward the female parent Lijiangxintuanheigu,only one toward heterozygote.It was found that the segregation distortion might be caused by the joint gametic and zygotic effects.

  14. Comparison of Haemophilus parasuis reference strains and field isolates by using random amplified polymorphic DNA and protein profiles

    OpenAIRE

    Zehr Emilie S; Lavrov Dennis V; Tabatabai Louisa B

    2012-01-01

    Abstract Background Haemophilus parasuis is the causative agent of Glässer’s disease and is a pathogen of swine in high-health status herds. Reports on serotyping of field strains from outbreaks describe that approximately 30% of them are nontypeable and therefore cannot be traced. Molecular typing methods have been used as alternatives to serotyping. This study was done to compare random amplified polymorphic DNA (RAPD) profiles and whole cell protein (WCP) lysate profiles as methods for dis...

  15. Allelic imbalance analysis by high-density single-nucleotide polymorphic allele (SNP) array with whole genome amplified DNA

    OpenAIRE

    Wong, Kwong-Kwok; Tsang, Yvonne T.M.; Shen, Jianhe; Cheng, Rita S.; Chang, Yi-Mieng; Man, Tsz-Kwong; Lau, Ching C.

    2004-01-01

    Besides their use in mRNA expression profiling, oligonucleotide microarrays have also been applied to single-nucleotide polymorphism (SNP) and loss of heterozygosity (LOH) or allelic imbalance studies. In this report, we evaluate the reliability of using whole genome amplified DNA for analysis with an oligonucleotide microarray containing 11 560 SNPs to detect allelic imbalance and chromosomal copy number abnormalities. Whole genome SNP analyses were performed with DNA extracted from osteosar...

  16. Genetic Dissection of New Genotypes of Drumstick Tree (Moringa oleifera Lam.) Using Random Amplified Polymorphic DNA Marker

    OpenAIRE

    Shamsuddeen Rufai; Hanafi, M. M.; Rafii, M. Y.; Ahmad, S; Arolu, I. W.; Jannatul Ferdous

    2013-01-01

    The knowledge of genetic diversity of tree crop is very important for breeding and improvement program for the purpose of improving the yield and quality of its produce. Genetic diversity study and analysis of genetic relationship among 20 Moringa oleifera were carried out with the aid of twelve primers from, random amplified polymorphic DNA marker. The seeds of twenty M. oleifera genotypes from various origins were collected and germinated and raised in nursery before transplanting to the fi...

  17. Using Random Amplified Polymorphic DNA to Assess Genetic Diversity and Structure of Natural Calophyllum brasiliense (Clusiaceae) Populations in Riparian Forests

    OpenAIRE

    Evânia Galvão Mendonça; Anderson Marcos de Souza; Fábio de Almeida Vieira; Regiane Abjaud Estopa; Cristiane Aparecida Fioravante Reis; Dulcinéia de Carvalho

    2014-01-01

    The objective of this study was to assess the genetic variability in two natural populations of Calophyllum brasiliense located along two different rivers in the state of Minas Gerais, Brazil, using RAPD molecular markers. Eighty-two polymorphic fragments were amplified using 27 primers. The values obtained for Shannon index (I) were 0.513 and 0.530 for the populations located on the margins of the Rio Grande and Rio das Mortes, respectively, demonstrating the high genetic diversity in the st...

  18. SDS-PAGE of Whole-Cell Proteins and Random Amplified Polymorphic DNA (RAPD) Analyses of Leptotrichia Isolates

    OpenAIRE

    Eribe, Emenike Ribs K.; Olsen, Ingar

    2011-01-01

    In a polyphasic approach to improve the taxonomy of Leptotrichia we have recently demonstrated heterogeneity in the enzymatic/biochemical reactions and cellular fatty acid content of Leptotrichia isolates. In the present study, SDS-PAGE of whole-cell proteins and random amplified polymorphic DNA (RAPD) analyses were used to further characterize and distinguish these isolates of which 57 had been assigned as Leptotrichia buccalis and two as ‘Leptotrichia pseudobuccalis’. The phylog...

  19. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H.M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  20. A Randomly Amplified Polymorphic DNA Marker Specific for the Bacillus cereus Group Is Diagnostic for Bacillus anthracis

    OpenAIRE

    Daffonchio, Daniele; Borin, Sara; Frova, Giuseppe; Gallo, Romina; Mori, Elena; Fani, Renato; Sorlini, Claudia

    1999-01-01

    Aiming to develop a DNA marker specific for Bacillus anthracis and able to discriminate this species from Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides, we applied the randomly amplified polymorphic DNA (RAPD) fingerprinting technique to a collection of 101 strains of the genus Bacillus, including 61 strains of the B. cereus group. An 838-bp RAPD marker (SG-850) specific for B. cereus, B. thuringiensis, B. anthracis, and B. mycoides was identified. This fragment included a pu...

  1. Characterization of family IV UDG from Aeropyrum pernix and its application in hot-start PCR by family B DNA polymerase.

    Directory of Open Access Journals (Sweden)

    Xi-Peng Liu

    Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.

  2. Intra-specific relationships among Tibetan Eared-pheasants based on randomly amplified polymorphic DNA(RAPD) analysis

    Institute of Scientific and Technical Information of China (English)

    DING Wei; ZHANG Zhengwang; CHANG Jiang; ZHANG Er; WU Xiushan; ZHANG Jinguo

    2006-01-01

    The Tibetan Eared-pheasant Crossoptilon harmani is a rare species native to China.A captive population has been established in the Beijing Zoo since 1999.In order to determine the kinship of the offsprings in 2001,randomly amplified polymorphic DNA (RAPD) was used to examine the parenthood of seven Tibetan Eared-pheasants in the Beijing Zoo.To amplify the genomic DNA of each individual,53 arbitrary primers were selected.The results of amplifica tions showed that 14 primers had clear and distinct RAPD patterns.Totally,226 amplified fragments were generated by RAPD in this study.Cluster analysis of the seven Tibetan Eared-pheasants indicated that all the four young birds had the same father (No.5 male).This study provides a practical method to determine the relationship of offsprings whose parents are unknown in birds.

  3. DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

  4. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus.

    OpenAIRE

    Saulnier, P; Bourneix, C; Prévost, G; Andremont, A

    1993-01-01

    Twenty-six strains of methicillin-resistant Staphylococcus aureus with different pulsed-field gel electrophoresis fingerprints were tested by random amplified polymorphic DNA assay with three primers, resulting in 15 to 20 different random amplified polymorphic DNA fingerprints. By summing the results for the three primers, the number of different fingerprints increased to 25, but two strains could not be differentiated. We conclude that pulsed-field gel electrophoresis remains the best metho...

  5. Adaptive Epigenetic Differentiation between Upland and Lowland Rice Ecotypes Revealed by Methylation-Sensitive Amplified Polymorphism

    Science.gov (United States)

    Xiong, Jie; Tao, Tao; Zheng, Xiaoguo; Wei, Haibin; Yue, Yunxia; Chen, Liang; Luo, Lijun

    2016-01-01

    The stress-induced epimutations could be inherited over generations and play important roles in plant adaption to stressful environments. Upland rice has been domesticated in water-limited environments for thousands of years and accumulated drought-induced epimutations of DNA methylation, making it epigenetically differentiated from lowland rice. To study the epigenetic differentiation between upland and lowland rice ecotypes on their drought-resistances, the epigenetic variation was investigated in 180 rice landraces under both normal and osmotic conditions via methylation-sensitive amplified polymorphism (MSAP) technique. Great alterations (52.9~54.3% of total individual-locus combinations) of DNA methylation are recorded when rice encountering the osmotic stress. Although the general level of epigenetic differentiation was very low, considerable level of ΦST (0.134~0.187) was detected on the highly divergent epiloci (HDE). The HDE detected in normal condition tended to stay at low levels in upland rice, particularly the ones de-methylated in responses to osmotic stress. Three out of four selected HDE genes differentially expressed between upland and lowland rice under normal or stressed conditions. Moreover, once a gene at HDE was up-/down-regulated in responses to the osmotic stress, its expression under the normal condition was higher/lower in upland rice. This result suggested expressions of genes at the HDE in upland rice might be more adaptive to the osmotic stress. The epigenetic divergence and its influence on the gene expression should contribute to the higher drought-resistance in upland rice as it is domesticated in the water-limited environment. PMID:27380174

  6. Diversity, molecular phylogeny and fingerprint profiles of airborne Aspergillus species using random amplified polymorphic DNA.

    Science.gov (United States)

    Kermani, Firoozeh; Shams-Ghahfarokhi, Masoomeh; Gholami-Shabani, Mohammadhassan; Razzaghi-Abyaneh, Mehdi

    2016-06-01

    In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)-polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method. PMID:27116962

  7. Biochemical evidence for the requirement of Hoogsteen base pairing for replication by human DNA polymerase iota.

    Science.gov (United States)

    Johnson, Robert E; Prakash, Louise; Prakash, Satya

    2005-07-26

    Because of the near geometric identity of Watson-Crick (W-C) GxC and AxT base pairs, a given DNA polymerase forms the four possible correct base pairs with nearly identical catalytic efficiencies. However, human DNA polymerase iota (Pol iota), a member of the Y family of DNA polymerases, exhibits a marked template specificity, being more efficient at incorporating the correct nucleotide opposite template purines than opposite pyrimidines. By using 7-deazaadenine and 7-deazaguanine as the templating residues, which disrupt Hoogsteen base pair formation, we show that, unlike the other DNA polymerases belonging to the A, B, or Y family, DNA synthesis by Pol iota is severely inhibited by these N7-modified bases. These observations provide biochemical evidence that, during normal DNA synthesis, template purines adopt a syn conformation in the Pol iota active site, enabling the formation of a Hoogsteen base pair with the incoming pyrimidine nucleotide. Additionally, mutational studies with Leu-62, which lies in close proximity to the templating residue in the Pol iota ternary complex, have indicated that both factors, steric constraints within the active site and the stability provided by the hydrogen bonds in the Hoogsteen base pair, contribute to the efficiency of correct nucleotide incorporation opposite template purines by Pol iota. PMID:16014707

  8. DNA polymerase activity in heat killing and hyperthermic radiosensitization of mammalian cells as observed after fractionated heat treatments.

    Science.gov (United States)

    Jorritsma, J B; Burgman, P; Kampinga, H H; Konings, A W

    1986-03-01

    Possible relations between hyperthermic inactivation of alpha and beta DNA polymerase activity and hyperthermic cell killing or hyperthermic radiosensitization were investigated. Ehrlich Ascites Tumor (EAT) cells and HeLa S3 cells were treated with fractionated doses of hyperthermia. The heating schedules were chosen such that the initial heat treatment resulted in either thermotolerance or thermosensitization (step-down heating) for the second heat treatment. The results show that for DNA polymerase activity and heat radiosensitization (cell survival) no thermotolerance or thermosensitization is observed. Thus hyperthermic cell killing and DNA polymerase activity are not correlated. The correlation of hyperthermic radiosensitization and DNA polymerase activity was substantially less than observed in previous experiments with normotolerant and thermotolerant HeLa S3 cells. We conclude that alpha and beta DNA polymerase inactivation is not always the critical cellular process responsible for hyperthermic cell killing or hyperthermic radiosensitization. Other possible cellular systems that might determine these processes are discussed. PMID:3754338

  9. DNA polymerase activity in heat killing and hyperthermic radiosensitization of mammalian cells as observed after fractionated heat treatments

    Energy Technology Data Exchange (ETDEWEB)

    Jorritsma, J.B.; Burgman, P.; Kampinga, H.H.; Konings, A.W.

    1986-03-01

    Possible relations between hyperthermic inactivation of alpha and beta DNA polymerase activity and hyperthermic cell killing or hyperthermic radiosensitization were investigated. Ehrlich Ascites Tumor (EAT) cells and HeLa S3 cells were treated with fractionated doses of hyperthermia. The heating schedules were chosen such that the initial heat treatment resulted in either thermotolerance or thermosensitization (step-down heating) for the second heat treatment. The results show that for DNA polymerase activity and heat radiosensitization (cell survival) no thermotolerance or thermosensitization is observed. Thus hyperthermic cell killing and DNA polymerase activity are not correlated. The correlation of hyperthermic radiosensitization and DNA polymerase activity was substantially less than observed in previous experiments with normotolerant and thermotolerant HeLa S3 cells. We conclude that alpha and beta DNA polymerase inactivation is not always the critical cellular process responsible for hyperthermic cell killing or hyperthermic radiosensitization. Other possible cellular systems that might determine these processes are discussed.

  10. Genotoxicity of Thermopsis turcica on Allium cepa L. roots revealed by alkaline comet and random amplified polymorphic DNA assays.

    Science.gov (United States)

    Ciğerci, İbrahim Hakkı; Cenkci, Süleyman; Kargıoğlu, Mustafa; Konuk, Muhsin

    2016-08-01

    This study was undertaken to evaluate genotoxic potential of Thermopsis turcica aqueous extracts on the roots of onion bulb (Allium cepa L.) by comet assay and random amplified polymorphic DNA technique. The Allium root growth inhibition test indicated that the EC50 and 2×EC50 values were 8 and 16 mg/ml concentrations of T. turcica aqueous extracts, respectively. The negative control (distilled water), positive control (methyl methane sulfonate, 10 mg/l) and 8 and 16 mg/ml concentrations of T. turcica extracts were introduced to the roots of onion bulbs for 24 and 96 h. The root growth, DNA damage in root cells and randomly amplified polymorphic DNA (RAPD) profiles of root tissue were used as endpoints of the genotoxicity. The comet assay clearly indicated that dose-dependent single strand DNA breaks in the root nuclei of onions were determined for the treatment concentrations of T. turcica extracts. In comparison to RAPD profile of negative control group, RAPD polymorphisms became evident as disappearance and/or appearance of RAPD bands in treated roots. The diagnostic and phenetic numerical analyses of RAPD profiles obviously indicated dose-dependent genotoxicity induced by Thermopsis extracts. In conclusion, the results clearly indicated that water extract of T. turcica has genotoxic potential on the roots of onion bulbs as shown by comet assay and RAPD technique. PMID:25550040

  11. Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

    Science.gov (United States)

    Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

    2016-08-01

    Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa. PMID:27052734

  12. Random amplified polymorphic DNA profiles as a tool for the characterization of Brazilian keratitis isolates of the genus Acanthamoeba

    Directory of Open Access Journals (Sweden)

    Alves J.M.P.

    2000-01-01

    Full Text Available The genus Acanthamoeba comprises free-living amebae identified as opportunistic pathogens of humans and other animal species. Morphological, biochemical and molecular approaches have shown wide genetic diversity within the genus. In an attempt to determine the genetic relatedness among isolates of Acanthamoeba we analyzed randomly amplified polymorphic DNA (RAPD profiles of 11 Brazilian isolates from cases of human keratitis and 8 American type culture collection (ATCC reference strains. We found that ATCC strains belonging to the same species present polymorphic RAPD profiles whereas strains of different species show very similar profiles. Although most Brazilian isolates could not be assigned with certainty to any of the reference species, they could be clustered according to pattern similarities. The results show that RAPD analysis is a useful tool for the rapid characterization of new isolates and the assessment of genetic relatedness of Acanthamoeba spp. A comparison between RAPD analyses and morphological characteristics of cyst stages is also discussed.

  13. Delineation of Campylobacter concisus genomospecies by amplified fragment length polymorphism analysis and correlation of results with clinical data

    DEFF Research Database (Denmark)

    Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.; Permin, H.; Andersen, L.P.

    2005-01-01

    phenotypically indistinguishable but genetically distinct taxa (i.e., genornospecies) that may vary in pathogenicity. We examined 62 C concisus strains by amplified fragment length polymorphism (AFLP) profiling and correlated the results with clinical data. All C. concisus strains gave unique AFLP profiles, and...... numerical analysis of these data distributed the strains among four clusters. The clustering was of taxonomic significance: two clusters contained, respectively, the type strain (of oral origin) and a reference strain (from diarrhea) of each of the known genomospecies. Genomospecies 2 strains were more...

  14. Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit.

    OpenAIRE

    F. Robert; Lebreton, F; Bougnoux, M. E.; Paugam, A; Wassermann, D.; Schlotterer, M; Tourte-Schaefer, C; Dupouy-Camet, J

    1995-01-01

    Burn patients are particularly exposed to deep-seated nosocomial infections caused by Candida species. Superficial carriage of C. albicans is a potential source of infection and dissemination, and typing methods could be useful to trace the different isolates. We report the use of random amplified polymorphic DNA to type isolates of C. albicans in the Hôpital Cochin burn unit. This molecular typing method, which is based on PCR with arbitrary short primers, was evaluated on a panel of 32 C. a...

  15. Identification of Random Amplified Polymorphic DNA Markers Linked to Sex Determination in Calamus simplicifolius C. F. Wei

    Institute of Scientific and Technical Information of China (English)

    Hua YANG; Si-Ming GAN; Guang-Tian YIN; Huang-Can XU

    2005-01-01

    The random amplified polymorphic DNA (RAPD) molecular marker technique was used to determine the sex of Calamus simplicifolius C. F. Wei In the present study, DNA samples were extracted individually from 10 male and 10 female plants. After a total of 1 040 decamer primers had been tested, an approximate 500-bp male-specific DNA fragment was generated with the S1443 primer. It is feasible to identify sex at the early stages of plant life, which is beneficial for improving breeding programs of this dioecious species. In addition, we have obtained a proper RAPD protocol that is useful for other species of rattan.

  16. Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

    Directory of Open Access Journals (Sweden)

    KUSUMADEWI SRI YULITA

    2011-07-01

    Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

  17. Comparison of the genetic diversity of wild and captive groups of Microcebus murinus using the random amplified polymorphic DNA method.

    Science.gov (United States)

    Neveu, H; Hafen, T; Zimmermann, E; Rumpler, Y

    1998-01-01

    Continued survival of most animal species depends on population management and active protection. It is generally agreed that, in order to avoid extinction of endangered species, ex situ and in situ conservation must be developed in tandem. However, even though many recommendations have been put forward to promote the survival of captive populations, some rapidly become extinct due to loss of genetic diversity (drift effect). Genetic markers, such as random amplified polymorphic DNA (RAPD) markers, can be applied to rapid testing of many individuals. They also permit analysis of very small amounts of DNA, when small species such as mouse lemurs (Microcebus) are to be tested. Using RAPD markers, we compare genetic diversity in four captive groups of Microcebus murinus to that in a sample of 70 wild mouse lemurs. Following the principles of Mendelian inheritance, each amplified fragment of DNA may be considered as a 'locus' (or an amplifying site). The series of bands amplified by a particular primer in any individual is referred to as the individual's 'profile'. We tested 5 primers, or, in the above terms, we studied 98 different 'loci'. Results showed that the captive groups had lost genetic information with respect to the wild sample. Among the four captive groups, the loss of genetic diversity varied according to their number of founders and/or the management of their captive reproduction. Our study of polymorphism permitted us to establish tools for the genetic management of captive breeding, and for the determination of paternity which frequently give better results than behavioural studies; and simulation of introductions or departures of individuals in one very monomorphic group permitted estimation of future increases in its genetic diversity. PMID:9595690

  18. Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer.

    Science.gov (United States)

    Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

    2007-01-01

    DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO PrimeSurface with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3' end of the immobilized DNA primers on the S-Bio by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

  19. Identification of a Taq DNA polymerase inhibitor from the red seaweed Symphyocladia latiuscula.

    Science.gov (United States)

    Jin, Hyung Joo; Oh, Mi Young; Jin, Deuk Hee; Hong, Yong Ki

    2008-07-01

    Two inhibitors of Taq DNA polymerase were isolated from the marine red alga Symphyocladia latiuscula. The inhibitors were purified by methanol extraction, molecular fractionation below 3000 MW and reverse-phase HPLC. The purified compound SL-1 containing three bromines was identified as 2,3,6-tribromo-4,5-dihydroxybenzyl alcohol (C7H5Br3O3: MW374) by NMR and MS analyses. The purified compound SL-2 was identified as 2,3, 6-tribromo-4,5-dihydroxybenzyl methyl ether(C8H7Br3O3: MW388). In a 25-microl reaction mixture containing 1.5 units of Taq DNA polymerase, the enzyme was completely inhibited by 0.5 microg SL-1 or 5 microg SL-2. PMID:19195384

  20. DNA polymerase activity and radiation-induced unscheduled synthesis of DNA at the nuclear matrix

    International Nuclear Information System (INIS)

    It is shown that both DNA polymerase α and β are involved in DNA synthesis at the nuclear matrix. DNA polymerase β is more firmly attached to the nuclear matrix of normal than of regenerating liver cells. In the nuclear matrix of UV- and gamma-irradiated cells of Zajdela hepatoma a higher level of hydroxyurea-resistant DNA synthesis has been observed in the initial 1.5-5 min of postradiation incubation if compared to that of total nuclear DNA. However 1-β-D-arabinofuranosylcytosine-resistant radiation-induced synthesis of DNA is similar in both the nuclear matrix and the whole nuclei of these cells. Poly(ADP-ribose)synthetase activity is shown to be associated with the nuclear matrix. Inhibition of this activity results in increase of the hydroxyurea-resistant synthesis of DNA at nuclear matrix. (author)

  1. Enzymatic Synthesis of Modified Oligonucleotides by PEAR Using Phusion and KOD DNA Polymerases

    OpenAIRE

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-01-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase–endonuclease amplification reaction (PEAR) for amplification of natural and 5′-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2′-deoxy-2′-fluoro-(2′-F) and 2′-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with on...

  2. Liquid Chromatography-Mass Spectrometry Analysis of DNA Polymerase Reaction Products

    OpenAIRE

    Chowdhury, Goutam; Guengerich, F. Peter

    2011-01-01

    This unit describes experimental and analytical procedures for characterizing the efficiency and fidelity of translesion DNA synthesis across various DNA damages by DNA polymerases in vitro. This procedure utilizes primer extension assays followed by LC-MS and LC-MS/MS analysis of the extension products. Detailed explanations for the analysis of the LC-MS/MS data for deciphering the nucleotide sequences of the DNA fragments are also presented. This approach provides a significant improvement ...

  3. Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

    Science.gov (United States)

    Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

    2006-08-18

    DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes. PMID:16859707

  4. Specific inhibitors of eukaryotic DNA synthesis and DNA polymerase alpha, 3-deoxyaphidicolin and aphidicolin-17-monoacetate.

    OpenAIRE

    Haraguchi, T; Oguro, M; Nagano, H; Ichihara, A; Sakamura, S

    1983-01-01

    Of several phytotoxins isolated from culture filtrates of Phoma betae Frank PS-13, an incitant of leaf spot disease of sugar beet, three have been identified as aphidicolin, 3-deoxyaphidicolin and aphidicolin-17-monoacetate. Aphidicolin is a selective inhibitor of eukaryotic DNA polymerase alpha (Ikegami et al. (1978) Nature 275, 458-460). Consequently, we studied the action mechanism of 3-deoxyaphidicolin and aphidicolin-17-monoacetate. These aphidicolin analogues markedly inhibited the in v...

  5. Architecture of the DNA polymerase B-proliferating cell nuclear antigen (PCNA)-DNA ternary complex

    OpenAIRE

    Mayanagi, Kouta; Kiyonari, Shinichi; Nishida, Hirokazu; Saito, Mihoko; Kohda, Daisuke; Ishino, Yoshizumi; Shirai, Tsuyoshi; Morikawa, Kosuke

    2011-01-01

    DNA replication in archaea and eukaryotes is executed by family B DNA polymerases, which exhibit full activity when complexed with the DNA clamp, proliferating cell nuclear antigen (PCNA). This replication enzyme consists of the polymerase and exonuclease moieties responsible for DNA synthesis and editing (proofreading), respectively. Because of the editing activity, this enzyme ensures the high fidelity of DNA replication. However, it remains unclear how the PCNA-complexed enzyme temporally ...

  6. Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I.

    OpenAIRE

    O'Connor, D; Stöhrer, G

    1985-01-01

    Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and "nick-mers", conditions of single-strand-directed DNA synthesis and nick-translation could be created. Our results show that the polymerase can bypass bot...

  7. Translesion synthesis by yeast DNA polymerase ζ from templates containing lesions of ultraviolet radiation and acetylaminofluorene

    OpenAIRE

    Guo, Dongyu; Wu, Xiaohua; Deepak K Rajpal; Taylor, John-Stephen; Wang, Zhigang

    2001-01-01

    In the yeast Saccharomyces cerevisiae, DNA polymerase ζ (Polζ) is required in a major lesion bypass pathway. To help understand the role of Polζ in lesion bypass, we have performed in vitro biochemical analyses of this polymerase in response to several DNA lesions. Purified yeast Polζ performed limited translesion synthesis opposite a template TT (6-4) photoproduct, incorporating A or T with similar efficiencies (and less frequently G) opposite the 3′ T, and pr...

  8. Mismatch repair causes the dynamic release of an essential DNA polymerase from the replication fork

    OpenAIRE

    Klocko, Andrew D.; Schroeder, Jeremy W.; Walsh, Brian W.; Lenhart, Justin S.; Evans, Margery L.; Simmons, Lyle A.

    2011-01-01

    Mismatch repair (MMR) corrects DNA polymerase errors occurring during genome replication. MMR is critical for genome maintenance, and its loss increases mutation rates several hundredfold. Recent work has shown that the interaction between the mismatch recognition protein MutS and the replication processivity clamp is important for MMR in Bacillus subtilis. To further understand how MMR is coupled to DNA replication, we examined the subcellular localization of MMR and DNA replication proteins...

  9. Replication of N[superscript 2],3-Ethenoguanine by DNA Polymerases

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Linlin; Christov, Plamen P.; Kozekov, Ivan D.; Pence, Matthew G.; Pallan, Pradeep S.; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter (Vanderbilt)

    2014-10-02

    The unstable DNA adduct N2,3-ethenoguanine, a product of both exposure to the carcinogen vinyl chloride and of oxidative stress, was built into an oligonucleotide, using an isostere strategy to stabilize the glycosidic bond. This modification was then used to examine the cause of mutations by DNA polymerases, in terms of both the biochemistry of the lesion and a structure of the lesion within a polymerase.

  10. Modulation of Pleurodeles waltl DNA Polymerase mu Expression by Extreme Conditions Encountered during Spaceflight

    OpenAIRE

    Véronique Schenten; Nathan Guéguinou; Sarah Baatout; Jean-Pol Frippiat

    2013-01-01

    DNA polymerase μ is involved in DNA repair, V(D)J recombination and likely somatic hypermutation of immunoglobulin genes. Our previous studies demonstrated that spaceflight conditions affect immunoglobulin gene expression and somatic hypermutation frequency. Consequently, we questioned whether Polμ expression could also be affected. To address this question, we characterized Polμ of the Iberian ribbed newt Pleurodeles waltl and exposed embryos of that species to spaceflight conditions or to e...

  11. Characterization of Pseudomonas aeruginosa in Burn Patients Using PCR- Restriction Fragment Length Polymorphism and Random Amplified Polymorphic DNA Analysis

    OpenAIRE

    Abdolaziz Rastegar Lari; Bagher Yakhchali; Parviz Owlia; Hassan Salimi

    2010-01-01

    One of the major opportunistic pathogens in patients with burninjuries is Pseudomonas aeruginosa, which causes severe infectionsin burned patients. The objective of the study was to examinethe molecular epidemiology of P. aeruginosa colonization inthe burn unit of Shahid Motahari Hospital in Tehran, Iran. Restrictionfragment length polymorphism (RFLP) and random amplifiedpolymorphic DNA (RAPD) analysis were employed tostudy 127 clinical and two environmental P. aeruginosa isolatescollected fr...

  12. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    Science.gov (United States)

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  13. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene.

    Science.gov (United States)

    Heilbronn, R; Jahn, G; Bürkle, A; Freese, U K; Fleckenstein, B; zur Hausen, H

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSV-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at Tm - 25 degrees C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Epstein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein. Images PMID:3023689

  14. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  15. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

  16. Hamster endogenous retrovirus (HaER) - distinct properties of structural proteins and DNA polymerase

    International Nuclear Information System (INIS)

    The structural proteins as well as some features of the RNA-dependent DNA polymerase of the hamster endogenous retrovirus (HaER) were examined. The polypeptide pattern of this virus is substantially different from that of other known retroviruses in containing major polypeptides with molecular weights of 68000, 59000, 27000, 24000 daltons. Double antibody competitive radioimmunoassays showed that the HaER particles do not share any detectable antigenic relatedness with the murine viruses' p30, but manifest a considerable relatedness with the feline leukemia virus p27 and a slight cross-reactivity with the rat virus major protein. The RNA-dependent DNA polymerase of HaER virus has a molecular size of approximately 73000 daltons and in contrast to other mammalian retroviruses shows no significant preference for Mn2+ over Mg2+. Apart from the lack of antigenic relatedness between the HaER virus proteins and the p30 protein of murine viruses, there is also no antigenic relatedness between HaER and murine viruses insofar as their DNA polymerase is concerned. (Author)

  17. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Science.gov (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-01-01

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy. PMID:27589807

  18. Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit.

    Science.gov (United States)

    Robert, F; Lebreton, F; Bougnoux, M E; Paugam, A; Wassermann, D; Schlotterer, M; Tourte-Schaefer, C; Dupouy-Camet, J

    1995-01-01

    Burn patients are particularly exposed to deep-seated nosocomial infections caused by Candida species. Superficial carriage of C. albicans is a potential source of infection and dissemination, and typing methods could be useful to trace the different isolates. We report the use of random amplified polymorphic DNA to type isolates of C. albicans in the Hôpital Cochin burn unit. This molecular typing method, which is based on PCR with arbitrary short primers, was evaluated on a panel of 32 C. albicans strains isolated from various anatomical sites of unrelated patients, and the strains showed 22 different patterns. Random amplified polymorphic DNA was then used in the epidemiological surveillance of the patients in the burn unit over a 9-month period. Seven patterns were identified among 84 isolates from 18 patients. One pattern (pattern A) corresponding to isolates from 7 of the 18 patients (68% of isolates) predominated throughout the 9-month study, while some strains with other profiles were isolated only once. Some profiles appeared to show a particular geographic pattern within the unit, suggesting transmission from room to room. These results underline the importance of fungal surveillance in such patients and the need to inform nursing staff of measures to prevent the spread of Candida spp. from patient to patient. PMID:7494029

  19. Population Structure and Genetic Relationships of Melia Taxa in China Assayed with Sequence-Related Amplified Polymorphism (SRAP Markers

    Directory of Open Access Journals (Sweden)

    Boyong Liao

    2016-04-01

    Full Text Available The uncertainty about whether, in China, the genus Melia (Meliaceae consists of one species (M. azedarach Linnaeus or two species (M. azedarach and M. toosendan Siebold & Zuccarini remains to be clarified. Although the two putative species are morphologically distinguishable, genetic evidence supporting their taxonomic separation is lacking. Here, we investigated the genetic diversity and population structure of 31 Melia populations across the natural distribution range of the genus in China. We used sequence-related amplified polymorphism (SRAP markers and obtained 257 clearly defined bands amplified by 20 primers from 461 individuals. The polymorphic loci (P varied from 35.17% to 76.55%, with an overall mean of 58.24%. Nei’s gene diversity (H ranged from 0.13 to 0.31, with an overall mean of 0.20. Shannon’s information index (I ranged from 0.18 to 0.45, with an average of 0.30. The genetic diversity of the total population (Ht and within populations (Hs was 0.37 ± 0.01 and 0.20 ± 0.01, respectively. Population differentiation was substantial (Gst = 0.45, and gene flow was low. Of the total variation, 31.41% was explained by differences among putative species, 19.17% among populations within putative species, and 49.42% within populations. Our results support the division of genus Melia into two species, which is consistent with the classification based on the morphological differentiation.

  20. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-01-01

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P < 0.05). Most of the variance was within populations. These findings will be important for more sustainable octopus fisheries, so that this marine resource can be conserved for its long-term utilization. PMID:26634529

  1. DNA polymerase ζ: new insight into eukaryotic mutagenesis and mammalian embryonic development

    Institute of Scientific and Technical Information of China (English)

    Feng Zhu; Ming Zhang

    2003-01-01

    Information about the mechanisms that generate mutationsin eukaryotes is likely to be useful for understanding humanhealth concerns, such as genotoxicity and cancer.Eukaryotic mutagenesis is largely the outcome of attacksby' endogenous and environmental agents. Except for DNArepair, cell cycle checkpoints and DNA damage avoidance,cells have also evolved DNA damage tolerance mechanism,by which lesion-targeted mutation might occur in thegenome during replication by specific DNA polymerases tobypass the lesions (translesion DNA synthesis, TLS), ormutation on undamaged DNA templates (untargetedmutation) might be induced. DNA polymerase ζ (poiζ),which was found firstly in budding yeast Saccharomycescerevisiae and consists of catalytic subunit scRev3 and stimulating subunit scRev7, has Received more attention in recent years. Poi ζ is a member of DNA polymerase δsubfamily, which belongs to DNA polymerase B family, and exists in almost all eukaryotes. Human homolog of the scRev3gene is located in chromosome region 6q21, and the mouse equivalent maps to chromosome 10, distal to the c-myb gene and close to the Macs gene. Alternative splicing, upstream out-of frame ATG can be found in yeast scRev3, mouse and human homologs. Furthermore, the sequence from 253-323 immediate upstream of the AUG initiator codon has the potential to form a stem-loop hairpin secondary structure in REV3 mRNA, suggesting that human REV3 protein may be expressed at low levels in human cells under normal growth conditions. The functional domain analysis showed that yeast Rev3-980 tyrosine in conserved region II is at the polymerase active site. Human REV3 amino acid residues 1 776-2 195 provide a REV7binding domain, and REV7 amino acid residues 1-211provide a bind domain for REV1, REV3 and REV7 itself.More interestingly, REV7 interacts with hMAD2 and therefore might function in the cell cycle control by affecting the activation of APC (anaphase promoting complex).Currently it has been known that

  2. Assessment of Genetic Variation Within Indian Mustard(Brassica juncea) Germplasm Using Random Amplified Polymorphic DNA Markers

    Institute of Scientific and Technical Information of China (English)

    Muhammad Ayub Khan; Malik Ashiq Rabbani; Muharnmad Munir; Saifullah Khan Ajmal; Muhammad Azim Malik

    2008-01-01

    Genetic diversity among 45 Indian mustard (Brassica Juncea L.) genotypes comprising 37 germplasm collections, five advance breeding lines and three improved cultivars was investigated at the DNA level using the random amplified polymorphic DNA (RAPD) technique. Fifteen primers used generated a total of 92 RAPD fragments, of which 81 (88%) were polymorphic. Of these, 13 were unique to accession 'Pak85559'. Each primer produced four to nine amplified products with an average of 6.13 bands per primer. Based on pairwise comparisons of RAPD amplification products, Nei and Li's similarity coefficients were calculated to evaluate the relationships among the accessions. Pairwise similarity indices were higher among the oilseed accessions and cultivars showing narrow ranges of 0.77-0.99. An unweighted pair-group method with arithmetic averages cluster analysis based on these genetic similarities placed most of the collections and oilseed cultivars close to each other, showing a low level of polymorphism between the accessions used. However, the clusters formed by oilseed collections and cultivars were comparatively distinct from that of advanced breeding lines. Genetically, all of the accessions were classified into a few major groups and a number of individual accessions. Advanced breeding lines were relatively divergent from the rest of the accessions and formed independent clusters. Clustering of the accessions did not show any pattern of association between the RAPD markers and the collection sites. A low level of genetic variability of oilseed mustard was attributed to the selection for similar traits and horticultural uses. Perhaps close parentage of these accessions further contributed towards their little diversity. The study demonstrated that RAPD is a simple and fast technique to compare the genetic relationship and pattern of variation among the gene pool of this crop.

  3. Computational investigation of locked nucleic acid (LNA) nucleotides in the active sites of DNA polymerases by molecular docking simulations.

    Science.gov (United States)

    Poongavanam, Vasanthanathan; Madala, Praveen K; Højland, Torben; Veedu, Rakesh N

    2014-01-01

    Aptamers constitute a potential class of therapeutic molecules typically selected from a large pool of oligonucleotides against a specific target. With a scope of developing unique shorter aptamers with very high biostability and affinity, locked nucleic acid (LNA) nucleotides have been investigated as a substrate for various polymerases. Various reports showed that some thermophilic B-family DNA polymerases, particularly KOD and Phusion DNA polymerases, accepted LNA-nucleoside 5'-triphosphates as substrates. In this study, we investigated the docking of LNA nucleotides in the active sites of RB69 and KOD DNA polymerases by molecular docking simulations. The study revealed that the incoming LNA-TTP is bound in the active site of the RB69 and KOD DNA polymerases in a manner similar to that seen in the case of dTTP, and with LNA structure, there is no other option than the locked C3'-endo conformation which in fact helps better orienting within the active site. PMID:25036012

  4. Genetic diversity and phylogenetic relationship among Tunisian cactus species (Opuntia) as revealed by random amplified microsatellite polymorphism markers.

    Science.gov (United States)

    Bendhifi Zarroug, M; Baraket, G; Zourgui, L; Souid, S; Salhi Hannachi, A

    2015-01-01

    Opuntia ficus indica is one of the most economically important species in the Cactaceae family. Increased interest in this crop stems from its potential contribution to agricultural diversification, application in the exploitation of marginal lands, and utility as additional income sources for farmers. In Tunisia, O. ficus indica has been affected by drastic genetic erosion resulting from biotic and abiotic stresses. Thus, it is imperative to identify and preserve this germplasm. In this study, we focused on the use of random amplified microsatellite polymorphisms to assess genetic diversity among 25 representatives of Tunisian Opuntia species maintained in the collection of the National Institute of Agronomic Research of Tunisia. Seventy-two DNA markers were screened to discriminate accessions using 16 successful primer combinations. The high percentage of polymorphic band (100%), the resolving power value (5.68), the polymorphic information content (0.94), and the marker index (7.2) demonstrated the efficiency of the primers tested. Therefore, appropriate cluster analysis used in this study illustrated a divergence among the cultivars studied and exhibited continuous variation that occurred independently of geographic origin. O. ficus indica accessions did not cluster separately from the other cactus pear species, indicating that their current taxonomical classifications are not well aligned with their genetic variability or locality of origin. PMID:25730081

  5. Genetic Characterization and Relatedness among Cherry Cultivars in a Germplasm Bank by Randomly Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Jesus Moreno

    2005-12-01

    Full Text Available Random amplified polymorphic DNA (RAPD analysis was performed on 38 cultivars of cherry (Prunus avium L. grown in the Jerte Valley, Cáceres, Spain. Thirty five selected decamer primers produced 69 reproducible polymorphic amplification products. The degree of polymorphism detected made possible the identification of all the cultivars by combining the RAPD banding patterns of only seven primers: OPK-08, OPQ-14, OPR-09, OPS-19, OPX-02, OPX-15 and OPZ-13. Eleven unique markers allowed identification of nine cultivars while 15 cultivars were identified by unique banding patterns. A similarity matrix derived from the RAPD amplification products generated by all the primers was obtained using the index of similarity of Jaccard. The similarity coefficients among cultivars ranged from 0.27 to 0.81 with an average of 0.50. A dendrogram based on UPGMA clustering method was constructed using the similarity matrix. The dendrogram showed a good correlation between the clustering of cherry cultivars and their geographic origin, especially revealing a stronger genetic proximity between some of the most characteristic cultivars of the Jerte Valley. This result supports the autochthonous origin hypothesis for these cultivars.

  6. Genetic variability in geographical populations of Culex quinquefasciatus Say (Diptera: Culicidae) from India based on random amplified polymorphic DNA analysis.

    Science.gov (United States)

    Sharma, A K; Mendki, M J; Tikar, S N; Chandel, K; Sukumaran, D; Parashar, B D; Veer, Vijay; Agarwal, O P; Prakash, Shri

    2009-10-01

    Genetic variability and environmental factors may influence the refractiveness, propagation of pathogen and transmission of disease. Random amplified polymorphic DNA (RAPD) is one of the widely used molecular markers for population genetic diversity studies. In present study, RAPD is used to ascertain the genetic variability in Culex quinquefasciatus populations collected from various Indian geographical locations. Out of 50 RAPD primers screened, 14 primers exhibited clear, concrete and distinct banding pattern showing up to 100% polymorphism. Primer OPBD3 was tested with DNA of 14 geographical populations from India (including one laboratory population) showed 21 loci representing 14 populations with 100% polymorphism. The genetic diversity among the populations indicated the Shannon index (I) and gene diversity index (H(ST)), 0.48 and 0.31, respectively among the population, displaying rich genetic variation among the Cx. quinquefasciatus populations. Consensus tree showed two clusters indicating the genetic variation among the various geographical populations. The findings of this study may be useful to understand the population variation under different ecological conditions and development of effective vector management strategies. PMID:19577531

  7. Translesion Synthesis DNA Polymerase: A Novel DNA Polymerase%跨损伤合成的DNA聚合酶——一类新的DNA聚合酶

    Institute of Scientific and Technical Information of China (English)

    陈建明; 余应年

    2001-01-01

    although there are many repair pathways in cells, some lesions still escape repair inevitably and remain in genome. In cells, the molecular mechanism of translesion DNA synthesis has been one of the major unsolved problems in DNA repair for a long time. Recently, it was found that the members of a structurally related UmuC/DinB protein superfarnily have DNA polyrnerase function. Unlike the classical replicative DNA polymerases, these newly identified DNA polymerases can carry out translesion DNA synthesis in both error prone/mutagenic and/or error-free ways. It was also found that their functions are conserved from bacteria to human.%细胞虽然拥有多种修复途径,但有些DNA损伤仍不可避免地会逃避修复而在基因组上保留下来,细胞跨 损伤DNA合成的分子机制一直是DNA修复中主要的未解决问题之一.最近通过对一类结构相关性UmuC/DinB 蛋白质超家族成员的研究发现它们具有DNA聚合酶功能.这类新发现的DNA聚合酶不同于经典的复制性DNA 聚合酶,它们能以易误/突变(error-prone/mutagenic)或无误(error-free)方式进行跨损伤(translesion)DNA合 成,并且从细菌到人在进化上功能保守.

  8. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Saulnier, P; Bourneix, C; Prévost, G; Andremont, A

    1993-04-01

    Twenty-six strains of methicillin-resistant Staphylococcus aureus with different pulsed-field gel electrophoresis fingerprints were tested by random amplified polymorphic DNA assay with three primers, resulting in 15 to 20 different random amplified polymorphic DNA fingerprints. By summing the results for the three primers, the number of different fingerprints increased to 25, but two strains could not be differentiated. We conclude that pulsed-field gel electrophoresis remains the best method of typing methicillin-resistant S. aureus strains. PMID:8463406

  9. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  10. Characterization of Pseudomonas aeruginosa in Burn Patients Using PCR- Restriction Fragment Length Polymorphism and Random Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Abdolaziz Rastegar Lari

    2010-09-01

    Full Text Available One of the major opportunistic pathogens in patients with burninjuries is Pseudomonas aeruginosa, which causes severe infectionsin burned patients. The objective of the study was to examinethe molecular epidemiology of P. aeruginosa colonization inthe burn unit of Shahid Motahari Hospital in Tehran, Iran. Restrictionfragment length polymorphism (RFLP and random amplifiedpolymorphic DNA (RAPD analysis were employed tostudy 127 clinical and two environmental P. aeruginosa isolatescollected from January to June 2008. In RFLP, the PCR productsof 16S rRNA gene were digested with restriction enzyme Alu I,Hae III, and Rsa I, and the fragments generated were analyzed byagarose electrophoresis. Molecular typing by RFLP did show nodiscriminatory power for P. aeruginosa isolates, but RAPD-PCRrevealed eight different genotypes; RAPD1to RAPD8 in clinicaland environmental isolates. RAPD1 was the major genotype inclinical (n=64, 50.4% and environmental isolates (n=1, 50%.The findings suggest that RAPD might have a superior typeabilityand discriminatory power over RFLP to study P. aeruginusa.Moreover, they highlight the need for further attention to the controlof infection sources in Burn Units to prevent the transmissionof the bacterium.

  11. Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

    Science.gov (United States)

    The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

  12. Cloning, expression and characterization of human tissue-specific DNA polymerase λ2

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    DNA polymerase (POL) λ plays an important role during DNA repair and DNA nonhomologous recom-bination processes. A novel POL λ variant was cloned from a human liver cDNA library and named POL λ2 (GenBank Accession No. AY302442). POL λ2 has 2206 base pairs in length with an open reading frame of 1452 base pairs encoding a 482-amino-acids protein. Bioinformatics analysis reveals that POL λ2 spans 7.9 kb on human chromosome 10q24 and is composed of 8 exons and 7 introns. It has the specific domain of DNA polymerase X family-POL Xc at the C-terminus and BRCT domain at the N-terminus. POL λ2 was localized predominantly in nucleus in transfected L0-2 cells. It was expressed abundantly in liver and testis, weakly in ovary, and undetectably in other tested human tissues. In comparison with the expression ratio between POL λ and POL λ2 in normal liver tissues and hepato-cellular carcinoma (HCC) adjacent tissues, the ratio was aberrant in 80% of those 15 HCC specimens examined due to the up-regulated expression of POL λ. This abnormality might be involved in hepato-carcinogenesis. The recombinant POL λ2 with His-tag was expressed as a soluble active protein in E. coli BL21 (DE3)CONDON Plus and purified by Ni-NTA resin and then desalted by Superdex-75 chro-matography in an FPLC system. The analysis using isotope α-32P-dCTP incorporation in vitro showed that the purified recombinant POL λ2 exhibited DNA polymerase activity.

  13. Cloning, expression and characterization of human tissue-specific DNA polymerase λ2

    Institute of Scientific and Technical Information of China (English)

    GU Fu; LI YuYang; L(U) Hong; YOU Chun; LIU JianPing; CHEN Ao; YU Yao; WANG Xiang; WAN DaFang; GU JianRen; YUAN HanYing

    2007-01-01

    DNA polymerase (POL) λ plays an important role during DNA repair and DNA nonhomologous recombination processes. A novel POL λ variant was cloned from a human liver cDNA library and named POL λ2 (GenBank Accession No. AY302442). POL λ2 has 2206 base pairs in length with an open reading frame of 1452 base pairs encoding a 482-amino-acids protein. Bioinformatics analysis reveals that POL λ2 spans 7.9 kb on human chromosome 10q24 and is composed of 8 exons and 7 introns. It has the specific domain of DNA polymerase X family-POL Xc at the C-terminus and BRCT domain at the N-terminus. POL λ2 was localized predominantly in nucleus in transfected L0-2 cells. It was expressed abundantly in liver and testis, weakly in ovary, and undetectably in other tested human tissues. In comparison with the expression ratio between POL λ and POL λ2 in normal liver tissues and hepatocellular carcinoma (HCC) adjacent tissues, the ratio was aberrant in 80% of those 15 HCC specimens examined due to the up-regulated expression of POL λ. This abnormality might be involved in hepatocarcinogenesis. The recombinant POL λ2 with His-tag was expressed as a soluble active protein in E.coli BL21 (DE3)CONDON Plus and purified by Ni-NTA resin and then desalted by Superdex-75 chromatography in an FPLC system. The analysis using isotope α-32p-dCTP incorporation in vitro showed that the purified recombinant POL λ2 exhibited DNA polymerase activity.

  14. Uso do Random Amplified Polymorphic DNA (RAPD no estudo populacional do Triatoma brasiliensis Neiva, 1911 Use of Random Amplified Polymorphic DNA (RAPD in the populational study of Triatoma brasiliensis Neiva, 1911

    Directory of Open Access Journals (Sweden)

    Érika C. Borges

    2000-01-01

    Full Text Available Para o estudo de variabilidade genética em Triatoma brasiliensis, o principal vetor da doença de Chagas no Nordeste brasileiro, espécimes de três diferentes populações intradomiciliares foram analisados. Regiões do DNA genômico foram amplificadas utilizando dois iniciadores randômicos através da técnica de RAPD (Random Amplified Polymorphic DNA, visualizados em géis de poliacrilamida corados pela prata. Os perfis originados se mostraram bastante homogêneos quando comparados intrapopulacionalmente. Populações capturadas em duas regiões diferentes do Estado do Ceará também apresentaram homogeneidade entre si, mas, quando comparadas com a população proveniente do Piauí, foi possível diferenciá-las. Esses resultados, preliminares, indicam que o RAPD pode ser usado com sucesso nos estudos de variabilidade em triatomíneos, bem como sugerem a existência de variabilidade entre diferentes populações de T. brasiliensis pertencentes a uma mesma subespécie.We evaluated the genetic variability of Triatoma brasiliensis, the main vector of Chagas disease in Northeast Brazil, using specimens from three populations. Regions of genomic DNA were amplified by RAPD (Random Amplified Polimorphic DNA, using two primers. The products were visualized after polyacrylamide gel electrophoresis followed by silver staining. A dendrogram constructed through the Dice similarity coefficient allowed for separation of the tested specimens into three distinct groups. The populations captured in areas from Ceará State showed similar profiles, but different from that captured in Piauí State. Our results indicate that RAPD can be used successfully in triatomine studies and suggest the presence of genetic variability between different populations of T. brasiliensis.

  15. Isolation, sequencing and overexpression of the gene encoding the theta subunit of DNA polymerase III holoenzyme.

    OpenAIRE

    J.R. Carter; Franden, M A; Aebersold, R.; Kim, D.R.; McHenry, C S

    1993-01-01

    The gene encoding the theta subunit of DNA polymerase III holoenzyme, designated holE, was isolated using a strategy in which peptide sequence was used to derive a DNA hybridization probe. Sequencing of the gene, which maps to 41.43 centisomes of the chromosome, revealed a 76-codon open reading frame predicted to produce a protein of 8,846 Da. When placed in a tac promoter expression vector, the open reading frame directed expression of a protein, that comigrated with authentic theta subunit ...

  16. Production of Recombinant Human DNA Polymerase Delta in a Bombyx mori Bioreactor

    OpenAIRE

    Zhou, Yajing; Chen, Huiqing; Li, Xiao; Wang, Yujue; Chen, Keping; Zhang, Sufang; MENG, XIAO; Lee, Ernest Y. C.; Lee, Marietta Y.W.T.

    2011-01-01

    Eukaryotic DNA polymerase δ (pol δ) plays a crucial role in chromosomal DNA replication and various DNA repair processes. It is thought to consist of p125, p66 (p68), p50 and p12 subunits. However, rigorous isolation of mammalian pol δ from natural sources has usually yielded two-subunit preparations containing only p125 and p50 polypeptides. While recombinant pol δ isolated from infected insect cells have some problems of consistency in the quality of the preparations, and the yields are muc...

  17. Study on the Interaction of Colloidal Gold with Taq DNA Polymerase

    Institute of Scientific and Technical Information of China (English)

    ZHU,Hong-Ping; MI,Li-Juan; CHEN,Shi-Mou; WANG,Wen-Feng; YAO,Si-De

    2007-01-01

    The interaction of colloidal gold with Taq DNA polymerase (Taq) was investigated in this study. Taq-gold conjugate was formed by adding the enzyme to the colloidal gold solution, as evidenced by UV-Vis spectroscopy,X-ray photoelectron spectroscopy, and photon cross correlation spectroscopy measurements. The conjugate was further characterized by transmission electron microscopy. It was found that the Taq-gold conjugate particles were still spherical and well-dispersed. The influence of gold nanoparticles on the bioactivity of Taq was studied by analyzing the yield of the polymerase chain reaction amplification. Results indicated that the enzymatic activity of Taq decreased after interaction with the colloidal gold.

  18. Bacteriophage T7 DNA polymerase: cloning and high-level expression.

    OpenAIRE

    Reutimann, H; Sjöberg, B M; Holmgren, A.

    1985-01-01

    Phage T7 DNA polymerase consists of a 1:1 complex of the viral T7 gene 5 protein and the host cell thioredoxin. A 3.25-kilobase T7 DNA fragment containing the complete coding sequence of gene 5, and the nearby genes 4.7 and 5.3, was cloned in the BamHI site of the plasmid pBR322. Transformation of the thioredoxin-negative (trxA-) Escherichia coli strain BH215 with the recombinant plasmid pRS101 resulted in large overproduction of gene 5 protein corresponding to a level about 60-fold higher th...

  19. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  20. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko; Baumgartner, Andreas; Wassenaar, Trudy M.; Wittwer, Matthias; Bissig-Choisat, Beatrice; Frey, Joachim

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping ba...

  1. Identification and molecular epidemiology of Campylobacter coli isolates from human gastroenteritis, food, and animal sources by amplified fragment length polymorphism analysis and Penner serotyping

    DEFF Research Database (Denmark)

    Siemer, B.L.; Nielsen, Elsa; On, Stephan L.w.

    2005-01-01

    Campylobacter coli is an infrequently studied but important food-borne pathogen with a wide natural distribution. We investigated its molecular epidemiology by use of amplified fragment length polymorphism (AFLP)-based genotyping and Penner serotyping. Serotype reference strains and 177 Danish is...

  2. High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) for the characterisation of pathogenic leptospires

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Craig, S B; Graham, G C;

    2010-01-01

    High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) is a novel technology that has emerged as a possible method to characterise leptospires to serovar level. RAPD-HRM has recently been used to measure intra-serovar convergence between strains of the same serovar as ...

  3. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hong Xian; Wen-Ming Cong; Shu-Hui Zhang; Meng-Chao Wu

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments.METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD)with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated,purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data.RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size,histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene.CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcinogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis.

  4. The DNA polymerase III holoenzyme contains γ and is not a trimeric polymerase

    Science.gov (United States)

    Dohrmann, Paul R.; Correa, Raul; Frisch, Ryan L.; Rosenberg, Susan M.; McHenry, Charles S.

    2016-01-01

    There is widespread agreement that the clamp loader of the Escherichia coli replicase has the composition DnaX3δδ’χψ. Two DnaX proteins exist in E. coli, full length τ and a truncated γ that is created by ribosomal frameshifting. τ binds DNA polymerase III tightly; γ does not. There is a controversy as to whether or not DNA polymerase III holoenzyme (Pol III HE) contains γ. A three-τ form of Pol III HE would contain three Pol IIIs. Proponents of the three-τ hypothesis have claimed that γ found in Pol III HE might be a proteolysis product of τ. To resolve this controversy, we constructed a strain that expressed only τ from a mutated chromosomal dnaX. γ containing a C-terminal biotinylation tag (γ-Ctag) was provided in trans at physiological levels from a plasmid. A 2000-fold purification of Pol III* (all Pol III HE subunits except β) from this strain contained one molecule of γ-Ctag per Pol III* assembly, indicating that the dominant form of Pol III* in cells is Pol III2τ2 γδδ’χψ. Revealing a role for γ in cells, mutants that express only τ display sensitivity to ultraviolet light and reduction in DNA Pol IV-dependent mutagenesis associated with double-strand-break repair, and impaired maintenance of an F’ episome. PMID:26786318

  5. DNA sequence recognition protein associated with a multiprotein form of DNA polymerase alpha

    International Nuclear Information System (INIS)

    The majority of DNA polymerase α activity in HeLa cells has been isolated and purified as a multiprotein Mr 640,000 form. A number of accessory activities cofractionate with this form of polymerase α. Among these are: Cl, C2 primer recognition proteins, primase, a 5' → 3' exonuclease, and a 5',5''',P1,P4-diadenosine tetraphosphate (Ap4A) binding protein. Preliminary results suggest an additional factor(s) or protein(s) is present in the multiprotein form of the HeLa cell DNA polymerase α which has an affinity for DNA sequences rich in A and T residues. Affinity chromatography on poly(dA)-or oligo(dT)-cellulose yields a highly purified protein. This protein has the ability to bind 3H-poly (dA) and 3H-poly(dT) in a nitrocellulose filter binding assay. The further physical properties of this protein and its DNA sequence binding specificity will be discussed

  6. Coumarins as Potential Inhibitors of DNA Polymerases and Reverse Transcriptases. Searching New Antiretroviral and Antitumoral Drugs.

    Science.gov (United States)

    Garro, Hugo A; Pungitore, Carlos R

    2015-01-01

    Human Immunodeficiency Virus (HIV) is the viral agent of Acquired Immunodeficiency Syndrome (AIDS), and at present, there is no effective vaccine against HIV. Reverse Transcriptase (RT) is an essential enzyme for retroviral replication, such as HIV as well as for other RNA infectious viruses like Human T lymphocyte virus. Polymerases act in DNA metabolism, modulating different processes like mitosis, damage repair, transcription and replication. It has been widely documented that DNA Polymerases and Reverse Transcriptases serve as molecular targets for antiviral and antitumoral chemotherapy. Coumarins are oxygen heterocycles that are widely distributed throughout the plant kingdom. Natural coumarins have attraction due to their bioactive properties such as tumor promotion inhibitory effects, and anti-HIV activity. Coumarins and derivates exhibit potent inhibitory effects on HIV-1 replication in lymphocytes and compounds isolated from Calophyllum inophyllum or DCK derivates showed inhibitory activity against human RT. Furthermore, natural isocoumarins isolated from cultures of fungi or hydroxycoumarins were able to inhibit human DNA polymerase. In view of their importance as drugs and biologically active natural products, and their medicinally useful properties, extensive studies have been carried out on the synthesis of coumarin compounds in recent years. Non-Nucleoside Reverse Transcriptase Inhibitors (NNRTIs), a class of antiretroviral chemotherapeutic agents, act by binding to an allosteric pocket showing, generally, low toxicity. This work tries to summarize the investigation about natural and synthetic coumarins with the ability to inhibit key enzymes that play a crucial role in DNA metabolism and their possible application as antiretroviral and antitumoral agents. PMID:26179474

  7. Priming DNA Replication from Triple Helix Oligonucleotides: Possible Threestranded DNA in DNA Polymerases

    Directory of Open Access Journals (Sweden)

    Patrick P. Lestienne

    2011-01-01

    Full Text Available Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second homologous duplex sequence through the formation of a triple helix, which is able to prime further DNA replication. In these case, the d(G-rich Triple Helix Primers (THP bind the homologous strand in a parallel manner, possibly via a RecA-like mechanism. This novel property is shared by all tested DNA polymerases: phage, retrovirus, bacteria, and human. These features may account for illegitimate initiation of replication upon single-strand breakage and annealing to a homologous sequence where priming may occur. Our experiments suggest that DNA polymerases can bind three instead of two polynucleotide strands in their catalytic centre.

  8. Priming DNA replication from triple helix oligonucleotides: possible threestranded DNA in DNA polymerases.

    Science.gov (United States)

    Lestienne, Patrick P

    2011-01-01

    Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs) are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second homologous duplex sequence through the formation of a triple helix, which is able to prime further DNA replication. In these case, the d(G)-rich Triple Helix Primers (THP) bind the homologous strand in a parallel manner, possibly via a RecA-like mechanism. This novel property is shared by all tested DNA polymerases: phage, retrovirus, bacteria, and human. These features may account for illegitimate initiation of replication upon single-strand breakage and annealing to a homologous sequence where priming may occur. Our experiments suggest that DNA polymerases can bind three instead of two polynucleotide strands in their catalytic centre. PMID:22229092

  9. A phage-encoded inhibitor of Escherichia coli DNA replication targets the DNA polymerase clamp loader.

    Science.gov (United States)

    Yano, Sho T; Rothman-Denes, Lucia B

    2011-03-01

    Coliphage N4 infection leads to shut-off of host DNA replication without inhibition of host transcription or translation. We report the identification and characterization of gp8, the N4 gene product responsible for this phenotype. N4 gp8 is an Escherichia coli bacteriostatic inhibitor that colocalizes with the E. coli replisome in a replication-dependent manner. Gp8 was purified and observed to cross-link to complexes containing the replicative DNA polymerase, DNAP III, in vivo. Purified gp8 inhibits DNA polymerization by DNA polymerase III holoenzyme in vitro by interfering with polymerase processivity. Gp8 specifically inhibits the clamp-loading activity of DNAP III by targeting the delta subunit of the DNAP III clamp loader; E. coli mutations conferring gp8 resistance were identified in the holA gene, encoding delta. Delta and gp8 interact in vitro; no interaction was detected between gp8 inactive mutants and wild-type delta or between delta gp8-resistant mutants and wild-type gp8. Therefore, this work identifies the DNAP III clamp loader as a new target for inhibition of bacterial growth. Finally, we show that gp8 is not essential in N4 development under laboratory conditions, but its activity contributes to phage yield. PMID:21205014

  10. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    Science.gov (United States)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  11. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    International Nuclear Information System (INIS)

    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  12. Photodynamic inhibition of Escherichia coli DNA polymerase 1 by 8-methoxypsoralen plus near ultraviolet irradiation

    International Nuclear Information System (INIS)

    Irradiation by UV-A of E. coli DNA polymerase I in the presence of 8-methoxypsoralen (8-MOP) leads to a similar inactivation of the 5' → 3' polymerase and 3' → 5' exonuclease activities of the enzyme. The kinetics of inactivation depend on the psoralen concentration and on the duration of irradiation. The 5' → 3' exonuclease activity is first slightly stimulated at short irradiation time in the presence of 8-MOP; further irradiation leads to inhibition of this activity. The mechanism of the reactions involves oxygen as shown by the absence of any effect of UV irradiation when oxygen is removed. The results obtained in D2O, in oxygen-saturated buffer or in the presence of singlet oxygen (1O2) quenchers show that 1O2 is one of the reactive intermediate species. Irradiation of homopolymers primed with oligomers in the presence of 8-MOP inhibits their template and initiating capacity in the same dose range as that required to inactivate DNA polymerase I. Mono-adducts of 8-MOP with nucleic acid bases can act as inhibitors of both replication and initiation. (author)

  13. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

    Science.gov (United States)

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun

    2016-04-01

    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future. PMID:26920159

  14. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ.

    Science.gov (United States)

    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya

    2015-12-15

    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  15. Heat damage to DNA polymerases as a possible cause for hyperthermic cell killing and radiosensitization by heat

    International Nuclear Information System (INIS)

    Reports in the literature suggest a causal relationship between heat effects on the activity of DNA polymerase β and hyperthermic cell killing. By using thermotolerance as a tool to investigate this possibility it was found that a poor correlation existed between these two parameters, but a good correlation was observed between the decrease in activity of this enzyme and the extent of radiosensitization by heat. To further pursue the role of DNA polymerases in the mechanism of cell killing, step-down heating procedures were introduced. No sensitization of polymerase inactivation was observed with this treatment. From the results of the experiments reported, the authors like to conclude that heat inactivation of DNA polymerase β is not to be considered as the general cause of hypethermic death

  16. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    International Nuclear Information System (INIS)

    To explain the development mechanism of mutation by radiation, DNA polymerase molecules repairing DNA should be identified. In this study, plasmid was constructed in order to express anti sense DNA of DNA polymerase in the cell and it was introduced into the cell by the calcium phosphate method. Polyclonal antibody of DNA polymerase δ and ε were produced so as to prove no existence of specific polymerase molecules in the cell. When center part of polymerase ε was immunized, antiserum with high antibody titer was obtained. Near terminal C of polymerase δ was immunized, then antiserum was obtained. We discovered very interesting fact that base sequence of polymerase ε published by Syvaoja was not correct. (S.Y.)

  17. Evidence against a Simple Tethering Model for Enhancement of Herpes Simplex Virus DNA Polymerase Processivity by Accessory Protein UL42

    OpenAIRE

    Chaudhuri, Murari; Parris, Deborah S.

    2002-01-01

    The DNA polymerase holoenzyme of herpes simplex virus type 1 (HSV-1) is a stable heterodimer consisting of a catalytic subunit (Pol) and a processivity factor (UL42). HSV-1 UL42 differs from most DNA polymerase processivity factors in possessing an inherent ability to bind to double-stranded DNA. It has been proposed that UL42 increases the processivity of Pol by directly tethering it to the primer and template (P/T). To test this hypothesis, we took advantage of the different sensitivities o...

  18. The β subunit sliding DNA clamp is responsible for unassisted mutagenic translesion replication by DNA polymerase III holoenzyme

    OpenAIRE

    Tomer, Guy; Reuven, Nina Bacher; Livneh, Zvi

    1998-01-01

    The replication of damaged nucleotides that have escaped DNA repair leads to the formation of mutations caused by misincorporation opposite the lesion. In Escherichia coli, this process is under tight regulation of the SOS stress response and is carried out by DNA polymerase III in a process that involves also the RecA, UmuD′ and UmuC proteins. We have shown that DNA polymerase III holoenzyme is able to replicate, unassisted, through a synthetic abasic site in a gapped duplex plasmid. Here, w...

  19. Genetic diversity analysis of Penicillium marneffei isolated from AIDS patients in Guangdong, China using randomly amplified polymorphic DNA

    Institute of Scientific and Technical Information of China (English)

    LI Ling-hua; HU Feng-yu; CHEN Wan-shan; CAI Wei-ping; SONG Wei-nan; KUANG Yan-ling; TANG Xiao-ping

    2012-01-01

    Background Penicillium mameffei (P.mameffei) is an emerging pathogenic fungus that can cause invasive mycosis in patients with AIDS.The epidemiological features of P.mameffei infection in AIDS patients in Guangdong province remain unclear so far.This study aimed to investigate the genetic diversity within a population of 163 P.mameffei isolates obtained from AIDS patients and search for the dominant clinical strains in Guangdong province.Methods One hundred and sixty-three P.marneffeiisolates obtained from AIDS patients in Guangdong province during January 2004 and December 2009 were studied by randomly amplified polymorphic DNA (RAPD) using two random primers (H2 and H22).The degree of similarity between samples was calculated through similarity coefficients from RAPD fragment data and the dendrogram was assessed using the unweighted pair group method with arithmetic mean (UPGMA).Results Two primers showed a high degree of discrimination and good stability.Primer H2 yielded eight different patterns (H2-1 to H2-8) among 163 isolates with the discriminatory power being 0.413.Primer H22 identified seven types (H22-1 to H22-7) among 163 isolates with the discriminatory power being 0.467.Genetic similarity coefficients based on RAPD data among 163 P.marneffei isolates ranged from 0.681 to 0.957,61.96% of which were no less than 0.83.The discriminatory power of the two primers was 0.524.One hundred and sixty-three P.marneffei isolates were clustered into nine distinct groups (groups I to IX) at the similarity coefficient value of 0.83 and group Ⅰ was the most common,including 101 strains (61.96%).Conclusion The RAPD analyses could provide important information as to the degree of genetic diversity and the relationship among clinical P.mameffei isolates,revealing genetic polymorphism and dominant strains.

  20. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  1. Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases.

    Science.gov (United States)

    Su, Yan; Peter Guengerich, F

    2016-01-01

    Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. © 2016 by John Wiley & Sons, Inc. PMID:27248785

  2. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    Science.gov (United States)

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  3. DNA polymerase β from rat liver. Isolation, properties, and inhibitory analysis of ahomogeneous preparation

    International Nuclear Information System (INIS)

    A simple and reproducible method for purifying DNA polymerase β from rat liver to the homogeneous state has been developed which includes the stages of the isolation and salt extraction of the chromatin and the chromatography of the proteins on DEAE-cellulose and phosphocellulose, Blue Gel A, and DNA-Sepharose. The final preparation consisted of a protein with a molecular weight 38-40 kD, a specific activity of 31 activity units/μg, and a pI value of 8.6-8.9. The total yield of active enzyme was 8.4%, calculated on the chromatin extract. The inclusion by the enzyme of radioactive dNTPs in activated DNA is effectively inhibited by dNTP (3'NH2)s, ddTTP, and dNTP(3'F)s, and, considerably more feebly, by aCTP and aNTP (3'NH2)s

  4. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  5. Suppression of rolling circle amplification by nucleotide analogs in circular template for three DNA polymerases.

    Science.gov (United States)

    Tang, Suming; Wei, Hua; Hu, Tianyu; Jiang, Jiquan; Chang, Jinglin; Guan, Yifu; Zhao, Guojie

    2016-08-01

    Among wide applications of nucleotide analogs, their roles in enzyme catalytic reactions are significant in both fundamental and medical researches. By introducing analogs into circular templates, we succeeded in determining effects of four analogs on RCA efficiency for three different DNA polymerases. Results showed an obvious suppression effect for 2'-OMeRNA modification, which might be due to the size of the C2'-modified moieties. 2'-F RNA, LNA and PS had little interference, suggesting good analog candidates for application in RCA. Different polymerases and nucleobases made a little difference according to analogs we used. These results are useful for understanding polymerase catalytic mechanism and analogs applications in RCA reaction. PMID:27151504

  6. Stable interactions between DNA polymerase δ catalytic and structural subunits are essential for efficient DNA repair

    International Nuclear Information System (INIS)

    Eukaryotic DNA polymerase δ (Pol δ) activity is crucial for chromosome replication and DNA repair and thus, plays an essential role in genome stability. In Saccharomyces cerevisiae, Pol δ is a heterotrimeric complex composed of the catalytic subunit Pol3, the structural B subunit Pol31, and Pol32, an additional auxiliary subunit. Pol3 interacts with Pol31 thanks to its C-terminal domain (CTD) and this interaction is of functional importance both in DNA replication and DNA repair. Interestingly, deletion of the last four C-terminal Pol3 residues, LSKW, in the Pol3-ct mutant does not affect DNA replication but leads to defects in homologous recombination and in break-induced replication (BIR) repair pathways. The defect associated with pol3-ct could result from a defective interaction between Pol δ and a protein involved in recombination. However, we show that the LSKW motif is required for the interaction between Pol3 C-terminal end and Pol31. This loss of interaction is relevant in vivo since we found that pol3-ct confers HU sensitivity on its own and synthetic lethality with a Pol32 deletion. Moreover, Pol3-ct shows genetic interactions, both suppression and synthetic lethality, with Pol31 mutant alleles. Structural analyses indicate that the B subunit of Pol displays a major conserved region at its surface and that Pol31 alleles interacting with Pol3-ct, correspond to substitutions of Pol31 amino acids that are situated in this particular region. Superimposition of our Pol31 model on the 3D architecture of the phylo-genetically related DNA polymerase α (Pol α) suggests that Pol3 CTD interacts with the conserved region of Pol31, thus providing a molecular basis to understand the defects associated with pol3-ct. Taken together, our data highlight a stringent dependence on Pol δ complex stability in DNA repair. (authors)

  7. DNA polymerase θ (POLQ), double-strand break repair, and cancer.

    Science.gov (United States)

    Wood, Richard D; Doublié, Sylvie

    2016-08-01

    DNA polymerase theta (pol θ) is encoded in the genomes of many eukaryotes, though not in fungi. Pol θ is encoded by the POLQ gene in mammalian cells. The C-terminal third of the protein is a family A DNA polymerase with additional insertion elements relative to prokaryotic homologs. The N-terminal third is a helicase-like domain with DNA-dependent ATPase activity. Pol θ is important in the repair of genomic double-strand breaks (DSBs) from many sources. These include breaks formed by ionizing radiation and topoisomerase inhibitors, breaks arising at stalled DNA replication forks, breaks introduced during diversification steps of the mammalian immune system, and DSB induced by CRISPR-Cas9. Pol θ participates in a route of DSB repair termed "alternative end-joining" (altEJ). AltEJ is independent of the DNA binding Ku protein complex and requires DNA end resection. Pol θ is able to mediate joining of two resected 3' ends harboring DNA sequence microhomology. "Signatures" of Pol θ action during altEJ are the frequent utilization of longer microhomologies, and the insertion of additional sequences at joining sites. The mechanism of end-joining employs the ability of Pol θ to tightly grasp a 3' terminus through unique contacts in the active site, allowing extension from minimally paired primers. Pol θ is involved in controlling the frequency of chromosome translocations and preserves genome integrity by limiting large deletions. It may also play a backup role in DNA base excision repair. POLQ is a member of a cluster of similarly upregulated genes that are strongly correlated with poor clinical outcome for breast cancer, ovarian cancer and other cancer types. Inhibition of pol θ is a compelling approach for combination therapy of radiosensitization. PMID:27264557

  8. Regulation of Mutagenic DNA Polymerase V Activation in Space and Time

    Science.gov (United States)

    Robinson, Andrew; McDonald, John P.; Caldas, Victor E. A.; Patel, Meghna; Wood, Elizabeth A.; Punter, Christiaan M.; Ghodke, Harshad; Cox, Michael M.; Woodgate, Roger; Goodman, Myron F.; van Oijen, Antoine M.

    2015-01-01

    Spatial regulation is often encountered as a component of multi-tiered regulatory systems in eukaryotes, where processes are readily segregated by organelle boundaries. Well-characterized examples of spatial regulation are less common in bacteria. Low-fidelity DNA polymerase V (UmuD′2C) is produced in Escherichia coli as part of the bacterial SOS response to DNA damage. Due to the mutagenic potential of this enzyme, pol V activity is controlled by means of an elaborate regulatory system at transcriptional and posttranslational levels. Using single-molecule fluorescence microscopy to visualize UmuC inside living cells in space and time, we now show that pol V is also subject to a novel form of spatial regulation. After an initial delay (~ 45 min) post UV irradiation, UmuC is synthesized, but is not immediately activated. Instead, it is sequestered at the inner cell membrane. The release of UmuC into the cytosol requires the RecA* nucleoprotein filament-mediated cleavage of UmuD→UmuD′. Classic SOS damage response mutants either block [umuD(K97A)] or constitutively stimulate [recA(E38K)] UmuC release from the membrane. Foci of mutagenically active pol V Mut (UmuD′2C-RecA-ATP) formed in the cytosol after UV irradiation do not co-localize with pol III replisomes, suggesting a capacity to promote translesion DNA synthesis at lesions skipped over by DNA polymerase III. In effect, at least three molecular mechanisms limit the amount of time that pol V has to access DNA: (1) transcriptional and posttranslational regulation that initially keep the intracellular levels of pol V to a minimum; (2) spatial regulation via transient sequestration of UmuC at the membrane, which further delays pol V activation; and (3) the hydrolytic activity of a recently discovered pol V Mut ATPase function that limits active polymerase time on the chromosomal template. PMID:26317348

  9. Regulation of Mutagenic DNA Polymerase V Activation in Space and Time.

    Directory of Open Access Journals (Sweden)

    Andrew Robinson

    2015-08-01

    Full Text Available Spatial regulation is often encountered as a component of multi-tiered regulatory systems in eukaryotes, where processes are readily segregated by organelle boundaries. Well-characterized examples of spatial regulation are less common in bacteria. Low-fidelity DNA polymerase V (UmuD'2C is produced in Escherichia coli as part of the bacterial SOS response to DNA damage. Due to the mutagenic potential of this enzyme, pol V activity is controlled by means of an elaborate regulatory system at transcriptional and posttranslational levels. Using single-molecule fluorescence microscopy to visualize UmuC inside living cells in space and time, we now show that pol V is also subject to a novel form of spatial regulation. After an initial delay (~ 45 min post UV irradiation, UmuC is synthesized, but is not immediately activated. Instead, it is sequestered at the inner cell membrane. The release of UmuC into the cytosol requires the RecA* nucleoprotein filament-mediated cleavage of UmuD→UmuD'. Classic SOS damage response mutants either block [umuD(K97A] or constitutively stimulate [recA(E38K] UmuC release from the membrane. Foci of mutagenically active pol V Mut (UmuD'2C-RecA-ATP formed in the cytosol after UV irradiation do not co-localize with pol III replisomes, suggesting a capacity to promote translesion DNA synthesis at lesions skipped over by DNA polymerase III. In effect, at least three molecular mechanisms limit the amount of time that pol V has to access DNA: (1 transcriptional and posttranslational regulation that initially keep the intracellular levels of pol V to a minimum; (2 spatial regulation via transient sequestration of UmuC at the membrane, which further delays pol V activation; and (3 the hydrolytic activity of a recently discovered pol V Mut ATPase function that limits active polymerase time on the chromosomal template.

  10. Production of recombinant human DNA polymerase delta in a Bombyx mori bioreactor.

    Science.gov (United States)

    Zhou, Yajing; Chen, Huiqing; Li, Xiao; Wang, Yujue; Chen, Keping; Zhang, Sufang; Meng, Xiao; Lee, Ernest Y C; Lee, Marietta Y W T

    2011-01-01

    Eukaryotic DNA polymerase δ (pol δ) plays a crucial role in chromosomal DNA replication and various DNA repair processes. It is thought to consist of p125, p66 (p68), p50 and p12 subunits. However, rigorous isolation of mammalian pol δ from natural sources has usually yielded two-subunit preparations containing only p125 and p50 polypeptides. While recombinant pol δ isolated from infected insect cells have some problems of consistency in the quality of the preparations, and the yields are much lower. To address these deficiencies, we have constructed recombinant BmNPV baculoviruses using MultiBac system. This method makes the generation of recombinant forms of pol δ containing mutations in any one of the subunits or combinations thereof extremely facile. From about 350 infected larvae, we obtained as much as 4 mg of pol δ four-subunit complex. Highly purified enzyme behaved like the one of native form by rigorous characterization and comparison of its activities on poly(dA)/oligo(dT) template-primer and singly primed M13 DNA, and its homogeneity on FPLC gel filtration. In vitro base excision repair (BER) assays showed that pol δ plays a significant role in uracil-intiated BER and is more likely to mediate LP BER, while the trimer lacking p12 is more likely to mediate SN BER. It seems likely that loss of p12 modulates the rate of SN BER and LP BER during the repair process. Thus, this work provides a simple, fast, reliable and economic way for the large-scale production of human DNA polymerase δ with a high activity and purity, setting up a new platform for our further research on the biochemical properties of pol δ, its regulation and the integration of its functions, and how alterations in pol δ function could contribute to the etiology of human cancer or other diseases that can result from loss of genomic stability. PMID:21789240

  11. DNA methylation changes detected by methylation-sensitive amplified polymorphism in two contrasting rice genotypes under salt stress

    Institute of Scientific and Technical Information of China (English)

    Wensheng Wang; Xiuqin Zhao; Yajiao Pan; Linghua Zhu; Binying Fu; Zhikang Li

    2011-01-01

    DNA methylation,one of the most important epigenetic phenomena,plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli.In the present study,a rnethylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress.Consistent with visibly different phenotypes in response to salt stress,epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salttolerant FL478 and salt-sensitive IR29.In addition,most tissue-specific DNA methylation loci were conserved,while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes.Strikingly,salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478.This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage,and helps to further elucidate the implications of DNA methylation in crop growth and development.

  12. Effect of DNA polymerase inhibitors on DNA repair in intact and permeable human fibroblasts: Evidence that DNA polymerases δ and β are involved in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine

    International Nuclear Information System (INIS)

    The involvement of DNA polymerases α, β, and δ in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase α) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of [3H]thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 μg of aphidicolin/mL, 6% by 10 μM BuPdGTP, 13% by anti-(DNA polymerse α) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 μg of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase α) antibodies into HF nuclei. These results indicate that both DNA polymerase δ and β are involved in repairing DNA damage caused by MNNG

  13. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  14. Use of Multienzyme Multiplex PCR Amplified Fragment Length Polymorphism Typing in Analysis of Outbreaks of Multiresistant Klebsiella pneumoniae in an Intensive Care Unit

    OpenAIRE

    van der Zee, Anneke; Steer, Niels; Thijssen, Eveline; Nelson, Jolande; van't Veen, Annemarie; Buiting, Anton

    2003-01-01

    We developed and optimized a new modified amplified fragment length polymorphism (AFLP) typing method to obtain a multibanding fingerprint that can be separated by agarose gel electrophoresis. Both to maximize the discriminatory power and to facilitate the computer-assisted analysis, bacterial DNA was digested with four different restriction enzymes. After ligation of adaptors to the DNA fragments, PCR testing of various single primers was performed. Two single primers that gave optimal resul...

  15. Diversity of Listeria monocytogenes isolates from cold-smoked salmon produced in different smokehouses as assessed by Random Amplified Polymorphic DNA analyses

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Jørgensen, Lasse Vigel; Ojeniyi, B.;

    2001-01-01

    One hundred and forty-eight Listeria monocytogenes isolates originating from vacuum packed cold-smoked salmon produced in 10 different Danish smokehouses were compared by Random Amplified Polymorphic DNA (RAPD) profiling. A total of 16 different reproducible RAPD profiles were obtained using a...... indicate a possible persistence of closely related strains of L. monocytogenes in smokehouses. (C) 2001 Elsevier Science B.V. All rights reserved...

  16. Diversity of Listeria monocytogenes isolates from cold-smoked salmon produced in different smokehouses as assessed by Random Amplified Polymorphic DNA analyses

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Jørgensen, Lasse Vigel; Ojeniyi, B.; Huss, Hans Henrik; Gram, Lone

    One hundred and forty-eight Listeria monocytogenes isolates originating from vacuum packed cold-smoked salmon produced in 10 different Danish smokehouses were compared by Random Amplified Polymorphic DNA (RAPD) profiling. A total of 16 different reproducible RAPD profiles were obtained using a st...... indicate a possible persistence of closely related strains of L. monocytogenes in smokehouses. (C) 2001 Elsevier Science B.V. All rights reserved...

  17. Application of random amplified polymorphic DNA (RAPD) analysis for identification of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets.

    Science.gov (United States)

    Asensio, Luis; González, Isabel; Fernández, Alicia; Rodríguez, Miguel A; Lobo, Esther; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2002-02-01

    A random amplified polymorphic DNA (RAPD) method was developed for the specific identification of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets. Using two different reaction primers (S1 and L1), RAPD analysis produced clear fingerprints from which the three fish species could be easily identified. This approach is rapid and reliable and offers the potential to detect fraudulent or unintentional mislabeling of these species in routine seafood authentication analysis. PMID:11848581

  18. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

    Czech Academy of Sciences Publication Activity Database

    Furukawa, T.; Angelis, Karel; Britt, A.B.

    2015-01-01

    Roč. 6, MAY 27 (2015). ISSN 1664-462X R&D Projects: GA ČR GA13-06595S Institutional support: RVO:61389030 Keywords : DNA polymerase * DNA repair * Non homologous end joining Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.948, year: 2014

  19. Cost-effective optimization of real-time PCR based detection of Campylobacter and Salmonella with inhibitor tolerant DNA polymerases

    DEFF Research Database (Denmark)

    Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey;

    2015-01-01

    AIMS: The aim of this study was to cost-effectively improve detection of foodborne pathogens in PCR inhibitory samples through the use of alternative DNA polymerases. METHODS AND RESULTS: Commercially available polymerases (n=16) and PCR master mixes (n=4) were screened on DNA purified from bacte...

  20. Analysis of UV-induced mutation spectra in Escherichia coli by DNA polymerase η from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    DNA polymerase η belongs to the Y-family of DNA polymerases, enzymes that are able to synthesize past template lesions that block replication fork progression. This polymerase accurately bypasses UV-associated cis-syn cyclobutane thymine dimers in vitro and therefore may contributes to resistance against sunlight in vivo, both ameliorating survival and decreasing the level of mutagenesis. We cloned and sequenced a cDNA from Arabidopsis thaliana which encodes a protein containing several sequence motifs characteristics of Polη homologues, including a highly conserved sequence reported to be present in the active site of the Y-family DNA polymerases. The gene, named AtPOLH, contains 14 exons and 13 introns and is expressed in different plant tissues. A strain from Saccharomyces cerevisiae, deficient in Polη activity, was transformed with a yeast expression plasmid containing the AtPOLH cDNA. The rate of survival to UV irradiation in the transformed mutant increased to similar values of the wild type yeast strain, showing that AtPOLH encodes a functional protein. In addition, when AtPOLH is expressed in Escherichia coli, a change in the mutational spectra is detected when bacteria are irradiated with UV light. This observation might indicate that AtPOLH could compete with DNA polymerase V and then bypass cyclobutane pyrimidine dimers incorporating two adenylates

  1. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291. ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.420, year: 2014

  2. Mapping of the vaccinia virus DNA polymerase gene by marker rescue and cell-free translation of selected RNA

    International Nuclear Information System (INIS)

    The previous demonstration that a phosphonoacetate (PAA)-resistant (PAA/sup r/) vaccinia virus mutant synthesized an altered DNA polymerase provided the key to mapping this gene. Marker rescue was performed in cells infected with wild-type PAA-sensitive (PAA/sup s/) vaccinia by transfecting with calcium phosphate-precipitated DNA from a PAA/sup r/ mutant virus. Formation of PAA/sup r/ recombinants was measured by plaque assay in the presence of PAA. Of the 12 HindIII fragments cloned in plasmid or cosmid vectors, only fragment E conferred the PAA/sup r/ phenotype. Successive subcloning of the 15-kilobase HindIII fragment E localized the marker within a 7.5-kilobase BamHI-HindIII fragment and then within a 2.9-kilobase EcoRI fragment. The location of the DNA polymerase gene, about 57 kilobases from the left end of the genome, was confirmed by cell-free translation of mRNA selected by hybridization to plasmids containing regions of PAA/sup r/ vaccinia DNA active in marker rescue. A 100,000-dalton polypeptide that comigrated with authentic DNA polymerase was synthesized. Correspondence of the in vitro translation product with purified vaccinia DNA polymerase was established by peptide mapping

  3. Studies on DNA replication in vitro by DNA polymerase-α/primase complex from embryonic chicken brain

    International Nuclear Information System (INIS)

    DNA polymerase - α activity, characterized by its sensitivity to N-ethylmaleimide, high sedimentation coefficient, and acidic isoelectric point was found to decline with increasing embryonic age. Primase activity, the enzyme responsible for the initiation of DNA synthesis, was found to co-sediment with DNA polymerase - α activity on a continuous glycerol velocity gradient. Of all the single-stranded DNA templates tested, primase activity was found to be maximally active with poly dC. In the presence of [α-32P] GTP, primase activity was found to catalyze the formation of an alkali-labile oligoriboguanylate, 15-20 nucleotides long. The chain length of the products were not altered by the presence or absence of dGTP. Primase activity was not inhibited by a high concentration of α- amanitin. Consistent with the finding of a decline of the activity level of DNA polymerase - α, the level of DNA polymerase - α antigen was also found to decrease with embryonic age, as evidenced by ELISA with a non-neutralizing monoclonal antibody, SJK 237-71

  4. Preparation of Taq DNA Polymerase by Thermal Purification%Taq DNA聚合酶的热纯化制备

    Institute of Scientific and Technical Information of China (English)

    丁燕华; 刘树涛; 齐庆远

    2011-01-01

    [Objective]The paper was to improve the preparation efficacy of Taq DNA polymerase.[Method]Ni column was used to purify Taq DNA polymerase carrying with 6xHis tag, and recombined vector.Using the thermal-resistant characteristics of Taq DNA polymerase, the crude extract was treated at 75 ℃ for 1 h, and the activity of prepared enzyme solution was verified by PCR test.[Result]The recombinant pET-32A-Taq could highly express in BL21 (DE3) host bacteria and remove hybrid protein by thermal denaturation.The enzyme preparation with the activity further higher than purchased Taq DNA polymerase was obtained.[Conclusion]Taq DNA polymerase prepared by thermal purification method is simple with low cost, and can meet the needs of a large number of conventional PCR amplification.%[目的]提高Taq DNA聚合酶的制备效率.[方法]利用Ni柱亲和色谱纯化载有6xHis标记的Taq DNA聚合酶,并重组载体,利用Taq DNA聚合酶的耐热特性,对粗提液75℃处理1h,之后通过PCR试验验证制备酶液的活力.[结果]所获重组的pET-32A-Taq能够在BL21(DE3)宿主菌中高效表达并可通过热变性去除杂蛋白,获得了活力远高于购买的Taq DNA聚合酶的酶制剂.[结论]使用热纯化法制备的Taq DNA聚合酶工艺简单,成本较低,能满足常规大量PCR实验要求.

  5. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  6. Random amplified polymorphisms between two South American subspecies of rattlesnakes (Crotalus durissus collilineatus and Crotalus durissus terrificus

    Directory of Open Access Journals (Sweden)

    Sergio Echeverrigaray

    2001-09-01

    Full Text Available The present work was made to determine the suitability of RAPD analysis for the identification of specimens of two subspecies of South American rattlesnakes (Crotalus durissus terrificus and Crotalus durissus collilineatus. The 11 arbitrary primer sequence tested amplified a total of 161 bands, of which 31% were polymorphics when compared with Crotalus specimens. The combining results from different primers allowed the identification of all the specimens under analysis. Several characteristic bands of each subspecies were identified. Dendrogram, based on RAPD markers, show three groups that corresponded to the subspecies of Crotalus, and to Bothrops jararaca specimen.O presente trabalho foi desenvolvido visando determinar a aplicabilidade da análise de RAPD na identificação de indivíduos pertencentes a duas sub-espécies de cascavéis sul-americanas (Crotalus durissus terrificus e Crotalus durissus collilineatus. As 11 sequências arbitrárias inicializadoras testadas nestes experimentos, amplificaram um total de 161 bandas, das quais 31% foram polimórficas na comparação entre espécimes de Cratalus. Os resultados combinados obtidos com as distintas sequências inicializadoras, permitiram a identificação de todos os indivíduos avaliados. Várias bandas características de cada sub-espécie foram identificadas. O dendrogama, baseado em marcaodres de RAPD, mostra tres grupos que correspondem às duas sub-espécies de Crotalus e ao especimen de Bothrops jararaca.

  7. Competition of Escherichia coli DNA polymerases I, II and III with DNA Pol IV in stressed cells.

    Directory of Open Access Journals (Sweden)

    P J Hastings

    Full Text Available Escherichia coli has five DNA polymerases, one of which, the low-fidelity Pol IV or DinB, is required for stress-induced mutagenesis in the well-studied Lac frameshift-reversion assay. Although normally present at approximately 200 molecules per cell, Pol IV is recruited to acts of DNA double-strand-break repair, and causes mutagenesis, only when at least two cellular stress responses are activated: the SOS DNA-damage response, which upregulates DinB approximately 10-fold, and the RpoS-controlled general-stress response, which upregulates Pol IV about 2-fold. DNA Pol III was also implicated but its role in mutagenesis was unclear. We sought in vivo evidence on the presence and interactions of multiple DNA polymerases during stress-induced mutagenesis. Using multiply mutant strains, we provide evidence of competition of DNA Pols I, II and III with Pol IV, implying that they are all present at sites of stress-induced mutagenesis. Previous data indicate that Pol V is also present. We show that the interactions of Pols I, II and III with Pol IV result neither from, first, induction of the SOS response when particular DNA polymerases are removed, nor second, from proofreading of DNA Pol IV errors by the editing functions of Pol I or Pol III. Third, we provide evidence that Pol III itself does not assist with but rather inhibits Pol IV-dependent mutagenesis. The data support the remaining hypothesis that during the acts of DNA double-strand-break (DSB repair, shown previously to underlie stress-induced mutagenesis in the Lac system, there is competition of DNA polymerases I, II and III with DNA Pol IV for action at the primer terminus. Up-regulation of Pol IV, and possibly other stress-response-controlled factor(s, tilt the competition in favor of error-prone Pol IV at the expense of more accurate polymerases, thus producing stress-induced mutations. This mutagenesis assay reveals the DNA polymerases operating in DSB repair during stress and also

  8. Stopped-flow DNA polymerase assay by continuous monitoring of dNTP incorporation by fluorescence.

    Science.gov (United States)

    Montgomery, Jesse L; Rejali, Nick; Wittwer, Carl T

    2013-10-15

    DNA polymerase activity was measured by a stopped-flow assay that monitors polymerase extension using an intercalating dye. Double-stranded DNA formation during extension of a hairpin substrate was monitored at 75°C for 2 min. Rates were determined in nucleotides per second per molecule of polymerase (nt/s) and were linear with time and polymerase concentration from 1 to 50 nM. The concentrations of 15 available polymerases were quantified and their extension rates determined in 50 mM Tris, pH 8.3, 0.5 mg/ml BSA, 2 mM MgCl₂, and 200 μM each dNTP as well as their commercially recommended buffers. Native Taq polymerases had similar extension rates of 10-45 nt/s. Three alternative polymerases showed faster speeds, including KOD (76 nt/s), Klentaq I (101 nt/s), and KAPA2G (155 nt/s). Fusion polymerases including Herculase II and Phusion were relatively slow (3-13 nt/s). The pH optimum for Klentaq extension was between 8.5 and 8.7 with no effect of Tris concentration. Activity was directly correlated to the MgCl2 concentration and inversely correlated to the KCl concentration. This continuous assay is relevant to PCR and provides accurate measurement of polymerase activity using a defined template without the need of radiolabeled substrates. PMID:23872003

  9. Structural basis for the suppression of skin cancers by DNA polymerase [eta

    Energy Technology Data Exchange (ETDEWEB)

    Silverstein, Timothy D.; Johnson, Robert E.; Jain, Rinku; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K. (Texas-MED); (Mount Sinai Hospital)

    2010-09-13

    DNA polymerase {eta} (Pol{eta}) is unique among eukaryotic polymerases in its proficient ability for error-free replication through ultraviolet-induced cyclobutane pyrimidine dimers, and inactivation of Pol{eta} (also known as POLH) in humans causes the variant form of xeroderma pigmentosum (XPV). We present the crystal structures of Saccharomyces cerevisiae Pol{eta} (also known as RAD30) in ternary complex with a cis-syn thymine-thymine (T-T) dimer and with undamaged DNA. The structures reveal that the ability of Pol{eta} to replicate efficiently through the ultraviolet-induced lesion derives from a simple and yet elegant mechanism, wherein the two Ts of the T-T dimer are accommodated in an active site cleft that is much more open than in other polymerases. We also show by structural, biochemical and genetic analysis that the two Ts are maintained in a stable configuration in the active site via interactions with Gln55, Arg73 and Met74. Together, these features define the basis for Pol{eta}'s action on ultraviolet-damaged DNA that is crucial in suppressing the mutagenic and carcinogenic consequences of sun exposure, thereby reducing the incidence of skin cancers in humans.

  10. Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase α

    International Nuclear Information System (INIS)

    In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol α from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol α with IC50 value of 0.5 μM, and did not influence the activities of other replicative pols such as pols δ and ε, but also showed no effect on pol α activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD50 values of 38.0-44.4 μM. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol α-specific inhibitor, but also as a candidate drug for anti-cancer treatment

  11. Structural and mechanistic investigations into a DNA polymerase from Drosophila melanogaster embryos

    International Nuclear Information System (INIS)

    A procedure for isolating DNA polymerase α (DNAPα) from Drosophila melanogaster embryos is described. A novel affinity chromatographic step exploits the differential binding affinity exhibited by this enzyme for poly A and poly G agarose. DNAPα isolated from embryos of 9 hour average age appears identical to an enzyme previously described. A potentially larger form of the enzyme is isolated from 2.5 hour average age embryos. Two independent methods were used to demonstrate that DNAPα obeys a rigidly ordered substrate binding mechanism with template-primer binding being prerequisite to dNTP binding. One method, utilizing alternative pathway kinetics, is described here for the first time. Pyridoxal-5-phosphate (PLP) was found to inhibit DNAPα reversibly, at low stoichiometry and with a saturation effect, all criteria for an affinity label. Furthermore, PLP inhibition is dependent on pH and MgCl2 concentration in the range of optimal DNAP activity. From protection experiments with normal substrates and dideoxyterminated primers and from the effects of substrates and PLP on initial velocities, it was conclusively shown that PLP inhibits DNAP by binding at two different sites. A procedure for the isolation of a pyridoxal kinase from Lactobacillus casei, optimal reaction conditions of the purified enzyme and its use in the synthesis of 32P PLP are all described

  12. The antitumor toxin CD437 is a direct inhibitor of DNA polymerase α.

    Science.gov (United States)

    Han, Ting; Goralski, Maria; Capota, Emanuela; Padrick, Shae B; Kim, Jiwoong; Xie, Yang; Nijhawan, Deepak

    2016-07-01

    CD437 is a retinoid-like small molecule that selectively induces apoptosis in cancer cells, but not in normal cells, through an unknown mechanism. We used a forward-genetic strategy to discover mutations in POLA1 that coincide with CD437 resistance (POLA1(R)). Introduction of one of these mutations into cancer cells by CRISPR-Cas9 genome editing conferred CD437 resistance, demonstrating causality. POLA1 encodes DNA polymerase α, the enzyme responsible for initiating DNA synthesis during the S phase of the cell cycle. CD437 inhibits DNA replication in cells and recombinant POLA1 activity in vitro. Both effects are abrogated by the identified POLA1 mutations, supporting POLA1 as the direct antitumor target of CD437. In addition, we detected an increase in the total fluorescence intensity and anisotropy of CD437 in the presence of increasing concentrations of POLA1 that is consistent with a direct binding interaction. The discovery of POLA1 as the direct anticancer target for CD437 has the potential to catalyze the development of CD437 into an anticancer therapeutic. PMID:27182663

  13. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    International Nuclear Information System (INIS)

    Highlights: • The UV sensitivity of POLH−/− cells was suppressed by disruption of WRNIP1. • In WRNIP1−/−/−/POLH−/− cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH−/− cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH−/−) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation

  14. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    Directory of Open Access Journals (Sweden)

    Wendy Ribble

    2015-01-01

    Full Text Available DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE. The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth, an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ, δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions.

  15. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N3-methyl-dT or O6-methyl-dG

  16. Inhibitory effect of tocotrienol on eukaryotic DNA polymerase λ and angiogenesis

    International Nuclear Information System (INIS)

    Tocotrienols, vitamin E compounds that have an unsaturated side chain with three double bonds, selectively inhibited the activity of mammalian DNA polymerase λ (pol λ) in vitro. These compounds did not influence the activities of replicative pols such as α, δ, and ε, or even the activity of pol β which is thought to have a very similar three-dimensional structure to the pol β-like region of pol λ. Since δ-tocotrienol had the strongest inhibitory effect among the four (α- to δ-) tocotrienols, the isomer's structure might be an important factor in the inhibition of pol λ. The inhibitory effect of δ-tocotrienol on both intact pol λ (residues 1-575) and a truncated pol λ lacking the N-terminal BRCA1 C-terminus (BRCT) domain (residues 133-575, del-1 pol λ) was dose-dependent, with 50% inhibition observed at a concentration of 18.4 and 90.1 μM, respectively. However, del-2 pol λ (residues 245-575) containing the C-terminal pol β-like region was unaffected. Tocotrienols also inhibited the proliferation of and formation of tubes by bovine aortic endothelial cells, with δ-tocotrienol having the greatest effect. These results indicated that tocotrienols targeted both pol λ and angiogenesis as anti-cancer agents. The relationship between the inhibition of pol λ and anti-angiogenesis by δ-tocotrienol was discussed

  17. Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

    Directory of Open Access Journals (Sweden)

    Lavrik O. I.

    2012-06-01

    Full Text Available Aim. To investigate the TLS-activity of human DNA polymerases β and λ (pols β and λ using 5-formyluridine (5-foU containing DNA duplexes which are imitating the intermediates during replication of the leading DNA strand, and to study the influence of replication factors hRPA and hPCNA on this activity. Methods. The EMSA and the methods of enzyme’s kinetics were used. Results. The capability of pols β and λ to catalyze DNA synthesis across 5-foU was investigated and the kinetic characteristics of this process in the presence and in the absence of protein factors hRPA and hPCNA were evaluated. Conclusions. It was shown that: (i both proteins are able to catalyze TLS on used DNA substrates regardless of the reaction conditions, however, pol λ was more accurate enzyme; (ii hRPA can stimulate the efficacy of the nonmutagenic TLS catalyzed by pol at the nucleotide incorporation directly opposite of 5-foU, at the same time it doesn’t influence the incorporation efficacy if the damage displaced into the duplex; (iii hPCNA doesn’t influence the efficacy of TLS catalyzed by both enzymes.

  18. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  19. DNA polymerase ι functions in the generation of tandem mutations during somatic hypermutation of antibody genes.

    Science.gov (United States)

    Maul, Robert W; MacCarthy, Thomas; Frank, Ekaterina G; Donigan, Katherine A; McLenigan, Mary P; Yang, William; Saribasak, Huseyin; Huston, Donald E; Lange, Sabine S; Woodgate, Roger; Gearhart, Patricia J

    2016-08-22

    DNA polymerase ι (Pol ι) is an attractive candidate for somatic hypermutation in antibody genes because of its low fidelity. To identify a role for Pol ι, we analyzed mutations in two strains of mice with deficiencies in the enzyme: 129 mice with negligible expression of truncated Pol ι, and knock-in mice that express full-length Pol ι that is catalytically inactive. Both strains had normal frequencies and spectra of mutations in the variable region, indicating that loss of Pol ι did not change overall mutagenesis. We next examined if Pol ι affected tandem mutations generated by another error-prone polymerase, Pol ζ. The frequency of contiguous mutations was analyzed using a novel computational model to determine if they occur during a single DNA transaction or during two independent events. Analyses of 2,000 mutations from both strains indicated that Pol ι-compromised mice lost the tandem signature, whereas C57BL/6 mice accumulated significant amounts of double mutations. The results support a model where Pol ι occasionally accesses the replication fork to generate a first mutation, and Pol ζ extends the mismatch with a second mutation. PMID:27455952

  20. Colon Cancer-associated DNA Polymerase β Variant Induces Genomic Instability and Cellular Transformation*

    Science.gov (United States)

    Nemec, Antonia A.; Donigan, Katherine A.; Murphy, Drew L.; Jaeger, Joachim; Sweasy, Joann B.

    2012-01-01

    Rapidly advancing technology has resulted in the generation of the genomic sequences of several human tumors. We have identified several mutations of the DNA polymerase β (pol β) gene in human colorectal cancer. We have demonstrated that the expression of the pol β G231D variant increased chromosomal aberrations and induced cellular transformation. The transformed phenotype persisted in the cells even once the expression of G231D was extinguished, suggesting that it resulted as a consequence of genomic instability. Biochemical analysis revealed that its catalytic rate was 140-fold slower than WT pol β, and this was a result of the decreased binding affinity of nucleotides by G231D. Residue 231 of pol β lies in close proximity to the template strand of the DNA. Molecular modeling demonstrated that the change from a small and nonpolar glycine to a negatively charged aspartate resulted in a repulsion between the template and residue 231 leading to the distortion of the dNTP binding pocket. In addition, expression of G231D was insufficient to rescue pol β-deficient cells treated with chemotherapeutic agents suggesting that these agents may be effectively used to treat tumors harboring this mutation. More importantly, this suggests that the G231D variant has impaired base excision repair. Together, these data indicate that the G231D variant plays a role in driving cancer. PMID:22573322

  1. Crystallization and preliminary X-ray analysis of the Plasmodium falciparum apicoplast DNA polymerase.

    Science.gov (United States)

    Milton, Morgan E; Choe, Jun-yong; Honzatko, Richard B; Nelson, Scott W

    2015-03-01

    Infection by the parasite Plasmodium falciparum is the leading cause of malaria in humans. The parasite has a unique and essential plastid-like organelle called the apicoplast. The apicoplast contains a genome that undergoes replication and repair through the action of a replicative polymerase (apPOL). apPOL has no direct orthologs in mammalian polymerases and is therefore an attractive antimalarial drug target. No structural information exists for apPOL, and the Klenow fragment of Escherichia coli DNA polymerase I, which is its closest structural homolog, shares only 28% sequence identity. Here, conditions for the crystallization of and preliminary X-ray diffraction data from crystals of P. falciparum apPOL are reported. Data complete to 3.5 Å resolution were collected from a single crystal (2 × 2 × 5 µm) using a 5 µm beam. The space group P6522 (unit-cell parameters a = b = 141.8, c = 149.7 Å, α = β = 90, γ = 120°) was confirmed by molecular replacement. Refinement is in progress. PMID:25760711

  2. Modulation of Pleurodeles waltl DNA polymerase mu expression by extreme conditions encountered during spaceflight.

    Science.gov (United States)

    Schenten, Véronique; Guéguinou, Nathan; Baatout, Sarah; Frippiat, Jean-Pol

    2013-01-01

    DNA polymerase µ is involved in DNA repair, V(D)J recombination and likely somatic hypermutation of immunoglobulin genes. Our previous studies demonstrated that spaceflight conditions affect immunoglobulin gene expression and somatic hypermutation frequency. Consequently, we questioned whether Polμ expression could also be affected. To address this question, we characterized Polμ of the Iberian ribbed newt Pleurodeles waltl and exposed embryos of that species to spaceflight conditions or to environmental modifications corresponding to those encountered in the International Space Station. We noted a robust expression of Polμ mRNA during early ontogenesis and in the testis, suggesting that Polμ is involved in genomic stability. Full-length Polμ transcripts are 8-9 times more abundant in P. waltl than in humans and mice, thereby providing an explanation for the somatic hypermutation predilection of G and C bases in amphibians. Polμ transcription decreases after 10 days of development in space and radiation seem primarily involved in this down-regulation. However, space radiation, alone or in combination with a perturbation of the circadian rhythm, did not affect Polμ protein levels and did not induce protein oxidation, showing the limited impact of radiation encountered during a 10-day stay in the International Space Station. PMID:23936065

  3. Modulation of Pleurodeles waltl DNA polymerase mu expression by extreme conditions encountered during spaceflight.

    Directory of Open Access Journals (Sweden)

    Véronique Schenten

    Full Text Available DNA polymerase µ is involved in DNA repair, V(DJ recombination and likely somatic hypermutation of immunoglobulin genes. Our previous studies demonstrated that spaceflight conditions affect immunoglobulin gene expression and somatic hypermutation frequency. Consequently, we questioned whether Polμ expression could also be affected. To address this question, we characterized Polμ of the Iberian ribbed newt Pleurodeles waltl and exposed embryos of that species to spaceflight conditions or to environmental modifications corresponding to those encountered in the International Space Station. We noted a robust expression of Polμ mRNA during early ontogenesis and in the testis, suggesting that Polμ is involved in genomic stability. Full-length Polμ transcripts are 8-9 times more abundant in P. waltl than in humans and mice, thereby providing an explanation for the somatic hypermutation predilection of G and C bases in amphibians. Polμ transcription decreases after 10 days of development in space and radiation seem primarily involved in this down-regulation. However, space radiation, alone or in combination with a perturbation of the circadian rhythm, did not affect Polμ protein levels and did not induce protein oxidation, showing the limited impact of radiation encountered during a 10-day stay in the International Space Station.

  4. Cloning of the cDNAs for the small subunits of bovine and human DNA polymerase {delta} and chromosomal location of the human gene (POLD2)

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jian; Tan, Cheng-Keat; Downey, K.M. [Univ. of Miami School of Medicine, FL (United States)] [and others

    1995-09-01

    cDNAs encoding the small subunit of bovine and human DNA polymerase {delta} have been cloned and sequenced. The predicted polypeptides, 50,885 and 51,289 Daltons, respectively, are 94% identical, similar to the catalytic subunits. The high degree of conservation of the polypeptides suggests an essential function for the small subunit in the heterodimeric core enzyme. Although the catalytic subunit of DNA polymerase 5 shares significant homology with those of the herpes virus family of DNA polymerases, the small subunit of mammalian DNA polymerase 6 is not homologous to the small subunit of either herpes simplex virus type 1 DNA polymerase (UL42 protein) or the Epstein-Barr virus DNA polymerase (BMRF1 protein). Searches of the protein databases failed to detect significant homology with any protein sequenced thus far. PCR analysis of DNA from a panel of human-hamster hybrid cell lines localized the gene (POLD2) for the small subunit of DNA polymerase 5 to human chromosome 7. 45 refs., 2 figs., 2 tabs.

  5. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  6. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    International Nuclear Information System (INIS)

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit δ or ε which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  7. Dihydrothymidine and thymidine glycol triphosphates as substrates for DNA polymerases: differential recognition of thymine C5-C6 bond saturation and sequence specificity of incorporation.

    OpenAIRE

    Ide, H; Wallace, S. S.

    1988-01-01

    The ability of dihydrothymidine (DHdTTP) and thymidine glycol (dTTP-GLY) 5'-triphosphates to serve as substrates for different DNA polymerases was investigated. DHdTTP but not dTTP-GLY was used as a substrate by E. coli DNA polymerase I (Pol I). Within the detection limit of the assay used, neither T4 DNA polymerase nor avian myeloblastosis virus (AMV) reverse transcriptase used DHdTTP or dTTP-GLY as substrates. The ability of DHdTTP and dTTP-GLY to undergo enzyme-catalyzed turnover to the mo...

  8. Pin1 Interacts with the Epstein-Barr Virus DNA Polymerase Catalytic Subunit and Regulates Viral DNA Replication

    OpenAIRE

    Narita, Yohei; Murata, Takayuki; Ryo, Akihide; Kawashima, Daisuke; Sugimoto, Atsuko; Kanda, Teru; Kimura, Hiroshi; Tsurumi, Tatsuya

    2013-01-01

    Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (Pin1) protein is known as a regulator which recognizes phosphorylated Ser/Thr-Pro motifs and increases the rate of cis and trans amide isomer interconversion, thereby altering the conformation of its substrates. We found that Pin1 knockdown using short hairpin RNA (shRNA) technology resulted in strong suppression of productive Epstein-Barr virus (EBV) DNA replication. We further identified the EBV DNA polymerase catalytic subunit, BALF5,...

  9. Role for DNA Polymerase κ in the Processing of N2-N2-Guanine Interstrand Cross-links*S⃞

    OpenAIRE

    Minko, Irina G.; Harbut, Michael B.; Kozekov, Ivan D.; Kozekova, Albena; Jakobs, Petra M.; Olson, Susan B; Moses, Robb E.; Harris, Thomas M.; Rizzo, Carmelo J.; Lloyd, R. Stephen

    2008-01-01

    Although there exists compelling genetic evidence for a homologous recombination-independent pathway for repair of interstrand cross-links (ICLs) involving translesion synthesis (TLS), biochemical support for this model is lacking. To identify DNA polymerases that may function in TLS past ICLs, oligodeoxynucleotides were synthesized containing site-specific ICLs in which the linkage was between N2-guanines, similar to cross-links formed by mitomycin C and enals. Here, ...

  10. Genotyping the hepatitis B virus with a fragment of the HBV DNA polymerase gene in Shenyang, China

    OpenAIRE

    Juan Feng; Ding Yang; Ma Ying; Dou Xiao

    2011-01-01

    Abstract The hepatitis B virus (HBV) has been classified into eight genotypes (A-H) based on intergenotypic divergence of at least 8% in the complete nucleotide sequence or more than 4% in the S gene. To facilitate the investigation of the relationship between the efficacy of drug treatment and the mutation with specific genotype of HBV, we have established a new genotyping strategy based on a fragment of the HBV DNA polymerase gene. Pairwise sequence and phylogenetic analyses were performed ...

  11. An ATF/CREB site is the major regulatory element in the human herpesvirus 6 DNA polymerase promoter.

    OpenAIRE

    Agulnick, A D; Thompson, J R; Ricciardi, R P

    1994-01-01

    Human herpesvirus 6 (HHV-6) is a recently described T-cell pathogen whose medical relevance and molecular biology are just beginning to be addressed. As a first look at the regulation of viral genes, control of the HHV-6 DNA polymerase promoter was examined. Polymerase gene transcription in HHV-6-infected cells was found to initiate from a single site located 115 bases upstream of the translation start codon. A polymerase promoter-chloramphenicol acetyltransferase reporter gene construct fail...

  12. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    Science.gov (United States)

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  13. Eukaryotic DNA repair is blocked at different steps by inhibitors of DNA topoisomerases and of DNA polymerases α and β

    International Nuclear Information System (INIS)

    Inhibitors of (a) DNA topoisomerases (novobiocin and nalidixic acid) and of (b) eukaryotic DNA polymerases α (cytosine arabinoside) and β (dideoxythymidine) blocked different steps of DNA repair, demonstrated by the effects of the inhibitors on the relaxation of supercoiled DNA nucleoids following treatment of human cell cultures with ultraviolet light (1-3 J/m2) or MNNG (5 or 20 μM) and the subsequent restoration of the supercoiled nucleoids during repair incubation. Inhibition of repair by novobiocin was partially reversible; upon its removal from the culture medium, the nucleoid DNA of repairing cells became relaxed. The DNA polymerase inhibitors allowed the initial relaxation of DNA after treatment of the cells with ultraviolet or MNNG but delayed the regeneration of rapidly-sedimenting (supercoiled) nucleoid DNA for 2-4 h. Dideoxythymidine (1 mM) was more effective than cytosine arabinoside (1 μM) in producing this delay, but neither inhibitor by itself blocked repair permanently. Incubation of ultraviolet-irradiated cells with 1 μM cytosine arabinoside plus 1 mM dideoxythymidine blocked the completion of repair for 24 h, whereas incubation with 10 μM cytosine arabinoside or 5 mM dideoxythymidine produced only temporary repair delays of 2-4 h. Thus, it is likely that the two DNA polymerase inhibitors act upon separate targets and that both targets are involved in repair. (Auth.)

  14. Structural Determinant for Switching between the Polymerase and Exonuclease Modes in the PCNA-Replicative DNA Polymerase Complex

    Science.gov (United States)

    Nishida, Hirokazu; Mayanagi, Kouta; Ishino, Yoshizumi; Morikawa, Kosuke

    Proliferating cell nuclear antigen (PCNA) is responsible for the processivity of DNA polymerase. We determined the crystal structure of Pyrococcus furiosus DNA polymerase (PfuPol) complexed with a cognate monomeric PCNA, which allowed us to construct a convincing model of the polymerase-PCNA ring interaction. Electron microscopy analyses confirmed that this complex structure exists among the multiple functional configurations in solution. Together with data from mutational analyses, this structural study indicated that the novel interaction between a stretched loop of PCNA and the PfuPol Thumb domain is quite important, in addition to the authentic PCNA-polymerase recognition site (PIP box). A comparison of the present structures with the previously reported structures of polymerases complexed with DNA suggested that the second interaction site plays a crucial role in switching between the polymerase and exonuclease modes, by stabilizing only the polymerase mode. This proposed mechanism of fidelity control of replicative DNA polymerases was supported by experiments, in which a mutation within the second interaction site caused an enhancement in the exonuclease activity in the presence of PCNA.

  15. The Second Subunit of DNA Polymerase Delta Is Required for Genomic Stability and Epigenetic Regulation1[OPEN

    Science.gov (United States)

    Cheng, Jinkui; Lai, Jinsheng; Gong, Zhizhong

    2016-01-01

    DNA polymerase δ plays crucial roles in DNA repair and replication as well as maintaining genomic stability. However, the function of POLD2, the second small subunit of DNA polymerase δ, has not been characterized yet in Arabidopsis (Arabidopsis thaliana). During a genetic screen for release of transcriptional gene silencing, we identified a mutation in POLD2. Whole-genome bisulfite sequencing indicated that POLD2 is not involved in the regulation of DNA methylation. POLD2 genetically interacts with Ataxia Telangiectasia-mutated and Rad3-related and DNA polymerase α. The pold2-1 mutant exhibits genomic instability with a high frequency of homologous recombination. It also exhibits hypersensitivity to DNA-damaging reagents and short telomere length. Whole-genome chromatin immunoprecipitation sequencing and RNA sequencing analyses suggest that pold2-1 changes H3K27me3 and H3K4me3 modifications, and these changes are correlated with the gene expression levels. Our study suggests that POLD2 is required for maintaining genome integrity and properly establishing the epigenetic markers during DNA replication to modulate gene expression. PMID:27208288

  16. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks.

    Science.gov (United States)

    Rozacky, Jenna; Nemec, Antoni A; Sweasy, Joann B; Kidane, Dawit

    2015-09-15

    DNA polymerase beta (Pol β) is a key enzyme for the protection against oxidative DNA lesions via its role in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5' phosphate group (5'-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5'-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  17. Biochemical analysis of DNA polymerase η fidelity in the presence of replication protein A.

    Directory of Open Access Journals (Sweden)

    Samuel C Suarez

    Full Text Available DNA polymerase η (pol η synthesizes across from damaged DNA templates in order to prevent deleterious consequences like replication fork collapse and double-strand breaks. This process, termed translesion synthesis (TLS, is an overall positive for the cell, as cells deficient in pol η display higher mutation rates. This outcome occurs despite the fact that the in vitro fidelity of bypass by pol η alone is moderate to low, depending on the lesion being copied. One possible means of increasing the fidelity of pol η is interaction with replication accessory proteins present at the replication fork. We have previously utilized a bacteriophage based screening system to measure the fidelity of bypass using purified proteins. Here we report on the fidelity effects of a single stranded binding protein, replication protein A (RPA, when copying the oxidative lesion 7,8-dihydro-8-oxo-guanine(8-oxoG and the UV-induced cis-syn thymine-thymine cyclobutane pyrimidine dimer (T-T CPD. We observed no change in fidelity dependent on RPA when copying these damaged templates. This result is consistent in multiple position contexts. We previously identified single amino acid substitution mutants of pol η that have specific effects on fidelity when copying both damaged and undamaged templates. In order to confirm our results, we examined the Q38A and Y52E mutants in the same full-length construct. We again observed no difference when RPA was added to the bypass reaction, with the mutant forms of pol η displaying similar fidelity regardless of RPA status. We do, however, observe some slight effects when copying undamaged DNA, similar to those we have described previously. Our results indicate that RPA by itself does not affect pol η dependent lesion bypass fidelity when copying either 8-oxoG or T-T CPD lesions.

  18. Role of DNA polymerase α in chromosomal aberration production by ionizing radiation

    International Nuclear Information System (INIS)

    The authors have shown that aphidicolin, like other inhibitors of DNA synthesis, both induces chromosomal aberrations in human peripheral lymphocytes and, as a post-treatment, interacts synergistically with X rays to produce greatly enhanced aberration yields. Because DNA polymerase α is the only DNA-synthetic or repair enzyme known to be affected by aphidicolin, the authors infer that this enzyme is directly involved in the repair of DNA lesions which, if unrepaired, can result in visible chromosomal aberrations. The present experiments were undertaken to further explore the effects of aphidicolin in human lymphocytes in the post-DNA-synthetic G2 phase of the cell cycle. Earlier experiments in which cells were simply fixed at times after treatment when the frequency of metaphases in the DNA-synthetic S phase of the cell cycle is zero in typical percentage labeled mitoses curves for human lymphocytes did not completely rule out the possibility that the aberrations induced by aphidicolin actually arose in a small subpopulation of cells actually in the S phase, and not in G2 cells. Furthermore, the yield of X-ray-induced aberrations in G2 cells falls rapidly as a function of increasing irradiation-fixation interval, so comparisons of yields at particular fixation times can be misleading if the cells in each group do not progress through G2 at the same rate. The experiments reported here utilized labeling with tritiated thymidine to positively identify cells in the S phase at the time of treatment and serial Colcemid collections and fixations to determine aberration yields over as much of the G2 phase as feasible

  19. AP endonuclease knockdown enhances methyl methanesulfonate hypersensitivity of DNA polymerase β knockout mouse embryonic fibroblasts

    International Nuclear Information System (INIS)

    Apurinic/apyrimidinic (AP) endonuclease (Apex) is required for base excision repair (BER), which is the major mechanism of repair for small DNA lesions such as alkylated bases. Apex incises the DNA strand at an AP site to leave 3'-OH and 5'-deoxyribose phosphate (5'-dRp) termini. DNA polymerase β (PolB) plays a dominant role in single nucleotide (Sn-) BER by incorporating a nucleotide and removing 5'-dRp. Methyl methanesulfonate (MMS)-induced damage is repaired by Sn-BER, and thus mouse embryonic fibroblasts (MEFs) deficient in PolB show significantly increased sensitivity to MMS. However, the survival curve for PolB-knockout MEFs (PolBKOs) has a shoulder, and increased sensitivity is only apparent at relatively high MMS concentrations. In this study, we prepared Apex-knockdown/PolB-knockout MEFs (AKDBKOs) to examine whether BER is related to the apparent resistance of PolBKOs at low MMS concentrations. The viability of PolBKOs immediately after MMS treatment was significantly lower than that of wild-type MEFs, but there was essentially no effect of Apex-knockdown on cell viability in the presence or absence of PolB. In contrast, relative counts of MEFs after repair were decreased by Apex knockdown. Parental PolBKOs showed especially high sensitivity at >1.5 mM MMS, suggesting that PolBKOs have another repair mechanism in addition to PolB-dependent Sn-BER, and that the back-up mechanism is unable to repair damage induced by high MMS concentrations. Interestingly, AKDBKOs were hypersensitive to MMS in a relative cell growth assay, suggesting that MMS-induced damage in PolB-knockout MEFs is repaired by Apex-dependent repair mechanisms, presumably including long-patch BER. (author)

  20. Use of random amplified polymorphic DNA (RAPD to detect DNA damage induced by Prangos ferulacea (Umbelliferae essential oil against the Mediterranean flour moth Ephestia kuehniella Zeller (Lepidoptera: Pyralidae

    Directory of Open Access Journals (Sweden)

    Ercan Fahriye Sumer

    2015-01-01

    Full Text Available DNA damage detection in Ephestia kuehniella by RAPD-PCR Abstract - The random amplified polymorphic DNA (RAPD assay is a useful method for detecting genotoxin-induced DNA damage. In the present study, this assay was evaluated to measure the essential oil of Prangos ferulacea-induced DNA changes in Ephestia kuehniella Zeller larvae. The third instar larvae of E. kuehniella were exposed to 500 μl L-1 essential oil for 24 h. Forty random primers were used for RAPD-PCR of which eleven produced unique polymorphic band patterns. In comparison with control larvae, the essential oil-treated larvae showed greater changes in RAPD profiles. This is the first report of an analysis of the genotoxic effect of P. ferulacea essential oil against E. kuehniella larvae using RAPD-PCR.

  1. Four cleaved amplified polymorphic sequence (CAPS) markers for the detection of the Juglans ailantifolia chloroplast in putatively native J. cinerea populations.

    Science.gov (United States)

    McCleary, Tim S; Robichaud, Rodney L; Nuanes, Steve; Anagnostakis, Sandra L; Schlarbaum, Scott E; Romero-Severson, Jeanne

    2009-03-01

    Hybridization between butternut (Juglans cinerea), a forest tree native to eastern North America, and Japanese walnut (J. ailantifolia), a tree tolerant to the lethal fungal disease butternut canker, casts doubt on the genetic identity of the remaining butternuts. We report a diagnostic test to distinguish the J. cinerea chloroplast from the J. ailantifolia chloroplast using cleaved amplified polymorphic sequences resolvable in 1.5% agarose gels. J. ailantifolia maternal ancestry in naturally regenerated stands provides a site selection criterion for studies of introgression dynamics when the non-native parent and the hybrids tolerate a disease to which the native species is susceptible. PMID:21564682

  2. Reconstitution of DNA base excision-repair with purified human proteins: interaction between DNA polymerase beta and the XRCC1 protein.

    OpenAIRE

    Kubota, Y; Nash, R. A.; Klungland, A; Schär, P; Barnes, D E.; Lindahl, T

    1996-01-01

    Repair of a uracil-guanine base pair in DNA has been reconstituted with the recombinant human proteins uracil-DNA glycosylase, apurinic/apyrimidinic endonuclease, DNA polymerase beta and DNA ligase III. The XRCC1 protein, which is known to bind DNA ligase III, is not absolutely required for the reaction but suppresses strand displacement by DNA polymerase beta, allowing for more efficient ligation after filling of a single nucleotide patch. We show that XRCC1 interacts directly with DNA polym...

  3. Characterization of an RNA-directed DNA polymerase from a cell line derived from a radiation-induced lymphoma in mice

    International Nuclear Information System (INIS)

    An RNA-directed DNA polymerase was purified from a cell line derived from a radiation-induced lymphoma in NIH Swiss mice which produced non-infectious type C virus particles. The enzyme was isolated from a high speed particulate fraction which bands at a density of 1.16-1.19 g/ml in a sucrose gradient, and purified by successive chromatography on DEAE-cellulose, phosphocellulose and hydroxyapatite. The purified DNA polymerase has a molecular weight of 68 000, a pH optimum of 7.5, a KCl optimum of 50 mM, and a Mn2+ optimum of 0.25 mM. It prefers (dT)15.(A)sub(n) to (dT)15.(dA)sub(n) as the primer template and transcribes the poly(C) strand of (dG)15.(C)sub(n) and (dG)15.(OMeC)sub(n). It transcribes heteropolymeric regions of avian myeloblastosis virus 70 S RNA, and is inhibited by antiserum to Rauscher murine leukemia virus DNA polymerase. Comparison of the properties of DNA polymerase purified from radiation-induced lymphoma cells with the DNA polymerase purified from non-defective murine type C RNA tumor viruses shows that the mouse lymphoma enzyme is both biochemically and immunologically related to murine leukemia virus DNA polymerases. (Auth.)

  4. Molecular Diversity of Antagonistic Streptomyces spp. against Botrytis allii, the agent of onion gray mold using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    M. Jorjandi

    2014-08-01

    Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.

  5. Carriage of a Tumor Necrosis Factor Polymorphism Amplifies the Cytotoxic T-Lymphocyte Antigen 4 Attributed Risk of Primary Biliary Cirrhosis: Evidence for a Gene–Gene Interaction

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Liu, Xiangdong; Heathcote, E. Jenny; Hirschfield, Gideon M.; Siminovitch, Katherine A.; Lazaridis, Konstantinos N.

    2010-01-01

    Common genetic variants significantly influence complex diseases such as primary biliary cirrhosis (PBC). We recently reported an association between PBC and a single nucleotide polymorphism (rs231725) of the immunoreceptor gene cytotoxic T-lymphocyte antigen 4 (CTLA4). We hypothesized that PBC risk attributed to this polymorphism might be increased by propensity to an overly robust inflammatory response. Thus, we examined its potential interaction with the commonly studied −308AG promoter polymorphism (rs1800629) of the tumor necrosis factor (TNF) gene for which the variant TNF2A allele causes increased TNF production. The polymorphisms were genotyped in 866 PBC patients and 761 controls from independent US and Canadian registries; the effects of individual single nucleotide polymorphisms (SNPs) and their interaction on PBC risk was assessed by logistic regression. The reported association of PBC with the CTLA4 “A/A” genotype was replicated in the Canadian cohort and significant for PBC risk in the combined data (odds ratio [OR], 1.68; P = 0.0005). TNF2A allele frequency was elevated in PBC patients, but only reached borderline significance using the combined data (OR, 1.21; P = 0.042). Analysis showed that TNF2A carriage was significantly increased in CTLA4 “A/A” PBC patients compared with CTLA4 “A/A” controls (39.7% versus 16.5%, P = 0.0004); no apparent increase of TNF2A carriage was noted in CTLA4 “A/G” or “G/G” individuals. Finally, interaction under a logistic model was highly significant, as TNF2A carriage in combination with the CTLA4 “A/A” genotype was present in 6.5% of PBC patients, compared with 1.7% of controls (OR, 3.98; P < 0.0001). Conclusion TNF2A amplifies the CTLA4 rs231725 “A/A” genotype risk for PBC. Although the mechanisms remain unclear, the premise that deficiency in T-cell regulation resulting in an increased risk of PBC is amplified by overexpression of an important proinflammatory cytokine provides a basis

  6. On the DNA polymerase-a mutant: Immunofluorescence assay of UV-induced thymidine dimers in Aphr-4-2 cells

    International Nuclear Information System (INIS)

    Aphidicolin inhibits purified DNA polymerases-a and -d in vitro and inhibits mitosis in animal cells. The Chinese hamster V79 cell mutant, Aphr-4-2, was selected for its ability to form colonies in cultured medium supplemented with 1.0 microM aphidicolin. At this concentration, the parental wild-type V79 cells (clone 743x) have a survival rate of less than 10(-7). The mutant DNA polymerase-a is resistant to aphidicolin at concentrations that are inhibitory to the wild-type V79 DNA polymerase-a. The apparent Km for dCTP of the mutant DNA polymerase-a is consistently lower than that of the wild-type DNA polymerase-a. This mutant exhibits slow growth, mutator activity, hypersensitivity, and hypermutability to UV. We wanted to know the basis of UV hypersensitivity in this mutant. Using the antisera (UV2) raised against UV-induced thymidine dimers and a sensitive immunofluorescence assay to measure UV-induced thymidine dimers and with detection in ACAS 570 Workstation, we observed that 50% of the thymidine dimers disappeared within 5 h after irradiation and more than 80% of the dimers were removed within 24 h in both cell lines. These results indicate that the recognition, incision, and excision steps in nucleotide excision repair pathway are normal in the mutant. In order to know if there is a difference in DNA polymerase-a or -d activities in the parental V79(wt) and Aphr-4-2 cells, DNA polymerases were partially purified from the parental and the mutant cells using sequential centrifugation and column chromatographies on DEAE-cellulose (DE23 and DE52) to remove DNA polymerases-beta and -gamma. More than 90% of the enzymatic activities from both cells showed characteristics of DNA polymerase-a type on the basis of these criteria: sensitivity to butyl phenyl dGTP (1 microM) and to IgG raised against DNA polymerase-a (SJK 132-20)

  7. Genetic Mapping of Laminaria japonica and L. longissima Using Amplified Fragment Length Polymorphism Markers in a "Two-Way Pseudo-Testcross" Strategy

    Institute of Scientific and Technical Information of China (English)

    Yuhui Li; Yingxia Yang; Jidong Liu; Xiuliang Wang; Tianxiang Gao; Delin Duan

    2007-01-01

    With a "two-way pseudo-testcross" mapping strategy, we applied the amplified fragment length polymorphism (AFLP) markers to construct two moderate density genetic linkage maps for Laminaria. The linkage maps were generated from the 60 progenies of the F1 cross family (Laminaria longissima Aresch. x L. japonica Miyabe) with twenty pairs of primer combinations. Of the 333 polymorphic loci scored in 60 progenies, 173 segregated in a 1:1ratio, corresponding to DNA polymorphisms heterozygous in a single parent, and the other 58 loci existing in both parents followed a 3:1 Mendelian segregation ratio. Among the loci with 1:1 segregating ratios, 79 loci were ordered in 14 linkage groups (648.6 cM) of the paternal map, and 72 loci were ordered in 14 linkage groups (601.9 cM) of the maternal map. The average density of loci was approximately 1 per 8 cM. To investigate the homologies between two parental maps, we used 58 loci segregated 3:1 for further analysis, and deduced one homologous linkage group. The linkage data developed in these maps will be useful for detecting loci-controlling commercially important traits for Laminaria.

  8. Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

    International Nuclear Information System (INIS)

    Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

  9. Mechanism of Translesion Synthesis Past an Equine Estrogen-DNA Adduct by Y-Family DNA Polymerases

    OpenAIRE

    Yasui, Manabu; Suzuki, Naomi; Liu, Xiaoping; Kim, Yoshinori Okamoto Sung Yeon; Laxmi, Y. R. Santosh; Shibutani, Shinya

    2007-01-01

    4-Hydroxyequilenin (4-OHEN)-dC is a major, potentially mutagenic DNA adduct induced by equine estrogens used for hormone replacement therapy. To study the miscoding property of 4-OHEN-dC and the involvement of Y-family human DNA polymerases (pols) η, κ and ι in that process, we incorporated 4-OHEN-dC into oligodeoxynucleotides and used them as templates in primer extension reactions catalyzed by pol η, κ and ι. Pol η inserted dAMP opposite 4-OHEN-dC, accompanied by lesser amounts of dCMP and ...

  10. Effects of Intermediates between Vitamins K2 and K3 on Mammalian DNA Polymerase Inhibition and Anti-Inflammatory Activity

    OpenAIRE

    Takeshi Azuma; Hiromi Yoshida; Masaru Yoshida; Isoko Kuriyama; Kazunori Tsubaki; Yasuyuki Kondo; Kazuyuki Nishio; Kouji Kuramochi; Shin Nishiumi; Masayuki Nishida; Yasuhiro Irino; Yoshiyuki Mizushina; Jun Maeda

    2011-01-01

    Previously, we reported that vitamin K3 (VK3), but not VK1 or VK2 (=MK-4), inhibits the activity of human DNA polymerase γ (pol γ). In this study, we chemically synthesized three intermediate compounds between VK2 and VK3, namely MK-3, MK-2 and MK-1, and investigated the inhibitory effects of all five compounds on the activity of mammalian pols. Among these compounds, MK-2 was the strongest inhibitor of mammalian pols α, κ and λ, which belong to the B, Y and X families of pols, respectively; ...

  11. Identification, isolation, and characterization of the structural gene encoding the delta' subunit of Escherichia coli DNA polymerase III holoenzyme.

    OpenAIRE

    J.R. Carter; Franden, M A; Aebersold, R.; McHenry, C S

    1993-01-01

    The gene encoding the delta' subunit of DNA polymerase III holoenzyme, designated holB, was cloned by a strategy in which peptide sequence was used to derive a DNA hybridization probe. The gene maps to 24.95 centisomes of the chromosome. Sequencing of holB revealed a 1,002-bp open reading frame predicted to produce a 36,936-Da protein. The gene has a ribosome-binding site and promoter that are highly similar to the consensus sequences and is flanked by two potential open reading frames. Prote...

  12. Molecular cloning, sequencing, and overexpression of the structural gene encoding the delta subunit of Escherichia coli DNA polymerase III holoenzyme.

    OpenAIRE

    J.R. Carter; Franden, M A; Aebersold, R.; McHenry, C S

    1992-01-01

    Using an oligonucleotide hybridization probe, we have mapped the structural gene for the delta subunit of Escherichia coli DNA polymerase III holoenzyme to 14.6 centisomes of the chromosome. This gene, designated holA, was cloned and sequenced. The sequence of holA matches precisely four amino acid sequences obtained for the amino terminus of delta and three internal tryptic peptides. A holA-overproducing plasmid that directs the expression of delta up to 4% of the soluble protein was constru...

  13. Reading DNA at single-nucleotide resolution with a mutant MspA nanopore and phi29 DNA polymerase

    OpenAIRE

    Manrao, Elizabeth A; Derrington, Ian M.; Laszlo, Andrew H; Langford, Kyle W.; Hopper, Matthew K; Gillgren, Nathaniel; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H.

    2012-01-01

    Nanopore technologies are being developed for fast and direct sequencing of single DNA molecules through detection of ionic current modulations as DNA passes through a pore’s constriction1,2. Here we demonstrate the ability to resolve changes in current that correspond to a known DNA sequence by combining the high sensitivity of a mutated form of the protein pore Mycobacterium smegmatis porin A (MspA)3 with phi29 DNA polymerase (DNAP)4, which controls the rate of DNA translocation through the...

  14. Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Surajit; Brown, Kyle L.; Egli, Martin; Stone, Michael P. (Vanderbilt)

    2012-07-18

    Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternary (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves

  15. Single-Molecule Investigation of Response to Oxidative DNA Damage by a Y-Family DNA Polymerase.

    Science.gov (United States)

    Raper, Austin T; Gadkari, Varun V; Maxwell, Brian A; Suo, Zucai

    2016-04-12

    Y-family DNA polymerases are known to bypass DNA lesions in vitro and in vivo and rescue stalled DNA replication machinery. Dpo4, a well-characterized model Y-family DNA polymerase, is known to catalyze translesion synthesis across a variety of DNA lesions including 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxo-dG). Our previous X-ray crystallographic, stopped-flow Förster resonance energy transfer (FRET), and computational simulation studies have revealed that Dpo4 samples a variety of global conformations as it recognizes and binds DNA. Here we employed single-molecule FRET (smFRET) techniques to investigate the kinetics and conformational dynamics of Dpo4 when it encountered 8-oxo-dG, a major oxidative lesion with high mutagenic potential. Our smFRET data indicated that Dpo4 bound the DNA substrate in multiple conformations, as suggested by three observed FRET states. An incoming correct or incorrect nucleotide affected the distribution and stability of these states with the correct nucleotide completely shifting the equilibrium toward a catalytically competent complex. Furthermore, the presence of the 8-oxo-dG lesion in the DNA stabilized both the binary and ternary complexes of Dpo4. Thus, our smFRET analysis provided a basis for the enhanced efficiency which Dpo4 is known to exhibit when replicating across from 8-oxo-dG. PMID:27002236

  16. Immunochemical detection of a primase activity related subunit of DNA polymerase. cap alpha. from human and mouse cells using the monoclonal antibody

    Energy Technology Data Exchange (ETDEWEB)

    Yagura, T.; Kozu, T.; Seno, T.; Tanaka, S.

    1987-12-01

    A hybrid cell line (HDR-854-Er) secreting monoclonal antibody (E4 antibody) against a subunit of human DNA polymerase ..cap alpha.. was established by immunizing mice with DNA replicase complex (DNA polymerase ..cap alpha..-primase complex) prepared from HeLa cells. The E4 antibody immunoprecipitates DNA replicase complex from both human and mouse cells. The E4 antibody neutralized the primase activity as assessed either by the direct primase assay (incorporation of (..cap alpha..-/sup 32/P)AMP) or by assay of DNA polymerase activity coupled with the primase activity using unprimed poly(dT) as a template. The E4 antibody does not neutralize DNA polymerase ..cap alpha.. activity with the activated calf thymus DNA as a template. Western immunoblotting analysis shows that the E4 antibody binds to a polypeptide of 77 kilodaltons (kDa) which is tightly associated with DNA polymerase ..cap alpha... The 77-kDa polypeptide was distinguished from the catalytic subunit (160 and 180 kDA) for DNA synthesis which was detected by another monoclonal antibody, HDR-863-A5. Furthermore, it is unlikely that the 77-kDa peptide is the primase, since we found that the E4 antibody also immunoprecipitates the mouse 7.3 S DNA polymerase ..cap alpha.. which has no primase activity, and Western immunoblotting analysis shows that the 77-kDa polypeptide is a subunit of the 7.3S DNA polymerase ..cap alpha... Furthermore, after dissociation of the primase from mouse DNA replicase by chromatography on a hydroxyapatite column in the presence of dimethyl sulfoxide and ethylene glycol, the 77-kDA polypeptide is associated with DNA polymerase ..cap alpha.., and not with the primase. These results indicate that the 77-kDa polypeptide detected with the E4 antibody is not the primase but is a subunit firmly bound to DNA polymerase ..cap alpha.. catalytic polypeptide and yet influences the activity of the associated DNA primase.

  17. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    Science.gov (United States)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  18. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    Science.gov (United States)

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler. PMID:27271319

  19. The levels of DNA polymerase alpha and beta during the cell cycle and their role in heat radiosensitization in CHO cells

    International Nuclear Information System (INIS)

    The levels of DNA polymerase alpha and beta were measured during the cell cycle using a whole cell assay technique. The results indicate a decrease in the levels of both enzymes during the G/sub 1/ phase and a gradual increase as cells enter the S phase. The recovery of the DNA polymerases was measured after heating for 10 minutes at 45.50C during G/sub 1/ phase or S phase. The activity of DNA polymerase beta recovers fully during 20-25 hours after heating for both G/sub 1/ phase or S phase cells. There is no recovery of the activity of the DNA polymerase alpha during this time. Survival was also measured when cells were irradiated (4 GY) at various times after hyperthermia (10 min at 45.50C), and for both G/sub 1/ and S phase the interaction between heat and x-ray disappeared fully after 20-25 hours following heating and was parallel to recovery of DNA polymerase beta. Furthermore, treatment with cyclohexamide inhibited protein synthesis and prevented recovery from heat damage assayed in terms of both cell survival and beta polymerase. These results, in addition to experiments with heat sensitization at low pH and heat protection with glycerol, indicate that beta polymerase is probably involved in repairing x-ray induced damage resulting in cell lethality

  20. Stoichiometric complex formation by proliferating cell nuclear antigen (PCNA) and its interacting protein: purification and crystallization of the DNA polymerase and PCNA monomer mutant complex from Pyrococcus furiosus

    International Nuclear Information System (INIS)

    A stable stoichiometric complex of archaeal DNA polymerase with proliferating cell nuclear antigen (PCNA) was formed using a PCNA monomer mutant and the complex was successfully crystallized. Replicative DNA polymerase interacts with processivity factors, the β-subunit of DNA polymerase III or proliferating cell nuclear antigen (PCNA), in order to function with a long template DNA. The archaeal replicative DNA polymerase from Pyrococcus furiosus interacts with PCNA via its PCNA-interacting protein (PIP) motif at the C-terminus. The PCNA homotrimeric ring contains one PIP interacting site on each monomer and since the ring can accommodate up to three molecules simultaneously, formation of a stable stoichiometric complex of PCNA with its interacting protein has been difficult to control in vitro. A stable complex of the DNA polymerase with PCNA, using a PCNA monomer mutant, has been purified and crystallized. The best ordered crystal diffracted to 3.0 Å resolution using synchrotron radiation. The crystals belong to space group P21212, with unit-cell parameters a = 225.3, b = 123.3, c = 91.3 Å

  1. Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

    Directory of Open Access Journals (Sweden)

    Nariaki Toita

    2013-01-01

    Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

  2. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.;

    2004-01-01

    analysis of AFLP profiles derived from genomic DNA. Extensive genetic diversity was seen among the strains examined; however, 43 groups of isolates were identified at the 92% similarity (S-) level. Thirteen groups contained isolates from a single host, possibly representing genotypes of 'low risk' to human......Aims: To use amplified fragment length polymorphism (AFLP) analysis to evaluate the genetic relatedness among 254 Campylobacter jejuni reference and field strains of diverse origin representing all defined 'Penner' serotypes for this species. Methods and Results: Field strains (n = 207) from human...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  3. First characterization of Candida albicans by random amplified polymorphic DNA method in Nicaragua and comparison of the diagnosis methods for vaginal candidiasis in Nicaraguan women

    Directory of Open Access Journals (Sweden)

    Bello Martha Darce

    2002-01-01

    Full Text Available A total of 106 women with vaginitis in Nicaragua were studied. The positive rate for the identification of Candida species was 41% (44 positive cultures out of 106 women with vaginitis. The sensitivity of microscopic examination of wet mount with the potassium hydroxide (KOH was 61% and 70% with Gram's stain when using the culture of vaginal fluid as gold standard for diagnosis of candidiasis. Among the 44 positives cultures, isolated species of yeast from vaginal swabs were C. albicans (59%, C. tropicalis (23%, C. glabrata (14% and C. krusei (4%. This study reports the first characterization of 26 C. albicans stocks from Nicaragua by the random amplified polymorphic DNA method. The genetic analysis in this small C. albicans population showed the existence of linkage disequilibrium, which is consistent with the hypothesis that C. albicans undergoes a clonal propagation.

  4. Existence of two geographically-linked clonal lineages in the bacterial fish pathogen Photobacterium damselae subsp. piscicida evidenced by random amplified polymorphic DNA analysis.

    Science.gov (United States)

    Magariños, B; Toranzo, A E; Barja, J L; Romalde, J L

    2000-08-01

    In this work, we applied the random amplified polymorphic DNA (RAPD) technique to evaluate the genetic diversity in Photobacterium damselae subsp. piscicida (formerly Pasteurella piscicida), an important pathogen for different marine fish. Regardless of the oligonucleotide primer employed, the 29 isolates of Ph. damselae subsp. piscicida tested were separated into two groups, the RAPD-PCR analysis differentiated the European strains from the Japanese strains. The similarity between both groups estimated on the basis of the Dice coefficient was 75-80%. These results show that European and Japanese isolates of Ph. damselae subsp. piscicida, regardless of their host fish species, belong to two different clonal lineages. Our findings also indicate that RAPD profiling constitutes a useful tool for epidemiological studies of this fish pathogen. PMID:11057980

  5. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. PMID:25461675

  6. An Analysis on DNA Fingerprints of Thirty Papaya Cultivars (Carica papaya L., Grown in Thailand with the Use of Amplified Fragment Length Polymorphisms Technique

    Directory of Open Access Journals (Sweden)

    Janthasri Ratchadaporn

    2007-01-01

    Full Text Available The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1 Kaeg Dum and Malador (2 Kaeg Nuan (3 Pakchong and Solo (4 Taiwan (5 Co Coa Hai Nan and (6 Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  7. Assessing genetic divergence in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, F; Ge, Y Y; Wang, W Y; Shen, X L; Yu, X Y

    2012-01-01

    Conventional hybridization and selection techniques have aided the development of new ornamental crop cultivars. However, little information is available on the genetic divergence of bromeliad hybrids. In the present study, we investigated the genetic variability in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism (SRAP) markers. The morphological analysis showed that the putative hybrids were intermediate between both parental species with respect to inflorescence characteristics. The 16 SRAP primer combinations yield 265 bands, among which 154 (57.72%) were polymorphic. The genetic similarity was an average of 0.59 and ranged from 0.21 to 0.87, indicating moderate genetic divergence among the hybrids. The unweighted pair group method with arithmetic average (UPGMA)-based cluster analysis distinguished the hybrids from their parents with a genetic distance coefficient of 0.54. The cophenetic correlation was 0.93, indicating a good fit between the dendrogram and the original distance matrix. The two-dimensional plot from the principal coordinate analysis showed that the hybrids were intermediately dispersed between both parents, corresponding to the results of the UPGMA cluster and the morphological analysis. These results suggest that SRAP markers could help to identify breeders, characterize F(1) hybrids of bromeliads at an early stage, and expedite genetic improvement of bromeliad cultivars. PMID:23079994

  8. Physical and genetic mapping of amplified fragment length polymorphisms and the leaf rust resistance Lr3 gene on chromosome 6BL of wheat.

    Science.gov (United States)

    Diéguez, M J; Altieri, E; Ingala, L R; Perera, E; Sacco, F; Naranjo, T

    2006-01-01

    The Argentinian wheat cultivar Sinvalocho MA carries the Lr3 gene for leaf rust resistance on distal chromosome 6BL. In this cultivar, 33 spontaneous susceptible lines were isolated and cytogenetically characterized by C-banding. The analysis revealed deletions on chromosome 6BL in most lines. One line was nulli-6B, two lines were ditelo 6BS, two, three, and ten lines had long terminal deletions of 40, 30, and 20%, respectively, three lines showed very small terminal deletions, and one line had an intercalary deletion of 11%. Physical mapping of 55 amplified fragment length polymorphism (AFLP) markers detected differences between deletions and led to the division of 6BL into seven bins delimited by deletion breakpoints. The most distal bin, with a length smaller than 5% of 6BL, contained 22 AFLP markers and the Lr3 gene. Polymorphism for nine AFLPs between Sinvalocho MA and the rust leaf susceptible cultivar Gamma 6 was used to construct a linkage map of Lr3. This gene is at a genetic distance of 0.9 cM from a group of seven closely linked AFLPs. The location of the gene in a high recombinogenic region indicated a physical distance of approximately 1 Mb to the markers. PMID:16215730

  9. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found. PMID:19090101

  10. Characterization of Grain Amaranth (Amaranthus spp. Germplasm in South West Nigeria Using Morphological, Nutritional, and Random Amplified Polymorphic DNA (RAPD Analysis

    Directory of Open Access Journals (Sweden)

    Pamela E. Akin-Idowu

    2016-01-01

    Full Text Available Efficient utilization of plant genetic resources for nutrition and crop improvement requires systematic understanding of the important traits. Amaranthus species are distributed worldwide with an interesting diversity of landraces and cultivars whose leaves and seeds are consumed. Despite their potential to enhance food security and economic livelihoods, grain amaranth breeding to improve nutritional quality and adoption by farmers in sub-Saharan Africa is scanty. This study assessed the variation among 29 grain amaranth accessions using 27 phenotypic (10 morphological and 17 nutritional characters and 16 random amplified polymorphic DNA (RAPD primers. Multivariate analysis of phenotypic characters showed the first four principal components contributing 57.53% of observed variability, while cluster analysis yielded five groups at 87.5% similarity coefficient. RAPD primers generated a total of 193 amplicons with an average of 12.06 amplicons per primer, 81% of which were polymorphic. Genetic similarities based on Jaccard’s coefficient ranged from 0.61 to 0.88. The RAPD-based unweighted pair group method with arithmetic mean dendrogram grouped the accessions into nine clusters, with the same species clustering together. RAPD primers distinguished the accessions more effectively than phenotypic markers. Accessions in the different clusters as obtained can be exploited for heterotic gain in desired nutritional traits.

  11. Identification of a differentially expressed thymidine kinase gene related to tapping panel dryness syndrome in the rubber tree (Hevea brasiliensis Muell. Arg. by random amplified polymorphic DNA screening

    Directory of Open Access Journals (Sweden)

    Arjunan Thulaseedharan

    2010-01-01

    Full Text Available Tapping panel dryness (TPD syndrome is one of the latex yield affecting factors in the rubber tree (Hevea brasiliensis Mull. Arg.. Therefore, identification of a DNA marker will be highly useful for screening progenies in breeding programs. The major goal of this study was to detect genetic variations and/or identification of gene fragments among 37 Hevea clones by the random amplified polymorphic DNA “fingerprinting” technique. Different levels of DNA polymorphism were detected with various primers and a distinct polymorphic band (2.0 kb was obtained with OPA-17 primer. It was cloned into a plasmid vector for further sequence characterization and the nucleotide sequence shows homology with a novel putative plant thymidine kinase (TK gene, designated as HbTK (Hevea brasiliensis thymidine kinase; GenBank accession number AY130829. The protein HbTK has 67%, 65%, 64%, and 63% similarity to TK genes of Medicago, Oryza, Arabidopsis, and Lyco- persicon, respectively, and it was highly conserved in all species analyzed. The predicted amino acid sequence contained conserved domains of TK proteins in the C-terminal half. Southern blot analysis indicated that HbTK is one of the members of a small gene family. Northern blot results revealed that the expression of the HbTK gene was up-regulated in mature bark tissues of the healthy tree while it was down-regulated in the TPD-affected one. These results suggest that this gene may play important roles in maintaining active nucleotide metabolism during cell division at the tapped site of bark tissues in the healthy tree under stress (tapping conditions for normal latex biosynthesis.

  12. Specific Residues in the Connector Loop of the Human Cytomegalovirus DNA Polymerase Accessory Protein UL44 Are Crucial for Interaction with the UL54 Catalytic Subunit

    OpenAIRE

    Loregian, Arianna; Appleton, Brent A; Hogle, James M.; Coen, Donald M.

    2004-01-01

    The human cytomegalovirus DNA polymerase includes an accessory protein, UL44, which has been proposed to act as a processivity factor for the catalytic subunit, UL54. How UL44 interacts with UL54 has not yet been elucidated. The crystal structure of UL44 revealed the presence of a connector loop analogous to that of the processivity subunit of herpes simplex virus DNA polymerase, UL42, which is crucial for interaction with its cognate catalytic subunit, UL30. To investigate the role of the UL...

  13. Interaction of hyperthermia and radiation in tolerant and nontolerant HeLa S3 cells: role of DNA polymerase inactivation

    International Nuclear Information System (INIS)

    The activities of DNA polymerase α and β were measured in tolerant and nontolerant HeLa S3 suspension cells. The heat-inactivation of the enzymes and their recovery when cells were incubated at 370C after the heat challenge was compared to the synergistic action of heat and x-radiation and its disappearance at the level of cell survival. Thermotolerant cells were radiosensitized by heat similarly to nontolerant cells, but the sensitization decreased more rapidly in the tolerant cells when time at 370C was allowed between the two treatments. For polymerase activities the extent of inactivation, as well as the kinetics of recovery, were similar in tolerant and nontolerant cells. (author)

  14. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    Science.gov (United States)

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  15. Direct and site-specific quantification of RNA 2'-O-methylation by PCR with an engineered DNA polymerase.

    Science.gov (United States)

    Aschenbrenner, Joos; Marx, Andreas

    2016-05-01

    Methylation of the 2'-hydroxyl-group of ribonucleotides is found in all major classes of RNA in eukaryotes and is one of the most abundant posttranscriptional modifications of stable RNAs. In spite of intense studies, the multiple functions of RNA 2'-O-methylation are still not understood. One major obstacle in the field are the technical demanding detection methods, which are typically laborious and do not always deliver unambiguous results. We present a thermostable KlenTaq DNA polymerase variant with significant reverse transcription activity that is able to discriminate 2'-O-methylated from unmethylated RNAs. The engineered enzyme catalyzes DNA synthesis from DNA as well as RNA templates and enables expeditious quantification of 2'-O-methylation of individual nucleotides directly from total RNA extracts by a simple qRT-PCR. PMID:27016740

  16. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F.

    2016-01-01

    ABSTRACT   Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. PMID:27302758

  17. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  18. The Crystal Structure of PF-8, the DNA Polymerase Accessory Subunit from Kaposi's Sarcoma-Associated Herpesvirus

    Energy Technology Data Exchange (ETDEWEB)

    Baltz, Jennifer L.; Filman, David J.; Ciustea, Mihai; Silverman, Janice Elaine Y.; Lautenschlager, Catherine L.; Coen, Donald M.; Ricciardi, Robert P.; Hogle, James M.; (UPENN)

    2009-12-01

    Kaposi's sarcoma-associated herpesvirus is an emerging pathogen whose mechanism of replication is poorly understood. PF-8, the presumed processivity factor of Kaposi's sarcoma-associated herpesvirus DNA polymerase, acts in combination with the catalytic subunit, Pol-8, to synthesize viral DNA. We have solved the crystal structure of residues 1 to 304 of PF-8 at a resolution of 2.8 {angstrom}. This structure reveals that each monomer of PF-8 shares a fold common to processivity factors. Like human cytomegalovirus UL44, PF-8 forms a head-to-head dimer in the form of a C clamp, with its concave face containing a number of basic residues that are predicted to be important for DNA binding. However, there are several differences with related proteins, especially in loops that extend from each monomer into the center of the C clamp and in the loops that connect the two subdomains of each protein, which may be important for determining PF-8's mode of binding to DNA and to Pol-8. Using the crystal structures of PF-8, the herpes simplex virus catalytic subunit, and RB69 bacteriophage DNA polymerase in complex with DNA and initial experiments testing the effects of inhibition of PF-8-stimulated DNA synthesis by peptides derived from Pol-8, we suggest a model for how PF-8 might form a ternary complex with Pol-8 and DNA. The structure and the model suggest interesting similarities and differences in how PF-8 functions relative to structurally similar proteins.

  19. A Preliminary Genetic Investigation of Rastrelliger Kanagurta Based on Random Amplified Polymorphic DNA and Mitochondrial ND2 Gene

    Institute of Scientific and Technical Information of China (English)

    Siti Azizah Mohd Nor; Abu Talib A; Mohd Ghows M A; Samsudin B

    2008-01-01

    In a preliminary investigation, Random Amplified Polymorphie DNA (RAPD) analysis and partial mitochon-drial ND2 gene sequencing were conducted to study the genetic variation of the Indian mackerel, Rastrelliger kanagurta along a 450 km stretch of its distribution on the west coast of Peninsular Malaysia. A total of 53 individuals from 6 popu-lations were analyzed using 4 RAPD primers and a sub-sample of 15 individuals was chosen for sequencing of partial ND2 gene. Comparison between the 2 markers revealed genetic structuring in the RAPD results but genetic homogeneity for ND2 gene. Based on the former there may be at least 2 genetically differentiated groups of Rastrelliger kanagurta a-long this stretch.

  20. Sequence-characterized amplified regions that differentiate New World screwworms from other potential wound-inhabiting flies.

    Science.gov (United States)

    Christen, Joan A; Skoda, Steven R; Heng-Moss, Tiffany M; Lee, Donald J; Foster, John E

    2015-01-01

    New World screwworms, Cochliomyia hominivorax (Coquerel, 1858), were once devastating pests of warm-blooded animals in the United States before they were successfully eradicated using the sterile insect technique. Guarding against the introduction of screwworms to North America or any other screwworm-free area relies on rapid, reliable identification of suspected cases. In the current study, the DNA from excised markers generated by randomly amplified polymorphic DNA polymerase chain reaction was used as the basis to generate 2 species-specific sequence-characterized amplified region molecular markers. Resulting primer pairs, named CR92A1 and J1A2 (each with forward and reverse components), produced amplicons of 852 and 848 base pairs, respectively. The 2 primer pairs successfully discriminated between C. hominivorax, Cochliomyia macellaria (Fabricius, 1775), 8 other species of blowflies, 3 noncalliphorid dipterans, and 1 nondipteran outlier. These primers may become important tools for veterinary laboratories and the screwworm eradication and exclusion program for rapid identification or verification of suspicious larval samples in presumed outbreaks. PMID:25387845

  1. Thermodynamic and mechanistic insights into translesion DNA synthesis catalyzed by Y-family DNA polymerase across a bulky double-base lesion of an antitumor platinum drug

    Czech Academy of Sciences Publication Activity Database

    Brabec, Viktor; Malina, Jaroslav; Margiotta, N.; Natile, G.; Kašpárková, Jana

    2012-01-01

    Roč. 18, č. 48 (2012), s. 15439-15448. ISSN 0947-6539 R&D Projects: GA ČR(CZ) GAP205/11/0856; GA ČR(CZ) GAP301/10/0598 Institutional research plan: CEZ:AV0Z50040702 Keywords : DNA polymerase * platinum * calorimetry Subject RIV: BO - Biophysics Impact factor: 5.831, year: 2012

  2. DNA polymerase-beta is expressed early in neurons of Alzheimer's disease brain and is loaded into DNA replication forks in neurons challenged with beta-amyloid

    NARCIS (Netherlands)

    A. Copani; J.J.M. Hoozemans; F. Caraci; M. Calafiore; E.S. van Haastert; R. Veerhuis; A.J.M. Rozemuller; E. Aronica; M.A. Sortino; F. Nicoletti

    2006-01-01

    Cultured neurons exposed to synthetic beta-amyloid (A beta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments

  3. Study on Suitability of KOD DNA Polymerase for Enzymatic Production of Artificial Nucleic Acids Using Base/Sugar Modified Nucleoside Triphosphates

    Directory of Open Access Journals (Sweden)

    Satoshi Obika

    2010-11-01

    Full Text Available Recently, KOD and its related DNA polymerases have been used for preparing various modified nucleic acids, including not only base-modified nucleic acids, but also sugar-modified ones, such as bridged/locked nucleic acid (BNA/LNA which would be promising candidates for nucleic acid drugs. However, thus far, reasons for the effectiveness of KOD DNA polymerase for such purposes have not been clearly elucidated. Therefore, using mutated KOD DNA polymerases, we studied here their catalytic properties upon enzymatic incorporation of nucleotide analogues with base/sugar modifications. Experimental data indicate that their characteristic kinetic properties enabled incorporation of various modified nucleotides. Among those KOD mutants, one achieved efficient successive incorporation of bridged nucleotides with a 2′-ONHCH2CH2-4′ linkage. In this study, the characteristic kinetic properties of KOD DNA polymerase for modified nucleoside triphosphates were shown, and the effectiveness of genetic engineering in improvement of the enzyme for modified nucleotide polymerization has been demonstrated.

  4. Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

    DEFF Research Database (Denmark)

    Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer;

    Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity and ...

  5. A uv-sensitive Chinese hamster lung fibroblast cell line (V79/UC) with a possible defect in DNA polymerase activity is deficient in DNA repair

    International Nuclear Information System (INIS)

    Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present

  6. Sequence-Related Amplified Polymorphism-PCR Analysis for Genetic Diversity in Rhizoctonia solani Populations Infecting Pulse Crops in Different Agro-Ecological Regions of India

    Directory of Open Access Journals (Sweden)

    Aradhika Tripathi

    2015-01-01

    Full Text Available Rhizoctonia solani is a destructive fungal pathogen infecting wide range of crop plants including pulses causing wet root rot or web blight disease. The present study was aimed to determine the genetic diversity of R. solani populations using Sequence-Related Amplified Polymorphism (SRAP markers. The SRAP markers were used for genetic diversity analysis of 89 isolates of R. solani belonging to 7 Anastomosis Groups (AGs isolated from different pulse crops representing 21 states from 16 agro-ecological regions of India. Out of 30 SRAP primer combinations evaluated, 16 combinations provided amplification with 100% polymorphism and the primer combinations Me1/Em1and Me1/Em4 provided the highest number of bands (14. The isolates of R. solani showed high level of genetic variability and grouped into 7 major clusters at 35% genetic similarity by using unweighted pair group method with an arithmetic average analysis. Bootstrap analysis grouped the isolates into five major clusters at 28% genetic similarity and about 95% isolates shared common sub-grouping patterns in both the analysis. The majority of the isolates representing various AGs were grouped together into different sub-clusters. The molecular clusters did not correspond to agro-ecological regions and crops of the origin of the isolates because of the diversity in the hosts and adopt ability of the pathogen under different environmental conditions prevalent in various parts of the country. First time an attempt was made in the present study to determine the genetic variability of the R. solani populations isolated from different pulse crops representing various AGs using SRAP markers.

  7. Detection of genetic variability in Basmati and non-Basmati rice varieties and their radiation induced mutants through random amplified polymorphic DNA (RAPD)

    International Nuclear Information System (INIS)

    Random Amplified Polymorphic DNA (RAPDs) markers were utilized to detect polymorphism between pure lines and commercially available Basmati rice varieties to assess variation which may be helpful in quality control and varietal identification (Basmati-370 and derived radiation induced mutants), differentiation of mutants and parents, and identification of RAPD markers co-segregating with important agronomic traits including plant height, days to flower and grain quality. Basmati varieties were distinguished from non-Basmati varieties with the help of five diagnostic markers which will be useful for detecting mixing of non-Basmati and Basmati rices, currently a serious marketing problem. Different Basmati cultivars were identified with the help of diagnostic RAPD markers which can be used in quality control as well as for ''fingerprinting'' of cultivars. Different radiation induced mutants were also successfully distinguished from the parents on the basis of variety specific and mutant specific markers which will be useful for varietal identification. In addition to this, other markers were also identified which can differentiate mutants from each other and are being, used for the fingerprinting of different mutants, particularly the dwarf mutants having similar appearance but different parentage. For identification of RAPD markers co-segregating with plant height and days to flower, 50 F2 plants and four F3 families were studied from a reciprocal cross made between Kashmir Basmati (tall and early) and Basmati-198 (dwarf and late). Segregating bands were observed within these populations, and indicating the possible use of RAPD markers for tagging gene(s) of agronomic importance in rice. (author)

  8. Prevalence of mutations in HBV DNA polymerase gene associated with nucleos(tide resistance in treatment-naive patients with Chronic Hepatitis B in Central China

    Directory of Open Access Journals (Sweden)

    Youyun Zhao

    2016-04-01

    Full Text Available Abstract Objective There are a lot of disagreements in the studies on hepatitis B virus (HBV DNA polymerase mutation rate associated with nucleos(tide analogues (NAs in treatment-naive chronic hepatitis B (CHB patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China. Methods This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay. Results 269 patients were infected with HBV genotype B (81.4%, C (17.9%, and both B and C (0.7%. Mutations in HBV DNA polymerase were detected in 24 patients (8.9% including rtM204I/V (n = 6, rtN236T (n = 5, rtM250V (n = 2, rtL180M (n = 2, rtT184G (n = 1, rtM207I (n = 1, rtS202I (n = 1, rtM204V/I & rtL180M (n = 5, and rtM204I & rtM250V (n = 1. Conclusion Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM, adefovir (ADV, and telbivudine (LdT.

  9. Identification of Amplified Fragment Length Polymorphism (AFLP Markers Tightly Associated with Drought Stress Gene in Male Sterile and Fertile Salvia miltiorrhiza Bunge

    Directory of Open Access Journals (Sweden)

    Hongbo Guo

    2013-03-01

    Full Text Available Consistent grain yield in drought environment has attracted wide attention due to global climate change. However, the important drought-related traits/genes in crops have been rarely reported. Many near-isogenic lines (NILs of male sterile and fertile Salvia miltiorrhiza have been obtained in our previous work through testcross and backcross in continuous field experiments conducted in 2006–2009. Both segregating sterile and fertile populations were subjected to bulked segregant analysis (BSA and amplified fragment length polymorphism (AFLP with 384 and 170 primer combinations, respectively. One out of 14 AFLP markers (E9/M3246 was identified in treated fertile population as tightly linked to the drought stress gene with a recombination frequency of 6.98% and at a distance of 7.02 cM. One of 15 other markers (E2/M5357 was identified in a treated sterile population that is closely associated with the drought stress gene. It had a recombination frequency of 4.65% and at a distance of 4.66 cM. Interestingly, the E9/M3246 fragment was found to be identical to another AFLP fragment E11/M4208 that was tightly linked to the male sterile gene of S. miltiorrhiza with 95% identity and e-value 4 × 10−93. Blastn analysis suggested that the drought stress gene sequence showed higher identity with nucleotides in Arabidopsis chromosome 1–5.

  10. Examining the genetic variation of reference microbial cultures used within food and environmental laboratories using fluorescent amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Cross, Lisa Jane; Russell, Julie Elizabeth; Desai, Meeta

    2011-08-01

    Fluorescent amplified fragment length polymorphism (FAFLP) analysis was applied to genetically fingerprint 'working culture control strains' used by accredited food microbiology laboratories. A working culture control strain is defined as a subculture from a strain initially obtained from an authenticated source [such as the National Collection of Type Cultures (NCTC)] that is maintained for use with routine testing within the laboratory. Working culture control strains from eight food examination laboratories, representing four bacterial species, were analysed by FAFLP; these were Salmonella Nottingham, Staphylococcus aureus, Listeria monocytogenes and Bacillus cereus. The resultant FAFLP profiles of the eight working culture control strains for each of these species were compared against the appropriate freeze-dried ampoules obtained directly from NCTC. FAFLP results demonstrated that within 50% of working cultures analysed, several laboratories were routinely using working cultures that were genetically different from the original reference NCTC strains. This study highlights the need for laboratories to review the protocols used to process and maintain control strains and working cultures, with a potential view to utilize single-use quality control materials. PMID:21623896

  11. Temporal order of evolution of DNA replication systems inferred by comparison of cellular and viral DNA polymerases

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2006-12-01

    Full Text Available Abstract Background The core enzymes of the DNA replication systems show striking diversity among cellular life forms and more so among viruses. In particular, and counter-intuitively, given the central role of DNA in all cells and the mechanistic uniformity of replication, the core enzymes of the replication systems of bacteria and archaea (as well as eukaryotes are unrelated or extremely distantly related. Viruses and plasmids, in addition, possess at least two unique DNA replication systems, namely, the protein-primed and rolling circle modalities of replication. This unexpected diversity makes the origin and evolution of DNA replication systems a particularly challenging and intriguing problem in evolutionary biology. Results I propose a specific succession for the emergence of different DNA replication systems, drawing argument from the differences in their representation among viruses and other selfish replicating elements. In a striking pattern, the DNA replication systems of viruses infecting bacteria and eukaryotes are dominated by the archaeal-type B-family DNA polymerase (PolB whereas the bacterial replicative DNA polymerase (PolC is present only in a handful of bacteriophage genomes. There is no apparent mechanistic impediment to the involvement of the bacterial-type replication machinery in viral DNA replication. Therefore, I hypothesize that the observed, markedly unequal distribution of the replicative DNA polymerases among the known cellular and viral replication systems has a historical explanation. I propose that, among the two types of DNA replication machineries that are found in extant life forms, the archaeal-type, PolB-based system evolved first and had already given rise to a variety of diverse viruses and other selfish elements before the advent of the bacterial, PolC-based machinery. Conceivably, at that stage of evolution, the niches for DNA-viral reproduction have been already filled with viruses replicating with the

  12. Distinct energetics and closing pathways for DNA polymerase β with 8-oxoG template and different incoming nucleotides

    Directory of Open Access Journals (Sweden)

    Wang Yanli

    2007-02-01

    Full Text Available Abstract Background 8-Oxoguanine (8-oxoG is a common oxidative lesion frequently encountered by DNA polymerases such as the repair enzyme DNA polymerase β (pol β. To interpret in atomic and energetic detail how pol β processes 8-oxoG, we apply transition path sampling to delineate closing pathways of pol β 8-oxoG complexes with dCTP and dATP incoming nucleotides and compare the results to those of the nonlesioned G:dCTP and G:dATPanalogues. Results Our analyses show that the closing pathways of the 8-oxoG complexes are different from one another and from the nonlesioned analogues in terms of the individual transition states along each pathway, associated energies, and the stability of each pathway's closed state relative to the corresponding open state. In particular, the closed-to-open state stability difference in each system establishes a hierarchy of stability (from high to low as G:C > 8-oxoG:C > 8-oxoG:A > G:A, corresponding to -3, -2, 2, 9 kBT, respectively. This hierarchy of closed state stability parallels the experimentally observed processing efficiencies for the four pairs. Network models based on the calculated rate constants in each pathway indicate that the closed species are more populated than the open species for 8-oxoG:dCTP, whereas the opposite is true for 8-oxoG:dATP. Conclusion These results suggest that the lower insertion efficiency (larger Km for dATP compared to dCTP opposite 8-oxoG is caused by a less stable closed-form of pol β, destabilized by unfavorable interactions between Tyr271 and the mispair. This stability of the closed vs. open form can also explain the higher insertion efficiency for 8-oxoG:dATP compared to the nonlesioned G:dATP pair, which also has a higher overall conformational barrier. Our study offers atomic details of the complexes at different states, in addition to helping interpret the different insertion efficiencies of dATP and dCTP opposite 8-oxoG and G.

  13. The Establishment of an Assay to Measure DNA Polymerase-Catalyzed Repair of UVB-Induced DNA Damage in Skin Cells and Screening of DNA Polymerase Enhancers from Medicinal Plants.

    Science.gov (United States)

    Ikeoka, Sawako; Nakahara, Tatsuo; Iwahashi, Hiroyasu; Mizushina, Yoshiyuki

    2016-01-01

    An in vitro assay method was established to measure the activity of cellular DNA polymerases (Pols) in cultured normal human epidermal keratinocytes (NHEKs) by modifying Pol inhibitor activity. Ultraviolet (UV) irradiation enhanced the activity of Pols, especially DNA repair-related Pols, in the cell extracts of NHEKs. The optimal ultraviolet B (UVB) exposure dose and culture time to upregulate Pols activity was 100 mJ/cm² and 4-h incubation, respectively. We screened eight extracts of medicinal plants for enhancement of UVB-exposed cellular Pols activity using NHEKs, and found that rose myrtle was the strongest Pols enhancer. A Pols' enhancement compound was purified from an 80% ethanol extract of rose myrtle, and piceatannol was isolated by spectroscopic analysis. Induction of Pol activity involved synergy between UVB irradiation and rose myrtle extract and/or piceatannol. Both the extract and piceatannol reduced UVB-induced cyclobutane pyrimidine dimer production, and prevented UVB-induced cytotoxicity. These results indicate that rose myrtle extract and piceatannol, its component, are potential photo-protective candidates for UV-induced skin damage. PMID:27153062

  14. Phenetic studies on randomly amplified polymorphic DNA-polymerase chain reaction-variability of four geographical populations of Lutzomyia whitmani (Diptera: Psychodidae in Brazil Estudos fenéticos de variabilidade de polimorfismos de DNA amplificados ao acaso pela reação em cadeia da polimerase em quatro populações geográficas de Lutzomyia whitmani (Diptera: Psychodidade no Brasil

    Directory of Open Access Journals (Sweden)

    Carina Margonari de Souza

    2004-03-01

    Full Text Available Previous evaluation of the genetic variability of four biogeographical populations of Lutzomyia whitmani from known foci of cutaneous leishmaniasis in Brazil demonstrated two main spatial clusters: Corte de Pedra-BA, Ilhéus-BA and Serra de Baturité-CE in the first cluster, and Martinho Campos-MG in the second. Further analysis showed a high degree of homogeneity in Corte de Pedra population but not in the others, which presented a significant percentage of specimens displaced from their phenon of origin (discrepant individuals. In the present work we analyzed the frequencies of association coefficients in the matrixes of similarity per population of Lutzomyia whitmani from both sexes and the general phenograms obtained, in a more detailed study of those discrepant specimens. Populational stability was observed for Corte de Pedra population, whereas the three remaining populations showed varying degrees of heterogeneity and different displacements according to sex. Our results strongly suggested the existence of a genetic flow between the lineages North-South/North-East and Ilhéus/Serra do Baturité of Lutzomyia whitmani.Uma avaliação prévia da variabilidade genética de quatro populações biogeográficas de Lutzomyia whitmani oriundas de focus conhecidos de leishmaniose cutânea no Brasil, evidenciou 2 agrupamentos espaciais principais: Corte de Pedra (BA, Ilhéus (BA e Serra de Baturité (CE no primeiro grupo, e Martinho Campos (MG em um segundo. O aprofundamento da análise acusou um alto grau de homogeneidade na população de Corte de Pedra mas não nas outras, nas quais uma porcentagem significativa de espécimens deslocou-se do seu feno de origem (indivíduos discrepantes. Neste trabalho analisamos as freqüências dos coeficientes de associação nas matrizes de similaridade por população de Lutzomyia whitmani, de ambos os sexos, e o fenograma geral obtido, em um estudo mais detalhado daqueles espécimens discrepantes. Para Corte de Pedra foi observada estabilidade populacional, enquanto as outras três populações restantes mostraram graus de heterogeneidade variáveis e deslocamentos distintos, de acordo com o sexo dos indivíduos. Nossos resultados sugerem fortemente a existência de um fluxo genético entre as linhagens Norte-Sul/Norte-Leste e Ilhéus/Serra do Baturité de Lutzomyia whitmani.

  15. 用RAPD技术检测不同来源微孢子虫基因组DNA多态性%Genomic DNA Polymorphisms in Eight Species of the Microsporidian Spores by Using Randomly Amplified Polymorphic DNA (RAPD) Method

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威

    1999-01-01

    @@ 家蚕微粒子病是由微粒子原虫(微孢子虫)类寄生于蚕体引起的病害.微粒子病对蚕丝业生产危害极大,一直被列为蚕种制造检疫对象.许多学者对病原的传播途径、侵染机制及分类地位作了大量研究.其中微孢子虫的分类又以血清学关系、发育增殖方式和孢子超微结构作为主要划分依据,这些表型依据仍然具有局限性.随机扩增多态性DNA技术(Randomly Amplified Polymorphic DNA,RAPD)因能方便、快速提供DNA多态性的丰富信息而被广泛用于动植物和微生物的遗传差异、亲缘关系和进化分类等领域,但应用于微孢子虫的分类研究尚未见报道.本文用60个随机引物构建了8种微孢子虫的DNA指纹图谱,以探讨其相互间的亲缘关系.

  16. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    Science.gov (United States)

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  17. Conserved interaction of Ctf18-RFC with DNA polymerase ε is critical for maintenance of genome stability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Okimoto, Hiroko; Tanaka, Seiji; Araki, Hiroyuki; Ohashi, Eiji; Tsurimoto, Toshiki

    2016-05-01

    Human Ctf18-RFC, a PCNA loader complex, interacts with DNA polymerase ε (Polε) through a structure formed by the Ctf18, Dcc1 and Ctf8 subunits. The C-terminal stretch of Ctf18, which is highly conserved from yeast to human, is necessary to form the Polε-capturing structure. We found that in the budding yeast Saccharomyces cerevisiae, Ctf18, Dcc1 and Ctf8 formed the same structure through the conserved C-terminus and interacted specifically with Polε. Thus, the specific interaction of Ctf18-RFC with Polε is a conserved feature between these proteins. A C-terminal deletion mutant of Ctf18 (ctf18(ΔC) ) exhibited the same high sensitivity to hydroxyurea as the complete deletion strain (ctf18Δ) or ATPase-deficient mutant (ctf18(K189A) ), but was somewhat less sensitive to methyl methanesulfonate than either of them. These phenotypes were also observed in dcc1Δ and ctf8Δ, predicted to be deficient in the interaction with Polε. Furthermore, both plasmid loss and gross chromosomal rearrangement (GCR) rates were increased in ctf18(ΔC) cells to the same extent as in ctf18Δ cells. These results indicate that the Ctf18-RFC/Polε interaction plays a crucial role in maintaining genome stability in budding yeast, probably through recruitment of this PCNA loader to the replication fork. PMID:26987677

  18. Hydrogen-Bonding Capability of a Templating Difluorotoluene Nucleotide Residue in an RB69 DNA Polymerase Ternary Complex

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin (Yale)

    2011-08-29

    Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templating dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.

  19. Processivity factor of KSHV contains a nuclear localization signal and binding domains for transporting viral DNA polymerase into the nucleus

    International Nuclear Information System (INIS)

    Kaposi's sarcoma-associated human herpesvirus (KSHV) encodes a processivity factor (PF-8, ORF59) that forms homodimers and binds to viral DNA polymerase (Pol-8, ORF9). PF-8 is essential for stabilizing Pol-8 on template DNA so that Pol-8 can incorporate nucleotides continuously. Here, the intracellular interaction of these two viral proteins was examined by confocal immunofluorescence microscopy. When individually expressed, PF-8 was observed exclusively in the nucleus, whereas Pol-8 was found only in the cytoplasm. However, when co-expressed, Pol-8 was co-translocated with PF-8 into the nucleus. Mutational analysis revealed that PF-8 contains a nuclear localization signal (NLS) as well as domains located at the N-terminus and the C-proximal regions that are required for Pol-8 binding. This study suggests that the mechanism that enables PF-8 to transport Pol-8 into the nucleus is the first critical step required for Pol-8 and PF-8 to function processively in KSHV DNA synthesis

  20. Cell proliferation and DNA dependent DNA polymerase estimation in acute lymphoblastic leukaemia during treatment with prednisone and vincristine

    International Nuclear Information System (INIS)

    The presence of DNA polymerase and primer-template DNA in lymphoblast nuclei by measuring the in vitro incorporation of 3H-thymidine-5'-triphosphate (3H-TTP) was studied in 10 patients with acute lymphoblastic leukemia. Protein synthesis and various other cytokinetic parameters were also studied. After prednisone (P) administration a marked decrease in 3H-TTP labelling index (3H-TTP LI) was apparent together with an inhibition of 3H-leucine incorporation (3H-LEU LI) into lymphoblasts. A moderate decrease in 3H-TDR labelling index (3H-TDR LI) and a later decrease in mitotic index (MI) were seen. Single cell DNA measurements showed a depletion of 3H-TDR labelled lymphoblasts in early part of S-phase apparent at 24 h lasting up to 54 h after P administration. Vincristine given as a flash injection later in the study period caused an immediate rise of the MI, at the same time the P induced decline in 3H-TTP LI, 3H-TDR LI and 3H-LEU LI were continued in most patients. P is thought to damage the cells both in and outside the cell cycle. In the cell cycle the effect of P is an arresting effect in G1. (author)

  1. Measurement of microbial DNA polymerase activity enables detection and growth monitoring of microbes from clinical blood cultures.

    Directory of Open Access Journals (Sweden)

    Daniel R Zweitzig

    Full Text Available Surveillance of bloodstream infections (BSI is a high priority within the hospital setting. Broth-based blood cultures are the current gold standard for detecting BSI, however they can require lengthy incubation periods prior to detection of positive samples. We set out to demonstrate the feasibility of using enzymatic template generation and amplification (ETGA-mediated measurement of DNA polymerase activity to detect microbes from clinical blood cultures. In addition to routine-collected hospital blood cultures, one parallel aerobic blood culture was collected and immediately refrigerated until being transported for ETGA analysis. After refrigeration holding and transport, parallel-collected cultures were placed into a BACTEC incubator and ETGA time-course analysis was performed. Of the 308 clinical blood cultures received, 22 were BACTEC positive, and thus were initially selected for ETGA time course analysis. The ETGA assay detected microbial growth in all 22 parallel-positive blood cultures in less time than a BACTEC incubator and also yielded genomic DNA for qPCR-based organism identification. In summary, feasibility of detecting microbes from clinical blood culture samples using the ETGA blood culture assay was demonstrated. Additional studies are being considered towards development of clinically beneficial versions of this methodology.

  2. Exonuclease mutations in DNA polymerase epsilon reveal replication strand specific mutation patterns and human origins of replication.

    Science.gov (United States)

    Shinbrot, Eve; Henninger, Erin E; Weinhold, Nils; Covington, Kyle R; Göksenin, A Yasemin; Schultz, Nikolaus; Chao, Hsu; Doddapaneni, HarshaVardhan; Muzny, Donna M; Gibbs, Richard A; Sander, Chris; Pursell, Zachary F; Wheeler, David A

    2014-11-01

    Tumors with somatic mutations in the proofreading exonuclease domain of DNA polymerase epsilon (POLE-exo*) exhibit a novel mutator phenotype, with markedly elevated TCT→TAT and TCG→TTG mutations and overall mutation frequencies often exceeding 100 mutations/Mb. Here, we identify POLE-exo* tumors in numerous cancers and classify them into two groups, A and B, according to their mutational properties. Group A mutants are found only in POLE, whereas Group B mutants are found in POLE and POLD1 and appear to be nonfunctional. In Group A, cell-free polymerase assays confirm that mutations in the exonuclease domain result in high mutation frequencies with a preference for C→A mutation. We describe the patterns of amino acid substitutions caused by POLE-exo* and compare them to other tumor types. The nucleotide preference of POLE-exo* leads to increased frequencies of recurrent nonsense mutations in key tumor suppressors such as TP53, ATM, and PIK3R1. We further demonstrate that strand-specific mutation patterns arise from some of these POLE-exo* mutants during genome duplication. This is the first direct proof of leading strand-specific replication by human POLE, which has only been demonstrated in yeast so far. Taken together, the extremely high mutation frequency and strand specificity of mutations provide a unique identifier of eukaryotic origins of replication. PMID:25228659

  3. A DNA polymerase alpha accessory protein, Mcl1, is required for propagation of centromere structures in fission yeast.

    Directory of Open Access Journals (Sweden)

    Toyoaki Natsume

    Full Text Available Specialized chromatin exists at centromeres and must be precisely transmitted during DNA replication. The mechanisms involved in the propagation of these structures remain elusive. Fission yeast centromeres are composed of two chromatin domains: the central CENP-A(Cnp1 kinetochore domain and flanking heterochromatin domains. Here we show that fission yeast Mcl1, a DNA polymerase alpha (Pol alpha accessory protein, is critical for maintenance of centromeric chromatin. In a screen for mutants that alleviate both central domain and outer repeat silencing, we isolated several cos mutants, of which cos1 is allelic to mcl1. The mcl1-101 mutation causes reduced CENP-A(Cnp1 in the central domain and an aberrant increase in histone acetylation in both domains. These phenotypes are also observed in a mutant of swi7(+, which encodes a catalytic subunit of Pol alpha. Mcl1 forms S-phase-specific nuclear foci, which colocalize with those of PCNA and Pol alpha. These results suggest that Mcl1 and Pol alpha are required for propagation of centromere chromatin structures during DNA replication.

  4. A DNA polymerase alpha accessory protein, Mcl1, is required for propagation of centromere structures in fission yeast.

    Science.gov (United States)

    Natsume, Toyoaki; Tsutsui, Yasuhiro; Sutani, Takashi; Dunleavy, Elaine M; Pidoux, Alison L; Iwasaki, Hiroshi; Shirahige, Katsuhiko; Allshire, Robin C; Yamao, Fumiaki

    2008-01-01

    Specialized chromatin exists at centromeres and must be precisely transmitted during DNA replication. The mechanisms involved in the propagation of these structures remain elusive. Fission yeast centromeres are composed of two chromatin domains: the central CENP-A(Cnp1) kinetochore domain and flanking heterochromatin domains. Here we show that fission yeast Mcl1, a DNA polymerase alpha (Pol alpha) accessory protein, is critical for maintenance of centromeric chromatin. In a screen for mutants that alleviate both central domain and outer repeat silencing, we isolated several cos mutants, of which cos1 is allelic to mcl1. The mcl1-101 mutation causes reduced CENP-A(Cnp1) in the central domain and an aberrant increase in histone acetylation in both domains. These phenotypes are also observed in a mutant of swi7(+), which encodes a catalytic subunit of Pol alpha. Mcl1 forms S-phase-specific nuclear foci, which colocalize with those of PCNA and Pol alpha. These results suggest that Mcl1 and Pol alpha are required for propagation of centromere chromatin structures during DNA replication. PMID:18493607

  5. Reading DNA at single-nucleotide resolution with a mutant MspA nanopore and phi29 DNA polymerase.

    Science.gov (United States)

    Manrao, Elizabeth A; Derrington, Ian M; Laszlo, Andrew H; Langford, Kyle W; Hopper, Matthew K; Gillgren, Nathaniel; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H

    2012-04-01

    Nanopore technologies are being developed for fast and direct sequencing of single DNA molecules through detection of ionic current modulations as DNA passes through a pore's constriction. Here we demonstrate the ability to resolve changes in current that correspond to a known DNA sequence by combining the high sensitivity of a mutated form of the protein pore Mycobacterium smegmatis porin A (MspA) with phi29 DNA polymerase (DNAP), which controls the rate of DNA translocation through the pore. As phi29 DNAP synthesizes DNA and functions like a motor to pull a single-stranded template through MspA, we observe well-resolved and reproducible ionic current levels with median durations of ∼28 ms and ionic current differences of up to 40 pA. Using six different DNA sequences with readable regions 42-53 nucleotides long, we record current traces that map to the known DNA sequences. With single-nucleotide resolution and DNA translocation control, this system integrates solutions to two long-standing hurdles to nanopore sequencing. PMID:22446694

  6. Differential gene expression in response to Papaya ringspot virus infection in Cucumis metuliferus using cDNA-amplified fragment length polymorphism analysis.

    Directory of Open Access Journals (Sweden)

    Yu-Tsung Lin

    Full Text Available A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV, Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP method. Transcript derived fragments (TDFs identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future.

  7. Differential gene expression in response to Papaya ringspot virus infection in Cucumis metuliferus using cDNA-amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Lin, Yu-Tsung; Jan, Fuh-Jyh; Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  8. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  9. The random amplified polymorphic DNA (RAPD) assay to determine DNA alterations, repair and transgenerational effects in B(a)P exposed Daphnia magna.

    Science.gov (United States)

    Atienzar, Franck A; Jha, Awadhesh N

    2004-08-18

    The random amplified polymorphic DNA (RAPD) is a useful assay for the detection of genotoxin-induced DNA damage and mutations. In this study, we have further evaluated the potential of this assay to measure benzo(a)pyrene [B(a)P]-induced DNA changes, and repair (in kinetic experiments) as well as transgenerational effects in the water fleas, Daphnia magna. The organisms, which reproduce parthenogenetically, were exposed to 50 microg L(-1) B(a)P for 3 or 6 days and were allowed to recover in clean medium for 12 or 9 days, respectively. Qualitative and quantitative changes were observed in RAPD profiles generated not only from the B(a)P exposed Daphnia but also from previously treated organisms during the recovery experiments. The fact that some of the RAPD changes disappeared at the end of both recovery experiments suggested that the DNA effects were fully repaired or reversed. In addition, some of the B(a)P-induced RAPD alterations detected in parental D. magna were also observed in the offspring patterns. This suggested that DNA alterations that occurred in germ cells were probably transmitted to the next cohorts. The present study shows that the RAPD method can be useful to qualitatively assess the kinetics of DNA changes, repair and transgenerational effects and such effects could potentially be linked to survival and reproductive success at higher levels of biological organisation. In addition, the water fleas have efficient capabilities to repair or reverse B(a)P-induced DNA effects. Finally, unrepaired or misrepaired genetic damage induced by genotoxins such as B(a)P could be transmitted to next generations in these parthenogenetically reproducing organisms. PMID:15288546

  10. Glycyrrhetinic acid and its derivatives as inhibitors of poly(ADP-ribose)polymerases 1 and 2, apurinic/apyrimidinic endonuclease 1 and DNA polymerase β

    OpenAIRE

    Salakhutdinov N. F.; Schreiber V.; Khodyreva S. N.; Ilina E. S.; Kutuzov M. M.; Sukhanova M. V.; Salomatina O. V.; Zakharenko A. L.; Lavrik O. I.

    2012-01-01

    Aim. For strengthening the efficiency of monofunctional alkylating antineoplastic drugs it is important to lower the capacity of base excision repair (BER) system which corrects the majority of DNA damages caused by these reagents. The objective was to create inhibitors of the key BER enzymes (PARP1, PARP2, DNA polymerase β, and APE1) by the directed modification of glycyrrhetinic acid (GA). Methods. Amides of GA were produced from the GA acetate by formation of the corresponding acyl chlorid...

  11. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E.; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  12. Neue Enzymeigenschaften durch gerichtete Evolution : Entwicklung und Charakterisierung einer thermostabilen Reversen Transkriptase aus einer DNA-abhängigen DNA-Polymerase

    OpenAIRE

    Sauter, Katharina B. M.

    2007-01-01

    Through screening of DNA polymerase libraries that contain arbitrary randomized mutants generated by epPCR, we were able to identify enzymes that exhibit RT-PCR function, a function that is imperceptible in the wildtype enzyme. As demonstrated, the identified mutants might find immediate applications and provide the basis for the development of new means for single-step RT-PCR technologies like pathogen RNA detection or gene expression analysis in real time.

  13. Slow rate of phosphodiester bond formation accounts for the strong bias that Taq DNA polymerase shows against 2',3'-dideoxynucleotide terminators.

    Science.gov (United States)

    Brandis, J W; Edwards, S G; Johnson, K A

    1996-02-20

    Taq and T7 DNA polymerases have become basic molecular biology "tools" for DNA sequence analysis. However, Taq, unlike T7 DNA polymerase, is strongly biased against the incorporation of 2',3'-dideoxynucleotide triphosphates (ddNTPs) indicating very different substrate selectivities. Equilibrium binding and rate constants were measured for 2',3'-ddNTPs as well as for several other 3'-substituted terminators and compared to 2'-deoxynucleotide substrates (dNTPs). In steady-state experiments, Taq Pol I was strongly biased in favor of dATP1 over ddATP incorporation by about 700 to 1, in contrast to T7 DNA polymerase which showed a preference of only about 4 to 1. Manganese reduced but did not eliminate selectivity against 2',3'-ddNTPs. Transient kinetic traces indicated different rate-limiting steps for substrate and terminator incorporation. Further mechanistic studies showed that the binding constants for substrates and terminators were equivalent. However, the rate constants for phosphodiester bond formation for 2',3'-ddNTPs were 200-3000-fold lower than for dNTPs. Alternative terminators showed only slight improvements. The data were consistent with a model in which both substrates and terminators undergo ground-state binding followed by formation of a tight-binding Enz.DNA.Nucleotide complex. Immediately after complex formation, substrates undergo a rapid nucleoside phosphoryl transfer reaction. However, the reaction rates for terminators were slower presumably due to misalignment of reactive groups in the active site. Thus, the strong bias that Taq DNA polymerase shows against terminators is due to a very slow "chemistry" step. Such a strong bias has several kinetic consequences for DNA sequence patterns. These consequences are discussed in the text. PMID:8652560

  14. Translesion replication by DNA polymerase beta is modulated by sequence context and stimulated by fork-like flap structures in DNA.

    Science.gov (United States)

    Daube, S S; Arad, G; Livneh, Z

    2000-01-18

    Mutations in the human genome are clustered in hot-spot regions, suggesting that some sequences are more prone to accumulate mutations than others. These regions are therefore more likely to lead to the development of cancer. Several pathways leading to the creation of mutations may be influenced by the DNA sequence, including sensitivity to DNA damaging agents, and repair mechanisms. We have analyzed sequence context effects on translesion replication, the error-prone repair of single-stranded DNA regions carrying lesions. By using synthetic oligonucleotides containing systematic variations of sequences flanking a synthetic abasic site, we show that translesion replication by the repair polymerase DNA polymerase beta is stimulated to a moderate extent by low stacking levels of the template nucleotides downstream of the lesion, combined with homopolymeric runs flanking the lesion both upstream and downstream. A strong stimulation of translesion replication by DNA polymerase beta was seen when fork-like flap structures were introduced into the DNA substrate downstream of the lesion. Unlike for gapped substrates, this stimulation was independent of the presence of a phosphate group at the 5' terminus of the flap. These results suggest that DNA polymerase beta may participate in cellular DNA transactions involving higher order structures. The significance of these results for in vivo translesion replication is discussed. PMID:10631001

  15. Nuclear distribution and chromatin association of DNA polymerase α-primase is affected by TEV protease cleavage of Cdc23 (Mcm10 in fission yeast

    Directory of Open Access Journals (Sweden)

    Gregan Juraj

    2005-06-01

    Full Text Available Abstract Background Cdc23/Mcm10 is required for the initiation and elongation steps of DNA replication but its biochemical function is unclear. Here, we probe its function using a novel approach in fission yeast, involving Cdc23 cleavage by the TEV protease. Results Insertion of a TEV protease cleavage site into Cdc23 allows in vivo removal of the C-terminal 170 aa of the protein by TEV protease induction, resulting in an S phase arrest. This C-terminal fragment of Cdc23 is not retained in the nucleus after cleavage, showing that it lacks a nuclear localization signal and ability to bind to chromatin. Using an in situ chromatin binding procedure we have determined how the S phase chromatin association of DNA polymerase α-primase and the GINS (Sld5-Psf1-Psf2-Psf3 complex is affected by Cdc23 inactivation. The chromatin binding and sub-nuclear distribution of DNA primase catalytic subunit (Spp1 is affected by Cdc23 cleavage and also by inactivation of Cdc23 using a degron allele, implying that DNA polymerase α-primase function is dependent on Cdc23. In contrast to the effect on Spp1, the chromatin association of the Psf2 subunit of the GINS complex is not affected by Cdc23 inactivation. Conclusion An important function of Cdc23 in the elongation step of DNA replication may be to assist in the docking of DNA polymerase α-primase to chromatin.

  16. Inhibitors of DNA topoisomerase or β-(but not α-) DNA polymerases alter the incision response of repair-deficient human cells after UV- or mnng-treatment

    International Nuclear Information System (INIS)

    Two types of repair-deficient human cells, those incapable of incision after UV irradiation (XPA or XPD) and those that fail to do so after incubation with MNNG (Al336 Mer/sup -/ cells), incised their DNA after treatment with UV or MNNG and incubation a) with inhibitors of DNA topoisomerase II (novobiocin) or b) with dideoxythymidine or at 450C (both inhibitory to β polymerase). This result was not produced by ara C or aphidicolin, specific inhibitors of α DNA polymerase. Thymidine incorporation in these cell lines was refractory to the β but not to the α polymerase inhibitors, although Al336 cells had normal in vitro β DNA polymerase activity with normal sensitivity to dideoxythymidine triphosphate. Thus, modulation of this activity in the cells prevented its inhibition. These results could be produced by allosteric interactions among components of an enzyme complex, similar to the ''replitase,'' that carries out DNA repair. The authors propose that DNA topoisomerase, β-DNA polymerase, a specific damage recognition protein (or proteins), and DNA nicking activity are part of this complex

  17. DNA polymerases δ and λ cooperate in repairing double-strand breaks by microhomology-mediated end-joining in Saccharomyces cerevisiae.

    Science.gov (United States)

    Meyer, Damon; Fu, Becky Xu Hua; Heyer, Wolf-Dietrich

    2015-12-15

    Maintenance of genome stability is carried out by a suite of DNA repair pathways that ensure the repair of damaged DNA and faithful replication of the genome. Of particular importance are the repair pathways, which respond to DNA double-strand breaks (DSBs), and how the efficiency of repair is influenced by sequence homology. In this study, we developed a genetic assay in diploid Saccharomyces cerevisiae cells to analyze DSBs requiring microhomologies for repair, known as microhomology-mediated end-joining (MMEJ). MMEJ repair efficiency increased concomitant with microhomology length and decreased upon introduction of mismatches. The central proteins in homologous recombination (HR), Rad52 and Rad51, suppressed MMEJ in this system, suggesting a competition between HR and MMEJ for the repair of a DSB. Importantly, we found that DNA polymerase delta (Pol δ) is critical for MMEJ, independent of microhomology length and base-pairing continuity. MMEJ recombinants showed evidence that Pol δ proofreading function is active during MMEJ-mediated DSB repair. Furthermore, mutations in Pol δ and DNA polymerase 4 (Pol λ), the DNA polymerase previously implicated in MMEJ, cause a synergistic decrease in MMEJ repair. Pol λ showed faster kinetics associating with MMEJ substrates following DSB induction than Pol δ. The association of Pol δ depended on RAD1, which encodes the flap endonuclease needed to cleave MMEJ intermediates before DNA synthesis. Moreover, Pol δ recruitment was diminished in cells lacking Pol λ. These data suggest cooperative involvement of both polymerases in MMEJ. PMID:26607450

  18. The eukaryotic leading and lagging strand DNA polymerases are loaded onto primer-ends via separate mechanisms but have comparable processivity in the presence of PCNA

    Science.gov (United States)

    Chilkova, Olga; Stenlund, Peter; Isoz, Isabelle; Stith, Carrie M.; Grabowski, Pawel; Lundström, Else-Britt; Burgers, Peter M.; Johansson, Erik

    2007-01-01

    Saccharomyces cerevisiae DNA polymerase δ (Pol δ) and DNA polymerase ε (Pol ε) are replicative DNA polymerases at the replication fork. Both enzymes are stimulated by PCNA, although to different levels. To understand why and to explore the interaction with PCNA, we compared Pol δ and Pol ε in physical interactions with PCNA and nucleic acids (with or without RPA), and in functional assays measuring activity and processivity. Using surface plasmon resonance technique, we show that Pol ε has a high affinity for DNA, but a low affinity for PCNA. In contrast, Pol δ has a low affinity for DNA and a high affinity for PCNA. The true processivity of Pol δ and Pol ε was measured for the first time in the presence of RPA, PCNA and RFC on single-stranded DNA. Remarkably, in the presence of PCNA, the processivity of Pol δ and Pol ε on RPA-coated DNA is comparable. Finally, more PCNA molecules were found on the template after it was replicated by Pol ε when compared to Pol δ. We conclude that Pol ε and Pol δ exhibit comparable processivity, but are loaded on the primer-end via different mechanisms. PMID:17905813

  19. Functions of replication factor C and proliferating-cell nuclear antigen: Functional similarity of DNA polymerase accessory proteins from human cells and bacteriophage T4

    International Nuclear Information System (INIS)

    The proliferating-cell nuclear antigen (PCNA) and the replication factors A and C (RF-A and RF-C) are cellular proteins essential for complete elongation of DNA during synthesis from the simian virus 40 origin of DNA replication in vitro. All three cooperate to stimulate processive DNA synthesis by DNA polymerase δ on a primed single-stranded M13 template DNA and as such can be categorized as DNA polymerase accessory proteins. Biochemical analyses with highly purified RF-C and PCNA have demonstrated functions that are completely analogous to the functions of bacteriophage T4 DNA polymerase accessory proteins. A primer-template-specific DNA binding activity and a DNA-dependent ATPase activity copurified with the multisubunit protein RF-C and are similar to the functions of the phage T4 gene 44/62 protein complex. Furthermore, PCNA stimulated the RF-C ATPase activity and is, therefore, analogous to the phage T4 gene 45 protein, which stimulates the ATPase function of the gene 44/62 protein complex. Indeed, some primary sequence similarities between human PCNA and the phage T4 gene 45 protein could be detected. These results demonstrate a striking conservation of the DNA replication apparatus in human cells and bacteriophage T4

  20. Effects of Intermediates between Vitamins K2 and K3 on Mammalian DNA Polymerase Inhibition and Anti-Inflammatory Activity

    Directory of Open Access Journals (Sweden)

    Takeshi Azuma

    2011-02-01

    Full Text Available Previously, we reported that vitamin K3 (VK3, but not VK1 or VK2 (=MK-4, inhibits the activity of human DNA polymerase γ (pol γ. In this study, we chemically synthesized three intermediate compounds between VK2 and VK3, namely MK-3, MK-2 and MK-1, and investigated the inhibitory effects of all five compounds on the activity of mammalian pols. Among these compounds, MK-2 was the strongest inhibitor of mammalian pols α, κ and λ, which belong to the B, Y and X families of pols, respectively; whereas VK3 was the strongest inhibitor of human pol γ, an A-family pol. MK-2 potently inhibited the activity of all animal species of pol tested, and its inhibitory effect on pol λ activity was the strongest with an IC50 value of 24.6 μM. However, MK-2 did not affect the activity of plant or prokaryotic pols, or that of other DNA metabolic enzymes such as primase of pol α, RNA polymerase, polynucleotide kinase or deoxyribonuclease I. Because we previously found a positive relationship between pol λ inhibition and anti-inflammatory action, we examined whether these compounds could inhibit inflammatory responses. Among the five compounds tested, MK-2 caused the greatest reduction in 12-O-tetradecanoylphorbol-13-acetate (TPA-induced acute inflammation in mouse ear. In addition, in a cell culture system using mouse macrophages, MK-2 displayed the strongest suppression of the production of tumor necrosis factor (TNF-α induced by lipopolysaccharide (LPS. Moreover, MK-2 was found to inhibit the action of nuclear factor (NF-κB. In an in vivo mouse model of LPS-evoked acute inflammation, intraperitoneal injection of MK-2 in mice led to suppression of TNF-α production in serum. In conclusion, this study has identified VK2 and VK3 intermediates, such as MK-2, that are promising anti-inflammatory candidates.

  1. Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC

    Directory of Open Access Journals (Sweden)

    Engelen Stefan

    2012-02-01

    Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.

  2. Docking of anti-HIV-1 oxoquinoline-acylhydrazone derivatives as potential HSV-1 DNA polymerase inhibitors

    Science.gov (United States)

    Yoneda, Julliane Diniz; Albuquerque, Magaly Girão; Leal, Kátia Zaccur; Santos, Fernanda da Costa; Batalha, Pedro Netto; Brozeguini, Leonardo; Seidl, Peter R.; de Alencastro, Ricardo Bicca; Cunha, Anna Cláudia; de Souza, Maria Cecília B. V.; Ferreira, Vitor F.; Giongo, Viveca A.; Cirne-Santos, Cláudio; Paixão, Izabel C. P.

    2014-09-01

    Although there are many antiviral drugs available for the treatment of herpes simplex virus (HSV) infections, still the synthesis of new anti-HSV candidates is an important strategy to be pursued, due to the emergency of resistant HSV strains mainly in human immunodeficiency virus (HIV) co-infected patients. Some 1,4-dihydro-4-oxoquinolines, such as PNU-183792 (1), show a broad spectrum antiviral activity against human herpes viruses, inhibiting the viral DNA polymerase (POL) without affecting the human POLs. Thus, on an ongoing antiviral research project, our group has synthesized ribonucleosides containing the 1,4-dihydro-4-oxoquinoline (quinolone) heterocyclic moiety, such as the 6-Cl derivative (2), which is a dual antiviral agent (HSV-1 and HIV-1). Molecular dynamics simulations of the complexes of 1 and 2 with the HSV-1 POL suggest that structural modifications of 2 should increase its experimental anti-HSV-1 activity, since its ribosyl and carboxyl groups are highly hydrophilic to interact with a hydrophobic pocket of this enzyme. Therefore, in this work, comparative molecular docking simulations of 1 and three new synthesized oxoquinoline-acylhydrazone HIV-1 inhibitors (3-5), which do not contain those hydrophilic groups, were carried out, in order to access these modifications in the proposition of new potential anti-HSV-1 agents, but maintaining the anti-HIV-1 activity. Among the docked compounds, the oxoquinoline-acylhydrazone 3 is the best candidate for an anti-HSV-1 agent, and, in addition, it showed anti-HIV-1 activity (EC50 = 3.4 ± 0.3 μM). Compounds 2 and 3 were used as templates in the design of four new oxoquinoline-acylhydrazones (6-9) as potential anti-HSV-1 agents to increase the antiviral activity of 2. Among the docked compounds, oxoquinoline-acylhydrazone 7 was selected as the best candidate for further development of dual anti-HIV/HSV activity.

  3. Efficiency, specificity and DNA polymerase-dependence of translesion replication across the oxidative DNA lesion 8-oxoguanine in human cells

    International Nuclear Information System (INIS)

    The oxidation product of guanine, 8-oxoguanine, is a major lesion formed in DNA by intracellular metabolism, ionizing radiation, and tobacco smoke. Using a recently developed method for the quantitative analysis of translesion replication, we have studied the bypass of 8-oxoguanine in vivo by transfecting human cells with a gapped plasmid carrying a site-specific 8-oxoguanine in the ssDNA region. The efficiency of bypass in the human large-cell lung carcinoma cell line H1299 was 80%, and it was similar when assayed in the presence of aphidicolin, an inhibitor of DNA polymerases α, δ and ε. A similar extent of bypass was observed also in XP-V cells, defective in pol η, both in the absence and presence of aphidicolin. DNA sequence analysis indicated that the major nucleotide inserted opposite the 8-oxoguanine was the correct nucleotide C, both in H1299 cells (81%) and in XP-V cells (77%). The major mutagenic event was the insertion of an A, both in H1299 and XP-V cells, and it occurred at a frequency of 16-17%, significantly higher than previously reported. Interestingly, the misinsertion frequency of A opposite 8-oxoguanine was decreased in XP-V cells in the presence of aphidicolin, and misinsertion of G was observed. This modulation of the mutagenic specificity at 8-oxoguanine is consistent with the notion that while not essential for the bypass reaction, pol η and pol δ, when present, are involved in bypass of 8-oxoguanine in vivo

  4. Site-specific mutagenesis of Drosophila proliferating cell nuclear antigen enhances its effects on calf thymus DNA polymerase δ

    Directory of Open Access Journals (Sweden)

    Miller Holly

    2004-08-01

    Full Text Available Abstract Background We and others have shown four distinct and presumably related effects of mammalian proliferating cell nuclear antigen (PCNA on DNA synthesis catalyzed by mammalian DNA polymerase δ(pol δ. In the presence of homologous PCNA, pol δ exhibits 1 increased absolute activity; 2 increased processivity of DNA synthesis; 3 stable binding of synthetic oligonucleotide template-primers (t1/2 of the pol δ•PCNA•template-primer complex ≥2.5 h; and 4 enhanced synthesis of DNA opposite and beyond template base lesions. This last effect is potentially mutagenic in vivo. Biochemical studies performed in parallel with in vivo genetic analyses, would represent an extremely powerful approach to investigate further, both DNA replication and repair in eukaryotes. Results Drosophila PCNA, although highly similar in structure to mammalian PCNA (e.g., it is >70% identical to human PCNA in amino acid sequence, can only substitute poorly for either calf thymus or human PCNA (~10% as well in affecting calf thymus pol δ. However, by mutating one or only a few amino acids in the region of Drosophila PCNA thought to interact with pol δ, all four effects can be enhanced dramatically. Conclusions Our results therefore suggest that all four above effects depend at least in part on the PCNA-pol δ interaction. Moreover unlike mammals, Drosophila offers the potential for immediate in vivo genetic analyses. Although it has proven difficult to obtain sufficient amounts of homologous pol δ for parallel in vitro biochemical studies, by altering Drosophila PCNA using site-directed mutagenesis as suggested by our results, in vitro biochemical studies may now be performed using human and/or calf thymus pol δ preparations.

  5. Binding of captan to DNA polymerase I from Escherichia coli and the concomitant effect on 5' → 3' exonuclease activity

    International Nuclear Information System (INIS)

    Captan (N-[(trichloromethyl)thio]-4-cyclohexene-1,2-dicarboximide) was shown to bind to DNA polymerase I from Escherichia coli. The ratio of [14C]captan bound to DNA pol I was 1:1 as measured by filter binding studies and sucrose gradient analysis. Preincubation of enzyme with polynucleotide prevented the binding of captan, but preincubation of enzyme with dGTP did not. Conversely, when the enzyme was preincubated with captan, neither polynucleotide nor dGTP binding was blocked. The modification of the enzyme by captan was described by an irreversible second-order rate process. The interaction of captan with DNA pol I altered each of the three catalytic functions. The 3' → 5' exonuclease and polymerase activities were inhibited, and the 5' → 3' exonuclease activity was enhanced. In order to study the 5' → 3' exonuclease activity more closely, [3H]hpBR322 (DNA-[3H]RNA hybrid) was prepared from pBR322 plasmid DNA and used as a specific substrate for 5' → 3' exonuclease activity. Collectively, the data support the hypothesis that captan acts on DNA pol I by irreversibly binding in the template-primer binding site associated with polymerase and 3' → 5' exonuclease activities. It is also shown that the chemical reaction between DNA pol I and a single captan molecule proceeds through a Michaelis complex. The final, irreversible step results in inhibited polymerase and 3' → 5' exonuclease activities as well as enhanced 5' → 3' exonuclease activity

  6. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    Science.gov (United States)

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  7. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration ofa transgene.

    Directory of Open Access Journals (Sweden)

    Tomoyuki eFurukawa

    2015-05-01

    Full Text Available The DNA double-strand break (DSB is a critical type of damage, and can be induced by both endogenous sources (e.g. errors of oxidative metabolism, transposable elements, programmed meiotic breaks, or perturbation of the DNA replication fork and exogenous sources (e.g. ionizing radiation or radiomimetic chemicals. Although higher plants, like mammals, are thought to preferentially repair DSBs via nonhomologous end joining (NHEJ, much remains unclear about plant DSB repair pathways. Our reverse genetic approach suggests that DNA polymerase λ is involved in DSB repair in Arabidopsis. The Arabidopsis T-DNA insertion mutant (atpolλ-1 displayed sensitivity to both gamma-irradiation and treatment with radiomimetic reagents, but not to other DNA damaging treatments. The atpolλ-1 mutant showed a moderate sensitivity to DSBs, while Arabidopsis Ku70 and DNA ligase 4 mutants (atku70-3 and atlig4-2, both of which play critical roles in NHEJ, exhibited a hypersensitivity to these treatments. The atpolλ-1/atlig4-2 double mutant exhibited a higher sensitivity to DSBs than each single mutant, but the atku70/atpolλ-1 showed similar sensitivity to the atku70-3 mutant. We showed that transcription of the DNA ligase 1, DNA ligase 6, and Wee1 genes was quickly induced by BLM in several NHEJ deficient mutants in contrast to wild-type. Finally, the T-DNA transformation efficiency dropped in NHEJ deficient mutants and the lowest transformation efficiency was scored in the atpolλ-1/atlig4-2 double mutant. These results imply that AtPolλ is involved in both DSB repair and DNA damage response pathway.

  8. Frameshift Deletion by Sulfolobus solfataricus P2 DNA Polymerase Dpo4 T239W Is Selective for Purines and Involves Normal Conformational Change Followed by Slow Phosphodiester Bond Formation*

    OpenAIRE

    Zhang, Huidong; Beckman, Jeff W.; Guengerich, F. Peter

    2009-01-01

    The human DNA polymerase κ homolog Sulfolobus solfataricus DNA polymerase IV (Dpo4) produces “−1” frameshift deletions while copying unmodified DNA and, more frequently, when bypassing DNA adducts. As judged by steady-state kinetics and mass spectrometry, bypass of purine template bases to produce these deletions occurred rarely but with 10-fold higher frequency than with pyrimidines. The DNA adduct 1,N2-etheno-2′-deoxyguanosine, with a larger stacking surface than canonical purines, showed t...

  9. A broadly applicable method to characterize large DNA viruses and adenoviruses based on the DNA polymerase gene

    Directory of Open Access Journals (Sweden)

    Montgomery Roy D

    2006-04-01

    Full Text Available Abstract Background Many viral pathogens are poorly characterized, are difficult to culture or reagents are lacking for confirmatory diagnoses. We have developed and tested a robust assay for detecting and characterizing large DNA viruses and adenoviruses. The assay is based on the use of degenerate PCR to target a gene common to these viruses, the DNA polymerase, and sequencing the products. Results We evaluated our method by applying it to fowl adenovirus isolates, catfish herpesvirus isolates, and largemouth bass ranavirus (iridovirus from cell culture and lymphocystis disease virus (iridovirus and avian poxvirus from tissue. All viruses with the exception of avian poxvirus produced the expected product. After optimization of extraction procedures, and after designing and applying an additional primer we were able to produce polymerase gene product from the avian poxvirus genome. The sequence data that we obtained demonstrated the simplicity and potential of the method for routine use in characterizing large DNA viruses. The adenovirus samples were demonstrated to represent 2 types of fowl adenovirus, fowl adenovirus 1 and an uncharacterized avian adenovirus most similar to fowl adenovirus 9. The herpesvirus isolate from blue catfish was shown to be similar to channel catfish virus (Ictalurid herpesvirus 1. The case isolate of largemouth bass ranavirus was shown to exactly match the type specimen and both were similar to tiger frog virus and frog virus 3. The lymphocystis disease virus isolate from largemouth bass was shown to be related but distinct from the two previously characterized lymphocystis disease virus isolates suggesting that it may represent a distinct lymphocystis disease virus species. Conclusion The method developed is rapid and broadly applicable to cell culture isolates and infected tissues. Targeting a specific gene for in the large DNA viruses and adenoviruses provide a common reference for grouping the newly identified

  10. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase {beta} in long patch base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanova, Maria; Khodyreva, Svetlana [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation); Lavrik, Olga, E-mail: lavrik@niboch.nsc.ru [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation)

    2010-03-01

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase {beta} (Pol {beta})-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol {beta} and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol {beta}. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol {beta} via strand-displacement mechanism. PARP1 also represses Pol {beta}/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol {beta} both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol {beta} activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol {beta}-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol {beta} and the overall efficiency of SP BER is practically unaffected by PARP1. Thus

  11. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase β in long patch base excision repair

    International Nuclear Information System (INIS)

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase β (Pol β)-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol β and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol β. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol β via strand-displacement mechanism. PARP1 also represses Pol β/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol β both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol β activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol β-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol β and the overall efficiency of SP BER is practically unaffected by PARP1. Thus, PARP1 differentially influences DNA synthesis in SP- and

  12. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data.

    Science.gov (United States)

    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu

    2016-03-01

    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon. PMID:27162496

  13. DNA-dependent DNA polymerase from yeast mitochondria. Dependence of enzyme activity on conditions of cell growth, and properties of the highly purified polymerase.

    Science.gov (United States)

    Wintersberger, U; Blutsch, H

    1976-09-01

    The activity of DNA polymerase was determined in gradient-purified mitochondria from yeast cells grown under a variety of conditions. The specific enzyme activity was found to be dependent on the degree of aeration of the cells, and on the carbon source used for the medium. It was sensitive to glucose repression, and was enhanced about two-fold by the growth of yeast cells in the presence of ethidium bromide. Mitochondria DNA polymerase was highly purified and several properties were determined. Sucrose density gradient centrifugation, and dodecylsulfate-polyacylamide gel electrophoresis revealed the following structure: a monomer of molecular weight around 60 000 aggregated under relatively high salt concentration (0.2 M phosphate buffer) to a dimer of about 120 000 which under low salt concentration (0.2 M Tris-HCl buffer) formed higher aggregates. For optimal activity an Mg2+ ion concentration of 50 mM was found necessary, Mn ions did not promote activity at any concentration tested (0.5--50 mM). Indeed, if added to Mg2+-containing assays, Mn2+ strongly inhibited enzyme activity at low concentrations. This might be an explanation for the inducation of mitochondrial mutants in yeast cells grown in the presence of Mn2+ ions. Mitochondrial DNA polymerase activity was strongly inhibited by low concentrations of the -SH reagent p-chloromercuribenzoate, the nucleotide analogue cytosine arabinoside triphosphate also exerted an inhibitory effect. An about 50% decrease of activity was observed in the presence of 1 mM o-phenanthroline in assay mixture containing DNA at about the Km concentration. The enzyme preferred a gapped template primer, poly(dA) - (dT)10, over nicked DNA and was unable to use a polyribonucleotide template, poly(rA) - (dT)10. In the purest preparations no exonuclease activity could be detected. PMID:786635

  14. Structural insights on the pamoic acid and the 8 kDa domain of DNA polymerase beta complex: Towards the design of higher-affinity inhibitors

    Directory of Open Access Journals (Sweden)

    Ciais Marion

    2008-04-01

    Full Text Available Abstract Background DNA polymerase beta (pol beta, the error-prone DNA polymerase of single-stranded DNA break repair as well as base excision repair pathways, is overexpressed in several tumors and takes part in chemotherapeutic agent resistance, like that of cisplatin, through translesion synthesis. For this reason pol beta has become a therapeutic target. Several inhibitors have been identified, but none of them presents a sufficient affinity and specificity to become a drug. The fragment-based inhibitor design allows an important improvement in affinity of small molecules. The initial and critical step for setting up the fragment-based strategy consists in the identification and structural characterization of the first fragment bound to the target. Results We have performed docking studies of pamoic acid, a 9 micromolar pol beta inhibitor, and found that it binds in a single pocket at the surface of the 8 kDa domain of pol beta. However, docking studies provided five possible conformations for pamoic acid in this site. NMR experiments were performed on the complex to select a single conformation among the five retained. Chemical Shift Mapping data confirmed pamoic acid binding site found by docking while NOESY and saturation transfer experiments provided distances between pairs of protons from the pamoic acid and those of the 8 kDa domain that allowed the identification of the correct conformation. Conclusion Combining NMR experiments on the complex with docking results allowed us to build a three-dimensional structural model. This model serves as the starting point for further structural studies aimed at improving the affinity of pamoic acid for binding to DNA polymerase beta.

  15. Cooperative motion of a key positively charged residue and metal ions for DNA replication catalyzed by human DNA Polymerase

    OpenAIRE

    Genna, Vito; Gaspari, Roberto; Dal Peraro, Matteo; De Vivo, Marco

    2016-01-01

    Trans-lesion synthesis polymerases, like DNA Polymerase-η (Pol-η), are essential for cell survival. Pol-η bypasses ultraviolet-induced DNA damages via a two-metal-ion mechanism that assures DNA strand elongation, with formation of the leaving group pyrophosphate (PPi). Recent structural and kinetics studies have shown that Pol-η function depends on the highly flexible and conserved Arg61 and, intriguingly, on a transient third ion resolved at the catalytic site, as lately observed in other nu...

  16. Application of electrospray ionization mass spectrometry to study the hydrophobic interaction between the ɛ and θ subunits of DNA polymerase III

    OpenAIRE

    Gupta, Rajesh; Hamdan, Samir M.; Dixon, Nicholas E.; Sheil, Margaret M.; Beck, Jennifer L.

    2004-01-01

    The interactions between the N-terminal domain of the ɛ (ɛ186) and θ subunits of DNA polymerase III of Escherichia coli were investigated using electrospray ionization mass spectrometry. The ɛ186–θ complex was stable in 9 M ammonium actetate (pH 8), suggesting that hydrophobic interactions have a predominant contribution to the stability of the complex. Addition of primary alkanols to ɛ186–θ in 0.1 M ammonium acetate (pH 8), led to dissociation of the complex, as observed in the mass spectrom...

  17. Real-time PCR-based genotyping from whole blood using Taq DNA polymerase and a buffer supplemented with 1,2-propanediol and trehalose

    Czech Academy of Sciences Publication Activity Database

    Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr

    2015-01-01

    Roč. 416, January (2015), s. 178-182. ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.820, year: 2014

  18. Ring-Opening of the γ-OH-PdG Adduct Promotes Error-Free Bypass by the Sulfolobus solfataricus DNA Polymerase Dpo4

    OpenAIRE

    Shanmugam, Ganesh; Minko, Irina G.; Banerjee, Surajit; Christov, Plamen P.; Kozekov, Ivan D.; Rizzo, Carmelo J.; Lloyd, R. Stephen; Egli, Martin; Michael P. Stone

    2013-01-01

    Acrolein, a mutagenic aldehyde, reacts with deoxyguanosine (dG) to form 3-(2′-deoxy-β-d-erythro-pentofuranosyl)-5,6,7,8-tetrahydro-8-hydroxypyrimido[1,2-a] purin-10(3H)-one (γ-OH-PdG). When placed opposite deoxycytosine (dC) in DNA, γ-OH-PdG undergoes ring-opening to the N 2-(3-oxopropyl)-dG. Ring-opening of the adduct has been hypothesized to facilitate nonmutagenic bypass, particularly by DNA polymerases of the Y family. This study examined the bypass of γ-OH-PdG by Sulfolobus solfataricus ...

  19. Residues of Human Cytomegalovirus DNA Polymerase Catalytic Subunit UL54 That Are Necessary and Sufficient for Interaction with the Accessory Protein UL44

    OpenAIRE

    Loregian, Arianna; Appleton, Brent A; Hogle, James M.; Coen, Donald M.

    2004-01-01

    The human cytomegalovirus DNA polymerase contains a catalytic subunit, UL54, and an accessory protein, UL44. Recent studies suggested that UL54 might interact via its extreme C terminus with UL44 (A. Loregian, R. Rigatti, M. Murphy, E. Schievano, G. Palu', and H. S. Marsden, J. Virol. 77:8336-8344, 2003). To address this hypothesis, we quantitatively measured the binding of peptides corresponding to the extreme C terminus of UL54 to UL44 by using isothermal titration calorimetry. A peptide co...

  20. A tumor necrosis factor α- and interleukin 6-inducible protein that interacts with the small subunit of DNA polymerase δ and proliferating cell nuclear antigen

    OpenAIRE

    He, Hua; Tan, Cheng-Keat; Downey, Kathleen M.; So, Antero G.

    2001-01-01

    A cDNA encoding a protein of 36 kDa, polymerase delta-interacting protein 1 (PDIP1), that interacts with the small subunit (p50) of DNA polymerase δ (pol δ) was identified in a two-hybrid screen of a HepG2 cDNA library by using p50 as bait. The interaction of PDIP1 with p50 was confirmed by pull-down assays, and a similar assay was used to demonstrate that PDIP1 interacts directly with the proliferating cell nuclear antigen (PCNA). PCNA and p50 bound to PDIP1 simultaneously, and PDIP1 stimula...

  1. Development of fluorescent amplified fragment length polymorphism for Streptococcus suis%猪链球菌荧光DNA扩增片段长度多态性检测方法的建立

    Institute of Scientific and Technical Information of China (English)

    王楷成; Linda van der Graaf; 陆承平; 黄保续; 范伟兴

    2012-01-01

    The fluorescent amplified fragment length for Streptococcus suis was developed using 2 pairs of primers.51 to 98 fragments of highly polymorphic products were obtained by 2 pairs of primers in 12 Streptococcus suis isolates.The fluorescent amplified fragment length technique can be used to detect the DNA polymorphism of Streptococcus suis.Different serotypes or different isolates of the same serotype in Streptococcus suis can be distinguished by the method.It is available in identification or tracking for Streptococcus suis strains.%利用荧光标记技术,采用2对引物初步建立检测猪链球菌荧光DNA扩增片段长度多态性方法,结果表明12株猪链球菌扩增的多态性位点数从51~98条不等,该方法能够检测猪链球菌的多态性,区分不同血清型以及同一血清型不同特性的菌株,可用于菌株鉴定及流行病学研究中细菌源的追踪。

  2. Mnemonic aspects of Escherichia coli DNA polymerase I. Interaction with one template influences the next interaction with another template.

    Science.gov (United States)

    Papanicolaou, C; Lecomte, P; Ninio, J

    1986-06-01

    When Escherichia coli DNA polymerase I (Pol I) replicates a homopolymer, the excision/polymerization (exo/pol) ratio varies with enzyme and initiator concentration. The study of this effect in the case of poly(dA).oligo(dT) replication led us to propose a mnemonic model for Pol I, in which the 3' to 5' excision activity warms up when the enzyme is actively polymerizing, and cools down when it dissociates from the template. The model predicts that the exo/pol ratio must increase with processivity length and initiator concentration and decrease with enzyme concentration. It predicts also that contact of the enzyme with one template alters its excision efficiency towards another template. The exo/pol ratio and processivities of Pol I and its Klenow fragment were studied on four templates: poly(dA).(dT)10, poly(dT).(dA)10, poly(dC).(dG)10 and poly(dI).(dC)10. We show that the Klenow fragment is usually much less processive than Pol I and when this is the case it has a much lower exo/pol ratio. At equal processivity, the exo/pol ratios are nearly equal. Furthermore, many factors that influence processivity length (e.g. manganese versus magnesium, inorganic pyrophosphate, ionic strength) influence the exo/pol ratio in the same direction. The study of deaminated poly(dC) replication, where we followed incorporation and excision of both G and A residues, allowed us to assign the origin of the dNMP variations to changes in the 3' to 5' proof-reading activity of Pol I. Similarly, the lower dNMP turnover of the Klenow fragment observed with deaminated poly(dC) was specifically assigned to a decreased 3' to 5' exonuclease activity. The exo/pol ratio generally increased with initiator and decreased with enzyme concentration, in agreement with the model, except for poly(dI).oligo(dC), where it decreased with initiator concentration. However, by terminating chain elongation with dideoxy CTP, we showed directly that, even in this system, excision is relatively inefficient at the

  3. Resolution of the diadenosine 5',5'''-P1,P4-tetraphosphate binding subunit from a multiprotein form of HeLa cell DNA polymerase α

    International Nuclear Information System (INIS)

    A diadenosine 5',5'''-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase α [deoxy-nucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatograpy on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A

  4. A molecular biological study on the identification of the molecular species of DNA polymerases for repairing radiation-damaged DNA and the factors modifying the mutation rate

    International Nuclear Information System (INIS)

    Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase α, δ and ε were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 μM inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense δ, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)

  5. Impacts of carbon nanotubes on biochemical reactions: insight into interaction between carbon nanotubes and DNA polymerase enzyme

    OpenAIRE

    Uysal, Ebru; Meral, Yüce; Meral, Yuce; Hasan KURT

    2014-01-01

    Recently, the Polymerase Chain Reaction technique has begun to benefit from nanotechnology. In this paper, effects of carbon nanotubes in the Polymerase Chain Reaction were investigated by Electrophoresis, Circular Dichroism Spectrometry and Dynamic Light Scattering Techniques. The unique ability to amplify low copy number DNA within minutes has made in vitro Polymerase Chain Reaction (PCR) one of the most essential techniques in modern biology. In order to harness this technique to its full ...

  6. In vitro bypass of the major malondialdehyde- and base propenal-derived DNA adduct by human Y-family DNA polymerases κ, ι, and Rev1.

    Science.gov (United States)

    Maddukuri, Leena; Eoff, Robert L; Choi, Jeong-Yun; Rizzo, Carmelo J; Guengerich, F Peter; Marnett, Lawrence J

    2010-09-28

    3-(2'-Deoxy-β-d-erythro-pentofuranosyl)pyrimido-[1,2-a]purin-10(3H)-one (M(1)dG) is the major adduct derived from the reaction of DNA with the lipid peroxidation product malondialdehyde and the DNA peroxidation product base propenal. M(1)dG is mutagenic in Escherichia coli and mammalian cells, inducing base-pair substitutions (M(1)dG → A and M(1)dG → T) and frameshift mutations. Y-family polymerases may contribute to the mutations induced by M(1)dG in vivo. Previous reports described the bypass of M(1)dG by DNA polymerases η and Dpo4. The present experiments were conducted to evaluate bypass of M(1)dG by the human Y-family DNA polymerases κ, ι, and Rev1. M(1)dG was incorporated into template-primers containing either dC or dT residues 5' to the adduct, and the template-primers were subjected to in vitro replication by the individual DNA polymerases. Steady-state kinetic analysis of single nucleotide incorporation indicates that dCMP is most frequently inserted by hPol κ opposite the adduct in both sequence contexts, followed by dTMP and dGMP. dCMP and dTMP were most frequently inserted by hPol ι, and only dCMP was inserted by Rev1. hPol κ extended template-primers in the order M(1)dG:dC > M(1)dG:dG > M(1)dG:dT ∼ M(1)dG:dA, but neither hPol ι nor Rev1 extended M(1)dG-containing template-primers. Liquid chromatography-mass spectrometry analysis of the products of hPol κ-catalyzed extension verified this preference in the 3'-GXC-5' template sequence but revealed the generation of a series of complex products in which dAMP is incorporated opposite M(1)dG in the 3'-GXT-5' template sequence. The results indicate that DNA hPol κ or the combined action of hPol ι or Rev1 and hPol κ bypass M(1)dG residues in DNA and generate products that are consistent with some of the mutations induced by M(1)dG in mammalian cells. PMID:20726503

  7. In Vitro Bypass of the Major Malondialdehyde- and Base Propenal-Derived DNA Adduct by Human Y-family DNA Polymerases κ, ι, and Rev1†

    Science.gov (United States)

    2010-01-01

    3-(2′-Deoxy-β-d-erythro-pentofuranosyl)pyrimido-[1,2-a]purin-10(3H)-one (M1dG) is the major adduct derived from the reaction of DNA with the lipid peroxidation product malondialdehyde and the DNA peroxidation product base propenal. M1dG is mutagenic in Escherichia coli and mammalian cells, inducing base-pair substitutions (M1dG → A and M1dG → T) and frameshift mutations. Y-family polymerases may contribute to the mutations induced by M1dG in vivo. Previous reports described the bypass of M1dG by DNA polymerases η and Dpo4. The present experiments were conducted to evaluate bypass of M1dG by the human Y-family DNA polymerases κ, ι, and Rev1. M1dG was incorporated into template-primers containing either dC or dT residues 5′ to the adduct, and the template-primers were subjected to in vitro replication by the individual DNA polymerases. Steady-state kinetic analysis of single nucleotide incorporation indicates that dCMP is most frequently inserted by hPol κ opposite the adduct in both sequence contexts, followed by dTMP and dGMP. dCMP and dTMP were most frequently inserted by hPol ι, and only dCMP was inserted by Rev1. hPol κ extended template-primers in the order M1dG:dC > M1dG:dG > M1dG:dT ∼ M1dG:dA, but neither hPol ι nor Rev1 extended M1dG-containing template-primers. Liquid chromatography−mass spectrometry analysis of the products of hPol κ-catalyzed extension verified this preference in the 3′-GXC-5′ template sequence but revealed the generation of a series of complex products in which dAMP is incorporated opposite M1dG in the 3′-GXT-5′ template sequence. The results indicate that DNA hPol κ or the combined action of hPol ι or Rev1 and hPol κ bypass M1dG residues in DNA and generate products that are consistent with some of the mutations induced by M1dG in mammalian cells. PMID:20726503

  8. Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

    Science.gov (United States)

    Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

    2016-06-01

    The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

  9. Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

    Science.gov (United States)

    Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

    2015-02-01

    DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars. PMID:26040115

  10. THE INHIBITORY EFFECT OF EXTRACT OF CAMELLIA SINENSIS AND EXTRACT OF CAMELLIA PTILOPHYLLA CHANG ON DNA POLYMERASE OF EHRLICH ASCITES CARCINOMA CELLS

    Institute of Scientific and Technical Information of China (English)

    Xian Lijian; Liu Zongchao; Pan Qichao; Li Hanxi

    1998-01-01

    Objective:To detect the effect of extract of Camellia Sinensis (ECS) and extract of Camellia Ptilophylla Chang (ECPC) on DNA polymerase (Pol) of Ehrlich ascites tumor cells. Methods: Referring to the method of K.Ono, Pol was extracted from Ehrlich ascites tumor cells in mice. Pol α, β, and γ were separated by phosphocellulose column chromatography and were identified. The effect of ECPC and ECS on Pol was studied. Results: ECPC and ECS were shown to inhibit the activity of Pol α, β, and γ. IC50 values of ECS on Polα, β, and γ were 10.2μ g/ml, 9.9μ g/ml and 28.9 μ g/mlrespectively. IC50 values of ECPC on Pol α, Pol β and Pol γ were 5.6 μ g/ml, 15 μ g/ml and 14.7 μ g/mlrespectively. The modes of inhibition of ECPC on Pol α,Pol β and Pol γ were noncompetitive with respect to template DNA. The Ki values of ECPC on Pol α, β, and γ were 2.68± 0.12 μ g/ml, 2.24 ± 0. 12 μ g/ml , 2.56 ±0. 18 μ g/ml . Conclusion: ECPC and ECS were shown to have inhibitory effect on DNA polymerase of tumor cells. The mode of inhibition of ECPC on Pol α, Pol βand Pol γwere noncompetitive with respect to template DNA.

  11. Random amplified polymorphic DNA markers for DNA fingerprinting and genetic variability assessment of minute parasitic wasp species (Hymenoptera: Mymaridae and Trichogrammatidae) used in biological control programs of phytophagous insects.

    Science.gov (United States)

    Landry, B S; Dextraze, L; Boivin, G

    1993-06-01

    Biological control of insects that feed on our crops has become more practical in recent years by mass release of egg parasitoid microhymenoptera. Trichogramma species are now commercially reared and spread in commercial fields to control specific insect pests. Microhymenoptera species are, however, very small and morphologically indistinguishable within species, although strains of a given species differ in their efficiency to control specific insect pests. Traditional taxonomy is unable to differentiate microhymenoptera species at the strain level. It is becoming increasingly important to develop a reliable system to monitor genetic variations both within and between strains of commercially important microhymenoptera, to detect genetic drift occurring during several generations of multiplication, to protect patents, and to certify the lots of commercially released microhymenoptera. We have developed a system based on DNA markers to rapidly characterize individuals of five species of microhymenoptera from the genus Anaphes and Trichogramma including a new species of Anaphes not previously described. The main components of our system are a rapid and simple DNA micro-extraction method and fast DNA polymorphism analyses based on random amplified polymorphic DNA markers. PMID:8349128

  12. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  13. Association of DNA sequence variation in mitochondrial DNA polymerase with mitochondrial DNA synthesis and risk of oral cancer.

    Science.gov (United States)

    Datta, Sayantan; Ray, Anindita; Roy, Roshni; Roy, Bidyut

    2016-01-10

    Enzymes responsible for mitochondrial (mt) DNA synthesis and transcription are encoded by nuclear genome and inherited mutations in these genes may play important roles in enhancing risk of precancer and cancer. Here, genetic variations in 23 functionally relevant tagSNPs in 6 genes responsible for mtDNA synthesis and transcription were studied in 522 cancer and 241 precancer (i.e. leukoplakia) patients and 525 healthy controls using Illumina Golden Gate assay to explore association with risk of oral precancer and cancer. Two SNPs, rs41553913 at POLRMT and rs9905016 at POLG2, significantly increased risk of oral leukoplakia and cancer, respectively, at both genotypic and allelic levels. Gene-environment interaction models also revealed that tobacco habits and SNPs at POLG2 and TFAM may modulate risk of both leukoplakia and cancer. In silico analysis of published data-set also revealed that variant heterozygote (TC) significantly increased transcription of POLG2 compared to wild genotype (p=0.03). Cancer tissues having variant allele genotypes (TC+CC) at POLG2 contained 1.6 times (pcancer tissues having wild genotype (TT). In conclusion, polymorphisms at POLG2 and POLRMT increased risk of oral cancer and leukoplakia, respectively, probably modulating synthesis and activity of the enzymes. Enhanced synthesis of mtDNA in cancer tissues may have implication in carcinogenesis, but the mechanism is yet to be explored. PMID:26403317

  14. The Biological Effect of Y-family DNA Polymerases on the Translesion Synthesis%DNA聚合酶Y家族在跨损伤复制中的作用

    Institute of Scientific and Technical Information of China (English)

    弓毅

    2013-01-01

    普通的DNA聚合酶可以对正常的DNA完成复制,但是当DNA发生损伤,损伤位置就会成为DNA复制的阻滞点,普通的DNA聚合酶就无法完成基因组的复制.为了应对这种情况,生物体内还拥有另一类DNA聚合酶:聚合酶Y家族,又被称为跨损伤复制(TLS)聚合酶,它们的主要功能就是跨越损伤位点,完成基因组复制,解救濒死细胞.本文主要对Y家族聚合酶的结构特点、功能效应、作用机制等方面做一综述.%A common DNA polymerase can replicate DNA which functions normally. However, if DNA suffers damage, the genome can not be replicated by a common DNA polymerase because DNA lesions will block the replication apparatus. Another kind of DNA polymerases in organism, Y-family DNA polymerases which is also called transle-sion synthesis (TLS) polymerases, can deal with this problem. Their main functions are bypassing the lesions in DNA, replicating the genome and saving the dying cells. This thesis presents a historical review of the literature pertinent to the structure, functions and roles of Y-family DNA polymerases.

  15. Characterization of DNA polymerase β from Danio rerio by overexpression in E. coli using the in vivo/in vitro compatible pIVEX plasmid

    Directory of Open Access Journals (Sweden)

    Ishikawa Mitsuru

    2011-10-01

    Full Text Available Abstract Background Eukaryotic DNA polymerase β (pol β, the polymerase thought to be responsible for DNA repair synthesis, has been extensively characterized in rats and humans. However, pol β has not been purified or enzymatically characterized from the model fish species Danio rerio (zebrafish. We used the in vitro/in vivo dual expression system plasmid, pIVEX, to express Danio rerio pol β (Danio pol β for biochemical characterization. Results Danio pol β encoded by the in vitro/in vivo-compatible pIVEX plasmid was expressed in E. coli BL21(DE3, BL21(DE3pLysS, and KRX, and in vitro as a C-terminal His-tagged protein. Danio pol β expressed in vitro was subject to proteolysis; therefore, bacterial overexpression was used to produce the protein for kinetic analyses. KRX cells were preferred because of their reduced propensity for leaky expression of pol β. The cDNA of Danio rerio pol β encodes a protein of 337 amino acids, which is 2-3 amino acids longer than other pol β proteins, and contains a P63D amino acid substitution, unlike mammalian pol βs. This substitution lies in a hairpin sequence within an 8-kDa domain, likely to be important in DNA binding. We performed extensive biochemical characterization of Danio pol β in comparison with rat pol β, which revealed its sensitivity to metal ion activators (Mn2+ and Mg2+, its optimum salt concentration (10 mM KCl and 50 mM NaCl, alkaline pH optimum (pH 9.0, and low temperature optimum (30°C. Substituting Mn2+ for Mg2+ resulted in 8.6-fold higher catalytic efficiency (kcat/Km. Conclusions Our characterization of pol β from a model fish organism contributes to the study of the function and evolution of DNA polymerases, which are emerging as important cellular targets for chemical intervention in the development of anticancer agents.

  16. Structural and Functional Analysis of Sulfolobus solfataricus Y-Family DNA Polymerase Dpo4-Catalyzed Bypass of the Malondialdehyde−Deoxyguanosine Adduct

    Energy Technology Data Exchange (ETDEWEB)

    Eoff, Robert L.; Stafford, Jennifer B.; Szekely, Jozsef; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter; Marnett, Lawrence J.; (Vanderbilt)

    2010-01-12

    Oxidative stress can induce the formation of reactive electrophiles, such as DNA peroxidation products, e.g., base propenals, and lipid peroxidation products, e.g., malondialdehyde. Base propenals and malondialdehyde react with DNA to form adducts, including 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-{alpha}]purin-10(3H)-one (M{sub 1}dG). When paired opposite cytosine in duplex DNA at physiological pH, M{sub 1}dG undergoes ring opening to form N{sup 2}-(3-oxo-1-propenyl)-dG (N{sup 2}-OPdG). Previous work has shown that M{sub 1}dG is mutagenic in bacteria and mammalian cells and that its mutagenicity in Escherichia coli is dependent on induction of the SOS response, indicating a role for translesion DNA polymerases in the bypass of M{sub 1}dG. To probe the mechanism by which translesion polymerases bypass M{sub 1}dG, kinetic and structural studies were conducted with a model Y-family DNA polymerase, Dpo4 from Sulfolobus solfataricus. The level of steady-state incorporation of dNTPs opposite M{sub 1}dG was reduced 260-2900-fold and exhibited a preference for dATP incorporation. Liquid chromatography-tandem mass spectrometry analysis of the full-length extension products revealed a spectrum of products arising principally by incorporation of dC or dA opposite M{sub 1}dG followed by partial or full-length extension. A greater proportion of -1 deletions were observed when dT was positioned 5' of M{sub 1}dG. Two crystal structures were determined, including a 'type II' frameshift deletion complex and another complex with Dpo4 bound to a dC-M{sub 1}dG pair located in the postinsertion context. Importantly, M{sub 1}dG was in the ring-closed state in both structures, and in the structure with dC opposite M{sub 1}dG, the dC residue moved out of the Dpo4 active site, into the minor groove. The results are consistent with the reported mutagenicity of M{sub 1}dG and illustrate how the lesion may affect replication events.

  17. The ORF59 DNA polymerase processivity factor homologs of Old World primate RV2 rhadinoviruses are highly conserved nuclear antigens expressed in differentiated epithelium in infected macaques

    Directory of Open Access Journals (Sweden)

    Burnside Kellie L

    2009-11-01

    Full Text Available Abstract Background ORF59 DNA polymerase processivity factor of the human rhadinovirus, Kaposi's sarcoma-associated herpesvirus (KSHV, is required for efficient copying of the genome during virus replication. KSHV ORF59 is antigenic in the infected host and is used as a marker for virus activation and replication. Results We cloned, sequenced and expressed the genes encoding related ORF59 proteins from the RV1 rhadinovirus homologs of KSHV from chimpanzee (PtrRV1 and three species of macaques (RFHVMm, RFHVMn and RFHVMf, and have compared them with ORF59 proteins obtained from members of the more distantly-related RV2 rhadinovirus lineage infecting the same non-human primate species (PtrRV2, RRV, MneRV2, and MfaRV2, respectively. We found that ORF59 homologs of the RV1 and RV2 Old World primate rhadinoviruses are highly conserved with distinct phylogenetic clustering of the two rhadinovirus lineages. RV1 and RV2 ORF59 C-terminal domains exhibit a strong lineage-specific conservation. Rabbit antiserum was developed against a C-terminal polypeptide that is highly conserved between the macaque RV2 ORF59 sequences. This anti-serum showed strong reactivity towards ORF59 encoded by the macaque RV2 rhadinoviruses, RRV (rhesus and MneRV2 (pig-tail, with no cross reaction to human or macaque RV1 ORF59 proteins. Using this antiserum and RT-qPCR, we determined that RRV ORF59 is expressed early after permissive infection of both rhesus primary fetal fibroblasts and African green monkey kidney epithelial cells (Vero in vitro. RRV- and MneRV2-infected foci showed strong nuclear expression of ORF59 that correlated with production of infectious progeny virus. Immunohistochemical studies of an MneRV2-infected macaque revealed strong nuclear expression of ORF59 in infected cells within the differentiating layer of epidermis corroborating previous observations that differentiated epithelial cells are permissive for replication of KSHV-like rhadinoviruses

  18. Low Genetic Diversity Among Garlic (Allium sativum L. Accessions Detected Using Random Amplified Polymorphic DNA (RAPD Escasa Diversidad Genética entre Accesiones de Ajo (Allium sativum L. Detectada Mediante ADN Polimórfico Amplificado al Azar (RAPD

    Directory of Open Access Journals (Sweden)

    Mario Paredes C

    2008-03-01

    Full Text Available Garlic (Allium sativum L. is a species of vegetative propagation, showing high morphological diversity. Besides, its clones have specific adaptations to different agroclimatic regions. The objective of this study was to determine the genetic diversity of 65 garlic clones collected in Chile and introduced from different countries, by using RAPD (Random Amplified Polymorphic DNA. Fourty random primers of 10 mers generated a total of 398 bands with an 87% of polymorphism. Each primer amplified between two and 20 bands. The size of the fragments obtained fluctuated between 3200 and 369 bp. The results showed that the clones analyzed had a genetic similarity rate of 94%. In addition, 70% of them were clustered in one major group. However, in spite of that situation several clones have different agronomic characteristicsEl ajo (Allium sativum L. es una especie de propagación vegetativa, que presenta una amplia variabilidad morfológica. Los clones de esta especie tienen una adaptación específica a diferentes regiones agroclimáticas. El objetivo de este estudio fue determinar la diversidad genética existente en 65 clones de ajos colectados en Chile e introducidos desde diferentes países, utilizando RAPD (ADN Polimórfico Amplificado al Azar. Para esta evaluación se utilizaron 40 partidores de 10-mers. Los partidores generaron entre dos y 20 bandas, observándose un alto número de patrones con bandas múltiples. Los fragmentos generados difieren en su tamaño entre 3.200 y 369 pb. Los partidores generaron 398 bandas, de las cuales un 87% fueron polimórficas. El análisis estadístico realizado detectó una similitud genética alta, de un 94% entre las accesiones evaluadas, donde aproximadamente un 70% de los clones formaron un grupo homogéneo. Sin embargo, este grupo incluye clones que presentan diferentes características agronómicas

  19. Molecular epidemiology and in-vitro antifungal susceptibility of Aspergillus terreus species complex isolates in Delhi, India: evidence of genetic diversity by amplified fragment length polymorphism and microsatellite typing.

    Directory of Open Access Journals (Sweden)

    Shallu Kathuria

    Full Text Available Aspergillus terreus is emerging as an etiologic agent of invasive aspergillosis in immunocompromised individuals in several medical centers in the world. Infections due to A. terreus are of concern due to its resistance to amphotericin B, in vivo and in vitro, resulting in poor response to antifungal therapy and high mortality. Herein we examined a large collection of molecularly characterized, geographically diverse A. terreus isolates (n = 140 from clinical and environmental sources in India for the occurrence of cryptic A. terreus species. The population structure of the Indian A. terreus isolates and their association with those outside India was determined using microsatellite based typing (STR technique and Amplified Fragment Length Polymorphism analysis (AFLP. Additionally, in vitro antifungal susceptibility of A. terreus isolates was determined against 7 antifungals. Sequence analyses of the calmodulin locus identified the recently described cryptic species A. hortai, comprising 1.4% of Aspergillus section Terrei isolates cultured from cases of aspergilloma and probable invasive aspergillosis not reported previously. All the nine markers used for STR typing of A. terreus species complex proved to be highly polymorphic. The presence of high genetic diversity revealing 75 distinct genotypes among 101 Indian A. terreus isolates was similar to the marked heterogeneity noticed in the 47 global A. terreus population exhibiting 38 unique genotypes mainly among isolates from North America and Europe. Also, AFLP analysis showed distinct banding patterns for genotypically diverse A. terreus isolates. Furthermore, no correlation between a particular genotype and amphotericin B susceptibility was observed. Overall, 8% of the A. terreus isolates exhibited low MICs of amphotericin B. All the echinocandins and azoles (voriconazole, posaconazole and isavuconazole demonstrated high potency against all the isolates. The study emphasizes the need of

  20. DNA polymerase eta participates in the mutagenic bypass of adducts induced by benzo[a]pyrene diol epoxide in mammalian cells.

    Directory of Open Access Journals (Sweden)

    Alden C Klarer

    Full Text Available Y-family DNA-polymerases have larger active sites that can accommodate bulky DNA adducts allowing them to bypass these lesions during replication. One member, polymerase eta (pol eta, is specialized for the bypass of UV-induced thymidine-thymidine dimers, correctly inserting two adenines. Loss of pol eta function is the molecular basis for xeroderma pigmentosum (XP variant where the accumulation of mutations results in a dramatic increase in UV-induced skin cancers. Less is known about the role of pol eta in the bypass of other DNA adducts. A commonly encountered DNA adduct is that caused by benzo[a]pyrene diol epoxide (BPDE, the ultimate carcinogenic metabolite of the environmental chemical benzo[a]pyrene. Here, treatment of pol eta-deficient fibroblasts from humans and mice with BPDE resulted in a significant decrease in Hprt gene mutations. These studies in mammalian cells support a number of in vitro reports that purified pol eta has error-prone activity on plasmids with site-directed BPDE adducts. Sequencing the Hprt gene from this work shows that the majority of mutations are G>T transversions. These data suggest that pol eta has error-prone activity when bypassing BPDE-adducts. Understanding the basis of environmental carcinogen-derived mutations may enable prevention strategies to reduce such mutations with the intent to reduce the number of environmentally relevant cancers.

  1. Glycyrrhetinic acid and its derivatives as inhibitors of poly(ADP-ribosepolymerases 1 and 2, apurinic/apyrimidinic endonuclease 1 and DNA polymerase β

    Directory of Open Access Journals (Sweden)

    Salakhutdinov N. F.

    2012-06-01

    Full Text Available Aim. For strengthening the efficiency of monofunctional alkylating antineoplastic drugs it is important to lower the capacity of base excision repair (BER system which corrects the majority of DNA damages caused by these reagents. The objective was to create inhibitors of the key BER enzymes (PARP1, PARP2, DNA polymerase β, and APE1 by the directed modification of glycyrrhetinic acid (GA. Methods. Amides of GA were produced from the GA acetate by formation of the corresponding acyl chloride, amidation with the appropriate amine and subsequent deacylation. Small library of 2-cyano substituted derivatives of GA methyl esters was obtained by the structural modification of GA framework and carboxylic acid group. The inhibitory capacity of the compounds was estimated by comparison of the enzyme activities in specific tests in the presence of compounds versus their absence. Results. None of tested compounds inhibits PARP1 significantly. Unmodified GA and its morpholinic derivative were shown to be weak inhibitors of PARP2. The derivatives of GA containing keto-group in 11 triterpene framework were shown to be moderate inhibitors of pol β. Compound 3, containing 12-oxo-9(11-en moiety in the ring C, was shown to be a single inhibitor of APE1 among all compounds studied. Conclusions. The class of GA derivatives, selective pol β inhibitors, was found out. The selective inhibitor of APE1 and weak selective inhibitor of PARP2 were also revealed.

  2. Cooperative motion of a key positively charged residue and metal ions for DNA replication catalyzed by human DNA Polymerase-η.

    Science.gov (United States)

    Genna, Vito; Gaspari, Roberto; Dal Peraro, Matteo; De Vivo, Marco

    2016-04-01

    Trans-lesion synthesis polymerases, like DNA Polymerase-η (Pol-η), are essential for cell survival. Pol-η bypasses ultraviolet-induced DNA damages via a two-metal-ion mechanism that assures DNA strand elongation, with formation of the leaving group pyrophosphate (PPi). Recent structural and kinetics studies have shown that Pol-η function depends on the highly flexible and conserved Arg61 and, intriguingly, on a transient third ion resolved at the catalytic site, as lately observed in other nucleic acid-processing metalloenzymes. How these conserved structural features facilitate DNA replication, however, is still poorly understood. Through extended molecular dynamics and free energy simulations, we unravel a highly cooperative and dynamic mechanism for DNA elongation and repair, which is here described by an equilibrium ensemble of structures that connect the reactants to the products in Pol-η catalysis. We reveal that specific conformations of Arg61 help facilitate the recruitment of the incoming base and favor the proper formation of a pre-reactive complex in Pol-η for efficient DNA editing. Also, we show that a third transient metal ion, which acts concertedly with Arg61, serves as an exit shuttle for the leaving PPi. Finally, we discuss how this effective and cooperative mechanism for DNA repair may be shared by other DNA-repairing polymerases. PMID:26935581

  3. Screening of mammalian DNA polymerase and topoisomerase inhibitors from Garcinia mangostana L. and analysis of human cancer cell proliferation and apoptosis.

    Science.gov (United States)

    Onodera, Takefumi; Takenaka, Yukiko; Kozaki, Sachiko; Tanahashi, Takao; Mizushina, Yoshiyuki

    2016-03-01

    We purified and identified eight xanthones from mangosteen (Garcinia mangostana L.) and investigated whether these compounds inhibited the activities of mammalian DNA polymerases (Pols) and human DNA topoisomerases (Topos). β-Mangostin was the strongest inhibitor of both mammalian Pols and human Topos among the isolated xanthones, with 50% inhibitory concentration (IC50) values of 6.4-39.6 and 8.5-10 µM, respectively. Thermal transition analysis indicated that β-mangostin did not directly bind to double-stranded DNA, suggesting that this compound directly bound the enzyme protein rather than the DNA substrate. β-Mangostin showed the strongest suppression of human cervical cancer HeLa cell proliferation among the eight compounds tested, with a 50% lethal dose (LD50) of 27.2 µM. This compound halted cell cycle in S phase at 12-h treatment and induced apoptosis. These results suggest that decreased proliferation by β-mangostin may be a result of the inhibition of cellular Pols rather than Topos, and β-mangostin might be an anticancer chemotherapeutic agent. PMID:26781450

  4. A Point Mutation in DNA Polymerase β (POLB) Gene Is Associated with Increased Progesterone Receptor (PR) Expression and Intraperitoneal Metastasis in Gastric Cancer

    Science.gov (United States)

    Tan, Xiaohui; Wu, Xiaoling; Ren, Shuyang; Wang, Hongyi; Li, Zhongwu; Alshenawy, Weaam; Li, Wenmei; Cui, Jiantao; Luo, Guangbin; Siegel, Robert S.; Fu, Sidney W.; Lu, Youyong

    2016-01-01

    Increased expression of progesterone receptor (PR) has been reported in gastric cancer (GC). We have previously identified a functional T889C point mutation in DNA polymerase beta (POLB), a DNA repair gene in GC. To provide a detailed analysis of molecular changes associated with the mutation, human cDNA microarrays focusing on 18 signal transduction pathways were used to analyze differential gene expression profiles between GC tissues with T889C mutant in POLB gene and those with wild type. Among the differentially expressed genes, notably, PR was one of the significantly up-regulated genes in T889C mutant POLB tissues, which were subsequently confirmed in POLB gene transfected AGS cell line. Interestingly, patients with T889C mutation and PR positivity were associated with higher incidence of intraperitoneal metastasis (IM). In vitro studies indicate that PR expression was upregulated in AGS cell line when transfected with T889C mutant expression vector. Cotransfection of T889C mutant allele and PR gene induced cell migration in the cell line. These data demonstrated that T889C mutation-associated PR overexpression results in increased IM. Therefore, T889C mutation-associated PR overexpression may serve as a biomarker for an adverse prognosis for human GC.

  5. A remote palm domain residue of RB69 DNA polymerase is critical for enzyme activity and influences the conformation of the active site.

    Directory of Open Access Journals (Sweden)

    Agata Jacewicz

    Full Text Available Non-conserved amino acids that are far removed from the active site can sometimes have an unexpected effect on enzyme catalysis. We have investigated the effects of alanine replacement of residues distant from the active site of the replicative RB69 DNA polymerase, and identified a substitution in a weakly conserved palm residue (D714A, that renders the enzyme incapable of sustaining phage replication in vivo. D714, located several angstroms away from the active site, does not contact the DNA or the incoming dNTP, and our apoenzyme and ternary crystal structures of the Pol(D714A mutant demonstrate that D714A does not affect the overall structure of the protein. The structures reveal a conformational change of several amino acid side chains, which cascade out from the site of the substitution towards the catalytic center, substantially perturbing the geometry of the active site. Consistent with these structural observations, the mutant has a significantly reduced k pol for correct incorporation. We propose that the observed structural changes underlie the severe polymerization defect and thus D714 is a remote, non-catalytic residue that is nevertheless critical for maintaining an optimal active site conformation. This represents a striking example of an action-at-a-distance interaction.

  6. Resolution of DNA polymerase-α and primase activities from embryonic chicken brain and stimulation of chain initiation by a protein factor

    International Nuclear Information System (INIS)

    Reconstitution of an in vitro system capable of DNA chain initiation in an eukaryotic system has been attempted in several laboratories. They have previously reported the isolation of three distinct forms of DNA polymerase-α from IMR-32 cells and 9-day-old embryonic chicken brains (9ECB). DNA primase activity is eluted from a DE-23 column with one of these Pol-α's when a linear gradient is used. Irrespective of embryonic age, primase and a pol-α activity coelutes at 250 mM K-PO4 buffer. The complex containing Pol-α/primase activities has been analyzed further on a continuous velocity gradient of either sucrose or glycerol. A polymerase-α-free primase activity sediments at 4.5S whereas the other 50% is recovered with the pol-α activity which sediments at 11S. Compared to polydC and poly(dC dT), of the 9ECB primase catalyzed 3H-dXMP incorporation into polydT and M13 is very low. The template poly(dC, dT) is active only in the presence of ATP. They have purified a protein factor (NPF-1) from rat liver which stimulates primase-associated pol-α activities from IMR-32 cells. The NPF-1 also stimulates (2 to 3-fold) primase-associated pol-α activity (11S) from 9ECB

  7. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

    Science.gov (United States)

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

    2009-07-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex. PMID:19420065

  8. Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Caron, P.R.; Kushner, S.R.; Grossman, L.

    1985-08-01

    The bimodal-incision nature of the reaction of UV-irradiated DNA catalyzed by the Escherichia coli uvrABC protein complex potentially leads to excision of a 12- to 13-nucleotide-long damaged fragment. However, the oligonucleotide fragment containing the UV-induced pyrimidine dimer is not released under nondenaturing in vitro reaction conditions. Also, the uvrABC proteins are stably bound to the incised DNA and do not turn over after the incision event. In this communication it is shown that release of the damaged fragment from the parental uvrABC-incised DNA is dependent upon either chelating conditions or the simultaneous addition of the uvrD gene product (helicase II) and the polA gene product (DNA polymerase I) when polymerization of deoxynucleoside triphosphate substrates is concomitantly catalyzed. The product of this multiprotein-catalyzed series of reactions serves as a substrate for polynucleotide ligase, resulting in the restoration of the integrity of the strands of DNA. The addition of the uvrD protein to the incised DNA-uvrABC complex also results in turnover of the uvrC protein. It is suggested that the repair processes of incision, excision, resynthesis, and ligation are coordinately catalyzed by a complex of proteins in a ''repairosome'' configuration.

  9. Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex

    International Nuclear Information System (INIS)

    The bimodal-incision nature of the reaction of UV-irradiated DNA catalyzed by the Escherichia coli uvrABC protein complex potentially leads to excision of a 12- to 13-nucleotide-long damaged fragment. However, the oligonucleotide fragment containing the UV-induced pyrimidine dimer is not released under nondenaturing in vitro reaction conditions. Also, the uvrABC proteins are stably bound to the incised DNA and do not turn over after the incision event. In this communication it is shown that release of the damaged fragment from the parental uvrABC-incised DNA is dependent upon either chelating conditions or the simultaneous addition of the uvrD gene product (helicase II) and the polA gene product (DNA polymerase I) when polymerization of deoxynucleoside triphosphate substrates is concomitantly catalyzed. The product of this multiprotein-catalyzed series of reactions serves as a substrate for polynucleotide ligase, resulting in the restoration of the integrity of the strands of DNA. The addition of the uvrD protein to the incised DNA-uvrABC complex also results in turnover of the uvrC protein. It is suggested that the repair processes of incision, excision, resynthesis, and ligation are coordinately catalyzed by a complex of proteins in a ''repairosome'' configuration

  10. DNA polymerase X from Deinococcus radiodurans implicated in bacterial tolerance to DNA damage is characterized as a short patch base excision repair polymerase.

    Science.gov (United States)

    Khairnar, Nivedita P; Misra, Hari S

    2009-09-01

    The Deinococcus radiodurans R1 genome encodes an X-family DNA repair polymerase homologous to eukaryotic DNA polymerase beta. The recombinant deinococcal polymerase X (PolX) purified from transgenic Escherichia coli showed deoxynucleotidyltransferase activity. Unlike the Klenow fragment of E. coli, this enzyme showed short patch DNA synthesis activity on heteropolymeric DNA substrate. The recombinant enzyme showed 5'-deoxyribose phosphate (5'-dRP) lyase activity and base excision repair function in vitro, with the help of externally supplied glycosylase and AP endonuclease functions. A polX disruption mutant of D. radiodurans expressing 5'-dRP lyase and a truncated polymerase domain was comparatively less sensitive to gamma-radiation than a polX deletion mutant. Both mutants showed higher sensitivity to hydrogen peroxide. Excision repair mutants of E. coli expressing this polymerase showed functional complementation of UV sensitivity. These results suggest the involvement of deinococcal polymerase X in DNA-damage tolerance of D. radiodurans, possibly by contributing to DNA double-strand break repair and base excision repair. PMID:19542005

  11. The S229L Colon Tumor-associated Variant of DNA Polymerase β Induces Cellular Transformation as a Result of Decreased Polymerization Efficiency*

    Science.gov (United States)

    Nemec, Antonia A.; Murphy, Drew L.; Donigan, Katherine A.; Sweasy, Joann B.

    2014-01-01

    DNA polymerase β (Pol β) plays a key role in base excision repair (BER) by filling in small gaps that are generated after base adducts are excised from the DNA. Pol β is mutated in a large number of colorectal tumors, and these mutations may drive carcinogenesis. In the present study, we wished to determine whether the S229L somatic Pol β variant identified in a stage 3 colorectal tumor is a driver of carcinogenesis. We show that S229L does not possess any defects in binding to either DNA or nucleotides compared with the WT enzyme, but exhibits a significant loss of polymerization efficiency, largely due to an 8-fold decrease in the polymerization rate. S229L participates in BER, but due to its lower catalytic rate, does so more slowly than WT. Expression of S229L in mammalian cells induces the accumulation of BER intermediate substrates, chromosomal aberrations, and cellular transformation. Our results are consistent with the interpretation that S229L is a driver of carcinogenesis, likely as a consequence of its slow polymerization activity during BER in vivo. PMID:24668809

  12. Intestinal carriage of Campylobacter jejuni and Campylobacter coli among cattle from South-western Norway and comparative genotyping of bovine and human isolates by amplified-fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Vardund T

    2006-06-01

    Full Text Available Abstract In a survey conducted in 1999–2001, the carriage of thermotolerant Campylobacters in cattle was investigated, and the genetic diversity of C. jejuni within one herd was examined and compared with human isolates. C. jejuni, C. coli and other thermotolerant Campylobacter spp. were isolated from intestinal contents from 26%, 3% and 2% of 804 cattle, respectively. The carriage rate was higher in calves (46% than in adults (29%. Twenty-nine C. jejuni isolates from one herd and 31 human isolates from the study area were genotyped with amplified-fragment length polymorphism (AFLP. Eighty-three % of the bovine isolates fell into three distinct clusters with 95–100% similarity, persistent in the herd for 5–10 months. Among human isolates, 58% showed >90% similarity with bovine isolates. The results show that cattle are a significant and stable reservoir for C. jejuni in the study area. Transmission between individuals within the herd may be sufficient to maintain a steady C. jejuni population independent of environmental influx. The results of this study have provided new information on C. jejuni and C. coli transmission, and also on the carriage in cattle, genotypes stability and similarity between bovine and human isolates.

  13. Evidence of genotypic diversity among Candida auris isolates by multilocus sequence typing, matrix-assisted laser desorption ionization time-of-flight mass spectrometry and amplified fragment length polymorphism.

    Science.gov (United States)

    Prakash, A; Sharma, C; Singh, A; Kumar Singh, P; Kumar, A; Hagen, F; Govender, N P; Colombo, A L; Meis, J F; Chowdhary, A

    2016-03-01

    Candida auris is a multidrug-resistant nosocomial bloodstream pathogen that has been reported from Asian countries and South Africa. Herein, we studied the population structure and genetic relatedness among 104 global C. auris isolates from India, South Africa and Brazil using multilocus sequence typing (MLST), amplified fragment length polymorphism (AFLP) fingerprinting and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). RPB1, RPB2 and internal transcribed spacer (ITS) and D1/D2 regions of the ribosomal DNA were sequenced for MLST. Further, genetic variation and proteomic assessment was carried out using AFLP and MALDI-TOF MS, respectively. Both MLST and AFLP typing clearly demarcated two major clusters comprising Indian and Brazilian isolates. However, the South African isolates were randomly distributed, suggesting different genotypes. MALDI-TOF MS spectral profiling also revealed evidence of geographical clustering but did not correlate fully with the genotyping methods. Notably, overall the population structure of C. auris showed evidence of geographical clustering by all the three techniques analysed. Antifungal susceptibility testing by the CLSI microbroth dilution method revealed that fluconazole had limited activity against 87% of isolates (MIC90, 64 mg/L). Also, MIC90 of AMB was 4 mg/L. Candida auris is emerging as an important yeast pathogen globally and requires reproducible laboratory methods for identification and typing. Evaluation of MALDI-TOF MS as a typing method for this yeast is warranted. PMID:26548511

  14. Variable lipoprotein haemagglutinin (vlhA) gene sequence typing of mainly Dutch Mycoplasma synoviae isolates: comparison with vlhA sequences from Genbank and with amplified fragment length polymorphism analysis.

    Science.gov (United States)

    Dijkman, R; Feberwee, A; Landman, W J M

    2014-01-01

    Molecular typing techniques with sufficient discriminatory power are required to better understand the transmission of Mycoplasma synoviae, a poultry pathogen with increasing clinical and economic relevance. A promising molecular technique is polymerase chain reaction and subsequent sequencing based on the conserved 5' region of the M. synoviae variable lipoprotein and haemagglutinin (vlhA) gene. This technique was used for genotyping 27 mainly Dutch M. synoviae isolates from different organs of various categories of poultry housed on different farms and collected during a period of 10 years. The obtained vlhA sequences were compared with those of M. synoviae strains from Genbank and data obtained by amplified fragment length polymorphism (AFLP). Grouping based on 100% similarity revealed nine genotypes. Some isolates had identical vlhA gene sequences although they originated from different geographical areas, different years and organs. AFLP analysis results largely confirmed the results obtained by vlhA sequence typing. Our findings raise concern regarding the discriminatory power of these techniques for its use in molecular epidemiology of Dutch M. synoviae isolates and for the differentiation between M. synoviae vaccine strains and field isolates, and indicate that molecular typing based on additional markers should be considered. PMID:25189763

  15. Random Amplified Polymorphic DNA (RAPD) Analyses among Hibiscus cannabinus and Related Species%红麻及其近缘种的RAPD分析

    Institute of Scientific and Technical Information of China (English)

    郭安平; 周鹏; 粟建光

    2002-01-01

    利用随机扩增多态性DNA(RAPD)技术分析了木槿属(Hibiscus)Furcaria组中纤维作物红麻(H.canabinus)及其6个近缘种植物的25份材料.用筛选出的16个引物扩增出192个RAPD条带,它们表现出丰富的多态性.根据得到的RAPD指纹图谱,计算其Nei氏相似系数和遗传距离,并构建了它们的系统树.结果表明:25份材料可划分为7个组,H.penduriformis和H.calyphyllus两个种为一组;红麻种分为两个组,一组为栽培品种,另1组为野生型材料;其余4个种各成为1组.玫瑰麻(H.sabdariffa)和金线吊芙蓉(H.radiatus)的关系较近,而且两者与红麻的亲缘关系也较近,而其它四个种与红麻的关系较远.H.trionum与其它六个种的关系较远.%RAPDs were used to study the relationships among species in Hibiscus sect. Furcaria.Twenty-five accessions of 7 species were examined. Sixteen primers of arbitrary sequences were screened from 80 primers for DNA amplification. A total of 192 bands were generated, of which 149 bands were polymorphic markers. Dendrogram was constructed using Nei's genetic similarity value and MINTS program. The result showed that 25 accessions were clustered in 7 clades, H.penduriformis and H. calyphyllus formed a clade, and 15 accessions of H. cannabinus were clustered in two clades, one being the cultivars, and the other, the wild type materials. The rest 4 species formed 4 individual clades. The most parsimonious dendrogram shows that H. radiatus is closely related to H. sabdariffa. The closely related species to the cultivars of H. cannabinus are H. sabdariffa and H. radiatus, whereas H. trionum appears to be highly diverged from all the other taxa.

  16. Use of single-enzyme amplified fragment length polymorphism for typing Clostridium perfringens isolated from diarrheic piglets Uso do polimorfismo do comprimento de fragmentos amplificados para tipagem de Clostridium perfringens isolados de suínos com diarréia

    OpenAIRE

    Luciane Tieko Shinya; Maria Regina Baccaro; Andrea Micke Moreno

    2006-01-01

    Clostridium perfringens is an important pathogen in human and veterinary medicine. In swine, the agent is responsible for necrotic enteritis and enterotoxemia characterized by diarrhea, weight loss, delayed development and, in some cases, death. In the present study amplified fragment length polymorphism analyses (AFLP) was used to characterize 54 C. perfringens strains isolated from swine presenting diarrhea. Analysis of the results showed 29 distinct profiles with discriminatory index equal...

  17. AFLP (Amplified Fragment Length Polymorphism:増幅断片長多型)解析による3倍性ギンブナ(Carassius auratus langsdorfi)に特徴的なゲノムマーカーの探索

    OpenAIRE

    高瀬, 有加里; 藤谷, 英男; 村上, 賢; タカセ, ユカリ; フジタニ, ヒデオ; ムラカミ, マサル; Yukari, TAKASE; Hideo, Fujitani; Masaru, MURAKAMI

    2007-01-01

    The Japanese silver crucian carp (so-called ginbuna, Carassius auratus langsdrofi) has two reproduction systems; one is a sexual reproduction practiced by diploid individuals and the other is gynogenetic reproduction by triploid individuals. In this study, AFLP (Amplified Fragment Length Polymorphism) analysis was carried out to isolate and characterize genomic DNA markers for triploid ginbuna, as a step toward revealing the genomic makeup and origin of triploid ginbuna. Two valuable DNA mark...

  18. Characterization of DNA polymerase β from Danio rerio by overexpression in E. coli using the in vivo/in vitro compatible pIVEX plasmid

    OpenAIRE

    Ishikawa Mitsuru; Yamazaki Naoshi; Ishido Tomomi; Hirano Ken

    2011-01-01

    Abstract Background Eukaryotic DNA polymerase β (pol β), the polymerase thought to be responsible for DNA repair synthesis, has been extensively characterized in rats and humans. However, pol β has not been purified or enzymatically characterized from the model fish species Danio rerio (zebrafish). We used the in vitro/in vivo dual expression system plasmid, pIVEX, to express Danio rerio pol β (Danio pol β) for biochemical characterization. Results Danio pol β encoded by the in vitro/in vivo-...

  19. 9种芦荟亲缘关系的RAPD分析%The Analysis of Phylogenetic Relationship among Nine Aloesby Random Amplified Polymorphic DNA

    Institute of Scientific and Technical Information of China (English)

    侯和胜; 刘洪艳; 佟少明

    2001-01-01

    应用40个引物对中国芦荟(Aloe vera var. chinese),鹿角芦荟库拉索芦荟(Aloe barbadensis L.),木立芦荟皂质芦荟(Aloe saponaria),Aloe vera hybrid 1 ,Aloe vera hybrid 2,皮具刺芦荟朱旺纳芦荟(Aloe juvenna)等9种芦荟的亲缘关系进行了初步分析。其中18个引物的扩增结果具有非常明显的品系间多态性。将结果以Phylip软件包,由程序Neighbor-Joining和UPGMA,分别构建聚类图。结果表明中国芦荟,Aloe vera hybrid 1和皮具刺芦荟具有较近的亲缘。鹿角芦荟,木立芦荟和库拉索芦荟具有较近的亲缘,其中鹿角芦荟,木立芦荟的遗传距离特别近,可认为是同一品种的变种,由于形态上的一些分化而出现了不同的命名。皂质芦荟,Aloe vera hybrid2 的亲缘关系较近。朱旺纳芦荟与各品种之间都保持着相当远的遗传距离,原因可能是该品种未广泛栽培,从而还保持着某些自己的遗传特性。%The phylogenetic relationship of nine Aloes,including Aloe vera var. chinese, Aloe arborescens var. natalensis bgr. ,Aloe barbadensis L. ,Aloe arboreseens , Aloe saponaria , Aloe vera hybrid 1, Aloe vera hybrid 2, Aloe aculeata and Aloe juvenna was investigated by RAPD analysis. 18 single primers were selected out of 40 random primers. The amplified fragments of 18 primers were analyzed by the Phylip software packet, and the phylogenetic trees were constructed by UPGMA method and N-J method respectively. The results indicated as the following: Aloe vera var. chinese, Aloe vera hybrid 1 and Aloe aculeata have close phylogenetic relationship. Aloe arborescens var. natalensis bgr., Aloe barbadensis L. and Aloe arborescens have close phylogenetic relationship. The phylogenetic relationship between Aloe arborescens and Aloe arborescens was much closer. Aloe saponaria and Aloe vera hybrid 2 have close phylogenetic relationship too. The phylogenetic relationship of Aloe juvenna was far away from the others.

  20. Evidence of sibling species in brown planthopper, Nilaparvata lugens complex, detected from long primer random amplified polymorphic DNA (LP-RAPD) fingerprints

    International Nuclear Information System (INIS)

    The brown planthopper, N. lugens (Staal), has become a serious threat to rice production throughout tropical and sub-tropical Asia with the spread of high yielding rice varieties and intensive culture practices since about 1970. It causes 'hopperburn' and complete wilting and drying of rice plants. Another N. lugens population was found to infest a weed grass, Leersia hexandra that grows abundantly in canals near irrigated rice fields in southeastern Asia. The Leersia infesting N. lugens population fails to survive on rice plants. Conversely, rice infesting N. lugens does not thrive on Leersia. Two sympatric populations of N. lugens, one from rice and other from L. hexandra were collected from five locations in Malaysia. The locations were University Putra Malaysia (UPM), Tanjung Karang (TK), Melaka (MK), Perak (PK) and Sabah (SB). An out group, N. bakeri was also collected from Cameron Highlands (CH). The insects used for long primer RAPD analysis were tested for esterase activity on a simple filter paper using the method reported by Pasteur and Georghiou. DNA extraction and PCR protocols were followed as described by Gillings and Holley. Four Long RAPD primers were used in this study. The primer, pehA no.6, 5'ATCGCACTTGATGCGCAGGCCGTT was diagnostic and the other three yielded the strongest bands and showed polymorphisms in rice and Leersia populations of N. lugens. Cluster analysis based on genetic distance revealed that the 10 brown planthopper populations and an out group, N. bakeri were divided into three major clusters. N. bakeri formed the most isolated cluster from populations of either rice or Leersia infesting populations of N. lugens. The rice infesting populations of five localities clustered together as a group. On the other hand Leersia infesting populations of the same localities formed another distinct cluster. An analysis of molecular variance was also performed and confirmed the differentiation into two groups. One RAPD band that was obtained

  1. Simultaneous disruption of two DNA polymerases, Polη and Polζ, in Avian DT40 cells unmasks the role of Polη in cellular response to various DNA lesions.

    Directory of Open Access Journals (Sweden)

    Kouji Hirota

    2010-10-01

    Full Text Available Replicative DNA polymerases are frequently stalled by DNA lesions. The resulting replication blockage is released by homologous recombination (HR and translesion DNA synthesis (TLS. TLS employs specialized TLS polymerases to bypass DNA lesions. We provide striking in vivo evidence of the cooperation between DNA polymerase η, which is mutated in the variant form of the cancer predisposition disorder xeroderma pigmentosum (XP-V, and DNA polymerase ζ by generating POLη(-/-/POLζ(-/- cells from the chicken DT40 cell line. POLζ(-/- cells are hypersensitive to a very wide range of DNA damaging agents, whereas XP-V cells exhibit moderate sensitivity to ultraviolet light (UV only in the presence of caffeine treatment and exhibit no significant sensitivity to any other damaging agents. It is therefore widely believed that Polη plays a very specific role in cellular tolerance to UV-induced DNA damage. The evidence we present challenges this assumption. The phenotypic analysis of POLη(-/-/POLζ(-/- cells shows that, unexpectedly, the loss of Polη significantly rescued all mutant phenotypes of POLζ(-/- cells and results in the restoration of the DNA damage tolerance by a backup pathway including HR. Taken together, Polη contributes to a much wide range of TLS events than had been predicted by the phenotype of XP-V cells.

  2. Cadmium treatment suppresses DNA polymerase δ catalytic subunit gene expression by acting on the p53 and Sp1 regulatory axis.

    Science.gov (United States)

    Antoniali, Giulia; Marcuzzi, Federica; Casarano, Elena; Tell, Gianluca

    2015-11-01

    Cadmium (Cd) is a carcinogenic and neurotoxic environmental pollutant. Among the proposed mechanisms for Cd toxic effects, its ability to promote oxidative stress and to inhibit, in vitro, the activities of some Base Excision DNA Repair (BER) enzymes, such as hOGG1, XRCC1 and APE1, have been already established. However, the molecular mechanisms at the basis of these processes are largely unknown especially at sub-lethal doses of Cd and no information is available on the effect of Cd on the expression levels of BER enzymes. Here, we show that non-toxic treatment of neuronal cell lines, with pro-mitogenic doses of Cd, promotes a significant time- and dose-dependent down-regulation of DNA polymerase δ (POLD1) expression through a transcriptional mechanism with a modest effect on Polβ, XRCC1 and APE1. We further elucidated that the observed transcriptional repression on Polδ is acted by through competition by activated p53 on Sp1 at POLD1 promoter and by a squelching effect. We further proved the positive effect of Sp1 not only on POLD1 expression but also on Polβ, XRCC1 and APE1 expression, suggesting that Sp1 has pleiotropic effects on the whole BER pathway. Our results indicated that Cd-mediated impairment of BER pathway, besides acting on the enzymatic functions of some key proteins, is also exerted at the gene expression level of Polδ by acting on the p53-Sp1 regulatory axis. These data may explain not only the Cd-induced neurotoxic effects but also the potential carcinogenicity of this heavy metal. PMID:26519823

  3. Photoaffinity labeling of the thymidine triphosphate binding domain in Escherichia coli DNA polymerase I: identification of histidine-881 as the site of cross-linking

    International Nuclear Information System (INIS)

    Using the technique of ultraviolet-mediated cross-linking of substrate deoxynucleoside triphosphates (dNTPs) to their acceptor site, the authors have labeled the Klenow fragment of Escherichia coli DNA polymerase I (Pol I) with [α-32P]dTTP. Covalent cross-linking of [α-32P]dTTP to the Klenow fragment is shown to be at the substrate binding site by the following criteria; (a) the cross-linking reaction requires dTTP in its metal chelate form; (b) dTTP is readily competed out by other dNTPs as well as by substrate binding site directed reagents; (c) labeling with dTTP occurs at a single site as judged by peptide mapping. Under optimal conditions, a modification of approximately 20% of the enzyme was achieved. Following tryptic digestion of the [α-32P]dTTP-labeled Klenow fragment, reverse-phase high-performance liquid chromatography demonstrated that 80% of the radioactivity was contained within a single peptide. The amino acid composition and sequence of this peptide identified it as the peptide spanning amino acid residues 876-890 in the primary sequence of E. coli Pol I. Chymotrypsin and Staphylococcus aureus V8 protease digestion of the labeled tryptic peptide in each case yielded a single smaller fragment that was radioactive. Amino acid analysis and sequencing of these small peptides further narrowed the dTTP cross-linking site to within the region spanning residues 876-883. They concluded that histidine-881 is the primary attachment site for dTTP in E. coli DNA Pol I, since during amino acid sequencing analysis of all three radioactive peptides loss of the histidine residue at the expected cycle is observed

  4. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Functional mapping of the fission yeast DNA polymerase δ B-subunit Cdc1 by site-directed and random pentapeptide insertion mutagenesis

    Directory of Open Access Journals (Sweden)

    Gray Fiona C

    2009-08-01

    Full Text Available Abstract Background DNA polymerase δ plays an essential role in chromosomal DNA replication in eukaryotic cells, being responsible for synthesising the bulk of the lagging strand. In fission yeast, Pol δ is a heterotetrameric enzyme comprising four evolutionarily well-conserved proteins: the catalytic subunit Pol3 and three smaller subunits Cdc1, Cdc27 and Cdm1. Pol3 binds directly to the B-subunit, Cdc1, which in turn binds the C-subunit, Cdc27. Human Pol δ comprises the same four subunits, and the crystal structure was recently reported of a complex of human p50 and the N-terminal domain of p66, the human orthologues of Cdc1 and Cdc27, respectively. Results To gain insights into the structure and function of Cdc1, random and directed mutagenesis techniques were used to create a collection of thirty alleles encoding mutant Cdc1 proteins. Each allele was tested for function in fission yeast and for binding of the altered protein to Pol3 and Cdc27 using the two-hybrid system. Additionally, the locations of the amino acid changes in each protein were mapped onto the three-dimensional structure of human p50. The results obtained from these studies identify amino acid residues and regions within the Cdc1 protein that are essential for interaction with Pol3 and Cdc27 and for in vivo function. Mutations specifically defective in Pol3-Cdc1 interactions allow the identification of a possible Pol3 binding surface on Cdc1. Conclusion In the absence of a three-dimensional structure of the entire Pol δ complex, the results of this study highlight regions in Cdc1 that are vital for protein function in vivo and provide valuable clues to possible protein-protein interaction surfaces on the Cdc1 protein that will be important targets for further study.

  6. Error-Prone Translesion DNA Synthesis by Escherichia coli DNA Polymerase IV (DinB on Templates Containing 1,2-dihydro-2-oxoadenine

    Directory of Open Access Journals (Sweden)

    Masaki Hori

    2010-01-01

    Full Text Available Escherichia coli DNA polymerase IV (Pol IV is involved in bypass replication of damaged bases in DNA. Reactive oxygen species (ROS are generated continuously during normal metabolism and as a result of exogenous stress such as ionizing radiation. ROS induce various kinds of base damage in DNA. It is important to examine whether Pol IV is able to bypass oxidatively damaged bases. In this study, recombinant Pol IV was incubated with oligonucleotides containing thymine glycol (dTg, 5-formyluracil (5-fodU, 5-hydroxymethyluracil (5-hmdU, 7,8-dihydro-8-oxoguanine (8-oxodG and 1,2-dihydro-2-oxoadenine (2-oxodA. Primer extension assays revealed that Pol IV preferred to insert dATP opposite 5-fodU and 5-hmdU, while it inefficiently inserted nucleotides opposite dTg. Pol IV inserted dCTP and dATP opposite 8-oxodG, while the ability was low. It inserted dCTP more effectively than dTTP opposite 2-oxodA. Pol IV's ability to bypass these lesions decreased in the order: 2-oxodA > 5-fodU~5-hmdU > 8-oxodG > dTg. The fact that Pol IV preferred to insert dCTP opposite 2-oxodA suggests the mutagenic potential of 2-oxodA leading to A:T→G:C transitions. Hydrogen peroxide caused an ~2-fold increase in A:T→G:C mutations in E. coli, while the increase was significantly greater in E. coli overexpressing Pol IV. These results indicate that Pol IV may be involved in ROS-enhanced A:T→G:C mutations.

  7. Evidence for interplay among yeast replicative DNA polymerases alpha, delta and epsilon from studies of exonuclease and polymerase active site mutations

    Directory of Open Access Journals (Sweden)

    Pavlov Youri I

    2004-05-01

    Full Text Available Abstract Background DNA polymerase ε (Pol ε is essential for S-phase replication, DNA damage repair and checkpoint control in yeast. A pol2-Y831A mutation leading to a tyrosine to alanine change in the Pol ε active site does not cause growth defects and confers a mutator phenotype that is normally subtle but strong in a mismatch repair-deficient strain. Here we investigate the mechanism responsible for the mutator effect. Results Purified four-subunit Y831A Pol ε turns over more deoxynucleoside triphosphates to deoxynucleoside monophosphates than does wild-type Pol ε, suggesting altered coordination between the polymerase and exonuclease active sites. The pol2-Y831A mutation suppresses the mutator effect of the pol2-4 mutation in the exonuclease active site that abolishes proofreading by Pol ε, as measured in haploid strain with the pol2-Y831A,4 double mutation. Analysis of mutation rates in diploid strains reveals that the pol2-Y831A allele is recessive to pol2-4. In addition, the mutation rates of strains with the pol2-4 mutation in combination with active site mutator mutations in Pol δ and Pol α suggest that Pol ε may proofread certain errors made by Pol α and Pol δ during replication in vivo. Conclusions Our data suggest that Y831A replacement in Pol ε reduces replication fidelity and its participation in chromosomal replication, but without eliminating an additional function that is essential for viability. This suggests that other polymerases can substitute for certain functions of polymerase ε.

  8. DNA polymerases κ and ζ cooperatively perform mutagenic translesion synthesis of the C8-2'-deoxyguanosine adduct of the dietary mutagen IQ in human cells.

    Science.gov (United States)

    Bose, Arindam; Pande, Paritosh; Jasti, Vijay P; Millsap, Amy D; Hawkins, Edward K; Rizzo, Carmelo J; Basu, Ashis K

    2015-09-30

    The roles of translesion synthesis (TLS) DNA polymerases in bypassing the C8-2'-deoxyguanosine adduct (dG-C8-IQ) formed by 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a highly mutagenic and carcinogenic heterocyclic amine found in cooked meats, were investigated. Three plasmid vectors containing the dG-C8-IQ adduct at the G1-, G2- or G3-positions of the NarI site (5'-G1G2CG3CC-3') were replicated in HEK293T cells. Fifty percent of the progeny from the G3 construct were mutants, largely G→T, compared to 18% and 24% from the G1 and G2 constructs, respectively. Mutation frequency (MF) of dG-C8-IQ was reduced by 38-67% upon siRNA knockdown of pol κ, whereas it was increased by 10-24% in pol η knockdown cells. When pol κ and pol ζ were simultaneously knocked down, MF of the G1 and G3 constructs was reduced from 18% and 50%, respectively, to <3%, whereas it was reduced from 24% to <1% in the G2 construct. In vitro TLS using yeast pol ζ showed that it can extend G3*:A pair more efficiently than G3*:C pair, but it is inefficient at nucleotide incorporation opposite dG-C8-IQ. We conclude that pol κ and pol ζ cooperatively carry out the majority of the error-prone TLS of dG-C8-IQ, whereas pol η is involved primarily in its error-free bypass. PMID:26220181

  9. Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis

    Directory of Open Access Journals (Sweden)

    Ramalho-Ortigão JM

    2001-01-01

    Full Text Available Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST. We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V. braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

  10. 从花斑糠疹皮损分离的马拉色菌随机扩增多态性DNA研究%Random amplified polymorphic DNA analysis of Malassezia isolates from cutaneous lesions of pityriasis versicolor

    Institute of Scientific and Technical Information of China (English)

    谢震; 冉玉平; 刘瑞; 杨如学; 李志瑜; 代亚玲

    2009-01-01

    目的 用随机扩增多态性DNA方法 研究分离自花斑糠疹的马拉色菌种间和株间差异,了解随机扩增多态性DNA分析(RAPD)与生理生化方法 在菌种分型上的差异及菌株DNA型别和菌种间的关系.方法 用氯化苄法提取马拉色菌标准株(10株7个种)和临床分离株(47株)的基因组DNA,其中临床株分离自34例花斑糠疹患者,经形态学和生理生化方法 鉴定为5个种(合轴马拉色菌、糠秕马拉色菌、钝形马拉色菌、球形马拉色菌、限制马拉色菌),用4种随机引物(S22、SS24、S25、S33)对菌株DNA做PCR随机扩增,NTSYS软件自动生成树状分支图.结果 绝大多数标本均可被4种引物扩增而获得清晰条带,其中2种引物(S22、S24)的条带更为稳定、清晰.共82条DNA片段被扩增,所有菌株均可见种间和株间多态性.有4例患者皮损同时分离出不同种的菌株显示遗传相似性高,在树状图中归入一类.结论 来自同一宿主的不同菌株遗传趋同现象提示马拉色菌的种特异性、菌种演化与宿主间存在密切关系.%Objective To investigate intraspecific and interspecific variation within Malassezia iso-lates from patients with pityriasis versicolor by random amplified polymorphic DNA (RAPD) analysis, to learn the difference between RAPD analysis and physiological and biochemical methods in the typing of Malassezia species, and to explore the relationship between RAPD patterns and Malassezia species. Methods A total of 47 Malassezia isolates were obtained from 34 patients with pityriasis versicolor, and they were classified into 5 species by morphological, physiological and biochemical features, I.e., M. Fin'fur, M. Obtusa, M. Globosa, M. Restricta and M. Sympodialis. Genomic DNA was extracted from the 47 clinical isolates and 10 reference strains (including 7 species) of Malassezia. PCR was performed using 4 random primers including S22, S24, S25 and S33. RAPD patterns were analyzed by NTSYS

  11. Replication Fidelity of Escherichia Coli DNA Polymerase III Holoenzyme in Vitro and Repair of Heteroduplex DNA with Multibase Loops in Vivo.

    Science.gov (United States)

    Carraway, Margaretha Bernardina Maria

    The genetic integrity of an organism is maintained by accurate replication and correction of asymmetry in the DNA. To study replication fidelity, single-stranded plasmid DNA containing the mnt gene, was replicated in vitro with DNA polymerase III holoenzyme by extension of a complimentary annealed primer. On this plasmid the mnt region is fused to a promoterless tet gene. Accurate replication of mnt generates a tetracycline sensitive phenotype, errors in replication are identified by mutation to tetracycline resistance. Mismatch repair deficient mutH cells were transformed to ampicillin-resistance by replicated circles. The mutations in mnt were identified by replica plating and selecting for tetracycline resistant cells. The mutation rate was 1 in 100,000. DNA sequence analysis of 65 isolates identified 33 single base changes, 20 deletions and 12 concurrent deletions and insertions. Except for the deletions and substitutions, identical mutations were isolated in vivo in mismatch repair deficient cells. Therefore, in vitro replication errors resemble those isolated in vivo. Heteroduplexes with loops occur as a result of replication or recombination. To examine if E. coli converts these molecules to a homoduplex via DNA repair, plasmid heteroduplexes with loops of 5, 7, 9, 192, 410 or 514 bases in mnt were constructed. Conversion was examined by tranforming the plasmid heteroduplexes into E. coli lysogens which had a non-functional mnt gene fused to a promoterless lac gene. Repair of the heteroduplex to wild type yields white/tetracycline sensitive colonies; repair to the mutant yields red/tetracycline resistant colonies and no repair results in red-white (mixed)/tetracycline resistant colonies. No significant change in colony color distribution was observed when the heteroduplexes were transformed into wild type and the following mutant strains: pcnB, mutS, recA, recD, recBC sbcBC, recF, recJ, recR, recN, recO, recG ruvC, ruvB, lexA3, lexA51, uvrA, recBC sbcBC rec

  12. Effects of Twelve Germline Missense Variations on DNA Lesion and G-Quadruplex Bypass Activities of Human DNA Polymerase REV1.

    Science.gov (United States)

    Yeom, Mina; Kim, In-Hyeok; Kim, Jae-Kwon; Kang, KyeongJin; Eoff, Robert L; Guengerich, F Peter; Choi, Jeong-Yun

    2016-03-21

    The Y-family DNA polymerase REV1 is involved in replicative bypass of damaged DNA and G-quadruplex (G4) DNA. In addition to a scaffolding role in the replicative bypass, REV1 acts in a catalytic role as a deoxycytidyl transferase opposite some replication stall sites, e.g., apurinic/apyrimidinic (AP) sites, N(2)-guanyl lesions, and G4 sites. We characterized the biochemical properties of 12 reported germline missense variants of human REV1, including the N373S variant associated with high risk of cervical cancer, using the recombinant REV1 (residues 330-833) proteins and DNA templates containing a G, AP site, N(2)-CH2(2-naphthyl)G (N(2)-NaphG), or G4. In steady-state kinetic analyses, the F427L, R434Q, M656V, D700N, R704Q, and P831L variants displayed 2- to 8-fold decreases in kcat/Km for dCTP insertion opposite all four templates, compared to that of wild-type, while the N373S, M407L, and N497S showed 2- to 3-fold increases with all four and the former three or two templates, respectively. The F427L, R434Q, M656V, and R704Q variants also had 2- to 3-fold lower binding affinities to DNA substrates containing G, an AP site, and/or N(2)-NaphG than wild-type. Distinctively, the N373S variant had a 3-fold higher binding affinity to G4 DNA than the wild-type, as well as a 2-fold higher catalytic activity opposite the first tetrad G, suggesting a facilitating effect of this variation on replication of G4 DNA sequences in certain human papillomavirus genomes. Our results suggest that the catalytic function of REV1 is moderately or slightly altered by at least nine genetic variations, and the G4 DNA processing function of REV1 is slightly enhanced by the N373S variation, which might provide the possibility that certain germline missense REV1 variations affect the individual susceptibility to carcinogenesis by modifying the capability of REV1 for replicative bypass past DNA lesions and G4 motifs derived from chemical and viral carcinogens. PMID:26914252

  13. Structure-Function Relationships in Miscoding by Sulfolobus solfataricus DNA Polymerase Dpo4: GUANINE N2,N2-DIMETHYL SUBSTITUTION PRODUCES INACTIVE AND MISCODING POLYMERASE COMPLEXES

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Huidong; Eoff, Robert L.; Kozekov, Ivan D.; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter; (Vanderbilt)

    2009-08-13

    Previous work has shown that Y-family DNA polymerases tolerate large DNA adducts, but a substantial decrease in catalytic efficiency and fidelity occurs during bypass of N{sup 2},N{sup 2}-dimethyl (Me{sub 2})-substituted guanine (N{sup 2},N{sup 2}-Me{sub 2}G), in contrast to a single methyl substitution. Therefore, it is unclear why the addition of two methyl groups is so disruptive. The presence of N{sup 2},N{sup 2}-Me{sub 2}G lowered the catalytic efficiency of the model enzyme Sulfolobus solfataricus Dpo4 16,000-fold. Dpo4 inserted dNTPs almost at random during bypass of N{sup 2},N{sup 2}-Me{sub 2}G, and much of the enzyme was kinetically trapped by an inactive ternary complex when N{sup 2},N{sup 2}-Me{sub 2}G was present, as judged by a reduced burst amplitude (5% of total enzyme) and kinetic modeling. One crystal structure of Dpo4 with a primer having a 3{prime}-terminal dideoxycytosine (Cdd) opposite template N{sup 2},N{sup 2}-Me{sub 2}G in a post-insertion position showed Cdd folded back into the minor groove, as a catalytically incompetent complex. A second crystal had two unique orientations for the primer terminal Cdd as follows: (i) flipped into the minor groove and (ii) a long pairing with N{sup 2},N{sup 2}-Me{sub 2}G in which one hydrogen bond exists between the O-2 atom of Cdd and the N-1 atom of N{sup 2},N{sup 2}-Me{sub 2}G, with a second water-mediated hydrogen bond between the N-3 atom of C{sub dd} and the O-6 atom of N{sup 2},N{sup 2}-Me{sub 2}G. A crystal structure of Dpo4 with dTTP opposite template N{sup 2},N{sup 2}-Me{sub 2}G revealed a wobble orientation. Collectively, these results explain, in a detailed manner, the basis for the reduced efficiency and fidelity of Dpo4-catalyzed bypass of N{sup 2},N{sup 2}-Me{sub 2}G compared with mono-substituted N{sup 2}-alkyl G adducts.

  14. Random Amplified Polymorphic DNA (RAPD) Analysis of Natural Lilium brownii from Guangdong, China%广东省野百合天然居群的随机扩增多态性DNA(RAPD)分析

    Institute of Scientific and Technical Information of China (English)

    蒋建平; 杨懋勋; 黄永芳

    2011-01-01

    representative mountain areas in Guangdong China were analyzed by RAPD markers , so as to provide good foundation for further natural germplasm resources and related studies of Lilium brownii populations, and provide good evidence of the discrimination of Brown lily and Greenish lily at molecular level. DNA from all samples was extracted from leaves and scales, which amplified clear, bright and steady RAPD bands. 20 primers were screened from 273 random primers, and a total 433 DNA bands were amplified, 430 (99. 3% ) of which were polymorphic, the percentage of polymorphic bands (PPB) at the population level was 60. 67% on average. The unweighted pair group method arithmetic average (UPGMA) clustery analysis of the RAPD data from 199 samples showed that all Brown lily samples and Greenish lily samples in the same population separated obviously atthe value of 0. 68 of genetic similarity coefficient, which was a good evidence of the discrimination of Brown lily and Greenish lily at molecular level.

  15. Over-expression of the catalytic core of mitochondrial DNA (mtDNA) polymerase in the nervous system of Drosophila melanogaster reduces median life span by inducing mtDNA depletion

    Science.gov (United States)

    Martínez-Azorín, Francisco; Calleja, Manuel; Hernández-Sierra, Rosana; Farr, Carol L.; Kaguni, Laurie S.; Garesse, Rafael

    2016-01-01

    DNA polymerase γ (pol γ) is the sole DNA polymerase devoted to mitochondrial DNA (mtDNA) replication. We have characterized the molecular and physiological effects of over-expression of the catalytic subunit of pol γ, pol γ-α, in the nervous system of Drosophila melanogaster using the upstream activation sequence (UAS)/yeast transcriptional activator by binding to UAS (GAL4) system. Tissue-specific over-expression of pol γ-α was confirmed by immunoblot analysis, whereas the very low levels of endogenous protein are undetectable in UAS or GAL4 control lines. The transgenic flies over-expressing pol γ-α in the nervous system showed a moderate increase in pupal lethality, and a significant decrease in the median life span of adult flies. Moreover, these flies displayed a decrease in the rate of synthesis of mtDNA, which is accompanied by a significant mtDNA depletion, and a corresponding decrease in the levels of mitochondrial transcription factor A (mtTFA). Biochemical analysis showed an oxidative phosphorylation (OXPHOS) defect in transgenic flies, which were more susceptible to oxidative stress. Although we did not detect apoptosis in the nervous system of adult transgenic flies, brains of larvae over-expressing pol γ-α showed evidence of increased cell death that correlates with the observed phenotypes. Our data establish an animal model that mimics some of the features of human mtDNA depletion syndromes. PMID:17999718

  16. MsDpo4—a DinB Homolog from Mycobacterium smegmatis—Is an Error-Prone DNA Polymerase That Can Promote G:T and T:G Mismatches

    Directory of Open Access Journals (Sweden)

    Amit Sharma

    2012-01-01

    Full Text Available Error-prone DNA synthesis in prokaryotes imparts plasticity to the genome to allow for evolution in unfavorable environmental conditions, and this phenomenon is termed adaptive mutagenesis. At a molecular level, adaptive mutagenesis is mediated by upregulating the expression of specialized error-prone DNA polymerases that generally belong to the Y-family, such as the polypeptide product of the dinB gene in case of E. coli. However, unlike E. coli, it has been seen that expression of the homologs of dinB in Mycobacterium tuberculosis are not upregulated under conditions of stress. These studies suggest that DinB homologs in Mycobacteria might not be able to promote mismatches and participate in adaptive mutagenesis. We show that a representative homolog from Mycobacterium smegmatis (MsDpo4 can carry out template-dependent nucleotide incorporation and therefore is a DNA polymerase. In addition, it is seen that MsDpo4 is also capable of misincorporation with a significant ability to promote G:T and T:G mismatches. The frequency of misincorporation for these two mismatches is similar to that exhibited by archaeal and prokaryotic homologs. Overall, our data show that MsDpo4 has the capacity to facilitate transition mutations and can potentially impart plasticity to the genome.

  17. Low cost instrumentation amplifier

    Science.gov (United States)

    Sturman, J. C.

    1974-01-01

    Amplifier can be used for many applications requiring high input impedance and common mode rejection, low drift, and gain accuracy on order of one percent. Performance of inexpensive amplifier approaches that of some commercial instrumentation amplifiers in many specifications.

  18. New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis

    OpenAIRE

    Xia, Yongzhen; Chu, Wenqiao; Qi, Qingsheng; Xun, Luying

    2014-01-01

    The QuikChangeTM site-directed mutagenesis method is popular but imperfect. An improvement by using partially overlapping primers has been reported several times; however, it is incompatible with the proposed mechanism. The QuikChangeTM method using complementary primers is proposed to linearly amplify a target plasmid with the products annealing to produce double-stranded DNA molecules with 5′-overhangs. The overhang annealing is supposed to form circular plasmids with staggered breaks, whic...

  19. Gain ranging amplifier

    International Nuclear Information System (INIS)

    A gain ranging amplifier system is provided for use in the acquisition of data. Voltage offset compensation is utilized to correct errors in the gain ranging amplifier system caused by thermal drift and temperature dependent voltage offsets, both of which are associated with amplifiers in the gain ranging amplifier system

  20. Amplified Quantum Transforms

    OpenAIRE

    Cornwell, David

    2014-01-01

    In this thesis we investigate two new Amplified Quantum Transforms. In particular we create and analyze the Amplified Quantum Fourier Transform (Amplified-QFT) and the Amplified-Haar Wavelet Transform. First, we provide a brief history of quantum mechanics and quantum computing. Second, we examine the Amplified-QFT in detail and compare it against the Quantum Fourier Transform (QFT) and Quantum Hidden Subgroup (QHS) algorithms for solving the Local Period Problem. We calculate the probabiliti...

  1. Frameshift Deletion by Sulfolobus solfataricus P2 DNA Polymerase Dpo4 T239W Is Selective for Purines and Involves Normal Conformational Change Followed by Slow Phosphodiester Bond Formation*

    Science.gov (United States)

    Zhang, Huidong; Beckman, Jeff W.; Guengerich, F. Peter

    2009-01-01

    The human DNA polymerase κ homolog Sulfolobus solfataricus DNA polymerase IV (Dpo4) produces “−1” frameshift deletions while copying unmodified DNA and, more frequently, when bypassing DNA adducts. As judged by steady-state kinetics and mass spectrometry, bypass of purine template bases to produce these deletions occurred rarely but with 10-fold higher frequency than with pyrimidines. The DNA adduct 1,N2-etheno-2′-deoxyguanosine, with a larger stacking surface than canonical purines, showed the highest frequency of formation of −1 frameshift deletions. Dpo4 T239W, a mutant we had previously shown to produce fluorescence changes attributed to conformational change following dNTP binding opposite cognate bases (Beckman, J. W., Wang, Q., and Guengerich, F. P. (2008) J. Biol. Chem. 283, 36711–36723), reported similar conformational changes when the incoming dNTP complemented the base following a templating purine base or bulky adduct (i.e. the “+1” base). However, in all mispairing cases, phosphodiester bond formation was inefficient. The frequency of −1 frameshift events and the associated conformational changes were not dependent on the context of the remainder of the sequence. Collectively, our results support a mechanism for −1 frameshift deletions by Dpo4 that involves formation of active complexes via a favorable conformational change that skips the templating base, without causing slippage or flipping out of the base, to incorporate a complementary residue opposite the +1 base, in a mechanism previously termed “dNTP-stabilized incorporation.” The driving force is attributed to be the stacking potential between the templating base and the incoming dNTP base. PMID:19837980

  2. Frameshift deletion by Sulfolobus solfataricus P2 DNA polymerase Dpo4 T239W is selective for purines and involves normal conformational change followed by slow phosphodiester bond formation.

    Science.gov (United States)

    Zhang, Huidong; Beckman, Jeff W; Guengerich, F Peter

    2009-12-11

    The human DNA polymerase kappa homolog Sulfolobus solfataricus DNA polymerase IV (Dpo4) produces "-1" frameshift deletions while copying unmodified DNA and, more frequently, when bypassing DNA adducts. As judged by steady-state kinetics and mass spectrometry, bypass of purine template bases to produce these deletions occurred rarely but with 10-fold higher frequency than with pyrimidines. The DNA adduct 1,N(2)-etheno-2'-deoxyguanosine, with a larger stacking surface than canonical purines, showed the highest frequency of formation of -1 frameshift deletions. Dpo4 T239W, a mutant we had previously shown to produce fluorescence changes attributed to conformational change following dNTP binding opposite cognate bases (Beckman, J. W., Wang, Q., and Guengerich, F. P. (2008) J. Biol. Chem. 283, 36711-36723), reported similar conformational changes when the incoming dNTP complemented the base following a templating purine base or bulky adduct (i.e. the "+1" base). However, in all mispairing cases, phosphodiester bond formation was inefficient. The frequency of -1 frameshift events and the associated conformational changes were not dependent on the context of the remainder of the sequence. Collectively, our results support a mechanism for -1 frameshift deletions by Dpo4 that involves formation of active complexes via a favorable conformational change that skips the templating base, without causing slippage or flipping out of the base, to incorporate a complementary residue opposite the +1 base, in a mechanism previously termed "dNTP-stabilized incorporation." The driving force is attributed to be the stacking potential between the templating base and the incoming dNTP base. PMID:19837980

  3. Portable musical instrument amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Christian, David E. (Danbury, CT)

    1990-07-24

    The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

  4. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  5. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    OpenAIRE

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restrict...

  6. High voltage distributed amplifier

    Science.gov (United States)

    Willems, D.; Bahl, I.; Wirsing, K.

    1991-12-01

    A high-voltage distributed amplifier implemented in GaAs MMIC technology has demonstrated good circuit performance over at least two octave bandwidth. This technique allows for very broadband amplifier operation with good efficiency in satellite, active-aperture radar, and battery-powered systems. Also, by increasing the number of FETs, the amplifier can be designed to match different voltage rails. The circuit does require a small amount of additional chip size over conventional distributed amplifiers but does not require power dividers or additional matching networks. This circuit configuration should find great use in broadband power amplifier design.

  7. Improved assays for DNA-polymerizing enzymes by the use of enzymatically synthesized 5-[125I]iodo-2'-deoxyuridine triphosphate, illustrated by direct quantitation of anti-HIV reverse transcriptase antibody and by serum DNA polymerase analyses

    International Nuclear Information System (INIS)

    A one-step procedure which uses enzymes in a crude extract of herpes simplex virus (HSV) type 1-infected cells to synthesize 5-[125I]iodo-2'-deoxyuridine triphosphate [( 125I]dUTP) from [125I]dU is described. The design of a one-step procedure for the purification of the product is also presented. The recovery of [125I]dUTP from [125I]dU varied between 50 and 75%, the radiochemical purity of the product was greater than 90%, and both synthesis and purification were completed within 8 h. The sensitivity and specificity of [125I]dUTP as a substrate for both DNA-dependent DNA polymerase (DNAp) and RNA-dependent DNA polymerase (reverse transcriptase, RT) were evaluated and compared to those of [3H]dTTP for the following specimens: purified cloned Klenow fragment, crude extracts of HeLa-, BHK-, and HSV-2-infected BHK cells, purified avian myeloblastosis virus RT, and purified cloned human immunodeficiency virus (HIV) RT. The [125I]dUTP was accepted as a substrate equally as well [3H]dTTP by all of the specimens at all of the concentrations tested. When the same amount of radiolabel was used, [125I]dUTP gave a sensitivity 10- to 25-fold higher than that of [3H]dTTP. The gain in sensitivity was due to the higher specific activity and a higher counting efficiency of the 125I-label compound. The use of [125I]dUTP also offered technical advantages over alternative substrates available, such as product separation without acid precipitation and exclusion of the need for scintillation cocktails. The half-life of the nucleic also gives a reasonable shelf-life for use in routine assays. Activity of less than 0.3 pg of HIV RT could be detected when the new substrate was used, and this made it possible to quantitate HIV RT antibodies (abs) in diluted serum samples without purifying the immunoglobulin

  8. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  9. Identificación de Cultivares y Líneas de Mejoramiento de Arroz de Chile Mediante Amplificación de Fragmentos Polimórficos (AFLP Identification of Chilean Rice Cultivars And Breeding Lines by Means of Amplified Fragment Length Polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Carlos Aguirre

    2005-12-01

    Full Text Available Doce cultivares y líneas de arroz (Oryza sativa L. desarrollados por el programa de fitomejoramiento del Instituto de Investigaciones Agropecuarias (INIA, Centro Regional de Investigación Quilamapu, fueron caracterizados genéticamente mediante amplificación de fragmentos polimórficos (AFLP. De 21 combinaciones ensayadas, sólo 16 fueron informativas, generando un total de 667 amplicones, 94 de ellos polimórficos (14,4%, con un rango entre 9 y 33% de polimorfismo por combinación. Esto indica que el material manejado por el programa de INIA presenta un bajo nivel de diversidad genética comparado tanto con germoplasma silvestre de la especie como con aquel usado por otros programas de fitomejoramiento de la especie. Los amplicones polimórficos detectados se usaron para preparar un dendrograma de distancias genéticas, detectándose cuatro grupos diferenciablesque sólo coinciden parcialmente con la información disponible de sus pedigrís. A pesar de la baja diversidad genética detectada, se determinó que con el uso de tres combinaciones de partidores de AFLP+3 (PE1G/PM1I, PE1H/PM1A y PE1G/PM1H es posible discriminar entre los cultivares estudiados.Twelve rice (Oryza sativa L. cultivars and breeding lines developed by the Rice Breeding Program at the National Institute of Agriculture Research (INIA,Quilamapu Regional ResearchCenter, were genetically characterized by amplified fragment length polymorphism (AFLP. Sixteen of 21 primer combinations evaluated were informative, generating a total of 667 amplicons, 94 of them polymorphic (14.4%, with a range between 9 to 33% of polymorphism per primer combination. This indicates that the material handled by the breeding program at INIA has low genetic diversity in comparison to wild germplasm of the species, or even compared to the material managed by other rice breeding programs. The detected polymorphic amplicons were used to prepare a dendrogram of the genetic distances, detecting four

  10. (1)H, (13)C, and (15)N backbone resonance assignments of the full-length 40 kDa S. acidocaldarius Y-family DNA polymerase, dinB homolog.

    Science.gov (United States)

    Moro, Sean L; Cocco, Melanie J

    2015-10-01

    The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains. PMID:26154586

  11. Family Polymorphism

    DEFF Research Database (Denmark)

    Ernst, Erik

    2001-01-01

    safety and flexibility at the level of multi-object systems. We are granted the flexibility of using different families of kinds of objects, and we are guaranteed the safety of the combination. This paper highlights the inability of traditional polymorphism to handle multiple objects, and presents family...... polymorphism as a way to overcome this problem. Family polymorphism has been implemented in the programming language gbeta, a generalized version of Beta, and the source code of this implementation is available under GPL....

  12. RF Power Amplifier Analysis

    OpenAIRE

    M. Lokay; K. Pelikan

    1993-01-01

    The special program is presented for the demonstration of RF power transistor amplifiers for the purposes of the high-school education in courses of radio transmitters. The program is written in Turbo Pascal 6. 0 and enables to study the waveforms in selected points of the amplifier and to draw the trajectories of the working point in a plot of output transistor characteristics.

  13. Amplifier improvement circuit

    Science.gov (United States)

    Sturman, J.

    1968-01-01

    Stable input stage was designed for the use with a integrated circuit operational amplifier to provide improved performance as an instrumentation-type amplifier. The circuit provides high input impedance, stable gain, good common mode rejection, very low drift, and low output impedance.

  14. Semiconductor optical amplifiers

    CERN Document Server

    Dutta, Niloy K

    2013-01-01

    This invaluable look provides a comprehensive treatment of design and applications of semiconductor optical amplifiers (SOA). SOA is an important component for optical communication systems. It has applications as in-line amplifiers and as functional devices in evolving optical networks. The functional applications of SOAs were first studied in the early 1990's, since then the diversity and scope of such applications have been steadily growing. This is the second edition of a book on Semiconductor Optical Amplifiers first published in 2006 by the same authors. Several chapters and sections rep

  15. 神经外科重症监护室肺炎克雷伯菌随机扩增多态性DNA分子流行病学研究%Analysis of randomly amplified polymorphic DNA of Klebsiella pneumonia, in neurosurgical department ICU: a molecular epidemiological study

    Institute of Scientific and Technical Information of China (English)

    郭泽兴; 李红玉

    2008-01-01

    目的 采用随机扩增多态性DNA(RAPD)基因分型方法 监测肺炎克雷伯菌医院感染情况. 方法 对我院神经外科重症监护室临床分离的72株肺炎克雷伯菌进行RAPD基因分型,并通过指纹图谱比较分析,确证医院感染爆发. 结果 72株肺炎克雷伯菌共分得68型,未发生肺炎克雷伯菌医院感染局部流行. 结论 RAID基因分型方法 可对肺炎克雷伯菌进行分子流行病学调查.%Objective To monitor nosocomial infections of Klebsiella pneumoniae by analyzing the randomly amplified polymorphic DNA (RAPD). Methods RAPD analysis was used to genotype 72 Klebsiella pneumoniae strains isolated from the intensive care unit (ICU) of the neurosurgical department, and the fingerprints were compared to confirm the outbreak of nosocomial infection of Klebsiella pneumoniae. Results 72 strains Klebsiella pneurnoniae were classified into 68 RAPD types, suggesting the absence of an outbreak of nosocomial infection of glebsiella pneurnoniae in the ICU.Conclusian RAPD genotyping can be used in the molecular epidemiological study ofKlebsiella pneurnoniae.

  16. RF Power Amplifier Analysis

    Directory of Open Access Journals (Sweden)

    M. Lokay

    1993-04-01

    Full Text Available The special program is presented for the demonstration of RF power transistor amplifiers for the purposes of the high-school education in courses of radio transmitters. The program is written in Turbo Pascal 6. 0 and enables to study the waveforms in selected points of the amplifier and to draw the trajectories of the working point in a plot of output transistor characteristics.

  17. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  18. Charge-sensitive amplifier

    OpenAIRE

    Startsev V. I.; Yampolsky Ju. S.

    2008-01-01

    The authors consider design and circuit design techniques of reduction of the influence of the pyroelectric effect on operation of the charge sensitive amplifiers. The presented experimental results confirm the validity of the measures taken to reduce the impact of pyroelectric currents. Pyroelectric currents are caused by the influence of the temperature gradient on the piezoelectric sensor and on the output voltage of charge sensitive amplifiers.

  19. E-537 MWPC amplifier

    International Nuclear Information System (INIS)

    The design of a fast MWPC amplifier for the beam chambers and the absorber chamber is completed and all parts are on order. A prototype 16 channel board has been built and satisfactorily tested. Artwork is completed for the board and out to be photographed. The board fabrication contract has been let. Listed below is a summary of the amplifier characteristics as well as test results obtained with the prototype

  20. Electrospun Amplified Fiber Optics

    OpenAIRE

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-01-01

    A lot of research is focused on all-optical signal processing, aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for an efficient signal transmission. However, the complex fabrication methods, involving high-temperature processes performed in highly pure environment, slow down the fabrication and make amplified components expensive with respect to an ideal, ...

  1. A micropower electrocardiogram amplifier.

    Science.gov (United States)

    Fay, L; Misra, V; Sarpeshkar, R

    2009-10-01

    We introduce an electrocardiogram (EKG) preamplifier with a power consumption of 2.8 muW, 8.1 muVrms input-referred noise, and a common-mode rejection ratio of 90 dB. Compared to previously reported work, this amplifier represents a significant reduction in power with little compromise in signal quality. The improvement in performance may be attributed to many optimizations throughout the design including the use of subthreshold transistor operation to improve noise efficiency, gain-setting capacitors versus resistors, half-rail operation wherever possible, optimal power allocations among amplifier blocks, and the sizing of devices to improve matching and reduce noise. We envision that the micropower amplifier can be used as part of a wireless EKG monitoring system powered by rectified radio-frequency energy or other forms of energy harvesting like body vibration and body heat. PMID:23853270

  2. A vircator amplifier

    International Nuclear Information System (INIS)

    A cavity vircator has demonstrated that formation of a virtual cathode in a cavity can improve microwave production efficiency and narrow the radiation bandwidth. When the virtual cathode radiates the microwave fields grow from noise. For each cavity, there is only one or a limited number of allowable modes for a given frequency. In this paper, a novel device - a vircator amplifier is described. The device consists of a relativistic magnetron and a cavity vircator with both devices powered by a 1 MeV, 3 Ω, 65 ns FWHM pulser. The idea is to inject a signal from the magnetron before and during virtual cathode formation in a cavity. The injected signal should lock the frequency and enhance electron bunching and therefore improve efficiency further. Experiments underway to evaluate the amplifier operating characteristics are discussed. The applicability of vircator amplifiers to the next generation of high-power microwave devices are addressed

  3. Optimization of random amplified polymorphic DNA protocol for molecular identification of Lophius gastrophysus Otimização do protocolo de amplificação randômica de DNA polimórfico para identificação molecular de Lophius gastrophysus

    Directory of Open Access Journals (Sweden)

    Micheline S. Ramella

    2005-12-01

    Full Text Available Lophius gastrophysus has important commercial value in Brazil particularly for foreign trade. In this study, we described the optimization of Random Amplified Polymorphic DNA (RAPD protocol for identification of L. gastrophysus. Different conditions (annealing temperatures, MgCl concentrations, DNA quantity were tested to find reproducible and adequate profiles. Amplifications performed with primers A01, ² A02 and A03 generate the best RAPD profiles when the conditions were annealing temperature of 36ºC, 25 ng of DNA quantity and 2.5 mM MgCl2. Exact identification of the species and origin of marine products is necessary and RAPD could be used as an accurate, rapid tool to expose commercial fraud.Lophius gastrophysus apresenta importante valor comercial no Brasil, principalmente para a exportação. Neste estudo, descrevemos uma otimização do protocolo de amplificação aleatória de DNA polimórfico (RAPD para identificação de L. gastrophysus. Diferentes condições (temperatura de recozimento, quantidade de DNA e concentração de MgCl2 foram testadas para obter perfis reprodutíveis. Os iniciadores A01, A02 e A03 geraram os melhores resultados de amplificação quando utilizados temperatura de recozimento de 36ºC, 25 ng de DNA e 2,5 mM de MgCl2. A identificação exata de espécies e da origem dos produtos marinhos faz-se necessária e a RAPD é uma ferramenta rápida e precisa para expor fraudes comerciais.

  4. Comparison of seven techniques for typing international epidemic strains of Clostridium difficile: restriction endonuclease analysis, pulsed-field gel electrophoresis, PCR-ribotyping, multilocus sequence typing, multilocus variable-number tandem-repeat analysis, amplified fragment length polymorphism, and surface layer protein A gene sequence typing.

    Science.gov (United States)

    Killgore, George; Thompson, Angela; Johnson, Stuart; Brazier, Jon; Kuijper, Ed; Pepin, Jacques; Frost, Eric H; Savelkoul, Paul; Nicholson, Brad; van den Berg, Renate J; Kato, Haru; Sambol, Susan P; Zukowski, Walter; Woods, Christopher; Limbago, Brandi; Gerding, Dale N; McDonald, L Clifford

    2008-02-01

    Using 42 isolates contributed by laboratories in Canada, The Netherlands, the United Kingdom, and the United States, we compared the results of analyses done with seven Clostridium difficile typing techniques: multilocus variable-number tandem-repeat analysis (MLVA), amplified fragment length polymorphism (AFLP), surface layer protein A gene sequence typing (slpAST), PCR-ribotyping, restriction endonuclease analysis (REA), multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE). We assessed the discriminating ability and typeability of each technique as well as the agreement among techniques in grouping isolates by allele profile A (AP-A) through AP-F, which are defined by toxinotype, the presence of the binary toxin gene, and deletion in the tcdC gene. We found that all isolates were typeable by all techniques and that discrimination index scores for the techniques tested ranged from 0.964 to 0.631 in the following order: MLVA, REA, PFGE, slpAST, PCR-ribotyping, MLST, and AFLP. All the techniques were able to distinguish the current epidemic strain of C. difficile (BI/027/NAP1) from other strains. All of the techniques showed multiple types for AP-A (toxinotype 0, binary toxin negative, and no tcdC gene deletion). REA, slpAST, MLST, and PCR-ribotyping all included AP-B (toxinotype III, binary toxin positive, and an 18-bp deletion in tcdC) in a single group that excluded other APs. PFGE, AFLP, and MLVA grouped two, one, and two different non-AP-B isolates, respectively, with their AP-B isolates. All techniques appear to be capable of detecting outbreak strains, but only REA and MLVA showed sufficient discrimination to distinguish strains from different outbreaks. PMID:18039796

  5. Random amplified polymorphic DNA reveals that TiO2 nanoparticles are genotoxic to Cucurbita pepo%随机扩增多态性DNA技术研究发现二氧化钛纳米颗粒对西葫芦具有基因毒性

    Institute of Scientific and Technical Information of China (English)

    Fabiola MORENO-OLIVAS; Vincent U.GANT Jr; Kyle L.JOHNSON; Jose R.PERALTA-VIDEA; Jorge L.GARDEA-TORRESDEY

    2014-01-01

      重要结论:采用随机扩增多态性DNA技术,发现TiO2纳米颗粒污染处理的西葫芦样品与未处理样品的基因组DNA图谱相比,不仅在谱带强度有明显差异,而且存在谱带消失和新谱带产生现象,表明TiO2纳米颗粒对西葫芦具有基因毒性。%Titanium dioxide nanoparticles (TiO2 NPs) are used in cosmetics, sunscreens, paints, and toothpaste, among other applications. These NPs are very stable and can be transported and dispersed in wastewater and biosolids. Animal species have shown negative reactions to TiO2 NPs. However, little is known about their toxicity in plants, specifically the possibility of gen-otoxic effects. In this study, we used a random amplified polymorphic DNA (RAPD) technique to study the genotoxic effects of TiO2 NPs on hydroponically cultivated zucchini (Cucurbita pepo) plants. Seeds were allowed to germinate for 7 d and plants were selected at random for individual and population studies. Four plants were selected for the individual study and 18 for the popu-lation study. RAPD profiles of TiO2 NPs treated plants showed differences in band intensity, loss of bands, or appearance of new bands, compared to untreated plants. To the authors’ knowledge, this is the first report of the genotoxic potential of TiO2 NPs in zucchini.

  6. Randomly Amplified DNA Fingerprinting: A Culmination of DNA Marker Technologies Based on Arbitrarily-Primed PCR Amplification

    OpenAIRE

    Waldron Julie; Peace Cameron P.; Searle Iain R.; Furtado Agnelo; Wade Nick; Findlay Ian; Graham Michael W.; Carroll Bernard J.

    2002-01-01

    Arbitrarily-primed DNA markers can be very useful for genetic fingerprinting and for facilitating positional cloning of genes. This class of technologies is particularly important for less studied species, for which genome sequence information is generally not known. The technologies include Randomly Amplified Polymorphic DNA (RAPD), DNA Amplification Fingerprinting (DAF), and Amplified Fragment Length Polymorphism (AFLP). We have modified the DAF protocol to produce a robust PCR-based DNA ma...

  7. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N[superscript 2]-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena; Rizzo, Carmelo J.; Egli, Martin; Stone, Michael P. (Vanderbilt)

    2014-10-02

    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N

  8. STABILIZED TRANSISTOR AMPLIFIER

    Science.gov (United States)

    Noe, J.B.

    1963-05-01

    A temperature stabilized transistor amplifier having a pair of transistors coupled in cascade relation that are capable of providing amplification through a temperature range of - 100 un. Concent 85% F to 400 un. Concent 85% F described. The stabilization of the amplifier is attained by coupling a feedback signal taken from the emitter of second transistor at a junction between two serially arranged biasing resistances in the circuit of the emitter of the second transistor to the base of the first transistor. Thus, a change in the emitter current of the second transistor is automatically corrected by the feedback adjustment of the base-emitter potential of the first transistor and by a corresponding change in the base-emitter potential of the second transistor. (AEC)

  9. Principal modes in fiber amplifiers

    CERN Document Server

    Fridman, Moti; Dubinskii, Mark; Friesem, Asher A; Davidson, Nir

    2010-01-01

    The dynamics of the state of polarization in single mode and multimode fiber amplifiers are presented. The experimental results reveal that although the state of polarizations at the output can vary over a large range when changing the temperatures of the fiber amplifiers, the variations are significantly reduced when resorting to the principal states of polarization in single mode fiber amplifiers and principal modes in multimode fiber amplifiers.

  10. Helical Fiber Amplifier

    Science.gov (United States)

    Koplow, Jeffrey P.; Kliner, Dahy; Goldberg, Lew

    2002-12-17

    A multi-mode gain fiber is provided which affords substantial improvements in the maximum pulse energy, peak power handling capabilities, average output power, and/or pumping efficiency of fiber amplifier and laser sources while maintaining good beam quality (comparable to that of a conventional single-mode fiber source). These benefits are realized by coiling the multimode gain fiber to induce significant bend loss for all but the lowest-order mode(s).

  11. Radio Frequency Solid State Amplifiers

    CERN Document Server

    Jacob, J

    2015-01-01

    Solid state amplifiers are being increasingly used instead of electronic vacuum tubes to feed accelerating cavities with radio frequency power in the 100 kW range. Power is obtained from the combination of hundreds of transistor amplifier modules. This paper summarizes a one hour lecture on solid state amplifiers for accelerator applications.

  12. Random amplified polymorphic DNA analysis of eel genome

    Institute of Scientific and Technical Information of China (English)

    QIUJIAJING; YIPINGLI

    1999-01-01

    Eel family is a huge one, in which many kinds of eels especially some migratory eels, bear strong resemblance to each other, and are therefore difficult to be identified. In this study 29 random primers were used to make RAPD analysis for Japaneses eel (Anguilla japonica), European eel (Anguilla anguilla) and Pike eel (Muraenesox cinereus).And totally 299 fragments were counted.Shared or specific fragments were counted and genetic similarity or genetic distance were calculated.The genetic similarity between Japanese eel and Pike eel is 0.68 and the genetic distance between them is 0.32;those between European eel and Pike eel are 0.72 and 0.28 respectively,and between Japanese eel and European eel are 0.74 and 0.25 respectively.The method has been shown to be suitable to molecular identification of eels.It provides an alternative approach to determine the relationship between species.

  13. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    whereas others are highly divergent. Conclusions: AFLP clearly clustered strains representing the subgroups of Salmonella together with high bootstrap values and the serotypes of subspecies enterica were divided into polyphyletic or monophyletic types corresponding well with multilocus enzyme...

  14. How to interpret Methylation Sensitive Amplified Polymorphism (MSAP) profiles?

    Czech Academy of Sciences Publication Activity Database

    Fulneček, Jaroslav; Kovařík, Aleš

    2014-01-01

    Roč. 15, JAN 2014 (2014). ISSN 1471-2156 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GA13-10057S; GA ČR(CZ) GA206/09/1751 Institutional support: RVO:68081707 Keywords : MSAP * DNA methylation * Methylcytosine Subject RIV: BO - Biophysics Impact factor: 2.397, year: 2014

  15. Electronic amplifiers for automatic compensators

    CERN Document Server

    Polonnikov, D Ye

    1965-01-01

    Electronic Amplifiers for Automatic Compensators presents the design and operation of electronic amplifiers for use in automatic control and measuring systems. This book is composed of eight chapters that consider the problems of constructing input and output circuits of amplifiers, suppression of interference and ensuring high sensitivity.This work begins with a survey of the operating principles of electronic amplifiers in automatic compensator systems. The succeeding chapters deal with circuit selection and the calculation and determination of the principal characteristics of amplifiers, as

  16. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  17. Building valve amplifiers

    CERN Document Server

    Jones, Morgan

    2013-01-01

    Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

  18. Wideband amplifier design

    CERN Document Server

    Hollister, Allen L

    2007-01-01

    In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

  19. REGENERATIVE TRANSISTOR AMPLIFIER

    Science.gov (United States)

    Kabell, L.J.

    1958-11-25

    Electrical circults for use in computers and the like are described. particularly a regenerative bistable transistor amplifler which is iurned on by a clock signal when an information signal permits and is turned off by the clock signal. The amplifier porforms the above function with reduced power requirements for the clock signal and circuit operation. The power requirements are reduced in one way by employing transformer coupling which increases the collector circuit efficiency by eliminating the loss of power in the collector load resistor.

  20. Quantum entanglement degrees amplifier

    CERN Document Server

    Wu, Xiang-Yao; Liu, Xiao-Jing; Liang, Yu; Meng, Xiang-Dong; Li, Hong; Zhang, Si-Qi

    2015-01-01

    The quantum entangled degrees of entangled states become smaller with the transmission distance increasing, how to keep the purity of quantum entangled states is the puzzle in quantum communication. In the paper, we have designed a new type entanglement degrees amplifier by one-dimensional photonic crystal, which is similar as the relay station of classical electromagnetic communication. We find when the entangled states of two-photon and three-photon pass through photonic crystal, their entanglement degrees can be magnified, which make the entanglement states can be long range propagation and the quantum communication can be really realized.