WorldWideScience

Sample records for amoebal map kinase

  1. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    YongliangZhang; ChenDong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses. Cellular & Molecular Immunology. 2005;2(1):20-27.

  2. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    Yongliang Zhang; Chen Dong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses.

  3. MAP kinases and histone modification

    Institute of Scientific and Technical Information of China (English)

    Tamaki Suganuma; Jerry L. Workman

    2012-01-01

    Signal transduction pathways alter the gene expression program in response to extracellular or intracellular cues.Mitogen-activated protein kinases (MAPKs) govern numerous cellular processes including cell growth,stress response,apoptosis,and differentiation.In the past decade,MAPKs have been shown to regulate the transcription machinery and associate with chromatin-modifying complexes.Moreover,recent studies demonstrate that several MAPKs bind directly to chromatin at target genes.This review highlights the recent discoveries of MAPK signaling in regard to histone modifications and chromatin regulation.Evidence suggesting that further unknown mechanisms integrate signal transduction with chromatin biology is discussed.

  4. MAP kinase meets mitosis: A role for Raf Kinase Inhibitory Protein in spindle checkpoint regulation

    Directory of Open Access Journals (Sweden)

    Rosner Marsha

    2007-01-01

    Full Text Available Abstract Raf Kinase Inhibitory Protein (RKIP is an evolutionarily conserved protein that functions as a modulator of signaling by the MAP kinase cascade. Implicated as a metastasis suppressor, Raf Kinase Inhibitory Protein depletion correlates with poor prognosis for breast, prostate and melanoma tumors but the mechanism is unknown. Recent evidence indicates that Raf Kinase Inhibitory Protein regulates the mitotic spindle assembly checkpoint by controlling Aurora B Kinase activity, and the mechanism involves Raf/MEK/ERK signaling. In contrast to elevated MAP kinase signaling during the G1, S or G2 phases of the cell cycle that activates checkpoints and induces arrest or senescence, loss of RKIP during M phase leads to bypass of the spindle assembly checkpoint and the generation of chromosomal abnormalities. These results reveal a role for Raf Kinase Inhibitory Protein and the MAP kinase cascade in ensuring the fidelity of chromosome segregation prior to cell division. Furthermore, these data highlight the need for precise titration of the MAP kinase signal to ensure the integrity of the spindle assembly process and provide a mechanism for generating genomic instability in tumors. Finally, these results raise the possibility that RKIP status in tumors could influence the efficacy of treatments such as poisons that stimulate the Aurora B-dependent spindle assembly checkpoint.

  5. Regulation and function of TPL-2,an IκB kinase-regulated MAP kinase kinase kinase

    Institute of Scientific and Technical Information of China (English)

    Thorsten Gantke; Srividya Sriskantharajah; Steven C Ley

    2011-01-01

    The IκB kinase(IKK)complex plays a well-documented role in innate and adaptive immunity.This function has been widely attributed to its role as the central activator of the NF-κB family of transcription factors.However,another important consequence of IKK activation is the regulation of TPL-2,a MEK kinase that is required for activation of ERK-1/2 MAP kinases in myeioid cells following Toll-like receptor and TNF receptor stimulation.In unstimulated cells,TPL-2 is stoichiometrically complexed with the NF-κB inhibitory protein NF-κB1 p105,which blocks TPL-2 access to its substrate MEK,and the ubiquitin-binding protein ABIN-2(A20-binding inhibitor of NF-κB 2),both of which are required to maintain TPL-2 protein stability.Following agonist stimulation,the IKK complex phosphorylates p105,triggering its K48-1inked ubiquitination and degradation by the proteasome.This releases TPL-2 from p105-mediated inhibition,facilitating activation of MEK,in addition to modulating NF-κB activation by liberating associated Rel subunits for translocation into the nucleus.IKK-induced proteolysis of 0105,therefore,can directly regulate both NF-κB and ERK MAP kinase activation via NF-κB1 p105.TPL-2 is critical for production of the proinflammatory cytokine TNF during inflammatory responses.Consequently,there has been considerable interest in the pharmaceutical industry to develop selective TPL-2 inhibitors as drugs for the treatment of TNF-dependent inflammatory,diseases,such as rheumatoid arthritis and inflammatory bowel disease.This review summarizes our current understanding of the regulation of TPL-2 signaling function,and also the complex positive and negative roles of TPL-2 in immune and inflammatory responses.

  6. MAP kinase cascades in Arabidopsis innate immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt; Roux, Milena Edna; Petersen, Morten

    2012-01-01

    Plant mitogen-activated protein kinase (MAPK) cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs) by host transmembrane pattern recognition receptors which trigger MAPK-dependent innate ...

  7. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  8. MAP kinases in inflammatory bowel disease

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Olsen, Jørgen; Seidelin, Jakob Benedict;

    2011-01-01

    The mammalian family of mitogen-activated protein kinases (MAPKs) is activated by diverse extracellular and intracellular stimuli, and thereby they play an essential role in connecting cell-surface receptors to changes in transcriptional programs. The MAPK signaling pathways regulate a wide range...

  9. Ras, Raf, and MAP kinase in melanoma.

    Science.gov (United States)

    Solus, Jason F; Kraft, Stefan

    2013-07-01

    A growing understanding of the biology and molecular mechanisms of melanoma has led to the identification of a number of driver mutations for this aggressive tumor. The most common mutations affect signaling of the Ras/Raf/MAPK (mitogen-activated protein kinase) pathway. This review will focus on mutations in genes encoding proteins that play a role in the MAPK pathway and that have been implicated in melanoma biology, such as BRAF, NRAS, and MEK (MAPK kinase), and detail the current understanding of their role in melanoma progression from a molecular biology perspective. Furthermore, this review will also consider some additional mutations in genes such as KIT, GNAQ, and GNA11, which can be seen in certain subtypes of melanoma and whose gene products interact with the MAPK pathway. In addition, the association of these molecular changes with clinical and classical histopathologic characteristics of melanoma will be outlined and their role in diagnosis of melanocytic lesions discussed. Finally, a basic overview of the current targeted therapy landscape, as far as relevant to the pathologist, will be provided.

  10. MAP Kinase Cascades in Plant Innate Immunity

    Directory of Open Access Journals (Sweden)

    Magnus Wohlfahrt Rasmussen

    2012-07-01

    Full Text Available Plant mitogen-activated protein kinase (MAPK cascades generally transduce extracellular stimuli into cellular responses. These stimuli include the perception of pathogen-associated molecular patterns (PAMPs by host transmembrane pattern recognition receptors (PRRs which trigger MAPK-dependent innate immune responses. In the model Arabidopsis, molecular genetic evidence implicates a number of MAPK cascade components in PAMP signaling, and in responses to immunity-related phytohormones such as ethylene, jasmonate and salicylate. In a few cases, cascade components have been directly linked to the transcription of target genes or to the regulation of phytohormone synthesis. Thus MAPKs are obvious targets for bacterial effector proteins and are likely guardees of resistance (R proteins, which mediate defense signaling in response to the action of effectors, or effector-triggered immunity (ETI. This mini-review discusses recent progress in this field with a focus on the Arabidopsis MAPKs MPK3, 4, 6 and 11 in their apparent pathways.

  11. Phosphorylation sites of Arabidopsis MAP Kinase Substrate 1 (MKS1)

    DEFF Research Database (Denmark)

    Caspersen, M.B.; Qiu, J.-L.; Zhang, X.

    2007-01-01

    The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified by electrophore......The Arabidopsis MAP kinase 4 (MPK4) substrate MKS1 was expressed in Escherichia coli and purified, full-length, 6x histidine (His)-tagged MKS1 was phosphorylated in vitro by hemagglutinin (HA)-tagged MPK4 immuno-precipitated from plants. MKS1 phosphorylation was initially verified...... phosphopeptide detection. As MAP kinases generally phosphorylate serine or threonine followed by proline (Ser/Thr-Pro), theoretical masses of potentially phosphorylated peptides were calculated and mass spectrometric peaks matching these masses were fragmented and searched for a neutral-loss signal...... at approximately 98 Da indicative of phosphorylation. Additionally, mass spectrometric peaks present in the MPK4-treated MKS1, but not in the control peptide map of untreated MKS1, were fragmented. Fragmentation spectra were subjected to a MASCOT database search which identified three of the twelve Ser-Pro serine...

  12. Mitogen-activated protein kinase kinase 4 (MAP2K4 promotes human prostate cancer metastasis.

    Directory of Open Access Journals (Sweden)

    Janet M Pavese

    Full Text Available Prostate cancer (PCa is the second leading cause of cancer death in the US. Death from PCa primarily results from metastasis. Mitogen-activated protein kinase kinase 4 (MAP2K4 is overexpressed in invasive PCa lesions in humans, and can be inhibited by small molecule therapeutics that demonstrate favorable activity in phase II studies. However, MAP2K4's role in regulating metastatic behavior is controversial and unknown. To investigate, we engineered human PCa cell lines which overexpress either wild type or constitutive active MAP2K4. Orthotopic implantation into mice demonstrated MAP2K4 increases formation of distant metastasis. Constitutive active MAP2K4, though not wild type, increases tumor size and circulating tumor cells in the blood and bone marrow. Complementary in vitro studies establish stable MAP2K4 overexpression promotes cell invasion, but does not affect cell growth or migration. MAP2K4 overexpression increases the expression of heat shock protein 27 (HSP27 protein and protease production, with the largest effect upon matrix metalloproteinase 2 (MMP-2, both in vitro and in mouse tumor samples. Further, MAP2K4-mediated increases in cell invasion are dependent upon heat shock protein 27 (HSP27 and MMP-2, but not upon MAP2K4's immediate downstream targets, p38 MAPK or JNK. We demonstrate that MAP2K4 increases human PCa metastasis, and prolonged over expression induces long term changes in cell signaling pathways leading to independence from p38 MAPK and JNK. These findings provide a mechanistic explanation for human studies linking increases in HSP27 and MMP-2 to progression to metastatic disease. MAP2K4 is validated as an important therapeutic target for inhibiting human PCa metastasis.

  13. Activation and signaling of the p38 MAP kinase pathway

    Institute of Scientific and Technical Information of China (English)

    Tyler ZARUBIN; Jiahuai HAN

    2005-01-01

    The family members of the mitogen-activated protein (MAP) kinases mediate a wide variety of cellular behaviors in response to extracellular stimuli. One of the four main sub-groups, the p38 group of MAP kinases, serve as a nexus for signal transduction and play a vital role in numerous biological processes. In this review, we highlight the known characteristics and components of the p38 pathway along with the mechanism and consequences of p38 activation. We focus on the role of p38 as a signal transduction mediator and examine the evidence linking p38 to inflammation, cell cycle, cell death, development, cell differentiation, senescence and tumorigenesis in specific cell types. Upstream and downstream components of p38 are described and questions remaining to be answered are posed. Finally, we propose several directions for future research on p38.

  14. Arabidopsis map kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Brodersen, P; Johansen, Bo; Petersen, M;

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) levels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....

  15. Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance

    DEFF Research Database (Denmark)

    Petersen, M.; Brodersen, P.; Naested, H.

    2000-01-01

    Transposon inactivation of Arabidopsis MAP kinase 4 produced the mpk4 mutant exhibiting constitutive systemic acquired resistance (SAR) including elevated salicylic acid (SA) revels, increased resistance to virulent pathogens, and constitutive pathogenesis-related gene expression shown by Northern...... of NPR1. PDF1.2 and THI2.1 gene induction by jasmonate was blocked in mpk4 expressing NahG, suggesting that MPK4 is required for jasmonic acid-responsive gene expression....

  16. Role of calcium, protein kinase C and MAP kinase in the activation of mast cells

    Directory of Open Access Journals (Sweden)

    Michael A. Beaven

    1996-01-01

    Full Text Available The mechanisms of activation of mast cells have been studied in most detail in rat RBL-2H3 cells. These cells respond to antigen via the IgE receptor (FceRI through sequential activation of the tyrosine kinases, Lyn and Syk, and to adenosine analogs via the adenosine A3 receptor (A3R and a pertussis toxin-sensitive G protein, most likely Gi-3. Other receptors, introduced through gene transfection, include the muscarinic ml receptor (mlR which acts via Gq/11. Stimulation of cells via FceRI, A3R or ml R leads to the activation of phospholipase (PL C, PLD and mitogen-activated protein (MAP kinase resulting in the generation of inositol phosphates and diglycerides, an increase of cytosolic Ca2+, the activation of protein kinase C (PKC and the phosphorylation of various proteins by PKC and MAP kinase. The extent and time course of these events varies for each receptor. These variations, as well as the effects of pharmacologic probes, gene transfection and reconstitution of responses in washed permeabilized cells, indicate how these events relate to functional responses. A modest but sustained elevation of cytosolic Ca2+ through an influx of extracellular Ca2+ and activation of PKCβ and PKCδ are sufficient for optimal release of preformed secretory granules. Phosphorylation of a cytosolic PLAj by AMP kinase (p42mapk and a modest increase in cytosolic Ca2+ are necessary for the activation of Pl^ and the binding of PLA2 to membranes, respectively. Finally, both de novo generation and secretion via Golgi-derived vesicles of certain cytokines are dependent on Ca2+ and PKC as well as additional signals most probably phosphorylation of proteins by Syk and p42mapk.

  17. MAP Kinase 4 Substrates and Plant Innate Immunity

    DEFF Research Database (Denmark)

    Rasmussen, Magnus Wohlfahrt

    recognition, which also induce its localization to cytoplasmic processing bodies. All three proteins; PAT1, AOC3 and eIF4E also interacts with MPK4 in vivo although the functional outcome of these interactions are still elusive. The thesis comprise a general introduction to plant innate immunity followed...... by two review articles “MAP kinase cascades in Arabidopsis innate immunity” published in Frontiers in Plant Science and “mRNA decay in plant immunity” under revision for Cellular and Molecular Life Science. Together these sections gives a comprehensive overview of Arabidopsis defense signaling...

  18. Modulation of the MAP kinase signaling cascade by Raf kinase inhibitory protein

    Institute of Scientific and Technical Information of China (English)

    Nicholas TRAKUL; Marsha R. ROSNER

    2005-01-01

    Proteins like Raf kinase inhibitory protein (RKIP) that serve as modulators of signaling pathways, either by promoting or inhibiting the formation of productive signaling complexes through protein-protein interactions, have been demonstrated to play an increasingly important role in a number of cell types and organisms. These proteins have been implicated in development as well as the progression of cancer. RKIP is a particularly interesting regulator, as it is a highly conserved, ubiquitously expressed protein that has been shown to play a role in growth and differentiation in a number of organisms and can regulate multiple signaling pathways. RKIP is also the first MAP kinase signaling modulator to be identified as playing a role in cancer metastasis, and identification of the mechanism by which it regulates Raf-1 activation provides new targets for therapeutic intervention.

  19. Identification of p38α MAP kinase inhibitors by pharmacophore based virtual screening

    DEFF Research Database (Denmark)

    Gangwal, Rahul P; Das, Nihar R; Thanki, Kaushik;

    2014-01-01

    The p38α mitogen-activated protein (MAP) kinase plays a vital role in treating many inflammatory diseases. In the present study, a combined ligand and structure based pharmacophore model was developed to identify potential DFG-in selective p38 MAP kinase inhibitors. Conformations of co-crystallised...

  20. The cAMP Signaling and MAP Kinase Pathways in Plant Pathogenic Fungi

    NARCIS (Netherlands)

    Mehrabi, R.; Zhao, X.; Kim, Y.; Xu, J.R.

    2009-01-01

    The key components of the well conserved cyclic AMP signaling and MAP kinase pathways have been functionally characterized in the corn smut Ustilago maydis, rice blast fungus Magnaporthe grisea, and a few other fungal pathogens. In general, the cAMP signaling and the MAP kinase cascade homologous to

  1. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  2. A mitotically inheritable unit containing a MAP kinase module.

    Science.gov (United States)

    Kicka, Sébastien; Bonnet, Crystel; Sobering, Andrew K; Ganesan, Latha P; Silar, Philippe

    2006-09-05

    Prions are novel kinds of hereditary units, relying solely on proteins, that are infectious and inherited in a non-Mendelian fashion. To date, they are either based on autocatalytic modification of a 3D conformation or on autocatalytic cleavage. Here, we provide further evidence that in the filamentous fungus Podospora anserina, a MAP kinase cascade is probably able to self-activate and generate C, a hereditary unit that bears many similarities to prions and triggers cell degeneration. We show that in addition to the MAPKKK gene, both the MAPKK and MAPK genes are necessary for the propagation of C, and that overexpression of MAPK as that of MAPKKK facilitates the appearance of C. We also show that a correlation exists between the presence of C and localization of the MAPK inside nuclei. These data emphasize the resemblance between prions and a self-positively regulated cascade in terms of their transmission. This thus further expands the concept of protein-base inheritance to regulatory networks that have the ability to self-activate.

  3. Regulation of MAP kinase-dependent apoptotic pathway: implication of reactive oxygen and nitrogen species.

    Science.gov (United States)

    Sumbayev, Vadim V; Yasinska, Inna M

    2005-04-15

    Mitogen-activated protein (MAP) kinase signaling cascades are multi-functional signaling networks that influence cell growth, differentiation, apoptosis, and cellular responses to stress. Apoptosis signal-regulating kinase 1 (ASK1) is a MAP kinase kinase kinase that triggers apoptogenic kinase cascade leading to the phosphorylation/activation of c-Jun N-terminal kinases and p38-MAP kinase, which are responsible for inducing apoptotic cell death. This pathway plays a pivotal role in transduction of signals from different apoptotic stimuli. In the present review, we summarized the recent evidence concerning MAP kinase-dependent apoptotic pathway and its regulation in the mammalian cells and organism in vivo. We have shown that the key messengers of regulation of this pathway are the reactive oxygen and nitrogen species. The role of protein oxidation and S-nitrosation in induction of apoptotic cell death via ASK1 is discussed. Also we have outlined other recently discovered signal transduction processes involved in the regulation of ASK1 activity and downstream pathway.

  4. Control of signaling in a MAP-kinase pathway by an RNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Susanne Prinz

    Full Text Available Signaling-protein mRNAs tend to have long untranslated regions (UTRs containing binding sites for RNA-binding proteins regulating gene expression. Here we show that a PUF-family RNA-binding protein, Mpt5, represses the yeast MAP-kinase pathway controlling differentiation to the filamentous form. Mpt5 represses the protein levels of two pathway components, the Ste7 MAP-kinase kinase and the Tec1 transcriptional activator, and negatively regulates the kinase activity of the Kss1 MAP kinase. Moreover, Mpt5 specifically inhibits the output of the pathway in the absence of stimuli, and thereby prevents inappropriate cell differentiation. The results provide an example of what may be a genome-scale level of regulation at the interface of signaling networks and protein-RNA binding networks.

  5. Involvement of the MAP kinase cascade in Xenopus mesoderm induction.

    OpenAIRE

    Gotoh, Y.; Masuyama, N; Suzuki, A.; Ueno, N; Nishida, E

    1995-01-01

    Mitogen-activated protein kinase (MAPK) is activated by MAPK kinase (MAPKK) in a variety of signaling pathways. This kinase cascade has been shown to function in cell proliferation and differentiation, but its role in early vertebrate development remains to be investigated. During early vertebrate embryogenesis, the induction and patterning of mesoderm are thought to be determined by signals from intercellular factors such as members of the fibroblast growth factor (FGF) family and members of...

  6. Crystal Structure of the MAP3K TAO2 Kinase Domain Bound by an Inhibitor Staurosporine

    Institute of Scientific and Technical Information of China (English)

    Tian-Jun ZHOU; Li-Guang SUN; Yan GAO; Elizabeth J. GOLDSMITH

    2006-01-01

    Mitogen-activated protein kinase (MAPK) signal transduction pathways are ubiquitous in eukaryotic cells, which transfer signals from the cell surface to the nucleus, controlling multiple cellular programs. MAPKs are activated by MAPK kinases [MAP2Ks or MAP/extracellular signal-regulated kinase (ERK) kinases (MEK)], which in turn are activated by MAPK kinase kinases (MAP3Ks). TAO2 is a MAP3K level kinase that activates the MAP2Ks MEK3 and MEK6 to activate p38 MAPKs. Because p38 MAPKs are key regulators of expression of inflammatory cytokines, they appear to be involved in human diseases such as asthma and autoimmunity. As an upstream activator of p38s, TAO2 represents a potential drug target. Here we report the crystal structure of active TAO2 kinase domain in complex with staurosporine, a broadrange protein kinase inhibitor that inhibits TAO2 with an IC50 of 3 μM. The structure reveals that staurosporine occupies the position where the adenosine of ATP binds in TAO2, and the binding of the inhibitor mimics many features of ATP binding. Both polar and nonpolar interactions contribute to the enzyme-inhibitor recognition. Staurosporine induces conformational changes in TAO2 residues that surround the inhibitor molecule, but causes very limited global changes in the kinase. The structure provides atomic details for TAO2-staurosporine interactions, and explains the relatively low potency of staurosporine against TAO2. The structure presented here should aid in the design of inhibitors specific to TAO2 and related kinases.

  7. Roles of MAP kinase signaling pathway in oocyte meiosis

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Mitogen-activated protein kinase (MAPK) is a family of Ser/Thr protein kinases expressed widely in eukaryotic cells. MAPK is activated by a cascade of protein kinase phosphorylation and plays pivotal roles in regulating meiosis process in oocytes. As an important physical substrate of MAPK, p90rsk mediates numerous MAPK functions. MAPK was activated at G2/M transition during meiosis. Its activity reached the peak at MⅠ stage and maintained at this level until the time before the pronuclear formation after fertilization. There is complex interplay between MAPK and MPF in the meiosis regulation. Furthermore, other intracellular signal transducers, such as cAMP, protein kinase C and protein phosphotase, ect., also regulated the activity of MAPK at different stages during meiosis in oocytes. In the present article, the roles of MAPK signaling pathway in oocyte meiosis are reviewed and discussed.

  8. Neurotrophins stimulate phosphorylation of synapsin I by MAP kinase and regulate synapsin I-actin interactions.

    OpenAIRE

    Jovanovic, J. N.; Benfenati, F; Siow, Y L; SIHRA, T. S.; Sanghera, J.S.; Pelech, S L; Greengard, P; Czernik, A J

    1996-01-01

    The ability of neurotrophins to modulate the survival and differentiation of neuronal populations involves the Trk/MAP (mitogen-activated protein kinase) kinase signaling pathway. More recently, neurotrophins have also been shown to regulate synaptic transmission. The synapsins are a family of neuron-specific phosphoproteins that play a role in regulation of neurotransmitter release, in axonal elongation, and in formation and maintenance of synaptic contacts. We report here that synapsin I is...

  9. Uveitis as a Result of MAP Kinase Pathway Inhibition

    Directory of Open Access Journals (Sweden)

    Lavnish Joshi

    2013-11-01

    Full Text Available We report the case of a patient treated with dabrafenib and trametinib (mitogen-activated protein kinase pathway inhibitors for stage 3b cutaneous melanoma who developed bilateral uveitis. Although there have been reports of ocular side effects with this class of drugs, uveitis has not been previously reported to the best of our knowledge. This case indicates the wide range of side effects that can be seen with the newer targeted biological therapies.

  10. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis

    OpenAIRE

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-01-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identica...

  11. The germinal center kinase GCK-1 is a negative regulator of MAP kinase activation and apoptosis in the C. elegans germline.

    Directory of Open Access Journals (Sweden)

    Katherine R Schouest

    Full Text Available The germinal center kinases (GCK constitute a large, highly conserved family of proteins that has been implicated in a wide variety of cellular processes including cell growth and proliferation, polarity, migration, and stress responses. Although diverse, these functions have been attributed to an evolutionarily conserved role for GCKs in the activation of ERK, JNK, and p38 MAP kinase pathways. In addition, multiple GCKs from different species promote apoptotic cell death. In contrast to these paradigms, we found that a C. elegans GCK, GCK-1, functions to inhibit MAP kinase activation and apoptosis in the C. elegans germline. In the absence of GCK-1, a specific MAP kinase isoform is ectopically activated and oocytes undergo abnormal development. Moreover, GCK-1- deficient animals display a significant increase in germ cell death. Our results suggest that individual germinal center kinases act in mechanistically distinct ways and that these functions are likely to depend on organ- and developmental-specific contexts.

  12. Structural Bioinformatics-Based Prediction of Exceptional Selectivity of p38 MAP Kinase Inhibitor PH-797804

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Li; Shieh, Huey S.; Selness, Shaun R.; Devraj, Rajesh V.; Walker, John K.; Devadas, Balekudru; Hope, Heidi R.; Compton, Robert P.; Schindler, John F.; Hirsch, Jeffrey L.; Benson, Alan G.; Kurumbail, Ravi G.; Stegeman, Roderick A.; Williams, Jennifer M.; Broadus, Richard M.; Walden, Zara; Monahan, Joseph B.; Pfizer

    2009-07-24

    PH-797804 is a diarylpyridinone inhibitor of p38{alpha} mitogen-activated protein (MAP) kinase derived from a racemic mixture as the more potent atropisomer (aS), first proposed by molecular modeling and subsequently confirmed by experiments. On the basis of structural comparison with a different biaryl pyrazole template and supported by dozens of high-resolution crystal structures of p38{alpha} inhibitor complexes, PH-797804 is predicted to possess a high level of specificity across the broad human kinase genome. We used a structural bioinformatics approach to identify two selectivity elements encoded by the TXXXG sequence motif on the p38{alpha} kinase hinge: (i) Thr106 that serves as the gatekeeper to the buried hydrophobic pocket occupied by 2,4-difluorophenyl of PH-797804 and (ii) the bidentate hydrogen bonds formed by the pyridinone moiety with the kinase hinge requiring an induced 180{sup o} rotation of the Met109-Gly110 peptide bond. The peptide flip occurs in p38{alpha} kinase due to the critical glycine residue marked by its conformational flexibility. Kinome-wide sequence mining revealed rare presentation of the selectivity motif. Corroboratively, PH-797804 exhibited exceptionally high specificity against MAP kinases and the related kinases. No cross-reactivity was observed in large panels of kinase screens (selectivity ratio of >500-fold). In cellular assays, PH-797804 demonstrated superior potency and selectivity consistent with the biochemical measurements. PH-797804 has met safety criteria in human phase I studies and is under clinical development for several inflammatory conditions. Understanding the rationale for selectivity at the molecular level helps elucidate the biological function and design of specific p38{alpha} kinase inhibitors.

  13. Amoebic keratitis in Iran (1997-2007

    Directory of Open Access Journals (Sweden)

    F Rahimi

    2007-07-01

    Full Text Available Background: Amoebic keratitis introduced as a painful corneal infection which sometimes lead to poor vision and blind-ness. The main goal of this study was to report amoebic keratitis during ten years from 1997-2007 in patients who was sus-pected to have amoebic keratitis and referred to Parasitology laboratory, School of Public Health, Tehran Univer¬sity of Medical Sciences, Iran. Other aim was to assess the major risk factor for developing this sight-threatening disease. Comparison of lens culture and corneal scrapes culture also was performed. "nMethods: During 1997-2007, 142 patients referred to Dept. of Medical Parasitology, School of Public Health, Tehran Uni-versity of Medical Sciences, Iran. Details of each patient such as age, sex, history of contact lens wear, type of contact lens, clinical symptoms were recorded in questioners. Keratitis was diagnosed on the basis of culture of lenses and/or corneal scrapes on non-nutrient agar overlaid with Escherichia coli and direct microscopy of lenses and/or corneal scrapes. "nResults: Among 142 patients, 49 (34.5% had amoebic keratitis. 73.46% of these patients were from Tehran but there were a few cases from other cities. The commonest age was between 15-25 yr (75.5% and more female (37:12 were identified then male. It is worth to mention that 44 patients (89.79% were contact lens wearers who among them 41 patients (93.18% wore soft contact lens and only three patients suffer from amoebic keratitis because of wearing hard contact lens. Other finding of this study demonstrated that the most common sign of the patients was severe pain combined with photophobia. "nConclusion: This study indicates that Acanthamoeba keratitis continue to rise in Iran. This is due to increase frequency of lens wearers as well as consideration of ophthalmologist to Acanthamoeba as an agent of keratitis and improvement of labo¬ratory methods. Another finding of this research was the confirmation of soft contact lens

  14. Involvement of PI3 kinase and MAP kinase in IGF-I and insulin-induced ovarian steroidogenesis in common carp Cyprinus carpio.

    Science.gov (United States)

    Paul, Sudipta; Pramanick, Kousik; Kundu, Sourav; Roy Moulik, Sujata; Pal, Puja; Mukherjee, Dilip

    2013-01-15

    Previously, we observed that in vitro steroidogenesis in intact ovarian follicles of common carp Cyprinus carpio can alone be induced by recombinant human insulin-like growth factor (IGF-I) and bovine insulin (b-insulin) and this induction was gonadotropin-independent. To investigate early signal transduction components involved in this process, the possible role of phosphatidylinositol 3-kinase (PI3 kinase) during ovarian steroidogenesis was examined. IGF-I and b-insulin induced testosterone and 17β-estradiol production in carp ovarian theca and granulosa cells in short-term coincubation and this induction was significantly inhibited by Wortmannin and LY294002, two mechanistically different specific inhibitors of PI3 kinase. IGF-I and b-insulin were shown to activate PI3 kinase from 30 min onwards with a maximum at 90 min. In this study, we found the involvement of mitogen-activated protein kinase (MAP kinase) in the regulation of IGF-I- and b-insulin-induced steroidogenesis in carp ovary. An antagonist of mitogen-activated protein kinase kinase1/2 (MEK1/2) markedly attenuated IGF-I- and b-insulin-induced steroid production. Cells treated with IGF-I and b-insulin stimulated ERK1/2-dependent phosphorylation of extracellular signal regulated protein kinase1/2 (ERKs1/2) in a time-dependent manner, which was significantly attenuated in presence of MEK1/2 inhibitor. PI3 kinase inhibitors strongly attenuated phosphorylation and activation of MAP kinase, which was increased during IGF-I and b-insulin-induced steroidogenesis. Taken together, these results suggest that PI3 kinase is an initial component of the signal transduction pathway which precedes the MAP kinase during IGF-I- and b-insulin-induced steroidogenesis in C. carpio ovarian follicles.

  15. MAP kinase pathways in the yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Gustin, M. C.; Albertyn, J.; Alexander, M.; Davenport, K.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    A cascade of three protein kinases known as a mitogen-activated protein kinase (MAPK) cascade is commonly found as part of the signaling pathways in eukaryotic cells. Almost two decades of genetic and biochemical experimentation plus the recently completed DNA sequence of the Saccharomyces cerevisiae genome have revealed just five functionally distinct MAPK cascades in this yeast. Sexual conjugation, cell growth, and adaptation to stress, for example, all require MAPK-mediated cellular responses. A primary function of these cascades appears to be the regulation of gene expression in response to extracellular signals or as part of specific developmental processes. In addition, the MAPK cascades often appear to regulate the cell cycle and vice versa. Despite the success of the gene hunter era in revealing these pathways, there are still many significant gaps in our knowledge of the molecular mechanisms for activation of these cascades and how the cascades regulate cell function. For example, comparison of different yeast signaling pathways reveals a surprising variety of different types of upstream signaling proteins that function to activate a MAPK cascade, yet how the upstream proteins actually activate the cascade remains unclear. We also know that the yeast MAPK pathways regulate each other and interact with other signaling pathways to produce a coordinated pattern of gene expression, but the molecular mechanisms of this cross talk are poorly understood. This review is therefore an attempt to present the current knowledge of MAPK pathways in yeast and some directions for future research in this area.

  16. The MAP kinase pathway is required for entry into mitosis and cell survival.

    Science.gov (United States)

    Liu, Xiaoqi; Yan, Shi; Zhou, Tianhua; Terada, Yasuhiko; Erikson, Raymond L

    2004-01-22

    In this communication, we examined the role of the MAP kinase pathway in the G2/M phase of the cell cycle. Activation of the Plk1 and MAP kinase pathways was initially evaluated in FT210 cells, which arrest at G2 phase at the restrictive temperature (39 degrees C), due to a mutation in the cdc2 gene. Previous studies had shown that these cells enter mitosis at the nonpermissive temperature upon incubation with okadaic acid, a protein phosphatase 1 and 2A inhibitor. We show that treatment of FT210 cells at 39 degrees C with okadaic acid activated Plk1, as shown by hyperphosphorylation and elevated protein kinase activity, and also induced activation of the MAP kinase pathway. The specific Mek inhibitor PD98059 antagonized the okadaic acid-induced activation of both Plk1 and MAP kinases. This suggests that activation of the MAP kinase pathway may contribute to the okadaic acid-induced activation of Plk1 in FT210 cells at 39 degrees C. We also found that PD98059 strongly attenuated progression of HeLa cells through mitosis, and active Mek colocalizes with Plk1 at mitotic structures. To study the potential function of the MAP kinase pathway during mitosis, RNAi was used to specifically deplete five members of this pathway (Raf1, Mek1/2, Erk1/2). Each of these five protein kinases is required for cell proliferation and survival, and depletion of any of these proteins eventually leads to apoptosis. Treatment with Mek inhibitors also inhibited cell proliferation and caused apoptosis. A dramatic increase of Plk1 activities and a moderate increase of Cdc2 activities in Raf1-depleted cells indicate that Raf1-depleted cells arrest in the late G2 or M phase. Mek1 and Erk1 depletion also caused cell cycle arrest at G2, suggesting that these enzymes are required for the G2/M transition, whereas the loss of Mek2 or Erk2 caused arrest at G1.

  17. Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus.

    Science.gov (United States)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus; Nielsen, Henrik Bjørn; Botanga, Christopher J; Thorgrimsen, Stephan; Palma, Kristoffer; Suarez-Rodriguez, Maria Cristina; Sandbech-Clausen, Signe; Lichota, Jacek; Brodersen, Peter; Grasser, Klaus D; Mattsson, Ole; Glazebrook, Jane; Mundy, John; Petersen, Morten

    2008-08-20

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP kinase 4 (MPK4) exists in nuclear complexes with the WRKY33 transcription factor. This complex depends on the MPK4 substrate MKS1. Challenge with Pseudomonas syringae or flagellin leads to the activation of MPK4 and phosphorylation of MKS1. Subsequently, complexes with MKS1 and WRKY33 are released from MPK4, and WRKY33 targets the promoter of PHYTOALEXIN DEFICIENT3 (PAD3) encoding an enzyme required for the synthesis of antimicrobial camalexin. Hence, wrky33 mutants are impaired in the accumulation of PAD3 mRNA and camalexin production upon infection. That WRKY33 is an effector of MPK4 is further supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation.

  18. The MAP kinase substrate MKS1 is a regulator of plant defense responses

    DEFF Research Database (Denmark)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter

    2005-01-01

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used...

  19. [COMPLICATED AMOEBIC APENDICITIS.REPORT OF A CASE

    Science.gov (United States)

    Casavilca Zambrano, Sandro; Gomez Anchante, Victor; Cisneros Gallegos, Eduardo

    2000-01-01

    We report a case of acute abdomen that is operated with the presumptive diagnosis of complicated acute appendicitis. In the histologic examination we make the diagnosis of complicated amoebic appendicitis. We discuss clinical manifestations and histopathologic findings of this unusual presentation of amoebic infection.

  20. Granulomatous Amoebic Encephalitis: Clinical Diagnosis and Management

    Directory of Open Access Journals (Sweden)

    Naveed A. Khan

    2005-01-01

    Full Text Available Granulomatous amoebic encephalitis (GAE is a serious human disease with fatal consequences. With the mortality rate of more than 90%, it is not surprising that the majority of GAE infections are identified at the post-mortem stage. The most distressing aspect is that the high level of mortality is attributed to lack of awareness. Early diagnosis with aggressive treatment can lead to successful prognosis for the patient. Here, we describe a brief overview of the current understanding of the pathophysiology of GAE, available diagnostic methods, possible therapeutic interventions and the causative agents.

  1. Mitogen activated protein kinase kinase kinase 3 (MAP3K3/MEKK3) overexpression is an early event in esophageal tumorigenesis and is a predictor of poor disease prognosis

    OpenAIRE

    2014-01-01

    Background Mitogen-activated protein kinase kinase kinase3 (MAP3K3/MEKK3) was identified to be differentially expressed in esophageal squamous cell carcinoma (ESCC) using cDNA microarrays by our laboratory. Here in we determined the clinical significance of MEKK3 in ESCC. Methods Immunohistochemical analysis of MEKK3 expression was carried out in archived tissue sections from 93 ESCCs, 47 histologically normal and 61 dysplastic esophageal tissues and correlated with clinicopathological parame...

  2. RKIP regulates MAP kinase signaling in cells with defective B-Raf activity.

    Science.gov (United States)

    Zeng, Lingchun; Ehrenreiter, Karin; Menon, Jyotsana; Menard, Ray; Kern, Florian; Nakazawa, Yoko; Bevilacqua, Elena; Imamoto, Akira; Baccarini, Manuela; Rosner, Marsha Rich

    2013-05-01

    MAP kinase (MAPK) signaling results from activation of Raf kinases in response to external or internal stimuli. Here, we demonstrate that Raf kinase inhibitory protein (RKIP) regulates the activation of MAPK when B-Raf signaling is defective. We used multiple models including mouse embryonic fibroblasts (MEFs) and primary keratinocytes from RKIP- or Raf-deficient mice as well as allografts in mice to investigate the mechanism. Loss of B-Raf protein or activity significantly reduces MAPK activation in these cells. We show that RKIP depletion can rescue the compromised ERK activation and promote proliferation, and this rescue occurs through a Raf-1 dependent mechanism. These results provide formal evidence that RKIP is a bona fide regulator of Raf-1. We propose a new model in which RKIP plays a key role in regulating the ability of cells to signal through Raf-1 to ERK in B-Raf compromised cells.

  3. BDNF stimulation of protein synthesis in cortical neurons requires the MAP kinase-interacting kinase MNK1.

    Science.gov (United States)

    Genheden, Maja; Kenney, Justin W; Johnston, Harvey E; Manousopoulou, Antigoni; Garbis, Spiros D; Proud, Christopher G

    2015-01-21

    Although the MAP kinase-interacting kinases (MNKs) have been known for >15 years, their roles in the regulation of protein synthesis have remained obscure. Here, we explore the involvement of the MNKs in brain-derived neurotrophic factor (BDNF)-stimulated protein synthesis in cortical neurons from mice. Using a combination of pharmacological and genetic approaches, we show that BDNF-induced upregulation of protein synthesis requires MEK/ERK signaling and the downstream kinase, MNK1, which phosphorylates eukaryotic initiation factor (eIF) 4E. Translation initiation is mediated by the interaction of eIF4E with the m(7)GTP cap of mRNA and with eIF4G. The latter interaction is inhibited by the interactions of eIF4E with partner proteins, such as CYFIP1, which acts as a translational repressor. We find that BDNF induces the release of CYFIP1 from eIF4E, and that this depends on MNK1. Finally, using a novel combination of BONCAT and SILAC, we identify a subset of proteins whose synthesis is upregulated by BDNF signaling via MNK1 in neurons. Interestingly, this subset of MNK1-sensitive proteins is enriched for functions involved in neurotransmission and synaptic plasticity. Additionally, we find significant overlap between our subset of proteins whose synthesis is regulated by MNK1 and those encoded by known FMRP-binding mRNAs. Together, our data implicate MNK1 as a key component of BDNF-mediated translational regulation in neurons.

  4. Interdomain allosteric regulation of Polo kinase by Aurora B and Map205 is required for cytokinesis.

    Science.gov (United States)

    Kachaner, David; Pinson, Xavier; El Kadhi, Khaled Ben; Normandin, Karine; Talje, Lama; Lavoie, Hugo; Lépine, Guillaume; Carréno, Sébastien; Kwok, Benjamin H; Hickson, Gilles R; Archambault, Vincent

    2014-10-27

    Drosophila melanogaster Polo and its human orthologue Polo-like kinase 1 fulfill essential roles during cell division. Members of the Polo-like kinase (Plk) family contain an N-terminal kinase domain (KD) and a C-terminal Polo-Box domain (PBD), which mediates protein interactions. How Plks are regulated in cytokinesis is poorly understood. Here we show that phosphorylation of Polo by Aurora B is required for cytokinesis. This phosphorylation in the activation loop of the KD promotes the dissociation of Polo from the PBD-bound microtubule-associated protein Map205, which acts as an allosteric inhibitor of Polo kinase activity. This mechanism allows the release of active Polo from microtubules of the central spindle and its recruitment to the site of cytokinesis. Failure in Polo phosphorylation results in both early and late cytokinesis defects. Importantly, the antagonistic regulation of Polo by Aurora B and Map205 in cytokinesis reveals that interdomain allosteric mechanisms can play important roles in controlling the cellular functions of Plks.

  5. FAK acts as a suppressor of RTK-MAP kinase signalling in Drosophila melanogaster epithelia and human cancer cells.

    OpenAIRE

    2014-01-01

    Receptor Tyrosine Kinases (RTKs) and Focal Adhesion Kinase (FAK) regulate multiple signalling pathways, including mitogen-activated protein (MAP) kinase pathway. FAK interacts with several RTKs but little is known about how FAK regulates their downstream signalling. Here we investigated how FAK regulates signalling resulting from the overexpression of the RTKs RET and EGFR. FAK suppressed RTKs signalling in Drosophila melanogaster epithelia by impairing MAPK pathway. This regulation was also ...

  6. Fulminant amoebic colitis during chemotherapy for advanced gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Noboru Hanaoka; Katsuhiko Higuchi; Satoshi Tanabe; Tohru Sasaki; Kenji Ishido; Takako Ae; Wasaburo Koizumi; Katsunori Saigenji

    2009-01-01

    A 52-year-old man had bloody stools during chemotherapy for gastric cancer. A colonoscopy revealed necrotizing ulcer-like changes. A biopsy confirmed the presence of amoebic trophozoites. Subsequently,peritonitis with intestinal perforation developed, and emergency peritoneal lavage and colostomy were performed. After surgery, endotoxin adsorption therapy was performed and metronidazole was given. Symptoms of peritonitis and colonitis resolved.with the progression of gastric cancer. The patient died 50 d after surgery. Fulminant amoebic colitis is very rarely associated with chemotherapy. Amoebic colitis should be considered in the differential diagnosis of patients who have bloody stools during chemotherapy.

  7. Combinatory action of VEGFR2 and MAP kinase pathways maintains endothelial-cell integrity

    Institute of Scientific and Technical Information of China (English)

    Hanbing Zhong; Danyang Wang; Nan Wang; Yesenia Rios; Haigen Huang; Song Li; Xinrong Wu; Shuo Lin

    2011-01-01

    Blood vessels normally maintain stereotyped lumen diameters and their stable structures are crucial for vascular function. However, very little is known about the molecular mechanisms controlling the maintenance of vessel diameters and the integrity of endothelial cells. We investigated this issue in zebrafish embryos by a chemical genetics approach. Small molecule libraries were screened using live Tg(kdrl:GRCFP)zn1 transgenic embryos in which endothelial cells are specifically labeled with GFP. By analyzing the effects of compounds on the morphology and function of embryonic blood vessels after lumen formation, PP1, a putative Src kinase inhibitor, was identified as capable of specifically reducing vascular lumen size by interrupting endothelial-cell integrity. The inhibitory effect is not due to Src or general VEGF signaling inhibition because another Src inhibitor and Src morpholino as well as several VEGFR inhibitors failed to produce a similar phenotype. After profiling a panel of 22 representative mammalian kinases and surveying published data, we selected a few possible new candidates. Combinational analysis of these candidate kinase inhibitors established that PP1 induced endothelial collapse by inhibiting both the VEGFR2 and MAP kinase pathways. More importantly, combinatory use of two clinically approved drugs Dasatinib and Sunitinib produced the same phenotype. This is the first study to elucidate the pathways controlling maintenance of endothelial integrity using a chemical genetics approach, indicating that endothelial integrity is controlled by the combined action of the VEGFR2 and MAP kinase pathways. Our results also suggest the possible side effect of the combination of two anticancer drugs on the circulatory system.

  8. Primary Amoebic Meningoencephalitis in an Iranian Infant

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi

    2012-01-01

    Full Text Available Introduction. Naegleria fowleri, a free living amoeba, can cause devastating and deadly diseases in humans. This is the first report of primary amoebic meningoencephalitis from Iran. Case report. A five-month-old male infant presented with the history of fever and eye gaze for three days, after beginning of bacterial meningitis, a plain and contrast CT revealed communicated hydrocephalus. In the repeat of CSF analysis on microscopic examination of wet preparation of CSF, Naegleria Fowleri was seen. Then, Amphotericin B and Rifampin were started. On followup, two months later, the patient was totally asymptomatic. Conclusion. Though occurrence of PAM is rare, this unusual disease has grave prognosis, so infection with free living amoebas must be considered in differential diagnosis of pediatric patients of purulent meningitis without evidence of bacteria on Gram’s stain and imaging findings, nonspecific brain edema on CT or hydrocephalus even without history of contact.

  9. Isolation of Legionella pneumophila from Pluvial Floods by Amoebal Coculture

    NARCIS (Netherlands)

    Schalk, J.A.C.; Docters van Leeuwen, A.E.; Lodder, W.J.; de Man-van der Vliet, H.; Euser, S.; den Boer, J.W.; de Roda Husman, A.M.

    2012-01-01

    Viable Legionella pneumophila bacteria were isolated by amoebal coculture from pluvial floods after intense rainfall and from water collected at sewage treatment plants. Several isolated L. pneumophila strains belonged to sequence types that have been previously identified in patients.

  10. Mapping of a liver phosphorylase kinase [alpha]-subunit gene on the mouse x chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Yan; Derry, J.M.J.; Barnard, P.J. (MRC Molecular Neurobiology Unit, Cambridge (United Kingdom)); Hendrickx, J.; Coucke, P.; Willems, P.R. (Univ. of Antwerp (Belgium))

    1993-01-01

    Phosphorylase kinase (PHK) is a regulatory enzyme of the glycogenolytic pathway composed of a complex of four subunits. We recently mapped the muscle [alpha]-subunit gene (Phka) to the mouse X chromosome in a region syntenic with the proximal long arm of the human X chromosome and containing the human homologue of this gene, PHKA. We now report the mapping of the liver [alpha]-subunit gene to the telomeric end of the mouse X chromosome. This mapping position would suggest a location for the human liver [alpha]-subunit gene on the proximal short arm of the X chromosome, a region recently implicated in X-linked liver glycogenosis (XLG). 20 refs., 2 figs.

  11. Amoebic ulcer of the male genitala: A rare case report

    Directory of Open Access Journals (Sweden)

    Mohanty Indrani

    2010-01-01

    Full Text Available Amoebic ulcer of the penis is a very rare clinical entity. We report a case of amoebic ulcer of the glans penis in a 47-year-old male homosexual, symptomatic with severe pain and foul-smelling hemopurulent discharge of acute onset. He had received systemic antibiotics like ciprofloxacin and azithromycin prior to presentation with no improvement. Diagnosis was confirmed by wet mount microscopic examination of the discharge. The patient responded well to a course of metronidazole.

  12. Involvement of the mitogen-activated protein (MAP kinase signalling pathway in host cell invasion by Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Robert-Gangneux F.

    2000-06-01

    Full Text Available Little is known about signalling in Toxoplasma gondii, but it is likely that protein kinases might play a key role in the parasite proliferation, differentiation and probably invasion. We previously characterized Mitogen-Activated Protein (MAP kinases in T. gondii lysates. In this study, cultured cells were tested for their susceptibility to Toxoplasma gondii infection after tachyzoite pretreatment with drugs interfering with AMP kinase activation pathways. Protein kinases inhibitors, i.e. genistein, R031-8220 and PD098059, reduced tachyzoite infectivity by 38 ± 4.5 %, 85.5 ± 9 % and 56 ± 10 %, respectively. Conversely, protein kinases activators, i.e. bombesin and PMA, markedly increased infectivity (by 202 ± 37 % and 258 ± 14 %, respectively. These results suggest that signalling pathways involving PKC and AAAP kinases play a role in host cell invasion by Toxoplasma.

  13. PSM/SH2-B distributes selected mitogenic receptor signals to distinct components in the PI3-kinase and MAP kinase signaling pathways.

    Science.gov (United States)

    Deng, Youping; Xu, Hu; Riedel, Heimo

    2007-02-15

    The Pro-rich, PH, and SH2 domain containing mitogenic signaling adapter PSM/SH2-B has been implicated as a cellular partner of various mitogenic receptor tyrosine kinases and related signaling mechanisms. Here, we report in a direct comparison of three peptide hormones, that PSM participates in the assembly of distinct mitogenic signaling complexes in response to insulin or IGF-I when compared to PDGF in cultured normal fibroblasts. The complex formed in response to insulin or IGF-I involves the respective peptide hormone receptor and presumably the established components leading to MAP kinase activation. However, our data suggest an alternative link from the PDGF receptor via PSM directly to MEK1/2 and consequently also to p44/42 activation, possibly through a scaffold protein. At least two PSM domains participate, the SH2 domain anticipated to link PSM to the respective receptor and the Pro-rich region in an association with an unidentified downstream component resulting in direct MEK1/2 and p44/42 regulation. The PDGF receptor signaling complex formed in response to PDGF involves PI 3-kinase in addition to the same components and interactions as described for insulin or IGF-I. PSM associates with PI 3-kinase via p85 and in addition the PSM PH domain participates in the regulation of PI 3-kinase activity, presumably through membrane interaction. In contrast, the PSM Pro-rich region appears to participate only in the MAP kinase signal. Both pathways contribute to the mitogenic response as shown by cell proliferation, survival, and focus formation. PSM regulates p38 MAP kinase activity in a pathway unrelated to the mitogenic response.

  14. Regulation of the MAP kinase cascade in PC12 cells: B-Raf activates MEK-1 (MAP kinase or ERK kinase) and is inhibited by cAMP

    DEFF Research Database (Denmark)

    Peraldi, P; Frödin, M; Barnier, J V

    1995-01-01

    the role of B-Raf in this process. We observed that NGF, PMA and cAMP induce the phosphorylation of B-Raf as well as an upward shift in its electrophoretic mobility. We show that B-Raf is activated following NGF and PMA treatment of PC12 cells, and that it can phosphorylate and activate MEK-1. However, c......AMP inhibits B-Raf autokinase activity as well as its ability to phosphorylate and activate MEK-1. This inhibition is likely to be due to a direct effect since we found that PKA phosphorylates B-Raf in vitro. Further, we show that B-Raf binds to p21ras, but more important, this binding to p21ras is virtually...... abolished with B-Raf from PC12 cells treated with CPT-cAMP. Hence, these data indicate that the PKA-mediated phosphorylation of B-Raf hampers its interaction with p21ras, which is responsible for the PKA-mediated decrease in B-Raf activity. Finally, our work suggests that in PC12 cells, cAMP stimulates MAP...

  15. Inhibition of fast axonal transport by pathogenic SOD1 involves activation of p38 MAP kinase.

    Directory of Open Access Journals (Sweden)

    Gerardo A Morfini

    Full Text Available Dying-back degeneration of motor neuron axons represents an established feature of familial amyotrophic lateral sclerosis (FALS associated with superoxide dismutase 1 (SOD1 mutations, but axon-autonomous effects of pathogenic SOD1 remained undefined. Characteristics of motor neurons affected in FALS include abnormal kinase activation, aberrant neurofilament phosphorylation, and fast axonal transport (FAT deficits, but functional relationships among these pathogenic events were unclear. Experiments in isolated squid axoplasm reveal that FALS-related SOD1 mutant polypeptides inhibit FAT through a mechanism involving a p38 mitogen activated protein kinase pathway. Mutant SOD1 activated neuronal p38 in mouse spinal cord, neuroblastoma cells and squid axoplasm. Active p38 MAP kinase phosphorylated kinesin-1, and this phosphorylation event inhibited kinesin-1. Finally, vesicle motility assays revealed previously unrecognized, isoform-specific effects of p38 on FAT. Axon-autonomous activation of the p38 pathway represents a novel gain of toxic function for FALS-linked SOD1 proteins consistent with the dying-back pattern of neurodegeneration characteristic of ALS.

  16. Intermittent hypoxia-induced endothelial barrier dysfunction requires ROS-dependent MAP kinase activation.

    Science.gov (United States)

    Makarenko, Vladislav V; Usatyuk, Peter V; Yuan, Guoxiang; Lee, May M; Nanduri, Jayasri; Natarajan, Viswanathan; Kumar, Ganesh K; Prabhakar, Nanduri R

    2014-04-15

    The objective of the present study was to determine the impact of simulated apnea with intermittent hypoxia (IH) on endothelial barrier function and assess the underlying mechanism(s). Experiments were performed on human lung microvascular endothelial cells exposed to IH-consisting alternating cycles of 1.5% O2 for 30s followed by 20% O2 for 5 min. IH decreased transendothelial electrical resistance (TEER) suggesting attenuated endothelial barrier function. The effect of IH on TEER was stimulus dependent and reversible after reoxygenation. IH-exposed cells exhibited stress fiber formation and redistribution of cortactin, vascular endothelial-cadherins, and zona occludens-1 junction proteins along with increased intercellular gaps at cell-cell boundaries. Extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) were phosphorylated in IH-exposed cells. Inhibiting either ERK or JNK prevented the IH-induced decrease in TEER and the reorganization of the cytoskeleton and junction proteins. IH increased reactive oxygen species (ROS) levels, and manganese (III) tetrakis (1-methyl-4-pyridyl) porphyrin pentachloride, a membrane-permeable antioxidant, prevented ERK and JNK phosphorylation as well as IH-induced changes in endothelial barrier function. These results demonstrate that IH via ROS-dependent activation of MAP kinases leads to reorganization of cytoskeleton and junction proteins resulting in endothelial barrier dysfunction.

  17. Identification and characterization of an ABA-activated MAP kinase cascade in Arabidopsis thaliana

    KAUST Repository

    Danquah, Agyemang

    2015-04-01

    Summary Abscisic acid (ABA) is a major phytohormone involved in important stress-related and developmental plant processes. Recent phosphoproteomic analyses revealed a large set of ABA-triggered phosphoproteins as putative mitogen-activated protein kinase (MAPK) targets, although the evidence for MAPKs involved in ABA signalling is still scarce. Here, we identified and reconstituted in vivo a complete ABA-activated MAPK cascade, composed of the MAP3Ks MAP3K17/18, the MAP2K MKK3 and the four C group MAPKs MPK1/2/7/14. In planta, we show that ABA activation of MPK7 is blocked in mkk3-1 and map3k17mapk3k18 plants. Coherently, both mutants exhibit hypersensitivity to ABA and altered expression of a set of ABA-dependent genes. A genetic analysis further reveals that this MAPK cascade is activated by the PYR/PYL/RCAR-SnRK2-PP2C ABA core signalling module through protein synthesis of the MAP3Ks, unveiling an atypical mechanism for MAPK activation in eukaryotes. Our work provides evidence for a role of an ABA-induced MAPK pathway in plant stress signalling. Significance Statement We report in this article the identification of a complete MAPK module, composed of MAP3K17/18, MKK3 and MPK1/2/7/14, which is activated by ABA through the ABA core signalling complex. We showed that the activation of this module requires the MAP3K protein synthesis which occurs after hours of stress treatment, suggesting that the pathway is involved in a delayed wave of cellular responses to ABA and drought. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  18. Rapamycin induces mitogen-activated protein (MAP) kinase phosphatase-1 (MKP-1) expression through activation of protein kinase B and mitogen-activated protein kinase kinase pathways.

    Science.gov (United States)

    Rastogi, Ruchi; Jiang, Zhongliang; Ahmad, Nisar; Rosati, Rita; Liu, Yusen; Beuret, Laurent; Monks, Robert; Charron, Jean; Birnbaum, Morris J; Samavati, Lobelia

    2013-11-22

    Mitogen-activated protein kinase phosphatase-1 (MKP-1), also known as dual specificity phosphatase-1 (DUSP-1), plays a crucial role in the deactivation of MAPKs. Several drugs with immune-suppressive properties modulate MKP-1 expression as part of their mechanism of action. We investigated the effect of mTOR inhibition through rapamycin and a dual mTOR inhibitor (AZD2014) on MKP-1 expression. Low dose rapamycin led to a rapid activation of both AKT and ERK pathways with a subsequent increase in MKP-1 expression. Rapamycin treatment led to phosphorylation of CREB, transcription factor 1 (ATF1), and ATF2, three transcription factors that bind to the cyclic AMP-responsive elements on the Mkp-1 promoter. Inhibition of either the MEK/ERK or the AKT pathway attenuated rapamycin-mediated MKP-1 induction. AZD2014 did not activate AKT but activated the ERK pathway, leading to a moderate MKP-1 induction. Using bone marrow-derived macrophages (BMDMs) derived from wild-type (WT) mice or mice deficient in AKT1 and AKT2 isoforms or BMDM from targeted deficiency in MEK1 and MEK2, we show that rapamycin treatment led to an increased MKP1 expression in BMDM from WT but failed to do so in BMDMs lacking the AKT1 isoform or MEK1 and MEK2. Importantly, rapamycin pretreatment inhibited LPS-mediated p38 activation and decreased nitric oxide and IL-6 production. Our work provides a conceptual framework for the observed immune modulatory effect of mTOR inhibition.

  19. Role of signal transduction crosstalk between adenylyl cyclase and MAP kinase in hippocampus-dependent memory.

    Science.gov (United States)

    Xia, Zhengui; Storm, Daniel R

    2012-08-16

    One of the intriguing questions in neurobiology is how long-term memory (LTM) traces are established and maintained in the brain. Memory can be divided into at least two temporally and mechanistically distinct forms. Short-term memory (STM) lasts no longer than several hours, while LTM persists for days or longer. A crucial step in the generation of LTM is consolidation, a process in which STM is converted to LTM. Hippocampus-dependent LTM depends on activation of Ca(2+), Erk/MAP kinase (MAPK), and cAMP signaling pathways, as well as de novo gene expression and translation. One of the transcriptional pathways strongly implicated in LTM is the CREB/CRE (calcium, cAMP response element) transcriptional pathway. Interestingly, this transcriptional pathway may also contribute to other forms of neuroplasticity including adaptive responses to drugs. Evidence discussed in this review indicates that activation of the Erk1/2 MAP Kinase (MAPK)/CRE transcriptional pathway during the formation of hippocampus-dependent memory depends on calmodulin (CaM)-stimulated adenylyl cyclases.

  20. An unusual MAP kinase is required for efficient penetration of the plant surface by Ustilago maydis.

    Science.gov (United States)

    Brachmann, Andreas; Schirawski, Jan; Müller, Philip; Kahmann, Regine

    2003-05-01

    In Ustilago maydis, pathogenic development is controlled by a heterodimer of the two homeodomain proteins bW and bE. We have identified by RNA fingerprinting a b-regulated gene, kpp6, which encodes an unusual MAP kinase. Kpp6 is similar to a number of other fungal MAP kinases involved in mating and pathogenicity, but contains an additional N-terminal domain unrelated to other proteins. Transcription of the kpp6 gene yields two transcripts differing in length, but encoding proteins of identical mass. One transcript is upregulated by the bW/bE heterodimer, while the other is induced after pheromone stimulation. kpp6 deletion mutants are attenuated in pathogenicity. kpp6(T355A,Y357F) mutants carrying a non-activatable allele of kpp6 are more severely compromised in pathogenesis. These strains can still form appressoria, but are defective in the subsequent penetration of the plant cuticle. Kpp6 is expressed during all stages of the sexual life cycle except mature spores. We speculate that Kpp6 may respond to a plant signal and regulate the genes necessary for efficient penetration of plant tissue.

  1. Valproate inhibits MAP kinase signalling and cell cycle progression in S. cerevisiae

    Science.gov (United States)

    Desfossés-Baron, Kristelle; Hammond-Martel, Ian; Simoneau, Antoine; Sellam, Adnane; Roberts, Stephen; Wurtele, Hugo

    2016-01-01

    The mechanism of action of valproate (VPA), a widely prescribed short chain fatty acid with anticonvulsant and anticancer properties, remains poorly understood. Here, the yeast Saccharomyces cerevisiae was used as model to investigate the biological consequences of VPA exposure. We found that low pH strongly potentiates VPA-induced growth inhibition. Transcriptional profiling revealed that under these conditions, VPA modulates the expression of genes involved in diverse cellular processes including protein folding, cell wall organisation, sexual reproduction, and cell cycle progression. We further investigated the impact of VPA on selected processes and found that this drug: i) activates markers of the unfolded protein stress response such as Hac1 mRNA splicing; ii) modulates the cell wall integrity pathway by inhibiting the activation of the Slt2 MAP kinase, and synergizes with cell wall stressors such as micafungin and calcofluor white in preventing yeast growth; iii) prevents activation of the Kss1 and Fus3 MAP kinases of the mating pheromone pathway, which in turn abolishes cellular responses to alpha factor; and iv) blocks cell cycle progression and DNA replication. Overall, our data identify heretofore unknown biological responses to VPA in budding yeast, and highlight the broad spectrum of cellular pathways influenced by this chemical in eukaryotes. PMID:27782169

  2. Entamoeba histolytica antigenic protein detected in pus aspirates from patients with amoebic liver abscess.

    Science.gov (United States)

    Othman, Nurulhasanah; Mohamed, Zeehaida; Yahya, Maya Mazuwin; Leow, Voon Meng; Lim, Boon Huat; Noordin, Rahmah

    2013-08-01

    Entamoeba histolytica is a causative agent of amoebic liver abscess (ALA) and is endemic in many underdeveloped countries. We investigated antigenic E. histolytica proteins in liver abscess aspirates using proteomics approach. Pus samples were first tested by real-time PCR to confirm the presence of E. histolytica DNA and the corresponding serum samples tested for E. histolytica-specific IgG by a commercial ELISA. Proteins were extracted from three and one pool(s) of pus samples from ALA and PLA (pyogenic liver abscess) patients respectively, followed by analysis using isoelectric focussing, SDS-PAGE and Western blot. Unpurified pooled serum samples from infected hamsters and pooled human amoebic-specific IgG were used as primary antibodies. The antigenic protein band was excised from the gel, digested and analysed by MALDI-TOF/TOF and LC-MS/MS. The results using both primary antibodies showed an antigenic protein band of ∼14kDa. Based on the mass spectrum analysis, putative tyrosine kinase is the most probable identification of the antigenic band.

  3. Primary Amoebic Meningoencephalitis in an Infant due to Naegleria fowleri

    Directory of Open Access Journals (Sweden)

    Vinay Khanna

    2011-01-01

    Full Text Available Primary amoebic meningoencephalitis (PAM caused by free-living amebae Naegleria fowleri is a rare and fatal condition. A fatal case of primary amoebic meningoencephalitis was diagnosed in a 5-month-old infant who presented with the history of decrease breast feeding, fever, vomiting, and abnormal body movements. Trophozoites of Naegleria fowleri were detected in the direct microscopic examination of CSF and infant was put on amphotericin B and ceftazidime. Patient condition deteriorated, and he was discharged against medical advice and subsequently expired. We also reviewed previously reported 8 Indian cases of primary amoebic meningoencephalitis (PAM and observed that for the last 5 years, none of the patients responded to amphotericin B. Has an era of amphotericin B-resistant Naegleria fowleri been emerged? Management strategy of PAM needs to be reviewed further.

  4. Fulminant amoebic enteritis that developed in the perinatal period.

    Science.gov (United States)

    Goto, Mayako; Mizushima, Yasuaki; Matsuoka, Tetsuya

    2015-06-25

    We present a case of a 30-year-old postpartum woman who delivered by caesarean section at 34 weeks. On postoperative day 9, she was admitted to our hospital in shock. Emergency abdominal surgery was performed. Massive purulent ascites collected in the abdominal cavity and was associated with intestinal necrosis, which extended from the ascending colon to one-third of the descending colon. The necrotic lesion was excised, and an artificial anus was constructed at the ileum end. A histological finding on the 15th day indicated the possibility of amoebic enteritis, and the patient was started on metronidazole therapy. The diarrhoea improved dramatically after metronidazole treatment was started. The patient was able to walk unassisted on the 45th day and was subsequently discharged. Amoebic enteritis has been thought to be epidemic in developing countries, but today, the incidence of amoebic enteritis as a sexually transmitted disease is increasing in developed countries.

  5. Purification of reversibly oxidized proteins (PROP reveals a redox switch controlling p38 MAP kinase activity.

    Directory of Open Access Journals (Sweden)

    Dennis J Templeton

    Full Text Available Oxidation of cysteine residues of proteins is emerging as an important means of regulation of signal transduction, particularly of protein kinase function. Tools to detect and quantify cysteine oxidation of proteins have been a limiting factor in understanding the role of cysteine oxidation in signal transduction. As an example, the p38 MAP kinase is activated by several stress-related stimuli that are often accompanied by in vitro generation of hydrogen peroxide. We noted that hydrogen peroxide inhibited p38 activity despite paradoxically increasing the activating phosphorylation of p38. To address the possibility that cysteine oxidation may provide a negative regulatory effect on p38 activity, we developed a biochemical assay to detect reversible cysteine oxidation in intact cells. This procedure, PROP, demonstrated in vivo oxidation of p38 in response to hydrogen peroxide and also to the natural inflammatory lipid prostaglandin J2. Mutagenesis of the potential target cysteines showed that oxidation occurred preferentially on residues near the surface of the p38 molecule. Cysteine oxidation thus controls a functional redox switch regulating the intensity or duration of p38 activity that would not be revealed by immunodetection of phosphoprotein commonly interpreted as reflective of p38 activity.

  6. The MAP kinase substrate MKS1 is a regulator of plant defense responses.

    Science.gov (United States)

    Andreasson, Erik; Jenkins, Thomas; Brodersen, Peter; Thorgrimsen, Stephan; Petersen, Nikolaj H T; Zhu, Shijiang; Qiu, Jin-Long; Micheelsen, Pernille; Rocher, Anne; Petersen, Morten; Newman, Mari-Anne; Bjørn Nielsen, Henrik; Hirt, Heribert; Somssich, Imre; Mattsson, Ole; Mundy, John

    2005-07-20

    Arabidopsis MAP kinase 4 (MPK4) functions as a regulator of pathogen defense responses, because it is required for both repression of salicylic acid (SA)-dependent resistance and for activation of jasmonate (JA)-dependent defense gene expression. To understand MPK4 signaling mechanisms, we used yeast two-hybrid screening to identify the MPK4 substrate MKS1. Analyses of transgenic plants and genome-wide transcript profiling indicated that MKS1 is required for full SA-dependent resistance in mpk4 mutants, and that overexpression of MKS1 in wild-type plants is sufficient to activate SA-dependent resistance, but does not interfere with induction of a defense gene by JA. Further yeast two-hybrid screening revealed that MKS1 interacts with the WRKY transcription factors WRKY25 and WRKY33. WRKY25 and WRKY33 were shown to be in vitro substrates of MPK4, and a wrky33 knockout mutant was found to exhibit increased expression of the SA-related defense gene PR1. MKS1 may therefore contribute to MPK4-regulated defense activation by coupling the kinase to specific WRKY transcription factors.

  7. First report of Entamoeba histolytica infection from Timor-Leste--acute amoebic colitis and concurrent late development of amoebic liver abscess in returned travellers to Australia.

    Science.gov (United States)

    Nourse, Clare B; Robson, Jennifer M; Whitby, Michael R; Francis, Josh R

    2016-02-01

    This communication reports invasive amoebic colitis and late onset amoebic liver abscess in three members of a group of 12 Australian travellers to Timor-Leste (TL). This is the first report of Entamoeba histolytica infection from TL. Clinicians in Australia need to consider amoebiasis in the differential diagnosis in travellers returning with colitis, abdominal pain and fever. Presentation with amoebic liver abscess months after exposure is rare but should be suspected in symptomatic individuals with a relevant history of travel.

  8. The MAP kinase-activated protein kinase Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen Candida albicans.

    Science.gov (United States)

    Li, Xichuan; Du, Wei; Zhao, Jingwen; Zhang, Lilin; Zhu, Zhiyan; Jiang, Linghuo

    2010-06-01

    Rck2p is the Hog1p-MAP kinase-activated protein kinase required for the attenuation of protein synthesis in response to an osmotic challenge in Saccharomyces cerevisiae. Rck2p also regulates rapamycin sensitivity in both S. cerevisiae and Candida albicans. In this study, we demonstrate that the deletion of CaRCK2 renders C. albicans cells sensitive to, and CaRck2p translocates from the cytosol to the nucleus in response to, cell wall stresses caused by Congo red, Calcoflor White, elevated heat and zymolyase. However, the kinase activity of CaRck2p is not required for the cellular response to these cell wall stresses. Furthermore, transcripts of cell wall protein-encoding genes CaBGL2, CaHWP1 and CaXOG1 are reduced in C. albicans cells lacking CaRCK2. The deletion of CaRCK2 also reduces the in vitro filamentation of C. albicans and its virulence in a mouse model of systemic candidasis. The kinase activity of CaRck2p is required for the virulence, but not for the in vitro filamentation, in C. albicans. Therefore, Rck2p regulates cellular responses to cell wall stresses, filamentation and virulence in the human fungal pathogen C. albicans.

  9. Protein kinase D stabilizes aldosterone-induced ERK1/2 MAP kinase activation in M1 renal cortical collecting duct cells to promote cell proliferation.

    LENUS (Irish Health Repository)

    McEneaney, Victoria

    2010-01-01

    Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.

  10. Adiponectin inhibits neutrophil apoptosis via activation of AMP kinase, PKB and ERK 1/2 MAP kinase.

    Science.gov (United States)

    Rossi, Alessandra; Lord, Janet M

    2013-12-01

    Neutrophils are abundant, short-lived leukocytes that play a key role in the immune defense against microbial infections. These cells die by apoptosis following activation and uptake of microbes and will also enter apoptosis spontaneously at the end of their lifespan if they do not encounter a pathogen. Adiponectin exerts anti-inflammatory effects on neutrophil antimicrobial functions, but whether this abundant adipokine influences neutrophil apoptosis is unknown. Here we report that adiponectin in the physiological range (1-10 μg/ml) reduced apoptosis in resting neutrophils, decreasing caspase-3 cleavage and maintaining Mcl-1 expression by stabilizing this anti-apoptotic protein. We show that adiponectin induced phosphorylation of AMP-activated kinase (AMPK), protein kinase B (PKB), extracellular signal-regulated kinase (ERK 1/2) and p38 mitogen activated protein kinase (MAPK). Pharmacological inhibition of AMPK, PKB and ERK 1/2 ablated the pro-survival effects of adiponectin and treatment of neutrophils with an AMPK specific activator (AICAR) and AMPK inhibitor (compound C) respectively decreased and increased apoptosis. Finally, activation of AMPK by AICAR or adiponectin also decreased ceramide accumulation in the neutrophil cell membrane, a process involved in the early stages of spontaneous apoptosis, giving another possible mechanism downstream of AMPK activation for the inhibition of neutrophil apoptosis.

  11. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Science.gov (United States)

    Kim, Tae-Hwan; Kwak, Yi-Seong; Kim, Na-Mi; Kim, Seung-Hyung

    2017-01-01

    Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin's effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun) activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound's potential as a candidate anti-inflammatory agent. PMID:28316375

  12. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Directory of Open Access Journals (Sweden)

    Mehari Endale

    2017-01-01

    Full Text Available Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin’s effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound’s potential as a candidate anti-inflammatory agent.

  13. Panaxynol induces neurite outgrowth in PC12D cells via cAMP- and MAP kinase-dependent mechanisms.

    Science.gov (United States)

    Wang, Ze-Jian; Nie, Bao-Ming; Chen, Hong-Zhuan; Lu, Yang

    2006-01-05

    Panaxynol, a polyacetylene ((3R)-heptadeca-1,9-diene-4,6-diyn-3-ol; syn. falcarinol), was isolated from the lipophilic fractions of Panax notoginseng, a Chinese traditional medicinal plant. In the present study, we reported the neurotrophic effects of panaxynol on PC12D cells and mechanism involved in neurite outgrowth of the cells. Panaxynol could morphologically promote neurite outgrowth in PC12D cells, concentration-dependently reduce cell division and up-regulate molecular marker (MAP1B) expression in PC12D cells. Panaxynol induces the elevation of intracellular cAMP in PC12D cells. The neurite outgrowth in PC12D cells induced by panaxynol could be inhibited by the protein kinase A inhibitor RpcAMPS and by MAP kinase kinase 1/2 inhibitor U0126. These observations reveal that panaxynol could induce the differentiation of PC12D cells in a process similar to but distinct from that of NGF and the panaxynol's effects were via cAMP- and MAP kinase-dependent mechanisms.

  14. Dual role for membrane localization in yeast MAP kinase cascade activation and its contribution to signaling fidelity.

    Science.gov (United States)

    Lamson, Rachel E; Takahashi, Satoe; Winters, Matthew J; Pryciak, Peter M

    2006-03-21

    Distinct MAP kinase pathways in yeast share several signaling components , including the PAK Ste20 and the MAPKKK Ste11, yet signaling is specific. Mating pheromones trigger an initial step in which Ste20 activates Ste11 , and this requires plasma membrane recruitment of the MAP kinase cascade scaffold protein, Ste5 . Here, we demonstrate an additional role for Ste5 membrane localization. Once Ste11 is activated, signaling through the mating pathway remains minimal but is substantially amplified when Ste5 is recruited to the membrane either by the Gbetagamma dimer or by direct membrane targeting, even to internal membranes. Ste11 signaling is also amplified by Ste5 oligomerization and by a hyperactivating mutation in the Ste7 binding region of Ste5. We suggest a model in which membrane recruitment of Ste5 concentrates its binding partners and thereby amplifies signaling through the kinase cascade. We find similar behavior in the osmotically responsive HOG pathway. Remarkably, while both pheromone and hyperosmotic stimuli amplify signaling from constitutively active Ste11, the resulting signaling output remains pathway specific. These findings suggest a common mode of regulation in which pathway stimuli both initiate and amplify MAP kinase cascade signaling. The regulation of rate-limiting steps that lie after a branchpoint from shared components helps ensure signaling specificity.

  15. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4 tumor suppressor gene in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Ryland Georgina L

    2011-05-01

    Full Text Available Abstract Background MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. Methods We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. Results In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. Conclusions MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort.

  16. Phosphorylation of MAP65-1 by Arabidopsis Aurora Kinases Is Required for Efficient Cell Cycle Progression1[OPEN

    Science.gov (United States)

    Weimer, Annika K.; Stoppin-Mellet, Virginie; Kosetsu, Ken; Cedeño, Cesyen; Jaquinod, Michel; Njo, Maria; De Milde, Liesbeth; Tompa, Peter; Inzé, Dirk; Beeckman, Tom; Vantard, Marylin

    2017-01-01

    Aurora kinases are key effectors of mitosis. Plant Auroras are functionally divided into two clades. The alpha Auroras (Aurora1 and Aurora2) associate with the spindle and the cell plate and are implicated in controlling formative divisions throughout plant development. The beta Aurora (Aurora3) localizes to centromeres and likely functions in chromosome separation. In contrast to the wealth of data available on the role of Aurora in other kingdoms, knowledge on their function in plants is merely emerging. This is exemplified by the fact that only histone H3 and the plant homolog of TPX2 have been identified as Aurora substrates in plants. Here we provide biochemical, genetic, and cell biological evidence that the microtubule-bundling protein MAP65-1—a member of the MAP65/Ase1/PRC1 protein family, implicated in central spindle formation and cytokinesis in animals, yeasts, and plants—is a genuine substrate of alpha Aurora kinases. MAP65-1 interacts with Aurora1 in vivo and is phosphorylated on two residues at its unfolded tail domain. Its overexpression and down-regulation antagonistically affect the alpha Aurora double mutant phenotypes. Phospho-mutant analysis shows that Aurora contributes to the microtubule bundling capacity of MAP65-1 in concert with other mitotic kinases. PMID:27879390

  17. Amoebic PI3K and PKC is required for Jurkat T cell death induced by Entamoeba histolytica.

    Science.gov (United States)

    Lee, Young Ah; Kim, Kyeong Ah; Min, Arim; Shin, Myeong Heon

    2014-08-01

    The enteric protozoan parasite Entamoeba histolytica is the causative agent of human amebiasis. During infection, adherence of E. histolytica through Gal/GalNAc lectin on the surface of the amoeba can induce caspase-3-dependent or -independent host cell death. Phosphorylinositol 3-kinase (PI3K) and protein kinase C (PKC) in E. histolytica play an important function in the adhesion, killing, or phagocytosis of target cells. In this study, we examined the role of amoebic PI3K and PKC in amoeba-induced apoptotic cell death in Jurkat T cells. When Jurkat T cells were incubated with E. histolytica trophozoites, phosphatidylserine (PS) externalization and DNA fragmentation in Jurkat cells were markedly increased compared to those of cells incubated with medium alone. However, when amoebae were pretreated with a PI3K inhibitor, wortmannin before being incubated with E. histolytica, E. histolytica-induced PS externalization and DNA fragmentation in Jurkat cells were significantly reduced compared to results for amoebae pretreated with DMSO. In addition, pretreatment of amoebae with a PKC inhibitor, staurosporine strongly inhibited Jurkat T cell death. However, E. histolytica-induced cleavage of caspase-3, -6, and -7 were not inhibited by pretreatment of amoebae with wortmannin or staurosporin. In addition, we found that amoebic PI3K and PKC have an important role on amoeba adhesion to host compartment. These results suggest that amebic PI3K and PKC activation may play an important role in caspase-independent cell death in Entamoeba-induced apoptosis.

  18. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Science.gov (United States)

    Jandric, Zeljkica; Gregori, Christa; Klopf, Eva; Radolf, Martin; Schüller, Christoph

    2013-01-01

    Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in C. glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologs CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG) pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species and it required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway. PMID:24324463

  19. Sorbic acid stress activates the Candida glabrata high osmolarity glycerol MAP kinase pathway

    Directory of Open Access Journals (Sweden)

    Zeljkica eJandric

    2013-11-01

    Full Text Available Weak organic acids such as sorbic acid are important food preservatives and powerful fungistatic agents. These compounds accumulate in the cytosol and disturb the cellular pH and energy homeostasis. Candida glabrata is in many aspects similar to Saccharomyces cerevisiae. However, with regard to confrontation to sorbic acid, two of the principal response pathways behave differently in Candida glabrata. In yeast, sorbic acid stress causes activation of many genes via the transcription factors Msn2 and Msn4. The C. glabrata homologues CgMsn2 and CgMsn4 are apparently not activated by sorbic acid. In contrast, in C. glabrata the high osmolarity glycerol (HOG pathway is activated by sorbic acid. Here we show that the MAP kinase of the HOG pathway, CgHog1, becomes phosphorylated and has a function for weak acid stress resistance. Transcript profiling of weak acid treated C. glabrata cells suggests a broad and very similar response pattern of cells lacking CgHog1 compared to wild type which is over lapping with but distinct from S. cerevisiae. The PDR12 gene was the highest induced gene in both species, and required CgHog1 for full expression. Our results support flexibility of the response cues for general stress signaling pathways, even between closely related yeasts, and functional extension of a specific response pathway.

  20. Lck is involved in interleukin-2 induced proliferation but not cell survival in human T cells through a MAP kinase-independent pathway

    DEFF Research Database (Denmark)

    Brockdorff, J; Nielsen, M; Kaltoft, K;

    2000-01-01

    found that an IL-2-sensitive, human mycosis fungoides-derived tumor T cell line is Lck negative, and that the IL-2-induced MAP kinase activation is comparable to non-cancerous T cells, although a little delayed in kinetics. An Lck expressing clone was established by transfecting Lck into mycosis...... fungoides tumor T cells, but Lck had no influence on the delayed kinetics of MAP kinase activation, indicating that Lck is not essential for MAP kinase activation in mycosis fungoides tumor T cells or in non-cancerous T cells. Taken together, this indicates that Lck is involved in IL-2-induced proliferation...

  1. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Serena A D'Souza

    2016-04-01

    Full Text Available The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  2. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans.

    Science.gov (United States)

    D'Souza, Serena A; Rajendran, Luckshika; Bagg, Rachel; Barbier, Louis; van Pel, Derek M; Moshiri, Houtan; Roy, Peter J

    2016-04-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle's plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue.

  3. The MADD-3 LAMMER Kinase Interacts with a p38 MAP Kinase Pathway to Regulate the Display of the EVA-1 Guidance Receptor in Caenorhabditis elegans

    Science.gov (United States)

    D’Souza, Serena A.; Rajendran, Luckshika; Bagg, Rachel; van Pel, Derek M.; Moshiri, Houtan; Roy, Peter J.

    2016-01-01

    The proper display of transmembrane receptors on the leading edge of migrating cells and cell extensions is essential for their response to guidance cues. We previously discovered that MADD-4, which is an ADAMTSL secreted by motor neurons in Caenorhabditis elegans, interacts with an UNC-40/EVA-1 co-receptor complex on muscles to attract plasma membrane extensions called muscle arms. In nematodes, the muscle arm termini harbor the post-synaptic elements of the neuromuscular junction. Through a forward genetic screen for mutants with disrupted muscle arm extension, we discovered that a LAMMER kinase, which we call MADD-3, is required for the proper display of the EVA-1 receptor on the muscle’s plasma membrane. Without MADD-3, EVA-1 levels decrease concomitantly with a reduction of the late-endosomal marker RAB-7. Through a genetic suppressor screen, we found that the levels of EVA-1 and RAB-7 can be restored in madd-3 mutants by eliminating the function of a p38 MAP kinase pathway. We also found that EVA-1 and RAB-7 will accumulate in madd-3 mutants upon disrupting CUP-5, which is a mucolipin ortholog required for proper lysosome function. Together, our data suggests that the MADD-3 LAMMER kinase antagonizes the p38-mediated endosomal trafficking of EVA-1 to the lysosome. In this way, MADD-3 ensures that sufficient levels of EVA-1 are present to guide muscle arm extension towards the source of the MADD-4 guidance cue. PMID:27123983

  4. Taking a bite: Amoebic trogocytosis in Entamoeba histolytica and beyond.

    Science.gov (United States)

    Ralston, Katherine S

    2015-12-01

    Entamoeba histolytica is a diarrheal pathogen with the ability to cause profound host tissue damage. This organism possesses contact-dependent cell killing activity, which is likely to be a major contributor to tissue damage. E. histolytica trophozoites were recently shown to ingest fragments of living human cells. It was demonstrated that this process, termed amoebic trogocytosis, contributes to cell killing. Recent advances in ex vivo and 3-D cell culture approaches have shed light on mechanisms for tissue destruction by E. histolytica, allowing amoebic trogocytosis to be placed in the context of additional host and pathogen mediators of tissue damage. In addition to its relevance to pathogenesis of amoebiasis, an appreciation is emerging that intercellular nibbling occurs in many organisms, from protozoa to mammals.

  5. Genetic analysis of the Arabidopsis protein kinases MAP3Kε1 and MAP3Kε2 indicates roles in cell expansion and embryo development.

    Science.gov (United States)

    Chaiwongsar, Suraphon; Strohm, Allison K; Su, Shih-Heng; Krysan, Patrick J

    2012-01-01

    MAP3Kε1 and MAP3Kε2 are a pair of Arabidopsis thaliana genes that encode protein kinases related to cdc7p from Saccharomyces cerevisiae. We have previously shown that the map3kε1;map3kε2 double-mutant combination causes pollen lethality. In this study, we have used an ethanol-inducible promoter construct to rescue this lethal phenotype and create map3kε1(-/-);map3kε2(-/-) double-mutant plants in order to examine the function of these genes in the sporophyte. These rescued double-mutant plants carry a yellow fluorescent protein (YFP)-MAP3Kε1 transgene under the control of the alcohol-inducible AlcA promoter from Aspergillus nidulans. The double-mutant plants were significantly smaller and had shorter roots than wild-type when grown in the absence of ethanol treatment. Microscopic analysis indicated that cell elongation was reduced in the roots of the double-mutant plants and cell expansion was reduced in rosette leaves. Treatment with ethanol to induce expression of YFP-MAP3Kε1 largely rescued the leaf phenotypes. The double-mutant combination also caused embryos to arrest in the early stages of development. Through the use of YFP reporter constructs we determined that MAP3Kε1 and MAP3Kε2 are expressed during embryo development, and also in root tissue. Our results indicate that MAP3Kε1 and MAP3Kε2 have roles outside of pollen development and that these genes affect several aspects of sporophyte development.

  6. Context Specificity of Stress-activated Mitogen-activated Protein (MAP) Kinase Signaling: The Story as Told by Caenorhabditis elegans.

    Science.gov (United States)

    Andrusiak, Matthew G; Jin, Yishi

    2016-04-01

    Stress-associated p38 and JNK mitogen-activated protein (MAP) kinase signaling cascades trigger specific cellular responses and are involved in multiple disease states. At the root of MAP kinase signaling complexity is the differential use of common components on a context-specific basis. The roundwormCaenorhabditis eleganswas developed as a system to study genes required for development and nervous system function. The powerful genetics ofC. elegansin combination with molecular and cellular dissections has led to a greater understanding of how p38 and JNK signaling affects many biological processes under normal and stress conditions. This review focuses on the studies revealing context specificity of different stress-activated MAPK components inC. elegans.

  7. Underestimated Amoebic Appendicitis among HIV-1-Infected Individuals in Japan

    Science.gov (United States)

    Kobayashi, Taiichiro; Yano, Hideaki; Murata, Yukinori; Igari, Toru; Nakada-Tsukui, Kumiko; Yagita, Kenji; Nozaki, Tomoyoshi; Kaku, Mitsuo; Tsukada, Kunihisa; Gatanaga, Hiroyuki; Kikuchi, Yoshimi; Oka, Shinichi

    2016-01-01

    ABSTRACT Entamoeba histolytica is not a common causative agent of acute appendicitis. However, amoebic appendicitis can sometimes be severe and life threatening, mainly due to a lack of awareness. Also, its frequency, clinical features, and pathogenesis remain unclear. The study subjects were HIV-1-infected individuals who presented with acute appendicitis and later underwent appendectomy at our hospital between 1996 and 2014. Formalin-fixed paraffin-embedded preserved appendix specimens were reexamined by periodic acid-Schiff (PAS) staining and PCR to identify undiagnosed amoebic appendicitis. Appendectomies were performed in 57 patients with acute appendicitis. The seroprevalence of E. histolytica was 33% (14/43) from the available stored sera. Based on the medical records, only 3 cases were clinically diagnosed as amoebic appendicitis, including 2 diagnosed at the time of appendectomy and 1 case diagnosed by rereview of the appendix after the development of postoperative complications. Retrospective analyses using PAS staining and PCR identified 3 and 3 more cases, respectively. Thus, E. histolytica infection was confirmed in 9 cases (15.8%) in the present study. Apart from a significantly higher leukocyte count in E. histolytica-positive patients than in negative patients (median, 13,760 versus 10,385 cells/μl, respectively, P = 0.02), there were no other differences in the clinical features of the PCR-positive and -negative groups. In conclusion, E. histolytica infection was confirmed in 9 (15.8%) of the appendicitis cases. However, only 3, including one diagnosed after intestinal perforation, were diagnosed before the present analyses. These results strongly suggest there is frequently a failure to detect trophozoites in routine examination, resulting in an underestimation of the incidence of amoebic appendicitis. PMID:27847377

  8. Mycosporine-Like Amino Acids Promote Wound Healing through Focal Adhesion Kinase (FAK and Mitogen-Activated Protein Kinases (MAP Kinases Signaling Pathway in Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yun-Hee Choi

    2015-11-01

    Full Text Available Mycosporine-like amino acids (MAAs are secondary metabolites found in diverse marine, freshwater, and terrestrial organisms. Evidence suggests that MAAs have several beneficial effects on skin homeostasis such as protection against UV radiation and reactive oxygen species (ROS. In addition, MAAs are also involved in the modulation of skin fibroblasts proliferation. However, the regulatory function of MAAs on wound repair in human skin is not yet clearly elucidated. To investigate the roles of MAAs on the wound healing process in human keratinocytes, three MAAs, Shinorine (SH, Mycosporine-glycine (M-Gly, and Porphyra (P334 were purified from Chlamydomonas hedlyei and Porphyra yezoensis. We found that SH, M-Gly, and P334 have significant effects on the wound healing process in human keratinocytes and these effects were mediated by activation of focal adhesion kinases (FAK, extracellular signal-regulated kinases (ERK, and c-Jun N-terminal kinases (JNK. These results suggest that MAAs accelerate wound repair by activating the FAK-MAPK signaling pathways. This study also indicates that MAAs can act as a new wound healing agent and further suggests that MAAs might be a novel biomaterial for wound healing therapies.

  9. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea.

    Science.gov (United States)

    Leroch, Michaela; Mueller, Nathalie; Hinsenkamp, Isabel; Hahn, Matthias

    2015-10-01

    Botrytis cinerea is a necrotrophic fungus that infects a wide range of fruit, vegetable and flower crops. Penetration of the host cuticle occurs via infection structures that are formed in response to appropriate plant surface signals. The differentiation of these structures requires a highly conserved mitogen-activated protein (MAP) kinase cascade including the MAP kinase BMP1. In yeast and several plant-pathogenic fungi, the signalling mucin Msb2 has been shown to be involved in surface recognition and MAP kinase activation. In this study, a B. cinerea msb2 mutant was generated and characterized. The mutant showed normal growth, sporulation, sclerotia formation and stress resistance. In the absence of nutrients, abnormal germination with multiple germ tubes was observed. In the presence of sugars, normal germination occurred, but msb2 germlings were almost unable to form appressoria or infection cushions on hard surfaces. Nevertheless, the msb2 mutant showed only a moderate delay in lesion formation on different host plants, and formed expanding lesions similar to the wild-type. Although the wild-type showed increasing BMP1 phosphorylation during the first hours of germination on hard surfaces, the phosphorylation levels in the msb2 mutant were strongly reduced. Several genes encoding secreted proteins were found to be co-regulated by BMP1 and Msb2 during germination. Taken together, B. cinerea Msb2 is likely to represent a hard surface sensor of germlings and hyphae that triggers infection structure formation via the activation of the BMP1 MAP kinase pathway.

  10. Stimulation of MAP kinase pathways after maternal IL-1β exposure induces fetal lung fluid absorption in guinea pigs

    Directory of Open Access Journals (Sweden)

    Carter Ethan P

    2007-03-01

    Full Text Available Abstract Background We tested the hypothesis that maternal interleukin-1β (IL-1β pretreatment and induction of fetal cortisol synthesis activates MAP kinases and thereby affects lung fluid absorption in preterm guinea pigs. Methods IL-1β was administered subcutaneously daily to timed-pregnant guinea pigs for three days. Fetuses were obtained by abdominal hysterotomy and instilled with isosmolar 5% albumin into the lungs and lung fluid movement was measured over 1 h by mass balance. MAP kinase expression was measured by western blot. Results Lung fluid absorption was induced at 61 days (D gestation and stimulated at 68D gestation by IL-1β. Maternal IL-1β pretreatment upregulated ERK and upstream MEK expression at both 61 and 68D gestation, albeit being much more pronounced at 61D gestation. U0126 instillation completely blocked IL-1β-induced lung fluid absorption as well as IL-1β-induced/stimulated ERK expression. Cortisol synthesis inhibition by metyrapone attenuated ERK expression and lung fluid absorption in IL-1β-pretreated fetal lungs. JNK expression after maternal IL-1β pretreatment remained unaffected at either gestation age. Conclusion These data implicate the ERK MAP kinase pathway as being important for IL-1β induction/stimulation of lung fluid absorption in fetal guinea pigs.

  11. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    Science.gov (United States)

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  12. Activation of the Cph1-dependent MAP kinase signaling pathway induces white-opaque switching in Candida albicans.

    Directory of Open Access Journals (Sweden)

    Bernardo Ramírez-Zavala

    Full Text Available Depending on the environmental conditions, the pathogenic yeast Candida albicans can undergo different developmental programs, which are controlled by dedicated transcription factors and upstream signaling pathways. C. albicans strains that are homozygous at the mating type locus can switch from the normal yeast form (white to an elongated cell type (opaque, which is the mating-competent form of this fungus. Both white and opaque cells use the Ste11-Hst7-Cek1/Cek2 MAP kinase signaling pathway to react to the presence of mating pheromone. However, while opaque cells employ the transcription factor Cph1 to induce the mating response, white cells recruit a different downstream transcription factor, Tec1, to promote the formation of a biofilm that facilitates mating of opaque cells in the population. The switch from the white to the opaque cell form is itself induced by environmental signals that result in the upregulation of the transcription factor Wor1, the master regulator of white-opaque switching. To get insight into the upstream signaling pathways controlling the switch, we expressed all C. albicans protein kinases from a tetracycline-inducible promoter in a switching-competent strain. Screening of this library of strains showed that a hyperactive form of Ste11 lacking its N-terminal domain (Ste11(ΔN467 efficiently stimulated white cells to switch to the opaque phase, a behavior that did not occur in response to pheromone. Ste11(ΔN467-induced switching specifically required the downstream MAP kinase Cek1 and its target transcription factor Cph1, but not Cek2 and Tec1, and forced expression of Cph1 also promoted white-opaque switching in a Wor1-dependent manner. Therefore, depending on the activation mechanism, components of the pheromone-responsive MAP kinase pathway can be reconnected to stimulate an alternative developmental program, switching of white cells to the mating-competent opaque phase.

  13. Translational control of myelin basic protein expression by ERK2 MAP kinase regulates timely remyelination in the adult brain.

    Science.gov (United States)

    Michel, Kelly; Zhao, Tianna; Karl, Molly; Lewis, Katherine; Fyffe-Maricich, Sharyl L

    2015-05-20

    Successful myelin repair in the adult CNS requires the robust and timely production of myelin proteins to generate new myelin sheaths. The underlying regulatory mechanisms and complex molecular basis of myelin regeneration, however, remain poorly understood. Here, we investigate the role of ERK MAP kinase signaling in this process. Conditional deletion of Erk2 from cells of the oligodendrocyte lineage resulted in delayed remyelination following demyelinating injury to the adult mouse corpus callosum. The delayed repair occurred as a result of a specific deficit in the translation of the major myelin protein, MBP. In the absence of ERK2, activation of the ribosomal protein S6 kinase (p70S6K) and its downstream target, ribosomal protein S6 (S6RP), was impaired at a critical time when premyelinating oligodendrocytes were transitioning to mature cells capable of generating new myelin sheaths. Thus, we have described an important link between the ERK MAP kinase signaling cascade and the translational machinery specifically in remyelinating oligodendrocytes in vivo. These results suggest an important role for ERK2 in the translational control of MBP, a myelin protein that appears critical for ensuring the timely generation of new myelin sheaths following demyelinating injury in the adult CNS.

  14. STATE OF JNK AND P38 MAP-KINASE SYSTEM IN BLOOD monon uclea r le ucocytes DUR ING INFLAMMATION

    Directory of Open Access Journals (Sweden)

    N. Y. Chasovskih

    2009-01-01

    Full Text Available Abstract. Pogrammed cell death of peripheral blood mononuclear leucocytes from patients with acute inflammatory diseases (non-nosocomial pneumonia, acute appendicitis was investigated under ex vivo conditions, upon cultivation of the cells with selective inhibitors of JNK (SP600125 and р38 МАРК (ML3403. In vitro addition of SP600125 and ML3403 under oxidative stress conditions prevents increase of annexinpositive mononuclear cells numbers, thus suggesting JNK and р38 МАР-kinases to be involved into oxidative mechanisms of apoptosis deregulation. A role of JNK in IL-8 production by mononuclear leucocytes was revealed in cases of acute inflammation. Regulatory effect of JNK and p38 MAP-kinases can be mediated through activation of redox-sensitive apoptogenic signal transduction systems, as well as due to changes in cellular cytokine-producing function.

  15. Neuronal development in Caenorhabditis elegans is regulated by inhibition of an MLK MAP kinase pathway.

    Science.gov (United States)

    Baker, Scott T; Turgeon, Shane M; Tulgren, Erik D; Wigant, Jeanne; Rahimi, Omeed; Opperman, Karla J; Grill, Brock

    2015-01-01

    We show that loss-of-function mutations in kinases of the MLK-1 pathway (mlk-1, mek-1, and kgb-1/jnk) function cell-autonomously in neurons to suppress defects in synapse formation and axon termination caused by rpm-1 loss of function. Our genetic analysis also suggests that the phosphatase PPM-1, like RPM-1, is a potential inhibitor of kinases in the MLK-1 pathway.

  16. CLINICAL PRESENTATION AND MANAGEMENT OF AMOEBIC LIVER ABSCESS

    Directory of Open Access Journals (Sweden)

    Naveen

    2015-12-01

    Full Text Available BACKGROUND AND OBJECTIVES ALA has gained importance during recent years as a result of increasing world travel, economic globalization and the growing number of chronically immunosuppressed people. AIDS and the increasing use of organ transplants have led to a new population at risk. In our study we aimed to analyse the clinical presentation and management of Amoebic liver abscess at Sree Rajarajeshwari Medical College and Hospital, Bangalore. METHODS A hospital based prospective observational study was conducted between Dec. 2013 to June 2015 in Sree Rajarajeshwari Medical College and Hospital, Bangalore. All patients admitted with suspicion of liver abscess were confirmed with ultrasonography. After establishing sonological diagnosis according to criteria, the treatment was started from the day of admission which consisted of Antibiotics, USG guided Aspiration, Pigtail catheterization and Open surgical Drainage. RESULTS Forty five cases of Amoebic liver abscess were studied; 28 patients (62% were between 21 and 40 years of age. Male-to-Female ratio was 14:1. All the patients were from rural background. History of alcoholism was present in 10 patients (22.2%. Plain X-ray abdomen showed signs of peritonitis in 2 patients. Right lobe of liver was involved in 40 cases and left lobe in 3 cases. Both lobes were involved in 2 cases. Twenty six cases were treated conservatively, 11 cases by aspiration, 6 patients by pigtail catheterization. Two patients underwent open surgical drainage for perforated liver abscess. Complications noted in our series were rupture into peritoneal cavity in 2 cases; mortality was seen in 1 case. CONCLUSION Amoebic liver abscess is still one of the commonest parasitic infections of the liver in developing countries. Prompt diagnosis, aggressive medical treatment along with minimal intervention can keep the morbidity and mortality associated with this condition to a bare minimum. The scope of surgery in this condition is

  17. Residual amoebic liver abscess in a prospective renal transplant recipient

    Directory of Open Access Journals (Sweden)

    Ashish V Choudhrie

    2012-01-01

    Full Text Available Amoebic liver abscess (ALA is by far the most common extraintestinal manifestation of invasive amoebiasis. The vast majority of these resolve with treatment; however, a small percentage of the treated ALAs are known to persist asymptomatically. Herein, we present a prospective renal allograft recipient with a residual liver abscess who had a successful renal transplant after treatment. In our opinion, persistence of a radiological finding of residual abscess in the absence of clinical disease does not appear to be a contraindication to renal transplantation.

  18. Gene for the catalytic subunit of mouse DNA-dependent protein kinase maps to the scid locus.

    Science.gov (United States)

    Miller, R D; Hogg, J; Ozaki, J H; Gell, D; Jackson, S P; Riblet, R

    1995-01-01

    The gene encoding the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) has been proposed recently as a candidate gene for the mouse severe combined immune deficiency (scid) locus. We have used a partial cDNA clone for human DNA-PKcs to map the mouse homologue using a large interspecific backcross panel. We found that the mouse gene for DNA-PKcs does not recombine with scid, consistent with the hypothesis that scid is a mutation in the mouse gene for DNA-PKcs. Images Fig. 3 PMID:7479885

  19. Gene-Environment Interactions Target Mitogen-activated Protein 3 Kinase 1 (MAP3K1) Signaling in Eyelid Morphogenesis*

    Science.gov (United States)

    Mongan, Maureen; Meng, Qinghang; Wang, Jingjing; Kao, Winston W.-Y.; Puga, Alvaro; Xia, Ying

    2015-01-01

    Gene-environment interactions determine the biological outcomes through mechanisms that are poorly understood. Mouse embryonic eyelid closure is a well defined model to study the genetic control of developmental programs. Using this model, we investigated how exposure to dioxin-like environmental pollutants modifies the genetic risk of developmental abnormalities. Our studies reveal that mitogen-activated protein 3 kinase 1 (MAP3K1) signaling is a focal point of gene-environment cross-talk. Dioxin exposure, acting through the aryl hydrocarbon receptor (AHR), blocked eyelid closure in genetic mutants in which MAP3K1 signaling was attenuated but did not disturb this developmental program in either wild type or mutant mice with attenuated epidermal growth factor receptor or WNT signaling. Exposure also markedly inhibited c-Jun phosphorylation in Map3k1+/− embryonic eyelid epithelium, suggesting that dioxin-induced AHR pathways can synergize with gene mutations to inhibit MAP3K1 signaling. Our studies uncover a novel mechanism through which the dioxin-AHR axis interacts with the MAP3K1 signaling pathways during fetal development and provide strong empirical evidence that specific gene alterations can increase the risk of developmental abnormalities driven by environmental pollutant exposure. PMID:26109068

  20. Pan-Genome Analysis of Brazilian Lineage A Amoebal Mimiviruses

    Directory of Open Access Journals (Sweden)

    Felipe L. Assis

    2015-06-01

    Full Text Available Since the recent discovery of Samba virus, the first representative of the family Mimiviridae from Brazil, prospecting for mimiviruses has been conducted in different environmental conditions in Brazil. Recently, we isolated using Acanthamoeba sp. three new mimiviruses, all of lineage A of amoebal mimiviruses: Kroon virus from urban lake water; Amazonia virus from the Brazilian Amazon river; and Oyster virus from farmed oysters. The aims of this work were to sequence and analyze the genome of these new Brazilian mimiviruses (mimi-BR and update the analysis of the Samba virus genome. The genomes of Samba virus, Amazonia virus and Oyster virus were 97%–99% similar, whereas Kroon virus had a low similarity (90%–91% with other mimi-BR. A total of 3877 proteins encoded by mimi-BR were grouped into 974 orthologous clusters. In addition, we identified three new ORFans in the Kroon virus genome. Additional work is needed to expand our knowledge of the diversity of mimiviruses from Brazil, including if and why among amoebal mimiviruses those of lineage A predominate in the Brazilian environment.

  1. Primary Amoebic Meningoencephalitis: Neurochemotaxis and Neurotropic Preferences of Naegleria fowleri.

    Science.gov (United States)

    Baig, Abdul Mannan

    2016-08-17

    Naegleria fowleri causes one of the most devastating necrotic meningoencephalitis in humans. The infection caused by this free-living amoeba is universally fatal within a week of onset of the signs and symptoms of the disease called primary amoebic meningoencephalitis (PAM). In all the affected patients, there is always a history of entry of water into the nose. Even though the diagnostic and treatment protocols have been revised and improved, the obstinate nature of the disease can be gauged by the fact that the mortality rate has persisted around ∼95% over the past 60 years. Some of the unanswered questions regarding PAM are is there a neurochemical basis of the chemotaxis of N. fowleri to the brain? What immune evasion means occurs preceding the neurotropic invasion? What is the contribution of the acute inflammatory response in the fatal cases? Can a combination of anti-amoebic drugs with antagonism of the acute inflammation help save the patient's life? As prevention remains the most valuable safeguard against N. fowleri, a quicker diagnosis, better understanding of the pathogenesis of PAM coupled with testing of newer and safer drugs could improve the chances of survival in patients affected with PAM.

  2. MAP kinase pathways and calcitonin influence CD44 alternate isoform expression in prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Yang Kui

    2008-09-01

    Full Text Available Abstract Background Dysregulated expression and splicing of cell adhesion marker CD44 is found in many types of cancer. In prostate cancer (PC specifically, the standard isoform (CD44s has been found to be downregulated compared with benign tissue whereas predominant variant isoform CD44v7-10 is upregulated. Mitogen-activated protein kinase pathways and paracrine calcitonin are two common factors linked to dysregulated expression and splicing of CD44 in cancer. Calcitonin has been found to increase proliferation and invasion in PC acting through the protein kinase A pathway. Methods In androgen-independent PC with known high CD44v7-10 expression, CD44 total and CD44v7-10 RNA or protein were assessed in response to exogenous and endogenous calcitonin and to inhibitors of protein kinase A, MEK, JNK, or p38 kinase. Benign cells and calcitonin receptor-negative PC cells were also tested. Results MEK or p38 but not JNK reduced CD44 total RNA by 40%–65% in cancer and benign cells. Inhibition of protein kinase A reduced CD44 total and v7-10 protein expression. In calcitonin receptor-positive cells only, calcitonin increased CD44 variant RNA and protein by 3 h and persisting to 48 h, apparently dependent on an uninhibited p38 pathway. Cells with constitutive CT expression showed an increase in CD44v7-10 mRNA but a decrease in CD44 total RNA. Conclusion The MEK pathway increases CD44 RNA, while calcitonin, acting through the protein kinase A and p38 pathway, facilitates variant splicing. These findings could be used in the formulation of therapeutic methods for PC targeting CD44 alternate splicing.

  3. A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development.

    Directory of Open Access Journals (Sweden)

    Meng Zhang

    Full Text Available PsSAK1, a mitogen-activated protein (MAP kinase from Phytophthora sojae, plays an important role in host infection and zoospore viability. However, the downstream mechanism of PsSAK1 remains unclear. In this study, the 3'-tag digital gene expression (DGE profiling method was applied to sequence the global transcriptional sequence of PsSAK1-silenced mutants during the cysts stage and 1.5 h after inoculation onto susceptible soybean leaf tissues. Compared with the gene expression levels of the recipient P. sojae strain, several candidates of Myb family were differentially expressed (up or down in response to the loss of PsSAK1, including of a R2R3-type Myb transcription factor, PsMYB1. qRT-PCR indicated that the transcriptional level of PsMYB1 decreased due to PsSAK1 silencing. The transcriptional level of PsMYB1 increased during sporulating hyphae, in germinated cysts, and early infection. Silencing of PsMYB1 results in three phenotypes: a no cleavage of the cytoplasm into uninucleate zoospores or release of normal zoospores, b direct germination of sporangia, and c afunction in zoospore-mediated plant infection. Our data indicate that the PsMYB1 transcription factor functions downstream of MAP kinase PsSAK1 and is required for zoospore development of P. sojae.

  4. QSAR Analysis of Some Antagonists for p38 map kinase Using Combination of Principal Component Analysis and Artificial Intelligence.

    Science.gov (United States)

    Doosti, Elham; Shahlaei, Mohsen

    2015-01-01

    Quantitative relationships between structures of a set of p38 map kinase inhibitors and their activities were investigated by principal component regression (PCR) and principal componentartificial neural network (PC-ANN). Latent variables (called components) generated by principal component analysis procedure were applied as the input of developed Quantitative structure- activity relationships (QSAR) models. An exact study of predictability of PCR and PC-ANN showed that the later model has much higher ability to calculate the biological activity of the investigated molecules. Also, experimental and estimated biological activities of compounds used in model development step have indicated a good correlation. Obtained results show that a non-linear model explaining the relationship between the pIC50s and the calculated principal components (that extract from structural descriptors of the studied molecules) is superior than linear model. Some typical figures of merit for QSAR studies explaining the accuracy and predictability of the suggested models were calculated. Therefore, to design novel inhibitors of p38 map kinase with high potency and low undesired effects the developed QSAR models were used to estimate biological pIC50 of the studied compounds.

  5. Inducible activation of ERK5 MAP kinase enhances adult neurogenesis in the olfactory bulb and improves olfactory function.

    Science.gov (United States)

    Wang, Wenbin; Lu, Song; Li, Tan; Pan, Yung-Wei; Zou, Junhui; Abel, Glen M; Xu, Lihong; Storm, Daniel R; Xia, Zhengui

    2015-05-20

    Recent discoveries have suggested that adult neurogenesis in the subventricular zone (SVZ) and olfactory bulb (OB) may be required for at least some forms of olfactory behavior in mice. However, it is unclear whether conditional and selective enhancement of adult neurogenesis by genetic approaches is sufficient to improve olfactory function under physiological conditions or after injury. Furthermore, specific signaling mechanisms regulating adult neurogenesis in the SVZ/OB are not fully defined. We previously reported that ERK5, a MAP kinase selectively expressed in the neurogenic regions of the adult brain, plays a critical role in adult neurogenesis in the SVZ/OB. Using a site-specific knock-in mouse model, we report here that inducible and targeted activation of the endogenous ERK5 in adult neural stem/progenitor cells enhances adult neurogenesis in the OB by increasing cell survival and neuronal differentiation. This conditional ERK5 activation also improves short-term olfactory memory and odor-cued associative olfactory learning under normal physiological conditions. Furthermore, these mice show enhanced recovery of olfactory function and have more adult-born neurons after a zinc sulfate-induced lesion of the main olfactory epithelium. We conclude that ERK5 MAP kinase is an important endogenous signaling pathway regulating adult neurogenesis in the SVZ/OB, and that conditional activation of endogenous ERK5 is sufficient to enhance adult neurogenesis in the OB thereby improving olfactory function both under normal conditions and after injury.

  6. A genome-wide RNAi screen reveals MAP kinase phosphatases as key ERK pathway regulators during embryonic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Shen-Hsi Yang

    Full Text Available Embryonic stem cells and induced pluripotent stem cells represent potentially important therapeutic agents in regenerative medicine. Complex interlinked transcriptional and signaling networks control the fate of these cells towards maintenance of pluripotency or differentiation. In this study we have focused on how mouse embryonic stem cells begin to differentiate and lose pluripotency and, in particular, the role that the ERK MAP kinase and GSK3 signaling pathways play in this process. Through a genome-wide siRNA screen we have identified more than 400 genes involved in loss of pluripotency and promoting the onset of differentiation. These genes were functionally associated with the ERK and/or GSK3 pathways, providing an important resource for studying the roles of these pathways in controlling escape from the pluripotent ground state. More detailed analysis identified MAP kinase phosphatases as a focal point of regulation and demonstrated an important role for these enzymes in controlling ERK activation kinetics and subsequently determining early embryonic stem cell fate decisions.

  7. MAP kinase specifically mediates the ABA-induced H2O2 generation in guard cells of Vicia faba L

    Institute of Scientific and Technical Information of China (English)

    JIANG Jing; AN Guoyong; WANG Pengcheng; WANG Pengtao; HAN Jinfeng; JIA Yanbin; SONG Chunpeng

    2003-01-01

    Mitogen-activated protein (MAP) kinase is involved in ABA- or H2O2-signaling, and H2O2 acts as intermediate in the downstream of ABA signal transduction pathway, which has recently emerged as a secondary messenger of ABA signaling. Using an epidermal strip bioassay and laser scanning confocal microscope, we provided the first evidence that MAP kinase plays an important role in H2O2 signal initial, amplification and specific targeting in response to stimuli in guard cells. ABA- or H2O2-induced Vicia faba stomatal closure was inhibited or reversed by the specific inhibitor PD98059 of MEK1/2; the guard cells were pre-incubated or -microinjected by 10 (mol·L-1 PD98059, ABA could not enhance the fluorescence intensity of H2O2 probe dichlorofluorescein (DCF). Meanwhile, after ABA induced the H2O2 accumulation in guard cells, the exogenous or intracellular PD98059 could reduce the DCF fluorescence intensity. Most interestingly, on the contrary to ABA, the DCF fluorescence intensity of guard cells treated by 100 (mol·L-1 salicylic acid (SA) was not down-regulated by PD98059, yet PD98059 did not regulate the stomatal movement being induced by light, dark or salicylic acid. These results suggest that MEK1/2 could mediate stomatal closure by abolishing the ABA-induced H2O2 generation/accumula- tion in the specific manner.

  8. Activation of the MAP Kinase Cascade by Exogenous Calcium-Sensing Receptor

    Energy Technology Data Exchange (ETDEWEB)

    Hobson, Susan A.; Wright, Jay W.; Lee, Fred; Mcneil, Scott; Bilderback, Tim R.; Rodland, Karin D.

    2003-02-01

    In Rat-1 fibroblasts and ovarian surface epithelial cells, extracellular calcium induces a proliferative response which appears to be mediated by the G-protein coupled Calcium-sensing Receptor (CaR), as expression of the non-functional CaR-R795W mutant inhibits both thymidine incorporation and activation of the extracellular-regulated kinase (ERK) in response to calcium. In this report we utilized CaR-transfected HEK293 cells to demonstrate that functional CaR is necessary and sufficient for calcium-induced ERK activation. CaR-dependent ERK activation was blocked by co-expression of the Ras dominant-negative mutant, Ras N17, and by exposure to the phosphatidyl inositol 3' kinase inhibitors wortmannin and LY294002. In contrast to Rat-1 fibroblasts, CaR-mediated in vitro kinase activity of ERK2 was unaffected by tyrosine kinase inhibitor herbimycin in CaR-transfected HEK293 cells. These results suggest that usage of distinct pathways downstream of the CaR varies in a cell-type specific manner, suggesting a potential mechanism by which activation of the CaR could couple to distinct calcium-dependent responses.

  9. Novel mechanisms of sildenafil in pulmonary hypertension involving cytokines/chemokines, MAP kinases and Akt.

    Directory of Open Access Journals (Sweden)

    Tamas Kiss

    Full Text Available Pulmonary arterial hypertension (PH is associated with high mortality due to right ventricular failure and hypoxia, therefore to understand the mechanism by which pulmonary vascular remodeling initiates these processes is very important. We used a well-characterized monocrotaline (MCT-induced rat PH model, and analyzed lung morphology, expression of cytokines, mitogen-activated protein kinase (MAPK phosphorylation, and phosphatidylinositol 3-kinase-Akt (PI-3k-Akt pathway and nuclear factor (NF-κB activation in order to elucidate the mechanisms by which sildenafil's protective effect in PH is exerted. Besides its protective effect on lung morphology, sildenafil suppressed multiple cytokines involved in neutrophil and mononuclear cells recruitment including cytokine-induced neutrophil chemoattractant (CINC-1, CINC-2α/β, tissue inhibitor of metalloproteinase (TIMP-1, interleukin (IL-1α, lipopolysaccharide induced CXC chemokine (LIX, monokine induced by gamma interferon (MIG, macrophage inflammatory protein (MIP-1α, and MIP-3α. NF-κB activation and phosphorylation were also attenuated by sildenafil. Furthermore, sildenafil reduced extracellular signal-regulated kinase (ERK1/2 and p38 MAPK activation while enhanced activation of the cytoprotective Akt pathway in PH. These data suggest a beneficial effect of sildenafil on inflammatory and kinase signaling mechanisms that substantially contribute to its protective effects, and may have potential implications in designing future therapeutic strategies in the treatment of pulmonary hypertension.

  10. Extracellular simian virus 40 induces an ERK/MAP kinase-independent signalling pathway that activates primary response genes and promotes virus entry.

    Science.gov (United States)

    Dangoria, N S; Breau, W C; Anderson, H A; Cishek, D M; Norkin, L C

    1996-09-01

    Simian virus 40 (SV40) binding to growth-arrested cells activated an intracellular signalling pathway that induced the up-regulation of the primary response genes c-myc, c-jun and c-sis within 30 min and of JE within 90 min. The up-regulation of the primary response genes occurred in the presence of cycloheximide and when UV-inactivated SV40 was adsorbed to cells. SV40 binding did not activate Raf or mitogen-activated protein kinase (MAP/ERK1), or mobilize intracellular Ca2+. The SV40-induced up-regulation of c-myc and c-jun was blocked by the tyrosine kinase inhibitor, genistein, and by the protein kinase C (PKC) inhibitor, calphostin C, but not by expression of the MAP kinase-specific phosphatase, MKP-1. These results suggest that the SV40-induced signalling pathway includes the activities of a tyrosine kinase and a Ca(2+)-independent isoform of PKC, but not of Raf or MAP kinase. Finally, SV40 infectious entry into cells was specifically and reversibly blocked by genistein.

  11. Investigating amoebic pathogenesis using Entamoeba histolytica DNA microarrays

    Indian Academy of Sciences (India)

    Upinder Singh; Preetam Shah

    2002-11-01

    Entamoeba histolytica, a protozoan parasite, causes diarrhea and liver abscesses resulting in 50 million cases of infection worldwide annually. Elucidation of parasite virulence determinants has recently been investigated using genetic approaches. We have undertaken a genomics approach to identify novel virulence determinants in the parasite. A DNA microarray of E. histolytica is being developed based on sequenced genomic clones from the genome sequencing efforts of The Institute of Genomic Research (TIGR) and the Sanger Center. Hybridization of the slides with samples labelled differentially using fluorescent dyes allows the characterization of transcriptional profiles of genes under the biological conditions tested. Additionally, a genome-wide comparison of E. histolytica and E. dispar can be undertaken. The development of an E. histolytica microarray will be outlined and its uses in identifying novel virulence determinants and characterizing amoebic biology will be discussed.

  12. Primary amoebic meningoencephalitis: first reported case from Rohtak, North India

    Directory of Open Access Journals (Sweden)

    Naveen Gupta

    2009-06-01

    Full Text Available A fatal case of primary amoebic encephalitis (PAM in a 20 year old boy, a proven case of acute leukemic leukemia (ALL type L2, in remission is described. No history of swimming could be elicited. The clinical presentation, the isolation of the amoeba from the cerebrospinal fluid (CSF, the poor response to amphotericin B, and the ultimately fatal outcome are all consistent with the diagnosis of PAM. On the basis of its ability to grow at temperature 42ºC and 45ºC, morphology of trophozoite, and the presence of flagellate forms in CSF, the amoeba was identified as Naegleria fowleri. Other drugs used in combination with amphotericin B are tetracycline, rifampicin, and miconazole. A possibility of PAM should always be considered in all cases of acute purulent meningoencephalitis in which no bacteria or fungus are found.

  13. Primary amoebic meningoencephalitis: first reported case from Rohtak, North India.

    Science.gov (United States)

    Gupta, Naveen; Bhaskar, Hemlata; Duggal, Shalini; Ghalaut, Pratap S; Kundra, Shailja; Arora, Des R

    2009-06-01

    A fatal case of primary amoebic encephalitis (PAM) in a 20 year old boy, a proven case of acute leukemic leukemia (ALL) type L2, in remission is described. No history of swimming could be elicited. The clinical presentation, the isolation of the amoeba from the cerebrospinal fluid (CSF), the poor response to amphotericin B, and the ultimately fatal outcome are all consistent with the diagnosis of PAM. On the basis of its ability to grow at temperature 42 degrees C and 45 degrees C, morphology of trophozoite, and the presence of flagellate forms in CSF, the amoeba was identified as Naegleria fowleri. Other drugs used in combination with amphotericin B are tetracycline, rifampicin, and miconazole. A possibility of PAM should always be considered in all cases of acute purulent meningoencephalitis in which no bacteria or fungus are found.

  14. Anti-Amoebic Properties of Carbonyl Thiourea Derivatives

    Directory of Open Access Journals (Sweden)

    Maizatul Akma Ibrahim

    2014-04-01

    Full Text Available Thiourea derivatives display a broad spectrum of applications in chemistry, various industries, medicines and various other fields. Recently, different thiourea derivatives have been synthesized and explored for their anti-microbial properties. In this study, four carbonyl thiourea derivatives were synthesized and characterized, and then further tested for their anti-amoebic properties on two potential pathogenic species of Acanthamoeba, namely A. castellanii (CCAP 1501/2A and A. polyphaga (CCAP 1501/3A. The results indicate that these newly-synthesized thiourea derivatives are active against both Acanthamoeba species. The IC50 values obtained were in the range of 2.39–8.77 µg·mL‑1 (9.47–30.46 µM for A. castellanii and 3.74–9.30 µg·mL‑1 (14.84–31.91 µM for A. polyphaga. Observations on the amoeba morphology indicated that the compounds caused the reduction of the amoeba size, shortening of their acanthopodia structures, and gave no distinct vacuolar and nuclear structures in the amoeba cells. Meanwhile, fluorescence microscopic observation using acridine orange and propidium iodide (AOPI staining revealed that the synthesized compounds induced compromised-membrane in the amoeba cells. The results of this study proved that these new carbonyl thiourea derivatives, especially compounds M1 and M2 provide potent cytotoxic properties toward pathogenic Acanthamoeba to suggest that they can be developed as new anti-amoebic agents for the treatment of Acanthamoeba keratitis.

  15. Cell-permeable p38 MAP kinase promotes migration of adult neural stem/progenitor cells

    Science.gov (United States)

    Hamanoue, Makoto; Morioka, Kazuhito; Ohsawa, Ikuroh; Ohsawa, Keiko; Kobayashi, Masaaki; Tsuburaya, Kayo; Akasaka, Yoshikiyo; Mikami, Tetsuo; Ogata, Toru; Takamatsu, Ken

    2016-01-01

    Endogenous neural stem/progenitor cells (NPCs) can migrate toward sites of injury, but the migration activity of NPCs is insufficient to regenerate damaged brain tissue. In this study, we showed that p38 MAP kinase (p38) is expressed in doublecortin-positive adult NPCs. Experiments using the p38 inhibitor SB203580 revealed that endogenous p38 participates in NPC migration. To enhance NPC migration, we generated a cell-permeable wild-type p38 protein (PTD-p38WT) in which the HIV protein transduction domain (PTD) was fused to the N-terminus of p38. Treatment with PTD-p38WT significantly promoted the random migration of adult NPCs without affecting cell survival or differentiation; this effect depended on the cell permeability and kinase activity of the fusion protein. These findings indicate that PTD-p38WT is a novel and useful tool for unraveling the roles of p38, and that this protein provides a reasonable approach for regenerating the injured brain by enhancing NPC migration. PMID:27067799

  16. Regulation of endothelial protein C receptor shedding by cytokines is mediated through differential activation of MAP kinase signaling pathways

    Energy Technology Data Exchange (ETDEWEB)

    Menschikowski, Mario, E-mail: Mario.Menschikowski@uniklinikum-dresden.de [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany); Hagelgans, Albert; Eisenhofer, Graeme; Siegert, Gabriele [Institute of Clinical Chemistry and Laboratory Medicine, Technical University of Dresden, Medical Faculty ' Carl Gustav Carus' , Fetscherstrasse 74, D-01307 Dresden (Germany)

    2009-09-10

    The endothelial protein C receptor (EPCR) plays a pivotal role in coagulation, inflammation, cell proliferation, and cancer, but its activity is markedly changed by ectodomain cleavage and release as the soluble protein (sEPCR). In this study we examined the mechanisms involved in the regulation of EPCR shedding in human umbilical endothelial cells (HUVEC). Interleukin-1{beta} (IL-1{beta}) and tumor necrosis factor-{alpha} (TNF-{alpha}), but not interferon-{gamma} and interleukin-6, suppressed EPCR mRNA transcription and cell-associated EPCR expression in HUVEC. The release of sEPCR induced by IL-1{beta} and TNF-{alpha} correlated with activation of p38 MAPK and c-Jun N-terminal kinase (JNK). EPCR shedding was also induced by phorbol 12-myristate 13-acetate, ionomycin, anisomycin, thiol oxidants or alkylators, thrombin, and disruptors of lipid rafts. Both basal and induced shedding of EPCR was blocked by the metalloproteinase inhibitors, TAPI-0 and GM6001, and by the reduced non-protein thiols, glutathione, dihydrolipoic acid, dithiothreitol, and N-acetyl-L-cysteine. Because other antioxidants and scavengers of reactive oxygen species failed to block the cleavage of EPCR, a direct suppression of metalloproteinase activity seems responsible for the observed effects of reduced thiols. In summary, the shedding of EPCR in HUVEC is effectively regulated by IL-1{beta} and TNF-{alpha}, and downstream by MAP kinase signaling pathways and metalloproteinases.

  17. Acanthamoeba polyphaga mimivirus prevents amoebal encystment-mediating serine proteinase expression and circumvents cell encystment.

    Science.gov (United States)

    Boratto, Paulo; Albarnaz, Jonas Dutra; Almeida, Gabriel Magno de Freitas; Botelho, Lucas; Fontes, Alide Caroline Lima; Costa, Adriana Oliveira; Santos, Daniel de Assis; Bonjardim, Cláudio Antônio; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

    2015-03-01

    Acanthamoeba is a genus of free-living amoebas distributed worldwide. Few studies have explored the interactions between these protozoa and their infecting giant virus, Acanthamoeba polyphaga mimivirus (APMV). Here we show that, once the amoebal encystment is triggered, trophozoites become significantly resistant to APMV. Otherwise, upon infection, APMV is able to interfere with the expression of a serine proteinase related to amoebal encystment and the encystment can no longer be triggered.

  18. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Science.gov (United States)

    Witte, Katrin; Koch, Egon; Volk, Hans-Dieter; Wolk, Kerstin; Sabat, Robert

    2015-01-01

    Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630) on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  19. The Pelargonium sidoides Extract EPs 7630 Drives the Innate Immune Defense by Activating Selected MAP Kinase Pathways in Human Monocytes.

    Directory of Open Access Journals (Sweden)

    Katrin Witte

    Full Text Available Pelargonium sidoides is a medical herb and respective extracts are used very frequently for the treatment of respiratory tract infections. However, the effects of Pelargonium sidoides and a special extract prepared from its roots (EPs 7630 on human immune cells are not fully understood. Here we demonstrate that EPs 7630 induced a rapid and dose-dependent production of TNF-α, IL-6, and IL-10 by human blood immune cells. This EPs 7630-induced cytokine profile was more pro-inflammatory in comparison with the profile induced by viral or bacterial infection-mimicking agents. The search for EPs 7630 target cells revealed that T-cells did not respond to EPs 7630 stimulation by production of TNF-α, IL-6, or IL-10. Furthermore, pretreatment of T-cells with EPs 7630 did not modulate their TNF-α, IL-6, and IL-10 secretion during subsequent activation. In contrast to lymphocytes, monocytes showed clear intracellular TNF-α staining after EPs 7630 treatment. Accordingly, EPs 7630 predominantly provoked activation of MAP kinases and inhibition of p38 strongly reduced the monocyte TNF-α production. The pretreatment of blood immune cells with EPs 7630 lowered their secretion of TNF-α and IL-10 and caused an IL-6 dominant response during second stimulation with viral or bacterial infection-mimicking agents. In summary, we demonstrate that EPs 7630 activates human monocytes, induces MAP kinase-dependent pro-inflammatory cytokines in these cells, and specifically modulates their production capacity of mediators known to lead to an increase of acute phase protein production in the liver, neutrophil generation in the bone marrow, and the generation of adaptive Th17 and Th22 cells.

  20. Comprehensive gene expression atlas for the Arabidopsis MAP kinase signalling pathways.

    Science.gov (United States)

    Menges, Margit; Dóczi, Róbert; Okrész, László; Morandini, Piero; Mizzi, Luca; Soloviev, Mikhail; Murray, James A H; Bögre, László

    2008-01-01

    * Mitogen activated protein kinase (MAPK) pathways are signal transduction modules with layers of protein kinases having c. 120 genes in Arabidopsis, but only a few have been linked experimentally to functions. * We analysed microarray expression data for 114 MAPK signalling genes represented on the ATH1 Affymetrix arrays; determined their expression patterns during development, and in a wide range of time-course microarray experiments for their signal-dependent transcriptional regulation and their coregulation with other signalling components and transcription factors. * Global expression correlation of the MAPK genes with each of the represented 21 692 Arabidopsis genes was determined by calculating Pearson correlation coefficients. To group MAPK signalling genes based on similarities in global regulation, we performed hierarchical clustering on the pairwise correlation values. This should allow inferring functional information from well-studied MAPK components to functionally uncharacterized ones. Statistical overrepresentation of specific gene ontology (GO) categories in the gene lists showing high expression correlation values with each of the MAPK components predicted biological themes for the gene functions. * The combination of these methods provides functional information for many uncharacterized MAPK genes, and a framework for complementary future experimental dissection of the function of this complex family.

  1. Mechanisms of cell signaling by nitric oxide and peroxynitrite: from mitochondria to MAP kinases

    Science.gov (United States)

    Levonen, A. L.; Patel, R. P.; Brookes, P.; Go, Y. M.; Jo, H.; Parthasarathy, S.; Anderson, P. G.; Darley-Usmar, V. M.

    2001-01-01

    Many of the biological and pathological effects of nitric oxide (NO) are mediated through cell signaling pathways that are initiated by NO reacting with metalloproteins. More recently, it has been recognized that the reaction of NO with free radicals such as superoxide and the lipid peroxyl radical also has the potential to modulate redox signaling. Although it is clear that NO can exert both cytotoxic and cytoprotective actions, the focus of this overview are those reactions that could lead to protection of the cell against oxidative stress in the vasculature. This will include the induction of antioxidant defenses such as glutathione, activation of mitogen-activated protein kinases in response to blood flow, and modulation of mitochondrial function and its impact on apoptosis. Models are presented that show the increased synthesis of glutathione in response to shear stress and inhibition of cytochrome c release from mitochondria. It appears that in the vasculature NO-dependent signaling pathways are of three types: (i) those involving NO itself, leading to modulation of mitochondrial respiration and soluble guanylate cyclase; (ii) those that involve S-nitrosation, including inhibition of caspases; and (iii) autocrine signaling that involves the intracellular formation of peroxynitrite and the activation of the mitogen-activated protein kinases. Taken together, NO plays a major role in the modulation of redox cell signaling through a number of distinct pathways in a cellular setting.

  2. The p38 MAP kinase inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-specific effect upon the ERK pathway

    NARCIS (Netherlands)

    Birkenkamp, KU; Tuyt, LML; Lummen, C; Wierenga, LTJ; Kruijer, W; Vellenga, E

    2000-01-01

    1 In the present study we investigated a possible role for the p38 mitogen-activated protein (MAP) kinase pathway in mediating nuclear factor-kappa B (NF-kappa B) transcriptional activity in the erythroleukaemic cell line TF-1. 2 TF-1 cells stimulated with the phosphatase inhibitor okadaic acid (OA)

  3. A review of redox signaling and the control of MAP kinase pathway in plants

    Directory of Open Access Journals (Sweden)

    Yukun Liu

    2017-04-01

    Full Text Available Mitogen-activated protein kinase (MAPK cascades are evolutionarily conserved modules among eukaryotic species that range from yeast, plants, flies to mammals. In eukaryotic cells, reactive oxygen species (ROS has both physiological and toxic effects. Both MAPK cascades and ROS signaling are involved in plant response to various biotic and abiotic stresses. It has been observed that not only can ROS induce MAPK activation, but also that disturbing MAPK cascades can modulate ROS production and responses. This review will discuss the potential mechanisms by which ROS may activate and/or regulate MAPK cascades in plants. The role of MAPK cascades and ROS signaling in regulating gene expression, stomatal function, and programmed cell death (PCD is also discussed. In addition, the relationship between Rboh-dependent ROS production and MAPK activation in PAMP-triggered immunity will be reviewed.

  4. Synergistic effect of vasoactive intestinal peptides on TNF-alpha-induced IL-6 synthesis in osteoblasts: amplification of p44/p42 MAP kinase activation.

    Science.gov (United States)

    Natsume, Hideo; Tokuda, Haruhiko; Mizutani, Jun; Adachi, Seiji; Matsushima-Nishiwaki, Rie; Minamitani, Chiho; Kato, Kenji; Kozawa, Osamu; Otsuka, Takanobu

    2010-05-01

    We previously showed that tumor necrosis factor-alpha (TNF-alpha) stimulates synthesis of interleukin-6 (IL-6), a potent bone resorptive agent, via p44/p42 mitogen-activated protein (MAP) kinase and phosphatidylinositol 3-kinase/Akt in osteoblast-like MC3T3-E1 cells. In the present study, we investigated the effect of vasoactive intestinal peptide (VIP) on TNF-alpha-induced IL-6 synthesis in these cells. VIP, which by itself slightly stimulated IL-6 synthesis, synergistically enhanced the TNF-alpha-induced IL-6 synthesis in MC3T3-E1 cells. The synergistic effect of VIP on the TNF-alpha-induced IL-6 synthesis was concentration-dependent in the range between 1 and 70 nM. We previously reported that VIP stimulated cAMP production in MC3T3-E1 cells. Forskolin, a direct activator of adenylyl cyclase, or 8-bromoadenosine-3',5'-cyclic monophosphate (8bromo-cAMP), a plasma membrane-permeable cAMP analogue, markedly enhanced the TNF-alpha-induced IL-6 synthesis as well as VIP. VIP markedly up-regulated the TNF-alpha-induced p44/p42 MAP kinase phosphorylation. The Akt phosphorylation stimulated by TNF-alpha was only slightly affected by VIP. PD98059, a specific inhibitor of MEK1/2, significantly suppressed the enhancement of TNF-alpha-induced IL-6 synthesis by VIP. The synergistic effect of a combination of VIP and TNF-alpha on the phosphorylation of p44/p42 MAP kinase was diminished by H-89, an inhibitor of cAMP-dependent protein kinase. These results strongly suggest that VIP synergistically enhances TNF-alpha-stimulated IL-6 synthesis via up-regulating p44/p42 MAP kinase through the adenylyl cyclase-cAMP system in osteoblasts.

  5. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  6. Clinical presentation and diagnostic difficulties in amoebic liver abscess

    Directory of Open Access Journals (Sweden)

    Kaushal D Suthar

    2014-07-01

    Full Text Available Background Amoebic liver abscess (ALA is a common and major health problem in India. ALA has a highly variable presentation, causing diagnostic difficulties. Early and correct diagnosis of Amoebic liver abscess is essential, because delayed diagnosis and treatment leads to complications which has significantly higher morbidity and mortality than uncomplicated disease. Objective To find out different clinical presentation and its differential diagnosis in order to establish early diagnosis of ALA. Patients and Methods This retrospective, observational study was carried out in the Department of Surgery during February 2010 to May 2013. Inclusion criteria were defined. The data of patients were enrolled according to variables in performa predesigned for this study and analyzed. Results 187 cases of ALA were enrolled with male to female ratio of 2.8:1. Right hypochondrial pain occurred in 69.52%, left hypochondrial pain occurred in 6.41%, pain radiating to tip of right shoulder in 8.02%, fever in 86.64%, co-incident diarrhea in 36.37% and concurrent pulmonary symptoms in 12.84%. The most common signs were tender hepatomegaly in 73.74% and jaundice in 17.65%. 3.20% patients had past history of aspiration of ALA. 23.52% patients had ruptured abscess. 11.12% were due to delayed diagnosis and 1.60% was ruptured despite treatment. Mortality rate was 3.20% amongst patients with ruptured ALA. Diabetes, hypertension, AIDS and alcoholism were commonly associated co morbidities. Right lobe (82.36% is commonly involved than left lobe and single abscess (83.42% was more common than multiple abscess. Diagnosis was missed in 30.48% patients particularly those with atypical presentations. Ultrasonography, Computerized tomography (CT scan with diagnostic aspiration were useful in diagnosing ALA. Conclusion The typical features of ALA, which include pain, fever and tender hepatomegaly, are nonspecific. ALA may be missed because of variable clinical features and

  7. Perturbation of EGF-induced MAP kinase activation by TGF-ß1

    Directory of Open Access Journals (Sweden)

    Wenner C.E.

    1999-01-01

    Full Text Available TGF-ß1 regulates both cellular growth and phenotypic plasticity important for maintaining a growth advantage and increased invasiveness in progressively malignant cells. Recent studies indicate that TGF-ß-1 stimulates the conversion of epitheliod to fibroblastoid phenotype which presumably leads to the inactivation of growth-inhibitory effects by TGF-ß1 (Portella et al. (1998 Cell Growth and Differentiation, 9: 393-404. Therefore, the investigation of TGF-ß1 signaling that leads to altered growth and migration may provide novel targets for the prevention of increased cell growth and invasion. Although much attention has been paid to TGF-ß1 responses in epithelial cells, the above studies suggest that examination of signal transduction pathways in fibroblasts are important as well. Data from our laboratory are consistent with the concept that TGF-ß1 can act as a regulatory switch in density-dependent C3H 10T1/2 fibroblasts capable of either promoting or delaying G1 traverse. The regulation of this switch is proposed to occur prior to pRb phosphorylation, namely prior to activation of cyclin-dependent kinases. The current study is concerned with the evaluation of a key cyclin (cyclin D1 which activates cdk4 and p27KIP1 which in turn inhibit cdk2 in the proliferative responses of epidermal growth factor (EGF and platelet-derived growth factor (PDGF and their modulation by TGF-ß1. Although the molecular events that lead to elevation of cyclin D1 are not completely understood, it appears likely that activation of p42/p44MAPK kinases is involved in its transcriptional regulation. TGF-ß1 delayed EGF- or PDGF-induced cyclin D1 expression and blocked the induction of active p42/p44MAPK. The mechanism by which TGF-ß1 induces a block in p42/p44MAPK activation is being examined and the possibility that TGF-ß1 regulates phosphatase activity is being tested.

  8. Mapping of protein-protein interactions within the DNA-dependent protein kinase complex.

    Science.gov (United States)

    Gell, D; Jackson, S P

    1999-01-01

    In mammalian cells, the Ku and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) proteins are required for the correct and efficient repair of DNA double-strand breaks. Ku comprises two tightly-associated subunits of approximately 69 and approximately 83 kDa, which are termed Ku70 and Ku80 (or Ku86), respectively. Previously, a number of regions of both Ku subunits have been demonstrated to be involved in their interaction, but the molecular mechanism of this interaction remains unknown. We have identified a region in Ku70 (amino acid residues 449-578) and a region in Ku80 (residues 439-592) that participate in Ku subunit interaction. Sequence analysis reveals that these interaction regions share sequence homology and suggests that the Ku subunits are structurally related. On binding to a DNA double-strand break, Ku is able to interact with DNA-PKcs, but how this interaction is mediated has not been defined. We show that the extreme C-terminus of Ku80, specifically the final 12 amino acid residues, mediates a highly specific interaction with DNA-PKcs. Strikingly, these residues appear to be conserved only in Ku80 sequences from vertebrate organisms. These data suggest that Ku has evolved to become part of the DNA-PK holo-enzyme by acquisition of a protein-protein interaction motif at the C-terminus of Ku80. PMID:10446239

  9. Mite and cockroach proteases activate p44/p42 MAP kinases in human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kong Xiaoyuan

    2003-10-01

    Full Text Available Abstract Background The mechanisms underlying epithelial cell activation by indoor inhaled antigens are poorly understood. Methods In this study, we investigated the role of mitogen-activated protein kinases (MAPKs in A549 epithelial cells upon exposure to antigens of house dust mite (HDMA, German cockroach (GCA, and American cockroach (ACA. Results Each of these antigens induced a significant increase in IL-8 levels compared to the medium control. Exposure of A549 cells to these antigens induced the phosphorylation of p44/42 MAPKs within 5 minutes, which reached a peak at 25 minutes later and reached baseline levels at 1 hour after exposure. PD98059, a MEK1 inhibitor, significantly decreased phosphorylation of p44/p42 MAPKs and IL-8 production. Exposure of A549 cells with antigens, which had been preincubated with different protease inhibitors, also resulted in a reduction of both MAPK phosphorylation and IL-8 production. Conclusion Thus, proteolytic antigens present in HDMA, GCA and ACA activate the p44/42 MAPKs airway epithelial cells, which lead to elevated IL-8 production and initiation of the inflammatory cascade.

  10. Network Modeling Reveals Cross Talk of MAP Kinases during Adaptation to Caspofungin Stress in Aspergillus fumigatus.

    Science.gov (United States)

    Altwasser, Robert; Baldin, Clara; Weber, Jakob; Guthke, Reinhard; Kniemeyer, Olaf; Brakhage, Axel A; Linde, Jörg; Valiante, Vito

    2015-01-01

    Mitogen activated protein kinases (MAPKs) are highly conserved in eukaryotic organisms. In pathogenic fungi, their activities were assigned to different physiological functions including drug adaptation and resistance. Aspergillus fumigatus is a human pathogenic fungus, which causes life-threatening invasive infections. Therapeutic options against invasive mycoses are still limited. One of the clinically used drugs is caspofungin, which specifically targets the fungal cell wall biosynthesis. A systems biology approach, based on comprehensive transcriptome data sets and mathematical modeling, was employed to infer a regulatory network and identify key interactions during adaptation to caspofungin stress in A. fumigatus. Mathematical modeling and experimental validations confirmed an intimate cross talk occurring between the cell wall-integrity and the high osmolarity-glycerol signaling pathways. Specifically, increased concentrations of caspofungin promoted activation of these signalings. Moreover, caspofungin affected the intracellular transport, which caused an additional osmotic stress that is independent of glucan inhibition. High concentrations of caspofungin reduced this osmotic stress, and thus decreased its toxic activity. Our results demonstrated that MAPK signaling pathways play a key role during caspofungin adaptation and are contributing to the paradoxical effect exerted by this drug.

  11. ERK1/2 map kinase metabolic pathway is responsible for phosphorylation of translation initiation factor eIF4E during in vitro maturation of pig oocytes.

    Science.gov (United States)

    Ellederová, Zdenka; Cais, Ondrej; Susor, Andrej; Uhlírová, Katka; Kovárová, Hana; Jelínková, Lucie; Tomek, Wolfgang; Kubelka, Michal

    2008-02-01

    Eukaryotic initiation factor 4E (eIF4E) plays an important role in mRNA translation by binding the 5'-cap structure of the mRNA and facilitating the recruitment to the mRNA of other translation factors and the 40S ribosomal subunit. eIF4E undergoes regulated phosphorylation on Ser-209 and this phosphorylation is believed to be important for its binding to mRNA and to other initiation factors. The findings showing that the translation initiation factor eIF4E becomes gradually phosphorylated during in vitro maturation (IVM) of pig oocytes with a maximum in metaphase II (M II) stage oocytes have been documented by us recently (Ellederova et al., 2006). The aim of this work was to study in details the metabolic pathways involved in this process. Using inhibitors of cyclin-dependent kinases, Butyrolactone I (BL I) and protein phosphatases, okadaic acid (OA) we show that ERK1/2 MAP kinase pathway is involved in this phosphorylation. We also demonstrate that activation and phosphorylation of ERK1/2 MAP kinase and eIF4E is associated with the activating phosphorylation of Mnk1 kinase, one of the two main kinases phosphorylating eIF4E in somatic cells.

  12. MAP-kinase activity in etiolated Cucumis sativus cotyledons: the effect of red and far-red light irradiation.

    Science.gov (United States)

    Alvarez-Flórez, Fagua; Vidal, Dolors; Simón, Esther

    2013-02-01

    Phytochrome (phy) signalling in plants may be transduced through protein phosphorylation. Mitogen-activated protein kinase (MAP-kinase, MAPK) activity and the effect of R (red) and FR (far-red) light irradiation on MAPK activity were studied in etiolated Cucumis sativus L. cotyledons. By in vitro protein phosphorylation and in-gel assays with myelin basic protein (MBP), a protein band (between 48 and 45 kDa) with MAPK-like activity was detected. The addition to the phosphorylation buffer of specific protein phosphatase (PTP) inhibitors (Na(3)VO(4) and NaF) and genistein, apigenin or PD98059 as MAPK inhibitors allowed us to confirm the MAPK activity of the protein band. Irradiation of etiolated cotyledons with FR light for 5, 10 or 60 min rapidly and transiently stimulated the MAPK activity of the protein band. This suggests that there was a very low fluence response (VLFR) of phys. In addition, 15 min of R light irradiation or a sequential treatment of 15 min of R plus 5 min of FR also increased MAPK activity. The stimulatory effect of R light was also attributed to the same photoreceptor, which suggests that MAPKs are involved in phytochrome signal transduction. Protein immunoprecipitation and immunoblotting analysis with the polyclonal antibody anti-pERK1/2 (Tyr 204) and the monoclonal antibody anti-phosphotyrosine PY20 allowed us to recognize the above mentioned protein band as two proteins with molecular masses (M(r)) of approximately 47 and 45 kDa, and MAPK activity. The biochemical and immunological properties showed by the proteins detected indicated that they were members of the MAPK family phosphorylated in tyrosine residues.

  13. Surviving within the amoebal exocyst: the Mycobacterium avium complex paradigm

    Directory of Open Access Journals (Sweden)

    Drancourt Michel

    2010-04-01

    Full Text Available Abstract Background Most of environmental mycobacteria have been previously demonstrated to resist free-living amoeba with subsequent increased virulence and resistance to antibiotics and biocides. The Mycobacterium avium complex (MAC comprises of environmental organisms that inhabit a wide variety of ecological niches and exhibit a significant degree of genetic variability. We herein studied the intra-ameobal location of all members of the MAC as model organisms for environmental mycobacteria. Results Type strains for M. avium, Mycobacterium intracellulare, Mycobacterium chimaera, Mycobacterium colombiense, Mycobacterium arosiense, Mycobacterium marseillense, Mycobacterium timonense and Mycobacterium bouchedurhonense were co-cultivated with the free-living amoeba Acanthamoeba polyphaga strain Linc-AP1. Microscopic analyses demonstrated the engulfment and replication of mycobacteria into vacuoles of A. polyphaga trophozoites. Mycobacteria were further entrapped within amoebal cysts, and survived encystment as demonstrated by subculturing. Electron microscopy observations show that, three days after entrapment into A. polyphaga cysts, all MAC members typically resided within the exocyst. Conclusions Combined with published data, these observations indicate that mycobacteria are unique among amoeba-resistant bacteria, in residing within the exocyst.

  14. Cryptococcal 3-Hydroxy Fatty Acids Protect Cells Against Amoebal Phagocytosis.

    Science.gov (United States)

    Madu, Uju L; Ogundeji, Adepemi O; Mochochoko, Bonang M; Pohl, Carolina H; Albertyn, Jacobus; Swart, Chantel W; Allwood, J William; Southam, Andrew D; Dunn, Warwick B; May, Robin C; Sebolai, Olihile M

    2015-01-01

    We previously reported on a 3-hydroxy fatty acid that is secreted via cryptococcal capsular protuberances - possibly to promote pathogenesis and survival. Thus, we investigated the role of this molecule in mediating the fate of Cryptococcus (C.) neoformans and the related species C. gattii when predated upon by amoebae. We show that this molecule protects cells against the phagocytic effects of amoebae. C. neoformans UOFS Y-1378 (which produces 3-hydroxy fatty acids) was less sensitive toward amoebae compared to C. neoformans LMPE 046 and C. gattii R265 (both do not produce 3-hydroxy fatty acids) and addition of 3-hydroxy fatty acids to C. neoformans LMPE 046 and C. gattii R265 culture media, causes these strains to become more resistant to amoebal predation. Conversely, addition of aspirin (a 3-hydroxy fatty acid inhibitor) to C. neoformans UOFS Y-1378 culture media made cells more susceptible to amoebae. Our data suggest that this molecule is secreted at a high enough concentration to effect intracellular signaling within amoeba, which in turn, promotes fungal survival.

  15. Cryptococcal 3-hydroxy fatty acids protect cells against amoebal phagocytosis

    Directory of Open Access Journals (Sweden)

    Uju Lynda Madu

    2015-12-01

    Full Text Available We previously reported on a 3-hydroxy fatty acid that is secreted via cryptococcal capsular protuberances - possibly to promote pathogenesis and survival. Thus, we investigated the role of this molecule in mediating the fate of Cryptococcus (C. neoformans and the related species C. gattii when predated upon by amoebae. We show that this molecule protects cells against the phagocytic effects of amoebae. C. neoformans UOFS Y-1378 (which produces 3-hydroxy fatty acids was less sensitive towards amoebae compared to C. neoformans LMPE 046 and C. gattii R265 (both do not produce 3-hydroxy fatty acids and addition of 3-hydroxy fatty acids to C. neoformans LMPE 046 and C. gattii R265 culture media, causes these strains to become more resistant to amoebal predation. Conversely, addition of aspirin (a 3-hydroxy fatty acid inhibitor to C. neoformans UOFS Y-1378 culture media made cells more susceptible to amoebae. Our data suggest that this molecule is secreted at a high enough concentration to effect intracellular signalling within amoeba, which in turn, promotes fungal survival.

  16. Ankyrin-repeat proteins from sponge symbionts modulate amoebal phagocytosis.

    Science.gov (United States)

    Nguyen, Mary T H D; Liu, Michael; Thomas, Torsten

    2014-03-01

    Bacteria-eukaryote symbiosis occurs in all stages of evolution, from simple amoebae to mammals, and from facultative to obligate associations. Sponges are ancient metazoans that form intimate symbiotic interactions with complex communities of bacteria. The basic nutritional requirements of the sponge are in part satisfied by the phagocytosis of bacterial food particles from the surrounding water. How bacterial symbionts, which are permanently associated with the sponge, survive in the presence of phagocytic cells is largely unknown. Here, we present the discovery of a genomic fragment from an uncultured gamma-proteobacterial sponge symbiont that encodes for four proteins, whose closest known relatives are found in a sponge genome. Through recombinant approaches, we show that these four eukaryotic-like, ankyrin-repeat proteins (ARP) when expressed in Eschericha coli can modulate phagocytosis of amoebal cells and lead to accumulation of bacteria in the phagosome. Mechanistically, two ARPs appear to interfere with phagosome development in a similar way to reduced vacuole acidification, by blocking the fusion of the early phagosome with the lysosome and its digestive enzymes. Our results show that ARP from sponge symbionts can function to interfere with phagocytosis, and we postulate that this might be one mechanism by which symbionts can escape digestion in a sponge host.

  17. Characterization of brain inflammation during primary amoebic meningoencephalitis.

    Science.gov (United States)

    Cervantes-Sandoval, Isaac; Serrano-Luna, José de Jesús; García-Latorre, Ethel; Tsutsumi, Víctor; Shibayama, Mineko

    2008-09-01

    Naegleria fowleri is a free-living amoeba and the etiologic agent of primary amoebic meningoencephalitis (PAM). Trophozoites reach the brain by penetrating the olfactory epithelium, and invasion of the olfactory bulbs results in an intense inflammatory reaction. The contribution of the inflammatory response to brain damage in experimental PAM has not been delineated. Using both optical and electron microscopy, we analyzed the morphologic changes in the brain parenchyma due to inflammation during experimental PAM. Several N. fowleri trophozoites were observed in the olfactory bulbs 72 h post-inoculation, and the number of amoebae increased rapidly over the next 24 h. Eosinophils and neutrophils surrounding the amoebae were then noted at later times during infection. Electron microscopic examination of the increased numbers of neutrophils and the interactions with trophozoites indicated an active attempt to eliminate the amoebae. The extent of inflammation increased over time, with a predominant neutrophil response indicating important signs of damage and necrosis of the parenchyma. These data suggest a probable role of inflammation in tissue damage. To test the former hypothesis, we used CD38-/- knockout mice with deficiencies in chemotaxis to compare the rate of mortality with the parental strain, C57BL/6J. The results showed that inflammation and mortality were delayed in the knockout mice. Based on these results, we suggest that the host inflammatory response and polymorphonuclear cell lysis contribute to a great extent to the central nervous system tissue damage.

  18. Conserved regulation of MAP kinase expression by PUF RNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Myon-Hee Lee

    2007-12-01

    Full Text Available Mitogen-activated protein kinase (MAPK and PUF (for Pumilio and FBF [fem-3 binding factor] RNA-binding proteins control many cellular processes critical for animal development and tissue homeostasis. In the present work, we report that PUF proteins act directly on MAPK/ERK-encoding mRNAs to downregulate their expression in both the Caenorhabditis elegans germline and human embryonic stem cells. In C. elegans, FBF/PUF binds regulatory elements in the mpk-1 3' untranslated region (3' UTR and coprecipitates with mpk-1 mRNA; moreover, mpk-1 expression increases dramatically in FBF mutants. In human embryonic stem cells, PUM2/PUF binds 3'UTR elements in both Erk2 and p38alpha mRNAs, and PUM2 represses reporter constructs carrying either Erk2 or p38alpha 3' UTRs. Therefore, the PUF control of MAPK expression is conserved. Its biological function was explored in nematodes, where FBF promotes the self-renewal of germline stem cells, and MPK-1 promotes oocyte maturation and germ cell apoptosis. We found that FBF acts redundantly with LIP-1, the C. elegans homolog of MAPK phosphatase (MKP, to restrict MAPK activity and prevent apoptosis. In mammals, activated MAPK can promote apoptosis of cancer cells and restrict stem cell self-renewal, and MKP is upregulated in cancer cells. We propose that the dual negative regulation of MAPK by both PUF repression and MKP inhibition may be a conserved mechanism that influences both stem cell maintenance and tumor progression.

  19. MAP kinase pathway gene copy alterations in NRAS/BRAF wild-type advanced melanoma.

    Science.gov (United States)

    Orouji, Elias; Orouji, Azadeh; Gaiser, Timo; Larribère, Lionel; Gebhardt, Christoffer; Utikal, Jochen

    2016-05-01

    Recent therapeutic advances have improved melanoma patientś clinical outcome. Novel therapeutics targeting BRAF, NRAS and cKit mutant melanomas are widely used in clinical practice. However therapeutic options in NRAS(wild-type) /BRAF(wild-type) /cKit(wild-type) melanoma patients are limited. Our study shows that gene copy numbers of members of the MAPK signaling pathway vary in different melanoma subgroups. NRAS(wild-type) /BRAF(wild-type) melanoma metastases are characterized by significant gains of MAP2K1 (MEK1) and MAPK3 (ERK1) gene loci. These additional gene copies could lead to an activation of the MAPK signaling pathway via a gene-dosage effect. Our results suggest that downstream analyses of the pMEK and pERK expression status in NRAS(wild-type) /BRAF(wild-type) melanoma patients identify patients that could benefit from targeted therapies with MEK and ERK inhibitors.

  20. Intein-mediated peptide arrays for epitope mapping and kinase/phosphatase assays.

    Science.gov (United States)

    Xu, Ming-Qun; Ghosh, Inca; Kochinyan, Samvel; Sun, Luo

    2007-01-01

    Synthetic peptides are widely used for production and analysis of antibodies as well as in the study of protein modification enzymes. To circumvent the technical challenges of the existing techniques regarding peptide quantization and normalization, a new method of producing peptide arrays has been developed. This approach utilizes intein-mediated protein ligation that involves linkage of a carrier protein possessing a reactive carboxyl-terminal thioester to a peptide with an amino-terminal cysteine through a native peptide bond. Ligated protein substrates or enzyme-treated samples are arrayed on nitrocellulose membranes with a standard dot-blot apparatus and analyzed by immunoassay. This technique has improved sensitivity and reproducibility, and is suitable for various peptide-based applications. In this report, several experimental procedures including epitope mapping and the study of protein modifications were described.

  1. Expression of protein phosphatases (PP-1, PP-2A, PP-2B and PTP-1B) and protein kinases (MAP kinase and P34cdc2) in the hippocampus of patients with Alzheimer disease and normal aged individuals.

    Science.gov (United States)

    Pei, J J; Sersen, E; Iqbal, K; Grundke-Iqbal, I

    1994-08-29

    Microtubule-associated protein tau is abnormally hyperphosphorylated in the brain of patients with Alzheimer disease (AD). Previous studies have shown (i) that in vitro tau can be phosphorylated to an Alzheimer abnormally phosphorylated state-like protein by proline-directed protein kinases MAP kinase and p34cdc2, and (ii) that the AD abnormally phosphorylated tau can be in vitro dephosphorylated by protein phosphatases PP-2B, PP-2A and PP-1 and not by PP-2C. However, to have a direct effect on the regulation of phosphorylation of tau, these enzymes should be present in the affected neurons. In the present study immunocytochemical localization of protein phosphatases PP-1, PP-2A, PP-2B and PTP, and protein kinases MAP kinase and p34cdc2 were studied in the hippocampal formation of AD and as a control in non-demented elderly patients. All the protein phosphatases and protein kinases studied were localized to both granular and pyramidal neurons. In the pyramidal neurons, the enzymes staining was observed in neuronal soma and neurites. PTP-1B, PP-1 and PP-2A were also highly expressed in microglia. The topographical distributions of all the enzymes studied were similar, i.e. the intensity of immunostaining in hippocampus in end-plate (CA3 and CA4) > prosubiculum, subiculum > entorhinal cortex > dentate gyrus > CA2 > CA1. Furthermore, the expression of all the enzymes was also observed in the tangle-bearing neurons. The PP-2B staining of the tangle-bearing neurons was weaker than the unaffected neurons in the same tissue section field in AD cases.

  2. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    LENUS (Irish Health Repository)

    Keld, Richard

    2010-12-09

    Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3\\/ETV4 and ER81\\/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  3. Conditional deletion of ERK5 MAP kinase in the nervous system impairs pheromone information processing and pheromone-evoked behaviors.

    Directory of Open Access Journals (Sweden)

    Junhui Zou

    Full Text Available ERK5 MAP kinase is highly expressed in the developing nervous system but absent in most regions of the adult brain. It has been implicated in regulating the development of the main olfactory bulb and in odor discrimination. However, whether it plays an essential role in pheromone-based behavior has not been established. Here we report that conditional deletion of the Mapk7 gene which encodes ERK5 in mice in neural stem cells impairs several pheromone-mediated behaviors including aggression and mating in male mice. These deficits were not caused by a reduction in the level of testosterone, by physical immobility, by heightened fear or anxiety, or by depression. Using mouse urine as a natural pheromone-containing solution, we provide evidence that the behavior impairment was associated with defects in the detection of closely related pheromones as well as with changes in their innate preference for pheromones related to sexual and reproductive activities. We conclude that expression of ERK5 during development is critical for pheromone response and associated animal behavior in adult mice.

  4. The ERK MAP kinase-PEA3/ETV4-MMP-1 axis is operative in oesophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Gulmann Christian

    2010-12-01

    Full Text Available Abstract Background Many members of the ETS-domain transcription factor family are important drivers of tumourigenesis. In this context, their activation by Ras-ERK pathway signaling is particularly relevant to the tumourigenic properties of many ETS-domain transcription factors. The PEA3 subfamily of ETS-domain transcription factors have been implicated in tumour metastasis in several different cancers. Results Here, we have studied the expression of the PEA3 subfamily members PEA3/ETV4 and ER81/ETV1 in oesophageal adenocarcinomas and determined their role in oesophageal adenocarcinoma cell function. PEA3 plays an important role in controlling both the proliferation and invasive properties of OE33 oesophageal adenocarcinoma cells. A key target gene is MMP-1. The ERK MAP kinase pathway activates PEA3 subfamily members and also plays a role in these PEA3 controlled events, establishing the ERK-PEA3-MMP-1 axis as important in OE33 cells. PEA3 subfamily members are upregulated in human adenocarcinomas and expression correlates with MMP-1 expression and late stage metastatic disease. Enhanced ERK signaling is also more prevalent in late stage oesophageal adenocarcinomas. Conclusions This study shows that the ERK-PEA3-MMP-1 axis is upregulated in oesophageal adenocarcinoma cells and is a potentially important driver of the metastatic progression of oesophageal adenocarcinomas.

  5. Molecular Basis of Meiotic Maturation and Apoptosis of Oocytes, Sperm-Oocyte Interactions and Early Cleavage of Embryos in Mice, Role of Phosphatidylinositol 3-Kinase, Mos, Fas-Fas Ligand, Integrinα6 and MAP Kinase

    Directory of Open Access Journals (Sweden)

    Yumi Hoshino

    2005-01-01

    Full Text Available The interaction between molecular biology and embryology made an extensive progress in the research on gametogenesis, fertilization and early embryogenesis in mice. In this article, molecules involving in meiotic maturation and apoptosis of oocytes, sperm-oocyte interactions and early cleavage of fertilized embryos in mice are described including our recent following experiments. 1 Phosphatidylinositol 3-kinase and Akt participate in the follicle stimulating hormone-induced meiotic maturation of mouse oocytes. 2 Mos plays a crucial role in normal spindle and chromosome morphology and the reactivation of maturation promoting factor after first meiosis. 3 Follicular atresia is caused by apoptosis and the apoptosis associated with internucleosomal DNA fragmentation is directly regulated by the Fas-Fas ligand system. 4 Integrin α6β1 is involved in sperm-egg binding leading to fusion via direct association of the integrin α 6 with sperm. 5 MAP kinase cascade is activated at the M-phase and some MAP kinases other than ERKs are activated during early cleavage of fertilized eggs.

  6. Localization of the human stress responsive MAP kinase-like CSAIDs binding protein (CSBP) gene to chromosome 6p21.3/21.2

    Energy Technology Data Exchange (ETDEWEB)

    McDonnell, P.C.; Young, P.R.; DiLella, A.G. [SmithKline Beecham Pharmaceuticals, King of Prussia, PA (United States)] [and others

    1995-09-01

    The proinflammatory cytokines interleukin 1 (IL-1) and tumor necrosis factor (TNF) play a pivotal role in the initiation of inflammatory responses. Soluble protein antagonists of IL-1 and TNF, such as IL-1ra, sTNFR-Fc fusion, and monoclonal antibodies to TNF have proven to be effective at blocking acute and chronic responses in a number of animal models of inflammatory diseases such as rheumatoid arthritis, septic shock, and inflammatory bowel disease. Consequently, there has been considerable interest in discovering compounds that could inhibit the production of these cytokines and might therefore become treatments. Recently, a structurally related series of pyridinyl imidazoles was found to block IL-1 and TNF production from LPS-stimulated human monocytes and to ameliorate inflammatory diseases significantly in vivo, leading to their being named CSAIDs (cytokine suppressive anti-inflammatory drugs). The protein target of these compounds, termed CSBP (CSAID binding protein), was discovered to be a new member of the MAP kinase family of serine-threonine protein kinases whose kinase activity is activated by LPS in human monocytes. Independently, the same kinase, or its rodent homologues, was found to respond also to chemical, thermal, and osmotic stress and IL-1 treatment. Inhibition of this kinase correlated with reduction in inflammatory cytokine production from LPS-activated monocytes. 15 refs., 1 fig.

  7. PRO40 is a scaffold protein of the cell wall integrity pathway, linking the MAP kinase module to the upstream activator protein kinase C.

    Directory of Open Access Journals (Sweden)

    Ines Teichert

    2014-09-01

    Full Text Available Mitogen-activated protein kinase (MAPK pathways are crucial signaling instruments in eukaryotes. Most ascomycetes possess three MAPK modules that are involved in key developmental processes like sexual propagation or pathogenesis. However, the regulation of these modules by adapters or scaffolds is largely unknown. Here, we studied the function of the cell wall integrity (CWI MAPK module in the model fungus Sordaria macrospora. Using a forward genetic approach, we found that sterile mutant pro30 has a mutated mik1 gene that encodes the MAPK kinase kinase (MAPKKK of the proposed CWI pathway. We generated single deletion mutants lacking MAPKKK MIK1, MAPK kinase (MAPKK MEK1, or MAPK MAK1 and found them all to be sterile, cell fusion-deficient and highly impaired in vegetative growth and cell wall stress response. By searching for MEK1 interaction partners via tandem affinity purification and mass spectrometry, we identified previously characterized developmental protein PRO40 as a MEK1 interaction partner. Although fungal PRO40 homologs have been implicated in diverse developmental processes, their molecular function is currently unknown. Extensive affinity purification, mass spectrometry, and yeast two-hybrid experiments showed that PRO40 is able to bind MIK1, MEK1, and the upstream activator protein kinase C (PKC1. We further found that the PRO40 N-terminal disordered region and the central region encompassing a WW interaction domain are sufficient to govern interaction with MEK1. Most importantly, time- and stress-dependent phosphorylation studies showed that PRO40 is required for MAK1 activity. The sum of our results implies that PRO40 is a scaffold protein for the CWI pathway, linking the MAPK module to the upstream activator PKC1. Our data provide important insights into the mechanistic role of a protein that has been implicated in sexual and asexual development, cell fusion, symbiosis, and pathogenicity in different fungal systems.

  8. A superoxide anion-scavenger, 1,3-selenazolidin-4-one suppresses serum deprivation-induced apoptosis in PC12 cells by activating MAP kinase

    Energy Technology Data Exchange (ETDEWEB)

    Nishina, Atsuyoshi, E-mail: nishina@yone.ac.jp [Yonezawa Women' s Junior College, 6-15-1 Tohrimachi, Yonezawa, Yamagata 992-0025 (Japan); Kimura, Hirokazu; Kozawa, Kunihisa [Gunma Prefectural Institute of Public Health and Environmental Sciences, 378 Kamioki, Maebashi, Gunma 371-0052 (Japan); Sommen, Geoffroy [Lonza Braine SA, Chaussee de Tubize 297, B-1420 Braine l' Alleud (Belgium); Nakamura, Takao [Department of Biomedical Information Engineering, Graduate School of Medical Science, Yamagata University, Yamagata 990-9585 (Japan); Heimgartner, Heinz [University of Zuerich, Institut of Organic Chemistry, Winterthurerstrasse 190, CH-8057 Zuerich (Switzerland); Koketsu, Mamoru [Department of Materials Science and Technology, Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan); Furukawa, Shoei [Laboratory of Molecular Biology, Gifu Pharmaceutical University, 5-6-1 Mitahora-higashi, Gifu 502-8585 (Japan)

    2011-12-15

    Synthetic organic selenium compounds, such as ebselen, may show glutathione peroxidase-like antioxidant activity and have a neurotrophic effect. We synthesized 1,3-selenazolidin-4-ones, new types of synthetic organic selenium compounds (five-member ring compounds), to study their possible applications as antioxidants or neurotrophic-like molecules. Their superoxide radical scavenging effects were assessed using the quantitative, highly sensitive method of real-time kinetic chemiluminescence. At 166 {mu}M, the O{sub 2}{sup -} scavenging activity of 1,3-selenazolidin-4-ones ranged from 0 to 66.2%. 2-[3-(4-Methoxyphenyl)-4-oxo-1,3-selenazolidin-2-ylidene]malononitrile (compound b) showed the strongest superoxide anion-scavenging activity among the 6 kinds of 2-methylene-1,3-selenazolidin-4-ones examined. Compound b had a 50% inhibitory concentration (IC{sub 50}) at 92.4 {mu}M and acted as an effective and potentially useful O{sub 2}{sup -} scavenger in vitro. The effect of compound b on rat pheochromocytome cell line PC12 cells was compared with that of ebselen or nerve growth factor (NGF) by use of the MTT [3-(4, 5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay. When ebselen was added at 100 {mu}M or more, toxicity toward PC12 cells was evident. On the contrary, compound b suppressed serum deprivation-induced apoptosis in PC12 cells more effectively at a concentration of 100 {mu}M. The activity of compound b to phosphorylate mitogen-activated protein kinase/extracellular signal-regulated protein kinase (ERK) 1/2 (MAP kinase) in PC12 cells was higher than that of ebselen, and the former at 100 {mu}M induced the phosphorylation of MAP kinase to a degree similar to that induced by NGF. From these results, we conclude that this superoxide anion-scavenger, compound b, suppressed serum deprivation-induced apoptosis by promoting the phosphorylation of MAP kinase. -- Highlights: Black-Right-Pointing-Pointer We newly synthesized 1,3-selenazolidin-4-ones to

  9. The Aspergillus fumigatus SchASCH9 kinase modulates SakAHOG1 MAP kinase activity and it is essential for virulence

    Science.gov (United States)

    Alves de Castro, Patrícia; dos Reis, Thaila Fernanda; Dolan, Stephen K.; Manfiolli, Adriana Oliveira; Brown, Neil Andrew; Jones, Gary W.; Doyle, Sean; Riaño-Pachón, Diego M.; Squina, Fábio Márcio; Caldana, Camila; Singh, Ashutosh; Del Poeta, Maurizio; Hagiwara, Daisuke; Silva-Rocha, Rafael; Goldman, Gustavo H.

    2016-01-01

    Summary The serine-threonine kinase TOR, the Target of Rapamycin, is an important regulator of nutrient, energy and stress signaling in eukaryotes. Sch9, a Ser/Thr kinase of AGC family (the cAMP-dependent PKA, cGMP- dependent protein kinase G and phospholipid-dependent protein kinase C family), is a substrate of TOR. Here, we characterized the fungal opportunistic pathogen Aspergillus fumigatus Sch9 homologue (SchA). The schA null mutant was sensitive to rapamycin, high concentrations of calcium, hyperosmotic stress and SchA was involved in iron metabolism. The ΔschA null mutant showed increased phosphorylation of SakA, the A. fumigatus Hog1 homologue. The schA null mutant has increased and decreased trehalose and glycerol accumulation, respectively, suggesting SchA performs different roles for glycerol and trehalose accumulation during osmotic stress. The schA was transcriptionally regulated by osmotic stress and this response was dependent on SakA and MpkC. The double ΔschA ΔsakA and ΔschA ΔmpkC mutants were more sensitive to osmotic stress than the corresponding parental strains. Transcriptomics and proteomics identified direct and indirect targets of SchA post-exposure to hyperosmotic stress. Finally, ΔschA was avirulent in a low dose murine infection model. Our results suggest there is a complex network of interactions amongst the A. fumigatus TOR, SakA and SchA pathways. PMID:27538790

  10. Microglial Signaling in Chronic Pain with a Special Focus on Caspase 6, p38 MAP Kinase, and Sex Dependence.

    Science.gov (United States)

    Berta, T; Qadri, Y J; Chen, G; Ji, R R

    2016-09-01

    Microglia are the resident immune cells in the spinal cord and brain. Mounting evidence suggests that activation of microglia plays an important role in the pathogenesis of chronic pain, including chronic orofacial pain. In particular, microglia contribute to the transition from acute pain to chronic pain, as inhibition of microglial signaling reduces pathologic pain after inflammation, nerve injury, and cancer but not baseline pain. As compared with inflammation, nerve injury induces much more robust morphologic activation of microglia, termed microgliosis, as shown by increased expression of microglial markers, such as CD11b and IBA1. However, microglial signaling inhibitors effectively reduce inflammatory pain and neuropathic pain, arguing against the importance of morphologic activation of microglia in chronic pain sensitization. Importantly, microglia enhance pain states via secretion of proinflammatory and pronociceptive mediators, such as tumor necrosis factor α, interleukins 1β and 18, and brain-derived growth factor. Mechanistically, these mediators have been shown to enhance excitatory synaptic transmission and suppress inhibitory synaptic transmission in the pain circuits. While early studies suggested a predominant role of microglia in the induction of chronic pain, further studies have supported a role of microglia in the maintenance of chronic pain. Intriguingly, recent studies show male-dominant microglial signaling in some neuropathic pain and inflammatory pain states, although both sexes show identical morphologic activation of microglia after nerve injury. In this critical review, we provide evidence to show that caspase 6-a secreted protease that is expressed in primary afferent axonal terminals surrounding microglia-is a robust activator of microglia and induces profound release of tumor necrosis factor α from microglia via activation of p38 MAP kinase. The authors also show that microglial caspase 6/p38 signaling is male dominant in some

  11. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Aniek van der Vaart

    2015-12-01

    Full Text Available Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL, resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  12. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.

    Science.gov (United States)

    van der Vaart, Aniek; Rademakers, Suzanne; Jansen, Gert

    2015-12-01

    Cilia are sensory organelles present on almost all vertebrate cells. Cilium length is constant, but varies between cell types, indicating that cilium length is regulated. How this is achieved is unclear, but protein transport in cilia (intraflagellar transport, IFT) plays an important role. Several studies indicate that cilium length and function can be modulated by environmental cues. As a model, we study a C. elegans mutant that carries a dominant active G protein α subunit (gpa-3QL), resulting in altered IFT and short cilia. In a screen for suppressors of the gpa-3QL short cilium phenotype, we identified uev-3, which encodes an E2 ubiquitin-conjugating enzyme variant that acts in a MAP kinase pathway. Mutation of two other components of this pathway, dual leucine zipper-bearing MAPKKK DLK-1 and p38 MAPK PMK-3, also suppress the gpa-3QL short cilium phenotype. However, this suppression seems not to be caused by changes in IFT. The DLK-1/p38 pathway regulates several processes, including microtubule stability and endocytosis. We found that reducing endocytosis by mutating rabx-5 or rme-6, RAB-5 GEFs, or the clathrin heavy chain, suppresses gpa-3QL. In addition, gpa-3QL animals showed reduced levels of two GFP-tagged proteins involved in endocytosis, RAB-5 and DPY-23, whereas pmk-3 mutant animals showed accumulation of GFP-tagged RAB-5. Together our results reveal a new role for the DLK-1/p38 MAPK pathway in control of cilium length by regulating RAB-5 mediated endocytosis.

  13. Rapid CB1 cannabinoid receptor desensitization defines the time course of ERK1/2 MAP kinase signaling.

    Science.gov (United States)

    Daigle, Tanya L; Kearn, Christopher S; Mackie, Ken

    2008-01-01

    Molecular mechanisms regulating the development of physiological and behavioral tolerance to cannabinoids are not well understood. Two cellular correlates implicated in the development and maintenance of tolerance are CB(1) cannabinoid receptor internalization and uncoupling of receptor signal transduction. Both processes have been proposed as mediators of tolerance because of observations that chronic Delta(9)-tetrahydrocannabinol (THC) treatment causes both region-specific decreases in CB(1) receptors and G-protein coupling in the brain. To determine the balance of these two processes in regulating CB(1) receptor signaling during sustained receptor stimulation, we evaluated the parameters affecting ERK1/2 MAP kinase activity in HEK293 cells stably expressing CB(1) receptors. CB(1) receptor stimulation by the potent CB(1) receptor agonist, CP 55,940 transiently activated ERK1/2. To determine if CB(1) receptor desensitization or internalization was responsible for the transient nature of ERK1/2 activation, we evaluated ERK1/2 phosphorylation in HEK293 cells expressing a desensitization-deficient CB(1) receptor (S426A/S430A CB(1)). Here, the duration of S426A/S430A CB(1) receptor-mediated activation of ERK1/2 was markedly prolonged relative to wild-type receptors, and was dynamically reversed by SR141716A. Interestingly, the S426A/S430A CB(1) receptor was still able to recruit betaarrestin-2, a key mediator of receptor desensitization, to the cell surface following agonist activation. In contrast to a central role for desensitization, pharmacological and genetic approaches suggested CB(1) receptor internalization is dispensable in the transient activation of ERK1/2. This study indicates that the duration of ERK1/2 activation by CB(1) receptors is regulated by receptor desensitization and underscores the importance of G-protein uncoupling in the regulation of CB(1) receptor signaling.

  14. Signaling through P2X7 receptor in human T cells involves p56lck, MAP kinases, and transcription factors AP-1 and NF-kappa B.

    Science.gov (United States)

    Budagian, Vadim; Bulanova, Elena; Brovko, Luba; Orinska, Zane; Fayad, Raja; Paus, Ralf; Bulfone-Paus, Silvia

    2003-01-17

    ATP-gated ion channel P2X receptors are expressed on the surface of most immune cells and can trigger multiple cellular responses, such as membrane permeabilization, cytokine production, and cell proliferation or apoptosis. Despite broad distribution and pleiotropic activities, signaling pathways downstream of these ionotropic receptors are still poorly understood. Here, we describe intracellular signaling events in Jurkat cells treated with millimolar concentrations of extracellular ATP. Within minutes, ATP treatment resulted in the phosphorylation and activation of p56(lck) kinase, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase but not p38 kinase. These effects were wholly dependent upon the presence of extracellular Ca(2+) ions in the culture medium. Nevertheless, calmodulin antagonist calmidazolium and CaM kinase inhibitor KN-93 both had no effect on the activation of p56(lck) and ERK, whereas a pretreatment of Jurkat cells with MAP kinase kinase inhibitor P098059 was able to abrogate phosphorylation of ERK. Further, expression of c-Jun and c-Fos proteins and activator protein (AP-1) DNA binding activity were enhanced in a time-dependent manner. In contrast, DNA binding activity of NF-kappa B was reduced. ATP failed to stimulate the phosphorylation of ERK and c-Jun N-terminal kinase and activation of AP-1 in the p56(lck)-deficient isogenic T cell line JCaM1, suggesting a critical role for p56(lck) kinase in downstream signaling. Regarding the biological significance of the ATP-induced signaling events we show that although extracellular ATP was able to stimulate proliferation of both Jurkat and JCaM1 cells, an increase in interleukin-2 transcription was observed only in Jurkat cells. The nucleotide selectivity and pharmacological profile data supported the evidence that the ATP-induced effects in Jurkat cells were mediated through the P2X7 receptor. Taken together, these results demonstrate the ability of extracellular ATP to activate

  15. Successful treatment of Balamuthia mandrillaris amoebic infection with extensive neurological and cutaneous involvement.

    Science.gov (United States)

    Martínez, Dalila Y; Seas, Carlos; Bravo, Francisco; Legua, Pedro; Ramos, Cesar; Cabello, Alfonso M; Gotuzzo, Eduardo

    2010-07-15

    Granulomatous amoebic encephalitis caused by Balamuthia mandrillaris is an uncommon infection for which there is no optimal therapy. We describe a young, female patient who presented with extensive cutaneous and neurological involvement and who recovered after receiving prolonged treatment with miltefosine, fluconazole, and albendazole.

  16. Entamoeba histolytica acetyl–CoA synthetase: biomarker of acute amoebic liver abscess

    Directory of Open Access Journals (Sweden)

    Lim Boon Huat

    2014-06-01

    Conclusions: This finding suggested the significant role of EhACS as a biomarker for moribund hamsters with acute amoebic liver abscess (ALA infection. It is deemed pertinent that future studies explore the potential roles of EhACS in better understanding the pathogenesis of ALA; and in the development of vaccine and diagnostic tests to control ALA in human populations.

  17. Infection of Acanthamoeba polyphaga with Simkania negevensis and S. negevensis survival within amoebal cysts.

    Science.gov (United States)

    Kahane, S; Dvoskin, B; Mathias, M; Friedman, M G

    2001-10-01

    Simkania negevensis, a novel microorganism belonging to the family Simkaniaceae in the order Chlamydiales, has an intracellular developmental cycle during which two morphological entities, elementary bodies (EB) and reticulate bodies (RB), are seen by electron microscopy. Rates of seropositivity to the organism are high in certain population groups, and S. negevensis has been associated with respiratory illness in humans. This study reports for the first time the ability of S. negevensis to survive and grow inside Acanthamoeba polyphaga in addition to its known ability to grow in cell cultures of human or simian origin. Infectivity of S. negevensis and growth in amoebae were monitored by immunoperoxidase assays. Long-term persistence and exponential growth of S. negevensis in amoebal trophozoites were demonstrated by infectivity assays and by electron microscopy. EB and dividing RB of S. negevensis were observed within inclusion bodies inside A. polyphaga. When S. negevensis-infected A. polyphaga amoebae were exposed to adverse conditions resulting in encystation of the amoebae, several possible outcomes were observed: cysts containing both normal amoebic cytoplasm and S. negevensis; cysts in which S. negevensis cells were relegated to the space between cyst walls; and cysts containing S. negevensis, but apparently lacking amoebal cytoplasm. S. negevensis within dried amoebal cysts was capable of long-term survival. The possibility that amoebae may have a role in natural transmission of S. negevensis needs to be investigated.

  18. Development of perianal ulcer as a result of acute fulminant amoebic colitis

    Institute of Scientific and Technical Information of China (English)

    Takayuki Torigoe; Yoshifumi Nakayama; Koji Yamaguchi

    2012-01-01

    We report a case of acute fulminant amoebic colitis that resulted in the development of a perianal ulcer in a 29-year-old Japanese homosexual man with acquired immunodeficiency syndrome (AIDS).The patient was admitted to our hospital with a persistent perianal abscess that was refractory to antibiotic therapy administered at another hospital.On admission,we observed a giant ulcer in the perianal region.At first,cytomegalovirus colitis was suspected by blood investigations.Ganciclovir therapy was initiated; however,the patient developed necrosis of the skin around the anus during therapy.We only performed end-sigmoidostomy and necrotomy to avoid excessive surgical invasion.Histopathological examination of the surgical specimen revealed the presence of trophozoite amoebae,indicating a final diagnosis of acute fulminant amoebic colitis.The patient's postoperative course was favorable,and proctectomy of the residual rectum was performed 11 mo later.Amoebic colitis is one of the most severe complications affecting patients with AIDS.Particularly,acute fulminant amoebic colitis may result in a poor prognosis; therefore,staged surgical therapy as a less invasive procedure should be considered as one of the treatment options for these patients.

  19. Inducible and targeted deletion of the ERK5 MAP kinase in adult neurogenic regions impairs adult neurogenesis in the olfactory bulb and several forms of olfactory behavior.

    Directory of Open Access Journals (Sweden)

    Yung-Wei Pan

    Full Text Available Although adult-born neurons in the subventricular zone (SVZ and olfactory bulb (OB have been extensively characterized at the cellular level, their functional impact on olfactory behavior is still highly controversial with many conflicting results reported in the literature. Furthermore, signaling mechanisms regulating adult SVZ/OB neurogenesis are not well defined. Here we report that inducible and targeted deletion of erk5, a MAP kinase selectively expressed in the adult neurogenic regions of the adult brain, impairs adult neurogenesis in the SVZ and OB of transgenic mice. Although erk5 deletion had no effect on olfactory discrimination among discrete odorants in the habituation/dishabituation assay, it reduced short-term olfactory memory as well as detection sensitivity to odorants and pheromones including those evoking aggression and fear. Furthermore, these mice show impaired acquisition of odor-cued associative olfactory learning, a novel phenotype that had not been previously linked to adult neurogenesis. These data suggest that ERK5 MAP kinase is a critical kinase signaling pathway regulating adult neurogenesis in the SVZ/OB, and provide strong evidence supporting a functional role for adult neurogenesis in several distinct forms of olfactory behavior.

  20. p42/p44 MAP kinase activation is localized to caveolae-free membrane domains in airway smooth muscle

    NARCIS (Netherlands)

    Gosens, Reinoud; Dueck, Gordon; Gerthoffer, William T; Unruh, Helmut; Zaagsma, Johan; Meurs, Herman; Halayko, Andrew J

    2007-01-01

    Caveolae are abundant plasma membrane invaginations in airway smooth muscle that may function as preorganized signalosomes by sequestering and regulating proteins that control cell proliferation, including receptor tyrosine kinases (RTKs) and their signaling effectors. We previously demonstrated, ho

  1. Opposite effects of the p52shc/p46shc and p66shc splicing isoforms on the EGF receptor-MAP kinase-fos signalling pathway

    DEFF Research Database (Denmark)

    Migliaccio, E; Mele, S; Salcini, A E;

    1997-01-01

    66shc expression varies from cell type to cell type. p66shc differs from p52shc/p46shc in its inability to transform mouse fibroblasts in vitro. Like p52shc/p46shc, p66shc is tyrosine-phosphorylated upon epidermal growth factor (EGF) stimulation, binds to activated EGF receptors (EGFRs) and forms...... on the EGFR-MAP kinase and other signalling pathways that control fos promoter activity. Regulation of p66shc expression might, therefore, influence the cellular response to growth factors.......Shc proteins are targets of activated tyrosine kinases and are implicated in the transmission of activation signals to Ras. The p46shc and p52shc isoforms share a C-terminal SH2 domain, a proline- and glycine-rich region (collagen homologous region 1; CH1) and a N-terminal PTB domain. We have...

  2. Histamine activates p38 MAP kinase and alters local lamellipodia dynamics, reducing endothelial barrier integrity and eliciting central movement of actin fibers.

    Science.gov (United States)

    Adderley, Shaquria P; Lawrence, Curtis; Madonia, Eyong; Olubadewo, Joseph O; Breslin, Jerome W

    2015-07-01

    The role of the actin cytoskeleton in endothelial barrier function has been debated for nearly four decades. Our previous investigation revealed spontaneous local lamellipodia in confluent endothelial monolayers that appear to increase overlap at intercellular junctions. We tested the hypothesis that the barrier-disrupting agent histamine would reduce local lamellipodia protrusions and investigated the potential involvement of p38 mitogen-activated protein (MAP) kinase activation and actin stress fiber formation. Confluent monolayers of human umbilical vein endothelial cells (HUVEC) expressing green fluorescent protein-actin were studied using time-lapse fluorescence microscopy. The protrusion and withdrawal characteristics of local lamellipodia were assessed before and after addition of histamine. Changes in barrier function were determined using electrical cell-substrate impedance sensing. Histamine initially decreased barrier function, lamellipodia protrusion frequency, and lamellipodia protrusion distance. A longer time for lamellipodia withdrawal and reduced withdrawal distance and velocity accompanied barrier recovery. After barrier recovery, a significant number of cortical fibers migrated centrally, eventually resembling actin stress fibers. The p38 MAP kinase inhibitor SB203580 attenuated the histamine-induced decreases in barrier function and lamellipodia protrusion frequency. SB203580 also inhibited the histamine-induced decreases in withdrawal distance and velocity, and the subsequent actin fiber migration. These data suggest that histamine can reduce local lamellipodia protrusion activity through activation of p38 MAP kinase. The findings also suggest that local lamellipodia have a role in maintaining endothelial barrier integrity. Furthermore, we provide evidence that actin stress fiber formation may be a reaction to, rather than a cause of, reduced endothelial barrier integrity.

  3. Staphylococcus aureus α-toxin-mediated cation entry depolarizes membrane potential and activates p38 MAP kinase in airway epithelial cells.

    Science.gov (United States)

    Eiffler, Ina; Behnke, Jane; Ziesemer, Sabine; Müller, Christian; Hildebrandt, Jan-Peter

    2016-09-01

    Membrane potential (Vm)-, Na(+)-, or Ca(2+)-sensitive fluorescent dyes were used to analyze changes in Vm or intracellular ion concentrations in airway epithelial cells treated with Staphylococcus aureus α-toxin (Hla), a major virulence factor of pathogenic strains of these bacteria. Gramicidin, a channel-forming peptide causing membrane permeability to monovalent cations, a mutated form of Hla, rHla-H35L, which forms oligomers in the plasma membranes of eukaryotic cells but fails to form functional transmembrane pores, or the cyclodextrin-derivative IB201, a blocker of the Hla pore, were used to investigate the permeability of the pore. Na(+) as well as Ca(2+) ions were able to pass the Hla pore and accumulated in the cytosol. The pore-mediated influx of calcium ions was blocked by IB201. Treatment of cells with recombinant Hla resulted in plasma membrane depolarization as well as in increases in the phosphorylation levels of paxillin (signaling pathway mediating disruption of the actin cytoskeleton) and p38 MAP kinase (signaling pathway resulting in defensive actions). p38 MAP kinase phosphorylation, but not paxillin phosphorylation, was elicited by treatment of cells with gramicidin. Although treatment of cells with rHla-H35L resulted in the formation of membrane-associated heptamers, none of these cellular effects were observed in our experiments. This indicates that formation of functional Hla-transmembrane pores is required to induce the cell physiological changes mediated by α-toxin. Specifically, the changes in ion equilibria and plasma membrane potential are important activators of p38 MAP kinase, a signal transduction module involved in host cell defense.

  4. The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

    Science.gov (United States)

    Gruber, Sabine; Zeilinger, Susanne

    2014-01-01

    Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

  5. [INHIBITORS OF MAP-KINASE PATHWAY U0126 AND PD98059 DIFFERENTLY AFFECT ORGANIZATION OF TUBULIN CYTOSKELETON AFTER STIMULATION OF EGF RECEPTOR ENDOCYTOSIS].

    Science.gov (United States)

    Zlobina, M V; Steblyanko, Yu Yu; Shklyaeva, M A; Kharchenko, V V; Salova, A V; Kornilova, E S

    2015-01-01

    To confirm the hypothesis about the involvement of EGF-stimulated MAP-kinase ERK1/2 in the regulation of microtubule (MT) system, the influence of two widely used ERK1/2 inhibitors, U0126 and PD98059, on the organization of tubulin cytoskeleton in interphase HeLa cells during EGF receptor endocytosis has been investigated. We have found that addition of U0126 or PD98059 to not-stimulated with EGF ells for 30 min has no effect on radially organized MT system. However, in the case of U0126 addition before EGF endocytosis stimulation, the number of MT per cell decreased within 15 min after such stimulation and was followed by complete MT depolymerization by 60-90 min. Stimulation of EGF endocytosis in the presence of PD98059 resulted only in insignificant depolymerization of MT and it could be detected mainly from their minus-ends. At the same time, MT regions close to plasma membrane became stabilized, which was proved by increase in tubulin acetylation level. This situation was characteristic for all period of the experiment. It has been also found that the inhibitors affect endocytosis dynamics of EGF-receptor complexes. Quantitative analysis demonstrated that the stimulation of endocytosis in the presence of U0126 generated a greater number of endosomes compared to control cells, and their number did not change significantly during the experiment. All these endosomes were localized peripherally. Effect of PD98059 resulted in the formation of lower number of endosomes that in control, but they demonstrated very slow clusterization despite the presence of some intact MT. Both inhibitors decreased EGFR colocolization with early endosomal marker EEA1, which indicated a delay in endosome fusions and maturation. The inhibitors were also shown to affect differently phospho-ERK 1 and 2 forms: U0126 completely inhibited phospho-ERK1 and 2, white, in the presence of PD98059, the two ERK forms demonstrated sharp transient activation in 15 min after stimulation, but only

  6. Amide-based inhibitors of p38alpha MAP kinase. Part 2: design, synthesis and SAR of potent N-pyrimidyl amides.

    Science.gov (United States)

    Tester, Richland; Tan, Xuefei; Luedtke, Gregory R; Nashashibi, Imad; Schinzel, Kurt; Liang, Weiling; Jung, Joon; Dugar, Sundeep; Liclican, Albert; Tabora, Jocelyn; Levy, Daniel E; Do, Steven

    2010-04-15

    Optimization of a tri-substituted N-pyridyl amide led to the discovery of a new class of potent N-pyrimidyl amide based p38alpha MAP kinase inhibitors. Initial SAR studies led to the identification of 5-dihydrofuran as an optimal hydrophobic group. Additional side chain modifications resulted in the introduction of hydrogen bond interactions. Through extensive SAR studies, analogs bearing free amino groups and alternatives to the parent (S)-alpha-methyl benzyl moiety were identified. These compounds exhibited improved cellular activities and maintained balance between p38alpha and CYP3A4 inhibition.

  7. Targeted deletion of the ERK5 MAP kinase impairs neuronal differentiation, migration, and survival during adult neurogenesis in the olfactory bulb.

    Directory of Open Access Journals (Sweden)

    Tan Li

    Full Text Available Recent studies have led to the exciting idea that adult-born neurons in the olfactory bulb (OB may be critical for complex forms of olfactory behavior in mice. However, signaling mechanisms regulating adult OB neurogenesis are not well defined. We recently reported that extracellular signal-regulated kinase (ERK 5, a MAP kinase, is specifically expressed in neurogenic regions within the adult brain. This pattern of expression suggests a role for ERK5 in the regulation of adult OB neurogenesis. Indeed, we previously reported that conditional deletion of erk5 in adult neurogenic regions impairs several forms of olfactory behavior in mice. Thus, it is important to understand how ERK5 regulates adult neurogenesis in the OB. Here we present evidence that shRNA suppression of ERK5 in adult neural stem/progenitor cells isolated from the subventricular zone (SVZ reduces neurogenesis in culture. By contrast, ectopic activation of endogenous ERK5 signaling via expression of constitutive active MEK5, an upstream activating kinase for ERK5, stimulates neurogenesis. Furthermore, inducible and conditional deletion of erk5 specifically in the neurogenic regions of the adult mouse brain interferes with cell cycle exit of neuroblasts, impairs chain migration along the rostral migratory stream and radial migration into the OB. It also inhibits neuronal differentiation and survival. These data suggest that ERK5 regulates multiple aspects of adult OB neurogenesis and provide new insights concerning signaling mechanisms governing adult neurogenesis in the SVZ-OB axis.

  8. FvBck1, a Component of Cell Wall Integrity MAP Kinase Pathway, is Required for Virulence and Oxidative Stress Response in Sugarcane Pokkah Boeng Pathogen

    Directory of Open Access Journals (Sweden)

    Chengkang eZhang

    2015-10-01

    Full Text Available Fusarium verticillioides (formerly F. moniliforme is suggested as one of the causal agents of Pokkah Boeng, a serious disease of sugarcane worldwide. Currently, detailed molecular and physiological mechanism of pathogenesis is unknown. In this study, we focused on cell wall integrity MAPK pathway as one of the potential signaling mechanisms associated with Pokkah Boeng pathogenesis. We identified FvBCK1 gene that encodes a MAP kinase kinase kinase homolog and determined that it is not only required for growth, micro- and macro-conidia production, and cell wall integrity but also for response to osmotic and oxidative stresses. The deletion of FvBCK1 caused a significant reduction in virulence and FB1 production, a carcinogenic mycotoxin produced by the fungus. Moreover, we found the expression levels of three genes, which are known to be involved in superoxide scavenging, were down regulated in the mutant. We hypothesized that the loss of superoxide scavenging capacity was one of the reasons for reduced virulence, but overexpression of catalase or peroxidase gene failed to restore the virulence defect in the deletion mutant. When we introduced Magnaporthe oryzae MCK1 into the FvBck1 deletion mutant, while certain phenotypes were restored, the complemented strain failed to gain full virulence. In summary, FvBck1 plays a diverse role in F. verticillioides, and detailed investigation of downstream signaling pathways will lead to a better understanding of how this MAPK pathway regulates Pokkah Boeng on sugarcane.

  9. Dual Roles of Quercetin in Platelets: Phosphoinositide-3-Kinase and MAP Kinases Inhibition, and cAMP-Dependent Vasodilator-Stimulated Phosphoprotein Stimulation

    Directory of Open Access Journals (Sweden)

    Won Jun Oh

    2012-01-01

    Full Text Available Background. Progressive diseases including cancer, metabolic, and cardiovascular disorders are marked by platelet activation and chronic inflammation. Studies suggest that dietary flavonoids such as quercetin possess antioxidant, anti-inflammatory, and antiplatelet properties, which could prevent various chronic diseases including atherosclerosis and thrombosis. However, the mechanism and the signaling pathway that links quercetin's antiplatelet activity with its anti-inflammatory property is limited and thus further exploration is required. The aim of this paper was to examine the link between antiplatelet and anti-inflammatory roles of quercetin in agonist-induced platelet activation. Methods. Quercetin effects on agonist-activated platelet-aggregation, granule-secretion, [Ca2+]i, and glycoprotein-IIb/IIIa activation were examined. Its effects on PI3K/Akt, VASP, and MAPK phosphorylations were also studied on collaged-activated platelets. Results. Quercetin dose dependently suppressed collagen, thrombin, or ADP-induced platelet aggregation. It significantly inhibited collagen-induced ATP release, P-selectin expression, [Ca2+]i mobilization, integrin-αIIbβ3 activation, and augmented cAMP and VASP levels. Moreover, quercetin attenuated PI3K, Akt, ERK2, JNK1, and p38 MAPK activations, which were supported by platelet-aggregation inhibition with the respective kinase inhibitors. Conclusion. Quercetin-mediated antiplatelet activity involves PI3K/Akt inactivation, cAMP elevation, and VASP stimulation that, in turn, suppresses MAPK phosphorylations. This result suggests quercetin may have a potential to treat cardiovascular diseases involving aberrant platelet activation and inflammation.

  10. Precision-cut hamster liver slices as an ex vivo model to study amoebic liver abscess.

    Science.gov (United States)

    Carranza-Rosales, Pilar; Santiago-Mauricio, María Guadalupe; Guzmán-Delgado, Nancy Elena; Vargas-Villarreal, Javier; Lozano-Garza, Gerardo; Ventura-Juárez, Javier; Balderas-Rentería, Isaías; Morán-Martínez, Javier; Gandolfi, A Jay

    2010-10-01

    Entamoeba histolytica is the etiological agent of amoebiasis, the second cause of global morbidity and mortality due to parasitic diseases in humans. In approximately 1% of the cases, amoebas penetrate the intestinal mucosa and spread to other organs, producing extra-intestinal lesions, among which amoebic liver abscess (ALA) is the most common. To study ALA, in vivo and in vitro models are used. However, animal models may pose ethical issues, and are time-consuming and costly; and cell cultures represent isolated cellular lineages. The present study reports the infection of precision-cut hamster liver slices with Entamoeba histolytica trophozoites. The infection time-course, including tissue damage, parallels findings previously reported in the animal model. At the same time amoebic virulence factors were detected in the infected slices. This new model to study ALA is simple and reproducible, and employs less than 1/3 of the hamsters required for in vivo analyses.

  11. Primary amoebic meningoencephalitis caused by Naegleria fowleri: an old enemy presenting new challenges.

    Science.gov (United States)

    Siddiqui, Ruqaiyyah; Khan, Naveed Ahmed

    2014-08-01

    First discovered in 1899, Naegleria fowleri is a protist pathogen, known to infect the central nervous system and produce primary amoebic meningoencephalitis. The most distressing aspect is that the fatality rate has remained more than 95%, despite our advances in antimicrobial chemotherapy and supportive care. Although rare worldwide, most cases have been reported in the United States, Australia, and Europe (France). A large number of cases in developing countries go unnoticed. In particular, religious, recreational, and cultural practices such as ritual ablution and/or purifications, Ayurveda, and the use of neti pots for nasal irrigation can contribute to this devastating infection. With increasing water scarcity and public reliance on water storage, here we debate the need for increased awareness of primary amoebic meningoencephalitis and the associated risk factors, particularly in developing countries.

  12. Primary amoebic meningoencephalitis caused by Naegleria fowleri: an old enemy presenting new challenges.

    Directory of Open Access Journals (Sweden)

    Ruqaiyyah Siddiqui

    2014-08-01

    Full Text Available First discovered in 1899, Naegleria fowleri is a protist pathogen, known to infect the central nervous system and produce primary amoebic meningoencephalitis. The most distressing aspect is that the fatality rate has remained more than 95%, despite our advances in antimicrobial chemotherapy and supportive care. Although rare worldwide, most cases have been reported in the United States, Australia, and Europe (France. A large number of cases in developing countries go unnoticed. In particular, religious, recreational, and cultural practices such as ritual ablution and/or purifications, Ayurveda, and the use of neti pots for nasal irrigation can contribute to this devastating infection. With increasing water scarcity and public reliance on water storage, here we debate the need for increased awareness of primary amoebic meningoencephalitis and the associated risk factors, particularly in developing countries.

  13. Mechanical stress triggers cardiomyocyte autophagy through angiotensin II type 1 receptor-mediated p38MAP kinase independently of angiotensin II.

    Directory of Open Access Journals (Sweden)

    Li Lin

    Full Text Available Angiotensin II (Ang II type 1 (AT1 receptor is known to mediate a variety of physiological actions of Ang II including autophagy. However, the role of AT1 receptor in cardiomyocyte autophagy triggered by mechanical stress still remains elusive. The aim of this study was therefore to examine whether and how AT1 receptor participates in cardiomyocyte autophagy induced by mechanical stresses. A 48-hour mechanical stretch and a 4-week transverse aorta constriction (TAC were imposed to cultured cardiomyocytes of neonatal rats and adult male C57B/L6 mice, respectively, to induce cardiomyocyte hypertrophy prior to the assessment of cardiomyocyte autophagy using LC3b-II. Losartan, an AT1 receptor blocker, but not PD123319, the AT2 inhibitor, was found to significantly reduce mechanical stretch-induced LC3b-II upregulation. Moreover, inhibition of p38MAP kinase attenuated not only mechanical stretch-induced cardiomyocyte hypertrophy but also autophagy. To the contrary, inhibition of ERK and JNK suppressed cardiac hypertrophy but not autophagy. Intriguingly, mechanical stretch-induced autophagy was significantly inhibited by Losartan in the absence of Ang II. Taken together, our results indicate that mechanical stress triggers cardiomyocyte autophagy through AT1 receptor-mediated activation of p38MAP kinase independently of Ang II.

  14. The inflammatory kinase MAP4K4 promotes reactivation of Kaposi's sarcoma herpesvirus and enhances the invasiveness of infected endothelial cells.

    Directory of Open Access Journals (Sweden)

    Darya A Haas

    Full Text Available Kaposi's sarcoma (KS is a mesenchymal tumour, which is caused by Kaposi's sarcoma herpesvirus (KSHV and develops under inflammatory conditions. KSHV-infected endothelial spindle cells, the neoplastic cells in KS, show increased invasiveness, attributed to the elevated expression of metalloproteinases (MMPs and cyclooxygenase-2 (COX-2. The majority of these spindle cells harbour latent KSHV genomes, while a minority undergoes lytic reactivation with subsequent production of new virions and viral or cellular chemo- and cytokines, which may promote tumour invasion and dissemination. In order to better understand KSHV pathogenesis, we investigated cellular mechanisms underlying the lytic reactivation of KSHV. Using a combination of small molecule library screening and siRNA silencing we found a STE20 kinase family member, MAP4K4, to be involved in KSHV reactivation from latency and to contribute to the invasive phenotype of KSHV-infected endothelial cells by regulating COX-2, MMP-7, and MMP-13 expression. This kinase is also highly expressed in KS spindle cells in vivo. These findings suggest that MAP4K4, a known mediator of inflammation, is involved in KS aetiology by regulating KSHV lytic reactivation, expression of MMPs and COX-2, and, thereby modulating invasiveness of KSHV-infected endothelial cells.

  15. The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

    Science.gov (United States)

    Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

    2012-08-01

    Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development.

  16. Specific MAP-kinase blockade protects against renal damage in homozygous TGR(mRen2)27 rats

    NARCIS (Netherlands)

    de Borst, MH; Navis, G; de Boer, RA; Vis, LM; van Gilst, WH; van Goor, H

    2003-01-01

    Angiotensin II (AngII) plays an important role in renal damage by acting on hemodynamics, cell-growth, proliferation, and fibrosis, mainly by effects on the AngII type 1 (AT,) receptor. The AT, receptor activates several intracellular signaling molecules such as mitogen-activated protein kinases ext

  17. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Science.gov (United States)

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  18. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Directory of Open Access Journals (Sweden)

    Jorg Kotzka

    Full Text Available The transcription factor sterol regulatory element binding protein (SREBP-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK. Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  19. Concurrent amoebic and histoplasma colitis:A rare cause of massive lower gastrointestinal bleeding

    Institute of Scientific and Technical Information of China (English)

    Peng; Soon; Koh; April; Camilla; Roslani; Kumar; Vasudeavan; Vimal; Mohd; Shariman; Ramasamy; Umasangar; Rajkumar; Lewellyn

    2010-01-01

    Infective colitis can be a cause of massive lower gastrointestinal bleeding requiring acute surgical intervention. Causative organisms include entamoeba and histoplasma species. However, concurrent colonic infection with both these organisms is very rare, and the in vivo consequences are not known. A 58-year-old male presented initially to the physicians with pyrexia of unknown origin and bloody diarrhea. Amoebic colitis was diagnosed based on biopsies, and he was treated with metronidazole. Five days later...

  20. Evidence that the intra-amoebal Legionella drancourtii acquired a sterol reductase gene from eukaryotes

    Directory of Open Access Journals (Sweden)

    Fournier Pierre-Edouard

    2009-03-01

    Full Text Available Abstract Background Free-living amoebae serve as a natural reservoir for some bacteria that have evolved into «amoeba-resistant» bacteria. Among these, some are strictly intra-amoebal, such as Candidatus "Protochlamydia amoebophila" (Candidatus "P. amoebophila", whose genomic sequence is available. We sequenced the genome of Legionella drancourtii (L. drancourtii, another recently described intra-amoebal bacterium. By comparing these two genomes with those of their closely related species, we were able to study the genetic characteristics specific to their amoebal lifestyle. Findings We identified a sterol delta-7 reductase-encoding gene common to these two bacteria and absent in their relatives. This gene encodes an enzyme which catalyses the last step of cholesterol biosynthesis in eukaryotes, and is probably functional within L. drancourtii since it is transcribed. The phylogenetic analysis of this protein suggests that it was acquired horizontally by a few bacteria from viridiplantae. This gene was also found in the Acanthamoeba polyphaga Mimivirus genome, a virus that grows in amoebae and possesses the largest viral genome known to date. Conclusion L. drancourtii acquired a sterol delta-7 reductase-encoding gene of viridiplantae origin. The most parsimonious hypothesis is that this gene was initially acquired by a Chlamydiales ancestor parasite of plants. Subsequently, its descendents transmitted this gene in amoebae to other intra-amoebal microorganisms, including L. drancourtii and Coxiella burnetii. The role of the sterol delta-7 reductase in prokaryotes is as yet unknown but we speculate that it is involved in host cholesterol parasitism.

  1. Detection of Entamoeba histolytica in experimentally induced amoebic liver abscess:comparison of three staining methods

    Institute of Scientific and Technical Information of China (English)

    Tan Zi Ning; Wong Weng Kin; Shaymoli Mustafa; Arefuddin Ahmed; Rahmah Noordin; Tan Gim Cheong; Olivos-Garcia Alfonso; Lim Boon Huat

    2012-01-01

    Objective: To compare the efficacy of three different tissue stains, namely haematoxylin and eosin (H&E), periodic-acid Schiff (PAS) and immunohistochemical (IHC) stains for detection of Entamoeba histolytica (E. histolytica) trophozoites in abscessed liver tissues of hamster.Methods:Amoebic liver abscess was experimentally induced in a hamster by injecting 1 × 106 of axenically cultured virulent E. histolytica trophozoites (HM1-IMSS strain) into the portal vein. After a week post-inoculation, the hamster was sacrificed and the liver tissue sections were stained with H&E, PAS and IHC stains to detect the amoebic trophozoite. Results: The three stains revealed tissue necrosis and amoebic trophozoites, but with varying clarity. H&E and PAS stained the trophozoites pink and magenta, respectively, however it was difficult to differentiate the stained trophozoites from the macrophages because of their similarity in size and morphology. On the other hand, IHC stain revealed distinct brown appearance of the trophozoites in the infected liver tissues. Conclusions: It can be concluded that out of the three stains, IHC is the best for identification of E. histolytica trophozoites in tissue sections.

  2. In vitro Effect of Monosaccharides on the Virulence of Acanthamoeba Isolated from Patients with Amoebic Keratitis

    Directory of Open Access Journals (Sweden)

    Y. Maroofi

    2007-04-01

    Full Text Available Introduction & Objective: Acanthamoeba is free-living amoeba that is found in soil, water, air as well as in human pharynx. Acanthamoeba is causative agent of granulomatose amoebic encephalitis (GAE in immunosuppressed and AIDS individuals and amoebic keratitis in people who use the lens. Pathogenic species of Acanthamoeba have protein receptors named mannose binding protein (MBP. Acanthamoeba via MBP adhere to the glycoproteins included mannose. Acanthamoeba adhesion to the target cells induces a protease secretion is called mannose inducing protein-133 (MIP-133. Exogense mannose can inhibit the adherence of Acanthamoeba; also, it can increase the cytopathatic effect (CPE through increase the secretion of MIP-133. In the present work, the effect of monosaccharides on the virulance of Acanthamoeba isolated from patient with amoebic keratitis, in HeLa cell culture was investigated.Materials & Methods: The isolates were cultured in HeLa cell culture, then 100, 50, 10, 1 and 0.1 mM of galactose, glucose and mannose were added to plates. Plates were observed with invert microscope in 8, 16, 32, 48, and 72 hours after culture.Results: Data implicated that mannose (100 mM showed the highest effect on increasing cytopathy of Acanthamoeba in HeLa cell culture. Meanwhile, galactose (100 mM increased the virulence of Acanthamoeba in the cell culture after 32 hours.Conclusion: Adding mannose and galactose to HeLa cell culture contain Acanthamoeba can increase the virulence of the parasite significantly.

  3. Cyanidin-3-glucoside inhibits UVB-induced oxidative damage and inflammation by regulating MAP kinase and NF-κB signaling pathways in SKH-1 hairless mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Pratheeshkumar, Poyil; Son, Young-Ok; Wang, Xin; Divya, Sasidharan Padmaja [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Joseph, Binoy [Spinal Cord and Brain Injury Research Center and Department of Physiology, University of Kentucky, Lexington, KY 40536-0509 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Yin, Yuanqin [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Cancer Institute, The First Affiliated Hospital, China Medical University, Shenyang (China); Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Lu, Jian [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu 212013 (China); Zhang, Zhuo [Graduate Center for Toxicology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Wang, Yitao [State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau (China); and others

    2014-10-01

    Skin cancer is one of the most commonly diagnosed cancers in the United States. Exposure to ultraviolet-B (UVB) radiation induces inflammation and photocarcinogenesis in mammalian skin. Cyanidin-3-glucoside (C3G), a member of the anthocyanin family, is present in various vegetables and fruits especially in edible berries, and displays potent antioxidant and anticarcinogenic properties. In this study, we have assessed the in vivo effects of C3G on UVB irradiation induced chronic inflammatory responses in SKH-1 hairless mice, a well-established model for UVB-induced skin carcinogenesis. Here, we show that C3G inhibited UVB-induced skin damage and inflammation in SKH-1 hairless mice. Our results indicate that C3G inhibited glutathione depletion, lipid peroxidation and myeloperoxidation in mouse skin by chronic UVB exposure. C3G significantly decreased the production of UVB-induced pro-inflammatory cytokines, such as IL-6 and TNF-α, associated with cutaneous inflammation. Likewise, UVB-induced inflammatory responses were diminished by C3G as observed by a remarkable reduction in the levels of phosphorylated MAP kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, C3G also decreased UVB-induced cyclooxygenase-2 (COX-2), PGE{sub 2} and iNOS levels, which are well-known key mediators of inflammation and cancer. Treatment with C3G inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mice skin. Immunofluorescence assay revealed that topical application of C3G inhibited the expression of 8-hydroxy-2′-deoxyguanosine, proliferating cell nuclear antigen, and cyclin D1 in chronic UVB exposed mouse skin. Collectively, these data indicates that C3G can provide substantial protection against the adverse effects of UVB radiation by modulating UVB-induced MAP kinase and NF-κB signaling pathways. - Highlights: • C3G inhibited UVB-induced oxidative damage and inflammation. • C3G inhibited UVB-induced COX-2, iNOS and PGE{sub 2} production. • C3G

  4. Short waves-induced enhancement of proliferation of human chondrocytes: involvement of extracellular signal-regulated map-kinase (erk).

    Science.gov (United States)

    Wang, Jue-Long; Chan, Rai-Chi; Cheng, He-Hsiung; Huang, Chun-Jen; Lu, Yih-Chau; Chen, I-Shu; Liu, Shiuh-Inn; Hsu, Shu-Shong; Chang, Hong-Tai; Huang, Jong-Khing; Chen, Jin-Shyr; Ho, Chin-Man; Jan, Chung-Ren

    2007-07-01

    1. Short-wave diathermy (SWD) is a form of radiofrequency radiation that is used therapeutically by physiotherapists. The cellular mechanisms of SWD are unclear. The present study was performed to explore the effect of different conditions of short-wave exposure on the proliferation of cultured human chondrocytes. 2. Cells exposed to short waves once per day for seven consecutive days exhibited a significant increase in proliferation by 42% compared with the control cells. In cells that were treated with short waves twice per day for seven consecutive days, or only once on Day 1 and then examined for proliferation on Day 7, cell proliferation was greater than the control cells by 40% and 30%, respectively. 3. Given the importance of mitogen-activated protein kinases (MAPK) in the proliferation of different cell types, efforts were extended to explore the role of three major types of MAPK; that is, extracellular signal-regulated kinase (ERK), c-Jun NH(2)-terminal protein kinase (JNK) and p38. 4. It was found that the level of phosphorylated ERK (phospho-ERK 1 and ERK 2) increased significantly within 5-120 min following consecutive exposure to short waves for 7 days. Exposure to short waves failed to alter the intensity of phosphorylated JNK and p38 within 0-240 min. 5. Cells were exposed to short waves once for seven consecutive days in the presence of 0, 10 micromol/L, 20 micromol/L or 50 micromol/L PD98059 (an ERK inhibitor). PD98059 totally inhibited short waves-induced enhancement of proliferation without altering normal control viability. In the presence of short waves and PD98059, the cell viability was lower than the normal control. Together, the data suggest that short waves could increase proliferation in human chondrocytes through activation of the ERK pathway, which is also involved in maintaining normal cell proliferation under physiological conditions.

  5. Convergent evidence identifying MAP/microtubule affinity-regulating kinase 1 (MARK1) as a susceptibility gene for autism.

    Science.gov (United States)

    Maussion, Gilles; Carayol, Jérôme; Lepagnol-Bestel, Aude-Marie; Tores, Frédéric; Loe-Mie, Yann; Milbreta, Ulla; Rousseau, Francis; Fontaine, Karine; Renaud, Julie; Moalic, Jean-Marie; Philippi, Anne; Chedotal, Alain; Gorwood, Philip; Ramoz, Nicolas; Hager, Jörg; Simonneau, Michel

    2008-08-15

    Autism spectrum disorders (ASDs) are common, heritable, but genetically heterogeneous neurodevelopmental conditions. We recently defined a susceptibility locus for ASDs on chromosome 1q41-q42. High-resolution single-nucleotide polymorphisms (126 SNPs) genotyping across the chromosome 1q41-q42 region, followed by a MARK1 (microtubule affinity-regulating kinase 1)-tagged-SNP association study in 276 families with autism from the Autism Genetic Research Exchange, showed that several SNPs within the MARK1 gene were significantly associated with ASDs by transmission disequilibrium tests. Haplotype rs12740310*C-rs3737296*G-rs12410279*A was overtransmitted (P(corrected)= 0.0016), with a relative risk for autism of 1.8 in homozygous carriers. Furthermore, ASD-associated SNP rs12410279 modulates the level of transcription of MARK1. We found that MARK1 was overexpressed in the prefrontal cortex (BA46) but not in cerebellar granule cells, on postmortem brain tissues from patients. MARK1 displayed an accelerated evolution along the lineage leading to humans, suggesting possible involvement of this gene in cognition. MARK1 encodes a kinase-regulating microtubule-dependent transport in axons and dendrites. Both overexpression and silencing of MARK1 resulted in significantly shorter dendrite length in mouse neocortical neurons and modified dendritic transport speed. As expected for a gene encoding a key polarity determinant Par-1 protein kinase, MARK1 is involved in axon-dendrite specification. Thus, MARK1 overexpression in humans may be responsible for subtle changes in dendritic functioning.

  6. Pharmacological profile of AW-814141, a novel, potent, selective and orally active inhibitor of p38 MAP kinase

    DEFF Research Database (Denmark)

    Chopra, Puneet; Kulkarni, Onkar; Gupta, Shashank

    2010-01-01

    -inflammatory activity of a p38 MAPK inhibitor, AW-814141. AW-814141 inhibited enzymatic activity of recombinant p38-alpha and beta isoforms with IC(50) value of 100nM and 158nM, respectively. AW-814141 also inhibited the release of tumor necrosis factor (TNF)-alpha by lipopolysaccharide (LPS) treated human peripheral...... blood mononuclear cells with an IC(50) value of 212nM and demonstrated selectivity against a panel of few kinases. Oral administration of AW-814141 (10mpk) in LPS-injected mice resulted in a significant reduction in TNF-alpha production in the circulation. In a carrageenan-induced rat paw edema model...

  7. 22(R)-hydroxycholesterol induces HuR-dependent MAP kinase phosphatase-1 expression via mGluR5-mediated Ca(2+)/PKCα signaling.

    Science.gov (United States)

    Kim, Hyunmi; Woo, Joo Hong; Lee, Jee Hoon; Joe, Eun-Hye; Jou, Ilo

    2016-08-01

    MAP kinase phosphatase (MKP)-1 plays a pivotal role in controlling MAP kinase (MAPK)-dependent (patho) physiological processes. Although MKP-1 gene expression is tightly regulated at multiple levels, the underlying mechanistic details remain largely unknown. In this study, we demonstrate that MKP-1 expression is regulated at the post-transcriptional level by 22(R)-hydroxycholesterol [22(R)-HC] through a novel mechanism. 22(R)-HC induces Hu antigen R (HuR) phosphorylation, cytoplasmic translocation and binding to MKP-1 mRNA, resulting in stabilization of MKP-1 mRNA. The resulting increase in MKP-1 leads to suppression of JNK-mediated inflammatory responses in brain astrocytes. We further demonstrate that 22(R)-HC-induced phosphorylation of nuclear HuR is mediated by PKCα, which is activated in the cytosol by increases in intracellular Ca(2+) levels mediated by the phospholipase C/inositol 1,4,5-triphosphate receptor (PLC/IP3R) pathway and translocates from cytoplasm to nucleus. In addition, pharmacological interventions reveal that metabotropic glutamate receptor5 (mGluR5) is responsible for the increases in intracellular Ca(2+) that underlie these actions of 22(R)-HC. Collectively, our findings identify a novel anti-inflammatory mechanism of 22(R)-HC, which acts through PKCα-mediated cytoplasmic shuttling of HuR to post-transcriptionally regulate MKP-1 expression. These findings provide an experimental basis for the development of a RNA-targeted therapeutic agent to control MAPK-dependent inflammatory responses.

  8. Interplay between calcineurin and the Slt2 MAP-kinase in mediating cell wall integrity, conidiation and virulence in the insect fungal pathogen Beauveria bassiana.

    Science.gov (United States)

    Huang, Shuaishuai; He, Zhangjiang; Zhang, Shiwei; Keyhani, Nemat O; Song, Yulin; Yang, Zhi; Jiang, Yahui; Zhang, Wenli; Pei, Yan; Zhang, Yongjun

    2015-10-01

    The entomopathogenic fungus, Beauveria bassiana, is of environmental and economic importance as an insect pathogen, currently used for the biological control of a number of pests. Cell wall integrity and conidiation are critical parameters for the ability of the fungus to infect insects and for production of the infectious propagules. The contribution of calcineurin and the Slt2 MAP kinase to cell wall integrity and development in B. bassiana was investigated. Gene knockouts of either the calcineurin CNA1 subunit or the Slt2 MAP kinase resulted in decreased tolerance to calcofluor white and high temperature. In contrast, the Δcna1 strain was more tolerant to Congo red but more sensitive to osmotic stress (NaCl, sorbitol) than the wild type, whereas the Δslt2 strain had the opposite phenotype. Changes in cell wall structure and composition were seen in the Δslt2 and Δcna1 strains during growth under cell wall stress as compared to the wild type. Both Δslt2 and Δcna1 strains showed significant alterations in growth, conidiation, and viability. Elevation of intracellular ROS levels, and decreased conidial hydrophobicity and adhesion to hydrophobic surfaces, were also seen for both mutants, as well as decreased virulence. Under cell wall stress conditions, inactivation of Slt2 significantly repressed CN-mediated phosphatase activity suggesting some level of cross talk between the two pathways. Comparative transcriptome profiling of the Δslt2 and Δcna1 strains revealed alterations in the expression of distinct gene sets, with overlap in transcripts involved in cell wall integrity, stress response, conidiation and virulence. These data illustrate convergent and divergent phenotypes and targets of the calcineurin and Slt2 pathways in B. bassiana.

  9. Analysis of Activated Platelet-Derived Growth Factor β Receptor and Ras-MAP Kinase Pathway in Equine Sarcoid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Gennaro Altamura

    2013-01-01

    Full Text Available Equine sarcoids are skin tumours of fibroblastic origin affecting equids worldwide. Bovine papillomavirus type-1 (BPV-1 and, less commonly, type-2 are recognized as etiological factors of sarcoids. The transforming activity of BPV is related to the functions of its major oncoprotein E5 which binds to the platelet-derived growth factor β receptor (PDGFβR causing its phosphorylation and activation. In this study, we demonstrate, by coimmunoprecipitation and immunoblotting, that in equine sarcoid derived cell lines PDGFβR is phosphorylated and binds downstream molecules related to Ras-mitogen-activated protein kinase-ERK pathway thus resulting in Ras activation. Imatinib mesylate is a tyrosine kinase receptors inhibitor which selectively inhibits the activation of PDGFβR in the treatment of several human and animal cancers. Here we show that imatinib inhibits receptor phosphorylation, and cell viability assays demonstrate that this drug decreases sarcoid fibroblasts viability in a dose-dependent manner. This study contributes to a better understanding of the molecular mechanisms involved in the pathology of sarcoids and paves the way to a new therapeutic approach for the treatment of this common equine skin neoplasm.

  10. Cloning and molecular characterization of a gene encoding MAP kinase from maize and its expression in E. coli

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A new MAPK gene, ZmSIMK1 (Zea mays L. salt-induced mitogen-activated protein kinase 1), is isolated from a maize cDNA library. The full-length ZmSIMK1 gene contains 1636 bp and an open reading frame of 1122 nucleotides capable of encoding 373 amino acid polypeptides with a predicted molecular mass of 42.3 kda and pI of 6.01. The putative ZmSIMK1 protein contains all 11 conserved subdomains that are characteristics of serine/threonine protein kinases and the TEY motif, which is the putative phosphorylation site. Northern blot analysis shows that ZmSIMK1 is ubiquitously expressed in roots, stems, and leaves of maize seedlings and its mRNA accumulation is observed in maize seedlings treated with 30 mmol/L PEG-6000 and 137 mmol/L NaCl, but the expression of ZmSIMK1 is not significantly affected by 4℃ treatment. The expression vector pET-ZmSIMK1 is constructed by inserting the coding region of ZmSIMK1 cDNA into pET-42a(+), and transformed into E. coli strain BL21(DE3). A 77kda fusion protein is induced by the further culture at 37℃ after addition of 1mmol/L IPTG.

  11. Activation of ERK/MAP kinase in the amygdala is required for memory consolidation of pavlovian fear conditioning.

    Science.gov (United States)

    Schafe, G E; Atkins, C M; Swank, M W; Bauer, E P; Sweatt, J D; LeDoux, J E

    2000-11-01

    Although much has been learned about the neurobiological mechanisms underlying Pavlovian fear conditioning at the systems and cellular levels, relatively little is known about the molecular mechanisms underlying fear memory consolidation. The present experiments evaluated the role of the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK) signaling cascade in the amygdala during Pavlovian fear conditioning. We first show that ERK/MAPK is transiently activated-phosphorylated in the amygdala, specifically the lateral nucleus (LA), at 60 min, but not 15, 30, or 180 min, after conditioning, and that this activation is attributable to paired presentations of tone and shock rather than to nonassociative auditory stimulation, foot shock sensitization, or unpaired tone-shock presentations. We next show that infusions of U0126, an inhibitor of ERK/MAPK activation, aimed at the LA, dose-dependently impair long-term memory of Pavlovian fear conditioning but leaves short-term memory intact. Finally, we show that bath application of U0126 impairs long-term potentiation in the LA in vitro. Collectively, these results demonstrate that ERK/MAPK activation is necessary for both memory consolidation of Pavlovian fear conditioning and synaptic plasticity in the amygdala.

  12. Role of stress-activated MAP kinase P38 in cisplatin-and DTT-induced apoptosis of the esophageal carcinoma cell line Eca109

    Institute of Scientific and Technical Information of China (English)

    Qian-Xian Zhang; Ruo Feng; Wei Zhang; Yi Ding; Ji-Yao Yang; Guo-Hong Liu

    2005-01-01

    AIM: To study the role of P38 kinase in esophageal cancer cell apoptosis induced by genotoxin, cisplatin and the unfolded protein response (UPR) inducer, dithiothreitol(DTT).METHODS: Esophageal carcinoma cell line Eca109 was cultured in RPMI 1640 medium to 70% confluency and treated with either cisplatin, DTT, or cisplatin plus DTT in the presence or absence of P38 inhibitor, SB203580. The untreated cells served as the control. The esophageal carcinoma cell apoptosis was detected by agarose gel DNA ladder analysis and quantified by flow cytometry.The P38 phosphorylation was detected by immunohis-tochemistry using antibodies specific to phosphorylated P38 protein.RESULTS: (1) Both cisplatin and DTT induced apoptosis in the esophageal cancer cell line Eca109 as shown by DNA ladder formation; (2) As detected by antibodies specific for the phosphorylated P38 protein (p-P38), both cisplatin and DTT treatments activated the stress-activated enzyme, MAP kinase P38. The number of positive cells was about 50% for the treatment groups, comparing to that of 10% for untreated group. DTT treatment, but not cisplatin treatment, induces nuclear localization of p-P38;(3) As measured by flow cytometry, inhibition of P38 activity by SB203580 blocks DFT- and cisplatin-induced apoptosis.The rates for DTT, cisplatin, and DTT plus cisplatin-induced apoptosis were 16.8%, 17.1%, and 21.4%, respectively.Addition of the SB compound during the incubation reduced the apoptotic rate to about 7.6% for all the treatment groups, suggesting that P38 activation is essential for cisplatin- and DTT-induced apoptosis in Eca109 cells.CONCLUSION: (1) Both DTT and cisplatin were able to induce apoptosis in esophageal cancer cell line Eca109;(2) P38 MAP kinase is essential for DTT- and cisplatin-induced apoptosis in Eca109 cells; (3) P38 activation may be the common signaling component relaying the multiple upstream signaling events to the downstream cell death program.

  13. cAMP-Induced Histones H3 Dephosphorylation Is Independent of PKA and MAP Kinase Activations and Correlates With mTOR Inactivation.

    Science.gov (United States)

    Rodriguez, Pedro; Rojas, Juan

    2016-03-01

    cAMP is a second messenger well documented to be involved in the phosphorylation of PKA, MAP kinase, and histone H3 (H3). Early, we reported that cAMP also induced H3 dephosphorylation in a variety of proliferating cell lines. Herein, it is shown that cAMP elicits a biphasic H3 dephosphorylation independent of PKA activation in cycling cells. H89, a potent inhibitor of PKA catalytic sub-unite, could not abolish this effect. Additionally, H89 induces a rapid and biphasic H3 serine 10 dephosphorylation, while a decline in the basal phosphorylation of CREB/ATF-1 is observed. Rp-cAMPS, an analog of cAMP and specific inhibitor of PKA, is unable to suppress cAMP-mediated H3 dephosphorylation, whereas Rp-cAMPS effectively blocks CREB/ATF-1 hyper-phosphorylation by cAMP and its inducers. Interestingly, cAMP exerts a rapid and profound H3 dephosphorylation at much lower concentration (50-fold lower, 0.125 mM) than the concentration required for maximal CREB/ATF-1 phosphorylation (5 mM). Much higher cAMP concentration is required to fully induce CREB/ATF-1 gain in phosphate (5 mM), which correlates with the inhibition of H3 dephosphorylation. Also, the dephosphorylation of H3 does not overlap at onset of MAP kinase phosphorylation pathways, p38 and ERK. Surprisingly, rapamycin (an mTOR inhibitor), cAMP, and its natural inducer isoproterenol, elicit identical dephosphorylation kinetics on both S6K1 ribosomal kinase (a downstream mTOR target) and H3. Finally, cAMP-induced H3 dephosphorylation is PP1/2-dependent. The results suggest that a pathway, requiring much lower cAMP concentration to that required for CREB/ATF-1 hyper-phosphorylation, is responsible for histone H3 dephosphorylation and may be linked to mTOR down regulation.

  14. Mutagenesis of p38alpha MAP Kinase Establishes Key Roles of Phe169 in Function and Structural Dynamics and Reveals a Novel DFG-OUT State

    Energy Technology Data Exchange (ETDEWEB)

    Bukhtiyarova,M.; Karpusas, M.; Northrup, K.; Namboodiri, H.; Springman, E.

    2007-01-01

    In order to study the role of Phe169 in p38{alpha} MAP kinase structure and function, wild-type p38{alpha} and five p38{alpha} DFG motif mutants were examined in vitro for phosphorylation by MKK6, kinase activity toward ATF2 substrate, thermal stability, and X-ray crystal structure. All six p38{alpha} variants were efficiently phosphorylated by MKK6. However, only one activated p38{alpha} mutant (F169Y) possessed measurable kinase activity (1% compared to wild-type). The loss of kinase activity among the DFG mutants may result from an inability to correctly position Asp168 in the activated form of p38{alpha}. Two mutations significantly increased the thermal stability of p38{alpha} (F169A {Delta}T{sub m} = 1.3 {sup o}C and D168G {Delta}T{sub m} = 3.8 {sup o}C), and two mutations significantly decreased the stability of p38{alpha} (F169R {Delta}T{sub m} = -3.2 {sup o}C and F169G {Delta}T{sub m} = -4.7 {sup o}C). Interestingly, X-ray crystal structures of two thermally destabilized p38{alpha}-F169R and p38{alpha}-F169G mutants revealed a DFG-OUT conformation in the absence of an inhibitor molecule. This DFG-OUT conformation, termed {alpha}-DFG-OUT, is different from the ones previously identified in p38{alpha} crystal structures with bound inhibitors and postulated from high-temperature molecular dynamics simulations. Taken together, these results indicate that Phe169 is optimized for p38{alpha} functional activity and structural dynamics, rather than for structural stability. The {alpha}-DFG-OUT conformation observed for p38{alpha}-F169R and p38{alpha}-F169G may represent a naturally occurring intermediate state of p38{alpha} that provides access for binding of allosteric inhibitors. A model of the local forces driving the DFG IN-OUT transition in p38{alpha} is proposed.

  15. Monocyte intracellular cytokine production during human endotoxaemia with or without a second in vitro LPS challenge : effect of RWJ-67657, a p38 MAP-kinase inhibitor, on LPS-hyporesponsiveness

    NARCIS (Netherlands)

    Faas, MM; Moes, H; Fijen, JW; Kobold, ACM; Tulleken, JE; Zijlstra, JG

    2002-01-01

    In the present study, we investigated the effect of RWJ-67657, a p38 MAP kinase inhibitor, upon in vivo LPS-induced monocyte cytokine production and upon monocyte LPS-hyporesponsiveness. Thirty minutes before a single injection of LPS (4 ng/kg BW), healthy male volunteers received a single oral dose

  16. Anti-amoebic properties of a Malaysian marine sponge Aaptos sp. on Acanthamoeba castellanii.

    Science.gov (United States)

    Nakisah, M A; Ida Muryany, M Y; Fatimah, H; Nor Fadilah, R; Zalilawati, M R; Khamsah, S; Habsah, M

    2012-03-01

    Crude methanol extracts of a marine sponge, Aaptos aaptos, collected from three different localities namely Kapas, Perhentian and Redang Islands, Terengganu, Malaysia, were tested in vitro on a pathogenic Acanthamoeba castellanii (IMR isolate) to examine their anti-amoebic potential. The examination of anti-Acanthamoebic activity of the extracts was conducted in 24 well plates for 72 h at 30 °C. All extracts possessed anti-amoebic activity with their IC(50) values ranging from 0.615 to 0.876 mg/mL. The effect of the methanol extracts on the surface morphology of A. castellanii was analysed under scanning electron microscopy. The ability of the extracts to disrupt the amoeba cell membrane was indicated by extensive cell's blebbing, changes in the surface morphology, reduced in cell size and with cystic appearance of extract-treated Acanthamoeba. Number of acanthapodia and food cup was also reduced in this Acanthamoeba. Morphological criteria of apoptosis in Acanthamoeba following treatment with the sponge's extracts was determined by acridine orange-propidium iodide staining and observed by fluorescence microscopy. By this technique, apoptotic and necrotic cells can be visualized and quantified. The genotoxic potential of the methanol extracts was performed by the alkaline comet assay. All methanol extracts used were significantly induced DNA damage compared to untreated Acanthamoeba by having high percentage of scores 1, 2, and 3 of the DNA damage. Results from cytotoxicity and genotoxicity studies carried out in the present study suggest that all methanol extracts of A. aaptos have anti-amoebic properties against A. castellanii.

  17. Stenotrophomonas maltophilia and Vermamoeba vermiformis relationships: bacterial multiplication and protection in amoebal-derived structures.

    Science.gov (United States)

    Cateau, Estelle; Maisonneuve, Elodie; Peguilhan, Samuel; Quellard, Nathalie; Hechard, Yann; Rodier, Marie-Helene

    2014-12-01

    Stenotrophomonas maltophilia, a bacteria involved in healthcare-associated infections, can be found in hospital water systems. Other microorganisms, such as Free Living amoebae (FLA), are also at times recovered in the same environment. Amongst these protozoa, many authors have reported the presence of Vermamoeba vermiformis. We show here that this amoeba enhances S. maltophilia growth and harbors the bacteria in amoebal-derived structures after 28 days in harsh conditions. These results highlight the fact that particular attention should be paid to the presence of FLA in hospital water systems, because of their potential implication in survival and growth of pathogenic bacterial species.

  18. Modulation of endogenous Cysteine Protease Inhibitor (ICP) 1 expression in Entamoeba histolytica affects amoebic adhesion to Extracellular Matrix proteins.

    Science.gov (United States)

    Lee, Young Ah; Saito-Nakano, Yumiko; Kim, Kyeong Ah; Min, Arim; Nozaki, Tomoyoshi; Shin, Myeong Heon

    2015-02-01

    Entamoeba histolytica is an enteric tissue-invading protozoan parasite that causes amoebic colitis and occasionally liver abscess in humans. During tissue invasion, amoebic adhesion to host components is an important event for host cell death leading to successful invasion and infection. Among amoebic virulence factors, Gal/GalNAc lectin is known to be major adhesion factor to host cells. In this study, we investigated the role of amoebic secreted CP (Cysteine Proteases) in amoebic adhesion to extracellular matrix (ECM) protein using CP inhibitor and E. histolytica strains in which the endogenous inhibitor of cysteine protease (ICP) 1 gene was overexpressed (ICP1(+)) or repressed by antisense small RNA-mediated gene silencing (ICP1(-)). We found that pretreatment of wild-type amoebae with CP inhibitor E64, or thiol-group modifiers such as diamide and N-Ethylmaleimide resulted in a significant decrease in adhesion to laminin and collagen ECM proteins. Furthermore, ICP1(+) strain, with a reduction of secreted CP activity, exhibited reduced ability by 40% to adhere to laminin. In contrast, ICP1(-) strain, with a 1.9-fold increase of secreted CP activity, showed a two-fold increase in amoebic adherence to laminin compared to the control strain. In addition, total amount of secreted CP5 was decreased in ICP1(+) amoeba. Conversely, total amount of secreted CP1 and mature-form CP5 were increased in ICP1(-) amoeba. We also found that ICP1 was secreted into extracellular milieu. These results suggest that secreted CP activity by E. histolytica may be an important factor affecting adhesion to host proteins, and regulation of CP secretion by ICP plays a major role in pathogenesis. This study provides insight into the CP-mediated tissue pathogenesis in amoeba-invaded lesions during human amoebiasis.

  19. Quantitative assay for the detection of the V617F variant in the Janus kinase 2 (JAK2 gene using the Luminex xMAP technology

    Directory of Open Access Journals (Sweden)

    Gaudet Daniel

    2010-04-01

    Full Text Available Abstract Background The availability of clinically valid biomarkers contribute to improve the diagnosis and clinical management of diseases. A valine-to-phenylalanine substitution at position 617 (V617F in the Janus kinase 2 (JAK2 gene has been recently associated with key signaling abnormalities in the transduction of haemopoietic growth-factor receptors and is now considered as a useful clinical marker of myeloproliferative neoplasms. Several methods have recently been reported to detect the JAK2 V617F point mutation and show variable sensitivity. Methods Using the Luminex xMAP technology, we developed a quantitative assay to detect the JAK2V617F variant. The method was based on polymerase chain reaction (PCR followed by hybridization to specific probes coupled with internally dyed microspheres. The assay comprises 3 steps: genomic DNA extraction, end point PCR reaction, direct hybridization of PCR fragments and quantification. It has been tested with different sources of nucleic acid. Results Applied to whole blood samples, this quantitative assay showed a limit of detection of 2%. A highly sensitive allele-specific primer extension reaction performed in parallel allowed to validate the results and to identify the specimens with values below 2%. Conclusion Direct hybridization assay using the Luminex xMAP technology allows sensitive quantification of JAK2V617F from blood spots. It is simple and can be easily performed in a clinical setting.

  20. P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis

    Directory of Open Access Journals (Sweden)

    Taiwo Yetunde O

    2008-12-01

    Full Text Available Abstract Background Evaluate the potential role of p38 inhibitors for the treatment of osteoarthritis using an animal model of joint degeneration (iodoacetate-induced arthritis and a pain model (Hargraeves assay. Methods P38 kinase activity was evaluated in a kinase assay by measuring the amount of phosphorylated substrate ATF2 using a phosphoATF2 (Thr71 specific primary antibody and an alkaline phosphate coupled secondary antibody and measuring the OD at 405 nm. TNFα and IL-1β secretion from LPS stimulated THP-1 monocytic cells and human peripheral blood mononuclear cells were measured by ELISA. Rats treated with vehicle or p38 inhibitor were injected intra-articularly in one knee with iodoacetate and damage to the tibial plateau was assessed from digitized images captured using an image analyzer. The effect of p38 inhibitors on hyperalgesia was evaluated in rats given an intraplantar injection of carrageenan and 4 h later the paw withdrawal time to a radiant heat source was measured. Results SB-203580 and VX-745 are both potent inhibitors of p38 with IC50s of 136 ± 64 nM and 35 ± 14 nM (mean ± S.D., respectively. Similarly, SB-203580 and VX-745 potently inhibited TNF release from LPS stimulated human THP-1 cells with IC50s of 72 ± 15 nM; and 29 ± 14 nM (mean ± S.D. respectively. TNF release from LPS stimulated human peripheral blood mononuclear cells was inhibited with IC50s 16 ± 6 nM and 14 ± 8 nM, (mean ± S.D. for SB-203580 and VX-745 and IL-1 was inhibited with IC50s of 20 ± 8 nM and 15 ± 4 nM (mean ± S.D., respectively. SB-203580 and VX-745 administered orally at a dose of 50 mg/kg resulted in the significant (p Conclusion SB203580 and VX-745 demonstrated attenuation of both cartilage degeneration and pain in animal models and suggest that p38 inhibitors may be a useful approach for the treatment of osteoarthritis.

  1. Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4.

    Science.gov (United States)

    Brodersen, Peter; Petersen, Morten; Bjørn Nielsen, Henrik; Zhu, Shijiang; Newman, Mari-Anne; Shokat, Kevan M; Rietz, Steffen; Parker, Jane; Mundy, John

    2006-08-01

    Arabidopsis MPK4 has been implicated in plant defense regulation because mpk4 knockout plants exhibit constitutive activation of salicylic acid (SA)-dependent defenses, but fail to induce jasmonic acid (JA) defense marker genes in response to JA. We show here that mpk4 mutants are also defective in defense gene induction in response to ethylene (ET), and that they are more susceptible than wild-type (WT) to Alternaria brassicicola that induces the ET/JA defense pathway(s). Both SA-repressing and ET/JA-(co)activating functions depend on MPK4 kinase activity and involve the defense regulators EDS1 and PAD4, as mutations in these genes suppress de-repression of the SA pathway and suppress the block of the ET/JA pathway in mpk4. EDS1/PAD4 thus affect SA-ET/JA signal antagonism as activators of SA but as repressors of ET/JA defenses, and MPK4 negatively regulates both of these functions. We also show that the MPK4-EDS1/PAD4 branch of ET defense signaling is independent of the ERF1 transcription factor, and use comparative microarray analysis of ctr1, ctr1/mpk4, mpk4 and WT to show that MPK4 is required for induction of a small subset of ET-regulated genes. The regulation of some, but not all, of these genes involves EDS1 and PAD4.

  2. Shock Waves Increase T-cell Proliferation or IL-2 Expression by Activating p38 MAP Kinase

    Institute of Scientific and Technical Information of China (English)

    Tie-Cheng YU; Yi LIU; Yan TAN; Yanfang JIANG; Xueqing ZHENG; Xinxiang XU

    2004-01-01

    Shock waves were elicited by transient pressure disturbances, which could be used to treat musculoskeletal disorders. In present studies, we i. nvestigated whether the low-density shock waves (LDSWs), which are able to damage plasma membrane without impairing the vimentin or other organelles, might augment T-cell proliferation as well as IL-2 expression, and if mitogen activated protein kinase p38 (p38 MAPK)might be an underlying mechanism through which the LDSWs enhanced T-cell function. We found that the LDSWs increased activation of p38 MAPK in Jurkat T cells. The LDSWs alone didn't result in the T-cell proliferation and IL-2 expression. However, in combination with other stimuli, LDSWs could augment the T-cell proliferation and IL-2 expression. Inhibition of p38 MAPK using SB203580 reduced the stimulatory effects of the LDSWs, which indicated that the LDSWs enhanced IL-2 expression through a mechanism that involved p38 MAPK activation. We concluded that the p38 MAPK activation played a key role in the regulation of T cell function by the LDSWs.

  3. Inhibition of the MAP kinase activity suppresses estrogen-induced breast tumor growth both in vitro and in vivo.

    Science.gov (United States)

    Reddy, Kaladhar B; Glaros, Selina

    2007-04-01

    Elevated expression of mitogen-activated protein kinase (Erk/MAPK) has been noted in a significant percentage of primary human breast cancers. To directly assess the importance of Erk/MAPK activation in estrogen (E2)-induced tumor progression, we blocked E2-signaling with MEK-inhibitor CI-1040 and/or tamoxifen (Tam). Our data show that both MEK-inhibitor CI-1040 and Tam blocked E2-induced MAPK phosphorylation and cell proliferation in MCF-7 breast cancer cells in vitro. However, in vivo studies show that anti-tumor efficacy of combining the CI-1040 and Tam was similar to single agent(s). Furthermore, sequential treatment with Tam followed by CI-1040 or CI-1040 followed by Tam did not significantly reduce E2-induced tumor growth. This suggests that the combination of CI-1040 and Tam may not be synergistic in inhibiting E2-induced tumor growth. However, these findings also indicate that MAPK plays a critical role in E2-induced tumor growth, and that this could be a potential therapeutic target to combat hormonally regulated growth in ER-positive tumors.

  4. Entamoeba histolytica acetyl-CoA synthetase:biomarker of acute amoebic liver abscess

    Institute of Scientific and Technical Information of China (English)

    Lim Boon Huat; Pim Chau Dam; Alfonso Olivos Garcia; Tan Zi Ning; Wong Weng Kin; Rahmah Noordin; Siti Shafiqah Anaqi Azham; Lee Zhi Jie; Guee Cher Ching; Foo Phiaw Chong

    2014-01-01

    Objective: To characterize the Entamoeba histolytica (E. histolytica) antigen(s) recognized by moribound amoebic liver abscess hamsters.Methods:in 1D- and 2D-Western blot analyses. The antigenic protein was then sent for tandem mass spectrometry analysis. The corresponding gene was cloned and expressed in Escherichia coli BL21-AI to produce the recombinant E. histolytica ADP-forming acetyl-CoA synthetase (EhACS) protein. A customised ELISA was developed to evaluate the sensitivity and specificity of the recombinant protein.Results:Crude soluble antigen of E. histolytica was probed with sera of moribund hamsters detected by sera of hamsters in the control group. Tandem mass spectrometry analysis revealed the protein to be the 77 kDa E. histolytica ADP-forming acetyl-CoA synthetase (EhACS). The customised ELISA results revealed 100% sensitivity and 100% specificity when tested against infected (n=31) and control group hamsters (n=5) serum samples, respectively.Conclusions:This finding suggested the significant role of EhACS as a biomarker for moribund A ~75 kDa protein band with a pI value of 5.91-6.5 was found to be antigenic; and not hamsters with acute amoebic liver abscess (ALA) infection. It is deemed pertinent that future studies explore the potential roles of EhACS in better understanding the pathogenesis of ALA; and in the development of vaccine and diagnostic tests to control ALA in human populations.

  5. Diagnostic tests for amoebic liver abscess: comparison of enzyme - linked immunosorbent assay (Elisa and counterimmunoelectrophoresis (CIE

    Directory of Open Access Journals (Sweden)

    Marcos I. Restrepo

    1996-02-01

    Full Text Available The liver abscess is the most frequent extraintestinal complication of intestinal amoebiasis: its diagnosis is suggested by the clinical picture but it must be confirmed by paraclinic tests. Themost stringent diagnosis requires identification of E. histolytica. But this is possible only in a few cases. Serological tests greatly improve the diagnosis of this severe complication of amoebiasis. We compared the Enzyme Linfed Immunosorbent Assay and the Counterimmunoeletrophoresis techniques. Both techniques were used to detect amoebic antibodies in 50 control patients, 30 patients with liver abscess and 30 patients with intestinal amoebiasis. All the sera from control patients gave negative results iin both techniques. When analysing the sera from patients with intestinal amoebiasis, 10% of them were positive by ELISA but non by CIE. The sera of patients with liver abscess, we found that 90% were positive by the ELISA method and 66.6% by the CIE technique. In patients with amoebic liver abscess, the results showed that the ELISA was more sensitive than the CIE, as it presented a higher sensitivity (100% than that of the CIE technique (66%.

  6. ANTI-MICROBIAL AND ANTI-AMOEBIC ACTIVITY SOME AZOMETHINES - POTENTIAL TEXTILE DYESTUFFS

    Directory of Open Access Journals (Sweden)

    DJORDJEVIC Dragan

    2016-05-01

    Full Text Available In this paper, new synthesized three azomethine derivatives applied in dyeing textiles checking the anti-microbial properties of active components, at the same time [1-3]. The emphasis is thrown on the verification of anti-microbial properties that are important for obtaining textile with significantly improved performance. All compounds were characterized and evaluated for their anti-microbial activity against 7 pathogenic bacteria, 1 parasitic protozoan and 1 fungus. It estimated anti-bacterial activity in vitro against the following microorganisms Staphylococcus aureus, Bacillus anthracis, Streptococcus faecalis, Enterobacter sp., Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis, and Candida albicans. The anti-amoebic activity in vitro was evaluated against the HM1: IMSS strain of Entamoeba histolytica and the results were compared with the standard drug, metronidazole. The synthesized azomethines, showed very good substantivity for wool fibers, gave fine coloring, with good degree of exhaustion after dyeing. The combination of extended synthetic analogues of natural molecules leads to discovery of chemical entities which might be excellent anti-microbial and anti-amoebic compounds as depicted in our results. Being highly the effects this compound can be explored in future as an option for decreasing pathogenic potential of infecting from different sources. Azomethines containing hydrazone (dyestuff 1 and phenylhydrazone (dyestuff 2 as moiety show average yield and moderate inhibition activity while azomethines containing thiosemicarbazone (dyestuff 3 as moiety show higher yield and greater inhibition activity towards gram-negative and gram-positive bacteria as well as a fungus.

  7. Oleanolic acid induces migration in Mv1Lu and MDA-MB-231 epithelial cells involving EGF receptor and MAP kinases activation

    Science.gov (United States)

    Ruzafa-Martínez, María; Ramos-Morcillo, Antonio Jesús

    2017-01-01

    During wound healing, skin function is restored by the action of several cell types that undergo differentiation, migration, proliferation and/or apoptosis. These dynamics are tightly regulated by the evolution of the extra cellular matrix (ECM) contents along the process. Pharmacologically active flavonoids have shown to exhibit useful physiological properties interesting in pathological states. Among them, oleanolic acid (OA), a pentacyclic triterpene, shows promising properties over wound healing, as increased cell migration in vitro and improved wound resolution in vivo. In this paper, we pursued to disclose the molecular mechanisms underlying those effects, by using an in vitro scratch assay in two epithelial cell lines of different linage: non-malignant mink lung epithelial cells, Mv1Lu; and human breast cancer cells, MDA-MB-231. In every case, we observed that OA clearly enhanced cell migration for in vitro scratch closure. This correlated with the stimulation of molecular pathways related to mitogen-activated protein (MAP) kinases, as ERK1,2 and Jun N-terminal kinase (JNK) 1,2 activation and c-Jun phosphorylation. Moreover, MDA-MB-231 cells treated with OA displayed an altered gene expression profile affecting transcription factor genes (c-JUN) as well as proteins involved in migration and ECM dynamics (PAI1), in line with the development of an epithelial to mesenchymal transition (EMT) status. Strikingly, upon OA treatment, we observed changes in the epidermal growth factor receptor (EGFR) subcellular localization, while interfering with its signalling completely prevented migration effects. This data provides a physiological framework supporting the notion that lipophilic plant extracts used in traditional medicine, might modulate wound healing processes in vivo through its OA contents. The molecular implications of these observations are discussed. PMID:28231262

  8. A Major Facilitator Superfamily Transporter-Mediated Resistance to Oxidative Stress and Fungicides Requires Yap1, Skn7, and MAP Kinases in the Citrus Fungal Pathogen Alternaria alternata

    Science.gov (United States)

    Chen, Li-Hung; Tsai, Hsieh-Chin; Yu, Pei-Ling

    2017-01-01

    Major Facilitator Superfamily (MFS) transporters play an important role in multidrug resistance in fungi. We report an AaMFS19 gene encoding a MFS transporter required for cellular resistance to oxidative stress and fungicides in the phytopathogenic fungus Alternaria alternata. AaMFS19, containing 12 transmembrane domains, displays activity toward a broad range of substrates. Fungal mutants lacking AaMFS19 display profound hypersensitivities to cumyl hydroperoxide, potassium superoxide, many singlet oxygen-generating compounds (eosin Y, rose Bengal, hematoporphyrin, methylene blue, and cercosporin), and the cell wall biosynthesis inhibitor, Congo red. AaMFS19 mutants also increase sensitivity to copper ions, clotrimazole, fludioxonil, and kocide fungicides, 2-chloro-5-hydroxypyridine (CHP), and 2,3,5-triiodobenzoic acid (TIBA). AaMFS19 mutants induce smaller necrotic lesions on leaves of a susceptible citrus cultivar. All observed phenotypes in the mutant are restored by introducing and expressing a wild-type copy of AaMFS19. The wild-type strain of A. alternata treated with either CHP or TIBA reduces radial growth and formation and germination of conidia, increases hyphal branching, and results in decreased expression of the AaMFS19 gene. The expression of AaMFS19 is regulated by the Yap1 transcription activator, the Hog1 and Fus3 mitogen-activated protein (MAP) kinases, the ‘two component’ histidine kinase, and the Skn7 response regulator. Our results demonstrate that A. alternata confers resistance to different chemicals via a membrane-bound MFS transporter. PMID:28060864

  9. C-type natriuretic peptide regulates endochondral bone growth through p38 MAP kinase-dependent and – independent pathways

    Directory of Open Access Journals (Sweden)

    Serra Rosa

    2007-03-01

    Full Text Available Abstract Background C-type natriuretic peptide (CNP has recently been identified as an important anabolic regulator of endochondral bone growth, but the molecular mechanisms mediating its effects are not completely understood. Results We demonstrate in a tibia organ culture system that pharmacological inhibition of p38 blocks the anabolic effects of CNP. We further show that CNP stimulates endochondral bone growth largely through expansion of the hypertrophic zone of the growth plate, while delaying mineralization. Both effects are reversed by p38 inhibition. We also performed Affymetrix microarray analyses on micro-dissected tibiae to identify CNP target genes. These studies confirmed that hypertrophic chondrocytes are the main targets of CNP signaling in the growth plate, since many more genes were regulated by CNP in this zone than in the others. While CNP receptors are expressed at similar levels in all three zones, cGMP-dependent kinases I and II, important transducers of CNP signaling, are expressed at much higher levels in hypertrophic cells than in other areas of the tibia, providing a potential explanation for the spatial distribution of CNP effects. In addition, our data show that CNP induces the expression of NPR3, a decoy receptor for natriuretic peptides, suggesting the existence of a feedback loop to limit CNP signaling. Finally, detailed analyses of our microarray data showed that CNP regulates numerous genes involved in BMP signaling and cell adhesion. Conclusion Our data identify novel target genes of CNP and demonstrate that the p38 pathway is a novel, essential mediator of CNP effects on endochondral bone growth, with potential implications for understanding and treatment of numerous skeletal diseases.

  10. Blackberry extract inhibits UVB-induced oxidative damage and inflammation through MAP kinases and NF-κB signaling pathways in SKH-1 mice skin

    Energy Technology Data Exchange (ETDEWEB)

    Divya, Sasidharan Padmaja; Wang, Xin; Pratheeshkumar, Poyil; Son, Young-Ok; Roy, Ram Vinod [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Kim, Donghern; Dai, Jin [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Asha, Padmaja [National Centre for Aquatic Animal Health, Cochin University of Science and Technology, Cochin (India); Shi, Xianglin [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Zhang, Zhuo, E-mail: zhuo.zhang@uky.edu [Department of Toxicology and Cancer Biology, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2015-04-01

    Extensive exposure of solar ultraviolet-B (UVB) radiation to skin induces oxidative stress and inflammation that play a crucial role in the induction of skin cancer. Photochemoprevention with natural products represents a simple but very effective strategy for the management of cutaneous neoplasia. In this study, we investigated whether blackberry extract (BBE) reduces chronic inflammatory responses induced by UVB irradiation in SKH-1 hairless mice skin. Mice were exposed to UVB radiation (100 mJ/cm{sup 2}) on alternate days for 10 weeks, and BBE (10% and 20%) was applied topically a day before UVB exposure. Our results show that BBE suppressed UVB-induced hyperplasia and reduced infiltration of inflammatory cells in the SKH-1 hairless mice skin. BBE treatment reduced glutathione (GSH) depletion, lipid peroxidation (LPO), and myeloperoxidase (MPO) in mouse skin by chronic UVB exposure. BBE significantly decreased the level of pro-inflammatory cytokines IL-6 and TNF-α in UVB-exposed skin. Likewise, UVB-induced inflammatory responses were diminished by BBE as observed by a remarkable reduction in the levels of phosphorylated MAP Kinases, Erk1/2, p38, JNK1/2 and MKK4. Furthermore, BBE also reduced inflammatory mediators such as cyclooxygenase-2 (COX-2), prostaglandin E{sub 2} (PGE{sub 2}), and inducible nitric oxide synthase (iNOS) levels in UVB-exposed skin. Treatment with BBE inhibited UVB-induced nuclear translocation of NF-κB and degradation of IκBα in mouse skin. Immunohistochemistry analysis revealed that topical application of BBE inhibited the expression of 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), cyclobutane pyrimidine dimers (CPD), proliferating cell nuclear antigen (PCNA), and cyclin D1 in UVB-exposed skin. Collectively, these data indicate that BBE protects from UVB-induced oxidative damage and inflammation by modulating MAP kinase and NF-κB signaling pathways. - Highlights: • Blackberry extract inhibits UVB-induced glutathione depletion.

  11. The role of EGFR/ERK/ELK-1 MAP kinase pathway in the underlying damage to diabetic rat skin

    Directory of Open Access Journals (Sweden)

    Xinhong Ge

    2013-01-01

    Full Text Available Background: Diabetes mellitus (DM is a highly prevalent disease. Atrophy and spontaneous ulcers are the most common cutaneous manifestation of diabetic dermopathy (DD. Before spontaneous ulcers, we believe there is an underlying damage stage although the mechanism is unknown. Aims: To explore the expression of extracellular signal-regulated kinase1/2 (ERK1/2, its correlated upstream protein epidermal growth factor receptor (EGFR and its downstream transcription factor E twenty-six (ETS-like 1(ELK-1in the damage of the diabetic rat skin, and to explore the role of ERK1/2 on the recessive damage to diabetic rat skin. Materials and Methods: Eighty Sprague-Dawley (SD rats weighing 260-300 g were randomly divided into control and streptozotocin (STZ-induced diabetes groups. After 0.5, 2, 4, and 8 weeks, the shaved skin specimens from the back of rats in both groups were collected to observe the histological characteristics of the skin, to measure the thickness of the epidermis and the dermis, and to observe the ultrastructure. Immunohistochemistry (IHC and Western blot techniques were used to detect the expression and activation of ERK1/2, EGFR, ELK-1 in the skin of the rats. Results: There are ultrastructural changes in the DM skin. With the continuance of the diabetes course, the thicknesses of the epidermis and dermis decreased, and the expression of phospho-ERK1/2 (P-ERK1/2, EGFR, and ELK-1 was decreased gradually in the back skin of the diabetes rats. It was significantly lower in 4 and 8 week DM than that of the normal control ( P < 0.05. The expression of P-EGFR and P-ERK1/2 in the back skin of the diabetes rats was positively correlated ( r = 0.572 P < 0.05, and the positive correlation was also obtained between P-ERK1/2 and P-ELK-1 ( r = 0.715, P < 0.05. Conclusion: The phenomenon of recessive damage exists in the skin of diabetes rats, which probably may relate to the weakness of the signal transduction: P-EGFR → ERK1/2 → ELK-1.

  12. Are free energy calculations useful in practice? A comparison with rapid scoring functions for the p38 MAP kinase protein system.

    Science.gov (United States)

    Pearlman, D A; Charifson, P S

    2001-10-11

    Precise thermodynamic integration free energy simulations have been applied to a congeneric series of 16 inhibitors to the p38 MAP kinase protein for which the experimental binding data (IC(50)) is known. The relative free energy of binding for each compound has been determined. For comparison, the same series of compounds have also scored using the best rapid scoring functions used in database screening. From the results of these calculations, we find (1) that precise free energy simulations allow predictions that are reliable and in good agreement with experiment; (2) that predictions of lower reliability, but still in good qualitative agreement with experiment, can be obtained using the OWFEG free energy grid method, at a much lower computational cost; (3) and that other methods, not based on free energy simulations yield results in much poorer agreement with experiment. A new predictive index, which measures the reliability of a prediction method in the context of normal use, is defined and calculated for each scoring method. Predictive indices of 0.84, 0.56, 0.04, -0.05, and 0.25 are calculated for thermodynamic integration, OWFEG, ChemScore, PLPScore, and Dock Energy Score, respectively, where +1.0 is perfect correct prediction, -1.0 is perfect incorrect prediction, and 0.0 is random.

  13. IDC1, a pezizomycotina-specific gene that belongs to the PaMpk1 MAP kinase transduction cascade of the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Jamet-Vierny, Corinne; Debuchy, Robert; Prigent, Magali; Silar, Philippe

    2007-12-01

    Components involved in the activation of the MAPK cascades in filamentous fungi are not well known. Here, we provide evidence that IDC1, a pezizomycotina-specific gene is involved along with the PaNox1 NADPH oxidase in the nuclear localization of the PaMpk1 MAP kinase, a prerequisite for MAPK activity. Mutants of IDC1 display the same phenotypes as mutants in PaNox1 and PaMpk1, i.e., lack of pigment and of aerial hyphae, female sterility, impairment in hyphal interference and inability to develop Crippled Growth cell degeneration. As observed for the PaNox1 mutant, IDC1 mutants are hypostatic to PaMpk1 mutants. IDC1 seems to play a key role in sexual reproduction. Indeed, fertility is diminished in strains with lower level of IDC1. In strains over-expressing IDC1, protoperithecia reach a later stage of development towards perithecia without fertilization; however, upon fertilization maturation of fertile perithecia is diminished and delayed. In addition, heterokaryon construction shows that IDC1 is necessary together with PaNox1 in the perithecial envelope but not in the dikaryon resulting from fertilization.

  14. Isolation of the etiological agent of primary amoebic meningoencephalitis from artificially heated waters

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, A.R.; Tyndall, R.L.; Coutant, C.C.; Willaert, E.

    1977-12-01

    To determine whether artificial heating of water by power plant discharges facilitates proliferation of the pathogenic free-living amoebae that cause primary amoebic meningoencephalitis, water samples (250 ml) were taken from discharges within 3,000 feet (ca. 914.4 m) of power plants and were processed for amoeba culture. Pathogenic Naegleria fowleri grew out of water samples from two of five lakes and rivers in Florida and from one of eight man-made lakes in Texas. Pathogenic N. fowleri did not grow from water samples taken from cooling towers and control lakes, the latter of which had no associated power plants. The identification of N. fowleri was confirmed by pathogenicity in mice and by indirect immunofluorescence analyses, by using a specific antiserum.

  15. Acquisition of contextual discrimination involves the appearance of a RAS-GRF1/p38 mitogen-activated protein (MAP) kinase-mediated signaling pathway that promotes long term potentiation (LTP).

    Science.gov (United States)

    Jin, Shan-Xue; Arai, Junko; Tian, Xuejun; Kumar-Singh, Rajendra; Feig, Larry A

    2013-07-26

    RAS-GRF1 is a guanine nucleotide exchange factor with the ability to activate RAS and RAC GTPases in response to elevated calcium levels. We previously showed that beginning at 1 month of age, RAS-GRF1 mediates NMDA-type glutamate receptor (NMDAR)-induction of long term depression in the CA1 region of the hippocampus of mice. Here we show that beginning at 2 months of age, when mice first acquire the ability to discriminate between closely related contexts, RAS-GRF1 begins to contribute to the induction of long term potentiation (LTP) in the CA1 hippocampus by mediating the action of calcium-permeable, AMPA-type glutamate receptors (CP-AMPARs). Surprisingly, LTP induction by CP-AMPARs through RAS-GRF1 occurs via activation of p38 MAP kinase rather than ERK MAP kinase, which has more frequently been linked to LTP. Moreover, contextual discrimination is blocked by knockdown of Ras-Grf1 expression specifically in the CA1 hippocampus, infusion of a p38 MAP kinase inhibitor into the CA1 hippocampus, or the injection of an inhibitor of CP-AMPARs. These findings implicate the CA1 hippocampus in the developmentally dependent capacity to distinguish closely related contexts through the appearance of a novel LTP-supporting signaling pathway.

  16. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

    Science.gov (United States)

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-10-19

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  17. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

    Directory of Open Access Journals (Sweden)

    Akiko Edagawa

    2015-10-01

    Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  18. Effects of interleukins 2 and 12 on TBT-induced alterations of MAP kinases p38 and p44/42 in human natural killer cells.

    Science.gov (United States)

    Aluoch, Aloice O; Whalen, Margaret M

    2006-01-01

    NK cells are lymphocytes in the non-adaptive immune system that protect the body against intracellular pathogens and eliminate tumor cells. Tributyltin (TBT) is a toxic chemical that has been detected in human foods as well as in human blood. The role of TBT in immunosuppression has been described, including inhibition of the human NK-cell cytotoxic function. Previous studies indicated that exposure of NK cells to TBT for 1 h induced progressive and irreversible inhibition of cytotoxic function. However, it was found that if NK cells were incubated in TBT-free media with either IL-2 or IL-12, loss of cytotoxic function was prevented/reversed within 24 h. Molecular studies established that loss of cytotoxic function is accompanied by alteration of MAP kinases (MAPKs) p38 and p44/42 phosphorylation. This study examined whether interleukin-mediated recovery of cytotoxicity involved reversal of tributyltin-altered p38 and p44/42 phosphorylation. The results indicated that there was no substantial IL-2 prevention/reversal of the TBT-induced alteration of phosphorylation of either p38 or p44/42 after either a 24 or 48 h recovery period. Additionally, IL-12 caused no substantial prevention/reversal of the TBT-induced alteration of phosphorylation of the MAPKs seen after either 24 or 48 h. These data suggest that IL-2 and/or IL-12-mediated recovery of NK cytotoxic function is not a result of prevention/reversal of TBT-induced phosphorylation of p38 and p44/42 MAPKs at the 24 or 48 h time points.

  19. Inhibition of lipid phosphate phosphatase activity by VPC32183 suppresses the ability of diacylglycerol pyrophosphate to activate ERK(1/2) MAP kinases.

    Science.gov (United States)

    Violet, Pierre-Christian; Billon-Denis, Emmanuelle; Robin, Philippe

    2012-11-01

    The lipidic metabolite, diacylglycerol pyrophosphate (DGPP), in its dioctanoyl form (DGPP 8:0), has been described as an antagonist for mammalian lysophosphatidic acid (LPA) receptors LPA1 and LPA3. In this study we show that DGPP 8:0 does not antagonize LPA dependent activation of ERK(1/2) MAP kinases but strongly stimulated them in various mammalian cell lines. LPA and DGPP 8:0 stimulation of ERK(1/2) occurred through different pathways. The DGPP 8:0 effect appeared to be dependent on PKC, Raf and MEK but was insensitive to pertussis toxin and did not involve G protein activation. Finally we showed that DGPP 8:0 effect on ERK(1/2) was dependent on its dephosphorylation by a phosphatase activity sharing lipid phosphate phosphatase properties. The inhibition of this phosphatase activity by VPC32183, a previously characterized LPA receptor antagonist, blocked the DGPP 8:0 effect on ERK(1/2) activation. Moreover, down-regulation of lipid phosphate phosphatase 1 (LPP1) expression by RNA interference technique also reduced DGPP 8:0-induced ERK(1/2) activation. Consistently, over expression of LPP1 in HEK293 cells increases DGPP 8:0 hydrolysis and this increased activity was inhibited by VPC32183. In conclusion, DGPP 8:0 does not exert its effect by acting on a G protein coupled receptor, but through its dephosphorylation by LPP1, generating dioctanoyl phosphatidic acid which in turn activates PKC. These results suggest that LPP1 could have a positive regulatory function on cellular signaling processes such as ERK(1/2) activation.

  20. Phosphorylation of ERK/MAP Kinase Is Required for Long-Term Potentiation in Anatomically Restricted Regions of the Lateral Amygdala in Vivo

    Science.gov (United States)

    Schafe, Glenn E.; Swank, Michael W.; Rodriguez, Sarina M.; Debiec, Jacek; Doyere, Valerie

    2008-01-01

    We have previously shown that the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/ MAPK) is transiently activated in anatomically restricted regions of the lateral amygdala (LA) following Pavlovian fear conditioning and that blockade of ERK/MAPK activation in the LA impairs both fear memory consolidation and long-term…

  1. Immunization with a tetramer derivative of an anti-inflammatory pentapeptide produced by Entamoeba histolytica protects gerbils (Meriones unguiculatus) against experimental amoebic abscess of the liver.

    Science.gov (United States)

    Giménez-Scherer, Juan Antonio; Cárdenas, Guadalupe; López-Osuna, Martha; Velázquez, Juan Raymundo; Rico, Guadalupe; Isibasi, Armando; Maldonado, María del Carmen; Morales, María Esther; Fernández-Diez, Jorge; Kretschmer, Roberto R

    2004-01-01

    Axenically grown Entamoeba histolytica produces a pentapeptide (Met-Gln-Cys-Asn-Ser) with several anti-inflammatory properties, including the inhibition of human monocyte locomotion (Monocyte Locomotion Inhibitory Factor (MLIF)). A construct displays the same effects as the native material. It remains to be seen if MLIF is used, or even produced in vivo by the tissue-invading parasite. If MLIF were to be relevant in invasive amoebiasis, immunizing against it could diminish this parasite advantage and prevent lesions. KLH-linked MLIF mixed with Freund's adjuvant was too aggressive an immunizing material to answer this question. However, immunization with a tetramer of MLIF (but not a scrambled version of MLIF) around a lysine core (MLIF-MAPS), that displays increased antigenicity, yet lacks excessive innate immunity activation, completely protects gerbils against amoebic abscess of the liver caused by the intraportal injection of virulent E. histolytica. Liver abscesses caused by Listeria monocytogenes were not prevented. Invasive E. histolytica may produce the parent protein of MLIF in vivo, and if appropriately cleaved, it may play a role in invasive amoebiasis. MLIF may join new vaccination strategies against amoebiasis.

  2. Serum antibodies to Balamuthia mandrillaris, a free-living amoeba recently demonstrated to cause granulomatous amoebic encephalitis.

    Science.gov (United States)

    Huang, Z H; Ferrante, A; Carter, R F

    1999-05-01

    Free-living amoebae cause three well-defined disease entities: a rapidly fatal primary meningoencephalitis, a chronic granulomatous amoebic encephalitis (GAE), and a chronic amoebic keratitis. GAE occurs in immunocompromised persons. Recently, another type of free-living amoeba, Balamuthia mandrillaris, has been shown to cause GAE. The finding that this amoeba has caused infection in some healthy children has raised the possibility that humans may lack immunity to B. mandrillaris. Human serum was examined for the presence of surface antibodies specific for this amoeba by immunofluorescence. Sera from adults contained titers of 1/64-1/256 of anti-B. mandrillaris antibodies (IgM and IgG classes), which did not cross-react with other amoebae. Cord blood contained very low antibody levels, but levels similar to those in adults were seen in serum of 1- to 5-year-old children.

  3. Amoebicidal Activity of Essential Oil of Dysphania ambrosioides (L.) Mosyakin & Clemants in an Amoebic Liver Abscess Hamster Model

    OpenAIRE

    Manuel Enrique Ávila-Blanco; Martín Gerardo Rodríguez; José Luis Moreno Duque; Martin Muñoz-Ortega; Javier Ventura-Juárez

    2014-01-01

    Amebiasis is a parasitic disease that extends worldwide and is a public health problem in developing countries. Metronidazole is the drug recommended in the treatment of amebiasis, but its contralateral effects and lack of continuity of treatment induce low efficiency, coupled with the appearance of resistant amoebic strains. Therefore, the search of new compounds with amoebicidal activity is urgent and important. In this study, we evaluated the in vitro and in vivo antiamoebic activity of th...

  4. Diagnostic tests for amoebic liver abscess: comparison of enzyme - linked immunosorbent assay (Elisa and counterimmunoelectrophoresis (CIE

    Directory of Open Access Journals (Sweden)

    Marcos I. Restrepo

    1996-02-01

    Full Text Available The liver abscess is the most frequent extraintestinal complication of intestinal amoebiasis: its diagnosis is suggested by the clinical picture but it must be confirmed by paraclinic tests. Themost stringent diagnosis requires identification of E. histolytica. But this is possible only in a few cases. Serological tests greatly improve the diagnosis of this severe complication of amoebiasis. We compared the Enzyme Linfed Immunosorbent Assay and the Counterimmunoeletrophoresis techniques. Both techniques were used to detect amoebic antibodies in 50 control patients, 30 patients with liver abscess and 30 patients with intestinal amoebiasis. All the sera from control patients gave negative results iin both techniques. When analysing the sera from patients with intestinal amoebiasis, 10% of them were positive by ELISA but non by CIE. The sera of patients with liver abscess, we found that 90% were positive by the ELISA method and 66.6% by the CIE technique. In patients with amoebic liver abscess, the results showed that the ELISA was more sensitive than the CIE, as it presented a higher sensitivity (100% than that of the CIE technique (66%.O abscesso hepático é a complicação mais freqüente da amebíase intestinal: o seu diagnótico sugere-se pelo quadro clínico, mas é confirmado pelos estudos paraclínicos. Para confirmar o diagnóstico precisa-se identificar a E. histolytica, o que é apenas possível em muito poucos casos. As provas sorolôgicas melhoram notadamente o diagnóstico das complicações severas da amebíase. Em nosso estudo comparamos o teste de ELISA e a Contraimunoeletroforese (CIE. Ambas as técnicas foram utilizadas para detectar anticorpos contra ameba em 50 pacientes sem amebíase, 30 pacientes com abscesso hepático e 30 com amebíase intestinal. Todos os soros dos pacientes sem amebíase foram negativos por ambas as técnicas. Quando analisamos os soros dos pacientes com amebíase intestinal, encontrou-se que 10% destes

  5. Tobacco-specific Carcinogen 4-(Methylnitrosoamino)-1-(3-pyridyl )-1-butanone(NNK) Activating ERK1/2 MAP Kinases and Stimulating Proliferation of Hmnan Mammary Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Cigarette smoking is correlated with the development of various cancers. 4 - (Methylnitrosoamino) -1 - ( 3 -pyridyl) -1-butanone (NNK) is one of the major tobacco-specific carcinogens in the cigarette smoke, which increases the risk of breast cancer. In the present study, it was demonstrated that NNK rapidly activated ERK1 and ERK2 MAP kinases in human normal mammary epithelial cells. It was found that there are two different routes for the activation of ERK1/2with NNK. One is from nicotinic receptor nAchR to MEK1/2, and the other is from tyrosine kinase containing receptor to MEK1/2. The tobacco-specific carcinogen NNK shows a strong proliferative effect on normal human mammary epithelial cells and cancer mammary epithelial cells.

  6. Identification of a 115kDa MAP-kinase activated by freezing and anoxic stresses in the marine periwinkle, Littorina littorea.

    Science.gov (United States)

    MacDonald, Justin A; Storey, Kenneth B

    2006-06-15

    The mitogen-activated protein kinase (MAPK) cascade regulates changes in gene transcription by transmitting extracellular stimuli from the plasma membrane to the cell nucleus and has an important role to play in organismal responses to environmental stresses. The activities of MAPKs were investigated in the marine gastropod mollusk, Littorina littorea, a species that tolerates both extracellular freezing and long term oxygen deprivation. In-gel kinase assays revealed the presence of two MAPKs in foot muscle and hepatopancreas, a 42 and a 115kDa protein. Immunoblot analysis showed that both were MAPK proteins and that one was the periwinkle homologue of p42(ERK2). Size exclusion chromatography confirmed the 115kDa size of the novel snail MAPK and its role as the dominant MAPK activity in foot muscle. In-gel kinase assays, immunoblotting with phospho-specific ERK antibody, as well as kinase activity profiles from hydroxyapatite chromatography demonstrated that p115 MAPK kinase activity was increased in foot muscle in response to in vivo freezing or anoxia exposures. The results suggest a role for this novel kinase in environmental stress response.

  7. Acanthamoeba genotypes T3 and T4 as causative agents of amoebic keratitis in Mexico.

    Science.gov (United States)

    Omaña-Molina, Maritza; Vanzzini-Zago, Virginia; Hernandez-Martinez, Dolores; Gonzalez-Robles, Arturo; Salazar-Villatoro, Lizbeth; Ramirez-Flores, Elizabeth; Oregon-Miranda, Eric; Lorenzo-Morales, Jacob; Martinez-Palomo, Adolfo

    2016-02-01

    Free-living amoebae (FLA) are widely distributed worldwide. Some genera included in this group act as opportunistic pathogens causing fatal encephalitis and Acanthamoeba keratitis (AK), a sight-threatening infection of the cornea associated with the use of soft contact lenses that could even end in blindness if an early diagnosis and treatment are not achieved. Furthermore, the numbers of AK cases keep rising worldwide mainly due to an increase of contact lens wearers and lack of hygiene in the maintenance of lenses and their cases. In Mexico, no cases of AK have been described so far although the isolation of other pathogenic FLA such as Naegleria fowleri and Balamuthia mandrillaris from both clinical and environmental sources has been reported. The present study reports two cases of Acanthamoeba keratitis diagnosed in two patients admitted to the Hospital "Luis Sánchez Bulnes" for Blindness Prevention in Mexico City, Mexico. Corneal scrapes and contact lenses were checked for the presence of Acanthamoeba strains in both patients. Strains were axenized after initial isolation to classify at the genotype level. After sequencing the diagnostic fragment 3 (DF3) region located on the 18S ribosomal DNA (rDNA) gene of Acanthamoeba, genotype T3 and genotype T4 were identified in clinical case 1 and 2, respectively. To our knowledge, these are the first reported cases of AK in Mexico in the literature and the first description of Acanthamoeba genotypes T3 and T4 as causative agents of amoebic infection.

  8. Lipid composition of multilamellar bodies secreted by Dictyostelium discoideum reveals their amoebal origin.

    Science.gov (United States)

    Paquet, Valérie E; Lessire, René; Domergue, Frédéric; Fouillen, Laetitia; Filion, Geneviève; Sedighi, Ahmadreza; Charette, Steve J

    2013-10-01

    When they are fed with bacteria, Dictyostelium discoideum amoebae produce and secrete multilamellar bodies (MLBs), which are composed of membranous material. It has been proposed that MLBs are a waste disposal system that allows D. discoideum to eliminate undigested bacterial remains. However, the real function of MLBs remains unknown. Determination of the biochemical composition of MLBs, especially lipids, represents a way to gain information about the role of these structures. To allow these analyses, a protocol involving various centrifugation procedures has been developed to purify secreted MLBs from amoeba-bacterium cocultures. The purity of the MLB preparation was confirmed by transmission electron microscopy and by immunofluorescence using H36, an antibody that binds to MLBs. The lipid and fatty acid compositions of pure MLBs were then analyzed by high-performance thin-layer chromatography (HPTLC) and gas chromatography (GC), respectively, and compared to those of amoebae as well as bacteria used as a food source. While the bacteria were devoid of phosphatidylcholine (PC) and phosphatidylinositol (PI), these two polar lipid species were major classes of lipids in MLBs and amoebae. Similarly, the fatty acid composition of MLBs and amoebae was characterized by the presence of polyunsaturated fatty acids, while cyclic fatty acids were found only in bacteria. These results strongly suggest that the lipids constituting the MLBs originate from the amoebal metabolism rather than from undigested bacterial membranes. This opens the possibility that MLBs, instead of being a waste disposal system, have unsuspected roles in D. discoideum physiology.

  9. Characterization of Naegleria fowleri strains isolated from human cases of primary amoebic meningoencephalitis in Mexico.

    Science.gov (United States)

    Cervantes-Sandoval, Isaac; de Serrano-Luna, José Jesús; Tapia-Malagón, José Luis; Pacheco-Yépez, Judith; Silva-Olivares, Angélica; Galindo-Gómez, Silvia; Tsutsumi, Victor; Shibayama, Mineko

    2007-01-01

    The protozoon Naegleria fowleri (N. fowleri) is a free-living amoeba that produces primary amoebic meningoencephalitis (PAM), which is an acute and frequently fatal infection of the central nervous system. We characterized the strains of N. fowleri isolated from the cerebrospinal fluid (CSF) of two cases presented in northwestern Mexico. The strains were isolated and cultured in 2% bactocasitone medium. Enflagellation assays, ultrastructural analysis, protein and protease electrophoresis patterns, and PCR were performed as confirmatory tests. Virulence tests were done using in Balb/c mice. Light microscopy analysis of brain tissue showed amoebae with abundant inflammatory reaction and extensive necrotic and hemorrhagic areas. The enflagellation assay was positive and the electron microscopy showed trophozoites with morphologic features typical of the genus. Protein and protease profiles of the isolated strains were identical to the reference strain. Finally, a 1500-bp PCR product was found in all three strains. Based on all the analyses performed, we concluded that the etiologic agent of both PAM cases was N. fowleri. The need for better epidemiological information and educational programs about basic clinical and pathological aspects of free-living amoebae provided by the health authorities are emphasized.

  10. Morphological Findings in Trophozoites during Amoebic Abscess Development in Misoprostol-Treated BALB/c Mice

    Directory of Open Access Journals (Sweden)

    Andrés Aceves-Cano

    2015-01-01

    Full Text Available During amoebic liver abscess (ALA formation in susceptible animals, immune response is regulated by prostaglandin E2 (PGE2 dependent mechanisms. The aim of this study was to analyze the effect of misoprostol (MPL, a PGE1 analogue, on ALA formation in BALB/c mice. Male mice from BALB/c strain were intrahepatically infected with 7.5×105 trophozoites of E. histolytica strain HM1:IMSS and treated with 10−4 M of MPL daily until sacrifice at 2, 4, and 7 days postinfection (p.i.. ALA formation was evaluated at 2, 4, and 7 days postinfection; trophozoite morphology was analyzed using immunohistochemistry and image analysis. Results showed an increase in frequency of ALA formation in infected and MPL-treated mice only at 2 days p.i. (P=0.03. A significant diminution in the size of trophozoites was detected in abscesses from mice independently of MPL treatment (from 5.8±1.1 µm at 2 days p.i. to 2.7±1.9 µm at 7 days p.i. compared with trophozoites dimensions observed in susceptible hamsters (9.6±2.7 µm (P<0.01. These results suggest that MPL treatment may modify the adequate control of inflammatory process to allow the persistence of trophozoites in the liver; however, natural resistance mechanisms cannot be discarded.

  11. In vivo Evaluation of Two Thiazolidin-4-one Derivatives in High Sucrose Diet Fed Pre-diabetic Mice and Their Modulatory Effect on AMPK, Akt and p38 MAP Kinase in L6 Cells

    Science.gov (United States)

    Mudgal, Jayesh; Shetty, Priya; Reddy, Neetinkumar D.; Akhila, H. S.; Gourishetti, Karthik; Mathew, Geetha; Nayak, Pawan G.; Kumar, Nitesh; Kishore, Anoop; Kutty, Nampurath G.; Nandakumar, Krishnadas; Shenoy, Rekha R.; Rao, Chamallamudi M.; Joseph, Alex

    2016-01-01

    We had previously demonstrated the anti-diabetic potential and pancreatic protection of two thiazolidin-4-one derivatives containing nicotinamide moiety (NAT-1 and NAT-2) in STZ-induced diabetic mice. However, due to the limitations of the STZ model, we decided to undertake a detailed evaluation of anti-diabetic potential of the molecules on a high sucrose diet (HSD) fed diabetic mouse model. Further, in vitro mechanistic studies on the phosphorylation of AMPK, Akt and p38 MAP kinase in L6 myotubes and anti-inflammatory studies in RAW264.7 mouse monocyte macrophage cells were performed. 15 months of HSD induced fasting hyperglycaemia and impaired glucose tolerance in mice. Treatment with NAT-1 and NAT-2 (100 mg/kg) for 45 days significantly improved the glucose tolerance and lowered fasting blood glucose levels compared to untreated control. An improvement in the elevated triglycerides and total cholesterol levels, and favorable rise in HDL cholesterol were also observed with test drug treatment. Also, no major changes were observed in the liver (albumin, AST and ALT) and kidney (creatinine and urea) parameters. This was further confirmed in their respective histology profiles which revealed no gross morphological changes. In L6 cells, significant phosphorylation of Akt and p38 MAP kinase proteins were observed with 100 μM of NAT-1 and NAT-2 with no significant changes in phosphorylation of AMPK. The molecules failed to exhibit anti-inflammatory activity as observed by their effect on the generation of ROS and nitrite, and nuclear levels of NF-κB in LPS-stimulated RAW264.7 cells. In summary, the molecules activated Akt and p38 MAP kinase which could have partly contributed to their anti-hyperglycaemic and hypolipidemic activities in vivo. PMID:27790148

  12. Differential expression profiles of poplar MAP kinase kinases in response to abiotic stresses and plant hormones, and overexpression of PtMKK4 improves the drought tolerance of poplar.

    Science.gov (United States)

    Wang, Lei; Su, Hongyan; Han, Liya; Wang, Chuanqi; Sun, Yanlin; Liu, Fenghong

    2014-07-15

    Mitogen-activated protein kinase (MAPK) cascades are universal signal transduction modules that play essential roles in plant growth, development and stress response. MAPK kinases (MAPKKs), which link MAPKs and MAPKK kinases (MAPKKKs), are integral in mediating various stress responses in plants. However, to date few data about the roles of poplar MAPKKs in stress signal transduction are available. In this study, we performed a systemic analysis of poplar MAPKK gene family expression profiles in response to several abiotic stresses and stress-associated hormones. Furthermore, Populus trichocarpa MAPKK4 (PtMKK4) was chosen for functional characterization. Transgenic analysis showed that overexpression of the PtMKK4 gene remarkably enhanced drought stress tolerance in the transgenic poplar plants. The PtMKK4-overexpressing plants also exhibited much lower levels of H2O2 and higher antioxidant enzyme activity after exposure to drought stress compared to the wide type lines. Besides, some drought marker genes including PtP5CS, PtSUS3, PtLTP3 and PtDREB8 exhibited higher expression levels in the transgenic lines than in the wide type under drought conditions. This study provided valuable information for understanding the putative functions of poplar MAPKKs involved in important signaling pathways under different stress conditions.

  13. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.; Hood, Molly M.; Lord, John W.; Lu, Wei-Ping; Miller, David F.; Patt, William C.; Smith, Bryan D.; Vogeti, Lakshminarayana; Kaufman, Michael D.; Petillo, Peter A.; Wise, Scott C.; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L. (Deciphera); (Emerald); (Cocrystal)

    2012-01-20

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  14. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region.

    Science.gov (United States)

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L; Hood, Molly M; Lord, John W; Lu, Wei-Ping; Miller, David F; Patt, William C; Smith, Bryan D; Vogeti, Lakshminarayana; Kaufman, Michael D; Petillo, Peter A; Wise, Scott C; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L

    2010-10-01

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  15. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    OpenAIRE

    Jorg Kotzka; Birgit Knebel; Jutta Haas; Lorena Kremer; Sylvia Jacob; Sonja Hartwig; Ulrike Nitzgen; Dirk Muller-Wieland

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress acti...

  16. Nuclease activity of Legionella pneumophila Cas2 promotes intracellular infection of amoebal host cells.

    Science.gov (United States)

    Gunderson, Felizza F; Mallama, Celeste A; Fairbairn, Stephanie G; Cianciotto, Nicholas P

    2015-03-01

    Legionella pneumophila, the primary agent of Legionnaires' disease, flourishes in both natural and man-made environments by growing in a wide variety of aquatic amoebae. Recently, we determined that the Cas2 protein of L. pneumophila promotes intracellular infection of Acanthamoeba castellanii and Hartmannella vermiformis, the two amoebae most commonly linked to cases of disease. The Cas2 family of proteins is best known for its role in the bacterial and archeal clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated protein (Cas) system that constitutes a form of adaptive immunity against phage and plasmid. However, the infection event mediated by L. pneumophila Cas2 appeared to be distinct from this function, because cas2 mutants exhibited infectivity defects in the absence of added phage or plasmid and since mutants lacking the CRISPR array or any one of the other cas genes were not impaired in infection ability. We now report that the Cas2 protein of L. pneumophila has both RNase and DNase activities, with the RNase activity being more pronounced. By characterizing a catalytically deficient version of Cas2, we determined that nuclease activity is critical for promoting infection of amoebae. Also, introduction of Cas2, but not its catalytic mutant form, into a strain of L. pneumophila that naturally lacks a CRISPR-Cas locus caused that strain to be 40- to 80-fold more infective for amoebae, unequivocally demonstrating that Cas2 facilitates the infection process independently of any other component encoded within the CRISPR-Cas locus. Finally, a cas2 mutant was impaired for infection of Willaertia magna but not Naegleria lovaniensis, suggesting that Cas2 promotes infection of most but not all amoebal hosts.

  17. Reevaluation of an Acanthamoeba Molecular Diagnostic Algorithm following an Atypical Case of Amoebic Keratitis.

    Science.gov (United States)

    Lau, Rachel; Cunanan, Marlou; Jackson, Jonathan; Ali, Ibne Karim M; Chong-Kit, Ann; Gasgas, Jason; Tian, Jinfang; Ralevski, Filip; Boggild, Andrea K

    2015-10-01

    Amoebic keratitis (AK) is a potentially blinding infection, the prompt diagnosis of which is essential for limiting ocular morbidity. We undertook a quality improvement initiative with respect to the molecular detection of acanthamoebae in our laboratory because of an unusual case of discordance. Nine ATCC strains of Acanthamoeba and 40 delinked, biobanked, surplus corneal scraping specimens were analyzed for the presence of acanthamoebae with four separate real-time PCR assays. The assay used by the Free-Living and Intestinal Amebas Laboratory of the CDC was considered the reference standard, and the performance characteristics of each individual assay and pairs of assays were calculated. Outcome measures were sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV). Of 49 included specimens, 14 (28.6%) were positive by the gold standard assay, and 35 (71.4%) were negative. The sensitivities of the individual assays ranged from 64.3% to 92.9%, compared to the gold standard, while the specificities ranged from 88.6% to 91.4%. The PPVs and NPVs ranged from 69.2% to 78.6% and from 86.1% to 96.9%, respectively. Combinations of assay pairs led to improved performance, with sensitivities ranging from 92.9% to 100% and specificities ranging from 97.1% to 100%. ATCC and clinical strains of Acanthamoeba that failed to be detected by certain individual assays included Acanthamoeba castellanii, Acanthamoeba culbertsoni, and Acanthamoeba lenticulata. For three clinical specimens, false negativity of the gold standard assay could not be excluded. Molecular diagnostic approaches, especially combinations of highly sensitive and specific assays, offer a reasonably performing, operator-independent, rapid strategy for the detection of acanthamoebae in clinical specimens and are likely to be more practical than either culture or direct microscopic detection.

  18. Long-term survival and virulence of Mycobacterium leprae in amoebal cysts.

    Directory of Open Access Journals (Sweden)

    William H Wheat

    2014-12-01

    Full Text Available Leprosy is a curable neglected disease of humans caused by Mycobacterium leprae that affects the skin and peripheral nerves and manifests clinically in various forms ranging from self-resolving, tuberculoid leprosy to lepromatous leprosy having significant pathology with ensuing disfiguration disability and social stigma. Despite the global success of multi-drug therapy (MDT, incidences of clinical leprosy have been observed in individuals with no apparent exposure to other cases, suggestive of possible non-human sources of the bacteria. In this study we show that common free-living amoebae (FLA can phagocytose M. leprae, and allow the bacillus to remain viable for up to 8 months within amoebic cysts. Viable bacilli were extracted from separate encysted cocultures comprising three common Acanthamoeba spp.: A. lenticulata, A. castellanii, and A. polyphaga and two strains of Hartmannella vermiformis. Trophozoites of these common FLA take up M. leprae by phagocytosis. M. leprae from infected trophozoites induced to encyst for long-term storage of the bacilli emerged viable by assessment of membrane integrity. The majority (80% of mice that were injected with bacilli extracted from 35 day cocultures of encysted/excysted A. castellanii and A. polyphaga showed lesion development that was similar to mice challenged with fresh M. leprae from passage mice albeit at a slower initial rate. Mice challenged with coculture-extracted bacilli showed evidence of acid-fast bacteria and positive PCR signal for M. leprae. These data support the conclusion that M. leprae can remain viable long-term in environmentally ubiquitous FLA and retain virulence as assessed in the nu/nu mouse model. Additionally, this work supports the idea that M. leprae might be sustained in the environment between hosts in FLA and such residence in FLA may provide a macrophage-like niche contributing to the higher-than-expected rate of leprosy transmission despite a significant decrease in

  19. Entamoeba histolytica calreticulin: an endoplasmic reticulum protein expressed by trophozoites into experimentally induced amoebic liver abscesses.

    Science.gov (United States)

    González, Enrique; de Leon, Maria del Carmen García; Meza, Isaura; Ocadiz-Delgado, Rodolfo; Gariglio, Patricio; Silva-Olivares, Angelica; Galindo-Gómez, Silvia; Shibayama, Mineko; Morán, Patricia; Valadez, Alicia; Limón, Angelica; Rojas, Liliana; Hernández, Eric G; Cerritos, René; Ximenez, Cecilia

    2011-02-01

    Entamoeba histolytica calreticulin (EhCRT) is remarkably immunogenic in humans (90-100% of invasive amoebiasis patients). Nevertheless, the study of calreticulin in this protozoan is still in its early stages. The exact location, biological functions, and its role in pathogenesis are yet to be fully understood. The aim of the present work is to determine the location of EhCRT in virulent trophozoites in vivo and the expression of the Ehcrt gene during the development of experimentally induced amoebic liver abscesses (ALA) in hamsters. Antibodies against recombinant EhCRT were used for the immunolocalization of EhCRT in trophozoites through confocal microscopy; immunohistochemical assays were also performed on tissue sections of ALAs at different times after intrahepatic inoculation. The expression of the Ehcrt gene during the development of ALA was estimated through both in situ RT-PCR and real-time RT-PCR. Confocal assays of virulent trophozoites showed a distribution of EhCRT in the cytoplasmic vesicles of different sizes. Apparently, EhCRT is not exported into the hepatic tissue. Real-time RT-PCR demonstrated an over-expression of the Ehcrt gene at 30 min after trophozoite inoculation, reaching a peak at 1-2 h; thereafter, the expression fell sharply to its original levels. These results demonstrate for the first time in an in vivo model of ALA, the expression of Ehcrt gene in E. histolytica trophozoites and add evidence that support CRT as a resident protein of the ER in E. histolytica species. The in vivo experiments suggest that CRT may play an important role during the early stages of the host-parasite relationship, when the parasite is adapting to a new environment, although the protein seems to be constitutively synthesized. Moreover, trophozoites apparently do not export EhCRT into the hepatic tissue in ALA.

  20. Experimental amoebic liver abscess in hamsters caused by trophozoites of a Brazilian strain of Entamoeba dispar.

    Science.gov (United States)

    Guzmán-Silva, Maria Angélica; Santos, Helena Lúcia Carneiro; Peralta, Regina Saramago; Peralta, José Mauro; de Macedo, Heloisa Werneck

    2013-05-01

    It has been claimed that amoebic molecules such as amoebapore, galactose/N-acetyl galactosamine inhibitable lectin, and cysteine proteases are responsible for host tissue destruction and are present in both pathogenic Entamoeba histolytica and non-pathogenic Entamoeba dispar. Some reports have provided evidence that after infection with E. dispar, pathological changes may occur in some humans. The aim of this study was to evaluate E. dispar pathogenicity by comparing it to the pathogenicity of E. histolytica through liver abscesses induced in hamsters. Syrian golden hamsters were challenged by intrahepatic inoculation with the 03C E. dispar strain or with two strains of E. histolytica (HM1:IMSS and EGG) to compare their virulence grades. As control groups, we used bacterial flora and Pavlova's modified medium. Lesions were verified at 1, 3 and 6 days after inoculation. Multiplex Polymerase Chain Reaction was performed to characterize each strain using EdP1/EdP2 and EhP1/EhP2 primers. The EGG and HM1:IMSS E. histolytica strains and 03C E. dispar were able to cause liver lesions. The EGG strain caused extensive hepatic abscesses, and trophozoites were found in the lesions throughout the three periods of study. The HM1:IMSS strain caused smaller abscesses when compared to EGG lesions; however, trophozoites were observed at 1 and 3 days after inoculation. The 03C E. dispar strain caused intermediate abscesses when compared to the others; trophozoites were observed in all periods analyzed. The EGG strain caused progressive evolution of the injury, which differed from the HM1:IMSS and 03C strains. These results strongly suggest that the 03C E. dispar strain is pathogenic in the experimental hamster model. Additional studies are necessary to identify potential factors that regulate the manifestation of virulence of this strain and others.

  1. The anti-amoebic activity of some medicinal plants used by AIDS patients in southern Thailand.

    Science.gov (United States)

    Sawangjaroen, Nongyao; Phongpaichit, S; Subhadhirasakul, S; Visutthi, M; Srisuwan, N; Thammapalerd, N

    2006-05-01

    The anti-amoebic activities of chloroform, methanol and water extracts from 12 Thai medicinal plants (39 extracts) commonly used by AIDS patients in southern Thailand were screened, at a concentration of 1,000 microg/ml, against Entamoeba histolytica strain HTH-56:MUTM and strain HM1:IMSS growing in vitro. The extracts were incubated with 2x10(5) E. histolytica trophozoites/ml of medium at 37 degrees C under anaerobic conditions for 24 h. The cultures were examined with an inverted microscope and scored (1-4) according to the appearance and numbers of the trophozoites. The extracts that caused inhibition were selected and retested using the same conditions but with concentrations that ranged from 31.25 to 1,000 microg/ml using E. histolytica strain HM1:IMSS, and the IC(50) values for each extract were calculated. The chloroform extracts from Alpinia galanga (IC(50) 55.2 microg/ml), Barleria lupulina (IC(50) 78.5 microg/ml), Boesenbergia pandurata (IC(50) 45.8 microg/ml), Piper betle (IC(50) 91.1 microg/ml) and Piper chaba (IC(50) 71.4 microg/ml) and the methanol extract from B. pandurata (IC(50) 57.6 microg/ml) were all classified as "active", i.e. with an IC(50) of less than 100 microg/ml, whereas those from Murraya paniculata (IC(50) 116.5 microg/ml) and Zingiber zerumbet (IC(50) 196.9 microg/ml) were classified as being "moderately active". The IC(50) of a standard drug, metronidazole, was 1.1 microg/ml.

  2. Gene expression studies demonstrate that the K-ras/Erk MAP kinase signal transduction pathway and other novel pathways contribute to the pathogenesis of cumene-induced lung tumors.

    Science.gov (United States)

    Wakamatsu, Nobuko; Collins, Jennifer B; Parker, Joel S; Tessema, Mathewos; Clayton, Natasha P; Ton, Thai-Vu T; Hong, Hue-Hua L; Belinsky, Steven; Devereux, Theodora R; Sills, Robert C; Lahousse, Stephanie A

    2008-07-01

    National Toxicology Program (NTP) inhalation studies demonstrated that cumene significantly increased the incidence of alveolar/bronchiolar adenomas and carcinomas in B6C3F1 mice. Cumene or isopropylbenzene is a component of crude oil used primarily in the production of phenol and acetone. The authors performed global gene expression analysis to distinguish patterns of gene regulation between cumene-induced tumors and normal lung tissue and to look for patterns based on the presence or absence of K-ras and p53 mutations in the tumors. Principal component analysis segregated the carcinomas into groups with and without K-ras mutations, but failed to separate the tumors based on p53 mutation status. Expression of genes associated with the Erk MAP kinase signaling pathway was significantly altered in carcinomas with K-ras mutations compared to tumors without K-ras mutations or normal lung. Gene expression analysis also suggested that cumene-induced carcinomas with K-ras mutations have greater malignant potential than those without mutations. In addition, significance analysis of function and expression (SAFE) demonstrated expression changes of genes regulated by histone modification in carcinomas with K-ras mutations. The gene expression analysis suggested the formation of alveolar/bronchiolar carcinomas in cumene-exposed mice typically involves mutation of K-ras, which results in increased Erk MAP kinase signaling and modification of histones.

  3. Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM

    DEFF Research Database (Denmark)

    Hansen, L; Arden, K C; Rasmussen, S B

    1997-01-01

    Activation of glycogen synthesis in skeletal muscle in response to insulin results from the combined inactivation of glycogen synthase kinase-3 (GSK-3) and activation of the protein phosphatase-1, changing the ratio between the inactive phosphorylated state of the glycogen synthase to the active ...

  4. The NO-cGMP-PKG Signaling Pathway Regulates Synaptic Plasticity and Fear Memory Consolidation in the Lateral Amygdala via Activation of ERK/MAP Kinase

    Science.gov (United States)

    Ota, Kristie T.; Pierre, Vicki J.; Ploski, Jonathan E.; Queen, Kaila; Schafe, Glenn E.

    2008-01-01

    Recent studies have shown that nitric oxide (NO) signaling plays a crucial role in memory consolidation of Pavlovian fear conditioning and in synaptic plasticity in the lateral amygdala (LA). In the present experiments, we examined the role of the cGMP-dependent protein kinase (PKG), a downstream effector of NO, in fear memory consolidation and…

  5. Inhibitory Effects of KP-A159, a Thiazolopyridine Derivative, on Osteoclast Differentiation, Function, and Inflammatory Bone Loss via Suppression of RANKL-Induced MAP Kinase Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Hye Jung Ihn

    Full Text Available Abnormally elevated formation and activation of osteoclasts are primary causes for a majority of skeletal diseases. In this study, we found that KP-A159, a newly synthesized thiazolopyridine derivative, inhibited osteoclast differentiation and function in vitro, and inflammatory bone loss in vivo. KP-A159 did not cause a cytotoxic response in bone marrow macrophages (BMMs, but significantly inhibited the formation of multinucleated tartrate-resistant acid phosphatase (TRAP-positive osteoclasts induced by macrophage colony-stimulating factor (M-CSF and receptor activator of nuclear factor-κB ligand (RANKL. KP-A159 also dramatically inhibited the expression of marker genes related to osteoclast differentiation, including TRAP (Acp5, cathepsin K (Ctsk, dendritic cell-specific transmembrane protein (Dcstamp, matrix metallopeptidase 9 (Mmp9, and nuclear factor of activated T-cells, cytoplasmic 1 (Nfatc1. Moreover, actin ring and resorption pit formation were inhibited by KP-A159. Analysis of the signaling pathway involved showed that KP-A159 inhibited RANKL-induced activation of extracellular signal-regulated kinase (ERK, c-Jun N-terminal kinase (JNK, and mitogen-activated protein kinase kinase1/2 (MEK1/2. In a mouse inflammatory bone loss model, KP-A159 significantly rescued lipopolysaccharide (LPS-induced bone loss by suppressing osteoclast numbers. Therefore, KP-A159 targets osteoclasts, and may be a potential candidate compound for prevention and/or treatment of inflammatory bone loss.

  6. Pathogenesis of amoebic encephalitis: Are the amoebae being credited to an 'inside job' done by the host immune response?

    Science.gov (United States)

    Baig, Abdul Mannan

    2015-08-01

    Pathogenic free living amoeba like Naegleria fowleri, Acanthamoeba spp., and Balamuthia mandrillaris are known to cause fatal "amoebic meningoencephalitis" by acquiring different route of entries to the brain. The host immune response to these protist pathogens differs from each another, as evidenced by the postmortem gross and microscopic findings from the brains of the affected patients. Cited with the expression of 'brain eating amoeba' when the infection is caused by N. fowleri, this expression is making its way into parasitology journals and books. The impression that it imparts is, as if the brain damage is substantially due to the enzymes and toxins produced by this amoeba. A detailed review of the literature, analysis of archived specimens and with our experimental assays, here we establish that with N. fowleri, Acanthamoeba and Balamuthia spp., the infections result in an extensive brain damage that in fact is substantially caused by the host immune response rather than the amoeba. Due to the comparatively larger sizes of these pathogens and the prior exposure of the amoebal antigen to the human body, the host immune system launches an amplified response that not only breaches the blood brain barrier (BBB), but also becomes the major cause of brain damage in Amoebic meningoencephalitis. It is our understanding that for N. fowleri the host immune response is dominated by acute inflammatory cytokines and that, in cases of Acanthamoeba and Balamuthia spp., it is the type IV hypersensitivity reaction that fundamentally not only contributes to disruption and leakiness of the blood brain barrier (BBB) but also causes the neuronal damage. The further intensification of brain damage is done by toxins and enzymes secreted by the amoeba, which causes the irreversible brain damage.

  7. QSAR STUDY TO PREDICT ANTI-AMOEBIC ACTIVITIES OF PYRAZOLINE AND DIOXAZOLE DERIVATIVES WITH THE HELP OF PM5-BASED DESCRIPTORS

    Directory of Open Access Journals (Sweden)

    Anil K. Srivastava et al

    2012-09-01

    Full Text Available In quest of better anti-amoebic agents, quantitative structure-activity relationship (QSAR studies were performed on a series of pyrazoline & dioxazoles derivatives with the help of PM5 calculations and geometry optimizations using CAChe software. Multiple Linear Regression (MLR analysis was performed to derive QSAR models using the descriptors, molecular weight (MW, conformation minimum energy (ɛ, HOMO energy (HOMO, shape index, basic kappa second order (k2, absolute hardness (h, electronegativity (c, electrophilicity index (ω, molar volume (MV, molar refractivity (MR, LogP (LP, parachor (Pc and solvent accessibility surface area (SASA. The QSAR models equations of anti-amoebic agents have been developed by using maximum of seven descriptors, in which conformation minimum energy, shape index, molar volume and parchor were present have good predictive powers of correlation coefficients. These models can successfully predict the anti-amoebic activity of any newly discovered pyrazoline and dioxazole derivatives which can later be tested in laboratory.

  8. Pseudomonas aeruginosa pyocyanin activates NRF2-ARE-mediated transcriptional response via the ROS-EGFR-PI3K-AKT/MEK-ERK MAP kinase signaling in pulmonary epithelial cells.

    Science.gov (United States)

    Xu, Ying; Duan, Chaohui; Kuang, Zhizhou; Hao, Yonghua; Jeffries, Jayme L; Lau, Gee W

    2013-01-01

    The redox-active pyocyanin (PCN) secreted by the respiratory pathogen Pseudomonas aeruginosa generates reactive oxygen species (ROS) and causes oxidative stress to pulmonary epithelial cells. Nuclear factor (erythroid-derived 2)-like 2 (NRF2) confers protection against ROS-mediated cell death by inducing the expression of detoxifying enzymes and proteins via its binding to the cis-acting antioxidant response element (ARE). However, a clear relationship between NRF2 and PCN-mediated oxidative stress has not been established experimentally. In this study, we investigated the induction of NRF2-ARE response by PCN in the pulmonary epithelial cells. We analyzed the effect of PCN on NRF2 expression and nuclear translocation in cultured human airway epithelial cells, and in a mouse model of chronic PCN exposure. NRF2-dependent transcription of antioxidative enzymes was also assessed. Furthermore, we used inhibitors to examine the involvement of EGFR and its downstream signaling components that mediate NRF2-ARE-activation in response to PCN. PCN enhances the nuclear NRF2 accumulation and activates the transcription of ARE-mediated antioxidant genes. Furthermore, PCN activates NRF2 by inducing the EGFR-phosphoinositide-3-kinase (PI3K) signaling pathway and its main downstream effectors, AKT and MEK1/2-ERK1/2 MAP kinases. Inhibition of the EGFR-PI3K signaling markedly attenuates PCN-stimulated NRF2 accumulation in the nucleus. We demonstrate for the first time that PCN-mediated oxidative stress activates the EGFR-PI3K-AKT/MEK1/2-ERK1/2 MAP kinase signaling pathway, leading to nuclear NRF2 translocation and ARE responsiveness in pulmonary epithelial cells.

  9. Sodium nitroprusside-induced mitochondrial apoptotic events in insulin-secreting RINm5F cells are associated with MAP kinases activation.

    Science.gov (United States)

    Bernabé, J C; Tejedo, J R; Rincón, P; Cahuana, G M; Ramírez, R; Sobrino, F; Bedoya, F J

    2001-10-01

    Exposure of insulin-secreting RINm5F cells to the chemical nitric oxide donor sodium nitroprusside (SNP) resulted in apoptotic cell death, as detected by cytochrome c release from mitochondria and caspase 3 activation. SNP exposure also leads to phosphorylation and activation of enzymes involved in cellular response to stress such as signal-regulated kinase 2 (ERK2) and c-Jun NH(2)-terminal kinase 46 (JNK46). Both cytochrome c release and caspase 3 activation were abrogated in cells exposed to MEK and p38 inhibitors. Treatment of cells with the NO donors SNP, DETA-NO, GEA 5024, and SNAP resulted in phosphorylation of the antiapoptotic protein Bcl-2, which was resistant to blockade of MEK, p38, and JNK pathways and sensitive to phosphoinositide 3-kinase (PI3K) inhibition. In addition, transient transfection of cells with the wild-type PI3K gamma gene mimics the increased rate of Bcl-2 phosphorylation detected in NO-treated cells. The generation of phosphoinositides seems to participate in the process since Bcl-2 phosphorylation was not observed in cells overexpressing lipid-kinase-deficient PI3Kgamma. The potential of SNP toxicity directly from NO was supported by our finding that the NO scavenger carboxy-PTIO prevented cell death. We found no evidence to support the contention that oxygen radicals generated during cellular SNP metabolism mediate cell toxicity in RINm5F cells, since neither addition of catalase/superoxide dismutase nor transfection with superoxide dismutase prevented SNP-induced cell death. Thus, we propose that exposure to apoptotic concentrations of NO triggers ERK- and p38-dependent cytochrome c release, caspase 3 activation, and PI3K-dependent Bcl-2 phosphorylation.

  10. Growth of Entamoeba invadens in sediments with metabolically repressed bacteria leads to multicellularity and redefinition of the amoebic cell system.

    Science.gov (United States)

    Niculescu, Vladimir F

    2013-01-01

    Extracellular signaling and mechanisms of cell differentiation in Entamoeba are misunderstood. The main reason is the popular use of axenic media, which do not correspond to the natural habitats of Entamoeba. The axenic environment lacks the exogenous activators and repressors provided by natural habitats. Absent bacterial commensals understanding of the development of the amoebic cell system remains deficient. The present Aa(Sm) culture method using mixed sediments of antibiotically repressed Aerobacter aerogens and amoebae was developed to model in vitro extracellular signaling that induce multicellularity in cultures of E. invadens. Repressed oxygen consuming sediment bacteria supply E. invadens the hypoxic environment needed for differentiation and development. The amoebae themselves alter the environment by consuming the bacteria by phagocytosis thus reversing hypoxia. Exogenous activators are in this manner down regulated and suppressed. This feedback effect controls amoebic development and differentiation. Co-existing cell types and cell fractions with different life spans and cell cycle length could be identified. Aa(Sm) long term cultures contain continuous and non-continuous self renewing cell lines producing quiescent and terminally differentiated daughter cells (precysts) by asymmetric division. This culturing method helps to understand the intimate relationship between hypoxic environments and the multicellular behaviour of E. invadens and the interrelations existing between the distinct cell types.

  11. The mitochondrial genome and a 60-kb nuclear DNA segment from Naegleria fowleri, the causative agent of primary amoebic meningoencephalitis.

    Science.gov (United States)

    Herman, Emily K; Greninger, Alexander L; Visvesvara, Govinda S; Marciano-Cabral, Francine; Dacks, Joel B; Chiu, Charles Y

    2013-01-01

    Naegleria fowleri is a unicellular eukaryote causing primary amoebic meningoencephalitis, a neuropathic disease killing 99% of those infected, usually within 7-14 days. Naegleria fowleri is found globally in regions including the US and Australia. The genome of the related nonpathogenic species Naegleria gruberi has been sequenced, but the genetic basis for N. fowleri pathogenicity is unclear. To generate such insight, we sequenced and assembled the mitochondrial genome and a 60-kb segment of nuclear genome from N. fowleri. The mitochondrial genome is highly similar to its counterpart in N. gruberi in gene complement and organization, while distinct lack of synteny is observed for the nuclear segments. Even in this short (60-kb) segment, we identified examples of potential factors for pathogenesis, including ten novel N. fowleri-specific genes. We also identified a homolog of cathepsin B; proteases proposed to be involved in the pathogenesis of diverse eukaryotic pathogens, including N. fowleri. Finally, we demonstrate a likely case of horizontal gene transfer between N. fowleri and two unrelated amoebae, one of which causes granulomatous amoebic encephalitis. This initial look into the N. fowleri nuclear genome has revealed several examples of potential pathogenesis factors, improving our understanding of a neglected pathogen of increasing global importance.

  12. Detection of Free-Living Amoebae Using Amoebal Enrichment in a Wastewater Treatment Plant of Gauteng Province, South Africa

    Directory of Open Access Journals (Sweden)

    P. Muchesa

    2014-01-01

    Full Text Available Free-living amoebae pose a potential health risk in water systems as they may be pathogenic and harbor potential pathogenic bacteria known as amoebae resistant bacteria. Free-living amoebae were observed in 150 (87.2% of the environmental water samples. In particular, Acanthamoeba sp. was identified in 22 (12.8% using amoebal enrichment and confirmed by molecular analysis. FLA were isolated in all 8 stages of the wastewater treatment plant using the amoebal enrichment technique. A total of 16 (9.3% samples were positive for FLA from influent, 20 (11.6% from bioreactor feed, 16 (9.3% from anaerobic zone, 16 (9.3% from anoxic zone, 32 (18.6% from aerators, 16 (9.3% from bioreactor effluent, 11 (6.4% from bioreactor final effluent, and 45 (26.2% from maturation pond. This study provides baseline information on the occurrence of amoebae in wastewater treatment plant. This has health implications on receiving water bodies as some FLA are pathogenic and are also involved in the transmission and dissemination of pathogenic bacteria.

  13. Detection of free-living amoebae using amoebal enrichment in a wastewater treatment plant of Gauteng Province, South Africa.

    Science.gov (United States)

    Muchesa, P; Mwamba, O; Barnard, T G; Bartie, C

    2014-01-01

    Free-living amoebae pose a potential health risk in water systems as they may be pathogenic and harbor potential pathogenic bacteria known as amoebae resistant bacteria. Free-living amoebae were observed in 150 (87.2%) of the environmental water samples. In particular, Acanthamoeba sp. was identified in 22 (12.8%) using amoebal enrichment and confirmed by molecular analysis. FLA were isolated in all 8 stages of the wastewater treatment plant using the amoebal enrichment technique. A total of 16 (9.3%) samples were positive for FLA from influent, 20 (11.6%) from bioreactor feed, 16 (9.3%) from anaerobic zone, 16 (9.3%) from anoxic zone, 32 (18.6%) from aerators, 16 (9.3%) from bioreactor effluent, 11 (6.4%) from bioreactor final effluent, and 45 (26.2%) from maturation pond. This study provides baseline information on the occurrence of amoebae in wastewater treatment plant. This has health implications on receiving water bodies as some FLA are pathogenic and are also involved in the transmission and dissemination of pathogenic bacteria.

  14. The nucleotide receptor P2X7 mediates actin reorganization and membrane blebbing in RAW 264.7 macrophages via p38 MAP kinase and Rho.

    Science.gov (United States)

    Pfeiffer, Zachary A; Aga, Mini; Prabhu, Usha; Watters, Jyoti J; Hall, David J; Bertics, Paul J

    2004-06-01

    Extracellular nucleotides regulate macrophage function via P2X nucleotide receptors that form ligand-gated ion channels. In particular, P2X7 activation is characterized by pore formation, membrane blebbing, and cytokine release. P2X7 is also linked to mitogen-activated protein kinases (MAPK) and Rho-dependent pathways, which are known to affect cytoskeletal structure in other systems. As cytoskeletal function is critical for macrophage behavior, we have tested the importance of these pathways in actin filament reorganization during P2X7 stimulation in RAW 264.7 macrophages. We observed that the P2X7 agonists adenosine 5'-triphosphate (ATP) and 3'-O-(4-benzoylbenzoyl) ATP (BzATP) stimulated actin reorganization and concomitant membrane blebbing within 5 min. Disruption of actin filaments with cytochalasin D attenuated membrane blebbing but not P2X7-dependent pore formation or extracellular-regulated kinase (ERK)1/ERK2 and p38 activation, suggesting that these latter processes do not require intact actin filaments. However, we provide evidence that p38 MAPK and Rho activation but not ERK1/ERK2 activation is important for P2X7-mediated actin reorganization and membrane blebbing. First, activation of p38 and Rho was detected within 5 min of BzATP treatment, which is coincident with membrane blebbing. Second, the p38 inhibitors SB202190 and SB203580 reduced nucleotide-induced blebbing and actin reorganization, whereas the MAPK kinase-1/2 inhibitor U0126, which blocks ERK1/ERK2 activation, had no discernable effect. Third, the Rho-selective inhibitor C3 exoenzyme and the Rho effector kinase, Rho-associated coiled-coil kinase, inhibitor Y-27632, markedly attenuated BzATP-stimulated actin reorganization and membrane blebbing. These data support a model wherein p38- and Rho-dependent pathways are critical for P2X7-dependent actin reorganization and membrane blebbing, thereby facilitating P2X7 involvement in macrophage inflammatory responses.

  15. Efficacy of hand held, inexpensive UV light sources on Acanthamoeba, causative organism in amoebic keratitis

    Directory of Open Access Journals (Sweden)

    Ivan Cometa

    2010-01-01

    /protocols might capitalize on this synergistic action.Keywords: UV light sources, amoebic keratitis, MPS

  16. Inhibitory effects of pentosan polysulfate sodium on MAP-kinase pathway and NF-κB nuclear translocation in canine chondrocytes in vitro.

    Science.gov (United States)

    Sunaga, Takafumi; Oh, Namgil; Hosoya, Kenji; Takagi, Satoshi; Okumura, Masahiro

    2012-06-01

    Pentosan polysulfate sodium (PPS) has a heparin-like structure and is purificated from the plant of European beech wood. PPS has been used for the treatment of interstitial cystitis for human patients. Recent years, it was newly recognised that PPS reduce pain and inflammation of OA. The molecular biological mechanism of PPS to express its clinical effects is not fully understood. The purpose of the present study is to investigate a mechanism of action of PPS on inflammatory reaction of chondrocytes in vitro. It was evaluated that effects of PPS on interleukin (IL)-1β-induced phosphorylation of mitogen-actiated protein kinases (MAPKs), such as p38, extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), nuclear translocation of nuclear factor-kappa B (NF-κB), and matrix metalloproteinase (MMP)-3 production in cultured articular chondrocytes. As a result, in the presence of PPS existence, IL-1β-induced phosphorylation of p38 and ERK were certainly inhibited, while JNK phosphorylation was not affected. Nuclear translocation of NF-κB and MMP-3 production were suppressed by PPS pretreatment prior to IL-1β stimulation. In conclusion, it is strongly suggested that PPS treatment prevents inflammatory intracellular responses induced by IL-1 β through inhibition of phosphorylation of certain MAPKs, p38 and ERK and then nuclear translocation of NF-κB in cultured chondrocytes. These PPS properties may contribute to suppressive consequence of catabolic MMP-3 synthesis. These data might translate the clinical efficacy as PPS treatment could inhibit the cartilage catabolism and related clinical symptoms of OA in dogs.

  17. Pioglitazone inhibition of lipopolysaccharide-induced nitric oxide synthase is associated with altered activity of p38 MAP kinase and PI3K/Akt

    Directory of Open Access Journals (Sweden)

    Hunter Randy

    2008-01-01

    Full Text Available Abstract Background Previous studies have suggested that peroxisome proliferator activated receptor-gamma (PPAR-γ-mediated neuroprotection involves inhibition of microglial activation and decreased expression and activity of inducible nitric oxide synthase (iNOS; however, the underlying molecular mechanisms have not yet been well established. In the present study we explored: (1 the effect of the PPAR-γ agonist pioglitazone on lipopolysaccharide (LPS-induced iNOS activity and nitric oxide (NO generation by microglia; (2 the differential role of p38 mitogen-activated protein kinase (p38 MAPK, c-Jun NH(2-terminal kinase (JNK, and phosphoinositide 3-kinase (PI3K on LPS-induced NO generation; and (3 the regulation of p38 MAPK, JNK, and PI3K by pioglitazone. Methods Mesencephalic neuron-microglia mixed cultures, and microglia-enriched cultures were treated with pioglitazone and/or LPS. The protein levels of iNOS, p38 MAPK, JNK, PPAR-γ, PI3K, and protein kinase B (Akt were measured by western blot. Different specific inhibitors of iNOS, p38MAPK, JNK, PI3K, and Akt were used in our experiment, and NO generation was measured using a nitrite oxide assay kit. Tyrosine hydroxylase (TH-positive neurons were counted in mesencephalic neuron-microglia mixed cultures. Results Our results showed that pioglitazone inhibits LPS-induced iNOS expression and NO generation, and inhibition of iNOS is sufficient to protect dopaminergic neurons against LPS insult. In addition, inhibition of p38 MAPK, but not JNK, prevented LPS-induced NO generation. Further, and of interest, pioglitazone inhibited LPS-induced phosphorylation of p38 MAPK. Wortmannin, a specific PI3K inhibitor, enhanced p38 MAPK phosphorylation upon LPS stimulation of microglia. Elevations of phosphorylated PPAR-γ, PI3K, and Akt levels were observed with pioglitazone treatment, and inhibition of PI3K activity enhanced LPS-induced NO production. Furthermore, wortmannin prevented the inhibitory effect of

  18. Discovery of 4-(5-(Cyclopropylcarbamoyl)-2-methylphenylamino)-5-methyl-N-propylpyrrolo[1,2-f][1,2,4]triazine-6-carboxamide (BMS-582949), a Clinical p38[alpha] MAP Kinase Inhibitor for the Treatment of Inflammatory Diseases

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chunjian; Lin, James; Wrobleski, Stephen T.; Lin, Shuqun; Hynes, Jr., John; Wu, Hong; Dyckman, Alaric J.; Li, Tianle; Wityak, John; Gillooly, Kathleen M.; Pitt, Sidney; Shen, Ding Ren; Zhang, Rosemary F.; McIntyre, Kim W.; Salter-Cid, Luisa; Shuster, David J.; Zhang, Hongjian; Marathe, Punit H.; Doweyko, Arthur M.; Sack, John S.; Kiefer, Susan E.; Kish, Kevin F.; Newitt, John A.; McKinnon, Murray; Dodd, John H.; Barrish, Joel C.; Schieven, Gary L.; Leftheris, Katerina (BMS)

    2013-11-20

    The discovery and characterization of 7k (BMS-582949), a highly selective p38{alpha} MAP kinase inhibitor that is currently in phase II clinical trials for the treatment of rheumatoid arthritis, is described. A key to the discovery was the rational substitution of N-cyclopropyl for N-methoxy in 1a, a previously reported clinical candidate p38{alpha} inhibitor. Unlike alkyl and other cycloalkyls, the sp{sup 2} character of the cyclopropyl group can confer improved H-bonding characteristics to the directly substituted amide NH. Inhibitor 7k is slightly less active than 1a in the p38{alpha} enzymatic assay but displays a superior pharmacokinetic profile and, as such, was more effective in both the acute murine model of inflammation and pseudoestablished rat AA model. The binding mode of 7k with p38{alpha} was confirmed by X-ray crystallographic analysis.

  19. The Role of Mitogen-Activated Protein (MAP Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Directory of Open Access Journals (Sweden)

    Yueqiang Leng

    Full Text Available Mitogen-activated protein kinases (MAPKs have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3 and one MAPK kinase kinase (MAPKKK gene (CsSTE11 were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal

  20. The Role of Mitogen-Activated Protein (MAP) Kinase Signaling Components in the Fungal Development, Stress Response and Virulence of the Fungal Cereal Pathogen Bipolaris sorokiniana.

    Science.gov (United States)

    Leng, Yueqiang; Zhong, Shaobin

    2015-01-01

    Mitogen-activated protein kinases (MAPKs) have been demonstrated to be involved in fungal development, sexual reproduction, pathogenicity and/or virulence in many filamentous plant pathogenic fungi, but genes for MAPKs in the fungal cereal pathogen Bipolaris sorokiniana have not been characterized. In this study, orthologues of three MAPK genes (CsSLT2, CsHOG1 and CsFUS3) and one MAPK kinase kinase (MAPKKK) gene (CsSTE11) were identified in the whole genome sequence of the B. sorokiniana isolate ND90Pr, and knockout mutants were generated for each of them. The ∆Csfus3 and ∆Csste11 mutants were defective in conidiation and formation of appressoria-like structures, showed hypersensitivity to oxidative stress and lost pathogenicity on non-wounded leaves of barley cv. Bowman. When inoculated on wounded leaves of Bowman, the ∆Csfus3 and ∆Csste11 mutants were reduced in virulence compared to the wild type. No morphological changes were observed in the ∆Cshog1 mutants in comparison with the wild type; however, they were slightly reduced in growth under oxidative stress and were hypersensitive to hyperosmotic stress. The ∆Cshog1 mutants formed normal appressoria-like structures but were reduced in virulence when inoculated on Bowman leaves. The ∆Csslt2 mutants produced more vegetative hyphae, had lighter pigmentation, were more sensitive to cell wall degrading enzymes, and were reduced in virulence on Bowman leaves, although they formed normal appressoria like the wild type. Root infection assays indicated that the ∆Cshog1 and ∆Csslt2 mutants were able to infect barley roots while the ∆Csfus3 and ∆Csste11 failed to cause any symptoms. However, no significant difference in virulence was observed for ∆Cshog1 mutants while ∆Csslt2 mutants showed significantly reduced virulence on barley roots in comparison with the wild type. Our results indicated that all of these MAPK and MAPKKK genes are involved in the regulation of fungal development under

  1. Differential regulation of iron chelator-induced IL-8 synthesis via MAP kinase and NF-κB in immortalized and malignant oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Lee Suk-Keun

    2007-09-01

    Full Text Available Abstract Background Interleukin-8 (IL-8 is a cytokine that plays an important role in tumor progression in a variety of cancer types; however, its regulation is not well understood in oral cancer cells. In the present study, we examined the expression and mechanism of IL-8 in which it is involved by treating immortalized (IHOK and malignant human oral keratinocytes (HN12 cells with deferoxamine (DFO. Methods IL-8 production was measured by an enzyme-linked immunoabsorbent assay and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. Electrophoretic mobility shift assays was used to determine NF-κB binding activity. Phosphorylation and degradation of the I-κB were analyized by Western blot. Results IHOK cells incubated with DFO showed increased expression of IL-8 mRNA, as well as higher release of the IL-8 protein. The up-regulation of DFO-induced IL-8 expression was higher in IHOK cells than in HN12 cells and was concentration-dependent. DFO acted additively with IL-1β to strongly up-regulate IL-8 in IHOK cells but not in HN12 cells. Accordingly, selective p38 and ERK1/2 inhibitors for both kinases abolished DFO-induced IL-8 expression in both IHOK and HN12 cells. Furthermore, DFO induced the degradation and phosphorylation of IκB, and activation of NF-κB. The IL-8 inducing effects of DFO were mediated by a nitric oxide donor (S-nitrosoglutathione, and by pyrrolidine dithiocarbamate, an inhibitor of NF-κB, as well as by wortmannin, which inhibits the phosphatidylinositol 3-kinase-dependent activation of NAD(PH oxidase. Conclusion This results demonstrate that DFO-induced IL-8 acts via multiple signaling pathways in immortalized and malignant oral keratinocytes, and that the control of IL-8 may be an important target for immunotheraphy against human oral premalignant lesions.

  2. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells

    Institute of Scientific and Technical Information of China (English)

    LI Li; ZHANG Xiao-Hui; LIU Guang-Rong; LIU Chang; DONG Yin-Mao

    2016-01-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm.Both cell types are involved in a variety of inflammatory and immune events,producing an array of inflammatory mediators,such as cytokines.The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation.The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI).The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays.Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels.Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines,such as interleukin (IL)-6,IL-8,IL-1β,and tumor necrosis factor (TNF)-α.The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK),revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition.Furthermore,isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells.In conclusion,the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  3. Isoquercitrin suppresses the expression of histamine and pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-κB in human KU812 cells.

    Science.gov (United States)

    Li, Li; Zhang, Xiao-Hui; Liu, Guang-Rong; Liu, Chang; Dong, Yin-Mao

    2016-06-01

    Mast cells and basophils are multifunctional effector cells that contain abundant secretory granules in their cytoplasm. Both cell types are involved in a variety of inflammatory and immune events, producing an array of inflammatory mediators, such as cytokines. The aim of the study was to examine whether isoquercitrin modulates allergic and inflammatory reactions in the human basophilic KU812 cells and to elucidate its influence on the phosphorylation of mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB activation. The KU812 cells were stimulated with phorbol-12-myristate 13-acetate plus the calcium ionophore A23187 (PMACI). The inhibitory effects of isoquercitrin on the productions of histamine and pro-inflammatory cytokines in the stimulated KU812 cells were measured using cytokine-specific enzyme-linked immunosorbent (ELISA) assays. Western blotting analysis was used to assess the effects of isoquercitrin on the MAPKs and NF-κB protein levels. Our results indicated that the isoquercitrin treatment of PMACI-stimulated KU812 cells significantly reduced the production of histamine and the pro-inflammatory cytokines, such as interleukin (IL)-6, IL-8, IL-1β, and tumor necrosis factor (TNF)-α. The treated cells exhibited decreased phosphorylation of extracellular signal-regulated kinase (ERK), revealing the role of ERK MAPK in isoquercitrin-mediated allergy inhibition. Furthermore, isoquercitrin suppressed the PMACI-mediated activation of NF-κB in the human basophil cells. In conclusion, the results from the present study provide insights into the potential therapeutic use of isoquercitrin for the treatment of inflammatory and allergic reactions.

  4. Amoebicidal Activity of Essential Oil of Dysphania ambrosioides (L.) Mosyakin & Clemants in an Amoebic Liver Abscess Hamster Model.

    Science.gov (United States)

    Avila-Blanco, Manuel Enrique; Rodríguez, Martín Gerardo; Moreno Duque, José Luis; Muñoz-Ortega, Martin; Ventura-Juárez, Javier

    2014-01-01

    Amebiasis is a parasitic disease that extends worldwide and is a public health problem in developing countries. Metronidazole is the drug recommended in the treatment of amebiasis, but its contralateral effects and lack of continuity of treatment induce low efficiency, coupled with the appearance of resistant amoebic strains. Therefore, the search of new compounds with amoebicidal activity is urgent and important. In this study, we evaluated the in vitro and in vivo antiamoebic activity of the essential oil Dysphania ambrosioides (L.) Mosyakin & Clemants. It exhibited an IC50 = 0.7 mg/mL against trophozoites. The oral administration of essential oil (8 mg/kg and 80 mg/kg) to hamster infected with Entamoeba histolytica reverted the infection. Ascaridole was identified as the main component of essential oil of D. ambrosioides. The identification of amoebicidal activity of Ascaridole gives support to the traditional use. Further studies with Ascaridole will be carried out to understand the mechanism involved.

  5. Entamoeba histolytica: inflammatory process during amoebic liver abscess formation involves cyclooxygenase-2 expression in macrophages and trophozoites.

    Science.gov (United States)

    Gutiérrez-Alarcón, A; Moguel-Torres, M; Mata-Leyva, O; Cuellar-Nevárez, G; Siqueiros-Cendón, T; Erosa, G; Ramos-Martínez, E; Talamás-Rohana, P; Sánchez-Ramírez, B

    2006-11-01

    It has been demonstrated that expression of cyclooxygenase-2 (COX-2) isoform is induced by Entamoeba histolytica in macrophages and polymorphonuclear cells during amoebic liver abscess (ALA) formation in hamsters. Trophozoites present in the lesion were also positive for COX-2 signal. However, no cross reactivity of the anti-COX-2 antibody with protein extract of cultivated trophozoites was found. To clarify if trophozoites are involved in PGE(2) production during ALA development, COX-2 expression was detected by in situ hybridization and RT-PCR in liver tissue from intrahepatically infected hamsters. COX-2 mRNA was in polymorphonuclear cells since 4h postinfection, and subsequently, local macrophages expressed COX-2 mRNA in a similar way. Additionally, a positive signal for COX-2 mRNA expression was detected in E. histolytica trophozoites, suggesting that, in vivo, parasite COX expression may be an important mechanism to promote inflammation.

  6. A RARE CASE REPORT OF SITUS INVERSUS TOTALIS WITH RUPTURED AMOEBIC LIVER ABSCESS IN A PATIENT SUFFERING FROM SERUM HEPATITIS

    Directory of Open Access Journals (Sweden)

    Suraj Kumar

    2015-05-01

    Full Text Available SITUS INVERSUS VISCERUM : The literal meaning of: Inverted position of internal organs is a rare autosomal recessive disorder with incidence of 0.001% to 0.01% with male: female ratio of 3:2 . (1 It can be either total or partial. Total situsinversus is characterized by mirror image dextrocardia where the heart and stomach is present on right side of midline and liver and gall bladder on left side. Generally this rare genetic anomaly is discovered/diagnosed incidentally during thoracic and abdominal imaging. Here we are presenting yo u a case of situsinversustotalis with ruptured amoebic liver abscess in a patient of serum hepatitis which is a rare clinical entity.

  7. Amoebic meningoencephalitis and disseminated infection caused by Balamuthia mandrillaris in a Western lowland gorilla (Gorilla gorilla gorilla).

    Science.gov (United States)

    Gjeltema, Jenessa L; Troan, Brigid; Muehlenbachs, Atis; Liu, Lindy; Da Silva, Alexandre J; Qvarnstrom, Yvonne; Tobias, Jeremy R; Loomis, Michael R; De Voe, Ryan S

    2016-02-01

    CASE DESCRIPTION A 22-year-old male gorilla (Gorilla gorilla gorilla) housed in a zoo was evaluated for signs of lethargy, head-holding, and cervical stiffness followed by development of neurologic abnormalities including signs of depression, lip droop, and tremors. CLINICAL FINDINGS Physical examination under general anesthesia revealed a tooth root abscess and suboptimal body condition. A CBC and serum biochemical analysis revealed mild anemia, neutrophilia and eosinopenia consistent with a stress leukogram, and signs consistent with dehydration. Subsequent CSF analysis revealed lymphocytic pleocytosis and markedly increased total protein concentration. TREATMENT AND OUTCOME Despite treatment with antimicrobials, steroids, and additional supportive care measures, the gorilla's condition progressed to an obtunded mentation with grand mal seizures over the course of 10 days. Therefore, the animal was euthanized and necropsy was performed. Multifocal areas of malacia and hemorrhage were scattered throughout the brain; on histologic examination, these areas consisted of necrosis and hemorrhage associated with mixed inflammation, vascular necrosis, and intralesional amoebic trophozoites. Tan foci were also present in the kidneys and pancreas. Immunohistochemical testing positively labeled free-living amoebae within the brain, kidneys, eyes, pancreas, heart, and pulmonary capillaries. Subsequent PCR assay of CSF and frozen kidney samples identified the organism as Balamuthia mandrillaris, confirming a diagnosis of amoebic meningoencephalitis. CLINICAL RELEVANCE Infection with B mandrillaris has been reported to account for 2.8% of captive gorilla deaths in North America over the past 19 years. Clinicians working with gorillas should have a high index of suspicion for this diagnosis when evaluating and treating animals with signs of centrally localized neurologic disease.

  8. Casein kinases

    DEFF Research Database (Denmark)

    Issinger, O G

    1993-01-01

    subunits are highly conserved during evolution. The relationship between CK-2 alpha from humans and plants is still 73%. Similar relationships are reported for the beta-subunit. Chromosomal assignment of CK-2 alpha shows two gene loci, one of which is a pseudogene. They are located on different chromosomes......, no genetic changes are necessarily involved; the observed changes may be entirely due to a signal transduction pathway where CK-2 could be phosphorylated by another kinase(s). CK-2 cDNAs from various organisms have been isolated and characterized. From the deduced amino acid sequence it turns out that CK-2......-subunit affecting: (i) stability, (ii) enzyme specificity and (iii) enzyme activity. The question where CK-2 and its subunits are located throughout the cell cycle has also been addressed, mainly because of the large discrepancies that still exist between results obtained by different investigators. Tissue...

  9. Basic fibroblast growth factor induces matrix metalloproteinase-13 via ERK MAP kinase-altered phosphorylation and sumoylation of Elk-1 in human adult articular chondrocytes

    Directory of Open Access Journals (Sweden)

    Hee-Jeong Im

    2009-10-01

    Full Text Available Hee-Jeong Im,1–4 Andrew D Sharrocks,5 Xia Lin,6 Dongyao Yan,1 Jaesung Kim,1 Andre J van Wijnen,7 Robert A Hipskind81Departments of Biochemistry, 2Internal Medicine, 3Section of Rheumatology, Orthopedic Surgery, 4Rush University Medical Center, and Department of Bioengineering; University of Illinois at Chicago, IL USA; 5Faculty of Life Sciences, University of Manchester, Oxford Rd, Manchester, UK; 6Michael D DeBakey Department of Surgery, Baylor College of Medicine, Houston, Texas, USA; 7Department of Cell Biology, University of Massachusetts Medical School, Worcester, MA, USA; 8Institute De Genetique Moleculaire de Montpellier, FranceAbstract: Degradation of the extracellular matrix (ECM by matrix metalloproteinases (MMPs and release of basic fibroblast growth factor (bFGF are principal aspects of the pathology of osteoarthritis (OA. ECM disruption leads to bFGF release, which activates the extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK pathway and its downstream target the Ets-like transcription factor Elk-1. Previously we demonstrated that the bFGF-ERK-Elk-1 signaling axis is responsible for the potent induction of MMP-13 in human primary articular chondrocytes. Here we report that, in addition to phosphorylation of Elk-1, dynamic posttranslational modification of Elk-1 by small ubiquitin-related modifier (SUMO serves as an important mechanism through which MMP-13 gene expression is regulated. We show that bFGF activates Elk-1 mainly through the ERK pathway and that increased phosphorylation of Elk-1 is accompanied by decreased conjugation of SUMO to Elk-1. Reporter gene assays reveal that phosphorylation renders Elk-1 competent for induction of MMP-13 gene transcription, while sumoylation has the opposite effect. Furthermore, we demonstrate that the SUMO-conjugase Ubc9 acts as a key mediator for Elk-1 sumoylation. Taken together, our results suggest that sumoylation antagonizes the phosphorylation

  10. Biochemical and pharmacological assessment of MAP-kinase signaling along pain pathways in experimental rodent models: a potential tool for the discovery of novel antinociceptive therapeutics.

    Science.gov (United States)

    Edelmayer, Rebecca M; Brederson, Jill-Desiree; Jarvis, Michael F; Bitner, Robert S

    2014-02-01

    Injury to the peripheral or central nervous system can induce changes within the nervous tissues that promote a state of sensitization that may underlie conditions of pathological chronic pain. A key biochemical event in the initiation and maintenance of peripheral and central neuronal sensitization associated with chronic pain is the phosphorylation and subsequent activation of mitogen-activated protein kinases (MAPKs) and immediate early gene transcription factors, in particular cAMP-response element binding protein (CREB). In this commentary we review the preclinical data that describe anatomical and mechanistic aspects of nociceptive-induced signaling along nociceptive pathways including peripheral cutaneous axons, the dorsal root ganglia, spinal cord dorsal horn and cerebral cortex. In addition to the regional manifestation of nociceptive signaling, investigations have attempted to elucidate the cellular origin of biochemical nociceptive processing in which communication, i.e. cross-talk between neurons and glia is viewed as an essential component of pathogenic pain development. Here, we outline a research strategy by which nociceptive-induced cellular signaling in experimental pain models, specifically MAPK and CREB phosphorylation can be utilized to provide mechanistic insight into drug-target interaction along the nociceptive pathways. We describe a series of studies using nociceptive inflammatory and neuropathic pain models to investigate the effects of known pain therapeutics on nociceptive-induced biochemical signaling and present this as a complementary research strategy for assessing antinociceptive activity useful in the preclinical development of novel pain therapeutics.

  11. Endothelin-1 induces proliferation of human lung fibroblasts and IL-11 secretion through an ET(A) receptor-dependent activation of MAP kinases.

    Science.gov (United States)

    Gallelli, Luca; Pelaia, Girolamo; D'Agostino, Bruno; Cuda, Giovanni; Vatrella, Alessandro; Fratto, Donatella; Gioffrè, Vincenza; Galderisi, Umberto; De Nardo, Marilisa; Mastruzzo, Claudio; Salinaro, Elisa Trovato; Maniscalco, Mauro; Sofia, Matteo; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Maselli, Rosario; Marsico, Serafino A; Vancheri, Carlo

    2005-11-01

    Endothelin-1 (ET-1) is implicated in the fibrotic responses characterizing interstitial lung diseases, as well as in the airway remodeling process occurring in asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal human lung fibroblasts (NHLFs), the ET-1 receptor subtypes, and the intracellular signal transduction pathways involved in the proliferative effects of this peptide. Therefore, cells were exposed to ET-1 in the presence or absence of an overnight pre-treatment with either ET(A) or ET(B) selective receptor antagonists. After cell lysis, immunoblotting was performed using monoclonal antibodies against the phosphorylated, active forms of mitogen-activated protein kinases (MAPK). ET-1 induced a significant increase in MAPK phosphorylation pattern, and also stimulated fibroblast proliferation and IL-6/IL-11 release into cell culture supernatants. All these effects were inhibited by the selective ET(A) antagonist BQ-123, but not by the specific ET(B) antagonist BQ-788. The stimulatory influence of ET-1 on IL-11, but not on IL-6 secretion, was prevented by MAPK inhibitors. Therefore, such results suggest that in human lung fibroblasts ET-1 exerts a profibrogenic action via an ET(A) receptor-dependent, MAPK-mediated induction of IL-11 release and cell proliferation.

  12. Deoxycholic acid and selenium metabolite methylselenol exert common and distinct effects on cell cycle, apoptosis, and MAP kinase pathway in HCT116 human colon cancer cells.

    Science.gov (United States)

    Zeng, Huawei; Botnen, James H; Briske-Anderson, Mary

    2010-01-01

    The cell growth inhibition induced by bile acid deoxycholic acid (DCA) may cause compensatory hyperproliferation of colonic epithelial cells and consequently increase colon cancer risk. On the other hand, there is increasing evidence for the efficacy of certain forms of selenium (Se) as anticancer nutrients. Methylselenol has been hypothesized to be a critical Se metabolite for anticancer activity in vivo. In this study, we demonstrated that both DCA (75-300 micromol/l) and submicromolar methylselenol inhibited colon cancer cell proliferation by up to 64% and 63%, respectively. In addition, DCA and methylselenol each increased colon cancer cell apoptosis rate by up to twofold. Cell cycle analyses revealed that DCA induced an increase in only the G1 fraction with a concomitant drop in G2 and S-phase; in contrast, methylselenol led to an increase in the G1 and G2 fractions with a concomitant drop only in the S-phase. Although both DCA and methylselenol significantly promoted apoptosis and inhibited cell growth, examination of mitogen-activated protein kinase (MAPK) pathway activation showed that DCA, but not methylselenol, induced SAPK/JNK1/2, p38 MAPK, ERK1/2 activation. Thus, our data provide, for the first time, the molecular basis for opposite effects of methylselenol and DCA on colon tumorigenesis.

  13. Stress-induced activation of protein kinase CK2 by direct interaction with p38 mitogen-activated protein kinase

    DEFF Research Database (Denmark)

    Sayed, M; Kim, S O; Salh, B S

    2000-01-01

    in the human cervical carcinoma HeLa cells by up to 8-fold, and this could be blocked by the p38 MAP kinase inhibitor SB203580. We show that p38alpha MAP kinase, in a phosphorylation-dependent manner, can directly interact with the alpha and beta subunits of CK2 to activate the holoenzyme through what appears...

  14. Mapping the sites of latency and reactivation by bovine herpesvirus 5 (BoHV-5 and a thymidine kinase-deleted BoHV-5 in lambs

    Directory of Open Access Journals (Sweden)

    Gustavo C. Cadore

    2013-12-01

    Full Text Available A thymidine kinase (tk-deleted bovine herpesvirus 5 (BoHV-5tkΔ was previously shown to establish latent infection and reactivate - even poorly - in a sheep model (Cadore et al. 2013. As TK-negative alphaherpesviruses are unlike to reactivate in neural tissue, this study investigated the sites of latency and reactivation by this recombinant in lambs. For this, groups of lambs were inoculated intranasally with the parental BoHV-5 strain (SV-507/99 or with the recombinant BoHV-5tkΔ. During latent infection (40 days post-inoculation, pi, the distribution of recombinant virus DNA in neural and non-neural tissues was similar to that of the parental virus. Parental and recombinant virus DNA was consistently detected by PCR in trigeminal ganglia (TGs; frequently in palatine and pharyngeal tonsils and, less frequently in the retropharyngeal lymph nodes. In addition, latent DNA of both viruses was detected in several areas of the brain. After dexamethasone (Dx administration (day 40pi, the recombinant virus was barely detected in nasal secretions contrasting with marked shedding of the parental virus. In tissues of lambs euthanized at day 3 post-Dx treatment (pDx, reverse-transcription-PCR (RT-PCR for a late viral mRNA (glycoprotein D gene demonstrated reactivation of parental virus in neural (TGs and lymphoid tissues (tonsils, lymph node. In contrast, recombinant virus mRNA was detected only in lymphoid tissues. These results demonstrate that BoHV-5 and the recombinant BoHV-5tkΔ do establish latent infection in neural and non-neural sites. Reactivation of the recombinant BoHV-5tkΔ, however, appeared to occur only in non-neural sites. In anyway, the ability of a tk-deleted strain to reactivate latent infection deserves attention in the context of vaccine safety.

  15. Different muscarinic receptor subtypes modulate proliferation of primary human detrusor smooth muscle cells via Akt/PI3K and map kinases.

    Science.gov (United States)

    Arrighi, Nicola; Bodei, Serena; Zani, Danilo; Michel, Martin C; Simeone, Claudio; Cosciani Cunico, Sergio; Spano, Pierfranco; Sigala, Sandra

    2013-08-01

    While acetylcholine (ACh) and muscarinic receptors in the bladder are mainly known for their role in the regulation of smooth muscle contractility, in other tissues they are involved in tissue remodelling and promote cell growth and proliferation. In the present study we have used primary cultures of human detrusor smooth muscle cells (HDSMCs), in order to investigate the role of muscarinic receptors in HDSMC proliferation. Samples were obtained as discarded tissue from men >65 years undergoing radical cystectomy for bladder cancer and cut in pieces that were either immediately frozen or placed in culture medium for the cell culture establishment. HDSMCs were isolated from samples, propagated and maintained in culture. [(3)H]-QNB radioligand binding on biopsies revealed the presence of muscarinic receptors, with a Kd of 0.10±0.02nM and a Bmax of 72.8±0.1fmol/mg protein. The relative expression of muscarinic receptor subtypes, based on Q-RT-PCR, was similar in biopsies and HDSMC with a rank order of M2≥M3>M1>M4>M5. The cholinergic agonist carbachol (CCh, 1-100μM) concentration-dependently increased [(3)H]-thymidine incorporation (up to 46±4%). This was concentration-dependently inhibited by the general muscarinic receptor antagonist atropine and by subtype-preferring antagonists with an order of potency of darifenacin >4-DAMP>AF-DX 116. The CCh-induced cell proliferation was blocked by selective PI-3 kinase and ERK activation inhibitors, strongly suggesting that these intracellular pathways mediate, at least in part, the muscarinic receptor-mediated cell proliferation. This work shows that M2 and M3 receptors can mediate not only HDSM contraction but also proliferation; they may also contribute bladder remodelling including detrusor hypertrophy.

  16. Effects of TGF-beta and glucocorticoids on map kinase phosphorylation, IL-6/IL-11 secretion and cell proliferation in primary cultures of human lung fibroblasts.

    Science.gov (United States)

    Pelaia, Girolamo; Gallelli, Luca; D'Agostino, Bruno; Vatrella, Alessandro; Cuda, Giovanni; Fratto, Donatella; Renda, Teresa; Galderisi, Umberto; Piegari, Elena; Crimi, Nunzio; Rossi, Francesco; Caputi, Mario; Costanzo, Francesco S; Vancheri, Carlo; Maselli, Rosario; Marsico, Serafino A

    2007-02-01

    Transforming growth factor-beta1 (TGF-beta1) is crucially involved in the fibrotic events characterizing interstitial lung diseases (ILDs), as well as in the airway remodeling process typical of asthma. Within such a context, the aim of our study was to investigate, in primary cultures of normal and fibrotic human lung fibroblasts (HLFs), the effects of TGF-beta1 on mitogen-activated protein kinase (MAPK) phosphorylation, cell proliferation, and production of interleukins 6 (IL-6) and 11 (IL-11), in the presence or absence of a pretreatment with budesonide (BUD). MAPK phosphorylation was detected by Western blotting, cell viability and proliferation were evaluated using Trypan blue staining and [(3)H]-thymidine incorporation assay, respectively, and the release of IL-6 and IL-11 into cell culture supernatants was assessed by ELISA. TGF-beta1 (10 ng/ml) significantly stimulated MAPK phosphorylation (P < 0.01), and also enhanced cell proliferation as well as the secretion of both IL-6 and IL-11, which reached the highest increases at the 72nd h of cell exposure to this growth factor. All such effects were prevented by BUD (10(-8) M) and, with the exception of IL-6 release, also by a mixture of MAPK inhibitors. Therefore, our findings suggest that the fibrotic action exerted by TGF-beta1 in the lung is mediated at least in part by MAPK activation and by an increased synthesis of the profibrogenic cytokines IL-6 and IL-11; all these effects appear to be prevented by corticosteroids via inhibition of MAPK phosphorylation.

  17. Central SDF-1/CXCL12 expression and its cardiovascular and sympathetic effects: the role of angiotensin II, TNF-α, and MAP kinase signaling.

    Science.gov (United States)

    Wei, Shun-Guang; Zhang, Zhi-Hua; Yu, Yang; Felder, Robert B

    2014-12-01

    The chemokine stromal cell-derived factor-1 (SDF-1/CXCL12) and its receptors are expressed by neurons and glial cells in cardiovascular autonomic regions of the brain, including the hypothalamic paraventricular nucleus (PVN), and contribute to neurohumoral excitation in rats with ischemia-induced heart failure. The present study examined factors regulating the expression of SDF-1 in the PVN and mechanisms mediating its sympatho-excitatory effects. In urethane anesthetized rats, a 4-h intracerebroventricular (ICV) infusion of angiotensin II (ANG II) or tumor necrosis factor-α (TNF-α) in doses that increase mean blood pressure (MBP) and sympathetic drive increased the expression of SDF-1 in PVN. ICV administration of SDF-1 increased the phosphorylation of p44/42 mitogen-activated protein kinase (MAPK), JNK, and p38 MAPK in PVN, along with MBP, heart rate (HR), and renal sympathetic nerve activity (RSNA), but did not affect total p44/42 MAPK, JNK, and p38 MAPK levels. ICV pretreatment with the selective p44/42 MAPK inhibitor PD98059 prevented the SDF-1-induced increases in MBP, HR, and RSNA; ICV pretreatment with the selective JNK and p38 MAPK inhibitors attenuated but did not block these SDF-1-induced excitatory responses. ICV PD98059 also prevented the sympatho-excitatory response to bilateral PVN microinjections of SDF-1. ICV pretreatment with SDF-1 short-hairpin RNA significantly reduced ANG II- and TNF-α-induced phosphorylation of p44/42 MAPK in PVN. These findings identify TNF-α and ANG II as drivers of SDF-1 expression in PVN and suggest that the full expression of their cardiovascular and sympathetic effects depends upon SDF-1-mediated activation of p44/42 MAPK signaling.

  18. Expression of Pseudomonas syringae type III effectors in yeast under stress conditions reveals that HopX1 attenuates activation of the high osmolarity glycerol MAP kinase pathway.

    Science.gov (United States)

    Salomon, Dor; Bosis, Eran; Dar, Daniel; Nachman, Iftach; Sessa, Guido

    2012-11-01

    The Gram-negative bacterium Pseudomonas syringae pv. tomato (Pst) is the causal agent of speck disease in tomato. Pst pathogenicity depends on a type III secretion system that delivers effector proteins into host cells, where they promote disease by manipulating processes to the advantage of the pathogen. Previous studies identified seven Pst effectors that inhibit growth when expressed in yeast under normal growth conditions, suggesting that they interfere with cellular processes conserved in yeast and plants. We hypothesized that effectors also target conserved cellular processes that are required for yeast growth only under stress conditions. We therefore examined phenotypes induced by expression of Pst effectors in yeast grown in the presence of various stressors. Out of 29 effectors tested, five (HopX1, HopG1, HopT1-1, HopH1 and AvrPtoB) displayed growth inhibition phenotypes only in combination with stress conditions. Viability assays revealed that the HopX1 effector caused loss of cell viability under prolonged osmotic stress. Using transcription reporters, we found that HopX1 attenuated the activation of the high osmolarity glycerol (HOG) mitogen-activated protein kinase (MAPK) pathway, which is responsible for yeast survival under osmotic stress, while other MAPK pathways were mildly affected by HopX1. Interestingly, HopX1-mediated phenotypes in yeast were dependent on the putative transglutaminase catalytic triad of the effector. This study enlarges the pool of phenotypes available for the functional analysis of Pst type III effectors in yeast, and exemplifies how analysis of phenotypes detected in yeast under stress conditions can lead to the identification of eukaryotic cellular processes affected by bacterial effectors.

  19. Mangiferin, a natural xanthone, protects murine liver in Pb(II induced hepatic damage and cell death via MAP kinase, NF-κB and mitochondria dependent pathways.

    Directory of Open Access Journals (Sweden)

    Pabitra Bikash Pal

    Full Text Available One of the most well-known naturally occurring environmental heavy metals, lead (Pb has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II] in the form of Pb(NO32 (at a dose of 5 mg/kg body weight, 6 days, orally induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally, on the other hand, diminished the formation of reactive oxygen species (ROS and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT and alkaline phosphatase (ALP]. Mangiferin also reduced Pb(II induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II-induced activation of mitogen-activated protein kinases (MAPKs (phospho-ERK 1/2, phosphor-JNK phospho- p38, nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II. Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II induced hepatic dysfunction.

  20. Mangiferin, a Natural Xanthone, Protects Murine Liver in Pb(II) Induced Hepatic Damage and Cell Death via MAP Kinase, NF-κB and Mitochondria Dependent Pathways

    Science.gov (United States)

    Pal, Pabitra Bikash; Sinha, Krishnendu; Sil, Parames C.

    2013-01-01

    One of the most well-known naturally occurring environmental heavy metals, lead (Pb) has been reported to cause liver injury and cellular apoptosis by disturbing the prooxidant-antioxidant balance via oxidative stress. Several studies, on the other hand, reported that mangiferin, a naturally occurring xanthone, has been used for a broad range of therapeutic purposes. In the present study, we, therefore, investigated the molecular mechanisms of the protective action of mangiferin against lead-induced hepatic pathophysiology. Lead [Pb(II)] in the form of Pb(NO3)2 (at a dose of 5 mg/kg body weight, 6 days, orally) induced oxidative stress, hepatic dysfunction and cell death in murine liver. Post treatment of mangiferin at a dose of 100 mg/kg body weight (6 days, orally), on the other hand, diminished the formation of reactive oxygen species (ROS) and reduced the levels of serum marker enzymes [alanine aminotranferase (ALT) and alkaline phosphatase (ALP)]. Mangiferin also reduced Pb(II) induced alterations in antioxidant machineries, restored the mitochondrial membrane potential as well as mutual regulation of Bcl-2/Bax. Furthermore, mangiferin inhibited Pb(II)-induced activation of mitogen-activated protein kinases (MAPKs) (phospho-ERK 1/2, phosphor-JNK phospho- p38), nuclear translocation of NF-κB and apoptotic cell death as was evidenced by DNA fragmentation, FACS analysis and histological assessment. In vitro studies using hepatocytes as the working model also showed the protective effect of mangiferin in Pb(II) induced cytotoxicity. All these beneficial effects of mangiferin contributes to the considerable reduction of apoptotic hepatic cell death induced by Pb(II). Overall results demonstrate that mangiferin exhibit both antioxidative and antiapoptotic properties and protects the organ in Pb(II) induced hepatic dysfunction. PMID:23451106

  1. Human p38{delta} MAP kinase mediates UV irradiation induced up-regulation of the gene expression of chemokine BRAK/CXCL14

    Energy Technology Data Exchange (ETDEWEB)

    Ozawa, Shigeyuki [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Ito, Shin; Kato, Yasumasa [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan); Kubota, Eiro [Department of Biochemistry and Molecular Biology (Japan); Department of Oral and Maxillofacial Surgery, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580 (Japan); Hata, Ryu-Ichiro, E-mail: ryuhata@gmail.com [Oral Health Science Research Center (Japan); Department of Biochemistry and Molecular Biology (Japan)

    2010-06-11

    The mitogen-activated protein kinase (MAPK) family comprises ERK, JNK, p38 and ERK5 (big-MAPK, BMK1). UV irradiation of squamous cell carcinoma cells induced up-regulation of gene expression of chemokine BRAK/CXCL14, stimulated p38 phosphorylation, and down-regulated the phosphorylation of ERK. Human p38 MAPKs exist in 4 isoforms: p38{alpha}, {beta}, {gamma} and {delta}. The UV stimulation of p38 phosphorylation was not inhibited by the presence of SB203580 or PD169316, inhibitors of p38{alpha} and {beta}, suggesting p38 phosphorylation was not dependent on these 2 isoforms and that p38{gamma} and/or {delta} was responsible for the phosphorylation. In fact, inhibition of each of these 4 p38 isoforms by the introduction of short hairpin (sh) RNAs for respective isoforms revealed that only shRNA for p38{delta} attenuated the UV-induced up-regulation of BRAK/CXCL14 gene expression. In addition, over-expression of p38 isoforms in the cells showed the association of p38{delta} with ERK1 and 2, concomitant with down-regulation of ERK phosphorylation. The usage of p38{delta} isoform by UV irradiation is not merely due to the abundance of this p38 isoform in the cells. Because serum deprivation of the cells also induced an increase in BRAK/CXCL14 gene expression, and in this case p38{alpha} and/or {beta} isoform is responsible for up-regulation of BRAK/CXCL14 gene expression. Taken together, the data indicate that the respective stress-dependent action of p38 isoforms is responsible for the up-regulation of the gene expression of the chemokine BRAK/CXCL14.

  2. Mucosal Delivery of ACNPV Baculovirus Driving Expression of the Gal-Lectin LC3 Fragment Confers Protection against Amoebic Liver Abscess in Hamster

    OpenAIRE

    Meneses-Ruiz, DM; Laclette, JP; Aguilar-Díaz, H; Hernández-Ruiz, J; Luz-Madrigal, A.; Sampieri, A.; Vaca, L; Carrero, JC

    2011-01-01

    Mucosal vaccination against amoebiasis using the Gal-lectin of E. histolytica has been proposed as one of the leading strategies for controlling this human disease. However, most mucosal adjuvants used are toxic and the identification of safe delivery systems is necessary. Here, we evaluate the potential of a recombinant Autographa californica baculovirus driving the expression of the LC3 fragment of the Gal-lectin to confer protection against amoebic liver abscess (ALA) in hamsters following...

  3. Role of the HaHOG1 MAP kinase in response of the conifer root and butt rot pathogen (heterobasidion annosum to osmotic and oxidative stress [corrected].

    Directory of Open Access Journals (Sweden)

    Tommaso Raffaello

    Full Text Available The basidiomycete Heterobasidion annosum (Fr. Bref. s.l. is a filamentous white rot fungus, considered to be the most economically important pathogen of conifer trees. Despite the severity of the tree infection, very little is known about the molecular and biochemical aspects related to adaptation to abiotic stresses. In this study, the osmotic and oxidative tolerance as well as the role of the HaHOG1 Mitogen Activated Protein Kinase (MAPK gene were investigated. The transcript levels of the yeast orthologues GPD1, HSP78, STL1, GRE2 and the ATPase pumps ENA1, PMR1, PMC1 known to have an important role in osmotolerance were also quantified under salt osmotic conditions. The HaHOG1 gene was used for a heterologous expression and functional study in the Saccharomyces cerevisiae Δhog1 strain. Moreover, the phosphorylation level of HaHog1p was studied under salt osmotic and oxidative stress. The result showed that H. annosum displayed a decreased growth when exposed to an increased concentration of osmotic and oxidative stressors. GPD1, HSP78, STL1 and GRE2 showed an induction already at 10 min after exposure to salt stress. Among the ATPase pumps studied, PMC1 was highly induced when the fungus was exposed to 0.2 M CaCl₂ for 60 min. The heterologous expression of the HaHOG1 sequence in yeast confirmed that the gene is able to restore the osmotolerance and oxidative tolerance in the S. cerevisiae hog1Δ mutant strain. The HaHog1p was strongly phosphorylated in the presence of NaCl, KCl, H₂O₂ but not in the presence of CaCl₂ and MgCl₂. The GFP-HaHog1p fusion protein accumulated in the nuclei of the S. cerevisiae hog1Δ cells when exposed to high osmotic conditions but not under oxidative stress. These results provide the first insights about the response of H. annosum to osmotic and oxidative stress and elucidate the role of the HaHOG1 gene in such conditions.

  4. Multi-walled carbon nanotubes induce COX-2 and iNOS expression via MAP Kinase-dependent and -independent mechanisms in mouse RAW264.7 macrophages

    Directory of Open Access Journals (Sweden)

    Lee Jong

    2012-05-01

    Full Text Available Abstract Background Carbon nanotubes (CNTs are engineered graphene cylinders with numerous applications in engineering, electronics and medicine. However, CNTs cause inflammation and fibrosis in the rodent lung, suggesting a potential human health risk. We hypothesized that multi-walled CNTs (MWCNTs induce two key inflammatory enzymes in macrophages, cyclooxygenase-2 (COX-2 and inducible nitric oxide synthase (iNOS, through activation of extracellular signal-regulated kinases (ERK1,2. Methods RAW264.7 macrophages were exposed to MWCNTs or carbon black nanoparticles (CBNPs over a range of doses and time course. Uptake and subcellular localization of MWCNTs was visualized by transmission electron microscopy (TEM. Protein levels of COX-2, iNOS, and ERK1,2 (total ERK and phosphorylated ERK were measured by Western blot analysis. Prostaglandin-E2 (PGE2 and nitric oxide (NO levels in cell supernatants were measured by ELISA and Greiss assay, respectively. Results MWCNTs, but not CBNPs, induced COX-2 and iNOS in a time- and dose-dependent manner. COX-2 and iNOS induction by MWCNTs correlated with increased PGE2 and NO production, respectively. MWCNTs caused ERK1,2 activation and inhibition of ERK1,2 (U0126 blocked MWCNT induction of COX-2 and PGE2 production, but did not reduce the induction of iNOS. Inhibition of iNOS (L-NAME did not affect ERK1,2 activation, nor did L-NAME significantly decrease COX-2 induction by MWCNT. Nickel nanoparticles (NiNPs, which are present in MWCNTs as a residual catalyst, also induced COX-2 via ERK-1,2. However, a comparison of COX-2 induction by MWCNTs containing 4.5 and 1.8% Ni did not show a significant difference in ability to induce COX-2, indicating that characteristics of MWCNTs in addition to Ni content contribute to COX-2 induction. Conclusion This study identifies COX-2 and subsequent PGE2 production, along with iNOS induction and NO production, as inflammatory mediators involved in the macrophage response to

  5. Skepinone-L, a Novel Potent and Highly Selective Inhibitor of p38 MAP Kinase, Effectively Impairs Platelet Activation and Thrombus Formation

    Directory of Open Access Journals (Sweden)

    Oliver Borst

    2013-06-01

    Full Text Available Background/Aims: Platelets are critically important for primary haemostasis and the major players in thrombotic vascular occlusion. Platelets are activated by agonists, such as thrombin and collagen-related peptide as well as second-wave mediators including thromboxane A2 via different intracellular signaling pathways resulting in degranulation, aggregation and thrombus formation. Platelet activation is paralleled by phosphorylation and activation of p38 MAPK. The limited specificity of hitherto known p38 MAPK inhibitors precluded safe conclusions on the precise role of p38 MAPK in the regulation of platelet function. The present study examined the impact of Skepinone-L, a novel and highly selective inhibitor of p38 mitogen-activated protein kinase (p38 MAPK, on platelet activation and thrombus formation. Methods: Experiments were performed in freshly isolated human platelets. Protein phosphorylation was quantified by Western blotting, thromboxane B2 synthesis by enzyme immunoassay, ATP release by ChronoLume luciferin assay, cytosolic Ca2+ concentration by Fura-2 fluorescence-measurements, platelet aggregation by a light transmissions measurement and in vitro thrombus formation by a flow chamber. Results: Skepinone-L (1 μM virtually abrogated the phosphorylation of platelet p38 MAPK substrate Hsp27 following stimulation with CRP (1 μg/ml, thrombin (5 mU/ml or thromboxane A2 analogue U-46619 (1 μM. Furthermore, Skepinone-L significantly blunted activation-dependent platelet secretion and aggregation following threshold concentrations of CRP, thrombin and thromboxane A2 analogue U-46619. Skepinone-L did not impair platelet Ca2+ signaling but prevented agonist-induced thromboxane A2 synthesis through abrogation of p38 MAPK-dependent phosphorylation of platelet cytosolic phospholipase A2 (cPLA2. Skepinone-L further markedly blunted thrombus formation under low (500-s and high (1700-s arterial shear rates. Conclusions: The present study discloses

  6. Mucosal delivery of ACNPV baculovirus driving expression of the Gal-lectin LC3 fragment confers protection against amoebic liver abscess in hamster.

    Science.gov (United States)

    Meneses-Ruiz, D M; Laclette, J P; Aguilar-Díaz, H; Hernández-Ruiz, J; Luz-Madrigal, A; Sampieri, A; Vaca, L; Carrero, J C

    2011-01-01

    Mucosal vaccination against amoebiasis using the Gal-lectin of E. histolytica has been proposed as one of the leading strategies for controlling this human disease. However, most mucosal adjuvants used are toxic and the identification of safe delivery systems is necessary. Here, we evaluate the potential of a recombinant Autographa californica baculovirus driving the expression of the LC3 fragment of the Gal-lectin to confer protection against amoebic liver abscess (ALA) in hamsters following oral or nasal immunization. Hamsters immunized by oral route showed complete absence (57.9%) or partial development (21%) of ALA, resulting in some protection in 78.9% of animals when compared with the wild type baculovirus and sham control groups. In contrast, nasal immunization conferred only 21% of protection efficacy. Levels of ALA protection showed lineal correlation with the development of an anti-amoebic cellular immune response evaluated in spleens, but not with the induction of seric IgG anti-amoeba antibodies. These results suggest that baculovirus driving the expression of E. histolytica vaccine candidate antigens is useful for inducing protective cellular and humoral immune responses following oral immunization, and therefore it could be used as a system for mucosal delivery of an anti-amoebic vaccine.

  7. Mucosal Delivery of ACNPV Baculovirus Driving Expression of the Gal-Lectin LC3 Fragment Confers Protection against Amoebic Liver Abscess in Hamster

    Directory of Open Access Journals (Sweden)

    DM Meneses-Ruiz, JP Laclette, H Aguilar-Díaz, J Hernández-Ruiz, A Luz-Madrigal, A Sampieri, L Vaca, JC Carrero

    2011-01-01

    Full Text Available Mucosal vaccination against amoebiasis using the Gal-lectin of E. histolytica has been proposed as one of the leading strategies for controlling this human disease. However, most mucosal adjuvants used are toxic and the identification of safe delivery systems is necessary. Here, we evaluate the potential of a recombinant Autographa californica baculovirus driving the expression of the LC3 fragment of the Gal-lectin to confer protection against amoebic liver abscess (ALA in hamsters following oral or nasal immunization. Hamsters immunized by oral route showed complete absence (57.9% or partial development (21% of ALA, resulting in some protection in 78.9% of animals when compared with the wild type baculovirus and sham control groups. In contrast, nasal immunization conferred only 21% of protection efficacy. Levels of ALA protection showed lineal correlation with the development of an anti-amoebic cellular immune response evaluated in spleens, but not with the induction of seric IgG anti-amoeba antibodies. These results suggest that baculovirus driving the expression of E. histolytica vaccine candidate antigens is useful for inducing protective cellular and humoral immune responses following oral immunization, and therefore it could be used as a system for mucosal delivery of an anti-amoebic vaccine.

  8. Mucosal Delivery of ACNPV Baculovirus Driving Expression of the Gal-Lectin LC3 Fragment Confers Protection against Amoebic Liver Abscess in Hamster

    Science.gov (United States)

    Meneses-Ruiz, DM; Laclette, JP; Aguilar-Díaz, H; Hernández-Ruiz, J; Luz-Madrigal, A; Sampieri, A; Vaca, L; Carrero, JC

    2011-01-01

    Mucosal vaccination against amoebiasis using the Gal-lectin of E. histolytica has been proposed as one of the leading strategies for controlling this human disease. However, most mucosal adjuvants used are toxic and the identification of safe delivery systems is necessary. Here, we evaluate the potential of a recombinant Autographa californica baculovirus driving the expression of the LC3 fragment of the Gal-lectin to confer protection against amoebic liver abscess (ALA) in hamsters following oral or nasal immunization. Hamsters immunized by oral route showed complete absence (57.9%) or partial development (21%) of ALA, resulting in some protection in 78.9% of animals when compared with the wild type baculovirus and sham control groups. In contrast, nasal immunization conferred only 21% of protection efficacy. Levels of ALA protection showed lineal correlation with the development of an anti-amoebic cellular immune response evaluated in spleens, but not with the induction of seric IgG anti-amoeba antibodies. These results suggest that baculovirus driving the expression of E. histolytica vaccine candidate antigens is useful for inducing protective cellular and humoral immune responses following oral immunization, and therefore it could be used as a system for mucosal delivery of an anti-amoebic vaccine. PMID:22110386

  9. G-Protein Inwardly Rectifying Potassium Channel 1 (GIRK1 Knockdown Decreases Beta-Adrenergic, MAP Kinase and Akt Signaling in the MDA-MB-453 Breast Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Michael W. Hance

    2008-01-01

    Full Text Available Previous data from our laboratory have indicated that there is a functional link between the beta-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in breast cancer cell lines and that these pathways are involved in growth regulation of these cells. To determine functionality, MDA-MB-453 breast cancer cells were stimulated with ethanol, known to open GIRK channels. Decreased GIRK1 protein levels were seen after treatment with 0.12% ethanol. In addition, serum-free media completely inhibited GIRK1 protein expression. This data indicates that there are functional GIRK channels in breast cancer cells and that these channels are involved in cellular signaling. In the present research, to further define the signaling pathways involved, we performed RNA interference (siRNA studies. Three stealth siRNA constructs were made starting at bases 1104, 1315, and 1490 of the GIRK1 sequence. These constructs were transfected into MDA-MB-453 cells, and both RNA and protein were isolated. GIRK1, β2-adrenergic and 18S control levels were determined using real-time PCR 24 hours after transfection. All three constructs decreased GIRK1 mRNA levels. However, β2 mRNA levels were unchanged by the GIRK1 knockdown. GIRK1 protein levels were also reduced by the knockdown, and this knockdown led to decreases in beta-adrenergic, MAP kinase and Akt signaling.

  10. Characterization of a new pathogenic Acanthamoeba Species, A. byersi n. sp., isolated from a human with fatal amoebic encephalitis.

    Science.gov (United States)

    Qvarnstrom, Yvonne; Nerad, Thomas A; Visvesvara, Govinda S

    2013-01-01

    Acanthamoeba spp. are free-living amoebae that are ubiquitous in natural environments. They can cause cutaneous, nasopharyngeal, and disseminated infection, leading to granulomatous amebic encephalitis (GAE) in immunocompromised individuals. In addition, they can cause amoebic keratitis in contact lens wearers. Acanthamoeba GAE is almost always fatal because of difficulty and delay in diagnosis and lack of optimal antimicrobial therapy. Here, we report the description of an unusual strain isolated from skin and brain of a GAE patient. The amoebae displayed large trophozoites and star-shaped cysts, characteristics for acanthamoebas belonging to morphology Group 1. However, its unique morphology and growth characteristics differentiated this new strain from other Group 1 species. DNA sequence analysis, secondary structure prediction, and phylogenetic analysis of the 18S rRNA gene confirmed that this new strain belonged to Group 1, but that it was distinct from the other sequence types within that group. Thus, we hereby propose the establishment of a new species, Acanthamoeba byersi n. sp. as well as a new sequence type, T18, for this new strain. To our knowledge, this is the first report of a Group 1 Acanthamoeba that is indisputably pathogenic in humans.

  11. In vivo programmed cell death of Entamoeba histolytica trophozoites in a hamster model of amoebic liver abscess.

    Science.gov (United States)

    Villalba-Magdaleno, José D'Artagnan; Pérez-Ishiwara, Guillermo; Serrano-Luna, Jesús; Tsutsumi, Víctor; Shibayama, Mineko

    2011-05-01

    Entamoeba histolytica trophozoites can induce host cell apoptosis, which correlates with the virulence of the parasite. This phenomenon has been seen during the resolution of an inflammatory response and the survival of the parasites. Other studies have shown that E. histolytica trophozoites undergo programmed cell death (PCD) in vitro, but how this process occurs within the mammalian host cell remains unclear. Here, we studied the PCD of E. histolytica trophozoites as part of an in vivo event related to the inflammatory reaction and the host-parasite interaction. Morphological study of amoebic liver abscesses showed only a few E. histolytica trophozoites with peroxidase-positive nuclei identified by terminal deoxynucleotidyltransferase enzyme-mediated dUTP nick end labelling (TUNEL). To better understand PCD following the interaction between amoebae and inflammatory cells, we designed a novel in vivo model using a dialysis bag containing E. histolytica trophozoites, which was surgically placed inside the peritoneal cavity of a hamster and left to interact with the host's exudate components. Amoebae collected from bags were then examined by TUNEL assay, fluorescence-activated cell sorting (FACS) and transmission electron microscopy. Nuclear condensation and DNA fragmentation of E. histolytica trophozoites were observed after exposure to peritoneal exudates, which were mainly composed of neutrophils and macrophages. Our results suggest that production of nitric oxide by inflammatory cells could be involved in PCD of trophozoites. In this modified in vivo system, PCD appears to play a prominent role in the host-parasite interaction and parasite cell death.

  12. Amoebicidal Activity of Essential Oil of Dysphania ambrosioides (L. Mosyakin & Clemants in an Amoebic Liver Abscess Hamster Model

    Directory of Open Access Journals (Sweden)

    Manuel Enrique Ávila-Blanco

    2014-01-01

    Full Text Available Amebiasis is a parasitic disease that extends worldwide and is a public health problem in developing countries. Metronidazole is the drug recommended in the treatment of amebiasis, but its contralateral effects and lack of continuity of treatment induce low efficiency, coupled with the appearance of resistant amoebic strains. Therefore, the search of new compounds with amoebicidal activity is urgent and important. In this study, we evaluated the in vitro and in vivo antiamoebic activity of the essential oil Dysphania ambrosioides (L. Mosyakin & Clemants. It exhibited an IC50 = 0.7 mg/mL against trophozoites. The oral administration of essential oil (8 mg/kg and 80 mg/kg to hamster infected with Entamoeba histolytica reverted the infection. Ascaridole was identified as the main component of essential oil of D. ambrosioides. The identification of amoebicidal activity of Ascaridole gives support to the traditional use. Further studies with Ascaridole will be carried out to understand the mechanism involved.

  13. Rac-1 and Raf-1 kinases, components of distinct signaling pathways, activate myotonic dystrophy protein kinase

    Science.gov (United States)

    Shimizu, M.; Wang, W.; Walch, E. T.; Dunne, P. W.; Epstein, H. F.

    2000-01-01

    Myotonic dystrophy protein kinase (DMPK) is a serine-threonine protein kinase encoded by the myotonic dystrophy (DM) locus on human chromosome 19q13.3. It is a close relative of other kinases that interact with members of the Rho family of small GTPases. We show here that the actin cytoskeleton-linked GTPase Rac-1 binds to DMPK, and coexpression of Rac-1 and DMPK activates its transphosphorylation activity in a GTP-sensitive manner. DMPK can also bind Raf-1 kinase, the Ras-activated molecule of the MAP kinase pathway. Purified Raf-1 kinase phosphorylates and activates DMPK. The interaction of DMPK with these distinct signals suggests that it may play a role as a nexus for cross-talk between their respective pathways and may partially explain the remarkable pleiotropy of DM.

  14. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  15. Plant protein kinase genes induced by drought, high salt and cold stresses

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Drought, high salt and cold are three different kinds of environment stresses that severely influence the growth, development and productivity of crops. They all decrease the water state of plant cells, and consequently result in the harm of plant from water deficit. Several genes encoding protein kinases and induced by drought, high salt and low temperature have been isolated from Arabidopsis. These protein kinases include receptor protein kinase (RPK), MAP kinases, ribosomal-protein kinases and transcription-regulation protein kinase. The expression features of these genes and the regulatory roles of these protein kinases in stress response and signal transduction are discussed.

  16. Cytokine-induced activation of Mixed Lineage Kinase 3 requires TRAF2 and TRAF6

    OpenAIRE

    Korchnak, Amanda C.; Zhan, Yu; Aguilar, Michael T.; Chadee, Deborah N.

    2009-01-01

    Mixed Lineage Kinase 3 (MLK3) is a mitogen-activated protein kinase kinase kinase (MAP3K) that activates multiple mitogen activated protein kinase (MAPK) pathways in response to growth factors, stresses and the pro-inflammatory cytokine, tumor necrosis factor (TNF). MLK3 is required for optimal activation of stress activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) signaling by TNF, however, the mechanism by which MLK3 is recruited and activated by the TNF receptor remains poorly und...

  17. The Crystal Structure of Cancer Osaka Thyroid Kinase Reveals an Unexpected Kinase Domain Fold*

    Science.gov (United States)

    Gutmann, Sascha; Hinniger, Alexandra; Fendrich, Gabriele; Drückes, Peter; Antz, Sylvie; Mattes, Henri; Möbitz, Henrik; Ofner, Silvio; Schmiedeberg, Niko; Stojanovic, Aleksandar; Rieffel, Sebastien; Strauss, André; Troxler, Thomas; Glatthar, Ralf; Sparrer, Helmut

    2015-01-01

    Macrophages are important cellular effectors in innate immune responses and play a major role in autoimmune diseases such as rheumatoid arthritis. Cancer Osaka thyroid (COT) kinase, also known as mitogen-activated protein kinase kinase kinase 8 (MAP3K8) and tumor progression locus 2 (Tpl-2), is a serine-threonine (ST) kinase and is a key regulator in the production of pro-inflammatory cytokines in macrophages. Due to its pivotal role in immune biology, COT kinase has been identified as an attractive target for pharmaceutical research that is directed at the discovery of orally available, selective, and potent inhibitors for the treatment of autoimmune disorders and cancer. The production of monomeric, recombinant COT kinase has proven to be very difficult, and issues with solubility and stability of the enzyme have hampered the discovery and optimization of potent and selective inhibitors. We developed a protocol for the production of recombinant human COT kinase that yields pure and highly active enzyme in sufficient yields for biochemical and structural studies. The quality of the enzyme allowed us to establish a robust in vitro phosphorylation assay for the efficient biochemical characterization of COT kinase inhibitors and to determine the x-ray co-crystal structures of the COT kinase domain in complex with two ATP-binding site inhibitors. The structures presented in this study reveal two distinct ligand binding modes and a unique kinase domain architecture that has not been observed previously. The structurally versatile active site significantly impacts the design of potent, low molecular weight COT kinase inhibitors. PMID:25918157

  18. Protection against Naegleria fowleri infection in mice immunized with Cry1Ac plus amoebic lysates is dependent on the STAT6 Th2 response.

    Science.gov (United States)

    Carrasco-Yepez, M; Rojas-Hernandez, S; Rodriguez-Monroy, M A; Terrazas, L I; Moreno-Fierros, L

    2010-01-01

    We previously reported that intranasal administration of Cry1Ac protoxin alone or in combination with amoebic lysates increases protection against Naegleria fowleri meningoencephalitis in mice. Those results suggested that both antibody responses and innate immune mechanisms may be participating in the protective effects observed. The present study was aimed to investigate whether the STAT6-induced Th2 immune response is essential for the resistance to N. fowleri infection, conferred by immunization with amoebic lysates plus Cry1Ac. STAT6-deficient (STAT6-/-) and wild-type (STAT6+/+) BALB/c mice were immunized by the intranasal route with a combination of N. fowleri lysates plus Cry1Ac, and subsequently challenged with lethal doses of N. fowleri trophozoites. STAT6+/+ mice displayed 100% protection, while no protection was observed in STAT6-/- mice. Significantly higher titres of Th2-associated IgG1 as well as interleukin-4 (IL-4) were found in STAT6+/+ mice, whereas in STAT6-/- mice significantly more IL-12 and IFN-gamma as well as significantly higher titres of Th1-associated IgG2a were detected. Thus, whereas protected STAT6+/+-immunized mice elicited a Th-2 type inclined immune response that produced predominantly humoral immunity, unprotected STAT6-/- mice exhibited a polarized Th1 type cellular response. These findings suggest that the STAT6-signalling pathway is critical for defence against N. fowleri infection.

  19. Staphylococcal PknB as the First Prokaryotic Representative of the Proline-Directed Kinases

    NARCIS (Netherlands)

    Miller, Malgorzata; Donat, Stefanie; Rakette, Sonja; Stehle, Thilo; Kouwen, Thijs R. H. M.; Diks, Sander H.; Dreisbach, Annette; Reilman, Ewoud; Gronau, Katrin; Becher, Doerte; Peppelenbosch, Maikel P.; van Dijl, Jan Maarten; Ohlsen, Knut

    2010-01-01

    In eukaryotic cell types, virtually all cellular processes are under control of proline-directed kinases and especially MAP kinases. Serine/threonine kinases in general were originally considered as a eukaryote-specific enzyme family. However, recent studies have revealed that orthologues of eukaryo

  20. Mixed Lineage Kinase-c-Jun N-Terminal Kinase Axis: A Potential Therapeutic Target in Cancer.

    Science.gov (United States)

    Rana, Ajay; Rana, Basabi; Mishra, Rajakishore; Sondarva, Gautam; Rangasamy, Velusamy; Das, Subhasis; Viswakarma, Navin; Kanthasamy, Anumantha

    2013-09-01

    Mixed lineage kinases (MLKs) are members of the mitogen-activated protein kinase kinase kinase (MAP3K) family and are reported to activate MAP kinase pathways. There have been at least 9 members of the MLK family identified to date, although the physiological functions of all the family members are yet unknown. However, MLKs in general have been implicated in neurodegenerative diseases, including Parkinson and Alzheimer diseases. Recent reports suggest that some of the MLK members could play a role in cancer via modulating cell migration, invasion, cell cycle, and apoptosis. This review article will first describe the biology of MLK members and then discuss the current progress that relates to their functions in cancer.

  1. Thymidine kinases in archaea

    DEFF Research Database (Denmark)

    Clausen, A.R.; Matakos, A.; Sandrini, Michael;

    2006-01-01

    Twenty-six fully sequenced archaeal genomes were searched for genes coding for putative deoxyribonucleoside kinases (dNKs). We identified only 5 human-like thymidine kinase 1 genes (TK1s) and none for non-TK1 kinases. Four TK1s were identified in the Euryarchaea and one was found in the Crenarchaea...... that a functional deoxyribonucleoside salvage pathway is not crucial for the archaeal cell....

  2. Diagnostic imaging and interventional radiology of the amoebic liver abscess. Personal experience; Diagnostica per immagini e radiologia interventistica degli ascessi amebici del fegato: esperienza personale

    Energy Technology Data Exchange (ETDEWEB)

    De Rosa, A. [Ospedale S. Maria di Lorento Nuovo, NA (Italy). Servizio di Radiologia; Nunziata, A. [Neapel, Presidio Sanitario Intermedio (Italy). Area di Diagnostica per Immagini; Catalano, O.; Cusati, B.; Esposito, M.; Siani, A. [Ospedale di S. Maria delle Grazie, Pozzuoli, NA (Italy). Servizio di Radiologia

    1999-10-01

    The diagnostic imaging findings in hepatic amoebiasis and the capabilities of percutaneous drainage have already been described but some debate is open on both diagnosis and treatment. It is reported the experience with the ultrasound (US) and Computed Tomography (CT) studies of the hepatic amoebic abscess and its management. [Italian] I reperti con diagnostica per immagini nell'amebiasi epatica e le possibilita' del drenaggio percutaneo sono stati gia' illustrati; esistono tuttavia controversie sul piano sia diagnostico che terapeutico. Obiettivo di questo lavoro e' quello di riportare l'esperienza personale nella diagnostica con ecografia e tomografia computerizzata (TC) e nel trattamento degli ascessi amebici del fegato.

  3. Naegleria fowleri That Induces Primary Amoebic Meningoencephalitis: Rapid Diagnosis and Rare Case of Survival in a 12-Year-Old Caucasian Girl.

    Science.gov (United States)

    Dunn, Andrew L; Reed, Tameika; Stewart, Charlotte; Levy, Rebecca A

    2016-05-01

    Primary amoebic meningoencephalitis (PAM) is a rare and almost always fatal disease that is caused by Naegleria fowleri, a freshwater thermophilic amoeba. Our case involves an adolescent female who presented with fever of unknown origin. A lumbar puncture was performed, and the Wright-Giemsa and Gram stained cerebrospinal fluid (CSF) cytospin slides showed numerous organisms. Experienced medical technologists in the microbiology and hematology laboratories identified the organisms as morphologically consistent with Naegleria species. The laboratory made a rapid diagnosis and alerted emergency department care providers within 75 minutes. The patient was treated for PAM with amphotericin, rifampin, azithromycin, fluconazole and aggressive supportive therapy including dexamethasone. The Centers for Disease Control and Prevention (CDC) was contacted, and miltefosine, an investigational medication, was started. Additional treatment included an intraventricular shunt and controlled hypothermia in order to mitigate potential cerebral edema. Our patient is a rare success story, as she was diagnosed swiftly, successfully treated, and survived PAM.

  4. Attenuation of pattern recognition receptor signaling is mediated by a MAP kinase kinase kinase

    NARCIS (Netherlands)

    Mithoe, S.C.; Ludwig, C.; Pel, M.J.C.; Cucinotta, M.; Casartelli, A.; Mbengue, M.; Sklenar, J.; Derbyshire, P.; Robatzek, S.; Pieterse, C.M.J.; Aebersold, R.; Menke, F.L.H.

    2016-01-01

    Pattern recognition receptors (PRRs) play a key role in plant and animal innate immunity. PRR binding of their cognate ligand triggers a signaling network and activates an immune response. Activation of PRR signaling must be controlled prior to ligand binding to prevent spurious signaling and immune

  5. Muscle phosphorylase kinase deficiency

    DEFF Research Database (Denmark)

    Preisler, N; Orngreen, M C; Echaniz-Laguna, A;

    2012-01-01

    To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD).......To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD)....

  6. Mixed - Lineage Protein kinases (MLKs) in inflammation, metabolism, and other disease states.

    Science.gov (United States)

    Craige, Siobhan M; Reif, Michaella M; Kant, Shashi

    2016-09-01

    Mixed lineage kinases, or MLKs, are members of the MAP kinase kinase kinase (MAP3K) family, which were originally identified among the activators of the major stress-dependent mitogen activated protein kinases (MAPKs), JNK and p38. During stress, the activation of JNK and p38 kinases targets several essential downstream substrates that react in a specific manner to the unique stressor and thus determine the fate of the cell in response to a particular challenge. Recently, the MLK family was identified as a specific modulator of JNK and p38 signaling in metabolic syndrome. Moreover, the MLK family of kinases appears to be involved in a very wide spectrum of disorders. This review discusses the newly identified functions of MLKs in multiple diseases including metabolic disorders, inflammation, cancer, and neurological diseases.

  7. Regulation of mitogen-activated protein kinase pathways by the plasma membrane Na+/H+ exchanger, NHE1

    DEFF Research Database (Denmark)

    Pedersen, Stine Helene Falsig; Darborg, Barbara Vasek; Rentsch, Maria Louise;

    2006-01-01

    The mitogen-activated protein kinases (MAPKs), including extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 MAPK, play a major role in the regulation of pivotal cellular processes such as cell death/survival balance, cell cycle progression, and cell migration. MAP...

  8. Mitogen-activated protein kinase signaling in plants

    DEFF Research Database (Denmark)

    Rodriguez, Maria Cristina Suarez; Petersen, Morten; Mundy, John

    2010-01-01

    Eukaryotic mitogen-activated protein kinase (MAPK) cascades have evolved to transduce environmental and developmental signals into adaptive and programmed responses. MAPK cascades relay and amplify signals via three types of reversibly phosphorylated kinases leading to the phosphorylation of subs...... the Arabidopsis thaliana MAPKs MPK3, 4, and 6 and MAP2Ks MKK1, 2, 4, and 5. Future work needs to focus on identifying substrates of MAPKs, and on understanding how specificity is achieved among MAPK signaling pathways....

  9. Mapping of p140Cap phosphorylation sites: the EPLYA and EGLYA motifs have a key role in tyrosine phosphorylation and Csk binding, and are substrates of the Abl kinase.

    Directory of Open Access Journals (Sweden)

    Daniele Repetto

    Full Text Available Protein phosphorylation tightly regulates specific binding of effector proteins that control many diverse biological functions of cells (e. g. signaling, migration and proliferation. p140Cap is an adaptor protein, specifically expressed in brain, testis and epithelial cells, that undergoes phosphorylation and tunes its interactions with other regulatory molecules via post-translation modification. In this work, using mass spectrometry, we found that p140Cap is in vivo phosphorylated on tyrosine (Y within the peptide GEGLpYADPYGLLHEGR (from now on referred to as EGLYA as well as on three serine residues. Consistently, EGLYA has the highest score of in silico prediction of p140Cap phosphorylation. To further investigate the p140Cap function, we performed site specific mutagenesis on tyrosines inserted in EGLYA and EPLYA, a second sequence with the same highest score of phosphorylation. The mutant protein, in which both EPLYA/EGLYA tyrosines were converted to phenylalanine, was no longer tyrosine phosphorylated, despite the presence of other tyrosine residues in p140Cap sequence. Moreover, this mutant lost its ability to bind the C-terminal Src kinase (Csk, previously shown to interact with p140Cap by Far Western analysis. In addition, we found that in vitro and in HEK-293 cells, the Abelson kinase is the major kinase involved in p140Cap tyrosine phosphorylation on the EPLYA and EGLYA sequences. Overall, these data represent an original attempt to in vivo characterise phosphorylated residues of p140Cap. Elucidating the function of p140Cap will provide novel insights into its biological activity not only in normal cells, but also in tumors.

  10. Mapping of p140Cap phosphorylation sites: the EPLYA and EGLYA motifs have a key role in tyrosine phosphorylation and Csk binding, and are substrates of the Abl kinase.

    Science.gov (United States)

    Repetto, Daniele; Aramu, Simona; Boeri Erba, Elisabetta; Sharma, Nanaocha; Grasso, Silvia; Russo, Isabella; Jensen, Ole N; Cabodi, Sara; Turco, Emilia; Di Stefano, Paola; Defilippi, Paola

    2013-01-01

    Protein phosphorylation tightly regulates specific binding of effector proteins that control many diverse biological functions of cells (e. g. signaling, migration and proliferation). p140Cap is an adaptor protein, specifically expressed in brain, testis and epithelial cells, that undergoes phosphorylation and tunes its interactions with other regulatory molecules via post-translation modification. In this work, using mass spectrometry, we found that p140Cap is in vivo phosphorylated on tyrosine (Y) within the peptide GEGLpYADPYGLLHEGR (from now on referred to as EGLYA) as well as on three serine residues. Consistently, EGLYA has the highest score of in silico prediction of p140Cap phosphorylation. To further investigate the p140Cap function, we performed site specific mutagenesis on tyrosines inserted in EGLYA and EPLYA, a second sequence with the same highest score of phosphorylation. The mutant protein, in which both EPLYA/EGLYA tyrosines were converted to phenylalanine, was no longer tyrosine phosphorylated, despite the presence of other tyrosine residues in p140Cap sequence. Moreover, this mutant lost its ability to bind the C-terminal Src kinase (Csk), previously shown to interact with p140Cap by Far Western analysis. In addition, we found that in vitro and in HEK-293 cells, the Abelson kinase is the major kinase involved in p140Cap tyrosine phosphorylation on the EPLYA and EGLYA sequences. Overall, these data represent an original attempt to in vivo characterise phosphorylated residues of p140Cap. Elucidating the function of p140Cap will provide novel insights into its biological activity not only in normal cells, but also in tumors.

  11. Mapping of the receptor protein-tyrosine kinase 10 to human chromosome 1q21-q23 and mouse chromosome 1H1-5 by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Edelhoff, S.; Disteche, C.M. [Univ. of Washington School of Medicine, Seattle, WA (United States); Lai, C. [Scripps Research Inst., LaJolla, CA (United States)

    1995-01-01

    Receptor protein-tyrosine kinases (PTKs) play a critical role in the transduction of signals important to cell growth, differentiation, and survival. Mutations affecting the expression of receptor PTK genes have been associated with a number of vertebrate and invertebrate developmental abnormalities, and the aberrant regulation of tyrosine phosphorylation is implicated in a variety of neoplasias. One estimate suggests that approximately 100 receptor PTK genes exist in the mammalian genome, about half of which have been identified. The tyro-10 receptor protein-tyrosine kinase, first identified in a PCR-based survey for novel tyrosine kinases in the rat nervous system, defines a new subfamily of PTKs. It exhibits a catalytic domain most closely related to those found in the trk PTK receptor subfamily, which transduces signals for nerve growth factor and the related molecules brain-derived neurotrophic factor (BDNF), neurotrophin-3, and neurotrophin-4 (NT-3 and NT-4). Trk and the related PTK receptors trkB and trkC play a critical role in the neurotrophin-dependent survival of subsets of sensory and motor neurons. The predicted tyro-10 extracellular region is, however, distinct from that of the trk subfamily and is unique except for a domain shared with the blood coagulation factors V and VIII, thought to be involved in phospholipid binding. Although tyro-10 RNA is most abundant in heart and skeletal muscle in the adult rat, it is expressed in a wide variety of tissues, including the developing and mature brain. Tyro-10 appears identical to the murine TKT sequence reported by Karn et al. and exhibits a high degree of similarity with the CaK, DDR, and Nep PTKs. A ligand for tyro-10 has not yet been identified. 10 refs., 1 fig.

  12. Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Zhou, Lu; Yun, Byung-Wook

    2008-01-01

    The Arabidopsis thaliana MKK1 and MKK2 MAP kinase kinases have been implicated in biotic and abiotic stress responses as part of a signalling cascade including MEKK1 and MPK4. Here, the double loss-of-function mutant (mkk1/2) of MKK1 and MKK2 is shown to have marked phenotypes in development...

  13. SRC protein tyrosine kinase, c-Jun N-terminal kinase (JNK), and NF-kappaBp65 signaling in commercial and wild-type turkey leukocytes

    Science.gov (United States)

    Studies comparing signaling in wild-type turkey (WT) leukocytes and commercial turkey (CT) leukocytes found that the activity of protein tyrosine kinases (PTK) and MAP kinases, ERK 1/2 and p38, were significantly higher in WT leukocytes compared to CT lines upon exposure to both SE and OPSE on days...

  14. Studying Kinetochore Kinases

    NARCIS (Netherlands)

    Saurin, Adrian T; Kops, Geert J P L

    2016-01-01

    Mitotic kinetochores are signaling network hubs that regulate chromosome movements, attachment error-correction, and the spindle assembly checkpoint. Key switches in these networks are kinases and phosphatases that enable rapid responses to changing conditions. Describing the mechanisms and dynamics

  15. Induction of interleukin-8 by Naegleria fowleri lysates requires activation of extracellular signal-regulated kinase in human astroglial cells.

    Science.gov (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Sang-Hee; Kwon, Daeho; Shin, Ho-Joon

    2012-08-01

    Naegleria fowleri is a pathogenic free-living amoeba which causes primary amoebic meningoencephalitis in humans and experimental animals. To investigate the mechanisms of such inflammatory diseases, potential chemokine gene activation in human astroglial cells was investigated following treatment with N. fowleri lysates. We demonstrated that N. fowleri are potent inducers for the expression of interleukin-8 (IL-8) genes in human astroglial cells which was preceded by activation of extracellular signal-regulated kinase (ERK). In addition, N. fowleri lysates induces the DNA binding activity of activator protein-1 (AP-1), an important transcription factor for IL-8 induction. The specific mitogen-activated protein kinase kinase/ERK inhibitor, U0126, blocks N. fowleri-mediated AP-1 activation and subsequent IL-8 induction. N. fowleri-induced IL-8 expression requires activation of ERK in human astroglial cells. These findings indicate that treatment of N. fowleri on human astroglial cells leads to the activation of AP-1 and subsequent expression of IL-8 which are dependent on ERK activation. These results may help understand the N. fowleri-mediated upregulation of chemokine and cytokine expression in the astroglial cells.

  16. Chemical genetic approach identifies microtubule affinity-regulating kinase 1 as a leucine-rich repeat kinase 2 substrate.

    Science.gov (United States)

    Krumova, Petranka; Reyniers, Lauran; Meyer, Marc; Lobbestael, Evy; Stauffer, Daniela; Gerrits, Bertran; Muller, Lionel; Hoving, Sjouke; Kaupmann, Klemens; Voshol, Johannes; Fabbro, Doriano; Bauer, Andreas; Rovelli, Giorgio; Taymans, Jean-Marc; Bouwmeester, Tewis; Baekelandt, Veerle

    2015-07-01

    Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant forms of Parkinson's disease. LRRK2 is a modular, multidomain protein containing 2 enzymatic domains, including a kinase domain, as well as several protein-protein interaction domains, pointing to a role in cellular signaling. Although enormous efforts have been made, the exact pathophysiologic mechanisms of LRRK2 are still not completely known. In this study, we used a chemical genetics approach to identify LRRK2 substrates from mouse brain. This approach allows the identification of substrates of 1 particular kinase in a complex cellular environment. Several of the identified peptides are involved in the regulation of microtubule (MT) dynamics, including microtubule-associating protein (MAP)/microtubule affinity-regulating kinase 1 (MARK1). MARK1 is a serine/threonine kinase known to phosphorylate MT-binding proteins such as Tau, MAP2, and MAP4 at KXGS motifs leading to MT destabilization. In vitro kinase assays and metabolic-labeling experiments in living cells confirmed MARK1 as an LRRK2 substrate. Moreover, we also showed that LRRK2 and MARK1 are interacting in eukaryotic cells. Our findings contribute to the identification of physiologic LRRK2 substrates and point to a potential mechanism explaining the reported effects of LRRK2 on neurite morphology.

  17. The role of MAP kinase cascades in cell signaling,neural plasticity and pain facilitation%MAP激酶在细胞内信号传递,神经可塑性及痛觉易化中的作用

    Institute of Scientific and Technical Information of China (English)

    Ru-Rong Ji; Yu-Qiu Zhang

    2005-01-01

    病理性疼痛通常指由组织损伤引起的炎性痛和神经损伤引起的神经病理性痛.损伤和强烈的伤害刺激能导致痛过敏.痛过敏现象的产生是由外周敏化(初级伤害感受器的敏感性增加)和中枢敏化(脊髓背角以及其他中枢神经元敏感性增加)引起的.有些蛋白激酶通过翻译后的调节如关键膜受体和通道蛋白磷酸化而参与外周和中枢敏化的形成.特别的是多种信号通路可汇聚而激活MAPK(mitogen-activated protein kinase).伤害性刺激、生长因子以及炎性介质均能在初级和二级痛感受神经元中激活MAPK家族成员ERK和P38.ERK和P38的激活不仅能够引起转录后过程发生改变,而且还能够通过对转录和非转录水平的调节增加多种基因的表达,从而导致损伤后痛过敏的形成和维持.%Pathological pain, normally referring to tissue injury-induced inflammatory pain and nerve injury-induced neuropathic pain, is an expression of neural plasticity. Injuries and intense noxious stimuli result in pain hypersensitivity,which is contributed by peripheral sensitization (increased sensitivity of primary sensory nociceptors) and central sensitization (increased sensitivity of spinal dorsal horn and other CNS neurons). Activation of several protein kinases causes both forms of sensitization via posttranslational regulation, such as phosphorylation of key membrane receptors and channels. In particular, activation of multiple signal cascades converge on the activation of MAPK (mitogen-activated protein kinase).Activation of MAPK family members of ERK and p38 by nociceptive activity, growth factors, and inflammatory mediators in primary sensory and secondary order neurons, not only results in posttranslational modification, but also increases the expression of numerous genes via transcriptional and non-transcriptional regulation. Eventually this activation contributes to the development and maintenance of heightened pain

  18. 14-3-3 proteins interact with specific MEK kinases.

    Science.gov (United States)

    Fanger, G R; Widmann, C; Porter, A C; Sather, S; Johnson, G L; Vaillancourt, R R

    1998-02-06

    MEK (mitogen-activated protein kinase/extracellular signal-regulated kinase kinase) kinases (MEKKs) regulate c-Jun N-terminal kinase and extracellular response kinase pathways. The 14-3-3zeta and 14-3-3epsilon isoforms were isolated in a two-hybrid screen for proteins interacting with the N-terminal regulatory domain of MEKK3. 14-3-3 proteins bound both the N-terminal regulatory and C-terminal kinase domains of MEKK3. The binding affinity of 14-3-3 for the MEKK3 N terminus was 90 nM, demonstrating a high affinity interaction. 14-3-3 proteins also interacted with MEKK1 and MEKK2, but not MEKK4. Endogenous 14-3-3 protein and MEKK1 and MEKK2 were similarly distributed in the cell, consistent with their in vitro interactions. MEKK1 and 14-3-3 proteins colocalized using two-color digital confocal immunofluorescence. Binding of 14-3-3 proteins mapped to the N-terminal 393 residues of 196-kDa MEKK1. Unlike MEKK2 and MEKK3, the C-terminal kinase domain of MEKK1 demonstrated little or no ability to interact with 14-3-3 proteins. MEKK1, but not MEKK2, -3 or -4, is a caspase-3 substrate that when cleaved releases the kinase domain from the N-terminal regulatory domain. Functionally, caspase-3 cleavage of MEKK1 releases the kinase domain from the N-terminal 14-3-3-binding region, demonstrating that caspases can selectively alter protein kinase interactions with regulatory proteins. With regard to MEKK1, -2 and -3, 14-3-3 proteins do not appear to directly influence activity, but rather function as "scaffolds" for protein-protein interactions.

  19. Participación del óxido nítrico durante el desarrollo del absceso hepático amebiano Nitric oxide participation during amoebic liver abscess development

    Directory of Open Access Journals (Sweden)

    Joel Ramírez-Emiliano

    2007-04-01

    Full Text Available El óxido nítrico participa en funciones fisiológicas y fisiopatológicas, así como en el mecanismo de defensa del sistema inmunológico de mamíferos contra parásitos, virus y bacterias. La Entamoeba histolytica es un parásito protozoario causante de la amebiasis, la cual se caracteriza por el daño intestinal y la formación del absceso hepático amebiano (AHA. El desarrollo del absceso hepático amebiano en el hámster es similar al que desarrolla el humano, mientras que el ratón es resistente a la formación de este absceso, debido a un incremento en la producción de óxido nítrico. A diferencia del ratón, el desarrollo del absceso hepático amebiano en el hámster es debido a un exceso en la producción de óxido nítrico o posiblemente a una mayor susceptibilidad del hámster al daño producido por el óxido nítrico. Por lo tanto, sería importante realizar más estudios para determinar si en el humano, un exceso en la producción de óxido nítrico favorece la formación del absceso hepático amebiano.Nitric oxide participates in both physiological and pathophysiological functions, and it plays an important role in the mammalian immune system in killing or inhibiting the growth of many pathogens, including parasites, viruses and bacteria. Entamoeba histolytica is a protozoan parasite that causes amoebiasis, which is characterized by intestinal damage and amoebic liver abscess development. The development of amoebic liver abscess in hamsters is similar to that in humans, whereas mice are resistant to amoebic liver abscess development due to an increase in nitric oxide production. Unlike in mice, amoebic liver abscess development in hamsters is due to an excess in nitric oxide production or possibly to a greater susceptibility of the hamster to damage caused by nitric oxide. Therefore, it could be important to elucidate if, in humans, an excess in nitric oxide production favors amoebic liver abscess development.

  20. Orexin-stimulated MAP kinase cascades are activated through multiple G-protein signalling pathways in human H295R adrenocortical cells: diverse roles for orexins A and B.

    Science.gov (United States)

    Ramanjaneya, Manjunath; Conner, Alex C; Chen, Jing; Kumar, Prashanth; Brown, James E P; Jöhren, Olaf; Lehnert, Hendrik; Stanfield, Peter R; Randeva, Harpal S

    2009-08-01

    Orexins A and B (ORA and ORB) are neuropeptide hormones found throughout the central nervous system and periphery. They are required for a host of physiological processes including mitogen-activated protein kinase (MAPK) regulation, steroidogenesis, appetite control and energy regulation. While some signalling mechanisms have been proposed for individual recombinant orexin receptors in generic mammalian cell types, it is clear that the peripheral effects of orexin are spatially and temporally complex. This study dissects the different G-protein signalling and MAPK pathways activated in a pluripotent human adrenal H295R cell line capable of all the physiological steps involved in steroidogenesis. Both extracellular receptor kinase 1/2 (ERK1/2) and p38 were phosphorylated rapidly with a subsequent decline, in a time- and dose-dependent manner, in response to both ORA and ORB. Conversely, there was little or no direct activation of the ERK5 or JNK pathway. Analysis using signalling and MAPK inhibitors as well as receptor-specific antagonists determined the precise mediators of the orexin response in these cells. Both ERK1/2 and p38 activation were predominantly G(q)- and to a lesser extent G(s)-mediated; p38 activation even had a small G(i)-component. Effects were broadly comparable for both orexin sub-types ORA and ORB and although most of the effects were transmitted through the orexin receptor-1 subtype, we did observe a role for orexin receptor-2-mediated activation of both ERK1/2 and p38. Cortisol secretion also differed in response to ORA and ORB. These data suggest multiple roles for orexin-mediated MAPK activation in an adrenal cell-line, this complexity may help to explain the diverse biological actions of orexins with wide-ranging consequences for our understanding of the mechanisms initiated by these steroidogenic molecules.

  1. Neoparamoeba pemaquidensis引起的海水鱼阿米巴鳃病%Amoebic gill disease of marine fish caused by Neoparamoeba pemaquidensis

    Institute of Scientific and Technical Information of China (English)

    D. ZILBERG

    2005-01-01

    海水养殖的鲑鱼及鲽鱼(Scophthalmus maximus)的阿米巴鳃病是由Neoparamoeba pemaquidensis引起的.在西班牙,该病对鲑鱼的海水养殖造成巨大损失,同时也正威胁着鲽鱼的养殖.组织病理损伤主要是鱼鳃上皮细胞的增生和肥大.该虫仅寄生在鱼鳃表面.现已有证据证明,非特异免疫参与鱼类抵御该病,但还没有证明特异性免疫在此过程中发挥作用的相似证据.对鲑鱼来说,治疗该病惟一有效的方法就是用淡水浸泡%Amoebic gill disease (AGD) of maricultured salmonids and turbot Scophthalmus maximus is caused by Neoparamoeba pemaquidensis. It causes significant losses mainly in marine-cultured salmonids and is an emerging problem in turbot culture in Spain. Histopathological lesions are mainly hyperplasia and hypertrophy of the gill epithelium. The parasite is confined to the gill surface. There is evidence that non-specific immunity is involved in fish acquiring resistance to AGD and there is no similar evidence for acquisition of a specific immune response. For salmonids, the only effective treatment for AGD is a freshwater bath

  2. Entamoeba histolytica and E. dispar Calreticulin: Inhibition of Classical Complement Pathway and Differences in the Level of Expression in Amoebic Liver Abscess

    Directory of Open Access Journals (Sweden)

    Cecilia Ximénez

    2014-01-01

    Full Text Available The role of calreticulin (CRT in host-parasite interactions has recently become an important area of research. Information about the functions of calreticulin and its relevance to the physiology of Entamoeba parasites is limited. The present work demonstrates that CRT of both pathogenic E. histolytica and nonpathogenic E. dispar species specifically interacted with human C1q inhibiting the activation of the classical complement pathway. Using recombinant EhCRT protein, we demonstrate that CRT interaction site and human C1q is located at the N-terminal region of EhCRT. The immunofluorescence and confocal microscopy experiments show that CRT and human C1q colocalize in the cytoplasmic vesicles and near to the surface membrane of previously permeabilized trophozoites or are incubated with normal human serum which is known to destroy trophozoites. In the presence of peripheral mononuclear blood cells, the distribution of EhCRT and C1q is clearly over the surface membrane of trophozoites. Nevertheless, the level of expression of CRT in situ in lesions of amoebic liver abscess (ALA in the hamster model is different in both Entamoeba species; this molecule is expressed in higher levels in E. histolytica than in E. dispar. This result suggests that EhCRT may modulate some functions during the early moments of the host-parasite relationship.

  3. Enterococcus faecalis phosphomevalonate kinase.

    Science.gov (United States)

    Doun, Stephanie S; Burgner, John W; Briggs, Scott D; Rodwell, Victor W

    2005-05-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone DNA thought to encode phosphomevalonate kinase into pET28b(+). Double-stranded DNA sequencing verified the sequence of the recombinant gene. The encoded N-terminal hexahistidine-tagged protein was expressed in Escherichia coli with induction by isopropylthiogalactoside and purified by Ni(++) affinity chromatography, yield 20 mg protein per liter. Analysis of the purified protein by MALDI-TOF mass spectrometry established it as E. faecalis phosphomevalonate kinase. Analytical ultracentrifugation revealed that the kinase exists in solution primarily as a dimer. Assay for phosphomevalonate kinase activity used pyruvate kinase and lactate dehydrogenase to couple the formation of ADP to the oxidation of NADH. Optimal activity occurred at pH 8.0 and at 37 degrees C. The activation energy was approximately 5.6 kcal/mol. Activity with Mn(++), the preferred cation, was optimal at about 4 mM. Relative rates using different phosphoryl donors were 100 (ATP), 3.6 (GTP), 1.6 (TTP), and 0.4 (CTP). K(m) values were 0.17 mM for ATP and 0.19 mM for (R,S)-5-phosphomevalonate. The specific activity of the purified enzyme was 3.9 micromol substrate converted per minute per milligram protein. Applications to an immobilized enzyme bioreactor and to drug screening and design are discussed.

  4. MEK kinases are regulated by EGF and selectively interact with Rac/Cdc42.

    Science.gov (United States)

    Fanger, G R; Johnson, N L; Johnson, G L

    1997-08-15

    MEK kinases (MEKKs) 1, 2, 3 and 4 are members of sequential kinase pathways that regulate MAP kinases including c-Jun NH2-terminal kinases (JNKs) and extracellular regulated kinases (ERKs). Confocal immunofluorescence microscopy of COS cells demonstrated differential MEKK subcellular localization: MEKK1 was nuclear and in post-Golgi vesicular-like structures; MEKK2 and 4 were localized to distinct Golgi-associated vesicles that were dispersed by brefeldin A. MEKK1 and 2 were activated by EGF, and kinase-inactive mutants of each MEKK partially inhibited EGF-stimulated JNK activity. Kinase-inactive MEKK1, but not MEKK2, 3 or 4, strongly inhibited EGF-stimulated ERK activity. In contrast to MEKK2 and 3, MEKK1 and 4 specifically associated with Rac and Cdc42 and kinase-inactive mutants blocked Rac/Cdc42 stimulation of JNK activity. Inhibitory mutants of MEKK1-4 did not affect p21-activated kinase (PAK) activation of JNK, indicating that the PAK-regulated JNK pathway is independent of MEKKs. Thus, in different cellular locations, specific MEKKs are required for the regulation of MAPK family members, and MEKK1 and 4 are involved in the regulation of JNK activation by Rac/Cdc42 independent of PAK. Differential MEKK subcellular distribution and interaction with small GTP-binding proteins provides a mechanism to regulate MAP kinase responses in localized regions of the cell and to different upstream stimuli.

  5. Plant phosphatidylinositol 3-kinase

    NARCIS (Netherlands)

    Lee, Y.; Munnik, T.; Munnik, T.

    2010-01-01

    Phosphatidylinositol 3-kinase (PI3K) phosphorylates the D-3 position of phosphoinositides. In Arabidopsis, only one PI3K exists, which belongs to the class-III PI3K subfamily which makes phosphatidylinositol 3-phosphate (PtdIns3P). The single AtPI3K gene is essential for survival, since loss of its

  6. Rho-kinase limits FGF-2-stimulated VEGF release in osteoblasts.

    Science.gov (United States)

    Natsume, Hideo; Tokuda, Haruhiko; Adachi, Seiji; Takai, Shinji; Matsushima-Nishiwaki, Rie; Kato, Kenji; Minamitani, Chiho; Niida, Shunpei; Mizutani, Jun; Kozawa, Osamu; Otsuka, Takanobu

    2010-04-01

    We previously reported that basic fibroblast growth factor (FGF-2) stimulates the release of vascular endothelial growth factor (VEGF) via p44/p42 mitogen-activated protein (MAP) kinase and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) in osteoblast-like MC3T3-E1 cells and that FGF-2-activated p38 MAP kinase negatively regulates the VEGF release in osteoblast-like MC3T3-E1 cells. In the present study, we investigated whether Rho-kinase is involved in FGF-2-stimulated VEGF release in MC3T3-E1 cells. FGF-2 induced the phosphorylation of myosin phosphatase targeting subunit (MYPT-1), a substrate of Rho-kinase. Y27632, a specific inhibitor of Rho-kinase, which attenuated the MYPT-1 phosphorylation, significantly enhanced the FGF-2-stimulated VEGF release. Fasudil, another Rho-kinase inhibitor, also amplified the VEGF release. FGF-2 significantly stimulated VEGF accumulation and fasudil enhanced FGF-2-stimulated VEGF accumulation also in whole cell lysates. Neither Y27632 nor fasudil affected the phosphorylation levels of p44/p42 MAP kinase or p38 MAP kinase. Y27632 and fasudil markedly strengthened the FGF-2-induced phosphorylation of SAPK/JNK. Y27632 as well as fasudil enhanced FGF-2-stimulated VEGF release and Y27632 enhanced the FGF-2-induced phosphorylation levels of SAPK/JNK also in human osteoblasts. These results strongly suggest that Rho-kinase negatively regulates FGF-2-stimulated VEGF release in osteoblasts.

  7. Triptolide down-regulates COX-2 expression and PGE2 release by suppressing the activity of NF-κB and MAP kinases in lipopolysaccharide-treated PC12 cells.

    Science.gov (United States)

    Geng, Yu; Fang, Marong; Wang, Jing; Yu, Haiyan; Hu, Zhiying; Yew, David T; Chen, Wei

    2012-03-01

    As an active compound extracted from the Chinese herb Tripterygium wilfordii, triptolide (TP) was demonstrated to have potent antiinflammatory and immunosuppressive properties in previous studies. Recently, it has been shown that TP prevented the loss of dopaminergic neurons in the substantia nigra of rats in a model of Parkinson's disease, but little is known about the precise neuroprotective mechanism of TP. This study was designed to elucidate whether the neuroprotective effect of TP is partially based on its direct inhibition of inflammatory molecules by investigating the effects of TP on the expression of cyclooxygenase (COX)-2 and prostaglandin E2 (PGE2) related to the nuclear factor (NF)-κB pathway in lipopolysaccharide (LPS)-stimulated PC12 cells. The activation of related upstream molecules such as NF-κB, P38, extracellular signal-regulated kinase (ERK)1/2, and beta-alanyl-alpha-ketoglutarate transaminase (AKT), in PC12 cells were investigated by real time polymerase chain reaction (PCR), western blotting and enzyme-linked immunosorbent assay (ELISA). Our results showed that TP directly inhibited the expression of both mRNA and protein of COX-2 (p < 0.01), decreased PGE2 production (p < 0.01) in a dose-dependent manner, down-regulated NF-κB activity (p < 0.01), and significantly inhibited the phosphorylation of p38, ERK1/2 (p42/p44) and AKT in PC12 cells after LPS challenge. This suggests that the neuroprotective effects of TP may be partially mediated by direct inhibition of the expression of COX-2, activation of NF-κB, and phosphorylation of p38, ERK1/2 (p42/p44) and AKT proteins of neuronal cells.

  8. IL-1β activates p44/42 and p38 mitogen-activated protein kinases via different pathways in cat esophageal smooth muscle cells

    Institute of Scientific and Technical Information of China (English)

    Tai Sang Lee; Hyun Ju Song; Ji Hoon Jeong; Young Sil Min; Chang Yell Shin; Uy Dong Sohn

    2006-01-01

    AIM: To examine the pathway related to the IL-1β-induced activation of mitogen-activated protein (MAP)kinases in cat esophageal smooth muscle cells.METHODS: Culture of the esophageal smooth muscle cells from cat was prepared. Specific inhibitors were treated before applying the IL-1β. Western blot analysis was performed to detect the expressions of COX, iNOS and MAP kinases.RESULTS: In the primary cultured cells, although IL-1βfailed to upregulate the COX and iNOS levels, the levels of the phosphorylated forms of p44/42 MAP kinase and p38 MAP klnase increased in both concentration- and time-dependent manner, of which the level of activation reached a maximum within 3 and 18 h, respectively.The pertussis toxin reduced the level of p44/42 MAP kinase phosphorylation. Tyrphostin 51 and genistein also inhibited this activation. Neomycin decreased the density of the p44/42 MAP kinase band to the basal level.Phosphokinase C (PKC) was found to play a mediating role in the IL-1β-induced p44/42 MAP kinase activity.In contrast, the activation of p38 MAP kinase was inhibited only by a pretreatment with forskolin, and was unaffected by the other compounds.CONCLUSION: Based on these results, IL-1β-Induced p44/42 MAP kinase activation is mediated by the Gi protein, tyrosine kinase, phospholipase C (PLC) and PKC. The pathway for p38 MAP kinase phosphorylation is different from that of p44/42 MAP kinase, suggesting that it plays a different role in the cellular response to IL-1β.

  9. Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation

    Science.gov (United States)

    Lorenzen, Stephan; Schuldt, Kathrin; Bernin, Hannah; Zaruba, Mareen; Lender, Corinna; Ittrich, Harald; Roeder, Thomas; Tannich, Egbert; Lotter, Hannelore; Bruchhaus, Iris

    2016-01-01

    We here compared pathogenic (p) and non-pathogenic (np) isolates of Entamoeba histolytica to identify molecules involved in the ability of this parasite to induce amoebic liver abscess (ALA)-like lesions in two rodent models for the disease. We performed a comprehensive analysis of 12 clones (A1–A12) derived from a non-pathogenic isolate HM-1:IMSS-A and 12 clones (B1–B12) derived from a pathogenic isolate HM-1:IMSS-B. “Non-pathogenicity” included the induction of small and quickly resolved lesions while “pathogenicity” comprised larger abscess development that overstayed day 7 post infection. All A-clones were designated as non-pathogenic, whereas 4 out of 12 B-clones lost their ability to induce ALAs in gerbils. No correlation between ALA formation and cysteine peptidase (CP) activity, haemolytic activity, erythrophagocytosis, motility or cytopathic activity was found. To identify the molecular framework underlying different pathogenic phenotypes, three clones were selected for in-depth transcriptome analyses. Comparison of a non-pathogenic clone A1np with pathogenic clone B2p revealed 76 differentially expressed genes, whereas comparison of a non-pathogenic clone B8np with B2p revealed only 19 differentially expressed genes. Only six genes were found to be similarly regulated in the two non-pathogenic clones A1np and B8np in comparison with the pathogenic clone B2p. Based on these analyses, we chose 20 candidate genes and evaluated their roles in ALA formation using the respective gene-overexpressing transfectants. We conclude that different mechanisms lead to loss of pathogenicity. In total, we identified eight proteins, comprising a metallopeptidase, C2 domain proteins, alcohol dehydrogenases and hypothetical proteins, that affect the pathogenicity of E. histolytica. PMID:27575775

  10. Mixed Lineage Kinase 3 negatively regulates IKK activity and enhances etoposide-induced cell death

    OpenAIRE

    Cole, Eric T.; Zhan, Yu; Abi Saab, Widian F.; Korchnak, Amanda C.; Ashburner, Brian P.; Chadee, Deborah N.

    2009-01-01

    Mixed Lineage Kinase 3 (MLK3) is a mitogen activated protein kinase kinase kinase (MAP3K) that activates multiple MAPK signaling pathways. Nuclear factor kappa B (NF-κB) is a transcription factor that has important functions in inflammation, immunity and cell survival. We found that silencing mlk3 expression with RNA interference (RNAi) in SKOV3 human ovarian cancer epithelial cells and NIH-3T3 murine fibroblasts led to a reduction in the level of the inhibitor of kappa B alpha (IκBα) protein...

  11. Glucose, other secretagogues, and nerve growth factor stimulate mitogen-activated protein kinase in the insulin-secreting beta-cell line, INS-1

    DEFF Research Database (Denmark)

    Frödin, M; Sekine, N; Roche, E;

    1995-01-01

    converge to activate 44-kDa mitogen-activated protein (MAP) kinase. Thus, glucose-induced insulin secretion was found to be associated with a small stimulatory effect on 44-kDa MAP kinase, which was synergistically enhanced by increased levels of intracellular cAMP and by the hormonal secretagogues...... glucagon-like peptide-1 and pituitary adenylate cyclase-activating polypeptide. Activation of 44-kDa MAP kinase by glucose was dependent on Ca2+ influx and may in part be mediated by MEK-1, a MAP kinase kinase. Stimulation of Ca2+ influx by KCl was in itself sufficient to activate 44-kDa MAP kinase and MEK......-1. Phorbol ester, an activator of protein kinase C, stimulated 44-kDa MAP kinase by both Ca(2+)-dependent and -independent pathways. Nerve growth factor, independently of changes in cytosolic Ca2+, efficiently stimulated 44-kDa MAP kinase without causing insulin release, indicating that activation...

  12. Tyrosine kinases in rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Kobayashi Akiko

    2011-08-01

    Full Text Available Abstract Rheumatoid arthritis (RA is an inflammatory, polyarticular joint disease. A number of cellular responses are involved in the pathogenesis of rheumatoid arthritis, including activation of inflammatory cells and cytokine expression. The cellular responses involved in each of these processes depends on the specific signaling pathways that are activated; many of which include protein tyrosine kinases. These pathways include the mitogen-activated protein kinase pathway, Janus kinases/signal transducers and activators transcription pathway, spleen tyrosine kinase signaling, and the nuclear factor κ-light-chain-enhancer of activated B cells pathway. Many drugs are in development to target tyrosine kinases for the treatment of RA. Based on the number of recently published studies, this manuscript reviews the role of tyrosine kinases in the pathogenesis of RA and the potential role of kinase inhibitors as new therapeutic strategies of RA.

  13. Enterococcus faecalis phosphomevalonate kinase

    OpenAIRE

    Doun, Stephanie S.; Burgner, John W.; Briggs, Scott D.; Rodwell, Victor W.

    2005-01-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone D...

  14. Oncoprotein protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Karin, Michael (San Diego, CA); Hibi, Masahiko (San Diego, CA); Lin, Anning (La Jolla, CA); Davis, Roger (Princeton, MA); Derijard, Benoit (Shrewsbury, MA)

    2003-02-04

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  15. Function and interaction of maturation-promoting factor and mitogen-activated protein kinase during meiotic maturation and fertilization of oocyte

    Institute of Scientific and Technical Information of China (English)

    HUO Lijun; FAN Hengyu; CHEN Dayuan; SUN Qingyuan

    2004-01-01

    Mitogen-activated protein kinase (MAP kinase) cascade and maturation-promoting factor (MPF) play very important roles during meiotic maturation and fertilization of oocyte. Interaction between MAP kinase and MPF influences meiotic maturation and fertilization of oocyte throughout the animal kingdom, including stimulation of germinal vesicle breakdown (GVBD), suppression of DNA replication, control of meiotic chromosome segregation, maintenance of metaphase II arrest, and resumption and completion of second meiosis. This review focuses on the function and interaction of MAP kinase and MPF during meiotic maturation and fertilization of oocyte.

  16. Different roles for non-receptor tyrosine kinases in arachidonate release induced by zymosan and Staphylococcus aureus in macrophages

    Directory of Open Access Journals (Sweden)

    Sundler Roger

    2006-05-01

    Full Text Available Abstract Background Yeast and bacteria elicit arachidonate release in macrophages, leading to the formation of leukotrienes and prostaglandins, important mediators of inflammation. Receptors recognising various microbes have been identified, but the signalling pathways are not entirely understood. Cytosolic phospholipase A2 is a major down-stream target and this enzyme is regulated by both phosphorylation and an increase in intracellular Ca2+. Potential signal components are MAP kinases, phosphatidylinositol 3-kinase and phospholipase Cγ2. The latter can undergo tyrosine phosphorylation, and Src family kinases might carry out this phosphorylation. Btk, a Tec family kinase, could also be important. Our aim was to further elucidate the role of Src family kinases and Btk. Methods Arachidonate release from murine peritoneal macrophages was measured by prior radiolabeling. Furthermore, immunoprecipitation and Western blotting were used to monitor changes in activity/phosphorylation of intermediate signal components. To determine the role of Src family kinases two different inhibitors with broad specificity (PP2 and the Src kinase inhibitor 1, SKI-1 were used as well as the Btk inhibitor LFM-A13. Results Arachidonate release initiated by either Staphylococcus aureus or yeast-derived zymosan beads was shown to depend on members of the Src kinase family as well as Btk. Src kinases were found to act upstream of Btk, phosphatidylinositol 3-kinase, phospholipase Cγ2 and the MAP kinases ERK and p38, thereby affecting all branches of the signalling investigated. In contrast, Btk was not involved in the activation of the MAP-kinases. Since the cytosolic phospholipase A2 in macrophages is regulated by both phosphorylation (via ERK and p38 and an increase in intracellular Ca2+, we propose that members of the Src kinase family are involved in both types of regulation, while the role of Btk may be restricted to the latter type. Conclusion Arachidonate release

  17. Genetic Mapping

    Science.gov (United States)

    ... Fact Sheets Fact Sheets En Español: Mapeo Genético Genetic Mapping What is genetic mapping? How do researchers create ... genetic map? What are genetic markers? What is genetic mapping? Among the main goals of the Human Genome ...

  18. Regulation of Autophagy by Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Sridharan, Savitha; Jain, Kirti; Basu, Alakananda, E-mail: alakananda.basu@unthsc.edu [Department of Molecular Biology and Immunology, Institute for Cancer Research, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-06-09

    Autophagy is a process of self-degradation that maintains cellular viability during periods of metabolic stress. Although autophagy is considered a survival mechanism when faced with cellular stress, extensive autophagy can also lead to cell death. Aberrations in autophagy are associated with several diseases, including cancer. Therapeutic exploitation of this process requires a clear understanding of its regulation. Although the core molecular components involved in the execution of autophagy are well studied there is limited information on how cellular signaling pathways, particularly kinases, regulate this complex process. Protein kinases are integral to the autophagy process. Atg1, the first autophagy-related protein identified, is a serine/threonine kinase and it is regulated by another serine/threonine kinase mTOR. Emerging studies suggest the participation of many different kinases in regulating various components/steps of this catabolic process. This review focuses on the regulation of autophagy by several kinases with particular emphasis on serine/threonine protein kinases such as mTOR, AMP-activated protein kinase, Akt, mitogen-activated protein kinase (ERK, p38 and JNK) and protein kinase C that are often deregulated in cancer and are important therapeutic targets.

  19. Rapid Identification of Protein Kinase Phosphorylation Site Motifs Using Combinatorial Peptide Libraries.

    Science.gov (United States)

    Miller, Chad J; Turk, Benjamin E

    2016-01-01

    Eukaryotic protein kinases phosphorylate substrates at serine, threonine, and tyrosine residues that fall within the context of short sequence motifs. Knowing the phosphorylation site motif for a protein kinase facilitates designing substrates for kinase assays and mapping phosphorylation sites in protein substrates. Here, we describe an arrayed peptide library protocol for rapidly determining kinase phosphorylation consensus sequences. This method uses a set of peptide mixtures in which each of the 20 amino acid residues is systematically substituted at nine positions surrounding a central site of phosphorylation. Peptide mixtures are arrayed in multiwell plates and analyzed by radiolabel assay with the kinase of interest. The preferred sequence is determined from the relative rate of phosphorylation of each peptide in the array. Consensus peptides based on these sequences typically serve as efficient and specific kinase substrates for high-throughput screening or incorporation into biosensors.

  20. Concept Maps

    OpenAIRE

    Schwendimann, Beat Adrian

    2014-01-01

    A concept map is a node-link diagram showing the semantic relationships among concepts. The technique for constructing concept maps is called "concept mapping". A concept map consists of nodes, arrows as linking lines, and linking phrases that describe the relationship between nodes. Two nodes connected with a labeled arrow are called a proposition. Concept maps are versatile graphic organizers that can represent many different forms of relationships between concepts. The relationship between...

  1. ProKinO: an ontology for integrative analysis of protein kinases in cancer.

    Directory of Open Access Journals (Sweden)

    Gurinder Gosal

    Full Text Available BACKGROUND: Protein kinases are a large and diverse family of enzymes that are genomically altered in many human cancers. Targeted cancer genome sequencing efforts have unveiled the mutational profiles of protein kinase genes from many different cancer types. While mutational data on protein kinases is currently catalogued in various databases, integration of mutation data with other forms of data on protein kinases such as sequence, structure, function and pathway is necessary to identify and characterize key cancer causing mutations. Integrative analysis of protein kinase data, however, is a challenge because of the disparate nature of protein kinase data sources and data formats. RESULTS: Here, we describe ProKinO, a protein kinase-specific ontology, which provides a controlled vocabulary of terms, their hierarchy, and relationships unifying sequence, structure, function, mutation and pathway information on protein kinases. The conceptual representation of such diverse forms of information in one place not only allows rapid discovery of significant information related to a specific protein kinase, but also enables large-scale integrative analysis of protein kinase data in ways not possible through other kinase-specific resources. We have performed several integrative analyses of ProKinO data and, as an example, found that a large number of somatic mutations (∼288 distinct mutations associated with the haematopoietic neoplasm cancer type map to only 8 kinases in the human kinome. This is in contrast to glioma, where the mutations are spread over 82 distinct kinases. We also provide examples of how ontology-based data analysis can be used to generate testable hypotheses regarding cancer mutations. CONCLUSION: We present an integrated framework for large-scale integrative analysis of protein kinase data. Navigation and analysis of ontology data can be performed using the ontology browser available at: http://vulcan.cs.uga.edu/prokino.

  2. Commitment to the CD4 lineage mediated by extracellular signal-related kinase mitogen-activated protein kinase and lck signaling.

    Science.gov (United States)

    Sharp, L L; Hedrick, S M

    1999-12-15

    The development of T cells results in a concordance between the specificity of the TCR for MHC class I and class II molecules and the expression of CD8 and CD4 coreceptors. Based on analogy to simple metazoan models of organ development and lineage commitment, we sought to determine whether extracellular signal-related kinase (Erk) mitogen-activated protein (MAP) kinase pathway signaling acts as an inductive signal for the CD4 lineage. Here, we show that, by altering the intracellular signaling involving the Erk/MAP kinase pathway, T cells with specificity for MHC class I can be diverted to express CD4, and, conversely, T cells with specificity for MHC class II can be diverted to express CD8. Furthermore, we find that activation of the src-family tyrosine kinase, p56lck is an upstream mediator of lineage commitment. These results suggest a simple mechanism for lineage commitment in T cell development.

  3. A genomic island present along the bacterial chromosome of the Parachlamydiaceae UWE25, an obligate amoebal endosymbiont, encodes a potentially functional F-like conjugative DNA transfer system

    Directory of Open Access Journals (Sweden)

    Guy Lionel

    2004-12-01

    Parachlamydiaceae and Chlamydiaceae, when the Parachlamydia-related symbiont was an intracellular bacteria. It suggests that this heterologous DNA was acquired from a phylogenetically-distant bacteria sharing an amoebal vacuole. Since Parachlamydiaceae are emerging agents of pneumonia, this GI might be involved in pathogenicity. In future, conjugative systems might be developed as genetic tools for Chlamydiales.

  4. Phosphatidylinositol 3-kinase in myogenesis.

    Science.gov (United States)

    Kaliman, P; Zorzano, A

    1997-08-01

    Phosphatidylinositol 3-kinase (PI 3-kinase) has been cloned and characterized in a wide range of organisms. PI 3-kinases are activated by a diversity of extracellular stimuli and are involved in multiple cell processes such as cell proliferation, protein trafficking, cell motility, differentiation, regulation of cytoskeletal structure, and apoptosis. It has recently been shown that PI 3-kinase is a crucial second messenger in the signaling of myogenesis. Two structurally unrelated highly specific inhibitors of PI 3-kinase-wortmannin and LY294002-block the morphological and biochemical differentiation program of different skeletal-muscle cell models. Moreover, L6E9 myoblasts overexpressing a dominant-negative mutant of PI 3-kinase p85 regulatory subunit (Δp85) are unable to differentiate. Furthermore, PI 3-kinase is specifically involved in the insulinlike growth factor (IGF)-dependent myogenic pathway. Indeed, the ability of IGF-I, des-1,3-IGF-I, and IGF-II to promote cell fusion and muscle-specific protein expression is impaired after treatment with PI 3-kinase inhibitors or in cells overexpressing Δp85. The identification of additional key downstream elements of the IGF/PI 3-kinase myogenic cascade is crucial to a detailed understanding of the process of muscle differentiation and may generate new tools for skeletal and cardiac muscle regeneration therapies. (Trends Cardiovasc Med 1997;7:198-202). © 1997, Elsevier Science Inc.

  5. LmxMPK4, an essential mitogen-activated protein kinase of Leishmania mexicana is phosphorylated and activated by the STE7-like protein kinase LmxMKK5

    DEFF Research Database (Denmark)

    John von Freyend, Simona; Rosenqvist, Heidi; Fink, Annette

    2010-01-01

    The essential mitogen-activated protein kinase (MAP kinase), LmxMPK4, of Leishmania mexicana is minimally active when purified following recombinant expression in Escherichia coli and was therefore unsuitable for drug screening until now. Using an E. coli protein co-expression system we identifie...... for new therapeutic drugs against leishmaniasis....

  6. Salmonella induces SRC protein tyrosine kinase, c-Jun N-terminal kinase (JNK), and NF-kappaBp65 signaling pathways in commercial and wild-type turkey leukocytes

    Science.gov (United States)

    Previous studies comparing signaling in wild-type turkey (WT) leukocytes and commercial turkey (CT) leukocytes found that the activity of protein tyrosine kinases and MAP kinases, ERK 1/2 and p38, were significantly higher in WT leukocytes compared to CT lines upon exposure to both SE and OPSE on d...

  7. Germinal-center kinase-like kinase co-crystal structure reveals a swapped activation loop and C-terminal extension.

    Science.gov (United States)

    Marcotte, Douglas; Rushe, Mia; M Arduini, Robert; Lukacs, Christine; Atkins, Kateri; Sun, Xin; Little, Kevin; Cullivan, Michael; Paramasivam, Murugan; Patterson, Thomas A; Hesson, Thomas; D McKee, Timothy; May-Dracka, Tricia L; Xin, Zhili; Bertolotti-Ciarlet, Andrea; Bhisetti, Govinda R; Lyssikatos, Joseph P; Silvian, Laura F

    2017-02-01

    Germinal-center kinase-like kinase (GLK, Map4k3), a GCK-I family kinase, plays multiple roles in regulating apoptosis, amino acid sensing, and immune signaling. We describe here the crystal structure of an activation loop mutant of GLK kinase domain bound to an inhibitor. The structure reveals a weakly associated, activation-loop swapped dimer with more than 20 amino acids of ordered density at the carboxy-terminus. This C-terminal PEST region binds intermolecularly to the hydrophobic groove of the N-terminal domain of a neighboring molecule. Although the GLK activation loop mutant crystallized demonstrates reduced kinase activity, its structure demonstrates all the hallmarks of an "active" kinase, including the salt bridge between the C-helix glutamate and the catalytic lysine. Our compound displacement data suggests that the effect of the Ser170Ala mutation in reducing kinase activity is likely due to its effect in reducing substrate peptide binding affinity rather than reducing ATP binding or ATP turnover. This report details the first structure of GLK; comparison of its activation loop sequence and P-loop structure to that of Map4k4 suggests ideas for designing inhibitors that can distinguish between these family members to achieve selective pharmacological inhibitors.

  8. P38促细胞分裂蛋白酶活性抑制剂的分子对接及3D-QSAR研究%Docking and 3D-QSAR study on p38α MAP kinase inhibitors

    Institute of Scientific and Technical Information of China (English)

    沈勇; 王源丰; 吴景恒; 肖利民

    2012-01-01

    运用分子对接方法研究了26个以嘧啶基咪唑环为基底的一系列同源化合物与p38促细胞分裂蛋白酶晶体结构的结合模式.采用比较分子力场分析法(CoMFA)对选取的对接优势构象进行三维定量构效关系(3D-QSAR)研究.建立了3D-QSAR的CoMFA模型,其非交叉验证系数r2为0.986,交叉验证相关系数q2为0.755,外部验证的标准偏差(SD)为0.13,表明该模型合理、可信,并具有良好的预测能力.有趣的是, 配体与活性周围氨基酸残基4个距离之和与其活性之间具有良好的线性关系(R2=0.752),揭示了配体分子大小及与氨基酸残基结合的紧密程度对化合物的抑制活性起着主要的作用.最后,根据研究总结的规律设计了4个具有潜在高活性的嘧啶基咪唑衍生物.研究结果可为实验工作者合成新药提供理论有意义的理论参考.%A series of 26 pyridinylimidazole derivatives were docked to the X-ray structure of p38α MAP kinase,and their best docking conformations were analyzed by three-dimensional quantitative structure-activity relationship (3D-QSAR) studies.A robust 3D-QSAR model with high correlation coefficient (r2=0.986) and cross-validation coefficient (q2=0.755) has been established by comparative molecular field analysis (CoMFA).An external validation by the compounds with high activities shows the standard deviation (SD) between experimental and predicted pIC50 values is 0.13.Docking results show that different binding modes of pyridinylimidazole derivatives have a great impact on the inhibitory activity of inhibitors.Interestingly,the summation of the four distances measuring the interaction between the ligands and the protein show a good linear relation (R2 =0.752) with the inhibitory activity of the compounds.Finally,four new pyridinylimidazole derivatives with potent high p38α MAP kinase inhibitory activity have been theoretically designed.

  9. Map Projection

    CERN Document Server

    Ghaderpour, Ebrahim

    2014-01-01

    In this paper, we introduce some known map projections from a model of the Earth to a flat sheet of paper or map and derive the plotting equations for these projections. The first fundamental form and the Gaussian fundamental quantities are defined and applied to obtain the plotting equations and distortions in length, shape and size for some of these map projections.

  10. Topographic mapping

    Science.gov (United States)

    ,

    2008-01-01

    The U.S. Geological Survey (USGS) produced its first topographic map in 1879, the same year it was established. Today, more than 100 years and millions of map copies later, topographic mapping is still a central activity for the USGS. The topographic map remains an indispensable tool for government, science, industry, and leisure. Much has changed since early topographers traveled the unsettled West and carefully plotted the first USGS maps by hand. Advances in survey techniques, instrumentation, and design and printing technologies, as well as the use of aerial photography and satellite data, have dramatically improved mapping coverage, accuracy, and efficiency. Yet cartography, the art and science of mapping, may never before have undergone change more profound than today.

  11. ERK kinases modulate the activation of PI3 kinase related kinases (PIKKs) in DNA damage response.

    Science.gov (United States)

    Lin, Xiaozeng; Yan, Judy; Tang, Damu

    2013-12-01

    DNA damage response (DDR) is the critical surveillance mechanism in maintaining genome integrity. The mechanism activates checkpoints to prevent cell cycle progression in the presence of DNA lesions, and mediates lesion repair. DDR is coordinated by three apical PI3 kinase related kinases (PIKKs), including ataxia-telangiectasia mutated (ATM), ATM- and Rad3-related (ATR), and DNA-PKcs (the catalytic subunit of the DNA dependent protein kinase). These kinases are activated in response to specific DNA damage or lesions, resulting in checkpoint activation and DNA lesion repair. While it is clear that the pathways of ATM, ATR, and DNA-PK are the core components of DDR, there is accumulating evidence revealing the involvement of other cellular pathways in regulating DDR; this is in line with the concept that in addition to being a nuclear event DDR is also a cellular process. One of these pathways is the extracellular signal-regulated kinase (ERK) MAPK (mitogen-activated protein kinase) pathway. ERK is a converging point of multiple signal transduction pathways involved in cell proliferation, differentiation, and apoptosis. Adding to this list of pathways is the recent development of ERK in DDR. The ERK kinases (ERK1 and ERK2) contribute to the proper execution of DDR in terms of checkpoint activation and the repair of DNA lesions. This review summarizes the contributions of ERK to DDR with emphasis on the relationship of ERK kinases with the activation of ATM, ATR, and DNA-PKcs.

  12. Identification of Differentially Expressed Kinase and Screening Potential Anticancer Drugs in Papillary Thyroid Carcinoma

    Science.gov (United States)

    Zhang, Huairong

    2016-01-01

    Aim. We aim to identify protein kinases involved in the pathophysiology of papillary thyroid carcinoma (PTC) in order to provide potential therapeutic targets for kinase inhibitors and unfold possible molecular mechanisms. Materials and Methods. The gene expression profile of GSE27155 was analyzed to identify differentially expressed genes and mapped onto human protein kinases database. Correlation of kinases with PTC was addressed by systematic literature search, GO and KEGG pathway analysis. Results. The functional enrichment analysis indicated that “mitogen-activated protein kinases pathway” expression was extremely enriched, followed by “neurotrophin signaling pathway,” “focal adhesion,” and “GnRH signaling pathway.” MAPK, SRC, PDGFRa, ErbB, and EGFR were significantly regulated to correct these pathways. Kinases investigated by the literature on carcinoma were considered to be potential novel molecular therapeutic target in PTC and application of corresponding kinase inhibitors could be possible therapeutic tool. Conclusion. SRC, MAPK, and EGFR were the most important differentially expressed kinases in PTC. Combined inhibitors may have high efficacy in PTC treatment by targeting these kinases. PMID:27703281

  13. Cyclic AMP activates the mitogen-activated protein kinase cascade in PC12 cells

    DEFF Research Database (Denmark)

    Frödin, M; Peraldi, P; Van Obberghen, E

    1994-01-01

    Mitogen-activated protein (MAP) kinases are activated in response to a large variety of extracellular signals, including growth factors, hormones, and neurotransmitters, which activate distinct intracellular signaling pathways. Their activation by the cAMP-dependent pathway, however, has not been...... reported. In rat pheochromocytoma PC12 cells, we demonstrate here a stimulation of the MAP kinase isozyme extracellular signal-regulated kinase 1 (ERK1) following elevation of intracellular cAMP after exposure of the cells to isobutylmethylxanthine, cholera toxin, forskolin, or cAMP-analogues. cAMP acted...... synergistically with phorbol ester, an activator of protein kinase C, in the stimulation of ERK1. In accordance with this observation, the peptide neurotransmitter pituitary adenylate cyclase-activating polypeptide 38 (PACAP38), which stimulates cAMP production as well as phosphatidylinositol breakdown in PC12...

  14. Kinase regulation by sulfur and selenium containing compounds.

    Science.gov (United States)

    Sanmartín, Carmen; Plano, Daniel; Font, María; Palop, Juan Antonio

    2011-05-01

    Kinases are enzymes that are involved in a wide-range of cellular targets such as cell proliferation, metabolism, survival and apoptosis. Aberrations in the activity of the kinases have been linked to many human diseases such as diabetes, inflammation and cancer. The discovery of more than 518 kinases encoded by the human genome has spurred the development of rapid screening techniques for potential drugs against these enzymes and these have been identified as interesting targets for medicinal chemistry programs, especially in cancer therapy. On the other hand, sulfur and selenium have been increasingly recognized as essential elements in biology and medicine. Converging data from epidemiological and clinical studies have highlighted these elements as effective chemopreventive agents, particularly against various types of cancer (prostate, lung, breast, leukemia, colon, skin, lymphome, thyroid, pancreas, liver). These elements act through a wide range of potential mechanisms where one identified signal pathway event is kinase modulation, which is common for the two elements and emerges as a valid target. The kinases modulated by sulfur and selenium derivatives include MAP, ERK, JNK, Akt, Cdc2, Cyclin B1 and Cdc25c amongst others. Although both of the elements in question are in the same group in the periodic table and have similar biochemistries, there are relevant differences related to redox potentials, stabilities, oxidation states and anticancer activity. Literature data suggest that the replacement of sulfur by selenium in established cancer chemopreventive agents results in more effective chemopreventive analogs. In view of the multi-target kinase mechanisms in preventing cellular transformation, as well as the differences and similarities between them, in this review we focus on the development of new structures that contain selenium and/or sulfur and discuss our understanding of the regulation of antitumoral effects with emphasis on kinase modulation

  15. RhoA/phosphatidylinositol 3-kinase/protein kinase B/mitogen-activated protein kinase signaling after growth arrest-specific protein 6/mer receptor tyrosine kinase engagement promotes epithelial cell growth and wound repair via upregulation of hepatocyte growth factor in macrophages.

    Science.gov (United States)

    Lee, Ye-Ji; Park, Hyun-Jung; Woo, So-Youn; Park, Eun-Mi; Kang, Jihee Lee

    2014-09-01

    Growth arrest-specific protein 6 (Gas6)/Mer receptor tyrosine kinase (Mer) signaling modulates cytokine secretion and helps to regulate the immune response and apoptotic cell clearance. Signaling pathways that activate an epithelial growth program in macrophages are still poorly defined. We report that Gas6/Mer/RhoA signaling can induce the production of epithelial growth factor hepatic growth factor (HGF) in macrophages, which ultimately promotes epithelial cell proliferation and wound repair. The RhoA/protein kinase B (Akt)/mitogen-activated protein (MAP) kinases, including p38 MAP kinase, extracellular signal-regulated protein kinase, and Jun NH2-terminal kinase axis in RAW 264.7 cells, was identified as Gas6/Mer downstream signaling pathway for the upregulation of HGF mRNA and protein. Conditioned medium from RAW 264.7 cells that had been exposed to Gas6 or apoptotic cells enhanced epithelial cell proliferation of the epithelial cell line LA-4 and wound closure. Cotreatment with an HGF receptor-blocking antibody or c-Met antagonist downregulated this enhancement. Inhibition of Mer with small interfering RNA (siRNA) or the RhoA/Rho kinase pathway by RhoA siRNA or Rho kinase pharmacologic inhibitor suppressed Gas6-induced HGF mRNA and protein expression in macrophages and blocked epithelial cell proliferation and wound closure induced by the conditioned medium. Our data provide evidence that macrophages can be reprogrammed by Gas6 to promote epithelial proliferation and wound repair via HGF, which is induced by the Mer/RhoA/Akt/MAP kinase pathway. Thus, defects in Gas6/Mer/RhoA signaling in macrophages may delay tissue repair after injury to the alveolar epithelium.

  16. Suburban amoebiasis. CT and US findings and percutaneous treatment of amoebic liver abscess; Amebiasi sub-urbana: aspetti diagnostici con tomografia computerizzata ed ecografia e trattamento percutaneo degli ascessi amebici del fegato

    Energy Technology Data Exchange (ETDEWEB)

    Salzano, A.; De Rosa, A. [Ospedale Loreto Mare, Naples (Italy). Servizio di Radiologia; Rossi, E.; Carbone, M.; Mondillo, F. [Naples Univ. II, Naples (Italy).Dipt. di Scienze Biomorfologiche e Funzionali, Servizio di Diagnostica per Immagini; Tuccillo, M. [Azienda Ospedaliera di Rilievo Nazionale A. Cardarelli, Naples (Italy). Servizio di Radiologia; Capuano, N. [Ospedale Loreto Mare, Naples (Italy). Div. di Chirurgia; Nunziata, A. [Naples Univ. II, Naples (Italy). Ist. di Radiologia

    2000-03-01

    The study reports ultrasonography and computerise tomography findings in 16 patients with amoebic abscesses, 12 of whom lived in a temperate peripheral area north-east of Naples (Italy). All patients have a clinical-diagnostic condition called sub-urban amoebiasis. The personal experience with the US guided therapeutic drainage of amoebic abscess with repeated cavity washing, which is important for positive parasitology. Combined US and CT assessment facilitated the diagnosis of amoebiasis and its differentiation from pyogenic abscess and hepatoma. [Italian] La colonizzazione epatica rappresenta la localizzazione piu' comune dell'amebiasi extraintestinale e gli ascessi epatici ne costituiscono la manifestazione piu' frequente sviluppandosi nel 3-9 % dei pazienti affetti da infezione parassitaria. Diversi studi confermano che la terapia medica dell'amebiasi risulta piu' efficace quando viene associato il drenaggio percutaneo degli ascessi epatici con piu' rapida guarigione clinica e risposta favorevole dell'organismo. Scopo del presente lavoro e' di descrivere gli aspetti ecografici e di tomografia computerizzata degli ascessi amebici in un gruppo di 16 pazienti, 12 dei quali residenti in zona temperata e periferica di una vasta area a nord-est di Napoli presentandosi con caratteristico e raro quadro clinico-diagnostico definito amebiasi sub-urbana. Si discute infine l'esperienza personale del drenaggio terapeutico sotto guida ecografica dell'ascesso con tecnica del lavaggio ripetuto dalla cavita', importante ai fini della positivita' dell'esame. L'associazione dei reperti tipici ecografici e TC ha consentito la diagnosi agevole dell'amebiasi differenziandola dall'ascesso piogenico e dall'epatoma.

  17. Mapping Deeply

    OpenAIRE

    Denis Wood

    2015-01-01

    This is a description of an avant la lettre deep mapping project carried out by a geographer and a number of landscape architecture students in the early 1980s. Although humanists seem to take the “mapping” in deep mapping more metaphorically than cartographically, in this neighborhood mapping project, the mapmaking was taken literally, with the goal of producing an atlas of the neighborhood. In this, the neighborhood was construed as a transformer, turning the stuff of the world (gas, wate...

  18. Targeting Mitogen-Activated Protein Kinase Signaling in Mouse Models of Cardiomyopathy Caused by Lamin A/C Gene Mutations.

    Science.gov (United States)

    Muchir, Antoine; Worman, Howard J

    2016-01-01

    The most frequently occurring mutations in the gene encoding nuclear lamin A and nuclear lamin C cause striated muscle diseases virtually always involving the heart. In this review, we describe the approaches and methods used to discover that cardiomyopathy-causing lamin A/C gene mutations increase MAP kinase signaling in the heart and that this plays a role in disease pathogenesis. We review different mouse models of cardiomyopathy caused by lamin A/C gene mutations and how transcriptomic analysis of one model identified increased cardiac activity of the ERK1/2, JNK, and p38α MAP kinases. We describe methods used to measure the activity of these MAP kinases in mouse hearts and then discuss preclinical treatment protocols using pharmacological inhibitors to demonstrate their role in pathogenesis. Several of these kinase inhibitors are in clinical development and could potentially be used to treat human subjects with cardiomyopathy caused by lamin A/C gene mutations.

  19. Collection Mapping.

    Science.gov (United States)

    Harbour, Denise

    2002-01-01

    Explains collection mapping for library media collections. Discusses purposes for creating collection maps, including helping with selection and weeding decisions, showing how the collection supports the curriculum, and making budget decisions; and methods of data collection, including evaluating a collaboratively taught unit with the classroom…

  20. Affective Maps

    DEFF Research Database (Denmark)

    Salovaara-Moring, Inka

    of environmental knowledge production. It uses InfoAmazonia, the databased platform on Amazon rainforests, as an example of affective geo-visualization within information mapping that enhances embodiment in the experience of the information. Amazonia is defined as a digitally created affective (map)space within...

  1. Causal mapping

    DEFF Research Database (Denmark)

    Rasmussen, Lauge Baungaard

    2006-01-01

    The lecture note explains how to use the causal mapping method as well as the theoretical framework aoosciated to the method......The lecture note explains how to use the causal mapping method as well as the theoretical framework aoosciated to the method...

  2. MOLECULAR MODELING AND DRUG DISCOVERY OF POTENTIAL INHIBITORS FOR ANTICANCER TARGET GENE MELK (MATERNAL EMBRYONIC LEUCINE ZIPPER KINASE

    Directory of Open Access Journals (Sweden)

    Sabitha. K

    2011-12-01

    Full Text Available Maternal embryonic leucine zipper kinase (MELK, a member of the AMP serine/threonine kinase family, exhibits multiple features consistent with the potential utility of this gene as an anticancer target. Reports show that MELK functions as a cancer-specific protein kinase, and that down-regulation of MELK results in growth suppression of breast cancer cells. There are many inhibitors which bind to kinases and are in clinical trials too. In our study we have taken a library of different inhibitors and docked those using GLIDE Induced Fit. From docking result we can conclude that Syk inhibitor II, Rho kinase inhibitor IV, p38 MAP Kinase Inhibitor III, HA 1004, Dihydrochloride and IKK -2 inhibitor VI have good binding affinity towards MELK and may have anticancer activity.

  3. Checkpoint Kinases Regulate a Global Network of Transcription Factors in Response to DNA Damage

    Directory of Open Access Journals (Sweden)

    Eric J. Jaehnig

    2013-07-01

    Full Text Available DNA damage activates checkpoint kinases that induce several downstream events, including widespread changes in transcription. However, the specific connections between the checkpoint kinases and downstream transcription factors (TFs are not well understood. Here, we integrate kinase mutant expression profiles, transcriptional regulatory interactions, and phosphoproteomics to map kinases and downstream TFs to transcriptional regulatory networks. Specifically, we investigate the role of the Saccharomyces cerevisiae checkpoint kinases (Mec1, Tel1, Chk1, Rad53, and Dun1 in the transcriptional response to DNA damage caused by methyl methanesulfonate. The result is a global kinase-TF regulatory network in which Mec1 and Tel1 signal through Rad53 to synergistically regulate the expression of more than 600 genes. This network involves at least nine TFs, many of which have Rad53-dependent phosphorylation sites, as regulators of checkpoint-kinase-dependent genes. We also identify a major DNA damage-induced transcriptional network that regulates stress response genes independently of the checkpoint kinases.

  4. CALS Mapping

    DEFF Research Database (Denmark)

    Collin, Ib; Nielsen, Povl Holm; Larsen, Michael Holm

    1998-01-01

    To enhance the industrial applications of CALS, CALS Center Danmark has developed a cost efficient and transparent assessment, CALS Mapping, to uncover the potential of CALS - primarily dedicated to small and medium sized enterprises. The idea behind CALS Mapping is that the CALS State...... enterprise is, when applied in a given organisation modified with respect to the industry regarded, hence irrelevant measure parameters are eliminated to avoid redundancy. This assessment of CALS Mapping, quantify the CALS potential of an organisation with the purpose of providing decision support to the top...

  5. Mapping VADEMECUM

    OpenAIRE

    1992-01-01

    The work plan for the implementation of the Convention on Long-Range Transboundary Air Pollution under the UN Economic Commission for Europe (UN ECE) includes the production of maps of critical loads, critical levels, and exceedances as a basis for developing potential abatement strategies for sulphur and nitrogen. This Vademecum is designed to provide guidance to those responsible for calculating and mapping critical loads, critical levels, and exceedances on a national or regional scale. Th...

  6. Elevated transforming growth factor β and mitogen-activated protein kinase pathways mediate fibrotic traits of Dupuytren's disease fibroblasts

    Directory of Open Access Journals (Sweden)

    Krause Carola

    2011-06-01

    Full Text Available Abstract Background Dupuytren's disease is a fibroproliferative disorder of the palmar fascia. The treatment used to date has mostly been surgery, but there is a high recurrence rate. Transforming growth factor β (TGF-β has been implicated as a key stimulator of myofibroblast activity and fascial contraction in Dupuytren's disease. Results We studied Dupuytren's fibroblasts in tissues ex vivo and in cells cultured in vitro and found increased TGF-β expression compared to control fibroblasts. This correlated not only with elevated expression and activation of downstream Smad effectors but also with overactive extracellular signal-regulated kinase 1/2 (ERK1/2/mitogen-activated protein (MAP kinase signalling. Treatment with the TGF-β type I receptor kinase inhibitor SB-431542 and bone morphogenetic protein 6 (BMP6 led to inhibition of elevated Smad and ERK1/2/MAP kinase signalling as well as to inhibition of the increased contractility of Dupuytren's fibroblasts. BMP6 attenuated TGF-β expression in Dupuytren's fibroblasts, but not in control fibroblasts. Platelet-derived growth factor (PDGF expression was strongly promoted by TGF-β in Dupuytren's fibroblasts and was curbed by SB-431542 or BMP6 treatment. High basal expression of phosphorylated ERK1/2 MAP kinase and fibroproliferative markers was attenuated in Dupuytren's fibroblasts by a selective PDGF receptor kinase inhibitor. Cotreatment of Dupuytren's fibroblasts with SB-431542 and the mitogen-activated protein kinase kinase 1 inhibitor PD98059 was sufficient to abrogate proliferation and contraction of Dupuytren's fibroblasts. Conclusions Both TGF-β and ERK1/2 MAP kinase pathways cooperated in mediating the enhanced proliferation and high spontaneous contraction of Dupuytren's fibroblasts. Our data indicate that both signalling pathways are prime targets for the development of nonsurgical intervention strategies to treat Dupuytren's disease.

  7. Protein kinase C and extracellular signal-regulated kinase regulate movement, attachment, pairing and egg release in Schistosoma mansoni.

    Directory of Open Access Journals (Sweden)

    Margarida Ressurreição

    2014-06-01

    Full Text Available Protein kinases C (PKCs and extracellular signal-regulated kinases (ERKs are evolutionary conserved cell signalling enzymes that coordinate cell function. Here we have employed biochemical approaches using 'smart' antibodies and functional screening to unravel the importance of these enzymes to Schistosoma mansoni physiology. Various PKC and ERK isotypes were detected, and were differentially phosphorylated (activated throughout the various S. mansoni life stages, suggesting isotype-specific roles and differences in signalling complexity during parasite development. Functional kinase mapping in adult worms revealed that activated PKC and ERK were particularly associated with the adult male tegument, musculature and oesophagus and occasionally with the oesophageal gland; other structures possessing detectable activated PKC and/or ERK included the Mehlis' gland, ootype, lumen of the vitellaria, seminal receptacle and excretory ducts. Pharmacological modulation of PKC and ERK activity in adult worms using GF109203X, U0126, or PMA, resulted in significant physiological disturbance commensurate with these proteins occupying a central position in signalling pathways associated with schistosome muscular activity, neuromuscular coordination, reproductive function, attachment and pairing. Increased activation of ERK and PKC was also detected in worms following praziquantel treatment, with increased signalling associated with the tegument and excretory system and activated ERK localizing to previously unseen structures, including the cephalic ganglia. These findings support roles for PKC and ERK in S. mansoni homeostasis, and identify these kinase groups as potential targets for chemotherapeutic treatments against human schistosomiasis, a neglected tropical disease of enormous public health significance.

  8. The association of the JNK scaffold protein, WDR62, with the mixed lineage kinase 3, MLK3

    Directory of Open Access Journals (Sweden)

    Miriam Hadad

    2015-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs form a kinase tier module in which MAPK, MAP2K and MAP3K are held by scaffold proteins. The scaffold proteins serve as a protein platform for selective and spatial kinase activation. The precise mechanism by which the scaffold proteins function has not yet been fully explained. WD40-repeat protein 62, WDR62 is a novel scaffold protein of the c-Jun N-terminal kinase (JNK pathway. WDR62 is a 1523 a.a. long protein with no significant sequence homology to a known gene. Previously WDR62 was shown to associate with JNK and MKK4/7 in a modular fashion. Here, we show that WDR62 is able to associate with multiple members of the MAP3K of the mixed lineage kinase family and we map WDR62-MLK3 interacting domains. We identify two separable interacting domains within WDR62 and MLK3 proteins that can cross associate. MLK3 association with WDR62 is independent of JNK and MKK4/7 domains and activities. CDC42 activation disrupts WDR62-MLK3 association independent of MLK3 kinase activity.

  9. The frequencies and clinical implications of mutations in 33 kinase-related genes in locally advanced rectal cancer: a pilot study.

    LENUS (Irish Health Repository)

    Abdul-Jalil, Khairun I

    2014-08-01

    Locally advanced rectal cancer (LARC: T3\\/4 and\\/or node-positive) is treated with preoperative\\/neoadjuvant chemoradiotherapy (CRT), but responses are not uniform. The phosphatidylinositol 3-kinase (PI3K), MAP kinase (MAPK), and related pathways are implicated in rectal cancer tumorigenesis. Here, we investigated the association between genetic mutations in these pathways and LARC clinical outcomes.

  10. Interleukin-6-induced STAT3 transactivation and Ser(727) phosphorylation involves Vav, Rac-1 and the kinase SEK-1/MKK-4 as signal transduction components

    NARCIS (Netherlands)

    Schuringa, JJ; Jonk, LJC; Dokter, WHA; Vellenga, E; Kruijer, W

    2000-01-01

    In the present study, signal transducer and activator of transcription 3 (STAT3) Ser(727) phosphorylation and transactivation was investigated in relation to activation of mitogen-activated protein (MAP) kinase family members including extracellular-signal-regulated protein kinase (ERK)-1, c-Jun N-t

  11. Repulsive axon guidance by Draxin is mediated by protein Kinase B (Akt), glycogen synthase kinase-3β (GSK-3β) and microtubule-associated protein 1B.

    Science.gov (United States)

    Meli, Rajeshwari; Weisová, Petronela; Propst, Friedrich

    2015-01-01

    Draxin is an important axon guidance cue necessary for the formation of forebrain commissures including the corpus callosum, but the molecular details of draxin signaling are unknown. To unravel how draxin signals are propagated we used murine cortical neurons and genetic and pharmacological approaches. We found that draxin-induced growth cone collapse critically depends on draxin receptors (deleted in colorectal cancer, DCC), inhibition of protein kinase B/Akt, activation of GSK-3β (glycogen synthase kinase-3β) and the presence of microtubule-associated protein MAP1B. This study, for the first time elucidates molecular events in draxin repulsion, links draxin and DCC to MAP1B and identifies a novel MAP1B-depenent GSK-3β pathway essential for chemo-repulsive axon guidance cue signaling.

  12. Detection of excretory Entamoeba histolytica DNA in the urine, and detection of E. histolytica DNA and lectin antigen in the liver abscess pus for the diagnosis of amoebic liver abscess

    Directory of Open Access Journals (Sweden)

    Khairnar Krishna

    2007-05-01

    Full Text Available Abstract Background Amoebic liver abscess (ALA and pyogenic liver abscesses (PLA appear identical by ultrasound and other imaging techniques. Collection of blood or liver abscess pus for diagnosis of liver abscesses is an invasive procedure, and the procedure requires technical expertise and disposable syringes. Collection of urine is a noninvasive procedure. Therefore, there has been much interest shown towards the use of urine as an alternative clinical specimen for the diagnosis of some parasitic infections. Here, we report for the first time the detection of E. histolytica DNA excreted in the urine for diagnosis of the cases of ALA. Results E. histolytica DNA was detected in liver abscess pus specimen of 80.4% of ALA patients by a nested multiplex polymerase chain reaction (PCR targeting 16S-like r RNA gene. The nested PCR detected E. histolytica DNA in all 37 (100% liver abscess pus specimens collected prior to metronidazole treatment, but were detected in only 53 of 75 (70.6% pus specimens collected after therapy with metronidazole. Similarly, the PCR detected E. histolytica DNA in 21 of 53 (39.6% urine specimens of ALA patients. The test detected E. histolytica DNA in only 4 of 23 (17.4% urine specimens collected prior to metronidazole treatment, but were detected in 17 of 30 (56.7% urine specimens collected after treatment with metronidazole. The enzyme-linked immunosorbent assay (ELISA for the detection of lectin E. histolytica antigen in the liver abscess pus showed a sensitivity of 50% and the indirect haemagglutination (IHA test for detection of amoebic antibodies in the serum showed a sensitivity of 76.8% for the diagnosis of the ALA. Conclusion The present study for the first time shows that the kidney barrier in ALA patients is permeable to E. histolytica DNA molecule resulting in excretion of E. histolytica DNA in urine which can be detected by PCR. The study also shows that the PCR for detection of E. histolytica DNA in urine of

  13. Microtubule affinity-regulating kinase 4: structure, function, and regulation.

    Science.gov (United States)

    Naz, Farha; Anjum, Farah; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz

    2013-11-01

    MAP/Microtubule affinity-regulating kinase 4 (MARK4) belongs to the family of serine/threonine kinases that phosphorylate the microtubule-associated proteins (MAP) causing their detachment from the microtubules thereby increasing microtubule dynamics and facilitating cell division, cell cycle control, cell polarity determination, cell shape alterations, etc. The MARK4 gene encodes two alternatively spliced isoforms, L and S that differ in their C-terminal region. These isoforms are differentially regulated in human tissues including central nervous system. MARK4L is a 752-residue-long polypeptide that is divided into three distinct domains: (1) protein kinase domain (59-314), (2) ubiquitin-associated domain (322-369), and (3) kinase-associated domain (703-752) plus 54 residues (649-703) involved in the proper folding and function of the enzyme. In addition, residues 65-73 are considered to be the ATP-binding domain and Lys88 is considered as ATP-binding site. Asp181 has been proposed to be the active site of MARK4 that is activated by phosphorylation of Thr214 side chain. The isoform MARK4S is highly expressed in the normal brain and is presumably involved in neuronal differentiation. On the other hand, the isoform MARK4L is upregulated in hepatocarcinoma cells and gliomas suggesting its involvement in cell cycle. Several biological functions are also associated with MARK4 including microtubule bundle formation, nervous system development, and positive regulation of programmed cell death. Therefore, MARK4 is considered as the most suitable target for structure-based rational drug design. Our sequence, structure- and function-based analysis should be helpful for better understanding of mechanisms of regulation of microtubule dynamics and MARK4 associated diseases.

  14. Activation of Phosphotyrosine Phosphatase Activity Attenuates Mitogen-Activated Protein Kinase Signaling and Inhibits c-FOS and Nitric Oxide Synthase Expression in Macrophages Infected with Leishmania donovani

    OpenAIRE

    Nandan, Devki; Lo, Raymond; Reiner, Neil E

    1999-01-01

    Intracellular protozoan parasites of the genus Leishmania antagonize host defense mechanisms by interfering with cell signaling in macrophages. In this report, the impact of Leishmania donovani on mitogen-activated protein (MAP) kinases and nitric oxide synthase (NOS) expression in the macrophage cell line RAW 264 was investigated. Overnight infection of cells with leishmania led to a significant decrease in phorbol-12-myristate-13-acetate (PMA)-stimulated MAP kinase activity and inhibited PM...

  15. Mapping Deeply

    Directory of Open Access Journals (Sweden)

    Denis Wood

    2015-08-01

    Full Text Available This is a description of an avant la lettre deep mapping project carried out by a geographer and a number of landscape architecture students in the early 1980s. Although humanists seem to take the “mapping” in deep mapping more metaphorically than cartographically, in this neighborhood mapping project, the mapmaking was taken literally, with the goal of producing an atlas of the neighborhood. In this, the neighborhood was construed as a transformer, turning the stuff of the world (gas, water, electricity into the stuff of individual lives (sidewalk graffiti, wind chimes, barking dogs, and vice versa. Maps in the central transformer section of the atlas were to have charted this process in action, as in one showing the route of an individual newspaper into the neighborhood, then through the neighborhood to a home, and finally, as trash, out of the neighborhood in a garbage truck; though few of these had been completed when the project concluded in 1986. Resurrected in 1998 in an episode on Ira Glass’ This American Life, the atlas was finally published, as Everything Sings: Maps for a Narrative Atlas, in 2010 (and an expanded edition in 2013.

  16. Damage-induced DNA replication stalling relies on MAPK-activated protein kinase 2 activity

    DEFF Research Database (Denmark)

    Köpper, Frederik; Bierwirth, Cathrin; Schön, Margarete;

    2013-01-01

    DNA damage can obstruct replication forks, resulting in replicative stress. By siRNA screening, we identified kinases involved in the accumulation of phosphohistone 2AX (γH2AX) upon UV irradiation-induced replication stress. Surprisingly, the strongest reduction of phosphohistone 2AX followed...... replication impaired by gemcitabine or by Chk1 inhibition. This rescue strictly depended on translesion DNA polymerases. In conclusion, instead of being an unavoidable consequence of DNA damage, alterations of replication speed and origin firing depend on MK2-mediated signaling....... knockdown of the MAP kinase-activated protein kinase 2 (MK2), a kinase currently implicated in p38 stress signaling and G2 arrest. Depletion or inhibition of MK2 also protected cells from DNA damage-induced cell death, and mice deficient for MK2 displayed decreased apoptosis in the skin upon UV irradiation...

  17. Reciprocal regulation of protein kinase and pyruvate kinase activities of pyruvate kinase M2 by growth signals.

    Science.gov (United States)

    Gao, Xueliang; Wang, Haizhen; Yang, Jenny J; Chen, Jing; Jie, Jiang; Li, Liangwei; Zhang, Yinwei; Liu, Zhi-Ren

    2013-05-31

    Pyruvate kinase isoform M2 (PKM2) is an enzyme-catalyzing conversion of phosphoenolpyruvate to pyruvate in the glycolysis pathway. It was demonstrated that PKM2 interacts with tyrosine phosphopeptide, and the interaction with the tyrosine phosphopeptide affects the pyruvate kinase activity of PKM2. Our experiments suggest that PKM2 is also an active protein kinase (Gao, X., Wang, H., Yang, J. J., Liu, X., and Liu, Z. R. (2012) Mol. Cell 45, 598-609). We report here that growth signals reciprocally regulate the pyruvate kinase and protein kinase activities of PKM2 by different mechanisms. On the one hand, growth signals induce protein tyrosine phosphorylations. The tyrosine-phosphorylated protein(s) regulates the conversion of pyruvate kinase and protein kinase of PKM2 by directly interacting with PKM2. Binding of the tyrosyl-phosphorylated proteins at the fructose 1,6-bisphosphate-binding site converts the tetrameric PKM2 to a dimer. On the other hand, growth stimulations also lead to PKM2 phosphorylation, which consequently regulates the conversion of protein kinase and pyruvate kinase activities. Growth factor stimulations significantly increase the dimer/tetramer PKM2 ratio in cells and consequently activate the protein kinase activity of PKM2. Our study suggests that the conversion between the pyruvate kinase and protein kinase activities of PKM2 may be an important mechanism mediating the effects of growth signals in promoting cell proliferation.

  18. Anticancer Alkaloid Lamellarins Inhibit Protein Kinases

    Directory of Open Access Journals (Sweden)

    Laurent Meijer

    2008-10-01

    Full Text Available Lamellarins, a family of hexacyclic pyrrole alkaloids originally isolated from marine invertebrates, display promising anti-tumor activity. They induce apoptotic cell death through multi-target mechanisms, including inhibition of topoisomerase I, interaction with DNA and direct effects on mitochondria. We here report that lamellarins inhibit several protein kinases relevant to cancer such as cyclin-dependent kinases, dualspecificity tyrosine phosphorylation activated kinase 1A, casein kinase 1, glycogen synthase kinase-3 and PIM-1. A good correlation is observed between the effects of lamellarins on protein kinases and their action on cell death, suggesting that inhibition of specific kinases may contribute to the cytotoxicity of lamellarins. Structure/activity relationship suggests several paths for the optimization of lamellarins as kinase inhibitors.

  19. Acetylation of cyclin-dependent kinase 5 is mediated by GCN5

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Juhyung; Yun, Nuri; Kim, Chiho [Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Seoul 120-749 (Korea, Republic of); Song, Min-Young; Park, Kang-Sik [Department of Physiology and Biomedical Science Institute, Kyung Hee University School of Medicine, Seoul 130-701 (Korea, Republic of); Oh, Young J., E-mail: yjoh@yonsei.ac.kr [Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Seoul 120-749 (Korea, Republic of)

    2014-04-25

    Highlights: • Cyclin-dependent kinase 5 (CDK5) is present as an acetylated form. • CDK5 is acetylated by GCN5. • CDK5’s acetylation site is mapped at Lys33. • Its acetylation may affect CDK5’s kinase activity. - Abstract: Cyclin-dependent kinase 5 (CDK5), a member of atypical serine/threonine cyclin-dependent kinase family, plays a crucial role in pathophysiology of neurodegenerative disorders. Its kinase activity and substrate specificity are regulated by several independent pathways including binding with its activator, phosphorylation and S-nitrosylation. In the present study, we report that acetylation of CDK5 comprises an additional posttranslational modification within the cells. Among many candidates, we confirmed that its acetylation is enhanced by GCN5, a member of the GCN5-related N-acetyl-transferase family of histone acetyltransferase. Co-immunoprecipitation assay and fluorescent localization study indicated that GCN5 physically interacts with CDK5 and they are co-localized at the specific nuclear foci. Furthermore, liquid chromatography in conjunction with a mass spectrometry indicated that CDK5 is acetylated at Lys33 residue of ATP binding domain. Considering this lysine site is conserved among a wide range of species and other related cyclin-dependent kinases, therefore, we speculate that acetylation may alter the kinase activity of CDK5 via affecting efficacy of ATP coordination.

  20. Inhibitors of protein kinase C

    Institute of Scientific and Technical Information of China (English)

    LIU Shiying; JIANG Yuyang; CAO Jian; LIU Feng; MA Li; ZHAO Yufen

    2005-01-01

    Protein kinase catalyzes the transfer of the γ-phosphoryl group from ATP to the hydroxyl groups of protein side chains, which plays critical roles in signal transduction pathways by transmitting extracellular signals across the plasma membrane and nuclear membrane to the destination sites in the cytoplasm and the nucleus. Protein kinase C (PKC) is a superfamily of phospholipid-dependent Ser/Thr kinase. There are at least 12 isozymes in PKC family. They are distributed in different tissues and play different roles in physiological processes. On account of their concern with a variety of pathophysiologic states, such as cancer, inflammatory conditions, autoimmune disorder, and cardiac diseases, the inhibitors, which can inhibit the activity of PKC and the interaction of cytokine with receptor, and interfere signal transduction pathway, may be candidates of therapeutic drugs. Therefore, intense efforts have been made to develop specific protein kinase inhibitors as biological tools and therapeutic agents. This article reviews the recent development of some of PKC inhibitors based on their interaction with different conserved domains and different inhibition mechanisms.

  1. Deferasirox in pyruvate kinase deficiency

    OpenAIRE

    Deeren, Dries

    2008-01-01

    Deferasirox in pyruvate kinase deficiency phone: +32-51-237437 (Deeren, Dries) (Deeren, Dries) Department of Haematology, Heilig-Hartziekenhuis Roeselare-Menen vzw - Wilgenstraat 2 - B-8800 - Roeselare - BELGIUM (Deeren, Dries) BELGIUM Registration: 2008-09-10 Received: 2008-09-05 Accepted: 2008-09-10 ePublished: 2008-09-23

  2. Non-Viral Deoxyribonucleoside Kinases

    DEFF Research Database (Denmark)

    Christiansen, Louise Slot; Munch-Petersen, Birgitte; Knecht, Wolfgang

    2015-01-01

    Deoxyribonucleoside kinases (dNKs) phosphorylate deoxyribonucleosides to their corresponding monophosphate compounds. dNks also phosphorylate deoxyribonucleoside analogues that are used in the treatment of cancer or viral infections. The study of the mammalian dNKs has therefore always been of gr...

  3. Renal targeting of kinase inhibitors

    NARCIS (Netherlands)

    Dolman, M. E. M.; Fretz, M. M.; Segers, Gj. W.; Lacombe, M.; Prakash, J.; Storm, G.; Hennink, W. E.; Kok, R. J.

    2008-01-01

    Activation of proximal tubular cells by fibrotic and inflammatory mediators is an important hallmark of chronic kidney disease. We have developed a novel strategy to intervene in renal fibrosis, by means of locally delivered kinase inhibitors. Such compounds will display enhanced activity within tub

  4. Cognitive maps

    DEFF Research Database (Denmark)

    Minder, Bettina; Laursen, Linda Nhu; Lassen, Astrid Heidemann

    2014-01-01

    . Conceptual clustering is used to analyse and order information according to concepts or variables from within the data. The cognitive maps identified are validated through the comments of some of the same experts. The study presents three cognitive maps and respective world-views explaining how the design...... and innovation field are related and under which dimensions they differ. The paper draws preliminary conclusions on the implications of the different world- views on the innovation process. With the growing importance of the design approach in innovation e.g. design thinking, a clear conception...

  5. Monoclonal Antibodies Against Xenopus Greatwall Kinase

    OpenAIRE

    WANG Ling; Fisher, Laura A.; Wahl, James K.; Peng, Aimin

    2011-01-01

    Mitosis is known to be regulated by protein kinases, including MPF, Plk1, Aurora kinases, and so on, which become active in M-phase and phosphorylate a wide range of substrates to control multiple aspects of mitotic entry, progression, and exit. Mechanistic investigations of these kinases not only provide key insights into cell cycle regulation, but also hold great promise for cancer therapy. Recent studies, largely in Xenopus, characterized a new mitotic kinase named Greatwall (Gwl) that pla...

  6. Biochemical Screening of Five Protein Kinases from Plasmodium falciparum against 14,000 Cell-Active Compounds.

    Directory of Open Access Journals (Sweden)

    Gregory J Crowther

    Full Text Available In 2010 the identities of thousands of anti-Plasmodium compounds were released publicly to facilitate malaria drug development. Understanding these compounds' mechanisms of action--i.e., the specific molecular targets by which they kill the parasite--would further facilitate the drug development process. Given that kinases are promising anti-malaria targets, we screened ~14,000 cell-active compounds for activity against five different protein kinases. Collections of cell-active compounds from GlaxoSmithKline (the ~13,000-compound Tres Cantos Antimalarial Set, or TCAMS, St. Jude Children's Research Hospital (260 compounds, and the Medicines for Malaria Venture (the 400-compound Malaria Box were screened in biochemical assays of Plasmodium falciparum calcium-dependent protein kinases 1 and 4 (CDPK1 and CDPK4, mitogen-associated protein kinase 2 (MAPK2/MAP2, protein kinase 6 (PK6, and protein kinase 7 (PK7. Novel potent inhibitors (IC50 < 1 μM were discovered for three of the kinases: CDPK1, CDPK4, and PK6. The PK6 inhibitors are the most potent yet discovered for this enzyme and deserve further scrutiny. Additionally, kinome-wide competition assays revealed a compound that inhibits CDPK4 with few effects on ~150 human kinases, and several related compounds that inhibit CDPK1 and CDPK4 yet have limited cytotoxicity to human (HepG2 cells. Our data suggest that inhibiting multiple Plasmodium kinase targets without harming human cells is challenging but feasible.

  7. Mole Mapping.

    Science.gov (United States)

    Crippen, Kent J.; Curtright, Robert D.; Brooks, David W.

    2000-01-01

    The abstract nature of the mole and its applications to problem solving make learning the concept difficult for students, and teaching the concept challenging for teachers. Presents activities that use concept maps and graphing calculators as tools for solving mole problems. (ASK)

  8. Projective mapping

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Bredie, Wender Laurentius Petrus

    2012-01-01

    Projective Mapping (Risvik et.al., 1994) and its Napping (Pagès, 2003) variations have become increasingly popular in the sensory field for rapid collection of spontaneous product perceptions. It has been applied in variations which sometimes are caused by the purpose of the analysis and sometime...

  9. Participatory maps

    DEFF Research Database (Denmark)

    Salovaara-Moring, Inka

    looks at computer-assisted cartography as part of environmental knowledge production. It uses InfoAmazonia, the databased platform on Amazon rainforests, as an example of affective geo-visualization within information mapping that enhances embodiment in the experience of the information. Amazonia...

  10. Integrative analysis of kinase networks in TRAIL-induced apoptosis provides a source of potential targets for combination therapy

    DEFF Research Database (Denmark)

    So, Jonathan; Pasculescu, Adrian; Dai, Anna Y.

    2015-01-01

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an endogenous secreted peptide and, in preclinical studies, preferentially induces apoptosis in tumor cells rather than in normal cells. The acquisition of resistance in cells exposed to TRAIL or its mimics limits their clinical....../threonine kinase (PXK) and AP2-associated kinase 1 (AAK1), which promote receptor endocytosis and may enable cells to resist TRAIL-induced apoptosis by enhancing endocytosis of the TRAIL receptors. We assembled protein interaction maps using mass spectrometry-based protein interaction analysis and quantitative...... efficacy. Because kinases are intimately involved in the regulation of apoptosis, we systematically characterized kinases involved in TRAIL signaling. Using RNA interference (RNAi) loss-of-function and cDNA overexpression screens, we identified 169 protein kinases that influenced the dynamics of TRAIL-induced...

  11. Cardiac protein kinases: the cardiomyocyte kinome and differential kinase expression in human failing hearts

    OpenAIRE

    Fuller, Stephen J.; Osborne, Sally A.; Leonard, Sam J.; Hardyman, Michelle A.; Vaniotis, George; Allen, Bruce G.; Sugden, Peter H.; Clerk, Angela

    2015-01-01

    Aims. Protein kinases are potential therapeutic targets for heart failure, but most studies of cardiac protein kinases derive from other systems, an approach that fails to account for specific kinases expressed in the heart and the contractile cardiomyocytes. We aimed to define the cardiomyocyte kinome (i.e. the protein kinases expressed in cardiomyocytes) and identify kinases with altered expression in human failing hearts. Methods and Results. Expression profiling (Affymetrix microarrays) d...

  12. Receptor tyrosine kinases in carcinogenesis.

    Science.gov (United States)

    Zhang, Xiao-Ying; Zhang, Pei-Ying

    2016-11-01

    Receptor tyrosine kinases (RTKs) are cell surface glycoproteins with enzymatic activity involved in the regulation of various important functions. In all-important physiological functions including differentiation, cell-cell interactions, survival, proliferation, metabolism, migration and signaling these receptors are the key players of regulation. Additionally, mutations of RTKs or their overexpression have been described in many human cancers and are being explored as a novel avenue for a new therapeutic approach. Some of the deregulated RTKs observed to be significantly affected in cancers included vascular endothelial growth factor receptor, epidermal growth factor receptor, fibroblast growth factor receptor, RTK-like orphan receptor 1 (ROR1) and the platelet-derived growth factor receptor. These deregulated RTKs offer attractive possibilities for the new anticancer therapeutic approach involving specific targeting by monoclonal antibodies as well as kinase. The present review aimed to highlight recent perspectives of RTK ROR1 in cancer.

  13. Endocytosis of Receptor Tyrosine Kinases

    Science.gov (United States)

    Goh, Lai Kuan

    2013-01-01

    Endocytosis is the major regulator of signaling from receptor tyrosine kinases (RTKs). The canonical model of RTK endocytosis involves rapid internalization of an RTK activated by ligand binding at the cell surface and subsequent sorting of internalized ligand-RTK complexes to lysosomes for degradation. Activation of the intrinsic tyrosine kinase activity of RTKs results in autophosphorylation, which is mechanistically coupled to the recruitment of adaptor proteins and conjugation of ubiquitin to RTKs. Ubiquitination serves to mediate interactions of RTKs with sorting machineries both at the cell surface and on endosomes. The pathways and kinetics of RTK endocytic trafficking, molecular mechanisms underlying sorting processes, and examples of deviations from the standard trafficking itinerary in the RTK family are discussed in this work. PMID:23637288

  14. DMPD: Bruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15081522 Bruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signall...ruton's tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? PubmedID 15081522 Title Bruton...'s tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling? Authors

  15. Bacterial Protein-Tyrosine Kinases

    DEFF Research Database (Denmark)

    Shi, Lei; Kobir, Ahasanul; Jers, Carsten

    2010-01-01

    phosphorylation. Protein-tyrosine phosphorylation in bacteria is particular with respect to very low occupancy of phosphorylation sites in vivo; this has represented a major challenge for detection techniques. Only the recent breakthroughs in gel-free high resolution mass spectrometry allowed the systematic...... and highlighted their importance in bacterial physiology. Having no orthologues in Eukarya, BY-kinases are receiving a growing attention from the biomedical field, since they represent a particularly promising target for anti-bacterial drug design....

  16. Thymidine kinase diversity in bacteria

    DEFF Research Database (Denmark)

    Sandrini, Michael; Clausen, A.R.; Munch-Petersen, B.

    2006-01-01

    Thymidine kinases (TKs) appear to be almost ubiquitous and are found in nearly all prokaryotes, eukaryotes, and several viruses. They are the key enzymes in thymidine salvage and activation of several anti-cancer and antiviral drugs. We show that bacterial TKs can be subdivided into 2 groups. The....... The TKs from Gram-positive bacteria are more closely related to the eukaryotic TK1 enzymes than are TKs from Gram-negative bacteria....

  17. Oncoprotein protein kinase antibody kit

    Science.gov (United States)

    Karin, Michael; Hibi, Masahiko; Lin, Anning

    2008-12-23

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  18. RIP Kinases Initiate Programmed Necrosis

    Institute of Scientific and Technical Information of China (English)

    Lorenzo Galluzzi; Oliver Kepp; Guido Kroemer

    2009-01-01

    Some lethal stimuli can induce either apoptosis or necrosis, depending on the cell type and/or experimental setting. Until recently,the molecular bases of this phenomenon were largely unknown. Now, two members of the receptor-interacting serine-threonine kinase (RIP) family, RIP1 and RIP3, have been demonstrated to control the switch between apoptotic and necrotic cell death.Some mechanistic details, however, remain controversial.

  19. MAPPING INNOVATION

    DEFF Research Database (Denmark)

    Thuesen, Christian Langhoff; Koch, Christian

    2011-01-01

    By adopting a theoretical framework from strategic niche management research (SNM) this paper presents an analysis of the innovation system of the Danish Construction industry. The analysis shows a multifaceted landscape of innovation around an existing regime, built around existing ways of working...... and developed over generations. The regime is challenged from various niches and the socio-technical landscape through trends as globalization. Three niches (Lean Construction, BIM and System Deliveries) are subject to a detailed analysis showing partly incompatible rationales and various degrees of innovation...... potential. The paper further discusses how existing policymaking operates in a number of tensions one being between government and governance. Based on the concepts from SNM the paper introduces an innovation map in order to support the development of meta-governance policymaking. By mapping some...

  20. Mapping filmmaking

    DEFF Research Database (Denmark)

    Gilje, Øystein; Frølunde, Lisbeth; Lindstrand, Fredrik

    2010-01-01

    This chapter concerns mapping patterns in regards to how young filmmakers (age 15 – 20) in the Scandinavian countries learn about filmmaking. To uncover the patterns, we present portraits of four young filmmakers who participated in the Scandinavian research project Making a filmmaker. The focus ...... is on their learning practices and how they create ‘learning paths’ in relation to resources in diverse learning contexts, whether formal, non-formal and informal contexts.......This chapter concerns mapping patterns in regards to how young filmmakers (age 15 – 20) in the Scandinavian countries learn about filmmaking. To uncover the patterns, we present portraits of four young filmmakers who participated in the Scandinavian research project Making a filmmaker. The focus...

  1. Oxidized Form of Creatine Kinase

    Institute of Scientific and Technical Information of China (English)

    王希成; 王帆; 邹晓明; 周海梦

    1994-01-01

    The purified rabbit muscle creatine kinase (R-CK) was previously considered homogeneousand without disulfide bonds.By the method of NR/R two-dimensional diagonal SDS-PAGE,two forms of R-CK,designated respectively "oxidized form" of creatine kinase which contained intrachain disulfide bondsand "reduced form" of creatine kinase which did not have any —S—S— bridges,were for the first time sepa-rated.They were found to be the same in amino acid composition,in subunit molecular Weight and in isoelec-tric point,and were almost identical in enzyme activities.Thus it is hard to isolate one from the other bycommon biochemical methods.More extensive studies show that the oxidized form of CK also contains a pair of reactive thiol groupswhich are essential to the enzyme activity,and it has one intrachain disulfide bond per subunit.In the nativestate,this —S—S— bond cannot be reduced by DTT,but by treating the reduced form of CK with some ox-idants,these —S—S— bonds can be formed in vitro.Thus it is presumed that the disulfide bonds are cross-linked through the oxidization of two shallowly buried —SH groups.

  2. A proteomic approach for comprehensively screening substrates of protein kinases such as Rho-kinase.

    Directory of Open Access Journals (Sweden)

    Mutsuki Amano

    Full Text Available BACKGROUND: Protein kinases are major components of signal transduction pathways in multiple cellular processes. Kinases directly interact with and phosphorylate downstream substrates, thus modulating their functions. Despite the importance of identifying substrates in order to more fully understand the signaling network of respective kinases, efficient methods to search for substrates remain poorly explored. METHODOLOGY/PRINCIPAL FINDINGS: We combined mass spectrometry and affinity column chromatography of the catalytic domain of protein kinases to screen potential substrates. Using the active catalytic fragment of Rho-kinase/ROCK/ROK as the model bait, we obtained about 300 interacting proteins from the rat brain cytosol fraction, which included the proteins previously reported as Rho-kinase substrates. Several novel interacting proteins, including doublecortin, were phosphorylated by Rho-kinase both in vitro and in vivo. CONCLUSIONS/SIGNIFICANCE: This method would enable identification of novel specific substrates for kinases such as Rho-kinase with high sensitivity.

  3. KSR2 Is An Essential Regulator of AMP Kinase, Energy Expenditure, and Insulin Sensitivity

    OpenAIRE

    2009-01-01

    Kinase Suppressors of Ras 1 and 2 (KSR1 and KSR2) function as molecular scaffolds to potently regulate the MAP kinases ERK1/2 and affect multiple cell fates. Here we show that KSR2 interacts with and modulates the activity of AMPK. KSR2 regulates AMPK-dependent glucose uptake and fatty acid oxidation in mouse embryo fibroblasts and glycolysis in a neuronal cell line. Disruption of KSR2 in vivo impairs AMPK-regulated processes affecting fatty acid oxidation and thermogenesis to cause obesity. ...

  4. A genomewide overexpression screen identifies genes involved in the phosphatidylinositol 3-kinase pathway in the human protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Koushik, Amrita B; Welter, Brenda H; Rock, Michelle L; Temesvari, Lesly A

    2014-03-01

    Entamoeba histolytica is a protozoan parasite that causes amoebic dysentery and liver abscess. E. histolytica relies on motility, phagocytosis, host cell adhesion, and proteolysis of extracellular matrix for virulence. In eukaryotic cells, these processes are mediated in part by phosphatidylinositol 3-kinase (PI3K) signaling. Thus, PI3K may be critical for virulence. We utilized a functional genomics approach to identify genes whose products may operate in the PI3K pathway in E. histolytica. We treated a population of trophozoites that were overexpressing genes from a cDNA library with a near-lethal dose of the PI3K inhibitor wortmannin. This screen was based on the rationale that survivors would be overexpressing gene products that directly or indirectly function in the PI3K pathway. We sequenced the overexpressed genes in survivors and identified a cDNA encoding a Rap GTPase, a protein previously shown to participate in the PI3K pathway. This supports the validity of our approach. Genes encoding a coactosin-like protein, EhCoactosin, and a serine-rich E. histolytica protein (SREHP) were also identified. Cells overexpressing EhCoactosin or SREHP were also less sensitive to a second PI3K inhibitor, LY294002. This corroborates the link between these proteins and PI3K. Finally, a mutant cell line with an increased level of phosphatidylinositol (3,4,5)-triphosphate, the product of PI3K activity, exhibited increased expression of SREHP and EhCoactosin. This further supports the functional connection between these proteins and PI3K in E. histolytica. To our knowledge, this is the first forward-genetics screen adapted to reveal genes participating in a signal transduction pathway in this pathogen.

  5. Domain specificity of MAP3K family members, MLK and Tak1, for JNK signaling in Drosophila.

    Science.gov (United States)

    Stronach, Beth; Lennox, Ashley L; Garlena, Rebecca A

    2014-06-01

    A highly diverse set of protein kinases functions as early responders in the mitogen- and stress-activated protein kinase (MAPK/SAPK) signaling pathways. For instance, humans possess 14 MAPK kinase kinases (MAP3Ks) that activate Jun kinase (JNK) signaling downstream. A major challenge is to decipher the selective and redundant functions of these upstream MAP3Ks. Taking advantage of the relative simplicity of Drosophila melanogaster as a model system, we assessed MAP3K signaling specificity in several JNK-dependent processes during development and stress response. Our approach was to generate molecular chimeras between two MAP3K family members, the mixed lineage kinase, Slpr, and the TGF-β activated kinase, Tak1, which share 32% amino acid identity across the kinase domain but otherwise differ in sequence and domain structure, and then test the contributions of various domains for protein localization, complementation of mutants, and activation of signaling. We found that overexpression of the wild-type kinases stimulated JNK signaling in alternate contexts, so cells were capable of responding to both MAP3Ks, but with distinct outcomes. Relative to wild-type, the catalytic domain swaps compensated weakly or not at all, despite having a shared substrate, the JNK kinase Hep. Tak1 C-terminal domain-containing constructs were inhibitory in Tak1 signaling contexts, including tumor necrosis factor-dependent cell death and innate immune signaling; however, depressing antimicrobial gene expression did not necessarily cause phenotypic susceptibility to infection. These same constructs were neutral in the context of Slpr-dependent developmental signaling, reflecting differential subcellular protein localization and by inference, point of activation. Altogether, our findings suggest that the selective deployment of a particular MAP3K can be attributed in part to its inherent sequence differences, cellular localization, and binding partner availability.

  6. Association of protein kinase Cmu with type II phosphatidylinositol 4-kinase and type I phosphatidylinositol-4-phosphate 5-kinase.

    Science.gov (United States)

    Nishikawa, K; Toker, A; Wong, K; Marignani, P A; Johannes, F J; Cantley, L C

    1998-09-04

    Protein kinase Cmu (PKCmu), also named protein kinase D, is an unusual member of the PKC family that has a putative transmembrane domain and pleckstrin homology domain. This enzyme has a substrate specificity distinct from other PKC isoforms (Nishikawa, K., Toker, A., Johannes, F. J., Songyang, Z., and Cantley, L. C. (1997) J. Biol. Chem. 272, 952-960), and its mechanism of regulation is not yet clear. Here we show that PKCmu forms a complex in vivo with a phosphatidylinositol 4-kinase and a phosphatidylinositol-4-phosphate 5-kinase. A region of PKCmu between the amino-terminal transmembrane domain and the pleckstrin homology domain is shown to be involved in the association with the lipid kinases. Interestingly, a kinase-dead point mutant of PKCmu failed to associate with either lipid kinase activity, indicating that autophosphorylation may be required to expose the lipid kinase interaction domain. Furthermore, the subcellular distribution of the PKCmu-associated lipid kinases to the particulate fraction depends on the presence of the amino-terminal region of PKCmu including the predicted transmembrane region. These results suggest a novel model in which the non-catalytic region of PKCmu acts as a scaffold for assembly of enzymes involved in phosphoinositide synthesis at specific membrane locations.

  7. Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress.

    Science.gov (United States)

    Xing, Yu; Chen, Wei-hua; Jia, Wensuo; Zhang, Jianhua

    2015-09-01

    Superoxide dismutases (SODs) are involved in plant adaptive responses to biotic and abiotic stresses but the upstream signalling process that modulates their expression is not clear. Expression of two iron SODs, FSD2 and FSD3, was significantly increased in Arabidopsis in response to NaCl treatment but blocked in transgenic MKK5-RNAi plant, mkk5. Using an assay system for transient expression in protoplasts, it was found that mitogen-activated protein kinase kinase 5 (MKK5) was also activated in response to salt stress. Overexpression of MKK5 in wild-type plants enhanced their tolerance to salt treatments, while mkk5 mutant exhibited hypersensitivity to salt stress in germination on salt-containing media. Moreover, another kinase, MPK6, was also involved in the MKK5-mediated iron superoxide dismutase (FSD) signalling pathway in salt stress. The kinase activity of MPK6 was totally turned off in mkk5, whereas the activity of MPK3 was only partially blocked. MKK5 interacted with the MEKK1 protein that was also involved in the salt-induced FSD signalling pathway. These data suggest that salt-induced FSD2 and FSD3 expressions are influenced by MEKK1 via MKK5-MPK6-coupled signalling. This MAP kinase cascade (MEKK1, MKK5, and MPK6) mediates the salt-induced expression of iron superoxide dismutases.

  8. 4-hydroxy-2, 3-nonenal activates activator protein-1 and mitogen-activated protein kinases in rat pancreatic stellate cells

    Institute of Scientific and Technical Information of China (English)

    Kazuhiro Kikuta; Atsushi Masamune; Masahiro Satoh; Noriaki Suzuki; Tooru Shimosegawa

    2004-01-01

    AIM: Activated pancreatic stellate cells (PSCs) are implicated in the pathogenesis of pancreatic inflammation and fibrosis,where oxidative stress is thought to play a key role. 4-hydroxy2,3-nonenal (HNE) is generated endogenously during the process of lipid peroxidation, and has been accepted as a mediator of oxidative stress. The aim of this study was to clarify the effects of HNE on the activation of signal transduction pathways and cellular functions in PSCs.METHODS: PSCs were isolated from the pancreas of male Wistar rats after perfusion with collagenase P, and used in their culture-activated, myofibroblast-like phenotype unless otherwise stated. PSCs were treated with physiologically relevant and non-cytotoxic concentrations (up to 5 μmol/L)of HNE. Activation of transcription factors was examined by electrophoretic mobility shift assay and luciferase assay.Activation of mitogen-activated protein (MAP) kinases was assessed by Western blotting using anti-phosphospecific antibodies. Cell proliferation was assessed by measuring the incorporation of 5-bromo-2'-deoxyuridine. Production of type Ⅰ collagen and monocyte chemoattractant protein-1was determined by enzyme-linked immunosorbent assay.The effect of HNE on the transformation of freshly isolated PSCs in culture was also assessed.RESULTS: HNE activated activator protein-1, but not nuclear factor κB. In addition, HNE activated three classes of MAP kinases: extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38 MAP kinase. HNE increased type Ⅰ collagen production through the activation of p38 MAP kinase and c-Jun N-terminal kinase. HNE did not alter the proliferation,or monocyte chemoattractant protein-1 production. HNE did not initiate the transformation of freshly isolated PSCs to myofibroblast-like phenotype.CONCLUSION: Specific activation of these signal transduction pathways and altered cell functions such as collagen production by HNE may play a role in the pathogenesis of pancreatic

  9. Protein Kinase D family kinases: roads start to segregate.

    Science.gov (United States)

    Wille, Christoph; Seufferlein, Thomas; Eiseler, Tim

    2014-01-01

    Highly invasive pancreatic tumors are often recognized in late stages due to a lack of clear symptoms and pose major challenges for treatment and disease management. Broad-band Protein Kinase D (PKD) inhibitors have recently been proposed as additional treatment option for this disease. PKDs are implicated in the control of cancer cell motility, angiogenesis, proliferation and metastasis. In particular, PKD2 expression is elevated in pancreatic cancer, whereas PKD1 expression is comparably lower. In our recent study we report that both kinases control PDAC cell invasive properties in an isoform-specific, but opposing manner. PKD1 selectively mediates anti-migratory/anti-invasive features by preferential regulation of the actin-regulatory Cofilin-phosphatase Slingshot1L (SSH1L). PKD2, on the other hand enhances invasion and angiogenesis of PDAC cells in 3D-ECM cultures and chorioallantois tumor models by stimulating expression and secretion of matrix-metalloproteinase 7 and 9 (MMP7/9). MMP9 also enhances PKD2-mediated tumor angiogenesis releasing extracellular matrix-bound VEGF-A. We thus suggest high PKD2 expression and loss of PKD1 may be beneficial for tumor cells to enhance their matrix-invading abilities. In our recent study we demonstrate for the first time PKD1 and 2 isoform-selective effects on pancreatic cancer cell invasion, in-vitro and in-vivo, defining isoform-specific regulation of PKDs as a major future issue.

  10. An Integrated Map of Soybean Physical Map and Genetic Map

    Institute of Scientific and Technical Information of China (English)

    QI Zhaoming; LI Hui; WU Qiong; SUN Yanan; LIU Chunyan; HU Guohua; CHEN Qingshan

    2009-01-01

    Soybean is a major crop in the world, and it is a main source of plant proteins and oil. A lot of soybean genetic maps and physical maps have been constructed, but there are no integrated map between soybean physical map and genetic map. In this study, soybean genome sequence data, released by JGI (US Department of Energy's Joint Genome Institute), had been downloaded. With the software Blast 2.2.16, a total of 161 super sequences were mapped on the soybean public genetic map to construct an integrated map. The length of these super sequences accounted for 73.08% of all the genome sequence. This integrated map could be used for gene cloning, gene mining, and comparative genome of legume.

  11. Mapping of

    Directory of Open Access Journals (Sweden)

    Sayed M. Arafat

    2014-06-01

    Full Text Available Land cover map of North Sinai was produced based on the FAO-Land Cover Classification System (LCCS of 2004. The standard FAO classification scheme provides a standardized system of classification that can be used to analyze spatial and temporal land cover variability in the study area. This approach also has the advantage of facilitating the integration of Sinai land cover mapping products to be included with the regional and global land cover datasets. The total study area is covering a total area of 20,310.4 km2 (203,104 hectare. The landscape classification was based on SPOT4 data acquired in 2011 using combined multispectral bands of 20 m spatial resolution. Geographic Information System (GIS was used to manipulate the attributed layers of classification in order to reach the maximum possible accuracy. GIS was also used to include all necessary information. The identified vegetative land cover classes of the study area are irrigated herbaceous crops, irrigated tree crops and rain fed tree crops. The non-vegetated land covers in the study area include bare rock, bare soils (stony, very stony and salt crusts, loose and shifting sands and sand dunes. The water bodies were classified as artificial perennial water bodies (fish ponds and irrigated canals and natural perennial water bodies as lakes (standing. The artificial surfaces include linear and non-linear features.

  12. Assessing protein kinase target similarity

    DEFF Research Database (Denmark)

    Gani, Osman A; Thakkar, Balmukund; Narayanan, Dilip

    2015-01-01

    : focussed chemical libraries, drug repurposing, polypharmacological design, to name a few. Protein kinase target similarity is easily quantified by sequence, and its relevance to ligand design includes broad classification by key binding sites, evaluation of resistance mutations, and the use of surrogate......" of sequence and crystal structure information, with statistical methods able to identify key correlates to activity but also here, "the devil is in the details." Examples from specific repurposing and polypharmacology applications illustrate these points. This article is part of a Special Issue entitled...

  13. MST kinases in development and disease

    OpenAIRE

    Thompson, Barry J.; Sahai, Erik

    2015-01-01

    The mammalian MST kinase family, which is related to the Hippo kinase in Drosophila melanogaster, includes five related proteins: MST1 (also called STK4), MST2 (also called STK3), MST3 (also called STK24), MST4, and YSK1 (also called STK25 or SOK1). MST kinases are emerging as key signaling molecules that influence cell proliferation, organ size, cell migration, and cell polarity. Here we review the regulation and function of these kinases in normal physiology and pathologies, including cance...

  14. MST kinases in development and disease.

    Science.gov (United States)

    Thompson, Barry J; Sahai, Erik

    2015-09-14

    The mammalian MST kinase family, which is related to the Hippo kinase in Drosophila melanogaster, includes five related proteins: MST1 (also called STK4), MST2 (also called STK3), MST3 (also called STK24), MST4, and YSK1 (also called STK25 or SOK1). MST kinases are emerging as key signaling molecules that influence cell proliferation, organ size, cell migration, and cell polarity. Here we review the regulation and function of these kinases in normal physiology and pathologies, including cancer, endothelial malformations, and autoimmune disease.

  15. The Arabidopsis kinase-associated protein phosphatase controls internalization of the somatic embryogenesis receptor kinase 1

    NARCIS (Netherlands)

    Shah, K.; Russinova, E.; Gadella, T.W.J.; Willemse, J.; Vries, de S.C.

    2002-01-01

    The AtSERK1 protein is a plasma membrane-located LRR receptor-like serine threonine kinase that is transiently expressed during plant embryogenesis. Our results show that AtSERK1 interacts with the kinase-associated protein phosphatase (KAPP) in vitro. The kinase interaction (KI) domain of KAPP does

  16. Mapping Resilience

    DEFF Research Database (Denmark)

    Carruth, Susan

    2015-01-01

    Resilience theory is a growing discipline with great relevance for the discipline of planning, particularly in fields like energy planning that face great uncertainty and rapidly transforming contexts. Building on the work of the Stockholm Resilience Centre, this paper begins by outlining...... the relationship between resilience and energy planning, suggesting that planning in, and with, time is a core necessity in this domain. It then reviews four examples of graphically mapping with time, highlighting some of the key challenges, before tentatively proposing a graphical language to be employed...... by planners when aiming to construct resilient energy plans. It concludes that a graphical language has the potential to be a significant tool, flexibly facilitating cross-disciplinary communication and decision-making, while emphasising that its role is to support imaginative, resilient planning rather than...

  17. Comparison of Peptide Array Substrate Phosphorylation of c-Raf and Mitogen Activated Protein Kinase Kinase Kinase 8

    NARCIS (Netherlands)

    Parikh, Kaushal; Diks, Sander H.; Tuynman, Jurriaan H. B.; Verhaar, Auke; Lowenberg, Mark; Hommes, Daan W.; Joore, Jos; Pandey, Akhilesh; Peppelenbosch, Maikel P.

    2009-01-01

    Kinases are pivotal regulators of cellular physiology. The human genome contains more than 500 putative kinases, which exert their action via the phosphorylation of specific substrates. The determinants of this specificity are still only partly understood and as a consequence it is difficult to pred

  18. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site.

    Science.gov (United States)

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R; Phillips, Chris; Augustin, Martin A; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-05-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5-inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented.

  19. Novel Library of Selenocompounds as Kinase Modulators

    Directory of Open Access Journals (Sweden)

    Carmen Sanmartín

    2011-07-01

    Full Text Available Although the causes of cancer lie in mutations or epigenic changes at the genetic level, their molecular manifestation is the dysfunction of biochemical pathways at the protein level. The 518 protein kinases encoded by the human genome play a central role in various diseases, a fact that has encouraged extensive investigations on their biological function and three dimensional structures. Selenium (Se is an important nutritional trace element involved in different physiological functions with antioxidative, antitumoral and chemopreventive properties. The mechanisms of action for selenocompounds as anticancer agents are not fully understood, but kinase modulation seems to be a possible pathway. Various organosulfur compounds have shown antitumoral and kinase inhibition effects but, in many cases, the replacement of sulfur by selenium improves the antitumoral effect of compounds. Although Se atom possesses a larger atomic volume and nucleophilic character than sulfur, Se can also formed interactions with aminoacids of the catalytic centers of proteins. So, we propose a novel chemical library that includes organoselenium compounds as kinase modulators. In this study thirteen selenocompounds have been evaluated at a concentration of 3 or 10 µM in a 24 kinase panel using a Caliper LabChip 3000 Drug Discover Platform. Several receptor (EGFR, IGFR1, FGFR1… and non-receptor (Abl kinases have been selected, as well as serine/threonine/lipid kinases (AurA, Akt, CDKs, MAPKs… implicated in main cancer pathways: cell cycle regulation, signal transduction, angiogenesis regulation among them. The obtained results showed that two compounds presented inhibition values higher than 50% in at least four kinases and seven derivatives selectively inhibited one or two kinases. Furthermore, three compounds selectively activated IGF-1R kinase with values ranging from −98% to −211%. In conclusion, we propose that the replacement of sulfur by selenium seems to be

  20. The AngFus3 Mitogen-Activated Protein Kinase Controls Hyphal Differentiation and Secondary Metabolism in Aspergillus niger.

    Science.gov (United States)

    Priegnitz, Bert-Ewald; Brandt, Ulrike; Pahirulzaman, Khomaizon A K; Dickschat, Jeroen S; Fleißner, André

    2015-06-01

    Adaptation to a changing environment is essential for the survival and propagation of sessile organisms, such as plants or fungi. Filamentous fungi commonly respond to a worsening of their growth conditions by differentiation of asexually or sexually produced spores. The formation of these specialized cell types is, however, also triggered as part of the general life cycle by hyphal age or density. Spores typically serve for dispersal and, therefore, translocation but can also act as resting states to endure times of scarcity. Eukaryotic differentiation in response to environmental and self-derived signals is commonly mediated by three-tiered mitogen-activated protein (MAP) kinase signaling cascades. Here, we report that the MAP kinase Fus3 of the black mold Aspergillus niger (AngFus3) and its upstream kinase AngSte7 control vegetative spore formation and secondary metabolism. Mutants lacking these kinases are defective in conidium induction in response to hyphal density but are fully competent in starvation-induced sporulation, indicating that conidiation in A. niger is triggered by various independent signals. In addition, the mutants exhibit an altered profile of volatile metabolites and secrete dark pigments into the growth medium, suggesting a dysregulation of the secondary metabolism. By assigning the AngFus3 MAP kinase pathway to the transduction of a potentially self-derived trigger, this work contributes to the unraveling of the intricate signaling networks controlling fungal differentiation. Moreover, our data further support earlier observations that differentiation and secondary metabolism are tightly linked in filamentous fungi.

  1. Ras-mutant cancer cells display B-Raf binding to Ras that activates extracellular signal-regulated kinase and is inhibited by protein kinase A phosphorylation.

    Science.gov (United States)

    Li, Yanping; Takahashi, Maho; Stork, Philip J S

    2013-09-20

    The small G protein Ras regulates proliferation through activation of the mitogen-activated protein (MAP) kinase (ERK) cascade. The first step of Ras-dependent activation of ERK signaling is Ras binding to members of the Raf family of MAP kinase kinase kinases, C-Raf and B-Raf. Recently, it has been reported that in melanoma cells harboring oncogenic Ras mutations, B-Raf does not bind to Ras and does not contribute to basal ERK activation. For other types of Ras-mutant tumors, the relative contributions of C-Raf and B-Raf are not known. We examined non-melanoma cancer cell lines containing oncogenic Ras mutations and express both C-Raf and B-Raf isoforms, including the lung cancer cell line H1299 cells. Both B-Raf and C-Raf were constitutively bound to oncogenic Ras and contributed to Ras-dependent ERK activation. Ras binding to B-Raf and C-Raf were both subject to inhibition by the cAMP-dependent protein kinase PKA. cAMP inhibited the growth of H1299 cells and Ras-dependent ERK activation via PKA. PKA inhibited the binding of Ras to both C-Raf and B-Raf through phosphorylations of C-Raf at Ser-259 and B-Raf at Ser-365, respectively. These studies demonstrate that in non-melanocytic Ras-mutant cancer cells, Ras signaling to B-Raf is a significant contributor to ERK activation and that the B-Raf pathway, like that of C-Raf, is a target for inhibition by PKA. We suggest that cAMP and hormones coupled to cAMP may prove useful in dampening the effects of oncogenic Ras in non-melanocytic cancer cells through PKA-dependent actions on B-Raf as well as C-Raf.

  2. Measuring the Activity of Leucine-Rich Repeat Kinase 2: A Kinase Involved in Parkinson's Disease

    Science.gov (United States)

    Lee, Byoung Dae; Li, Xiaojie; Dawson, Ted M.; Dawson, Valina L.

    2015-01-01

    Mutations in the LRRK2 (Leucine-Rich Repeat Kinase 2) gene are the most common cause of autosomal dominant Parkinson's disease. LRRK2 has multiple functional domains including a kinase domain. The kinase activity of LRRK2 is implicated in the pathogenesis of Parkinson's disease. Developing an assay to understand the mechanisms of LRRK2 kinase activity is important for the development of pharmacologic and therapeutic applications. Here, we describe how to measure in vitro LRRK2 kinase activity and its inhibition. PMID:21960214

  3. Mutational profiling of kinases in glioblastoma

    NARCIS (Netherlands)

    F.E. Bleeker (Fonnet); S. Lamba (Simona); C. Zanon (Carlo); R.J. Molenaar (Remco J.); T. Hulsebos (Theo); D. Troost (Dirk); A.A.G. van Tilborg (Angela); W.P. Vandertop (Peter); S. Leenstra (Sieger); C.J.F. van Noorden (Cornelis); A. Bardelli (Alberto)

    2014-01-01

    textabstractBackground: Glioblastoma is a highly malignant brain tumor for which no cure is available. To identify new therapeutic targets, we performed a mutation analysis of kinase genes in glioblastoma.Methods: Database mining and a literature search identified 76 kinases that have been found to

  4. A multisubstrate deoxyribonucleoside kinase from plants

    DEFF Research Database (Denmark)

    Clausen, Anders R.; Girandon, Lenart; Knecht, Wolfgang;

    2008-01-01

    and biochemical properties suggest that this deoxyribonucleoside kinase represents a living fossil resembling the progenitor of the modern animal deoxycytidine, deoxyguanosine and thymidine 2 kinases. The broad substrate specificity makes this enzyme an interesting candidate to be evaluated as a suicide gene...

  5. Regulation of the interaction between protein kinase C-related protein kinase 2 (PRK2) and its upstream kinase, 3-phosphoinositide-dependent protein kinase 1 (PDK1)

    DEFF Research Database (Denmark)

    Dettori, Rosalia; Sonzogni, Silvina; Meyer, Lucas;

    2009-01-01

    The members of the AGC kinase family frequently exhibit three conserved phosphorylation sites: the activation loop, the hydrophobic motif (HM), and the zipper (Z)/turn-motif (TM) phosphorylation site. 3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates the activation loop of numer...

  6. Agonist-biased signaling via proteinase activated receptor-2: differential activation of calcium and mitogen-activated protein kinase pathways.

    Science.gov (United States)

    Ramachandran, Rithwik; Mihara, Koichiro; Mathur, Maneesh; Rochdi, Moulay Driss; Bouvier, Michel; Defea, Kathryn; Hollenberg, Morley D

    2009-10-01

    We evaluated the ability of different trypsin-revealed tethered ligand (TL) sequences of rat proteinase-activated receptor 2 (rPAR(2)) and the corresponding soluble TL-derived agonist peptides to trigger agonist-biased signaling. To do so, we mutated the proteolytically revealed TL sequence of rPAR(2) and examined the impact on stimulating intracellular calcium transients and mitogen-activated protein (MAP) kinase. The TL receptor mutants, rPAR(2)-Leu(37)Ser(38), rPAR(2)-Ala(37-38), and rPAR(2)-Ala(39-42) were compared with the trypsin-revealed wild-type rPAR(2) TL sequence, S(37)LIGRL(42)-. Upon trypsin activation, all constructs stimulated MAP kinase signaling, but only the wt-rPAR(2) and rPAR(2)-Ala(39-42) triggered calcium signaling. Furthermore, the TL-derived synthetic peptide SLAAAA-NH2 failed to cause PAR(2)-mediated calcium signaling but did activate MAP kinase, whereas SLIGRL-NH2 triggered both calcium and MAP kinase signaling by all receptors. The peptides AAIGRL-NH2 and LSIGRL-NH2 triggered neither calcium nor MAP kinase signals. Neither rPAR(2)-Ala(37-38) nor rPAR(2)-Leu(37)Ser(38) constructs recruited beta-arrestins-1 or -2 in response to trypsin stimulation, whereas both beta-arrestins were recruited to these mutants by SLIGRL-NH2. The lack of trypsin-triggered beta-arrestin interactions correlated with impaired trypsin-activated TL-mutant receptor internalization. Trypsin-stimulated MAP kinase activation by the TL-mutated receptors was not blocked by inhibitors of Galpha(i) (pertussis toxin), Galpha(q) [N-cyclohexyl-1-(2,4-dichlorophenyl)-1,4-dihydro-6-methylindeno[1,2-c]pyrazole-3-carboxamide (GP2A)], Src kinase [4-amino-5-(4-methylphenyl)-7-(t-butyl)pyrazolo[3,4-d]-pyrimidine (PP1)], or the epidermal growth factor (EGF) receptor [4-(3'-chloroanilino)-6,7-dimethoxy-quinazoline (AG1478)], but was inhibited by the Rho-kinase inhibitor (R)-(+)-trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide, 2HCl (Y27362). The data indicate that the

  7. Activation of the cellular mitogen-activated protein kinase pathways ERK, P38 and JNK during Toxoplasma gondii invasion

    Directory of Open Access Journals (Sweden)

    Valère A.

    2003-03-01

    Full Text Available Host cell invasion is essential for the pathogenicity of the obligate intracellular protozoan parasite Toxoplasma gondii. In the present study, we evaluated the ability of T. gondii tachyzoites to trigger phosphorylation of the different mitogen-activated protein kinases (MAPK in human monocytic cells THP1. Kinetic experiments show that the peak of extracellular-signal-regulated kinase (ERK 1/2, P38 and cjun-NH2 terminal kinase (JNKs phosphorylation occurs between 10 and 60 min. The use of specific inhibitors of ERK1/2, P38 and JNK1/2 phosphorylation indicates the specificity of MAPKs phosphorylation during invasion. Signaling through cellular and parasite mitogen-activated protein (MAP kinase pathways appears to be critical for T. gondii invasion.

  8. TYROSINE KINASE INHIBITORS AND PREGNANCY

    Directory of Open Access Journals (Sweden)

    Elisabetta Abruzzese

    2014-04-01

    Full Text Available The management of patients with chronic myeloid leukemia (CML during pregnancy has became recently a matter of continuous debate.  The introduction of the Tyrosine Kinase Inhibitors (TKIs in clinical practice has dramatically changed the prognosis of CML patients.  Patients diagnosed in chronic phase can reasonably expect many years of excellent disease control and good quality of life, as well as a normal life expectancy.  This fact has come the necessity to address issues relating to fertility and pregnancy. Physicians are not infrequently being asked for advice regarding the need for, and or the appropriateness of, stopping treatment in order to conceive. In this report we will review the data published in terms of fertility, conception, pregnancy, pregnancy outcome and illness control for all the approved TKIs, as well as suggest how to manage a planned and/or unplanned pregnancy.

  9. Methylglyoxal activates the target of rapamycin complex 2-protein kinase C signaling pathway in Saccharomyces cerevisiae.

    Science.gov (United States)

    Nomura, Wataru; Inoue, Yoshiharu

    2015-04-01

    Methylglyoxal is a typical 2-oxoaldehyde derived from glycolysis. We show here that methylglyoxal activates the Pkc1-Mpk1 mitogen-activated protein (MAP) kinase cascade in a target of rapamycin complex 2 (TORC2)-dependent manner in the budding yeast Saccharomyces cerevisiae. We demonstrate that TORC2 phosphorylates Pkc1 at Thr(1125) and Ser(1143). Methylglyoxal enhanced the phosphorylation of Pkc1 at Ser(1143), which transmitted the signal to the downstream Mpk1 MAP kinase cascade. We found that the phosphorylation status of Pkc1(T1125) affected the phosphorylation of Pkc1 at Ser(1143), in addition to its protein levels. Methylglyoxal activated mammalian TORC2 signaling, which, in turn, phosphorylated Akt at Ser(473). Our results suggest that methylglyoxal is a conserved initiator of TORC2 signaling among eukaryotes.

  10. Escitalopram Ameliorates Tau Hyperphosphorylation and Spatial Memory Deficits Induced by Protein Kinase A Activation in Sprague Dawley Rats.

    Science.gov (United States)

    Ren, Qing-Guo; Wang, Yan-Juan; Gong, Wei-Gang; Xu, Lin; Zhang, Zhi-Jun

    2015-01-01

    Here, we investigated the effect of escitalopram pretreatment on protein kinase A (PKA)-induced tau hyperphosphorylation and spatial memory deficits in rats using western blot and behavioral tests, respectively. We demonstrated that escitalopram effectively ameliorated tau hyperphosphorylation and the spatial memory deficits induced by PKA activation. We measured the total and activity-dependent Ser9-phosphorylated levels of glycogen synthase kinase (GSK)-3β in hippocampal extracts. No significant change in the total level of GSK-3β was observed between the different groups. However, compared with forskolin injection alone, pretreatment with escitalopram increased the level of Ser9-phosphorylated GSK-3β. We also demonstrated that escitalopram increased Akt phosphorylation at Ser473 (the active form of Akt). Furthermore, we identified other important kinases and phosphatases, such as protein phosphatase 2A, extracellular signal-regulated kinases 1 and 2, and MAP kinase kinase-1/2, that have previously been reported to play a crucial role in tau phosphorylation; however, we did not detect any significant change in the activation of these kinases or phosphatases in our study. We unexpectedly demonstrated that forskolin caused anxiety-like behavior in rats, and pretreatment with escitalopram did not significantly ameliorate the anxiety-like behavior induced by forskolin. These data provide the first evidence that escitalopram ameliorates forskolin-induced tau hyperphosphorylation and spatial memory impairment in rats; these effects do not occur via the anti-anxiety activity of escitalopram but may involve the Akt/GSK-3β signaling pathway.

  11. Human Mind Maps

    Science.gov (United States)

    Glass, Tom

    2016-01-01

    When students generate mind maps, or concept maps, the maps are usually on paper, computer screens, or a blackboard. Human Mind Maps require few resources and little preparation. The main requirements are space where students can move around and a little creativity and imagination. Mind maps can be used for a variety of purposes, and Human Mind…

  12. Whole-brain activity mapping onto a zebrafish brain atlas.

    Science.gov (United States)

    Randlett, Owen; Wee, Caroline L; Naumann, Eva A; Nnaemeka, Onyeka; Schoppik, David; Fitzgerald, James E; Portugues, Ruben; Lacoste, Alix M B; Riegler, Clemens; Engert, Florian; Schier, Alexander F

    2015-11-01

    In order to localize the neural circuits involved in generating behaviors, it is necessary to assign activity onto anatomical maps of the nervous system. Using brain registration across hundreds of larval zebrafish, we have built an expandable open-source atlas containing molecular labels and definitions of anatomical regions, the Z-Brain. Using this platform and immunohistochemical detection of phosphorylated extracellular signal–regulated kinase (ERK) as a readout of neural activity, we have developed a system to create and contextualize whole-brain maps of stimulus- and behavior-dependent neural activity. This mitogen-activated protein kinase (MAP)-mapping assay is technically simple, and data analysis is completely automated. Because MAP-mapping is performed on freely swimming fish, it is applicable to studies of nearly any stimulus or behavior. Here we demonstrate our high-throughput approach using pharmacological, visual and noxious stimuli, as well as hunting and feeding. The resultant maps outline hundreds of areas associated with behaviors.

  13. Atheroprotective effects of antioxidants through inhibition of mitogen-activated protein kinases

    Institute of Scientific and Technical Information of China (English)

    Moe KYAW; Masanori YOSHIZUMI; Koichiro TSUCHIYA; Yuki IZAWA; Yasuhisa KANEMATSU; Toshiaki TAMAKI

    2004-01-01

    Reactive oxygen species (ROS) have been known to play an important role in the pathogenesis of atherosclerosis and several other cardiovascular diseases. It is now apparent that ROS induce endothelial cell damage and vascular smooth muscle cell (VSMC) growth and cardiac remodeling, which are associated with hypertension,atherosclerosis, heart failure, and restenosis. Several lines of evidence have indicated that ROS and mitogenactivated protein (MAP) kinases were involved in vascular remodeling under various pathological conditions. Recenfiy,it was also reported that MAP kinases were sensitive to oxidative stress. MAP kinases play an important role in cell differentiation, growth, apoptosis, and the regulation of a variety of transcription factors and gene expressions.Bioflavonoids and polyphenolic compounds are believed to be beneficial for the prevention and treatment of atherosclerosis and cardiovascular diseases. One of the most widely distributed bioflavonoids, 3,3',4',5,7-pentahydroxyflavone (quercetin) and its metabolite quercetin 3-O-β-D-glucuronide (Q3GA) inhibited Angiotensin Ⅱstimulated JNK activation and resultant hypertrophy of VSMC. Several studies have suggested that various antioxidants including probucol, N-acetyl-L-cysteine, diphenylene iodonium, Trolox C (vitamin E analogue), and vitamin C inhibit VSMC growth, which is associated with pathogenesis of cardiovascular diseases. Therefore, inhibition of MAP kinases by antioxidant treatment may prove to be a therapeutic strategy for cardiovascular diseases. In contrast, some clinical studies have reported that antioxidant vitamins did not show beneficial effects in coronary artery disease or in a number of high-risk people. Thus, further studies are needed to clarify why antioxidants showed beneficial effects in vitro, whereas less satisfactory results were obtained in some clinical conditions.

  14. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  15. Lunar Map Catalog

    Data.gov (United States)

    National Aeronautics and Space Administration — The Lunar Map Catalog includes various maps of the moon's surface, including Apollo landing sites; earthside, farside, and polar charts; photography index maps; zone...

  16. ShakeMap

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — ShakeMap is a product of the USGS Earthquake Hazards Program in conjunction with the regional seismic networks. ShakeMaps provide near-real-time maps of ground...

  17. Mapping: A Course.

    Science.gov (United States)

    Whitmore, Paul M.

    1988-01-01

    Reviews the history of cartography. Describes the contributions of Strabo and Ptolemy in early maps. Identifies the work of Gerhard Mercator as the most important advancement in mapping. Discusses present mapping standards from history. (CW)

  18. Mapping with the Masses: Google Map Maker

    Science.gov (United States)

    Pfund, J.

    2008-12-01

    After some 15,000 years of map making, which saw the innovations of cardinal directions, map projections for a spherical earth, and GIS analysis, many parts of the world still appear as the "Dark Continent" on modern maps. Google Map Maker intends to shine a light on these areas by tapping into the power of the GeoWeb. Google Map Maker is a website which allows you to collaborate with others on one unified map to add, edit, locate, describe, and moderate map features, such as roads, cities, businesses, parks, schools and more, for certain regions of the world using Google Maps imagery. In this session, we will show some examples of how people are mapping with this powerful tool as well as what they are doing with the data. With Google Map Maker, you can become a citizen cartographer and join the global network of users helping to improve the quality of maps and local information in your region of interest. You are invited to map the world with us!

  19. Physiological roles of mitogen-activated-protein-kinase-activated p38-regulated/activated protein kinase

    Institute of Scientific and Technical Information of China (English)

    Sergiy; Kostenko; Gianina; Dumitriu; Kari; Jenssen; Lgreid; Ugo; Moens

    2011-01-01

    Mitogen-activated protein kinases(MAPKs)are a family of proteins that constitute signaling pathways involved in processes that control gene expression,cell division, cell survival,apoptosis,metabolism,differentiation and motility.The MAPK pathways can be divided into conventional and atypical MAPK pathways.The first group converts a signal into a cellular response through a relay of three consecutive phosphorylation events exerted by MAPK kinase kinases,MAPK kinase,and MAPK.Atypical MAPK pathways are not organized into this three-tiered cascade.MAPK that belongs to both conventional and atypical MAPK pathways can phosphorylate both non-protein kinase substrates and other protein kinases.The latter are referred to as MAPK-activated protein kinases.This review focuses on one such MAPK-activated protein kinase,MAPK-activated protein kinase 5(MK5)or p38-regulated/activated protein kinase(PRAK).This protein is highly conserved throughout the animal kingdom and seems to be the target of both conventional and atypical MAPK pathways.Recent findings on the regulation of the activity and subcellular localization,bona fide interaction partners and physiological roles of MK5/PRAK are discussed.

  20. Role of extracellular signal-regulated kinases 1 and 2 and p38 mitogen-activated protein kinase pathways in regulating replication of Penicillium marneffei in human macrophages.

    Science.gov (United States)

    Chen, Renqiong; Li, Xiqing; Lu, Sha; Ma, Tuan; Huang, Xiaowen; Mylonakis, Eleftherios; Liang, Yuheng; Xi, Liyan

    2014-05-01

    Penicillium marneffei (P. marneffei) is a human pathogen which persists in macrophages and threatens the immunocompromised patients. To elucidate the mechanisms involved, we investigated the role of extracellular signal-regulated kinases 1 and 2 (ERK1/2) and p38 mitogen-activated protein kinase (p38) pathways in cytokine expression, phagosome-lysosome fusion and replication of P. marneffei in P. marneffei-infected human macrophages. Analysis of both ERK1/2 and p38 showed rapid phosphorylation in response to P. marneffei. Using specific inhibitors of p38 (SB203580) and MAP kinase kinase-1 (PD98059), we found that ERK1/2 and p38 were essential for P. marneffei-induced tumor necrosis factor-α production, whereas p38, but not that of ERK, was essential for IL-10 production. Furthermore, the presence of PD98059 always decreased phagosomal acidification and maturation and increased intracellular multiplication of P. marneffei, whereas the use of SB203580 always increased phagosomal acidification and maturation and decreased intracellular replication. These data suggest that a proper balance of between ERK1/2 and p38 may play an important role in controlling the replication of P. marneffei. Our findings further indicate a novel therapeutic avenue for treating P. marneffei by stimulating ERK1/2 or activating ERK1/2-dependent mechanisms.

  1. The mechanism of protein kinase C regulation

    Institute of Scientific and Technical Information of China (English)

    Julhash U. KAZI

    2011-01-01

    Protein kinase C (PKC) is a family ofserine/threonine protein kinases that plays a central role in transducing extracellular signals into a variety of intracellular responses ranging from cell proliferation to apoptosis.Nine PKC genes have been identified in the human genome,which encode 10 proteins.Each member of this protein kinase family displays distinct biochemical characteristics and is enriched in different cellular and subcellular locations.Activation of PKC has been implicated in the regulation of cell growth and differentiation.This review summarizes works of the past years in the field of PKC biochemistry that covers regulation and activation mechanism of different PKC isoforms.

  2. Functional analysis of anomeric sugar kinases.

    Science.gov (United States)

    Conway, Louis P; Voglmeir, Josef

    2016-09-02

    Anomeric sugar kinases perform fundamental roles in the metabolism of carbohydrates. Under- or overexpression of these enzymes, or mutations causing functional impairments can give rise to diseases such as galactosaemia and so the study of this class of kinase is of critical importance. In addition, anomeric sugar kinases which are naturally promiscuous, or have been artificially made so, may find application in the synthesis of libraries of drug candidates (for example, antibiotics), and natural or unnatural oligosaccharides and glycoconjugates. In this review, we provide an overview of the biological functions of these enzymes, the tools which have been developed to investigate them, and the current frontiers in their study.

  3. Proteomic and functional genomic landscape of receptor tyrosine kinase and ras to extracellular signal-regulated kinase signaling.

    Science.gov (United States)

    Friedman, Adam A; Tucker, George; Singh, Rohit; Yan, Dong; Vinayagam, Arunachalam; Hu, Yanhui; Binari, Richard; Hong, Pengyu; Sun, Xiaoyun; Porto, Maura; Pacifico, Svetlana; Murali, Thilakam; Finley, Russell L; Asara, John M; Berger, Bonnie; Perrimon, Norbert

    2011-10-25

    Characterizing the extent and logic of signaling networks is essential to understanding specificity in such physiological and pathophysiological contexts as cell fate decisions and mechanisms of oncogenesis and resistance to chemotherapy. Cell-based RNA interference (RNAi) screens enable the inference of large numbers of genes that regulate signaling pathways, but these screens cannot provide network structure directly. We describe an integrated network around the canonical receptor tyrosine kinase (RTK)-Ras-extracellular signal-regulated kinase (ERK) signaling pathway, generated by combining parallel genome-wide RNAi screens with protein-protein interaction (PPI) mapping by tandem affinity purification-mass spectrometry. We found that only a small fraction of the total number of PPI or RNAi screen hits was isolated under all conditions tested and that most of these represented the known canonical pathway components, suggesting that much of the core canonical ERK pathway is known. Because most of the newly identified regulators are likely cell type- and RTK-specific, our analysis provides a resource for understanding how output through this clinically relevant pathway is regulated in different contexts. We report in vivo roles for several of the previously unknown regulators, including CG10289 and PpV, the Drosophila orthologs of two components of the serine/threonine-protein phosphatase 6 complex; the Drosophila ortholog of TepIV, a glycophosphatidylinositol-linked protein mutated in human cancers; CG6453, a noncatalytic subunit of glucosidase II; and Rtf1, a histone methyltransferase.

  4. Isoprenoid biosynthesis and mevalonate kinase deficiency

    NARCIS (Netherlands)

    Henneman, L.

    2011-01-01

    Mevalonaat Kinase Deficiëntie (MKD) is een aangeboren ziekte geassocieerd met heftige koortsaanvallen die drie tot vier dagen aanhouden en gepaard gaan met koude rillingen, gewrichtsklachten, huiduitslag, hoofdpijn, duizeligheid, buikpijn, braken en diarree. De koortsaanvallen treden gemiddeld eens

  5. The role of MAP4K3 in lifespan regulation of Caenorhabditiselegans

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Maruf H. [Barshop Institute for Longevity and Aging Studies, Department of Physiology, University of Texas Health Science Center, San Antonio, TX 78240 (United States); Hart, Matthew J., E-mail: HartMJ@uthscsa.edu [Barshop Institute for Longevity and Aging Studies, Department of Molecular Medicine, University of Texas Health Science Center, San Antonio, TX 78240 (United States); Rea, Shane L., E-mail: reas3@uthscsa.edu [Barshop Institute for Longevity and Aging Studies, Department of Physiology, University of Texas Health Science Center, San Antonio, TX 78240 (United States)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Inhibition of MAP4K3 by RNAi leads to increased mean lifespan in Caenorhabditis elegans. Black-Right-Pointing-Pointer Mutation in the citron homology domain of MAP4K3 leads to increased mean lifespan. Black-Right-Pointing-Pointer Mutation in the kinase domain of MAP4K3 has no significant effect on mean lifespan. -- Abstract: The TOR pathway is a kinase signaling pathway that regulates cellular growth and proliferation in response to nutrients and growth factors. TOR signaling is also important in lifespan regulation - when this pathway is inhibited, either naturally, by genetic mutation, or by pharmacological means, lifespan is extended. MAP4K3 is a Ser/Thr kinase that has recently been found to be involved in TOR activation. Unexpectedly, the effect of this protein is not mediated via Rheb, the more widely known TOR activation pathway. Given the role of TOR in growth and lifespan control, we looked at how inhibiting MAP4K3 in Caenorhabditiselegans affects lifespan. We used both feeding RNAi and genetic mutants to look at the effect of MAP4K3 deficiency. Our results show a small but significant increase in mean lifespan in MAP4K3 deficient worms. MAP4K3 thus represents a new target in the TOR pathway that can be targeted for pharmacological intervention to control lifespan.

  6. A Molecular Brake in the Kinase Hinge Region Regulates the Activity of Receptor Tyrosine Kinases

    Energy Technology Data Exchange (ETDEWEB)

    Chen,H.; Ma, J.; Li, W.; Eliseenkova, A.; Xu, C.; Neubert, T.; Miller, W.; Mohammadi, M.

    2007-01-01

    Activating mutations in the tyrosine kinase domain of receptor tyrosine kinases (RTKs) cause cancer and skeletal disorders. Comparison of the crystal structures of unphosphorylated and phosphorylated wild-type FGFR2 kinase domains with those of seven unphosphorylated pathogenic mutants reveals an autoinhibitory 'molecular brake' mediated by a triad of residues in the kinase hinge region of all FGFRs. Structural analysis shows that many other RTKs, including PDGFRs, VEGFRs, KIT, CSF1R, FLT3, TEK, and TIE, are also subject to regulation by this brake. Pathogenic mutations activate FGFRs and other RTKs by disengaging the brake either directly or indirectly.

  7. AKT (protein kinase B) is implicated in meiotic maturation of porcine oocytes.

    Science.gov (United States)

    Kalous, Jaroslav; Kubelka, Michal; Solc, Petr; Susor, Andrej; Motlík, Jan

    2009-10-01

    The aim of this study was to investigate the involvement of the serine/threonine protein kinase AKT (also called protein kinase B) in the control of meiosis of porcine denuded oocytes (DOs) matured in vitro. Western blot analysis revealed that the two principal AKT phosphorylation sites, Ser473 and Thr308, are phosphorylated at different stages of meiosis. In freshly isolated germinal vesicle (GV)-stage DOs, Ser473 was already phosphorylated. After the onset of oocyte maturation, the intensity of the Ser473 phosphorylation increased, however, which declined sharply when DOs underwent GV breakdown (GVBD) and remained at low levels in metaphase I- and II-stage (MI- and MII-stage). In contrast, phosphorylation of Thr308 was increased by the time of GVBD and reached maximum at MI-stage. A peak of AKT activity was noticed around GVBD and activity of AKT declined at MI-stage. To assess the role of AKT during meiosis, porcine DOs were cultured in 50 microM SH-6, a specific inhibitor of AKT. In SH-6-treated DOs, GVBD was not inhibited; on the contrary, a significant acceleration of meiosis resumption was observed. The dynamics of the Ser473 phosphorylation was not affected; however, phosphorylation of Thr308 was reduced, AKT activity was diminished at the time of GVBD, and meiotic progression was arrested in early MI-stage. Moreover, the activity of the cyclin-dependent kinase 1 (CDK1) and MAP kinase declined when SH-6-treated DOs underwent GVBD, indicating that AKT activity is involved in the regulation of CDK1 and MAP kinase. These results suggest that activity of AKT is not essential for induction of GVBD in porcine oocytes but plays a substantial role during progression of meiosis to MI/MII-stage.

  8. Mapping the Heart

    Science.gov (United States)

    Hulse, Grace

    2012-01-01

    In this article, the author describes how her fourth graders made ceramic heart maps. The impetus for this project came from reading "My Map Book" by Sara Fanelli. This book is a collection of quirky, hand-drawn and collaged maps that diagram a child's world. There are maps of her stomach, her day, her family, and her heart, among others. The…

  9. Fibronectin phosphorylation by ecto-protein kinase

    Energy Technology Data Exchange (ETDEWEB)

    Imada, Sumi; Sugiyama, Yayoi; Imada, Masaru (Meiji Institute of Health Science, Odawara (Japan))

    1988-12-01

    The presence of membrane-associated, extracellular protein kinase (ecto-protein kinase) and its substrate proteins was examined with serum-free cultures of Swiss 3T3 fibroblast. When cells were incubated with ({gamma}-{sup 32})ATP for 10 min at 37{degree}C, four proteins with apparent molecular weights between 150 and 220 kDa were prominently phosphorylated. These proteins were also radiolabeled by lactoperoxidase catalyzed iodination and were sensitive to mild tryptic digestion, suggesting that they localized on the cell surface or in the extracellular matrix. Phosphorylation of extracellular proteins with ({gamma}-{sup 32}P)ATP in intact cell culture is consistent with the existence of ecto-protein kinase. Anti-fibronectin antibody immunoprecipitated one of the phosphoproteins which comigrated with a monomer and a dimer form of fibronectin under reducing and nonreducing conditions of electrophoresis, respectively. The protein had affinity for gelatin as demonstrated by retention with gelatin-conjugated agarose. This protein substrate of ecto-protein kinase was thus concluded to be fibronectin. The sites of phosphorylation by ecto-protein kinase were compared with those of intracellularly phosphorylated fibronectin by the analysis of radiolabeled amino acids and peptides. Ecto-protein kinase phosphorylated fibronectin at serine and threonine residues which were distinct from the sites of intracellular fibronectin phosphorylation.

  10. USGS Map Indices Overlay Map Service from The National Map

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The USGS Map Indices service from The National Map (TNM) consists of 1x1 Degree, 30x60 Minute (100K), 15 Minute (63K), 7.5 Minute (24K), and 3.75 Minute grid...

  11. Activation of brain B-Raf protein kinase by Rap1B small GTP-binding protein.

    Science.gov (United States)

    Ohtsuka, T; Shimizu, K; Yamamori, B; Kuroda, S; Takai, Y

    1996-01-19

    Rap1 small GTP-binding protein has the same amino acid sequence at its effector domain as that of Ras. Rap1 has been shown to antagonize the Ras functions, such as the Ras-induced transformation of NIH 3T3 cells and the Ras-induced activation of the c-Raf-1 protein kinase-dependent mitogen-activated protein (MAP) kinase cascade in Rat-1 cells, whereas we have shown that Rap1 as well as Ras stimulates DNA synthesis in Swiss 3T3 cells. We have established a cell-free assay system in which Ras activates bovine brain B-Raf protein kinase. Here we have used this assay system and examined the effect of Rap1 on the B-Raf activity to phosphorylate recombinant MAP kinase kinase (MEK). Recombinant Rap1B stimulated the activity of B-Raf, which was partially purified from bovine brain and immunoprecipitated by an anti-B-Raf antibody. The GTP-bound form was active, but the GDP-bound form was inactive. The fully post-translationally lipid-modified form was active, but the unmodified form was nearly inactive. The maximum B-Raf activity stimulated by Rap1B was nearly the same as that stimulated by Ki-Ras. Rap1B enhanced the Ki-Ras-stimulated B-Raf activity in an additive manner. These results indicate that not only Ras but also Rap1 is involved in the activation of the B-Raf-dependent MAP kinase cascade.

  12. Intracellular Theileria annulata promote invasive cell motility through kinase regulation of the host actin cytoskeleton.

    Directory of Open Access Journals (Sweden)

    Min Ma

    2014-03-01

    Full Text Available The intracellular, protozoan Theileria species parasites are the only eukaryotes known to transform another eukaryotic cell. One consequence of this parasite-dependent transformation is the acquisition of motile and invasive properties of parasitized cells in vitro and their metastatic dissemination in the animal, which causes East Coast Fever (T. parva or Tropical Theileriosis (T. annulata. These motile and invasive properties of infected host cells are enabled by parasite-dependent, poorly understood F-actin dynamics that control host cell membrane protrusions. Herein, we dissected functional and structural alterations that cause acquired motility and invasiveness of T. annulata-infected cells, to understand the molecular basis driving cell dissemination in Tropical Theileriosis. We found that chronic induction of TNFα by the parasite contributes to motility and invasiveness of parasitized host cells. We show that TNFα does so by specifically targeting expression and function of the host proto-oncogenic ser/thr kinase MAP4K4. Blocking either TNFα secretion or MAP4K4 expression dampens the formation of polar, F-actin-rich invasion structures and impairs cell motility in 3D. We identified the F-actin binding ERM family proteins as MAP4K4 downstream effectors in this process because TNFα-induced ERM activation and cell invasiveness are sensitive to MAP4K4 depletion. MAP4K4 expression in infected cells is induced by TNFα-JNK signalling and maintained by the inhibition of translational repression, whereby both effects are parasite dependent. Thus, parasite-induced TNFα promotes invasive motility of infected cells through the activation of MAP4K4, an evolutionary conserved kinase that controls cytoskeleton dynamics and cell motility. Hence, MAP4K4 couples inflammatory signaling to morphodynamic processes and cell motility, a process exploited by the intracellular Theileria parasite to increase its host cell's dissemination capabilities.

  13. Google Maps: You Are Here

    Science.gov (United States)

    Jacobsen, Mikael

    2008-01-01

    Librarians use online mapping services such as Google Maps, MapQuest, Yahoo Maps, and others to check traffic conditions, find local businesses, and provide directions. However, few libraries are using one of Google Maps most outstanding applications, My Maps, for the creation of enhanced and interactive multimedia maps. My Maps is a simple and…

  14. -Deformed nonlinear maps

    Indian Academy of Sciences (India)

    Ramaswamy Jaganathan; Sudeshna Sinha

    2005-03-01

    Motivated by studies on -deformed physical systems related to quantum group structures, and by the elements of Tsallis statistical mechanics, the concept of -deformed nonlinear maps is introduced. As a specific example, a -deformation procedure is applied to the logistic map. Compared to the canonical logistic map, the resulting family of -logistic maps is shown to have a wider spectrum of interesting behaviours, including the co-existence of attractors – a phenomenon rare in one-dimensional maps.

  15. VEGETATION MAPPING IN WETLANDS

    Directory of Open Access Journals (Sweden)

    F. PEDROTTI

    2004-01-01

    Full Text Available The current work examines the main aspects of wetland vegetation mapping, which can be summarized as analysis of the ecological-vegetational (ecotone gradients; vegetation complexes; relationships between vegetation distribution and geomorphology; vegetation of the hydrographic basin lo which the wetland in question belongs; vegetation monitoring with help of four vegetation maps: phytosociological map of the real and potential vegetation, map of vegetation dynamical tendencies, map of vegetation series.

  16. Identification of a kinase profile that predicts chromosome damage induced by small molecule kinase inhibitors.

    Directory of Open Access Journals (Sweden)

    Andrew J Olaharski

    2009-07-01

    Full Text Available Kinases are heavily pursued pharmaceutical targets because of their mechanistic role in many diseases. Small molecule kinase inhibitors (SMKIs are a compound class that includes marketed drugs and compounds in various stages of drug development. While effective, many SMKIs have been associated with toxicity including chromosomal damage. Screening for kinase-mediated toxicity as early as possible is crucial, as is a better understanding of how off-target kinase inhibition may give rise to chromosomal damage. To that end, we employed a competitive binding assay and an analytical method to predict the toxicity of SMKIs. Specifically, we developed a model based on the binding affinity of SMKIs to a panel of kinases to predict whether a compound tests positive for chromosome damage. As training data, we used the binding affinity of 113 SMKIs against a representative subset of all kinases (290 kinases, yielding a 113x290 data matrix. Additionally, these 113 SMKIs were tested for genotoxicity in an in vitro micronucleus test (MNT. Among a variety of models from our analytical toolbox, we selected using cross-validation a combination of feature selection and pattern recognition techniques: Kolmogorov-Smirnov/T-test hybrid as a univariate filter, followed by Random Forests for feature selection and Support Vector Machines (SVM for pattern recognition. Feature selection identified 21 kinases predictive of MNT. Using the corresponding binding affinities, the SVM could accurately predict MNT results with 85% accuracy (68% sensitivity, 91% specificity. This indicates that kinase inhibition profiles are predictive of SMKI genotoxicity. While in vitro testing is required for regulatory review, our analysis identified a fast and cost-efficient method for screening out compounds earlier in drug development. Equally important, by identifying a panel of kinases predictive of genotoxicity, we provide medicinal chemists a set of kinases to avoid when designing

  17. Contribution of ATM and ATR kinase pathways to p53-mediated response in etoposide and methyl methanesulfonate induced DNA damage.

    Science.gov (United States)

    Sun, Bin; Ross, Susan M; Rowley, Sean; Adeleye, Yeyejide; Clewell, Rebecca A

    2017-03-01

    p53 is a key integrator of cellular response to DNA damage, supporting post-translational repair and driving transcription-mediated responses including cell cycle arrest, apoptosis, and repair. DNA damage sensing kinases recognize different types of DNA damage and initiate specific responses through various post-translational modifications of p53. This study evaluated chemical specificity of the p53 pathway response by manipulating p53 or its upstream kinases and assessing the effect on DNA damage and cellular responses to prototype chemicals: etoposide (ETP, topoisomerase II inhibitor) and methyl methane sulfonate (MMS, alkylating agent). p53-deficient cells demonstrated reduced accumulation of the p53 target proteins MDM2, p21, and Wip1; reduced apoptotic response; and increased DNA damage (p-H2AX and micronuclei) with both chemicals. However, p53 was not essential for cell cycle arrest in HT1080 or HCT116 cells. The two chemicals induced different patterns of kinase activation, particularly in terms of Chk 1, Chk 2, p38, and ERK 1/2. However, inhibition of the ATM pathway showed a greater effect on p53 activtation, apoptosis, and accumulation of DNA damage than ATR-Chk 1 or the MAP kinases regardless of the chemical used. These results indicate that ATM is the predominant upstream kinase responsible for activation of the p53-mediated DNA damage response for both MMS and ETP, though the downstream kinase response is markedly different. Environ. Mol. Mutagen. 58:72-83, 2017. © 2017 Wiley Periodicals, Inc.

  18. Amoebic Liver Abscess. A Case Report

    OpenAIRE

    2013-01-01

    A amebíase é uma das doenças parasitárias mais comuns no mundo. As principais formas invasivas da doença são a colite amebiana e o abcesso hepático. Apresenta-se o caso clínico de um homem de 42 anos admitido com um quadro agudo de febre elevada e dor abdominal no hipocôndrio direito com dois dias de evolução. A tomografia axial computorizada do abdómen revelou a presença de 3 lesões abcedadas a nível do lobo direito do fígado. Tratando-se de um doente residente em área endémica de ameb...

  19. Amoebic liver abscess production by Entamoeba dispar.

    Science.gov (United States)

    Dolabella, Silvio S; Serrano-Luna, Jesús; Navarro-García, Fernando; Cerritos, René; Ximénez, Cecilia; Galván-Moroyoqui, José Manuel; Silva, Edward F; Tsutsumi, Víctor; Shibayama, Mineko

    2012-01-01

    Although Entamoeba dispar displays a similar morphology to Entamoeba histolytica, cellular and molecular studies have revealed significant differences between these two amoebae, including the former being characterized as non-pathogenic and the later as pathogenic. However, recent in vivo and in vitro experiments have shown that E. dispar strains of different origin are capable of causing liver damage and destroying cell culture lines in the presence of common intestinal bacteria. These results suggested that E. dispar may present pathogenic behavior according to the specific E. dispar strain, culture and environmental conditions. To investigate this possibility, we carried out in vivo and in vitro studies using a xenic strain E. dispar (ICB-ADO) isolated from a symptomatic non-dysenteric Brazilian patient. This strain was able to induce liver necrosis in a hamster model that was more severe than that produced by E. histolytica. The ICB-ADO isolate also caused significantly more destruction of cultured MDCK cells and increased loss of transepithelial resistance than did the E. histolytica. Xenic E. dispar exhibited high proteolytic activity, which was partially inhibited by the addition of cysteine-protease inhibitors. Based on our biochemical and molecular characterization of E. dispar (ICB-ADO) xenic culture and its ability to produce liver abscesses, we conclude that this specific strain can indeed produce tissue damage, distinct from the frequently used non- pathogenic E. dispar SAW 760 strain.

  20. Assignment of the protein kinase C [delta] polypeptide gene (PRKCD) to human chromosome 3 and mouse chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Huppi, K.; Siwarski, D.; Goodnight, J.; Mischak, H. (Molecular Genetics Section Lab. of Genetics, Bethesda, MD (United States))

    1994-01-01

    The protein kinase C (pkc) enzymes are a family of serine-threonine protein kinases, each encoded by a distinct and separate gene. The chromosomal locations of human PRKCA, PRKCB, and PRKCG have previously been established. The authors now report that PRKCD, a novel member of the pkc gene family, maps to human chromosome 3. The chromosomal location of Pkcd has also been determined in the mouse by analysis of recombination frequency in an interspecific panel of back-cross mice. They find that the locus encoding pkcd resides proximal to nucleoside phosphorylase (Np-2) and Tcra on mouse chromosome 14 in a region syntenic with human 3p. 9 refs., 2 tabs.

  1. Assignment of the protein kinase C delta polypeptide gene (PRKCD) to human chromosome 3 and mouse chromosome 14.

    Science.gov (United States)

    Huppi, K; Siwarski, D; Goodnight, J; Mischak, H

    1994-01-01

    The protein kinase C (pkc) enzymes are a family of serine-threonine protein kinases, each encoded by a distinct and separate gene. The chromosomal locations of human PRKCA, PRKCB, and PRKCG have previously been established. We now report that PRKCD, a novel member of the pkc gene family, maps to human chromosome 3. The chromosomal location of Pkcd has also been determined in the mouse by analysis of recombination frequency in an interspecific panel of backcross mice. We find that the locus encoding pkcd resides proximal to nucleoside phosphorylase (Np-2) and Tcra on mouse chromosome 14 in a region syntenic with human 3p.

  2. Mixed lineage kinase 3 is required for matrix metalloproteinase expression and invasion in ovarian cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhan, Yu; Abi Saab, Widian F.; Modi, Nidhi; Stewart, Amanda M. [Department of Biological Sciences, The University of Toledo, 2801 W. Bancroft, Toledo, OH 43606 (United States); Liu, Jinsong [Department of Pathology, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 (United States); Chadee, Deborah N., E-mail: deborah.chadee@utoledo.edu [Department of Biological Sciences, The University of Toledo, 2801 W. Bancroft, Toledo, OH 43606 (United States)

    2012-08-15

    Mixed lineage kinase 3 (MLK3) is a mitogen-activated protein kinase kinase kinase (MAP3K) that activates MAPK signaling pathways and regulates cellular responses such as proliferation, migration and apoptosis. Here we report high levels of total and phospho-MLK3 in ovarian cancer cell lines in comparison to immortalized nontumorigenic ovarian epithelial cell lines. Using small interfering RNA (siRNA)-mediated gene silencing, we determined that MLK3 is required for the invasion of SKOV3 and HEY1B ovarian cancer cells. Furthermore, mlk3 silencing substantially reduced matrix metalloproteinase (MMP)-1, -2, -9 and -12 gene expression and MMP-2 and -9 activities in SKOV3 and HEY1B ovarian cancer cells. MMP-1, -2, -9 and-12 expression, and MLK3-induced activation of MMP-2 and MMP-9 requires both extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) activities. In addition, inhibition of activator protein-1 (AP-1) reduced MMP-1, MMP-9 and MMP-12 gene expression. Collectively, these findings establish MLK3 as an important regulator of MMP expression and invasion in ovarian cancer cells. -- Highlights: Black-Right-Pointing-Pointer Ovarian cancer cell lines have high levels of total and phosphorylated MLK3. Black-Right-Pointing-Pointer MLK3 is required for MMP expression and activity in ovarian cancer cells. Black-Right-Pointing-Pointer MLK3 is required for invasion of SKOV3 and HEY1B ovarian cancer cells. Black-Right-Pointing-Pointer MLK3-dependent regulation of MMP-2 and MMP-9 activities requires ERK and JNK.

  3. Web Mapping Using Logo on Map

    Directory of Open Access Journals (Sweden)

    Ximing Hou

    2012-12-01

    Full Text Available The newly proposed Logo on Map (LoM system consists of three modules: picture extraction module (PEM, logo matching module (LMM and web mapping module (WMM. Since the first two modules were covered in our previous paper, the third module WMM is described here to present a complete LoM system. Current research is focused on geo-location distribution of brands on Google Maps. Pictures taken by ordinary people are extracted using Picture Extraction Module (PEM. The pictures containing relevant logos are obtained via Logo Matching Module (LMM. Brand distributions are overlaid on Google Maps. In this paper, GPS and brands are briefly described, and the implementation of Web Mapping Module (WMM based on Google Maps API is detailed. Then several experiments are carried out on the selected top brands. Finally the LMM-pictures are mapped on the Google Maps and the geographical distributions of the brands are visualised. Brand uniqueness is discussed and conclusion is drawn that with unique brand names web mapping can visually reflect the real economic activities of a company in the world.

  4. Nuclear Localization Signal and p53 Binding Site in MAP/ERK Kinase Kinase 1 (MEKK1)

    Science.gov (United States)

    Chipps, Elizabeth; Protzman, April; Muhi, M. Zubayed; Ando, Shoko; Calvet, James P.; Islam, M. Rafiq

    2015-01-01

    Previously, we showed that Mekk1 translocates to the nucleus, interacts with tumor suppressor protein p53 and co-represses PKD1 transcription via an atypical p53 binding site on the minimal PKD1 promoter (JBC 285:38818-38831, 2010). In this study, we report the mechanisms of Mekk1 nuclear transport and p53 binding. Using GFP-linked constitutively active-Mekk1 (CA-Mekk1) and a deletion strategy, we identified a nuclear localization signal (HRDVK) located at amino acid (aa) residues 1349–1353 in the C-terminal Mekk1 catalytic domain. Deletion of this sequence in CA-Mekk1 and full-length Mekk1 significantly reduced their nuclear translocation in both HEK293T and COS-1 cells. Using co-immunoprecipitation we identified an adjacent sequence (GANLID, aa 1354–1360) in Mekk1 responsible for p53 binding. Deletion of this sequence markedly reduced the interaction of Mekk1 with p53. Mekk1 does not appear to affect phosphorylation of Ser15, located in the Mdm2 interaction site, or other Ser residues in p53. However, Mekk1 mediates p53 protein stability in the presence of Mdm2 and reduces p53 ubiquitination, suggesting an interference with Mdm2-mediated degradation of p53 by the ubiquitin-proteasome pathway. PMID:26018553

  5. Non-degradative Ubiquitination of Protein Kinases.

    Directory of Open Access Journals (Sweden)

    K Aurelia Ball

    2016-06-01

    Full Text Available Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well.

  6. Crystal structure of Cryptosporidium parvum pyruvate kinase.

    Directory of Open Access Journals (Sweden)

    William J Cook

    Full Text Available Pyruvate kinase plays a critical role in cellular metabolism of glucose by serving as a major regulator of glycolysis. This tetrameric enzyme is allosterically regulated by different effector molecules, mainly phosphosugars. In response to binding of effector molecules and substrates, significant structural changes have been identified in various pyruvate kinase structures. Pyruvate kinase of Cryptosporidium parvum is exceptional among known enzymes of protozoan origin in that it exhibits no allosteric property in the presence of commonly known effector molecules. The crystal structure of pyruvate kinase from C. parvum has been solved by molecular replacement techniques and refined to 2.5 Å resolution. In the active site a glycerol molecule is located near the γ-phosphate site of ATP, and the protein structure displays a partially closed active site. However, unlike other structures where the active site is closed, the α6' helix in C. parvum pyruvate kinase unwinds and assumes an extended conformation. In the crystal structure a sulfate ion is found at a site that is occupied by a phosphate of the effector molecule in many pyruvate kinase structures. A new feature of the C. parvum pyruvate kinase structure is the presence of a disulfide bond cross-linking the two monomers in the asymmetric unit. The disulfide bond is formed between cysteine residue 26 in the short N-helix of one monomer with cysteine residue 312 in a long helix (residues 303-320 of the second monomer at the interface of these monomers. Both cysteine residues are unique to C. parvum, and the disulfide bond remained intact in a reduced environment. However, the significance of this bond, if any, remains unknown at this time.

  7. Non-degradative Ubiquitination of Protein Kinases.

    Science.gov (United States)

    Ball, K Aurelia; Johnson, Jeffrey R; Lewinski, Mary K; Guatelli, John; Verschueren, Erik; Krogan, Nevan J; Jacobson, Matthew P

    2016-06-01

    Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well.

  8. Mitogen-activated protein kinase pathways in osteoblasts.

    Science.gov (United States)

    Greenblatt, Matthew B; Shim, Jae-Hyuck; Glimcher, Laurie H

    2013-01-01

    Mitogen-activated protein kinases (MAPKs) are ancient signal transducers well characterized as mediators of inflammation and neoplastic transformation. Recent work has expanded our understanding of their developmental functions, particularly in the regulation of bone mass via control of osteoblast differentiation. Here, we review the functions of MAPK pathways in osteoblasts, including a consideration of MAPK substrates. In particular, MAPKs function to regulate the key transcriptional mediators of osteoblast differentiation, with ERK and p38 MAPKs phosphorylating RUNX2, the master regulator of osteoblast differentiation. ERK also activates RSK2, which in turn phosphorylates ATF4, a transcriptional regulator of late-stage osteoblast synthetic functions. The MAP3Ks and MAP2Ks upstream of MAPKs have also been investigated, and significant differences have been found in the wiring of MAPK pathways in osteoblasts relative to other tissues. Thus, the investigation of MAPKs in osteoblasts has both revealed critical mechanisms for the maintenance of bone mass and added to our understanding of how the individual components of MAPK pathways function in concert in a complex in vivo system.

  9. A systematic evaluation of protein kinase A-A-kinase anchoring protein interaction motifs

    NARCIS (Netherlands)

    Burgers, Pepijn P; van der Heyden, MAG; Kok, Bart; Heck, Albert J R; Scholten, Arjen

    2015-01-01

    Protein kinase A (PKA) in vertebrates is localized to specific locations in the cell via A-kinase anchoring proteins (AKAPs). The regulatory subunits of the four PKA isoforms (RIα, RIβ, RIIα, and RIIβ) each form a homodimer, and their dimerization domain interacts with a small helical region present

  10. Phosphorylation of nm23/nucleoside diphosphate kinase by casein kinase 2 in vitro

    DEFF Research Database (Denmark)

    Engel, M; Issinger, O G; Lascu, I;

    1994-01-01

    We have investigated phosphorylation of human nucleoside diphosphate kinase (NDPK) and of homologous NDPK from different species by human casein kinase 2 (CK-2). The human NDPK isotypes A and B were phosphorylated by CK-2 in vitro both when the purified proteins and total lysate of HL-60 leukemia...

  11. Homo- and heterodimerization of ROCO kinases: LRRK2 kinase inhibition by the LRRK2 ROCO fragment.

    Science.gov (United States)

    Klein, Christian L; Rovelli, Giorgio; Springer, Wolfdieter; Schall, Christoph; Gasser, Thomas; Kahle, Philipp J

    2009-11-01

    Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are the most common cause of autosomal-dominant familial and late-onset sporadic Parkinson's disease (PD). LRRK2 is a large multi-domain protein featuring a GTP-binding C-terminal of Ras of complex proteins (ROC) (ROCO) domain combination unique for the ROCO protein family, directly followed by a kinase domain. Dimerization is a well-established phenomenon among protein kinases. Here, we confirm LRRK2 self-interaction, and provide evidence for general homo- and heterodimerization potential among the ROCO kinase family (LRRK2, LRRK1, and death-associated protein kinase 1). The ROCO domain was critically, though not exclusively involved in dimerization, as a LRRK2 deletion mutant lacking the ROCO domain retained dimeric properties. GTP binding did not appear to influence ROCO(LRRK2) self-interaction. Interestingly, ROCO(LRRK2) fragments exerted an inhibitory effect on both wild-type and the elevated G2019S LRRK2 autophosphorylation activity. Insertion of PD mutations into ROCO(LRRK2) reduced self-interaction and led to a reduction of LRRK2 kinase inhibition. Collectively, these results suggest a functional link between ROCO interactions and kinase activity of wild-type and mutant LRRK2. Importantly, our finding of ROCO(LRRK2) fragment-mediated LRRK2 kinase inhibition offers a novel lead for drug design and thus might have important implications for new therapeutic avenues in PD.

  12. Pro-life role for c-Jun N-terminal kinase and p38 mitogen-activated protein kinase at rostral ventrolateral medulla in experimental brain stem death

    Directory of Open Access Journals (Sweden)

    Chang Alice YW

    2012-11-01

    Full Text Available Abstract Background Based on an experimental brain stem death model, we demonstrated previously that activation of the mitogen-activated protein kinase kinase 1/2 (MEK1/2/extracellular signal-regulated kinase 1/2 (ERK1/2/mitogen-activated protein kinase signal-interacting kinase 1/2 (MNK1/2 cascade plays a pro-life role in the rostral ventrolateral medulla (RVLM, the origin of a life-and-death signal detected from systemic arterial pressure, which sequentially increases (pro-life and decreases (pro-death to reflect progressive dysfunction of central cardiovascular regulation during the advancement towards brain stem death in critically ill patients. The present study assessed the hypothesis that, in addition to ERK1/2, c-Jun NH2-terminal kinase (JNK and p38 mitogen-activated protein kinase (p38MAPK, the other two mammalian members of MAPKs that are originally identified as stress-activated protein kinases, are activated specifically by MAPK kinase 4 (MAP2K4 or MAP2K6 and play a pro-life role in RVLM during experimental brain stem death. We further delineated the participation of phosphorylating activating transcriptional factor-2 (ATF-2 and c-Jun, the classical transcription factor activated by JNK or p38MAPK, in this process. Results An experimental model of brain stem death that employed microinjection of the organophosphate insecticide mevinphos (Mev; 10 nmol bilaterally into RVLM of Sprague–Dawley rats was used, alongside cardiovascular, pharmacological and biochemical evaluations. Results from ELISA showed that whereas the total JNK, p38MAPK, MAP2K4 and MAP2K6 were not affected, augmented phosphorylation of JNK at Thr183 and Tyr185 and p38MAPK at Thr180 and Tyr182, accompanied by phosphorylation of their upstream activators MAP2K4 at Ser257 and Thr261 and MAP2K6 at Ser207 and Thr211 in RVLM occurred preferentially during the pro-life phase of experimental brain stem death. Moreover, the activity of transcription factors ATF-2 at Thr71 and

  13. Mapping in the cloud

    CERN Document Server

    Peterson, Michael P

    2014-01-01

    This engaging text provides a solid introduction to mapmaking in the era of cloud computing. It takes students through both the concepts and technology of modern cartography, geographic information systems (GIS), and Web-based mapping. Conceptual chapters delve into the meaning of maps and how they are developed, covering such topics as map layers, GIS tools, mobile mapping, and map animation. Methods chapters take a learn-by-doing approach to help students master application programming interfaces and build other technical skills for creating maps and making them available on the Internet. Th

  14. Mapping with Drupal

    CERN Document Server

    Palazzolo, Alan

    2011-01-01

    Build beautiful interactive maps on your Drupal website, and tell engaging visual stories with your data. This concise guide shows you how to create custom geographical maps from top to bottom, using Drupal 7 tools and out-of-the-box modules. You'll learn how mapping works in Drupal, with examples on how to use intuitive interfaces to map local events, businesses, groups, and other custom data. Although building maps with Drupal can be tricky, this book helps you navigate the system's complexities for creating sophisticated maps that match your site design. Get the knowledge and tools you ne

  15. Coded MapReduce

    OpenAIRE

    Li, Songze; Maddah-Ali, Mohammad Ali; Avestimehr, A. Salman

    2015-01-01

    MapReduce is a commonly used framework for executing data-intensive jobs on distributed server clusters. We introduce a variant implementation of MapReduce, namely "Coded MapReduce", to substantially reduce the inter-server communication load for the shuffling phase of MapReduce, and thus accelerating its execution. The proposed Coded MapReduce exploits the repetitive mapping of data blocks at different servers to create coding opportunities in the shuffling phase to exchange (key,value) pair...

  16. Some Semi - Equivelar Maps

    CERN Document Server

    Upadhyay, Ashish K; Maity, Dipendu

    2011-01-01

    Semi-Equivelar maps are generalizations of Archimedean Solids (as are equivelar maps of the Platonic solids) to the surfaces other than $2-$Sphere. We classify some semi equivelar maps on surface of Euler characteristic -1 and show that none of these are vertex transitive. We establish existence of 12-covered triangulations for this surface. We further construct double cover of these maps to show existence of semi-equivelar maps on the surface of double torus. We also construct several semi-equivelar maps on the surfaces of Euler characteristics -8 and -10 and on non-orientable surface of Euler characteristics -2.

  17. Parabolic-like maps

    CERN Document Server

    Lomonaco, Luciana Luna Anna

    2011-01-01

    In this paper we introduce the notion of parabolic-like mapping, which is an object similar to a polynomial-like mapping, but with a parabolic external class, i.e. an external map with a parabolic fixed point. We prove a straightening theorem for parabolic-like maps, which states that any parabolic-like map of degree 2 is hybrid conjugate to a member of the family Per_1(1), and this member is unique (up to holomorphic conjugacy) if the filled Julia set of the parabolic-like map is connected.

  18. Tyrosine kinase BMX phosphorylates phosphotyrosine-primed motif mediating the activation of multiple receptor tyrosine kinases.

    Science.gov (United States)

    Chen, Sen; Jiang, Xinnong; Gewinner, Christina A; Asara, John M; Simon, Nicholas I; Cai, Changmeng; Cantley, Lewis C; Balk, Steven P

    2013-05-28

    The nonreceptor tyrosine kinase BMX (bone marrow tyrosine kinase gene on chromosome X) is abundant in various cell types and activated downstream of phosphatidylinositol-3 kinase (PI3K) and the kinase Src, but its substrates are unknown. Positional scanning peptide library screening revealed a marked preference for a priming phosphorylated tyrosine (pY) in the -1 position, indicating that BMX substrates may include multiple tyrosine kinases that are fully activated by pYpY sites in the kinase domain. BMX phosphorylated focal adhesion kinase (FAK) at Tyr⁵⁷⁷ subsequent to its Src-mediated phosphorylation at Tyr⁵⁷⁶. Loss of BMX by RNA interference or by genetic deletion in mouse embryonic fibroblasts (MEFs) markedly impaired FAK activity. Phosphorylation of the insulin receptor in the kinase domain at Tyr¹¹⁸⁹ and Tyr¹¹⁹⁰, as well as Tyr¹¹⁸⁵, and downstream phosphorylation of the kinase AKT at Thr³⁰⁸ were similarly impaired by BMX deficiency. However, insulin-induced phosphorylation of AKT at Ser⁴⁷³ was not impaired in Bmx knockout MEFs or liver tissue from Bmx knockout mice, which also showed increased insulin-stimulated glucose uptake, possibly because of decreased abundance of the phosphatase PHLPP (PH domain leucine-rich repeat protein phosphatase). Thus, by identifying the pYpY motif as a substrate for BMX, our findings suggest that BMX functions as a central regulator among multiple signaling pathways mediated by tyrosine kinases.

  19. Raf kinase inhibitory protein: a signal transduction modulator and metastasis suppressor

    Institute of Scientific and Technical Information of China (English)

    Alexey E Granovsky; Marsha Rich Rosner

    2008-01-01

    Cells have a multitude of controls to maintain their integrity and prevent random switching from one biological state to another. Raf Kinase Inhibitory Protein (RKIP), a member of the phosphatidylethanolamine binding protein (PEBP) family, is representative of a new class of modulators of signaling cascades that function to maintain the "yin yang" or balance of biological systems. RKIP inhibits MAP kinase (Raf-MEK-ERK), G protein-coupled receptor (GPCR) kinase and NFkB signaling cascades. Because RKIP targets different kinases dependent upon its state of phosphorylation, RKIP also acts to integrate crosstalk initiated by multiple environmental stimuli. Loss or depletion of RKIP results in disruption of the normal cellular stasis and can lead to chromosomal abnormalities and disease states such as cancer. Since RKIP and the PEBP family have been reviewed previously, the goal of this analysis is to provide an update and highlight some of the unique features of RKIP that make it a critical player in the regulation of cellular signaling processes.

  20. SRC kinase regulation in progressively invasive cancer.

    Directory of Open Access Journals (Sweden)

    Weichen Xu

    Full Text Available Metastatic progression is a multistep process that involves tumor growth and survival, motility and invasion, and subsequent proliferation in an inappropriate environment. The Src protein tyrosine kinase has been implicated in many of the biochemical pathways that drive these behaviors. Although Src itself is only rarely mutated in human tumors, its aberrant activity has been noted in various cancers and suggested to serve as a barometer of metastatic potential. With these features in mind, we examined Src kinase regulation at the structural, enzymatic, and expression levels as a function of progressively invasive prostate cancer cell lines. Surprisingly, both total Src content and kinase activity decrease with increasing cell line aggressiveness, an observation that appears to be inconsistent with the well-documented role of Src in the signaling pathways that drive growth and invasion. However, we do observe a direct correlation between Src kinase specific activity (total Src kinase activity/total Src content and metastatic aggressiveness, possibly suggesting that in highly aggressive cell lines, key signaling enzymes are globally recruited to drive the cancerous phenotype. In addition, although the expected enhanced phosphorylation of Src at Tyr-416 (activation site is present in the most aggressive prostate cancer cell lines, unexpectedly high phosphorylation levels at the Tyr-527 inhibitory site are observed as well. The latter, rather than representative of inhibited enzyme, is more indicative of primed Src responsive to local phosphorylated binding partners.

  1. Therapeutic Innovations: Tyrosine Kinase Inhibitors in Cancer

    Directory of Open Access Journals (Sweden)

    Nikolaos Dervisis

    2016-01-01

    Full Text Available Conventional cytotoxic chemotherapy involving DNA-interacting agents and indiscriminate cell death is no longer the future of cancer management. While chemotherapy is not likely to completely disappear from the armamentarium; the use of targeted therapies in combination with conventional treatment is becoming the standard of care in human medicine. Tyrosine kinases are pivotal points of functional cellular pathways and have been implicated in malignancy, inflammatory, and immune-mediated diseases. Pharmaceutical interventions targeting aberrant tyrosine kinase signaling has exploded and is the second most important area of drug development. The “Valley of Death” between drug discovery and approval threatens to blunt the enormous strides in cancer management seen thus far. Kinase inhibitors, as targeted small molecules, hold promise in the treatment and diagnosis of cancer. However, there are still many unanswered questions regarding the use of kinase inhibitors in the interpretation and management of cancer. Comparative oncology has the potential to address restrictions and limitations in the advancement in kinase inhibitor therapy.

  2. Protein Kinases and Parkinson’s Disease

    Science.gov (United States)

    Mehdi, Syed Jafar; Rosas-Hernandez, Hector; Cuevas, Elvis; Lantz, Susan M.; Barger, Steven W.; Sarkar, Sumit; Paule, Merle G.; Ali, Syed F.; Imam, Syed Z.

    2016-01-01

    Currently, the lack of new drug candidates for the treatment of major neurological disorders such as Parkinson’s disease has intensified the search for drugs that can be repurposed or repositioned for such treatment. Typically, the search focuses on drugs that have been approved and are used clinically for other indications. Kinase inhibitors represent a family of popular molecules for the treatment and prevention of various cancers, and have emerged as strong candidates for such repurposing because numerous serine/threonine and tyrosine kinases have been implicated in the pathobiology of Parkinson’s disease. This review focuses on various kinase-dependent pathways associated with the expression of Parkinson’s disease pathology, and evaluates how inhibitors of these pathways might play a major role as effective therapeutic molecules. PMID:27657053

  3. Crystal structure of human nicotinamide riboside kinase.

    Science.gov (United States)

    Khan, Javed A; Xiang, Song; Tong, Liang

    2007-08-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD(+) as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 A resolution and in a ternary complex with ADP and tiazofurin at 2.7 A resolution. The active site is located in a groove between the central parallel beta sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  4. Crystal Structure of Human Nicotinamide Riboside Kinase

    Energy Technology Data Exchange (ETDEWEB)

    Khan,J.; Xiang, S.; Tong, L.

    2007-01-01

    Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD{sup +} as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 {angstrom} resolution and in a ternary complex with ADP and tiazofurin at 2.7 {angstrom} resolution. The active site is located in a groove between the central parallel {beta} sheet core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.

  5. MapBook

    Data.gov (United States)

    National Aeronautics and Space Administration — Beginning with the systematic mapping of the lunar surface more than three decades ago, this database contains over 1600 maps of the planets and satellites of the...

  6. NGS Survey Control Map

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The NGS Survey Control Map provides a map of the US which allows you to find and display geodetic survey control points stored in the database of the National...

  7. Letter of Map Revision

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The National Flood Hazard Layer (NFHL) data incorporates all Digital Flood Insurance Rate Map(DFIRM) databases published by FEMA, and any Letters Of Map Revision...

  8. NAIP Status Maps Gallery

    Data.gov (United States)

    Farm Service Agency, Department of Agriculture — NAIP Status Maps Gallery. These maps illustrate what aerial imagery collection is planned, whats been collected, when it is available and how it is available. These...

  9. Mapping Medicare Disparities Tool

    Data.gov (United States)

    U.S. Department of Health & Human Services — The CMS Office of Minority Health has designed an interactive map, the Mapping Medicare Disparities Tool, to identify areas of disparities between subgroups of...

  10. Improving wetland mapping techniques

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Mapping wetland extent, structure and invasives using radar imagery. Acquiring optical, thermal, LIDAR, and RADAR images and analysis for improved wetland mapping,...

  11. Recovery Action Mapping Tool

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Recovery Action Mapping Tool is a web map that allows users to visually interact with and query actions that were developed to recover species listed under the...

  12. Invariants for Parallel Mapping

    Institute of Scientific and Technical Information of China (English)

    YIN Yajun; WU Jiye; FAN Qinshan; HUANG Kezhi

    2009-01-01

    This paper analyzes the geometric quantities that remain unchanged during parallel mapping (i.e., mapping from a reference curved surface to a parallel surface with identical normal direction). The second gradient operator, the second class of integral theorems, the Gauss-curvature-based integral theorems, and the core property of parallel mapping are used to derive a series of parallel mapping invadants or geometri-cally conserved quantities. These include not only local mapping invadants but also global mapping invari-ants found to exist both in a curved surface and along curves on the curved surface. The parallel mapping invadants are used to identify important transformations between the reference surface and parallel surfaces. These mapping invadants and transformations have potential applications in geometry, physics, biome-chanics, and mechanics in which various dynamic processes occur along or between parallel surfaces.

  13. Mapping Mutations on Phylogenies

    DEFF Research Database (Denmark)

    Nielsen, Rasmus

    2005-01-01

    This chapter provides a short review of recent methodologies developed for mapping mutations on phylogenies. Mapping of mutations, or character changes in general, using the maximum parsimony principle has been one of the most powerful tools in phylogenetics, and it has been used in a variety...... of different applications, for example, in the detection of correlated evolution and to identify selection acting on DNA sequences. However, many uses of parsimony mappings have been criticized because they focus on only one of many possible mappings and/or because they do not incorporate statistical...... uncertainty in the mapping. Recently developed probabilistic methods can incorporate statistical uncertainty in the character mappings. In these methods, focus is on a probability distribution of mutational mappings instead of a single estimate of the mutational mapping....

  14. Lying with Maps

    OpenAIRE

    Monmonier, Mark

    2005-01-01

    Darrell Huff’s How to Lie with Statistics was the inspiration for How to Lie with Maps, in which the author showed that geometric distortion and graphic generalization of data are unavoidable elements of cartographic representation. New examples of how ill-conceived or deliberately contrived statistical maps can greatly distort geographic reality demonstrate that lying with maps is a special case of lying with statistics. Issues addressed include the effects of map scale on geometry and featu...

  15. Structural insights into the recognition of β3 integrin cytoplasmic tail by the SH3 domain of Src kinase.

    Science.gov (United States)

    Katyal, Priya; Puthenveetil, Robbins; Vinogradova, Olga

    2013-10-01

    Src kinase plays an important role in integrin signaling by regulating cytoskeletal organization and cell remodeling. Previous in vivo studies have revealed that the SH3 domain of c-Src kinase directly associates with the C-terminus of β3 integrin cytoplasmic tail. Here, we explore this binding interface with a combination of different spectroscopic and computational methods. Chemical shift mapping, PRE, transferred NOE and CD data were used to obtain a docked model of the complex. This model suggests a different binding mode from the one proposed through previous studies wherein, the C-terminal end of β3 spans the region in between the RT and n-Src loops of SH3 domain. Furthermore, we show that tyrosine phosphorylation of β3 prevents this interaction, supporting the notion of a constitutive interaction between β3 integrin and Src kinase.

  16. Cloning and expression of the heterodimeric deoxyguanosine kinase/deoxyadenosine kinase of Lactobacillus acidophilus R-26.

    Science.gov (United States)

    Ma, G T; Hong, Y S; Ives, D H

    1995-03-24

    Two uniquely paired deoxynucleoside kinases, deoxycytidine kinase/deoxyadenosine kinase (dCK/dAK) and deoxyguanosine kinase/deoxyadenosine kinase (dGK/dAK) are required, together with thymidine kinase (TK), for deoxynucleotide synthesis in Lactobacillus acidophilus R-26. Using polymerase chain reaction-generated probes based on N-terminal amino acid sequences, we have cloned tandem genes for 25- and 26-kDa polypeptides, whose derived amino acid sequences and size correspond to wild-type Lactobacillus enzyme subunits. Expression in Escherichia coli uses a single endogenous promoter and yields active dGK/dAK (approximately 3% of extracted protein) closely resembling wild-type dGK/dAK in specificity, kinetics, heterotropic activation, and end product inhibition. Alignment of cloned genes reveals 65% identity in their DNA sequences and 61% identity in derived amino acid sequences. Comparison with herpes-viral TKs reveals three conserved regions: glycine- and arginine-rich ATP-binding motifs and a D/E-R-S/H motif at the putative TK deoxynucleoside site. Greater homology, however, is seen upon multiple alignment of dGK with mammalian deoxycytidine kinases, yielding the consensus sequence-D/E-R-S-I/V-Y-x-D-.dGK also shares a sequence (-Y-D-P-T-I/L-E-D-S/Y-Y-) required for GTP hydrolysis by p21ras.

  17. CMP kinase from Escherichia coli is structurally related to other nucleoside monophosphate kinases.

    Science.gov (United States)

    Bucurenci, N; Sakamoto, H; Briozzo, P; Palibroda, N; Serina, L; Sarfati, R S; Labesse, G; Briand, G; Danchin, A; Bărzu, O; Gilles, A M

    1996-02-02

    CMP kinase from Escherichia coli is a monomeric protein of 225 amino acid residues. The protein exhibits little overall sequence similarities with other known NMP kinases. However, residues involved in binding of substrates and/or in catalysis were found conserved, and sequence comparison suggested conservation of the global fold found in adenylate kinases or in several CMP/UMP kinases. The enzyme was purified to homogeneity, crystallized, and analyzed for its structural and catalytic properties. The crystals belong to the hexagonal space group P6(3), have unit cell parameters a = b = 82.3 A and c = 60.7 A, and diffract x-rays to a 1.9 A resolution. The bacterial enzyme exhibits a fluorescence emission spectrum with maximum at 328 nm upon excitation at 295 nm, which suggests that the single tryptophan residue (Trp30) is located in a hydrophobic environment. Substrate specificity studies showed that CMP kinase from E. coli is active with ATP, dATP, or GTP as donors and with CMP, dCMP, and arabinofuranosyl-CMP as acceptors. This is in contrast with CMP/UMP kinase from Dictyostelium discoideum, an enzyme active on CMP or UMP but much less active on the corresponding deoxynucleotides. Binding of CMP enhanced the affinity of E. coli CMP kinase for ATP or ADP, a particularity never described in this family of proteins that might explain inhibition of enzyme activity by excess of nucleoside monophosphate.

  18. Purification and kinase assay of PKN.

    Science.gov (United States)

    Mukai, Hideyuki; Ono, Yoshitaka

    2006-01-01

    PKN is a serine/threonine protein kinase, which has a catalytic domain highly homologous to that of protein kinase C (PKC) in the carboxyl-terminal region and three repeats of the antiparallel coiled coil (ACC) domain in the amino-terminal region. Mammalian PKN has three isoforms each derived from different genes, PKN1 (PKNalpha/PRK1/PAK1), PKN2 (PRK2/PAK2/PKNgamma), and PKN3 (PKNbeta). PKN isoforms show different enzymatic properties and tissue distributions and have been implicated in various distinct cellular processes (reviewed in Mukai [2003]). This chapter discusses methods to prepare purified enzymes and to assay substrate phosphorylation activities.

  19. Rational design of protein kinase inhibitors

    Directory of Open Access Journals (Sweden)

    Yarmoluk S. M.

    2013-07-01

    Full Text Available Modern methodological approaches to rational design of low molecular weight compounds with specific activity in relation to predetermined biomolecular targets are considered by example of development of high effective protein kinase inhibitors. The application of new computational methods that allow to significantly improve the quality of computational experiments (in, particular, accuracy of low molecular weight compounds activity prediction without increase of computational and time costs are highlighted. The effectiveness of strategy of rational design is demonstrated by examples of several own investigations devoted to development of new inhibitors that are high effective and selective towards protein kinases CK2, FGFR1 and ASK1.

  20. Lipid activators of protein kinase C

    Energy Technology Data Exchange (ETDEWEB)

    Chauhan, V.P.S.; Chauhan, A.; Deshmukh, D.S.; Brockerhoff, H. (New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY (USA))

    1990-01-01

    Among the many reported lipid activators of protein kinase C only those of high affinity can be considered true physiological effectors, at present the tumor promoters, e.g., phorbol esters; 1,2-diacyl-sn-glycerols; and phosphatidylinositol 4,5-bisphosphate. Many other compounds (including arachidonic acid) are activators at high, unphysiological concentrations only, and they seem to be sterically unsuited for bonding to the enzyme. Such pseudoactivators possibly act by scrambling the structure of the regulatory moiety of the kinase.