WorldWideScience

Sample records for aminopeptidases

  1. [Endocellular aminopeptidase from Astasia longa].

    Science.gov (United States)

    Rudenskaia, Iu A; Aseev, V V; Rudensaia, G N

    2008-01-01

    A new aminopeptidase was isolated from the biomass of the flagellate Astasia longa by precipitation with ammonium sulfate, gel filtration, and affinity chromatography on Arginine-Silochrome in 41% yield and with purification degree 490. The enzyme is irreversible inhibited by mercury chloride, EDTA, o-phenanthroline and, partially, bestatin and zinc chloride. It has an optimum pH 8.5 toward the hydrolysis of a synthetic chromogenic substrate Ala-pNA. The enzyme molecular mass is 45 kDa, isoelectric point 5.5, and temperature optimum 45 degrees C. The enzyme most effectively hydrolyzes p-nitroanilides of alanine, arginine, and leucine; it is classified as metalloaminopeptidase. PMID:18672681

  2. Arginine specific aminopeptidase from Lactobacillus brevis

    Directory of Open Access Journals (Sweden)

    Arya Nandan

    2010-12-01

    Full Text Available The proteolytic system of lactic acid bacteria contribute to the development of flavor during the ripening of cheese through the generation of short peptides and free amino acids, which directly or indirectly act as flavor precursors. Newly isolated lactic acid bacteria (LAB as well as those procured from culture collection centers were screened for the production of various substrate specific aminopeptidases. Among all the strains screened, L. brevis (NRRL B-1836 was found to produce quantifiable amount of intracellular arginine specific aminopeptidase (EC 3.4.11.6. The productivity of arginine aminopeptidase in 5 L fermentor was 36 IU/L/h. The Luedeking and Piret model was tested for intracellular production of aminopeptidase and the data seemed to fit well, as the correlation coefficient was 0.9964 for MRS. The αAP and βAP was 0.4865 and 0.0046, respectively in MRS medium indicating that the yield was predominantly depended on growth. The culture produced lactic acid and also tolerated pH 2.0-3.0 and 0.3-0.5% bile salts, the most important probiotic features.

  3. Novel selective inhibitors of aminopeptidases that generate antigenic peptides.

    Science.gov (United States)

    Papakyriakou, Athanasios; Zervoudi, Efthalia; Theodorakis, Emmanuel A; Saveanu, Loredana; Stratikos, Efstratios; Vourloumis, Dionisios

    2013-09-01

    Endoplasmic reticulum aminopeptidases, ERAP1 and ERAP2, as well as Insulin regulated aminopeptidase (IRAP) play key roles in antigen processing, and have recently emerged as biologically important targets for manipulation of antigen presentation. Taking advantage of the available structural and substrate-selectivity data for these enzymes, we have rationally designed a new series of inhibitors that display low micromolar activity. The selectivity profile for these three highly homologous aminopeptidases provides a promising avenue for modulating intracellular antigen processing. PMID:23916253

  4. Purification and characterization of an immunogenic aminopeptidase of Brucella melitensis.

    Science.gov (United States)

    Contreras-Rodriguez, Araceli; Ramirez-Zavala, Bernardo; Contreras, Andrea; Schurig, Gerhardt G; Sriranganathan, Nammalwar; Lopez-Merino, Ahide

    2003-09-01

    An immunogenic aminopeptidase was purified from Brucella melitensis strain VTRM1. The purification procedure consisted of ammonium sulfate fractionation and three chromatographic steps. This procedure resulted in a yield of 29% and a 144-fold increase in specific activity. The aminopeptidase appeared to be a monomeric enzyme with a molecular mass of 96 kDa and an isoelectric point of 4.8. Its activity was optimal at pH 7.0 at 40 degrees C. The enzyme was strongly inhibited by EDTA, 1,10-phenathroline, and divalent cations (Zn(2+) and Hg(2+)), suggesting that this protein was a metalloaminopeptidase. The enzyme showed preference for alanine at the N termini of aminoacyl derivatives. The K(m) values for L-alanine-p-nitroanilide (Ala-pNA) and Lys-pNA were 0.35 and 0.18 mM, respectively. The N-terminal sequence of aminopeptidase was used for a homologous search in the genomes of B. melitensis 16M and Brucella suis 1330. The analysis revealed an exact match of the probe sequence (36 bp) with an open reading frame of 2,652 bp encoding a protein predicted to be alanyl aminopeptidase (aminopeptidase N). Collectively, these data suggest designation of the B. melitensis enzyme as an aminopeptidase N. The aminopeptidase was recognized by sera from patients with acute and chronic brucellosis, suggesting that the enzyme may have important diagnostic implications. PMID:12933870

  5. Identification and Characterization of Novel Inhibitors of Mammalian Aspartyl Aminopeptidase

    OpenAIRE

    Chen, Yuanyuan; Tang, Hong; Seibel, William; Papoian, Ruben; Oh, Ki; Li, Xiaoyu; Zhang, Jianye; Golczak, Marcin; Palczewski, Krzysztof; Kiser, Philip D.

    2014-01-01

    Aspartyl aminopeptidase (DNPEP) has been implicated in the control of angiotensin signaling and endosome trafficking, but its precise biologic roles remain incompletely defined. We performed a high-throughput screen of ∼25,000 small molecules to identify inhibitors of DNPEP for use as tools to study its biologic functions. Twenty-three confirmed hits inhibited DNPEP-catalyzed hydrolysis of angiotensin II with micromolar potency. A counter screen against glutamyl aminopeptidase (ENPEP), an enz...

  6. Transcytosis of Aminopeptidase N in caco-2 cells is mediated by a Non-cytoplasmic Signal

    DEFF Research Database (Denmark)

    Vogel, L K; Norén, Ove; Sjöström, H

    1995-01-01

    transmembrane or cytoplasmic domain of aminopeptidase N for transport of aminopeptidase N by the indirect pathway by analysis of mutated forms of aminopeptidase N recombinantly expressed in Caco-2 cells. A tail-less and two secretory forms of aminopeptidase N, all deprived of the cytoplasmic tail, were...... transported to the basolateral plasma membrane in proportions equivalent to the wild type enzyme. This shows that no cytoplasmic basolateral sorting signal is involved in directing aminopeptidase N to the basolateral plasma membrane. Both the wild type and the tail-less aminopeptidase N were transcytosed from...

  7. Probing the S1 specificity pocket of the aminopeptidases that generate antigenic peptides

    OpenAIRE

    Zervoudi, Efthalia; Papakyriakou, Athanasios; Georgiadou, Dimitra; Evnouchidou, Irini; Gajda, Anna; Poreba, Marcin; Salvesen, Guy S.; Drag, Marcin; Hattori, Akira; Swevers, Luc; Vourloumis, Dionisios; Stratikos, Efstratios

    2011-01-01

    Abstract ER aminopeptidase 1 (ERAP1), ER aminopeptidase 2 (ERAP2) and Insulin Regulated aminopeptidase (IRAP) are three homologous enzymes that play critical roles in the generation of antigenic peptides. These aminopeptidases excise amino acids from N-terminally extended precursors of antigenic peptides in order to generate the correct length epitopes for binding onto MHC class I molecules. The specificity of these peptidases can affect antigenic peptide selection, but has not yet...

  8. Evidence for Catalytic Roles for Plasmodium falciparum Aminopeptidase P in the Food Vacuole and Cytosol*

    OpenAIRE

    Ragheb, Daniel; Bompiani, Kristin; Dalal, Seema; Klemba, Michael

    2009-01-01

    The metalloenzyme aminopeptidase P catalyzes the hydrolysis of amino acids from the amino termini of peptides with a prolyl residue in the second position. The human malaria parasite Plasmodium falciparum expresses a homolog of aminopeptidase P during its asexual intraerythrocytic cycle. P. falciparum aminopeptidase P (PfAPP) shares with mammalian cytosolic aminopeptidase P a three-domain, homodimeric organization and is most active with Mn(II) as the cofactor. A distinguishing feature of PfA...

  9. 21 CFR 184.1985 - Aminopeptidase enzyme preparation derived from lactococcus lactis.

    Science.gov (United States)

    2010-04-01

    ...) and 1 CFR part 51. Copies are available from the National Academy Press, 2101 Constitution Ave. NW... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Aminopeptidase enzyme preparation derived from... Aminopeptidase enzyme preparation derived from lactococcus lactis. (a) Aminopeptidase enzyme preparation...

  10. Advances in Bacterial Methionine Aminopeptidase Inhibition.

    Science.gov (United States)

    Helgren, Travis R; Wangtrakuldee, Phumvadee; Staker, Bart L; Hagen, Timothy J

    2016-01-01

    Methionine aminopeptidases (MetAPs) are metalloenzymes that cleave the N-terminal methionine from newly synthesized peptides and proteins. These MetAP enzymes are present in bacteria, and knockout experiments have shown that MetAP activity is essential for cell life, suggesting that MetAPs are good antibacterial drug targets. MetAP enzymes are also present in the human host and selectivity is essential. There have been significant structural biology efforts and over 65 protein crystal structures of bacterial MetAPs are deposited into the PDB. This review highlights the available crystallographic data for bacterial MetAPs. Structural comparison of bacterial MetAPs with human MetAPs highlights differences that can lead to selectivity. In addition, this review includes the chemical diversity of molecules that bind and inhibit the bacterial MetAP enzymes. Analysis of the structural biology and chemical space of known bacterial MetAP inhibitors leads to a greater understanding of this antibacterial target and the likely development of potential antibacterial agents. PMID:26268344

  11. A leakage of aminopeptidases from maturing fish and crayfish eggs

    Czech Academy of Sciences Publication Activity Database

    Barth, Tomislav; Barthová, Jana; Hauzerová, Linda; Kouřil, J.; Hamačková, J.; Kozák, P.; Bečková, P.

    Praha : ICARIS Ltd., 2003 - (Dick, R.). s. 48 [Enzymes in the Environment: Activity, Ecology and Applications. 14.07.2003-17.07.2003, Praha] R&D Projects: GA AV ČR IBS4055006 Institutional research plan: CEZ:AV0Z4055905 Keywords : crayfish eggs * aminopeptidases Subject RIV: CE - Biochemistry

  12. Puromycin-sensitive aminopeptidase: an antiviral prodrug activating enzyme.

    Science.gov (United States)

    Tehler, Ulrika; Nelson, Cara H; Peterson, Larryn W; Provoda, Chester J; Hilfinger, John M; Lee, Kyung-Dall; McKenna, Charles E; Amidon, Gordon L

    2010-03-01

    Cidofovir (HPMPC) is a broad-spectrum antiviral agent, currently used to treat AIDS-related human cytomegalovirus retinitis. Cidofovir has recognized therapeutic potential for orthopox virus infections, although its use is hampered by its inherent low oral bioavailability. Val-Ser-cyclic HPMPC (Val-Ser-cHPMPC) is a promising peptide prodrug which has previously been shown by us to improve the permeability and bioavailability of the parent compound in rodent models (Eriksson et al., 2008. Molecular Pharmaceutics 5, 598-609). Puromycin-sensitive aminopeptidase was partially purified from Caco-2 cell homogenates and identified as a prodrug activating enzyme for Val-Ser-cHPMPC. The prodrug activation process initially involves an enzymatic step where the l-Valine residue is removed by puromycin-sensitive aminopeptidase, a step that is bestatin-sensitive. Subsequent chemical hydrolysis results in the generation of cHPMPC. A recombinant puromycin-sensitive aminopeptidase was generated and its substrate specificity investigated. The k(cat) for Val-pNA was significantly lower than that for Ala-pNA, suggesting that some amino acids are preferred over others. Furthermore, the three-fold higher k(cat) for Val-Ser-cHPMPC as compared to Val-pNA suggests that the leaving group may play an important role in determining hydrolytic activity. In addition to its ability to hydrolyze a variety of substrates, these observations strongly suggest that puromycin-sensitive aminopeptidase is an important enzyme for activating Val-Ser-cHPMPC in vivo. Taken together, our data suggest that puromycin-sensitive aminopeptidase makes an attractive target for future prodrug design. PMID:19969024

  13. Placental Leucine Aminopeptidase- and Aminopeptidase A- Deficient Mice Offer Insight concerning the Mechanisms Underlying Preterm Labor and Preeclampsia

    Directory of Open Access Journals (Sweden)

    Shigehiko Mizutani

    2011-01-01

    Full Text Available Preeclampsia and preterm delivery are important potential complications in pregnancy and represent the leading causes for maternal and perinatal morbidity and mortality. The mechanisms underlying both diseases remain unknown, thus available treatments (beta2-stimulants and magnesium sulfate are essentially symptomatic. Both molecules have molecular weights less than 5–8 kDa, cross the placental barrier, and thus exert their effects on the fetus. The fetus produces peptides that are highly vasoactive and uterotonic and increase in response to maternal stress and with continued development. Fetal peptides are also small molecules that inevitably leak across into the maternal circulation. Aminopeptidases such as placental leucine aminopeptidase (P-LAP and aminopeptidase A (APA are large molecules that do not cross the placental barrier. We have shown that APA acts as an antihypertensive agent in the pregnant spontaneously hypertensive rat by degrading vasoactive peptides and as a result returns the animal to a normotensive state. P-LAP also acts as an antiuterotonic agent by degrading uterotonic peptides and thus prolongs gestation in the pregnant mouse. Given the ever increasing worldwide incidences of preeclampsia and preterm labor, it is imperative that new agents be developed to safely prolong gestation. We believe that the use of aminopeptidases hold promise in this regard.

  14. Genetic associations and functional characterization of M1 aminopeptidases and immune-mediated diseases.

    Science.gov (United States)

    Agrawal, N; Brown, M A

    2014-12-01

    Endosplasmic reticulum aminopeptidase 1 (ERAP1), endoplasmic reticulum aminopeptidase 2 (ERAP2) and puromycin-sensitive aminopeptidase (NPEPPS) are key zinc metallopeptidases that belong to the oxytocinase subfamily of M1 aminopeptidase family. NPEPPS catalyzes the processing of proteosome-derived peptide repertoire followed by trimming of antigenic peptides by ERAP1 and ERAP2 for presentation on major histocompatibility complex (MHC) Class I molecules. A series of genome-wide association studies have demonstrated associations of these aminopeptidases with a range of immune-mediated diseases such as ankylosing spondylitis, psoriasis, Behçet's disease, inflammatory bowel disease and type I diabetes, and significantly, genetic interaction between some aminopeptidases and HLA Class I loci with which these diseases are strongly associated. In this review, we highlight the current state of understanding of the genetic associations of this class of genes, their functional role in disease, and potential as therapeutic targets. PMID:25142031

  15. Genetic characterization of a polymorphic dipeptidyl aminopeptidase of Apis mellifera

    OpenAIRE

    Marco Antonio Del Lama,; Boraschi, Daniele; Ademilson Espencer Egea Soares,; Duran, Ximena

    2004-01-01

    International audience Dipeptidyl aminopeptidase (DAP) activity towards L-leucylglycine-$\\beta$-naphthylamide (Leu-Gly NA) was characterized in pupae and adult extracts of Apis mellifera. Enzyme activity was more conspicuous in pupae than in adult extracts and it seemed to be concentrated in digestive tract tissues. Two genetically determined electrophoretic variants were observed in honeybee samples from the USA and Chile; in Brazilian Africanized bees, two additional variants were observ...

  16. The M1 family of vertebrate aminopeptidases: role of evolutionarily conserved tyrosines in the enzymatic mechanism of aminopeptidase B.

    Science.gov (United States)

    Cadel, Sandrine; Darmon, Cécile; Pernier, Julien; Hervé, Guy; Foulon, Thierry

    2015-02-01

    Aminopeptidase B (Ap-B), a member of the M1 family of Zn(2+)-aminopeptidases, removes basic residues at the NH2-terminus of peptides and is involved in the in vivo proteolytic processing of miniglucagon and cholecystokinin-8. M1 enzymes hydrolyze numerous different peptides and are implicated in many physiological functions. As these enzymes have similar catalytic mechanisms, their respective substrate specificity and/or catalytic efficiency must be based on subtle structural differences at or near the catalytic site. This leads to the hypothesis that each primary structure contains a consensus structural template, strictly necessary for aminopeptidase activity, and a specific amino acid environment localized in or outside the catalytic pocket that finely tunes the substrate specificity and catalytic efficiency of each enzyme. A multiple sequence alignment of M1 peptidases from vertebrates allowed to identify conserved tyrosine amino acids, which are members of this catalytic backbone. In the present work, site-directed mutagenesis and 3D molecular modeling of Ap-B were used to specify the role of four fully (Y281, Y229, Y414, and Y441) and one partially (Y409) conserved residues. Tyrosine to phenylalanine mutations allowed confirming the influence of the hydroxyl groups on the enzyme activity. These groups are implicated in the reaction mechanism (Y414), in substrate specificity and/or catalytic efficiency (Y409), in stabilization of essential amino acids of the active site (Y229, Y409) and potentially in the maintenance of its structural integrity (Y281, Y441). The importance of hydrogen bonds is verified by the Y229H substitution, which preserves the enzyme activity. These data provide new insights into the catalytic mechanism of Ap-B in the M1 family of aminopeptidases. PMID:25530263

  17. Methionine aminopeptidase gene of Escherichia coli is essential for cell growth.

    OpenAIRE

    Chang, S. Y.; McGary, E C; Chang, S.

    1989-01-01

    We localized the methionine aminopeptidase (map) gene on the Escherichia coli chromosome next to the rpsB gene at min 4. Genetically modified strains with the chromosomal map gene under lac promoter control grew only in the presence of the lac operon inducer isopropyl-beta-thiogalactoside. Thus, methionine aminopeptidase is essential for cell growth.

  18. Biosynthesis of intestinal microvillar proteins. Expression of aminopeptidase N along the crypt-villus axis

    DEFF Research Database (Denmark)

    Danielsen, E M

    1984-01-01

    The expression of pig small-intestinal aminopeptidase N (EC 3.4.11.2) along the crypt-villus axis was studied in tangential sections of [35S]-methionine-labelled, organ-cultured explants. The only detectable molecular forms of aminopeptidase N along the crypt-villus axis were polypeptides of Mr 140...

  19. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  20. CD13 (human aminopeptidase N) mediates human cytomegalovirus infection.

    OpenAIRE

    Söderberg, C; Giugni, T D; Zaia, J A; Larsson, S.; Wahlberg, J M; Möller, E

    1993-01-01

    Human cytomegalovirus (HCMV) infects cells by a series of processes including attachment, penetration via fusion of the envelope with the plasma membrane, and transport of the viral DNA to the nucleus. The details of the early events of HCMV infection are poorly understood. We have recently reported that CD13, human aminopeptidase N, a metalloprotease, is present on blood cells susceptible in vitro to HCMV infection (C. Söderberg, S. Larsson, S. Bergstedt-Lindqvist, and E. Möller, J. Virol. 6...

  1. Zinc Regulation of Aminopeptidase B Involved in Neuropeptide Production

    OpenAIRE

    Hwang, Shin-Rong; Hook, Vivian

    2008-01-01

    Aminopeptidase B (AP-B) is a metallopeptidase that removes basic residues from the N-termini of neuropeptide substrates in secretory vesicles. This study assessed zinc regulation of AP-B activity, since secretory vesicles contain endogenous zinc. AP-B was inhibited by zinc at concentrations typically present in secretory vesicles. Zinc effects were dependent on concentration, incubation time, and the molar ratio of zinc to enzyme. AP-B activity was recovered upon removal of zinc. AP-B with zi...

  2. Functional characterization of X-prolyl aminopeptidase from Toxoplasma gondii.

    Science.gov (United States)

    Yang, Mingfa; Zheng, Jun; Jia, Honglin; Song, Mingxin

    2016-09-01

    In the present study, a recombinant aminopeptidase P (rTgAPP) from Toxoplasma gondii was expressed in Escherichia coli to evaluate its enzyme parameters. The rTgAPP showed strong activity against a synthetic substrate for aminopeptidase P at pH 8·0 with a K m value of 0·255 µ m and a k cat value of 35·6 s-1. The overall catalytic efficiency (k cat/K m) of the rTgAPP was 139·6 × 105 M-1 s-1. The activity of rTgAPP was enhanced by the addition of divalent cations and inhibited by bestatin. Deletion of TgAPP gene in the parasite through a CRISPR/Cas9 system resulted in inhibition of growth indicating the importance of TgAPP. Thus our findings reveal that TgAPP is an active enzyme in T. gondii and provide an insight into the function of TgAPP. PMID:27220680

  3. The Aminopeptidase Inhibitor CHR-2863 Is an Orally Bioavailable Inhibitor of Murine Malaria

    OpenAIRE

    Skinner-Adams, Tina S.; Peatey, Christopher L.; Anderson, Karen; Trenholme, Katharine R.; Krige, David; Christopher L. Brown; Stack, Colin; Nsangou, Desire M. M.; Mathews, Rency T.; Thivierge, Karine; Dalton, John P; GARDINER, DONALD L.

    2012-01-01

    Malaria remains a significant risk in many areas of the world, with resistance to the current antimalarial pharmacopeia an ever-increasing problem. The M1 alanine aminopeptidase (PfM1AAP) and M17 leucine aminopeptidase (PfM17LAP) are believed to play a role in the terminal stages of digestion of host hemoglobin and thereby generate a pool of free amino acids that are essential for parasite growth and development. Here, we show that an orally bioavailable aminopeptidase inhibitor, CHR-2863, is...

  4. HISTOCHEMICAL DISTRIBUTION OF LEUCINE AMINOPEPTIDASE (LAP-ase)IN THE YOUNG RABBIT INTESTINE

    OpenAIRE

    Sabatakou, O.; Xylouri-Frangiadaki, E.; Paraskevakou, E.

    2000-01-01

    Abstract not available. Sabatakou, O.; Xylouri-Frangiadaki, E.; Paraskevakou, E. (2000). HISTOCHEMICAL DISTRIBUTION OF LEUCINE AMINOPEPTIDASE (LAP-ase)IN THE YOUNG RABBIT INTESTINE. http://hdl.handle.net/10251/10176.

  5. Biosynthesis of intestinal microvillar proteins. Processing of aminopeptidase N by microsomal membranes

    DEFF Research Database (Denmark)

    Danielsen, E M; Norén, Ove; Sjöström, H

    1983-01-01

    that microsomal fractions should be added before about 25% of the polypeptide was synthesized to ensure processing to the high-mannose glycosylated form. This suggests that the signal sequence is situated in the N-terminal part of the aminopeptidase N. The size of the cell-free translation product in......The biosynthesis of small-intestinal aminopeptidase N (EC 3.4.11.2) was studied in a cell-free translation system derived from rabbit reticulocytes. When dog pancreatic microsomal fractions were present during translation, most of the aminopeptidase N synthesized was found in a membrane......-bound rather than a soluble form, indicating that synthesis of the enzyme takes place on ribosomes attached to the rough endoplasmic reticulum. The microsomal fractions process the Mr-115 000 polypeptide, which is the primary translation product of aminopeptidase N, to a polypeptide of Mr 140 000. This was...

  6. Antigenic peptide trimming by ER aminopeptidases – insights from structural studies

    OpenAIRE

    Stratikos, Efstratios; Stern, Lawrence J.

    2013-01-01

    Generation and destruction of antigenic peptides by ER resident aminopeptidases ERAP1 and ERAP2 have been shown in the last few years to be important for the correct functioning and regulation of the adaptive immune response. These two highly homologous aminopeptidases appear to have evolved complex mechanisms well suited for their biological role in antigen presentation. Furthermore, polymorphic variability in these enzymes appears to affect their function and predispose individuals to disea...

  7. Aminopeptidase N (APN)/CD13 inhibitor, Ubenimex, enhances radiation sensitivity in human cervical cancer

    OpenAIRE

    Nawa Akihiro; Terauchi Mikio; Kajiyama Hiroaki; Shibata Kiyosumi; Tsukamoto Hirohisa; Kikkawa Fumitaka

    2008-01-01

    Abstract Background Radiotherapy can be used to treat all stages of cervical cancer. For improving local control via radiotherapy, it is important to use additional antitumor agents. Aminopeptidase N (APN)/CD13, a 150-kDa metalloproteinase, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression in several human malignancies. Methods We investigated whether the suppression of APN/CD13...

  8. Purification and Characterization of an Aminopeptidase from Lactococcus lactis subsp. cremoris Wg2

    OpenAIRE

    Tan, P. S. T.; Konings, W. N.

    1990-01-01

    An aminopeptidase was purified to homogeneity from a crude cell extract of Lactococcus lactis subsp. cremoris Wg2 by a procedure that included diethyl-aminoethane-Sephacel chromatography, phenyl-Sepharose chromatography, gel filtration, and high-performance liquid chromatography over an anion-exchange column. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme showed a single protein band with a molecular weight of 95,000. The aminopeptidase was capable of degradi...

  9. Development of cognitive enhancers based on inhibition of insulin-regulated aminopeptidase

    OpenAIRE

    Chai, Siew Yeen; Yeatman, Holly R; Parker, Michael W.; Ascher, David B.; Thompson, Philip E.; Mulvey, Hayley T; Albiston, Anthony L.

    2008-01-01

    The peptides angiotensin IV and LVV-hemorphin 7 were found to enhance memory in a number of memory tasks and reverse the performance deficits in animals with experimentally induced memory loss. These peptides bound specifically to the enzyme insulin-regulated aminopeptidase (IRAP), which is proposed to be the site in the brain that mediates the memory effects of these peptides. However, the mechanism of action is still unknown but may involve inhibition of the aminopeptidase activity of IRAP,...

  10. Endoplasmic reticulum aminopeptidases in the pathogenesis of ankylosing spondylitis.

    Science.gov (United States)

    Kenna, Tony J; Robinson, Philip C; Haroon, Nigil

    2015-09-01

    There has been significant progress in our understanding of the pathogenesis of AS. The advent of genome-wide association studies has increased the known loci associated with AS to more than 40. The endoplasmic reticulum resident aminopeptidases (ERAP) 1 and 2 were identified in this manner and are of particular interest. There appears to be a genetic as well as a functional interaction of ERAP1 and 2 with HLA-B27 based on the known functions of these molecules. Recent studies on the structure, immunological effects and the peptide-trimming properties of ERAP 1 and 2 have helped to provide insight into their pathogenic potential in AS. In this review, we explore the role of ERAP 1 and 2 in the pathogenesis of AS. PMID:26070942

  11. Substrate-dependent nitric oxide synthesis by secreted endoplasmic reticulum aminopeptidase 1 in macrophages.

    Science.gov (United States)

    Goto, Yoshikuni; Ogawa, Kenji; Nakamura, Takahiro J; Hattori, Akira; Tsujimoto, Masafumi

    2015-06-01

    In this study, we examined the role of aminopeptidases with reference to endoplasmic reticulum aminopeptidase 1 (ERAP1) in nitric oxide (NO) synthesis employing murine macrophage cell line RAW264.7 cells activated by lipopolysaccharide (LPS) and interferon (IFN)-γ and LPS-activated peritoneal macrophages derived from ERAP1 knockout mouse. When NO synthesis was measured in the presence of peptides having N-terminal Arg, comparative NO synthesis was seen with that measured in the presence of Arg. In the presence of an aminopeptidase inhibitor amastatin, NO synthesis in activated RAW264.7 cells was significantly decreased. These results suggest that aminopeptidases are involved in the NO synthesis in activated RAW264.7 cells. Subsequently, significant reduction of NO synthesis was observed in ERAP1 knockdown cells compared with wild-type cells. This reduction was rescued by exogenously added ERAP1. Furthermore, when peritoneal macrophages prepared from ERAP1 knockout mouse were employed, reduction of NO synthesis in knockout mouse macrophages was also attributable to ERAP1. In the presence of amastatin, further reduction was observed in knockout mouse-derived macrophages. Taken together, these results suggest that several aminopeptidases play important roles in the maximum synthesis of NO in activated macrophages in a substrate peptide-dependent manner and ERAP1 is one of the aminopeptidases involved in the NO synthesis. PMID:25577645

  12. Immunogold labelling is a quantitative method as demonstrated by studies on aminopeptidase N in microvillar membrane vesicles

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Wetterberg, L L; Sjöström, H;

    1992-01-01

    Microvillar membrane vesicle preparations with varying content of aminopeptidase N were prepared from enterocytes of the pig small intestine. Postembedding immunogold labelling of aminopeptidase N was performed on these glutaraldehyde/paraformaldehyde-fixed, osmium tetroxide-treated and Epon......-embedded microvillar membrane vesicles. The number of gold particles per micrometre microvillar membrane (labelling intensity) was calculated and compared to the corresponding enzymatic activity. A very close relationship was found between labelling intensity and aminopeptidase N activity, demonstrating that...

  13. Characterization of an N-glycosylated Bacillus subtilis leucine aminopeptidase expressed in Pichia pastoris.

    Science.gov (United States)

    Xi, Hongxing; Tian, Yaping; Zhou, Nandi; Zhou, Zhemin; Shen, Wei

    2015-02-01

    Aminopeptidase is an important flavorsome especially in protein hydrolysate debittering by removing hydrophobic amino acid residue at the N-terminal end. Besides, it is also applied to preparation of active peptides and analysis of protein sequence. In this study, leucine aminopeptidase from Bacillus subtilis was cloned and expressed in Pichia pastoris, a widely used heterologous protein expression host. Then it was purified and characterized. After methanol induction for 96 h, the aminopeptidase activity in culture supernatant reached 28.4 U ml(À1) , which was 7.1 times that of wild strain B. subtilis Zj016. The optimal temperature and pH of the purified recombinant enzyme were 60 °C and 8.5, respectively. The purified aminopeptidase was stable within 30-60 °C and pH 8.0-9.0. It was intensively inhibited by Ni(2β) , Ca(2β) , DL-dithiothreitol (DTT) and ethylene diamine tetraacetic acid (EDTA), but activated by Co(2β) . The Km toward leucine-p-nitroanilines (Leu-pNA) of the enzyme was 0.97 mM. The sequence analysis of aminopeptidase indicated three potential N-glycosylation sites and it was further verified via MALDI-TOF-MS analysis. Consequently, the N-glycosylated aminopeptidase exhibited higher thermostability and catalytic efficiency. The purified enzyme exhibited two bands through sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) while a single band can be identified when the enzyme was deglycosylated. Circular dichroism spectroscopy indicated that the secondary structure of recombinant aminopeptidase was similar to the wild-type. PMID:25389014

  14. Probing the S1 specificity pocket of the aminopeptidases that generate antigenic peptides: S1 specificity of ERAP1, ERAP2 and IRAP

    OpenAIRE

    Zervoudi, Efthalia; Papakyriakou, Athanasios; Georgiadou, Dimitra; Evnouchidou, Irini; Gajda, Anna; Poreba, Marcin; Salvesen, Guy S.; Drag, Marcin; Hattori, Akira; Swevers, Luc; Vourloumis, Dionisios; Stratikos, Efstratios

    2011-01-01

    ER aminopeptidase 1 (ERAP1), ER aminopeptidase 2 (ERAP2) and Insulin Regulated aminopeptidase (IRAP) are three homologous enzymes that play critical roles in the generation of antigenic peptides. These aminopeptidases excise amino acids from N-terminally extended precursors of antigenic peptides in order to generate the correct length epitopes for binding onto MHC class I molecules. The specificity of these peptidases can affect antigenic peptide selection, but has not yet been investigated i...

  15. Novel chromogenic aminopeptidase substrates for the detection and identification of clinically important microorganisms.

    Science.gov (United States)

    Cellier, Marie; James, Arthur L; Orenga, Sylvain; Perry, John D; Rasul, Ari K; Robinson, Shaun N; Stanforth, Stephen P

    2014-10-01

    A series of amino acid derivatives 8-10, 42 and 43 have been prepared as chromogenic enzyme substrates in order to detect aminopeptidase activity in clinically important Gram-negative and Gram-positive bacteria. Enzymatic hydrolysis liberates the amino acid moiety and either a 4-aminophenol or a 4-dialkylaminoaniline derivative which undergoes oxidative coupling with 1-naphthol or a substituted 1-naphthol giving an indophenol dye. Substrates and 1-naphthols were incorporated into an agar-based culture medium and this allowed growth of intensely coloured bacterial colonies based on hydrolysis by specific enzymes. Red/pink coloured colonies were produced by the substrates 8-10 and blue coloured colonies were formed by the substrates 42 and 43. The L-alanyl aminopeptidase substrates 8 targeted L-alanyl aminopeptidase activity and gave coloured colonies with a range of Gram-negative bacteria. Substrates 9 targeted β-alanyl aminopeptidase activity and generated coloured colonies with selected Gram-negative species including Pseudomonas aeruginosa. Three substrates for L-pyroglutamyl acid aminopeptidase (10a, 10c and 43) were hydrolysed by enterococci and Streptococcus pyogenes to generate coloured colonies. Two yeasts were also included in the study, but they did not produce coloured colonies with any of the substrates examined. PMID:25172150

  16. Characterisation of the aminopeptidase from non-germinated winter rape (Brassica napus L.) seeds.

    Science.gov (United States)

    Kania, Joanna; Gillner, Danuta M

    2016-09-15

    Rapeseed plays a crucial role in food and fuel industry. Since aminopeptidases take part in many physiological processes in all organisms, it is important to learn their role and characteristics in economically relevant plants. Extracts of non-germinated winter rape seeds were screened for aminopeptidase activity. Substrate specificity, the influence of pH and temperature, as well as effect of protease inhibitors and chosen metal ions on the aminopeptidase activity were determined. The approximate molecular weight estimated by NATIVE-PAGE and SDS-PAGE electrophoresis was ∼60 kDa. The partially purified enzyme as well as the aminopeptidases present in crude extract cleaved preferentially Phe-pNA. The activity profiles toward several substrates were also determined. Maximum activity was observed at pH 6.5 and temperature of 40 °C for Phe-pNA as a substrate. Two visible picks in the pH profile toward Phe-pNA, together with other results (IEF) suggest the presence of more than one aminopeptidase, having similar molecular mass. Much lower activity and broad pH profiles were observed for Leu- and Ala-pNA as substrates. PMID:27080895

  17. Biosynthesis of intestinal microvillar proteins. Pulse-chase labelling studies on maltase-glucoamylase, aminopeptidase A and dipeptidyl peptidase IV

    DEFF Research Database (Denmark)

    Danielsen, E M; Sjöström, H; Norén, Ove

    1983-01-01

    The biogenesis of three intestinal microvillar enzymes, maltase-glucoamylase (EC 3.2.1.20), aminopeptidase A (aspartate aminopeptidase, EC 3.4.11.7) and dipeptidyl peptidase IV (EC 3.4.14.5), was studied by pulse-chase labelling of pig small-intestinal explants kept in organ culture. The earliest...

  18. The alkylating prodrug J1 can be activated by aminopeptidase N, leading to a possible target directed release of melphalan

    DEFF Research Database (Denmark)

    Wickström, Malin; Viktorsson, Kristina; Lundholm, Lovisa; Aesoy, Reidun; Nygren, Helen; Sooman, Linda; Fryknäs, Mårten; Vogel, Lotte; Lewensohn, Rolf; Larsson, Rolf; Gullbo, Joachim

    2010-01-01

    could be inhibited in both magnitude and in time by bestatin, a broad spectrum inhibitor of the aminopeptidases, including the metalloproteinase aminopeptidase N (APN, EC 3.4.11.2.), and ebelactone A, an esterase inhibitor. These effects resulted, as expected, in decreased cytotoxic effects of J1. A...

  19. Altered glutamyl-aminopeptidase activity and expression in renal neoplasms

    International Nuclear Information System (INIS)

    Advances in the knowledge of renal neoplasms have demonstrated the implication of several proteases in their genesis, growth and dissemination. Glutamyl-aminopeptidase (GAP) (EC. 3.4.11.7) is a zinc metallopeptidase with angiotensinase activity highly expressed in kidney tissues and its expression and activity have been associated wtih tumour development. In this prospective study, GAP spectrofluorometric activity and immunohistochemical expression were analysed in clear-cell (CCRCC), papillary (PRCC) and chromophobe (ChRCC) renal cell carcinomas, and in renal oncocytoma (RO). Data obtained in tumour tissue were compared with those from the surrounding uninvolved kidney tissue. In CCRCC, classic pathological parameters such as grade, stage and tumour size were stratified following GAP data and analyzed for 5-year survival. GAP activity in both the membrane-bound and soluble fractions was sharply decreased and its immunohistochemical expression showed mild staining in the four histological types of renal tumours. Soluble and membrane-bound GAP activities correlated with tumour grade and size in CCRCCs. This study suggests a role for GAP in the neoplastic development of renal tumours and provides additional data for considering the activity and expression of this enzyme of interest in the diagnosis and prognosis of renal neoplasms

  20. Partial purification and characterization of an aminopeptidase from Eimeria tenella.

    Science.gov (United States)

    Fetterer, R H; Miska, K B; Barfield, R C

    2005-12-01

    Our previous investigation demonstrated the expression in Eimeria tenella sporulated oocysts of an aminopeptidase (AP) with strong homology to AP N. To further understand the role of proteases during development, we investigated the molecular and biochemical properties of E. tenella AP. Greater than 95% AP activity was present in a soluble extract during sporulation of oocysts with highest activity in fully sporulated oocysts. The AP activity was inhibited by the AP inhibitors bestatin and 1,6-phenanthroline, but not by serine protease inhibitors. The AP had specificity for synthetic endopeptidase substrates that contain arginine, alanine, or glycine at the N terminus. Partial purification of the enzyme yielded a major protein band with an Mr of about 106 kDa and an isoelectric point (Ip) of 5.1. Reverse transcription-polymerase chain reaction indicated that the gene for AP is expressed during sporulation, but expression is absent or greatly reduced in the sporozoites and merozoites. On the basis of the deduced gene structure, the predicted Mr is 110 kDa with a pI of 5.59. Database search indicates that the E. tenella AP shares significant homology with the AP from Apicomplexan taxa: Toxoplasma gondii, Cryptosporidium parvum, and Cryptosporidium hominis. Together, these results confirm the presence of a cytosolic AP related to AP N, which is expressed and active during sporulation of E. tenella oocysts. PMID:16539006

  1. Aminopeptidase N inhibition could be involved in the anti-angiogenic effect of dobesilates

    Directory of Open Access Journals (Sweden)

    Farsa Oldřich

    2015-01-01

    Full Text Available Calcium, magnesium and zinc 2,5-dihydroxybenzenesulfonates (dobesilates were synthesized by sulfonation of hydroquinone with sulfuric acid under mild conditions. To form the salts, neutralization with calcium carbonate followed by cation exchange by means of magnesium or zinc sulfates was performed. The dobesilates were characterized by standard spectral methods and by AAS for metal content and then tested for inhibitory activity against aminopeptidase N. Calcium and magnesium 2,5-dihydroxybenzene sulfonates exhibited rather weak inhibitory activity to aminopeptidase N as demonstrated by IC50 values of 978.0 and 832.1 mmol l-1 respectively while zinc 2,5-dihydroxybenzene sulfonate reached the more significant inhibitory activity characterized by IC50 77.4 mmol l-1. The inhibitory activity results suggest that the inhibition of aminopeptidase N could play a role in the anti-angiogenic activity of 2,5-dihydroxybenzenesulfonates.

  2. Organelles involved in the intracellular transport of newly synthesized aminopeptidase N and their acidity

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Danielsen, E M; Sjöström, H; Norén, Ove

    1989-01-01

    vesicles are exocytotic and that the low pH in the acid compartments is of no importance for intracellular transport and correct sorting of aminopeptidase N. Furthermore, our results show that the majority of the aminopeptidase N in the lysosomal/endosomal-like compartments is newly synthesized....... microvillar membrane, the Golgi complex, apical small smooth vesicles, and various acidic lysosomal/endosomal-like organelles. By culturing mucosal explants in the presence of either cycloheximide or (3-(2,4-dinitroanilino)-3-amino-N-methylpropylamine) (DAMP) it was demonstrated that the apical small smooth...

  3. Antigenic peptide trimming by ER aminopeptidases--insights from structural studies.

    Science.gov (United States)

    Stratikos, Efstratios; Stern, Lawrence J

    2013-10-01

    Generation and destruction of antigenic peptides by ER resident aminopeptidases ERAP1 and ERAP2 have been shown in the last few years to be important for the correct functioning and regulation of the adaptive immune response. These two highly homologous aminopeptidases appear to have evolved complex mechanisms well suited for their biological role in antigen presentation. Furthermore, polymorphic variability in these enzymes appears to affect their function and predispose individuals to disease. This review discusses our current understanding of the molecular mechanisms behind ERAP1/2 function as suggested by several recently determined crystallographic structures of these enzymes. PMID:23545452

  4. Novel leucine ureido derivatives as aminopeptidase N inhibitors. Design, synthesis and activity evaluation.

    Science.gov (United States)

    Ma, Chunhua; Cao, Jiangying; Liang, Xuewu; Huang, Yongxue; Wu, Ping; Li, Yingxia; Xu, Wenfang; Zhang, Yingjie

    2016-01-27

    Aminopeptidase N (APN/CD13) over-expressed on tumor cells and tumor microenvironment, plays critical roles in tumor invasion, metastasis and angiogenesis. Here we described the design, synthesis and preliminary activity studies of novel leucine ureido derivatives as aminopeptidase N (APN/CD13) inhibitors. The results showed that compound 7a had the most potent inhibitory activity against APN with the IC50 value of 20 nM, which could be used for further anticancer agent research. PMID:26629857

  5. Glycylproline dipeptidyl aminopeptidase isoenzyme in diagnosis of primary hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Run-Zhou Ni; Jie-Fei Huang; Ming-Bing Xiao; Mei Li; Xian-Yong Meng

    2003-01-01

    AIM: To investigate the role of glycylproline dipeptidyl aminopeptidase (GPDA) isoenzyme in the diagnosis of primary hepatocellular carcinoma (PHC), especially in patients with negative alpha-fetoprotein (AFP).METHODS: A stage gradient polyacrylamide gel discontinuous electrophoresis system was developed to separate serum GPDA isoenzymes, which were determined in 102 patients with PHC, 45 cases with liver cirrhosis, 24cases with chronic hepatitis, 35 cases with benign liver spaceoccupying lesions, 20 cases with metastatic liver cancer and 50 cases with extra-hepatic cancer, as well as 80 healthy subjects. The relationships between GPDA isoenzymes and AFP, the sizes of tumors, as well as alanine aminotransferase (ALT) were also analyzed.RESULTS: Serum GPDA was separated into two isoenzymes,GPDA-S and GPDA-F. The former was positive in all subjects,while the latter was found mainly in majority of PHC (85.3 %)and a few cases with liver cirrhosis (11.1%), chronic hepatitis (33.3 %), metastatic liver cancer (15.0 %) and non-hepatic cancer (16.0 %). GPDA-F was negative in all healthy subjects and patients with benign liver space-occupying lesions,including abscess, cysts and angioma. There was no correlation between GPDA-F and AFP concentration or tumor size. GPDA-F was consistently positive and not correlated with ALT in PHC, but GPDA-F often converted to negative as decline of ALT in benign liver diseases. The electrophoretic migration of GPDA-F became sluggish after the treatment of neuraminidase.CONCLUSION: GPDA-F is a new useful serum marker for PHC. Measurement of serum GPDA-F is helpful in diagnosis of PHC, especially in patients with negative AFP. GPDA-F is one kind of glycoproteins rich in sialic acid.

  6. Immunomicroscopic localization of aminopeptidase N in the pig enterocyte. Implications for the route of intracellular transport

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Sjöström, H; Norén, Ove; Dabelsteen, E

    1987-01-01

    The subcellular localization of aminopeptidase N (EC 3.4.11.2) in the pig enterocyte was investigated by immunofluorescence and immunoelectron microscopy (immunogold staining). By indirect immunofluorescence on either frozen or paraffin-embedded sections, a very intense staining in the microvillar...

  7. The occurrence of aminopeptidase N and desquamated cell proteins in intestinal perfusate of the rat

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Hansen, G H; Sjöström, Hans Gunnar; Norén, O

    1988-01-01

    The in vivo release of a microvillar enzyme, aminopeptidase N (EC 3.4.11.2), and a cytosolic enzyme, lactate dehydrogenase (EC 1.1.1.27), into the intestinal lumen was measured to gain information on the fraction of desquamated cell protein in intestinal juice and on the mechanism of release of...

  8. Biosynthesis of intestinal microvillar proteins. Effect of castanospermine on cell-free synthesis of aminopeptidase N

    DEFF Research Database (Denmark)

    Danielsen, E M; Olsen, Jørgen

    1988-01-01

    Pig small intestinal mRNA was translated in a rabbit reticulocyte lysate system supplemented with microsomal membranes. Castanospermine, an inhibitor of glucosidase I, induced a high mannose-glycosylated form of microvillar aminopeptidase N (EC 3.4.11.2) of increased molecular mass, indicating the...

  9. Biosynthesis of intestinal microvillar proteins. Forskolin reduces surface expression of aminopeptidase N

    DEFF Research Database (Denmark)

    Danielsen, E M; Hansen, Gert Helge; Cowell, G M

    1987-01-01

    The effect of forskolin on the biosynthesis and intracellular transport of pig intestinal aminopeptidase N (EC 3.4.11.2) was studied in organ cultured mucosal explants. The drug which activates adenylate cyclase and hence the cAMP-dependent glycogenolytic pathway did not affect the explant content...

  10. Tyrosine sulphation is not required for microvillar expression of intestinal aminopeptidase N

    DEFF Research Database (Denmark)

    Danielsen, E M

    1988-01-01

    The effect of 2,6-dichloro-4-nitrophenol (DCNP), an inhibitor of phenol sulphotransferases (EC 2.8.2.-), on the biosynthesis of aminopeptidase N (EC 3.4.11.2) was studied in organ-cultured pig intestinal mucosal explants. At 50 microM DCNP did not affect protein synthesis but it decreased...

  11. Canalicular immunostaining of aminopeptidase N (CD13) as a diagnostic marker for hepatocellular carcinoma

    OpenAIRE

    Röcken, C; Licht, J.; Roessner, A; Carl-McGrath, S

    2005-01-01

    Background: Aminopeptidase N (CD13) is expressed in normal and neoplastic liver tissue, where it exhibits a characteristic canalicular pattern (CD13can), similar to that seen for CD10 and when antibodies crossreact with biliary glycoprotein I (p-CEA).

  12. Effect of X-Prolyl Dipeptidyl Aminopeptidase Deficiency on Lactococcus lactis

    NARCIS (Netherlands)

    Mayo, Baltasar; Kok, Jan; Bockelmann, Wilhelm; Haandrikman, Alfred; Leenhouts, Kees J.; Venema, Gerhardus

    1993-01-01

    The genetic determinant (pepXP) of an X-prolyl dipeptidyl aminopeptidase (PepXP) has recently been cloned and sequenced from both Lactococcus lactis subsp. cremoris (B. Mayo, J. Kok, K. Venema, W. Bockelmann, M. Teuber, H. Reinke, and G. Venema, Appl. Environ. Microbiol. 57:38-44, 1991) and L. lacti

  13. Co-and post-translational events in the biogenesis of pig small intestinal aminopeptidase N

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Norén, O; Sjöström, H

    1982-01-01

    high mannose to complex glycosylation and the appearance of the enzyme in the microvillar membrane, indicating a role of the Golgi complex in these processes. Colchicine prevented aminopeptidase N from reaching the microvillar membrane, suggesting the involvement of microtubules in the transport....

  14. Tissue-specific interactions between nuclear proteins and the aminopeptidase N promoter

    DEFF Research Database (Denmark)

    Kärnström, U; Sjöström, H; Norén, O; Olsen, Jørgen; Laustsen, Lotte

    1991-01-01

    cells. LF-B1 could not be detected in spleen nuclei. In accordance with this, RNA analysis demonstrated that the aminopeptidase N promoter operating in the small intestine and in the liver is inactive in the spleen. In this tissue initiation of transcription from the aminopeptidase N gene occurs from an...... elements (DF, LF-B1, UF) were identified in the aminopeptidase N promoter. The DF region (-53 to -30) interacts with the ubiquitously expressed transcription factor Sp1. The LF-B1 region (-85 to -58) interacts with the liver transcription factor LF-B1 (HNF-1) which was detected as well in nuclei from small...... intestinal mucosa. The UF region (-112 to -90) interacts with nuclear factors which seem to be expressed differentially in the liver and the small intestine. Transfection of promoter deletions into HepG2 cells showed that the LF-B1 region is necessary for high expression of the aminopeptidase N gene in liver...

  15. Human glutaminyl cyclase and bacterial zinc aminopeptidase share a common fold and active site

    Directory of Open Access Journals (Sweden)

    Misquitta Stephanie A

    2004-02-01

    Full Text Available Abstract Background Glutaminyl cyclase (QC forms the pyroglutamyl residue at the amino terminus of numerous secretory peptides and proteins. We previously proposed the mammalian QC has some features in common with zinc aminopeptidases. We now have generated a structural model for human QC based on the aminopeptidase fold (pdb code 1AMP and mutated the apparent active site residues to assess their role in QC catalysis. Results The structural model proposed here for human QC, deposited in the protein databank as 1MOI, is supported by a variety of fold prediction programs, by the circular dichroism spectrum, and by the presence of the disulfide. Mutagenesis of the six active site residues present in both 1AMP and QC reveal essential roles for the two histidines (140 and 330, QC numbering and the two glutamates (201 and 202, while the two aspartates (159 and 248 appear to play no catalytic role. ICP-MS analysis shows less than stoichiometric zinc (0.3:1 in the purified enzyme. Conclusions We conclude that human pituitary glutaminyl cyclase and bacterial zinc aminopeptidase share a common fold and active site residues. In contrast to the aminopeptidase, however, QC does not appear to require zinc for enzymatic activity.

  16. Characterization and overexpression of the Lactococcus lactis pepN gene and localization of its product, aminopeptidase N.

    OpenAIRE

    van Alen-Boerrigter, I J; Baankreis, R; de Vos, W M

    1991-01-01

    The chromosomal pepN gene encoding lysyl-aminopeptidase activity in Lactococcus lactis has been identified in a lambda EMBL3 library in Escherichia coli by using an immunological screening with antiserum against a purified aminopeptidase fraction. The pepN gene was localized and subcloned in E. coli on the basis of its expression and hybridization to a mixed-oligonucleotide probe for the previously determine N-terminal amino acid sequence of lysyl-aminopeptidase (P. S. T. Tan and W. N. Koning...

  17. The Thermophilic, Homohexameric Aminopeptidase of Borrelia burgdorferi Is a Member of the M29 Family of Metallopeptidases

    OpenAIRE

    Bertin, Patrícia B.; Silene P Lozzi; Howell, Jerrilyn K.; Restrepo-Cadavid, Glória; Neves, David; Teixeira, Antonio R. L.; de Sousa, Marcelo V.; Norris, Steven J; Santana, Jaime M.

    2005-01-01

    Proteases are implicated in several aspects of the physiology of microorganisms, as well as in host-pathogen interactions. Aminopeptidases are also emerging as novel drug targets in infectious agents. In this study, we have characterized an aminopeptidase from the spirochete Borrelia burgdorferi, the causative agent of Lyme disease. The aminopeptidolytic activity was identified in cell extracts from B. burgdorferi by using the substrate leucine-7-amido-4-methylcoumarin. A protein displaying t...

  18. N-Terminal methionine processing by the zinc-activated Plasmodium falciparum methionine aminopeptidase 1b.

    Science.gov (United States)

    Calcagno, Sarah; Klein, Christian D

    2016-08-01

    The methionine aminopeptidase 1b from Plasmodium falciparum (PfMetAP 1b) was cloned, expressed in Escherichia coli and characterized. Surprisingly, and in contrast to other methionine aminopeptidases (MetAPs) that require heavy-metal cofactors such as cobalt, the enzyme is reliably activated by zinc ions. Immobilization of the enzyme is possible by His-tag metal chelation to iminodiacetic acid-agarose and by covalent binding to chloroacetamido-hexyl-agarose. The covalently immobilized enzyme shows long-term stability, allowing a continuous, heterogenous processing of N-terminal methionines, for example, in recombinant proteins. Activation by zinc, instead of cobalt as for other MetAPs, avoids the introduction of heavy metals with toxicological liabilities and oxidative potential into biotechnological processes. The PfMetAP 1b therefore represents a useful tool for the enzymatic, posttranslational processing of recombinant proteins. PMID:27023914

  19. Characterization of Activity of a Potential Food-Grade Leucine Aminopeptidase from Kiwifruit

    Directory of Open Access Journals (Sweden)

    A. A. A. Premarathne

    2010-01-01

    Full Text Available Aminopeptidase (AP activity in ripe but firm fruit of Actinidia deliciosa was characterized using L-leucine-p-nitroanilide as a substrate. The enzyme activity was the highest under alkaline conditions and was thermolabile. EDTA, 1,10-phenanthroline, iodoacetamide, and Zn2+ had inhibitory effect while a low concentration of dithiothreitol (DTT had stimulatory effect on kiwifruit AP activity. However, DTT was not essential for the enzyme activity. The results obtained indicated that the kiwifruit AP was a thiol-dependent metalloprotease. Its activity was the highest in the seeds, followed by the core and pericarp tissues of the fruit. The elution profile of the AP activity from a DEAE-cellulose column suggested that there were at least two AP isozymes in kiwifruit: one unadsorbed and one adsorbed fractions. It is concluded that useful food-grade aminopeptidases from kiwifruit could be revealed using more specific substrates.

  20. Characterization of Activity of a Potential Food-Grade Leucine Aminopeptidase from Kiwifruit

    Science.gov (United States)

    Premarathne, A. A. A.; Leung, David W. M.

    2010-01-01

    Aminopeptidase (AP) activity in ripe but firm fruit of Actinidia deliciosa was characterized using L-leucine-p-nitroanilide as a substrate. The enzyme activity was the highest under alkaline conditions and was thermolabile. EDTA, 1,10-phenanthroline, iodoacetamide, and Zn2+ had inhibitory effect while a low concentration of dithiothreitol (DTT) had stimulatory effect on kiwifruit AP activity. However, DTT was not essential for the enzyme activity. The results obtained indicated that the kiwifruit AP was a thiol-dependent metalloprotease. Its activity was the highest in the seeds, followed by the core and pericarp tissues of the fruit. The elution profile of the AP activity from a DEAE-cellulose column suggested that there were at least two AP isozymes in kiwifruit: one unadsorbed and one adsorbed fractions. It is concluded that useful food-grade aminopeptidases from kiwifruit could be revealed using more specific substrates. PMID:21076540

  1. Small potent ligands to the insulin-regulated aminopeptidase (IRAP)/AT(4) receptor.

    Science.gov (United States)

    Axén, Andreas; Andersson, Hanna; Lindeberg, Gunnar; Rönnholm, Harriet; Kortesmaa, Jarkko; Demaegdt, Heidi; Vauquelin, Georges; Karlén, Anders; Hallberg, Mathias

    2007-07-01

    Angiotensin IV analogs encompassing aromatic scaffolds replacing parts of the backbone of angiotensin IV have been synthesized and evaluated in biological assays. Several of the ligands displayed high affinities to the insulin-regulated aminopeptidase (IRAP)/AT(4) receptor. Displacement of the C-terminal of angiotensin IV with an o-substituted aryl acetic acid derivative delivered the ligand 4, which exhibited the highest binding affinity (K(i) = 1.9 nM). The high affinity of this ligand provides support to the hypothesis that angiotensin IV adopts a gamma-turn in the C-terminal of its bioactive conformation. Ligand (4) inhibits both human IRAP and aminopeptidase N-activity and induces proliferation of adult neural stem cells at low concentrations. Furthermore, ligand 4 is degraded considerably more slowly in membrane preparations than angiotensin IV. Hence, it might constitute a suitable research tool for biological studies of the (IRAP)/AT(4) receptor. PMID:17559064

  2. Crystal structure of human insulin-regulated aminopeptidase with specificity for cyclic peptides.

    Science.gov (United States)

    Hermans, Stefan J; Ascher, David B; Hancock, Nancy C; Holien, Jessica K; Michell, Belinda J; Chai, Siew Yeen; Morton, Craig J; Parker, Michael W

    2015-02-01

    Insulin-regulated aminopeptidase (IRAP or oxytocinase) is a membrane-bound zinc-metallopeptidase that cleaves neuroactive peptides in the brain and produces memory enhancing effects when inhibited. We have determined the crystal structure of human IRAP revealing a closed, four domain arrangement with a large, mostly buried cavity abutting the active site. The structure reveals that the GAMEN exopeptidase loop adopts a very different conformation from other aminopeptidases, thus explaining IRAP's unique specificity for cyclic peptides such as oxytocin and vasopressin. Computational docking of a series of IRAP-specific cognitive enhancers into the crystal structure provides a molecular basis for their structure-activity relationships and demonstrates that the structure will be a powerful tool in the development of new classes of cognitive enhancers for treating a variety of memory disorders such as Alzheimer's disease. PMID:25408552

  3. Aminopeptidase N is directly sorted to the apical domain in MDCK cells

    DEFF Research Database (Denmark)

    Wessels, H P; Hansen, Gert Helge; Fuhrer, C; Look, A T; Sjöström, H; Norén, Ove; Spiess, M

    In different epithelial cell types, integral membrane proteins appear to follow different sorting pathways to the apical surface. In hepatocytes, several apical proteins were shown to be transported there indirectly via the basolateral membrane, whereas in MDCK cells a direct sorting pathway from...... the trans-Golgi-network to the apical membrane has been demonstrated. However, different proteins had been studied in these cells. To compare the sorting of a single protein in both systems, we have expressed aminopeptidase N, which already had been shown to be sorted indirectly in hepatocytes, in...... transfected MDCK cells. As expected, it was predominantly localized to the apical domain of the plasma membrane. By monitoring the appearance of newly synthesized aminopeptidase N at the apical and basolateral surface, it was found to be directly sorted to the apical domain in MDCK cells, indicating that the...

  4. Biosynthesis of intestinal microvillar proteins. Dimerization of aminopeptidase N and lactase-phlorizin hydrolase

    DEFF Research Database (Denmark)

    Danielsen, E M

    1990-01-01

    explants. For aminopeptidase N, dimerization did not begin until 5-10 min after synthesis, and maximal dimerization by cross-linking of the transient form of the enzyme required 1 h, whereas the mature form of aminopeptidase N cross-linked with unchanged efficiency from 45 min to 3 h of labeling. Formation...... of dimers of this enzyme therefore occurs prior to the Golgi-associated processing, and the slow rate of dimerization may be the rate-limiting step in the transport from the endoplasmic reticulum to the Golgi complex. For lactase-phlorizin hydrolase, the posttranslational processing includes a...... proteolytic cleavage of its high molecular weight precursor. Since only the mature form and not the precursor of this enzyme could be cross-linked, formation of tightly associated dimers only takes place after transport out of the endoplasmic reticulum. Dimerization of the two brush border enzymes therefore...

  5. Novel chromogenic aminopeptidase substrates for the detection and identification of clinically important microorganisms

    OpenAIRE

    Cellier, Marie; James, Arthur; Orenga, Sylvain; Perry, John; Rasul, Ari; Robinson, Shaun; Stanforth, Stephen

    2014-01-01

    A series of amino acid derivatives 8-10, 42 and 43 have been prepared as chromogenic enzyme substrates in order to detect aminopeptidase activity in clinically important Gram-negative and Gram-positive bacteria. Enzymatic hydrolysis liberates the amino acid moiety and either a 4-aminophenol or a 4-dialkylaminoaniline derivative which undergoes oxidative coupling with 1-naphthol or a substituted 1-naphthol giving an indophenol dye. Substrates and 1-naphthols were incorporated into an agar-base...

  6. Bioluminogenic Imaging of AminopeptidaseN In Vitro and In Vivo.

    Science.gov (United States)

    Wu, Wenxiao; Chen, Laizhong; Li, Jing; Du, Lupei; Li, Minyong

    2016-01-01

    Bioluminescence is a process that converts biochemical energy to visible light. Bioluminescence-based imaging technology has been widely applicable in the imaging of process envisioned in life sciences. As one of the most popular bioluminescence system, the firefly luciferin-luciferase system is exceptionally suitable for deep tissue imaging in living animals owing to its long wavelength emission light. Herein, we report the experimental detail of bioluminogenic imaging of aminopeptidase N activity both in vitro and in vivo. PMID:27424897

  7. Role of Endoplasmic Reticulum Aminopeptidases in Health and Disease: from Infection to Cancer

    OpenAIRE

    Doriana Fruci; Franco Locatelli; Paolo Romania; Silvia Lorenzi; Loredana Cifaldi

    2012-01-01

    Endoplasmic reticulum (ER) aminopeptidases ERAP1 and ERAP2 (ERAPs) are essential for the maturation of a wide spectrum of proteins involved in various biological processes. In the ER, these enzymes work in concert to trim peptides for presentation on MHC class I molecules. Loss of ERAPs function substantially alters the repertoire of peptides presented by MHC class I molecules, critically affecting recognition of both NK and CD8+ T cells. In addition, these enzymes are ...

  8. Endoplasmic Reticulum Aminopeptidase-1 Functions Regulate Key Aspects of the Innate Immune Response

    OpenAIRE

    Aldhamen, Yasser A; Seregin, Sergey S.; Rastall, David P. W.; Charles F Aylsworth; Pepelyayeva, Yuliya; Busuito, Christopher J.; Godbehere-Roosa, Sarah; Kim, Sungjin; Amalfitano, Andrea

    2013-01-01

    Endoplasmic reticulum aminopeptidase-1 (ERAP1) is a multifunctional, ubiquitously expressed enzyme whose peptide-trimming role during antigen processing for presentation by MHC I molecules is well established, however, a role for ERAP1 in modulating global innate immune responses has not been described to date. Here we demonstrate that, relative to wild type mice, mice lacking ERAP1 exhibit exaggerated innate immune responses early during pathogen recognition, as characterized by increased ac...

  9. Structural insights into the molecular ruler mechanism of the endoplasmic reticulum aminopeptidase ERAP1

    OpenAIRE

    Amit Gandhi; Damodharan Lakshminarasimhan; Yixin Sun; Hwai-Chen Guo

    2011-01-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) is an essential component of the immune system, because it trims peptide precursors and generates the N--restricted epitopes. To examine ERAP1's unique properties of length- and sequence-dependent processing of antigen precursors, we report a 2.3 Å resolution complex structure of the ERAP1 regulatory domain. Our study reveals a binding conformation of ERAP1 to the carboxyl terminus of a peptide, and thus provides direct evidence for the molecular...

  10. Aminopeptidase N (CD13) Is Involved in Phagocytic Processes in Human Dendritic Cells and Macrophages

    OpenAIRE

    Mónica I. Villaseñor-Cardoso; Dulce A. Frausto-Del-Río; Enrique Ortega

    2013-01-01

    Aminopeptidase N (APN or CD13) is a membrane ectopeptidase expressed by many cell types, including myelomonocytic lineage cells: monocytes, macrophages, and dendritic cells. CD13 is known to regulate the biological activity of various peptides by proteolysis, and it has been proposed that CD13 also participates in several functions such as angiogenesis, cell adhesion, metastasis, and tumor invasion. We had previously reported that, in human monocytes and macrophages, CD13 modulates the phagoc...

  11. Anti-tumor targeted drug delivery systems mediated by aminopeptidase N/CD13

    OpenAIRE

    Xun Wang; Bin Wang; Qiang Zhang

    2011-01-01

    Aminopeptidase N (APN)/CD13 is a transmembrane glycoprotein, which is overexpressed on tumor neovascular endothelial cells and most tumor cells, where it plays an important role in tumor angiogenesis. Peptides containing the Asn-Gly-Arg (NGR) motif can specifically recognize APN/CD13 allowing them to act as tumor-homing peptides for the targeted delivery of anti-tumor drugs to tumor neovascular endothelial cells and tumor cells. This article reviews the literature and recent developments rela...

  12. Unusual activity pattern of leucine aminopeptidase inhibitors based on phosphorus containing derivatives of methionine and norleucine

    Czech Academy of Sciences Publication Activity Database

    Pícha, Jan; Liboska, Radek; Buděšínský, Miloš; Jiráček, Jiří; Pawelczak, M.; Mucha, A.

    2011-01-01

    Roč. 26, č. 2 (2011), s. 155-161. ISSN 1475-6366 R&D Projects: GA ČR GA203/06/1405; GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z40550506 Keywords : aminophosphonates * aminophospinates * methionine * norleucine * phosphorus containing dipeptides * cytosolic leucine aminopeptidase * inhibitors Subject RIV: CC - Organic Chemistry Impact factor: 1.617, year: 2011

  13. Purification and functional characterisation of rhiminopeptidase A, a novel aminopeptidase from the venom of Bitis gabonica rhinoceros.

    Directory of Open Access Journals (Sweden)

    Sakthivel Vaiyapuri

    Full Text Available BACKGROUND: Snake bite is a major neglected public health issue within poor communities living in the rural areas of several countries throughout the world. An estimated 2.5 million people are bitten by snakes each year and the cost and lack of efficacy of current anti-venom therapy, together with the lack of detailed knowledge about toxic components of venom and their modes of action, and the unavailability of treatments in rural areas mean that annually there are around 125,000 deaths worldwide. In order to develop cheaper and more effective therapeutics, the toxic components of snake venom and their modes of action need to be clearly understood. One particularly poorly understood component of snake venom is aminopeptidases. These are exo-metalloproteases, which, in mammals, are involved in important physiological functions such as the maintenance of blood pressure and brain function. Although aminopeptidase activities have been reported in some snake venoms, no detailed analysis of any individual snake venom aminopeptidases has been performed so far. As is the case for mammals, snake venom aminopeptidases may also play important roles in altering the physiological functions of victims during envenomation. In order to further understand this important group of snake venom enzymes we have isolated, functionally characterised and analysed the sequence-structure relationships of an aminopeptidase from the venom of the large, highly venomous West African gaboon viper, Bitis gabonica rhinoceros. METHODOLOGY AND PRINCIPAL FINDINGS: The venom of B. g. rhinoceros was fractionated by size exclusion chromatography and fractions with aminopeptidase activities were isolated. Fractions with aminopeptidase activities showed a pure protein with a molecular weight of 150 kDa on SDS-PAGE. In the absence of calcium, this purified protein had broad aminopeptidase activities against acidic, basic and neutral amino acids but in the presence of calcium, it had only

  14. Crystallization and preliminary X-ray diffraction analysis of human endoplasmic reticulum aminopeptidase 2

    International Nuclear Information System (INIS)

    The luminal domain of human endoplasmic reticulum aminopeptidase 2 has been expressed, purified and crystallized. The crystals belonged to the orthorhombic space group P21212 and diffracted anisotropically to 3.3 Å resolution in the best direction on an in-house source. Endoplasmic reticulum aminopeptidase 2 (ERAP2) is a critical enzyme involved in the final processing of MHC class I antigens. Peptide trimming by ERAP2 and the other members of the oxytocinase subfamily is essential to customize longer precursor peptides in order to fit them to the correct length required for presentation on major histocompatibility complex class I molecules. While recent structures of ERAP1 have provided an understanding of the ‘molecular-ruler’ mechanism of substrate selection, little is known about the complementary activities of its homologue ERAP2 despite their sharing 49% sequence identity. In order to gain insights into the structure–function relationship of the oxytocinase subfamily, and in particular ERAP2, the luminal region of human ERAP2 has been crystallized in the presence of the inhibitor bestatin. The crystals belonged to an orthorhombic space group and diffracted anisotropically to 3.3 Å resolution in the best direction on an in-house X-ray source. A molecular-replacement solution suggested that the enzyme has adopted the closed state as has been observed in other inhibitor-bound aminopeptidase structures

  15. Tyrosine sulphation is not required for microvillar expression of intestinal aminopeptidase N.

    Science.gov (United States)

    Danielsen, E M

    1988-01-01

    The effect of 2,6-dichloro-4-nitrophenol (DCNP), an inhibitor of phenol sulphotransferases (EC 2.8.2.-), on the biosynthesis of aminopeptidase N (EC 3.4.11.2) was studied in organ-cultured pig intestinal mucosal explants. At 50 microM DCNP did not affect protein synthesis but it decreased incorporation of [35S]sulphate into aminopeptidase N and other major microvillar hydrolases by 70-85% compared with controls, indicating an inhibition of their post-translational tyrosine sulphation. In labelling experiments with [35S]methionine from 0.5 to 5 h, DCNP was tested for its possible influence on synthesis, processing and microvillar expression of aminopeptidase N, but no effect on any of these parameters could be detected. It can therefore be concluded that tyrosine sulphation is not required (for instance as a sorting signal) for the targeting of newly synthesized enzymes to the microvillar membrane. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:2902847

  16. MHJ_0461 is a multifunctional leucine aminopeptidase on the surface of Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Jarocki, Veronica M; Santos, Jerran; Tacchi, Jessica L; Raymond, Benjamin B A; Deutscher, Ania T; Jenkins, Cheryl; Padula, Matthew P; Djordjevic, Steven P

    2015-01-01

    Aminopeptidases are part of the arsenal of virulence factors produced by bacterial pathogens that inactivate host immune peptides. Mycoplasma hyopneumoniae is a genome-reduced pathogen of swine that lacks the genetic repertoire to synthesize amino acids and relies on the host for availability of amino acids for growth. M. hyopneumoniae recruits plasmin(ogen) onto its cell surface via the P97 and P102 adhesins and the glutamyl aminopeptidase MHJ_0125. Plasmin plays an important role in regulating the inflammatory response in the lungs of pigs infected with M. hyopneumoniae. We show that recombinant MHJ_0461 (rMHJ_0461) functions as a leucine aminopeptidase (LAP) with broad substrate specificity for leucine, alanine, phenylalanine, methionine and arginine and that MHJ_0461 resides on the surface of M. hyopneumoniae. rMHJ_0461 also binds heparin, plasminogen and foreign DNA. Plasminogen bound to rMHJ_0461 was readily converted to plasmin in the presence of tPA. Computational modelling identified putative DNA and heparin-binding motifs on solvent-exposed sites around a large pore on the LAP hexamer. We conclude that MHJ_0461 is a LAP that moonlights as a multifunctional adhesin on the cell surface of M. hyopneumoniae. PMID:25589579

  17. Age-dependent changes in extracellular proteins, aminopeptidase and proteinase activities in Frankia isolate BR.

    Science.gov (United States)

    Müller, A; Benoist, P; Diem, H G; Schwencke, J

    1991-12-01

    To investigate protein secretion by the nitrogen-fixing actinomycete Frankia isolate BR, we designed a rapid DEAE adsorption, salt elution and Biogel P6DG desalination method to concentrate protein from the growth medium. Secreted proteins reached a maximum concentration (5.6 gm l-1) in the medium at growth arrest. Analysis by SDS-PAGE detected up to 63 extracellular polypeptides when Frankia cells were grown under stirred conditions in BAP medium supplemented with phosphatidylcholine and MES buffer and 65 proteins in stirred BAP media alone. The pattern of extracellular polypeptides changed during growth. Several extracellular proteolytic activities were detected and compared with intracellular ones. The substrate specificity of the extracellular and intracellular aminopeptidase activities were the same. Also, the electrophoretic migration patterns of secreted and intracellular aminopeptidases could not be distinguished. Secretion of the proline-specific aminopeptidase FAP proteinase (PF) were secreted: 10 had the same electrophoretic mobility as their intracellular counterparts after SDS-gelatine-PAGE while five (PF - 39.5, PF - 38.5, PF - 36.5, PF - 25.5 and PF - 20.5 kDa) had a different electrophoretic mobility and, therefore, appeared to be exclusively extracellular. At least seven extracellular proteinases appeared to increase coordinately in activity shortly before growth arrest. PMID:15101385

  18. Structural analysis of inhibition of E. coli methionine aminopeptidase: implication of loop adaptability in selective inhibition of bacterial enzymes

    Directory of Open Access Journals (Sweden)

    Hurley Thomas D

    2007-12-01

    Full Text Available Abstract Background Methionine aminopeptidase is a potential target of future antibacterial and anticancer drugs. Structural analysis of complexes of the enzyme with its inhibitors provides valuable information for structure-based drug design efforts. Results Five new X-ray structures of such enzyme-inhibitor complexes were obtained. Analysis of these and other three similar structures reveals the adaptability of a surface-exposed loop bearing Y62, H63, G64 and Y65 (the YHGY loop that is an integral part of the substrate and inhibitor binding pocket. This adaptability is important for accommodating inhibitors with variations in size. When compared with the human isozymes, this loop either becomes buried in the human type I enzyme due to an N-terminal extension that covers its position or is replaced by a unique insert in the human type II enzyme. Conclusion The adaptability of the YHGY loop in E. coli methionine aminopeptidase, and likely in other bacterial methionine aminopeptidases, enables the enzyme active pocket to accommodate inhibitors of differing size. The differences in this adaptable loop between the bacterial and human methionine aminopeptidases is a structural feature that can be exploited to design inhibitors of bacterial methionine aminopeptidases as therapeutic agents with minimal inhibition of the corresponding human enzymes.

  19. Onset of transcription of the aminopeptidase N (leukemia antigen CD 13) gene at the crypt/villus transition zone during rabbit enterocyte differentiation

    DEFF Research Database (Denmark)

    Norén, O; Dabelsteen, E; Høyer, P E; Sjöström, H; Olsen, Jørgen; Hansen, Gert Helge

    1989-01-01

    The sequence of a cDNA clone (2.82 kbp) of rabbit intestinal aminopeptidase N (CD 13) is reported. Using the corresponding anti-sense RNA probe, the distribution of aminopeptidase N mRNA along the crypt/villus axis of the rabbit small intestine was studied by in situ hybridization. The...

  20. Distribution and Biochemical Properties of an M1-family Aminopeptidase in Plasmodium falciparum Indicate a Role in Vacuolar Hemoglobin Catabolism*

    OpenAIRE

    Ragheb, Daniel; Dalal, Seema; Bompiani, Kristin M.; Ray, W. Keith; Klemba, Michael

    2011-01-01

    Aminopeptidases catalyze N-terminal peptide bond hydrolysis and occupy many diverse roles across all domains of life. Here we present evidence that an M1-family aminopeptidase, PfA-M1, has been recruited to specialized roles in the human malaria parasite Plasmodium falciparum. PfA-M1 is abundant in two subcellular compartments in asexual intraerythrocytic parasites; that is, the food vacuole, where the catabolism of host hemoglobin takes place, and the nucleus. A unique N-terminal extension c...

  1. Structural Basis for Antigenic Peptide Recognition and Processing by Endoplasmic Reticulum (ER) Aminopeptidase 2.

    Science.gov (United States)

    Mpakali, Anastasia; Giastas, Petros; Mathioudakis, Nikolas; Mavridis, Irene M; Saridakis, Emmanuel; Stratikos, Efstratios

    2015-10-23

    Endoplasmic reticulum (ER) aminopeptidases process antigenic peptide precursors to generate epitopes for presentation by MHC class I molecules and help shape the antigenic peptide repertoire and cytotoxic T-cell responses. To perform this function, ER aminopeptidases have to recognize and process a vast variety of peptide sequences. To understand how these enzymes recognize substrates, we determined crystal structures of ER aminopeptidase 2 (ERAP2) in complex with a substrate analogue and a peptidic product to 2.5 and 2.7 Å, respectively, and compared them to the apo-form structure determined to 3.0 Å. The peptides were found within the internal cavity of the enzyme with no direct access to the outside solvent. The substrate analogue extends away from the catalytic center toward the distal end of the internal cavity, making interactions with several shallow pockets along the path. A similar configuration was evident for the peptidic product, although decreasing electron density toward its C terminus indicated progressive disorder. Enzymatic analysis confirmed that visualized interactions can either positively or negatively impact in vitro trimming rates. Opportunistic side-chain interactions and lack of deep specificity pockets support a limited-selectivity model for antigenic peptide processing by ERAP2. In contrast to proposed models for the homologous ERAP1, no specific recognition of the peptide C terminus by ERAP2 was evident, consistent with functional differences in length selection and self-activation between these two enzymes. Our results suggest that ERAP2 selects substrates by sequestering them in its internal cavity and allowing opportunistic interactions to determine trimming rates, thus combining substrate permissiveness with sequence bias. PMID:26381406

  2. Bovine brain pyroglutamyl aminopeptidase (type-1): purification and characterisation of a neuropeptide-inactivating peptidase.

    Science.gov (United States)

    Cummins, P M; O'Connor, B

    1996-08-01

    Pyroglutamyl aminopeptidase type-1 (PAP-I) is reported to be a soluble, broad specificity aminopeptidase, capable of removing the pyroglutamic acid (pGlu) residue from the amino terminus of pGlu-peptides (e.g. TRH, LHRH, neurotensin and bombesin). The central aim of this study was to undertake, for the first time, the complete purification and characterisation of a PAP activity observed within the cytosolic fraction of bovine whole brain and to compare the properties of the enzyme with previous findings. A series of chromatographic steps (DEAE-Sepharose, Sephacryl S-200 and Activated Thiol Sepharose 4B) generated a soluble PAP activity purified to near homogeneity with a total active yield of 6.6% The enzyme displayed a native molecular mass of approximately 23,700 Da, which compares well with that value obtained under denaturing conditions via SDS-PAGE (24,000 Da), suggesting that the enzyme exists as a monomer. The expression of PAP activity displayed an absolute requirement for the presence of a disulphide bond-reducing agent such as DTT, whilst optimum activity was observed at pH 8.5. strong inhibition of PAP activity was observed with a number of different agents, including transition metal ions, sulphydryl-blocking agents and 2-pyrrolidone (a pGlu analog). A broad pyroglutamyl substrate specificity, which excludes substrates commencing with the pGlu-Pro bond, was also demonstrated for the bovine brain enzyme. Based on a comparison of these findings with those reported for PAP-I in other mammalian tissues, the soluble PAP activity observed in bovine whole brain can tentatively be classified as a pyroglutamyl aminopeptidase type-1 (EC 3.4.19.3). PMID:8811836

  3. Hypertension and Angiotensin II Hypersensitivity in Aminopeptidase A–deficient Mice

    OpenAIRE

    MITSUI, Takashi; NOMURA, Seiji; Okada, Mayumi; Ohno, Yasumasa; Kobayashi, Honami; Nakashima,Yutaka; Murata, Yasutaka; Takeuchi, Mikihito; Kuno, Naohiko; Nagasaka, Tetsuo; O-Wang, Jiyang; Cooper, Max D.; Mizutani, Shigehiko

    2003-01-01

    Local concentrations of the vasopressor peptide, angiotensin II (AngII), depend upon the balance between synthesis and degradation. Previous studies of blood pressure (BP) regulation have focused primarily on the generation of AngII and its receptors, and less attention has been devoted to angiotensin degradation. Aminopeptidase A (APA, EC 3.4.11.7) is responsible for the N-terminal cleavage of AngII, a hydrolytic event that serves as a rate-limiting step in angiotensin degradation. To evalua...

  4. Localization and biosynthesis of aminopeptidase N in pig fetal small intestine

    DEFF Research Database (Denmark)

    Danielsen, E M; Niels-Christiansen, L L; Hansen, Gert Helge

    1995-01-01

    [35S]methionine labeling of cultured mucosal explants. RESULTS: Enzyme activity was present in the brush border membrane and extended into the apical cytoplasm. The protein was colocalized with cationized ferritin at the surface of endocytic structures including coated pits, vesicles, tubules, and...... large vacuoles in the apical cytoplasm. The transient high mannose-glycosylated form of fetal aminopeptidase N was processed to the mature complex-glycosylated form at a markedly slower rate than the enzyme in adult intestine. Likewise, dimerization occurred slowly compared with the adult form of...

  5. Investigation of the metal binding site in methionine aminopeptidase by density functional theory

    DEFF Research Database (Denmark)

    Jørgensen, Anne Techau; Norrby, Per-Ola; Liljefors, Tommy

    2002-01-01

    All methionine aminopeptidases exhibit the same conserved metal binding site. The structure of this site with either Co2+ ions or Zn2+ ions was investigated using density functional theory. The calculations showed that the structure of the site was not influenced by the identity of the metal ions...... bridging oxygen, which is part of either a water molecule or a hydroxide ion. Within the site of hMetAP-2 the results strongly indicate that a hydroxide ion bridges the metal ions. By contrast, the nature of the oxygen bridging the metal ions within the metal binding site of eMetAP-1 cannot be determined...

  6. Anti-tumor targeted drug delivery systems mediated by aminopeptidase N/CD13

    Directory of Open Access Journals (Sweden)

    Xun Wang

    2011-08-01

    Full Text Available Aminopeptidase N (APN/CD13 is a transmembrane glycoprotein, which is overexpressed on tumor neovascular endothelial cells and most tumor cells, where it plays an important role in tumor angiogenesis. Peptides containing the Asn-Gly-Arg (NGR motif can specifically recognize APN/CD13 allowing them to act as tumor-homing peptides for the targeted delivery of anti-tumor drugs to tumor neovascular endothelial cells and tumor cells. This article reviews the literature and recent developments related to APN/CD13, its role in tumor growth and some anti-tumor drug delivery systems containing NGR peptides designed to target APN/CD13.

  7. Purification and Some Properties of a Membrane-Bound Aminopeptidase A from Streptococcus cremoris

    OpenAIRE

    Exterkate, Fred A.; de Veer, Gerrie J. C. M.

    1987-01-01

    A membrane-bound l-α-glutamyl (aspartyl)-peptide hydrolase (aminopeptidase A) (EC 3.4.11.7) from Streptococcus cremoris HP has been purified to homogeneity. The free γ-carboxyl group rather than the amino group of the N-terminal l-α-glutamyl (aspartyl) residue appeared to be essential for catalysis. No endopeptidase activity could be established with this enzyme. The native enzyme is a polymeric, most probably trimeric, metalloenzyme (relative molecular weight, approximately 130,000) which sh...

  8. Aminopeptidase N/CD13 targeting fluorescent probes: synthesis and application to tumor cell imaging.

    Science.gov (United States)

    Zhang, Zhouen; Harada, Hiroshi; Tanabe, Kazuhito; Hatta, Hiroshi; Hiraoka, Masahiro; Nishimoto, Sei-ichi

    2005-11-01

    A family of fluorescein-peptide conjugates (CNP1-3) for aminopeptidase N (APN/CD13) targeting fluorescent probes were designed and synthesized. Among the three conjugates, CNP1 bearing tumor-homing cyclic peptide CNGRC, could selectively label APN/CD13 over-expressing on the surface of tumor cells of HT-1080, as identified by means of fluorescent microscopic cell imaging. CNP1 was shown to be a promising fluorescent probe applicable to tumor-targeting molecular imaging. PMID:15885853

  9. Biosynthesis of intestinal microvillar proteins. Surface expression of aminopeptidase N is not affected by chloroquine

    DEFF Research Database (Denmark)

    Danielsen, E M; Sjöström, H; Norén, Ove

    1985-01-01

    The effect of chloroquine on the biosynthesis of pig intestinal aminopeptidase N (EC 3.4.11.2) was studied by labelling with [35S]methionine in organ cultured mucosal explants. The lysosomotropic agent did not alter the molecular size of either the transient or the mature form of the enzyme and d...... no consequence on the intracellular transport of the newly synthesized microvillar enzyme. This suggests that the acidic compartments are not involved in the post-Golgi transport and that this, in turn, probably occurs via a constitutive rather than a regulated pathway....

  10. FE(II) Is the Native Cofactor for Escherichia coli Methionine Aminopeptidase*

    OpenAIRE

    Chai, Sergio C.; Wang, Wen-Long; Ye, Qi-Zhuang

    2008-01-01

    Divalent metal ions play a critical role in the removal of N-terminal methionine from nascent proteins by methionine aminopeptidase (MetAP). Being an essential enzyme for bacteria, MetAP is an appealing target for the development of novel antibacterial drugs. Although purified enzyme can be activated by several divalent metal ions, the exact metal ion used by MetAP in cells is unknown. Many MetAP inhibitors are highly potent on purified enzyme, but they fail to show si...

  11. Purification, Characterization, Gene Cloning, Sequencing, and Overexpression of Aminopeptidase N from Streptococcus thermophilus A

    OpenAIRE

    Chavagnat, Frederic; Casey, Michael G.; Meyer, Jacques

    1999-01-01

    The general aminopeptidase PepN from Streptococcus thermophilus A was purified to protein homogeneity by hydroxyapatite, anion-exchange, and gel filtration chromatographies. The PepN enzyme was estimated to be a monomer of 95 kDa, with maximal activity on N-Lys–7-amino-4-methylcoumarin at pH 7 and 37°C. It was strongly inhibited by metal chelating agents, suggesting that it is a metallopeptidase. The activity was greatly restored by the bivalent cations Co2+, Zn2+, and Mn2+. Except for prolin...

  12. Leucine aminopeptidase and transaminase activity of intestine epithelium of chickens fed on gamma-irradiated feed

    International Nuclear Information System (INIS)

    An experiment was conducted with 4 groups of male broilers. From hatching to the age of 49 days the chickens were fed as follows: group 1 (control) - compound feed, group 2 - feed gamma treated at 0.35 Mrad, group 3 - at 0.7 Mrad, and group 4 - at 1.0 Mrad. In a homogenate of jejunum mucosa, isolated from 24 chickens, it was determined the activity of leucine aminopeptidase, glutamic oxalacetic transminase and glutamic pyruvic transminase as well as the content of protein. Data obtained showed that activity of leucine aminopeptidase in the intestinal mucosa decreased at most twofold in chickens receiving feed treated at 0.7 Mrad. Irradiation at 1.0 Mrad also led to a significant lowering of enzime activity; at 0.35 Mrad there was of no impact on the activity of this hydrolase in the jejunal mucosa of chickens fed on such feed. Glutamic oxalacetic transminase activity increased significantly only when treated at 0.7 Mrad. Glutamic pyruvic transminase activity was not effected by the applied gamma ray radiation in this experiment

  13. Unexpected Diversity of pepA Genes Encoding Leucine Aminopeptidases in Sediments from a Freshwater Lake

    Science.gov (United States)

    Tsuboi, Shun; Yamamura, Shigeki; Imai, Akio; Iwasaki, Kazuhiro

    2016-01-01

    We herein designed novel PCR primers for universal detection of the pepA gene, which encodes the representative leucine aminopeptidase gene, and investigated the genetic characteristics and diversity of pepA genes in sediments of hypereutrophic Lake Kasumigaura, Japan. Most of the amino acid sequences deduced from the obtained clones (369 out of 370) were related to PepA-like protein sequences in the M17 family of proteins. The developed primers broadly detected pepA-like clones associated with diverse bacterial phyla—Alpha-, Beta-, Gamma-, and Deltaproteobacteria, Acidobacteria, Actinobacteria, Aquificae, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Nitrospirae, Planctomycetes, and Spirochetes as well as the archaeal phylum Thaumarchaeota, indicating that prokaryotes in aquatic environments possessing leucine aminopeptidase are more diverse than previously reported. Moreover, prokaryotes related to the obtained pepA-like clones appeared to be r- and K-strategists, which was in contrast to our previous findings showing that the neutral metalloprotease gene clones obtained were related to the r-strategist genus Bacillus. Our results suggest that an unprecedented diversity of prokaryotes with a combination of different proteases participate in sedimentary proteolysis. PMID:26936797

  14. Bacillus thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one of four Aminopeptidase N genes

    NARCIS (Netherlands)

    Herrero, S.; Gechev, T.; Bakker, P.L.; Moar, W.; Maagd, de R.A.

    2005-01-01

    BACKGROUND: Insecticidal toxins from Bacillus thuringiensis bind to receptors on midgut epithelial cells of susceptible insect larvae. Aminopeptidases N (APNs) from several insect species have been shown to be putative receptors for these toxins. Here we report the cloning and expression analysis of

  15. Biosynthesis of intestinal microvillar proteins. Pulse-chase labelling studies on aminopeptidase N and sucrase-isomaltase

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael

    1982-01-01

    The biogenesis of two microvillar enzymes, aminopeptidase N (EC 3.4.11.2) and sucrase (EC 3.2.1.48)-isomaltase (EC 3.2.1.10), was studied by pulse-chase labelling of pig small-intestinal explants kept in organ culture. Both enzymes became inserted into the membrane during or immediately after...

  16. Biosynthesis of intestinal microvillar proteins. The effect of swainsonine on post-translational processing of aminopeptidase N

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M; Norén, Ove;

    1983-01-01

    The post-translational processing of pig small-intestinal aminopeptidase N (EC 3.4.11.2) was studied in organ-cultured mucosal explants. Exposure of the explants to swainsonine, an inhibitor of Golgi mannosidase II, resulted in the formation of a Mr-160000 polypeptide, still sensitive to endo...

  17. Crystal Structure of the Leucine Aminopeptidase from Pseudomonas putida Reveals the Molecular Basis for its Enantioselectivity and Broad Substrate Specificity

    NARCIS (Netherlands)

    Kale, Avinash; Pijning, Tjaard; Sonke, Theo; Dijkstra, Bauke W.; Thunnissen, Andy-Mark W. H.; Guss, M.

    2010-01-01

    The zinc-dependent leucine aminopeptidase from Pseudomonas putida (ppLAP) is an important enzyme for the industrial production of enantiomerically pure amino acids. To provide a better understanding of its structure function relationships, the enzyme was studied by X-ray crystallography. Crystal str

  18. T cell responses affected by aminopeptidase N (CD13)-mediated trimming of major histocompatibility complex class II-bound peptides

    DEFF Research Database (Denmark)

    Larsen, S L; Pedersen, L O; Buus, S; Stryhn, A

    1996-01-01

    the exopeptidase Aminopeptidase N (APN, CD13) as one of the enzymes involved in the observed cell-surface antigen processing. The NH2-terminal end of the longer peptide could, even while bound to major histocompatibility complex (MHC) class II molecules, be digested by APN with dramatic consequences...

  19. Molecular Cloning and Sequence Analysis of the X-Prolyl Dipeptidyl Aminopeptidase Gene From Lactococcus lactis subsp. cremoris

    NARCIS (Netherlands)

    Mayo, Baltasar; Kok, Jan; Venema, Konraad; Bockelmann, Wilhelm; Teuber, Michael; Reinke, Heinz; Venema, Gerhardus

    1991-01-01

    Lactococcus lactis subsp. cremoris P8-2-47 contains an X-prolyl dipeptidyl aminopeptidase (X-PDAP; EC 3.4.14.5). A mixed-oligonucleotide probe prepared on the basis of the N-terminal amino acid sequence of the purified protein was made and used to screen a partial chromosomal DNA bank in Escherichia

  20. Changes in vasopressin-converting aminopeptidase activity in the rat pineal gland during summer : Relationship to vasopressin contents

    NARCIS (Netherlands)

    Liu, B.; Burbach, J.P.H.

    1988-01-01

    Vasopressin (VP)-converting aminopeptidase (VP-AP) activity and VP contents were measured in single rat pineal glands during the summer of two successive years. The peptidase activity decreased significantly in August. The lowest activity (±SEM) of 0.18±0.02 pmol·hour−1 was recorded on August 14, co

  1. S1 pocket fingerprints of human and bacterial methionine aminopeptidases determined using fluorogenic libraries of substrates and phosphorus based inhibitors

    Czech Academy of Sciences Publication Activity Database

    Poreba, M.; Gajda, A.; Pícha, Jan; Jiráček, Jiří; Marschner, A.; Klein, Ch. D.; Salvesen, G. S.; Drag, M.

    2012-01-01

    Roč. 94, č. 3 (2012), s. 704-710. ISSN 0300-9084 R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z40550506 Keywords : methionine aminopeptidase * substrate library * protease * enzyme * inhibitor * substrate specificity Subject RIV: CC - Organic Chemistry Impact factor: 3.142, year: 2012

  2. Defectively N-glycosylated and non-O-glycosylated aminopeptidase N (CD13) is normally expressed at the cell surface and has full enzymatic activity

    DEFF Research Database (Denmark)

    Norén, K; Hansen, Gert Helge; Clausen, H;

    1997-01-01

    the glycoprotein aminopeptidase N can be synthesized and the effects of altered glycosylation can be studied. It is demonstrated that aminopeptidase N carries "mucin-type" O-glycans and that this is predominantly located in the stalk, which connects the catalytic headgroup to the membrane anchor...... changes in N-glycosylation as the various glycosylated forms of aminopeptidase N are normally converted from the high-mannose form to the complex glycosylated form. Enzymatic activity is not influenced by the changes in glycosylation....

  3. Exploring S1 plasticity and probing S1' subsite of mammalian aminopeptidase N/CD13 with highly potent and selective aminobenzosuberone inhibitors.

    Science.gov (United States)

    Revelant, Germain; Al-Lakkis-Wehbe, Mira; Schmitt, Marjorie; Alavi, Sarah; Schmitt, Céline; Roux, Lionel; Al-Masri, Mounir; Schifano-Faux, Nadège; Maiereanu, Carmen; Tarnus, Céline; Albrecht, Sébastien

    2015-07-01

    In order to probe the S1 and S1' mammalian aminopeptidase N subsites, racemic 1- or 4-substituted 7-aminobenzocyclohepten-6-one derivatives were synthesized and evaluated for their ability to inhibit mammalian aminopeptidase N. We focused on improving the physicochemical and ADME properties of this series by targeting lipophilicity and LELP score. Some 4-heteroaryl substituted analogues displayed reduced lipophilicity and enhanced inhibition potency with Ki values in the nanomolar range. PMID:25982416

  4. High-level expression and characterization of the Bacillus subtilis subsp. subtilis str. BSP1 YwaD aminopeptidase in Pichia pastoris.

    Science.gov (United States)

    Tang, Wei; Li, Zhezhe; Li, Chunhua; Yu, Xianhong; Wang, Fei; Wan, Xin; Wang, Yaping; Ma, Lixin

    2016-06-01

    Aminopeptidases are widely used for creating protein hydrolysates and peptide sequencing. The ywaD gene from a new Bacillus isolate, named Bacillus subtilis subsp. subtilis str. BSP1, was cloned into the yeast expression vector pHBM905A and expressed and secreted by Pichia pastoris strain GS115. The deduced amino acid sequence of the aminopeptidase encoded by the ywaD gene shared up to 98% identity with aminopeptidases from B. subtilis strains 168 and zj016. The yield (3.81 g/l) and specific activity (788 U/mg) of recombinant YwaD in high-density fermentation were extremely high. And 829.83 mg of the purified enzyme (4089.72 U/mg) were harvested. YwaD was glycosylated, and its activity decreased after deglycosylation, which was similar to that of the aminopeptidase from B. subtilis strain zj016. YwaD was most active toward l-arginine-4-nitroanilide. Moreover, it exhibited high resistance to carbamide, which was not true for aminopeptidases from B. subtilis strains 168 and zj016, which could simplify the purification of YwaD. Moreover, the expression and parts of characterization of the aminopeptidase from B. subtilis strain 168 in Pichia pastoris were added as supplementary material. The sequence and other characteristics of YwaD were compared with those of aminopeptidases from B. subtilis strains 168 and zj016, and they will provide a solid foundation for further research on the influence of amino acid mutations on the function of aminopeptidases. PMID:26898926

  5. Degradation and debittering of a tryptic digest from beta-casein by aminopeptidase N from Lactococcus lactis subsp. cremoris Wg2.

    OpenAIRE

    Tan, P S; van Kessel, T A; van de Veerdonk, F.L.; Zuurendonk, P F; Bruins, A P; Konings, W. N.

    1993-01-01

    The mode of action of purified aminopeptidase N from Lactococcus lactis subsp. cremoris Wg2 on a complex peptide mixture of a tryptic digest from bovine beta-casein was analyzed. The oligopeptides produced in the tryptic digest before and after aminopeptidase N treatment were identified by analysis of the N- and C-terminal amino acid sequences and amino acid compositions of the isolated peptides and by on-line liquid chromatography-mass spectrometry. Incubation of purified peptides with amino...

  6. Endoplasmic reticulum aminopeptidase 2 is highly expressed in papillary thyroid microcarcinoma with cervical lymph node metastasis

    Directory of Open Access Journals (Sweden)

    Woo Young Kim

    2015-01-01

    Full Text Available Background: The cervical lymph node metastasis (CLNM of papillary thyroid microcarcinoma (PTMC is not uncommon. However, prophylactic cervical lymph node dissection in all PTMC is debatable. Molecular markers of predicting CLNM would help to decide to either do or not do cervical lymph node dissection which might increase morbidities. Aims: We aimed to characterize gene expression profiles and molecular markers of CLNM in PTMC. Settings and Design: The thyroid frozen tissues were obtained with from six PTMC patients, who underwent total thyroidectomy. Methods: We performed oligonucleotide microarray analysis with three PTMCs with CLNM and three without CLNM. Real-time quantitative reverse transcription-polymerase chain reaction was used to validate the gene. Statistical Analysis Used: We used linear models for microarray data. Results: We identified 12 differentially expressed gene, and most one is endoplasmic reticulum aminopeptidase 2 (ERAP2. Conclusion: ERAP2 might be associated with CLNM in PTMC.

  7. Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-12-17

    The Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N (APN) was analyzed, to better understand the molecular mechanism of susceptibility to the toxin and the development of resistance in insects. APN was digested with lysylendopeptidase and the ability of the resulting fragments to bind to Cry1Aa and 1Ac toxins was examined. The binding abilities of the two toxins to these fragments were different. The Cry1Aa toxin bound to the fragment containing 40-Asp to 313-Lys, suggesting that the Cry1Aa toxin-binding site is located in the region between 40-Asp and 313-Lys, while Cry1Ac toxin bound exclusively to mature APN. Next, recombinant APN of various lengths was expressed in Escherichia coli cells and its ability to bind to Cry1Aa toxin was examined. The results localized the Cry1Aa toxin binding to the region between 135-Ile and 198-Pro. PMID:10606725

  8. Feline aminopeptidase N is not a functional receptor for avian infectious bronchitis virus

    Directory of Open Access Journals (Sweden)

    Harbison Carole E

    2007-02-01

    Full Text Available Abstract Background Coronaviruses are an important cause of infectious diseases in humans, including severe acute respiratory syndrome (SARS, and have the continued potential for emergence from animal species. A major factor in the host range of a coronavirus is its receptor utilization on host cells. In many cases, coronavirus-receptor interactions are well understood. However, a notable exception is the receptor utilization by group 3 coronaviruses, including avian infectious bronchitis virus (IBV. Feline aminopeptidase N (fAPN serves as a functional receptor for most group 1 coronaviruses including feline infectious peritonitis virus (FIPV, canine coronavirus, transmissible gastroenteritis virus (TGEV, and human coronavirus 229E (HCoV-229E. A recent report has also suggested a role for fAPN during IBV entry (Miguel B, Pharr GT, Wang C: The role of feline aminopeptidase N as a receptor for infectious bronchitis virus. Brief review. Arch Virol 2002, 147:2047–2056. Results Here we show that, whereas both transient transfection and constitutive expression of fAPN on BHK-21 cells can rescue FIPV and TGEV infection in non-permissive BHK cells, fAPN expression does not rescue infection by the prototype IBV strain Mass41. To account for the previous suggestion that fAPN could serve as an IBV receptor, we show that feline cells can be infected with the prototype strain of IBV (Mass 41, but with low susceptibility compared to primary chick kidney cells. We also show that BHK-21 cells are slightly susceptible to certain IBV strains, including Ark99, Ark_DPI, CA99, and Iowa97 ( Conclusion We conclude that fAPN is not a functional receptor for IBV, the identity of which is currently under investigation.

  9. Aminopeptidase N (APN/CD13 inhibitor, Ubenimex, enhances radiation sensitivity in human cervical cancer

    Directory of Open Access Journals (Sweden)

    Nawa Akihiro

    2008-03-01

    Full Text Available Abstract Background Radiotherapy can be used to treat all stages of cervical cancer. For improving local control via radiotherapy, it is important to use additional antitumor agents. Aminopeptidase N (APN/CD13, a 150-kDa metalloproteinase, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression in several human malignancies. Methods We investigated whether the suppression of APN/CD13 using Ubenimex, an inhibitor of APN/CD13 activity, may affect tumor radiosensitivity in cervical cancer cells both in vitro and in vivo. Cell surface APN/CD13 activity in HeLa cells was calculated using alanine-p-nitroanilido as a substrate. For colony formation assays, single-dose radiation and/or Ubenimex were administered to each dish of HeLa cells, and these dishes were cultured for 14 days. Molecular changes of apoptosis were determined by Western blot. Apoptosis was evaluated by Annexin-V PI staining (flow cytometry analysis and the Tunel method. Moreover, we investigated the effect of combining Ubenimex and low-dose radiation on tumor growth using nude mice. Results We demonstrated that Ubenimex enhanced the effectiveness of radiotherapy, acting as a radiosensitizer both in vitro and in vivo. In colony formation assays, a significant decline in clonogenic survival was observed in Ubenimex-treated cells. Mice treated with a combination of radiation and Ubenimex showed a significant prolongation of the tumor-doubling time compared with the control, Ubenimex, or radiation-alone groups. We also showed that ubenimex enhanced radiation-induced apoptosis in vitro and in vivo. Conclusion Although further studies are needed, this report suggests that Ubeniemx acts as a radiosensitizer in cervical cancer treatment, and that the inhibition of APN/CD13 activity may represent a new approach for improving the therapeutic efficacy of radiotherapy for uterine

  10. Aminopeptidase N (APN)/CD13 inhibitor, Ubenimex, enhances radiation sensitivity in human cervical cancer

    International Nuclear Information System (INIS)

    Radiotherapy can be used to treat all stages of cervical cancer. For improving local control via radiotherapy, it is important to use additional antitumor agents. Aminopeptidase N (APN)/CD13, a 150-kDa metalloproteinase, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression in several human malignancies. We investigated whether the suppression of APN/CD13 using Ubenimex, an inhibitor of APN/CD13 activity, may affect tumor radiosensitivity in cervical cancer cells both in vitro and in vivo. Cell surface APN/CD13 activity in HeLa cells was calculated using alanine-p-nitroanilido as a substrate. For colony formation assays, single-dose radiation and/or Ubenimex were administered to each dish of HeLa cells, and these dishes were cultured for 14 days. Molecular changes of apoptosis were determined by Western blot. Apoptosis was evaluated by Annexin-V PI staining (flow cytometry analysis) and the Tunel method. Moreover, we investigated the effect of combining Ubenimex and low-dose radiation on tumor growth using nude mice. We demonstrated that Ubenimex enhanced the effectiveness of radiotherapy, acting as a radiosensitizer both in vitro and in vivo. In colony formation assays, a significant decline in clonogenic survival was observed in Ubenimex-treated cells. Mice treated with a combination of radiation and Ubenimex showed a significant prolongation of the tumor-doubling time compared with the control, Ubenimex, or radiation-alone groups. We also showed that ubenimex enhanced radiation-induced apoptosis in vitro and in vivo. Although further studies are needed, this report suggests that Ubeniemx acts as a radiosensitizer in cervical cancer treatment, and that the inhibition of APN/CD13 activity may represent a new approach for improving the therapeutic efficacy of radiotherapy for uterine cervical cancer

  11. Expression levels of aminopeptidase-N genes in the lightbrown apple moth,Epiphyas postvittana

    Institute of Scientific and Technical Information of China (English)

    Robert M.Simpson; Joanne Poulton; Ngaire P.Markwick

    2008-01-01

    Five aminopeptidase-N genes(EpAPNl-5)of the tortricid moth Epiphyas postvittana have been isolated from a midgut expressed sequence tag(EST)library.Relative RNA expression of these genes was measured by quantitative reverse transcription poly-merase chain reaction using actin as a reference gene.Measurements were made on various tissues of fifth instar larvac.over all stages of the life cycle and under differing dietary conditions:different protein sources and levels,and in presence of trypsin and metalloproteatm ininbitors.Gene expression for all five genes Was the greatest in midgut tissue,but Was also detected in the hindgut,fat body and Malpighian tubules.EpAPN4 was consistently the highest expressed,with EpAPN3 at about half that level;EpAPN5 Was the least expressed.During larval stages expression Was high,generally increasing OVer the instars,after an early Deak as neonates or first instars.Expression in other life stages Was much lower.Males and females showed differing expression in the pupal and adult stages:female expression was higher in the pupa,this reversed in tlle adult.Gene expression levels and ratios both changed with diet.A natural apple leaf diet depressed levels.Diets with the most impaired amino acid balance induced the greatest change;generally EpAPN1 increased by the greatest proportion.The addition of proteinase inhibitor also increased gene expression,and it Was noteworthy that the trypsin inhibitor addition,which has been shown to double aminopeptidase activity,also doubled levels of gene expression.

  12. Molecular and biochemical characterization of methionine aminopeptidase of Babesia bovis as a potent drug target.

    Science.gov (United States)

    Munkhjargal, Tserendorj; Ishizaki, Takahiro; Guswanto, Azirwan; Takemae, Hitoshi; Yokoyama, Naoaki; Igarashi, Ikuo

    2016-05-15

    Aminopeptidases are increasingly being investigated as therapeutic targets in various diseases. In this study, we cloned, expressed, and biochemically characterized a member of the methionine aminopeptidase (MAP) family from Babesia bovis (B. bovis) to develop a potential molecular drug target. Recombinant B. bovis MAP (rBvMAP) was expressed in Escherichia coli (E. coli) as a glutathione S-transferase (GST)-fusion protein, and we found that it was antigenic. An antiserum against the rBvMAP protein was generated in mice, and then a native B. bovis MAP was identified in B. bovis by Western blot assay. Further, an immunolocalization assay showed that MAP is present in the cytoplasm of the B. bovis merozoite. Analysis of the biochemical properties of rBvMAP revealed that it was enzymatically active, with optimum activity at pH 7.5. Enhanced enzymatic activity was observed in the presence of divalent manganese cations and was effectively inhibited by a metal chelator, ethylenediaminetetraacetic acid (EDTA). Moreover, the enzymatic activity of BvMAP was inhibited by amastatin and bestatin as inhibitors of MAP (MAPi) in a dose-dependent manner. Importantly, MAPi was also found to significantly inhibit the growth of Babesia parasites both in vitro and in vivo; additionally, they induced high levels of cytokines and immunoglobulin (IgG) titers in the host. Therefore, our results suggest that BvMAP is a molecular target of amastatin and bestatin, and those inhibitors may be drug candidates for the treatment of babesiosis, though more studies are required to confirm this. PMID:27084466

  13. Cloning and Sequencing of a Gene Encoding Aminopeptidase N in the Midgut of Helicoverpa armigera (Hübner)

    Institute of Scientific and Technical Information of China (English)

    WANG Gui-rong; LIANG Ge-mei; WU Kong-ming; GUO Yu-yuan

    2003-01-01

    A cDNA encoding aminopeptidase N was cloned by degenerated PCR combined with RACEtechnique in this paper. The full-length of APN-Harm is 3 043 bp. Open reading frame is 2 856 bp inlength, encoding 951 amino acid residues. Its predicted molecular weight and isoelectric point are 108.3kDa and 5.29, respectively. This deduced amino acid sequence shares some common structural features withaminopeptidase N from several moth species, including the consensus zinc-binding motif HEXXHX18 E and the GAMEN motif common to gluzincin aminopeptidases. The first 20 amino acid residues at N-termini ishydrophobic transmembrane helix. The sequence of APN-Harm was deposited in GenBank and the accessionnumber is AY181026.

  14. A novel virulence strategy for Pseudomonas aeruginosa mediated by an autotransporter with arginine-specific aminopeptidase activity

    OpenAIRE

    Luckett, Jeni C. A.; Owen Darch; Chase Watters; Manal Abuoun; Victoria Wright; Esteban Paredes-Osses; Jenny Ward; Hana Goto; Stephan Heeb; Stéphanie Pommier; Rumbaugh, Kendra P.; Miguel Cámara; Hardie, Kim R.

    2012-01-01

    Author Summary We present a new Pseudomonas aeruginosa virulence factor that promotes chronic skin wound infections. We propose the name AaaA for this cell-surface tethered autotransporter. This arginine-specific aminopeptidase confers a growth advantage upon P. aeruginosa, providing a fitness advantage by creating a supply of arginine in chronic wounds where oxygen availability is limited and biofilm formation is involved. To our knowledge, this is the first mechanistic evidence linking the ...

  15. A common SNP in ER aminopeptidase 2 induces a specificity switch that leads to altered antigen processing

    OpenAIRE

    Evnouchidou, Irini; Birtley, James; Seregin, Sergey; Papakyriakou, Athanasios; Zervoudi, Efthalia; Samiotaki, Martina; Panayotou, George; Giastas, Petros; Petrakis, Olivia; Georgiadis, Dimitris; Amalfitano, Andrea; Saridakis, Emmanuel; Mavridis, Irene M.; Stratikos, Efstratios

    2012-01-01

    ER aminopeptidases 1 and 2 (ERAP1 and ERAP2) cooperate to trim antigenic peptide precursors for loading onto MHC class I molecules and help regulate the adaptive immune response. Common coding single nucleotide polymorphisms (SNPs) in ERAP1 and ERAP2 have been linked with predisposition to human diseases ranging from viral and bacterial infections to autoimmunity and cancer. It has been hypothesized that altered antigen processing by these enzymes is a causal link to disease etiology but the ...

  16. A Role for Naturally Occurring Alleles of Endoplasmic Reticulum Aminopeptidases in Tumor Immunity and Cancer Pre-Disposition

    OpenAIRE

    Stratikos, Efstratios; Stamogiannos, Athanasios; Zervoudi, Efthalia; Fruci, Doriana

    2014-01-01

    Endoplasmic reticulum aminopeptidase 1 and 2 (ERAP1 and ERAP2) are key components on the pathway that generates antigenic epitopes for presentation to cytotoxic T-lymphocytes (CTLs). Coding single nucleotide polymorphisms (SNPs) in these enzymes have been associated with pre-disposition to several major human diseases including inflammatory diseases with autoimmune etiology, viral infections, and virally induced cancer. The function of these enzymes has been demonstrated to affect CTL and nat...

  17. Secretion of Endoplasmic Reticulum Aminopeptidase 1 Is Involved in the Activation of Macrophages Induced by Lipopolysaccharide and Interferon-γ*

    OpenAIRE

    Goto, Yoshikuni; Ogawa, Kenji; Hattori, Akira; Tsujimoto, Masafumi

    2011-01-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) is a multifunctional enzyme with an important role in processing antigenic peptides presented to class I major histocompatibility complex in the endoplasmic reticulum. In this study, we found that endoplasmic reticulum-retained ERAP1 was secreted from macrophages in response to activation by treatment with lipopolysaccharide (LPS) and interferon (IFN)-γ and enhanced their phagocytic activity. Enhancement of the phagocytic activity of murine macro...

  18. Crystal structures of the endoplasmic reticulum aminopeptidase-1 (ERAP1) reveal the molecular basis for N-terminal peptide trimming

    OpenAIRE

    Kochan, Grazyna; Krojer, Tobias; Harvey, David; Fischer, Roman; Chen, Liye; Vollmar, Melanie; von Delft, Frank; Kavanagh, Kathryn L.; Brown, Matthew A.; Bowness, Paul; Wordsworth, Paul; Kessler, Benedikt M.; Oppermann, Udo

    2011-01-01

    Endoplasmatic reticulum aminopeptidase 1 (ERAP1) is a multifunctional enzyme involved in trimming of peptides to an optimal length for presentation by major histocompatibility complex (MHC) class I molecules. Polymorphisms in ERAP1 have been associated with chronic inflammatory diseases, including ankylosing spondylitis (AS) and psoriasis, and subsequent in vitro enzyme studies suggest distinct catalytic properties of ERAP1 variants. To understand structure-activity relationships of this enzy...

  19. Concerted In Vitro Trimming of Viral HLA-B27-Restricted Ligands by Human ERAP1 and ERAP2 Aminopeptidases

    OpenAIRE

    Lorente, Elena; Barriga, Alejandro; Johnstone, Carolina; Mir, Carmen; Jiménez, Mercedes; López, Daniel

    2013-01-01

    In the classical human leukocyte antigen (HLA) class I antigen processing and presentation pathway, the antigenic peptides are generated from viral proteins by multiple proteolytic cleavages of the proteasome (and in some cases other cytosolic proteases) and transported to the endoplasmic reticulum (ER) lumen where they are exposed to aminopeptidase activity. In human cells, two different ER-resident enzymes, ERAP1 and ERAP2, can trim the N-terminally extended residues of peptide precursors. ...

  20. Expression and clinical significance of aminopeptidase N/CD13 in non-small cell lung cancer

    OpenAIRE

    Quan Zhang; Jinghui Wang; Haiqing Zhang; Dan Zhao; Zongde Zhang; Shucai Zhang

    2015-01-01

    Background: The objective of this study was to analyze the expression of aminopeptidase N/CD13 (APN/CD13) in non-small cell lung cancer (NSCLC) and investigate its correlation with various clinical factors, including prognosis and efficacy of adjuvant chemotherapy. Materials and Methods: Using immunohistochemistry analysis, we analyzed the expression of CD13 in clinicopathologically characterized 127 NSCLC cases. The relationship between the expression levels of CD13 and clinical features ...

  1. Involvement of Aminopeptidase N (CD13) in Infection of Human Neural Cells by Human Coronavirus 229E

    OpenAIRE

    Lachance, Claude; Arbour, Nathalie; Cashman, Neil R.; Talbot, Pierre J

    1998-01-01

    Attachment to a cell surface receptor can be a major determinant of virus tropism. Previous studies have shown that human respiratory coronavirus HCV-229E uses human aminopeptidase N (hAPN [CD13]) as its cellular receptor for infection of lung fibroblasts. Although human coronaviruses are recognized respiratory pathogens, occasional reports have suggested their possible neurotropism. We have previously shown that human neural cells, including glial cells in primary cultures, are susceptible t...

  2. Structural analysis of inhibition of E. coli methionine aminopeptidase: implication of loop adaptability in selective inhibition of bacterial enzymes

    OpenAIRE

    Ma, Ze-qiang; Xie, Sheng-xue; Huang, Qing-Qing; Nan, Fa-jun; Hurley, Thomas D.; Ye, Qi-Zhuang

    2007-01-01

    Background Methionine aminopeptidase is a potential target of future antibacterial and anticancer drugs. Structural analysis of complexes of the enzyme with its inhibitors provides valuable information for structure-based drug design efforts. Results Five new X-ray structures of such enzyme-inhibitor complexes were obtained. Analysis of these and other three similar structures reveals the adaptability of a surface-exposed loop bearing Y62, H63, G64 and Y65 (the YHGY loop) that is an integral ...

  3. 3’-RACE Amplification of Aminopeptidase N Gene from Anopheles stephensi Applicable in Transmission Blocking Vaccines

    OpenAIRE

    Bokharaei, Hanieh; Raz, Abbasali; Zakeri, Sedigheh; Djadid, Navid Dinparast

    2012-01-01

    Background Because of the lack of an effective and economical control strategy against malaria (the most devastating infectious disease in developing countries) Transmission-Blocking Vaccines (TBVs) concept has been raised in recent years, promising a more efficient way to malaria control. TBVs aim at interfering and/or blocking pathogen development within the vector, halting transmission to non-infected vertebrate host. Aminopeptidase N (APN) is one of the most potent proteins in parasite de...

  4. Activity of neutral endopeptidase and aminopeptidase N in mouse thymic stromal cells which bind double-positive thymocytes.

    Science.gov (United States)

    Small, M; Kaiser, M; Tse, W; Heimfeld, S; Blumberg, S

    1996-04-01

    The activity of two peptidases was determined in immortalized lines of thymic stromal cells. A line of total stromal cells (T-TG-St) was grown from transgenic mouse expressing temperature-sensitive SV40 T antigen under the control of the regulatory elements of the mouse major histocompatibility complex class I gene. From these cells we isolated a subset (DP-TG-St) that binds thymocytes which are mainly CD4+8+. We also assayed a clone of fetal thymic epithelial cells (BA/10) that binds CD4+8+ thymocytes. Both lines of double -positive cell-binding stroma exhibited strong activity of two peptidases, neutral endopeptidase (NEP; EC 3.4.24.11) and aminopeptidase N (APN; EC 3.4.11.2). In contrast, the activity of both enzymes was very low in the total thymic stromal line. Use of the specific inhibitors confirmed that these two enzymes were responsible for the activity observed but also suggested the presence of additional unidentified aminopeptidase(s) in the same stromal cells. The high activity of the two peptidases on stromal cells that bind thymocytes at the double-positive stage raises the possibility that they might contribute to the microenvironment of the developing thymocytes. PMID:8625997

  5. Radiation inactivation probe of membrane-bound enzymes: gamma-glutamyltranspeptidase, aminopeptidase N, and sucrase

    International Nuclear Information System (INIS)

    gamma-Glutamyltranspeptidase (GGT), aminopeptidase N (AP-N), and sucrase in purified rabbit intestinal brush border membrane vesicles were irradiated in situ at -135 degrees C using high energy electrons. Surviving activities of the enzymes were measured as a function of radiation dose, and the functional unit target sizes (corresponding to carbohydrate-free polypeptides) were determined using target analysis. The in situ functional unit sizes were GGT 59 kDa, AP-N 59 kDa, and sucrase 63 kDa. Together with biochemical data determined previously, it is concluded that the noncovalently attached large (approximately 40 kDa) and small (approximately 25 kDa) subunits of GGT are both required for catalytic activity. Furthermore, these data suggest that (i) the membrane-bound form of AP-N consists of one or more noncovalently attached subunits of 59 kDa, each of which is enzymatically active; and (ii) in situ sucrase activity is associated with a subunit of 63 kDa which is noncovalently attached within the sucrase-isomaltase complex

  6. LJNK, an indoline-2,3-dione-based aminopeptidase N inhibitor with promising antitumor potency.

    Science.gov (United States)

    Hou, Jinning; Jin, Kang; Li, Jin; Jiang, Yuqi; Li, Xiaoyang; Wang, Xuejian; Huang, Yongxue; Zhang, Yingjie; Xu, Wenfang

    2016-07-01

    In our previous study, we found that LJNK showed potent aminopeptidase N (APN)-inhibitory activity. In the current study, we further evaluated the antitumor effects of LJNK both in vitro and in vivo. Enzyme experiments showed that LJNK showed better inhibitory activity than bestatin against APN both from human carcinoma cells' surface and from porcine kidney microsomes. In addition, LJNK could suppress rat aortic ring microvessel growth and HUVEC tubular structure formation, which showed its stronger antiangiogenesis effects than bestatin. [(3-[4,5-Dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide)] assay and clonogenic assay showed that LJNK suppressed cancer cell growth both in the short and the long term. Mice bearing H22 transplantation tumor proved its antitumor effects in vivo. Annexin V-fluorescein isothiocyanate/propidium iodide assay showed that LJNK could induce 28.1% PLC/PRF/5 cell apoptosis and the apoptotic pathway was probably identified by western blot. The above-mentioned results suggested that LJNK inhibited cell proliferation and angiogenesis, and induced apoptosis by decreasing APN activity. PMID:26872309

  7. Recombinant methionine aminopeptidase protein of Babesia microti: immunobiochemical characterization as a vaccine candidate against human babesiosis.

    Science.gov (United States)

    Munkhjargal, Tserendorj; Yokoyama, Naoaki; Igarashi, Ikuo

    2016-09-01

    Human babesiosis is the most important zoonotic protozoan infection in the world. This is the first report of the cloning, expression, purification, and immunobiochemical characterization of a methionine aminopeptidase 1 (MetAP1) protein from Babesia microti (B. microti). The gene encodes a MetAP1 protein of B. microti (BmMetAP1) of approximately 66.8 kDa that includes glutathione S-transferase (GST) tag and shows MetAP activity. BmMetAP1 was detected in a lysate of B. microti and further localized in cytoplasm of the B. microti merozoite. rBmMetAP1 was found to be immunogenic, eliciting a high antibody titer in mice. Moreover, rBmMetAP1 stimulated the production of IFN-γ and IL-12 but not IL-4. Finally, rBmMetAP1 was able to provide considerable protection to mice against a B. microti challenge infection based on a reduction in peak parasitemia levels and earlier clearance of the parasite as compared with control mice. Taken together, these results suggest that rBmMetAP1 confers significant protection against experimental B. microti infection and might be considered a potential vaccine target against human babesiosis. PMID:27306898

  8. Role of Endoplasmic Reticulum Aminopeptidases in Health and Disease: from Infection to Cancer

    Directory of Open Access Journals (Sweden)

    Doriana Fruci

    2012-07-01

    Full Text Available Endoplasmic reticulum (ER aminopeptidases ERAP1 and ERAP2 (ERAPs are essential for the maturation of a wide spectrum of proteins involved in various biological processes. In the ER, these enzymes work in concert to trim peptides for presentation on MHC class I molecules. Loss of ERAPs function substantially alters the repertoire of peptides presented by MHC class I molecules, critically affecting recognition of both NK and CD8+ T cells. In addition, these enzymes are involved in the modulation of inflammatory responses by promoting the shedding of several cytokine receptors, and in the regulation of both blood pressure and angiogenesis. Recent genome-wide association studies have identified common variants of ERAP1 and ERAP2 linked to several human diseases, ranging from viral infections to autoimmunity and cancer. More recently, inhibition of ER peptide trimming has been shown to play a key role in stimulating innate and adaptive anti-tumor immune responses, suggesting that inhibition of ERAPs might be exploited for the establishment of innovative therapeutic approaches against cancer. This review summarizes data currently available for ERAP enzymes in ER peptide trimming and in other immunological and non-immunological functions, paying attention to the emerging role played by these enzymes in human diseases.

  9. TLR-mediated secretion of endoplasmic reticulum aminopeptidase 1 from macrophages.

    Science.gov (United States)

    Goto, Yoshikuni; Ogawa, Kenji; Nakamura, Takahiro J; Hattori, Akira; Tsujimoto, Masafumi

    2014-05-01

    Macrophages play an important role in host defense under several immunological, inflammatory, and/or infectious conditions. In our previous work, we demonstrated that endoplasmic reticulum aminopeptidase 1 (ERAP1) was secreted from macrophages in response to LPS and IFN-γ, and it enhanced their phagocytic activity. In this study, we analyzed the mechanism of LPS/IFN-γ-induced ERAP1 secretion. LPS/IFN-γ-induced secretion of the enzyme from the murine macrophage cell line RAW264.7 was suppressed by polymyxin B. Several agonists of TLRs, such as Pam3CSK4, FSL-1, and ODN1826, induced its secretion. In contrast, neutralizing Abs to IFN-β and TNF-α receptor type 1 suppressed its secretion. Using murine peritoneal macrophages derived from TNF-α and type 1 IFNR knockout mice, we confirmed the involvement of these two cytokines in ERAP1 secretion. In addition, secretion of ERAP1 from both RAW264.7 cells and murine peritoneal macrophages was induced by A23187 and thapsigargin and inhibited by BAPTA-AM and the calmodulin inhibitor W7. These results suggest that LPS/IFN-γ-induced secretion of ERAP1 is mediated by TLRs via induction of intermediate cytokines such as IFN-β and TNF-α, which in turn lead to enhanced cytosolic Ca(2+) levels and calmodulin activation. PMID:24688025

  10. Structural Basis For Antigenic Peptide Precursor Processing by the Endoplasmic Reticulum Aminopeptidase ERAP1

    Energy Technology Data Exchange (ETDEWEB)

    T Nguyen; S Chang; I Evnouchidou; I York; C Zikos; K Rock; A Goldberg; E Stratikos; L Stern

    2011-12-31

    ERAP1 trims antigen precursors to fit into MHC class I proteins. To fulfill this function, ERAP1 has unique substrate preferences, trimming long peptides but sparing shorter ones. To identify the structural basis for ERAP1's unusual properties, we determined the X-ray crystal structure of human ERAP1 bound to bestatin. The structure reveals an open conformation with a large interior compartment. An extended groove originating from the enzyme's catalytic center can accommodate long peptides and has features that explain ERAP1's broad specificity for antigenic peptide precursors. Structural and biochemical analyses suggest a mechanism for ERAP1's length-dependent trimming activity, whereby binding of long rather than short substrates induces a conformational change with reorientation of a key catalytic residue toward the active site. ERAP1's unique structural elements suggest how a generic aminopeptidase structure has been adapted for the specialized function of trimming antigenic precursors.

  11. A role for naturally occurring alleles of Endoplasmic Reticulum Aminopeptidases in tumor immunity and cancer predisposition

    Directory of Open Access Journals (Sweden)

    Efstratios eStratikos

    2014-12-01

    Full Text Available Endoplasmic Reticulum aminopeptidase 1 and 2 (ERAP1 and ERAP2 are key components on the pathway that generates antigenic epitopes for presentation to cytotoxic T-lymphocytes (CTLs. Coding single nucleotide polymorphisms (SNPs in these enzymes have been associated with predisposition to several major human diseases including inflammatory diseases with autoimmune aetiology, viral infections and virally induced cancer. The function of these enzymes has been demonstrated to affect cytotoxic T-lymphocyte (CTL and natural killer (NK cell responses towards healthy and malignant cells as well as the production of inflammatory cytokines. Recent studies have demonstrated that SNPs in ERAP1 and ERAP2 can affect their ability to generate or destroy antigenic epitopes and define the immunopeptidome. In this review we examine the potential role of these enzymes and their polymorphic states on the generation of cytotoxic responses towards malignantly transformed cells. Given the current state-of-the-art, it is possible that polymorphic variation in these enzymes may contribute to the individual’s predisposition to cancer through altered generation or destruction of tumor antigens that can facilitate tumor immune evasion.

  12. Structure of a microsporidian methionine aminopeptidase type 2 complexed with fumagillin and TNP-470

    Energy Technology Data Exchange (ETDEWEB)

    Alvarado, J.; Nemkal, A; Sauder, J; Russell, M; Akiyoshi, D; Shi, W; Almo, S; Weiss, L

    2009-01-01

    Microsporidia are protists that have been reported to cause infections in both vertebrates and invertebrates. They have emerged as human pathogens particularly in patients that are immunosuppressed and cases of gastrointestinal infection, encephalitis, keratitis, sinusitis, myositis and disseminated infection are well described in the literature. While benzimidazoles are active against many species of microsporidia, these drugs do not have significant activity against Enterocytozoon bieneusi. Fumagillin and its analogues have been demonstrated to have activity in vitro and in animal models of microsporidiosis and human infections due to E. bieneusi. Fumagillin and its analogues inhibit methionine aminopeptidase type 2. Encephalitozoon cuniculi MetAP2 (EcMetAP2) was cloned and expressed as an active enzyme using a baculovirus system. The crystal structure of EcMetAP2 was determined with and without the bound inhibitors fumagillin and TNP-470. This structure classifies EcMetAP2 as a member of the MetAP2c family. The EcMetAP2 structure was used to generate a homology model of the E. bieneusi MetAP2. Comparison of microsporidian MetAP2 structures with human MetAP2 provides insights into the design of inhibitors that might exhibit specificity for microsporidian MetAP2.

  13. Discovery of inhibitors of insulin-regulated aminopeptidase as cognitive enhancers.

    Science.gov (United States)

    Andersson, Hanna; Hallberg, Mathias

    2012-01-01

    The hexapeptide angiotensin IV (Ang IV) is a metabolite of angiotensin II (Ang II) and plays a central role in the brain. It was reported more than two decades ago that intracerebroventricular injection of Ang IV improved memory and learning in the rat. Several hypotheses have been put forward to explain the positive effects of Ang IV and related analogues on cognition. It has been proposed that the insulin-regulated aminopeptidase (IRAP) is the main target of Ang IV. This paper discusses progress in the discovery of inhibitors of IRAP as potential enhancers of cognitive functions. Very potent inhibitors of the protease have been synthesised, but pharmacokinetic issues (including problems associated with crossing the blood-brain barrier) remain to be solved. The paper also briefly presents an overview of the status in the discovery of inhibitors of ACE and renin, and of AT1R antagonists and AT2R agonists, in order to enable other discovery processes within the RAS system to be compared. The paper focuses on the relationship between binding affinities/inhibition capacity and the structures of the ligands that interact with the target proteins. PMID:23304452

  14. Differential Dissolved Organic Nitrogen Availability and Bacterial Aminopeptidase Activity in Limnic and Marine Waters.

    Science.gov (United States)

    Stepanauskas; Edling; Tranvik

    1999-10-01

    Abstract Nitrogen often limits primary production in marine ecosystems and its loading from terrestrial sources is the major cause of enhanced coastal eutrophication worldwide. About 70% of nitrogen transported by rivers globally is dissolved organic nitrogen (DON). Therefore, terrestrial DON is potentially an important component of the N dynamics in aquatic ecosystems, but the bioavailability of this organic nitrogen is poorly known. Bacterial extracellular hydrolysis of polymers is a bottleneck in the utilization of natural dissolved organic matter, mostly consisting of high molecular weight compounds. To study the bacterial utilization and extracellular enzymatic hydrolysis of DON, we developed a bioassay employing natural DON as the only N source, and N as the limiting nutrient. Bacterial cell density and activity of an unspecific aminopeptidase (AMPase) were followed in the cultures. Natural DON stimulated the cell-specific AMPase activity. Furthermore, refractory and humus-rich DOM caused a stronger stimulation than labile DOM. We propose that the previously reported inhibitory effect of humic substances on enzyme activity was outweighed by the induction of enzyme synthesis caused by refractory substrates. AMPase activity and the estimated DON bioavailability were more than twofold higher in seawater than in freshwater with identical substrate additions. This indicates that hydrolysis and turnover of land-derived DON is enhanced when it enters coastal marine waters, enabling it to support elevated bacterioplankton and phytoplankton growth.http://link.springer-ny.com/link/service/journals/00248/bibs/38n3p264.html

  15. Type I methionine aminopeptidase from Saccharomyces cerevisiae is a potential target for antifungal drug screening

    Institute of Scientific and Technical Information of China (English)

    Ling-ling CHEN; Jia LI; Jing-ya LI; Qun-li LUO; Wei-feng MAO; Qiang SHEN; Fa-jun NAN; Qi-zhuang YE

    2004-01-01

    AIM: To screen antifungal drug candidates using in vitro and in vivo assays based on type I methionine aminopeptidase from Saccharomyces cerevisiae (ScMetAP1). METHODS: A colorimetric assay suitable for high throughput screening (HTS) using recombinant ScMetAP1 protein expressed in Escherichia coli was established for antifungal lead discovery. A series of pyridine-2-carboxylic acid derivatives were characterized and a chemical library of 12 800 pure organic compounds was screened with the in vitro ScMetAP1 assay. Active compounds from the in vitro assay were further evaluated by a growth inhibition assay on yeast strain with deletion of ScMetAP1 gene mapl in comparison with the wild-type yeast strain and the yeast strain with deletion of type II enzyme (ScMetAP2)gene map2. RESULTS: Active ScMetAP1 inhibitors were identified from HTS. Some of the pyridine-2-carboxylic acid derivatives (compound 2 and 3) had selective inhibition of the growth of map2 deletion yeast and weak inhibition on wild-type yeast growth, while no inhibition on mapl deletion yeast. CONCLUSION: ScMetAP1 is a novel potential target for developing antifungal drugs. The in vitro and in vivo ScMetAP1 assays can serve as tools in discovering antifungal drug candidates.

  16. In ovo Administration of Ghrelin and Subsequent Intestinal Leucine aminopeptidase (LAP Activity in Broiler Chickens

    Directory of Open Access Journals (Sweden)

    J. Ghiasi Ghaleh-kandi,

    2011-02-01

    Full Text Available Aim of this study was to investigation on effect of in ovo administration of ghrelin on subsequent Leucine Aminopeptidase (LAP activity in broiler chickens. In this experiment 250 fertilized eggs were collected from commercial breeder flock. The eggs were divided into five experimental groups; control T1 (without injection, group T2 (in ovo injected with solution, group T3 (in ovo injected with 50 μg/egg ghrelin, group T4 (in ovo injected with 100 μg/egg ghrelin and group T5 (in ovo injected with 150 μg/egg ghrelin. All of groups were incubated. In ovo injection was done at day 7 of incub ation. in ovo administration of 150 μg/egg ghrelin in embryonic period, could stimulate LAP activity at 21-day- old chicks in 10, 30 and 50% of intestine with 3520.4, 266.9, 4595.6 IU/g protein, also in ovo injected 50 and 150 μg/egg ghrelin could stimulate LAP activity in 1, 50 and 70% of intestine with 3071.4, 4779.3 and 5013.4 IU/g. In 42-day-old chicks, in ovo injected 50 μg/egg ghrelin could stimulate LAP activity in 1, 10, 30, 40, 70, and 90% percent of intestine. These findings demonstrated stimulatory effects of ghrelin in low doses (50 μg in chicken intestine LAP activity.

  17. Aminopeptidase activity in rat brain synaptosomes - 2-mercaptoethanol stimulation and Arg-vasopressin degradation

    International Nuclear Information System (INIS)

    Rat brain synaptic plasma membranes contain an amastatin-inhibited aminopeptidase activity which degrades Arg-vaso-pressin (AVP). The pH optimum for AVP cleavage was found to be 6.8, similar to that reported for oxytocin. The ability of other peptides and arylamides such as oxytocin, Tyr-Phe-Met-Arg-Phe-NH2 and Arg-Arg-βNA to inhibit cleavage of [3H-Tyr2]-AVP suggests that the enzyme may not be specific for AVP. The AVP-cleaving activity has been solubilized and partially characterized. Synaptosomes were lysed with hypotonic buffer, washed, and extracted with 1% Nonidet P-40 detergent. The solubilized protein was chromatographed by gel filtration HPLC on Superose 6. A single peak of activity was found with a M.W. = 117,000 which could hydrolyze 1mM Ala-βNA, Arg-βNA, Arg-Arg-βNA, Phe-Met and Phe-Arg as well as slowly cleave AVP with the ultimate release of 3H-Tyr. 2-Mercaptoethanol (3.9mM) (ME) stimulated activity 3.6 to 6.6-fold for arylamide and dipeptide substrates, but 35-fold for labelled AVP, possibly owing to reduction of the AVP disulfide bond. All activities in the presence of ME were completely inhibited by 0.2mM amastatin

  18. Insulin-regulated aminopeptidase deficiency provides protection against ischemic stroke in mice.

    Science.gov (United States)

    Pham, Vi; Albiston, Anthony L; Downes, Catherine E; Wong, Connie H Y; Diwakarla, Shanti; Ng, Leelee; Lee, Seyoung; Crack, Peter J; Chai, Siew Yeen

    2012-04-10

    Recent studies have demonstrated that angiotensin IV (Ang IV) provides protection against brain injury caused by cerebral ischemia. Ang IV is a potent inhibitor of insulin-regulated aminopeptidase (IRAP). Therefore, we examined the effect of IRAP gene inactivation on neuroprotection following transient middle cerebral artery occlusion (MCAo) in mice. IRAP knockout mice and wild-type controls were subjected to 2 h of transient MCAo using the intraluminal filament technique. Twenty-four hours after reperfusion, neurological deficits of the stroke-induced mice were assessed and infarct volumes were measured by TTC staining. The cerebral infarct volume was significantly reduced in the IRAP knockout mice compared to wild-type littermates with corresponding improvement in neurological performance at 24 h post-ischemia. An increase in compensatory cerebral blood flow during MCAo was observed in the IRAP knockout animals with no differences in cerebral vascular anatomy detected. The current study demonstrates that deletion of the IRAP gene protects the brain from ischemic damage analogous to the effect of the IRAP inhibitor, Ang IV. This study indicates that IRAP is potentially a new therapeutic target for the development of treatment for ischemic stroke. PMID:21895534

  19. Inhibition of the methionine aminopeptidase 2 enzyme for the treatment of obesity

    Directory of Open Access Journals (Sweden)

    Joharapurkar AA

    2014-02-01

    Full Text Available Amit A Joharapurkar, Nirav A Dhanesha, Mukul R Jain Department of Pharmacology and Toxicology, Zydus Research Centre, Cadila Healthcare Limited, Ahmedabad, India Abstract: Worldwide prevalence of obesity has nearly doubled since 1980. Obesity is the result of interactions among the environmental factors, genetic predisposition, and human behavior. Even modest weight reduction in obese patients provides beneficial health outcomes. For effective weight reduction, a drug should either increase energy expenditure or decrease energy intake without causing serious adverse effects. To overcome lack of efficacy and central nervous system related side effects, exploitation of the peripheral mechanism of anti-obesity action is needed. Inhibition of pathological angiogenesis in adipose tissue is one such peripheral mechanism that has attracted the attention of researchers in this area. Although originally developed as anti-cancer agents, methionine aminopeptidase (MetAP2 inhibitors induce significant and sustained weight reduction. Here, we review preclinical and clinical pharmacology of MetAP2 inhibitors. Beloranib is a prototype MetAP2 inhibitor, and currently in advanced clinical trials for the treatment of obesity. Clinical data of beloranib indicate that MetAP2 inhibitors could be a future treatment option for weight reduction without serious adverse effects. Further clinical data from Phase III trials will add to our growing knowledge of MetAP2 inhibitor potential for anti-obesity therapy. Keywords: angiogenesis, beloranib, body weight, MetAP2, anti-obesity

  20. Aminopeptidase activity in rat brain synaptosomes - 2-mercaptoethanol stimulation and Arg-vasopressin degradation

    Energy Technology Data Exchange (ETDEWEB)

    Simmons, W.H.; Orawski, A.T.

    1986-03-05

    Rat brain synaptic plasma membranes contain an amastatin-inhibited aminopeptidase activity which degrades Arg-vaso-pressin (AVP). The pH optimum for AVP cleavage was found to be 6.8, similar to that reported for oxytocin. The ability of other peptides and arylamides such as oxytocin, Tyr-Phe-Met-Arg-Phe-NH/sub 2/ and Arg-Arg-..beta..NA to inhibit cleavage of (/sup 3/H-Tyr/sup 2/)-AVP suggests that the enzyme may not be specific for AVP. The AVP-cleaving activity has been solubilized and partially characterized. Synaptosomes were lysed with hypotonic buffer, washed, and extracted with 1% Nonidet P-40 detergent. The solubilized protein was chromatographed by gel filtration HPLC on Superose 6. A single peak of activity was found with a M.W. = 117,000 which could hydrolyze 1mM Ala-..beta..NA, Arg-..beta..NA, Arg-Arg-..beta..NA, Phe-Met and Phe-Arg as well as slowly cleave AVP with the ultimate release of /sup 3/H-Tyr. 2-Mercaptoethanol (3.9mM) (ME) stimulated activity 3.6 to 6.6-fold for arylamide and dipeptide substrates, but 35-fold for labelled AVP, possibly owing to reduction of the AVP disulfide bond. All activities in the presence of ME were completely inhibited by 0.2mM amastatin.

  1. Activity of leucine aminopeptidase of Telchin licus licus: an important insect pest of sugarcane.

    Science.gov (United States)

    Valencia, Jorge W Arboleda; de Sá, Maria Fátima Grossi; Jiménez, Arnubio Valencia

    2014-06-01

    The enzymatic activity of leucine aminopeptidase (EC 3.4.11.1) from the intestinal tract of sugarcane giant borer (Telchin licus licus) was assayed by using a simple and sensitive spectrophotometric assay that uses L-leucyl-2- naphthylamide as substrate. In this assay, L-leucyl-2-naphthylamide is hydrolyzed to produce 2-naphthylamine and Lleucine. The product 2-naphthylamine reacts with Fast Black K and can be monitored using a continuous spectrophotometric measurement at 590 nm. The data on the kinetic parameters indicates that the Km for the L-leucyl-2- naphthylamide at pH 7.0 was found to be lower than those found for other LAP substrates. The Km and Vmax for the LAP were determined to be 84.03 µM and 357.14 enzymatic units mg(-1), respectively. A noticeable difference of LAP activity between the two insect orders tested was observed. This method could be used to screen for natural LAP inhibitors. PMID:24410745

  2. Specific myeloprotection via multidrug resistance 1 gene controlled by aminopeptidase N myeloid promoter

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In the treatment of tumor patients introduction of multidrug resistance genes into hematopoietic cells has been reported as an approach for reducing myelotoxicity created by antitumor drugs. However, the nonspecific expression of the genes can also increase the chemoresistance of the tumor cells invaded into bone marrow, which influences seriously the effectiveness of chemotherapy. In this study, a new strategy is described for specific myeloprotection. The recombinant retroviral vector containing multidrug resistance 1 (MDR1) gene regulated by aminopeptidase N (APN) myeloid promoter was constructed and then introduced into myeloblastic cells KG1a and tumor cell line BEL7402. The specific transcript of MDR1 was detected in KG1a cells transduced with MDR1 gene and rhodamine 123 was effectively extruded by Pgp, the protein of MDR1 gene. The resistance elevated markedly by 10.6, 10.4, 11.2, 4.2 and 14.2 folds in MDR1 gene-transduced KG1a cells to chemotherapeutic drugs such as cochicine, VP-16, vincristine, doxorubi- cin and paclitaxel, respectively. In contrast, the chemoresistance had no significant changes in BEL7402 cells transduced with MDR1 gene. Expression of MDR1 directed by APN myeloid promoter resulted in myelospecific protection during the killing of tumor cells treated with antitumor drugs. The study would provide a new mean for circumventing myelosuppression of tumor patients undergoing chemotherapy.

  3. Expression of Caenorhabditis elegans-expressed Trans-HPS, partial aminopeptidase H11 from Haemonchus contortus.

    Science.gov (United States)

    Zhou, Qian-Jin; Yang, Yi; Guo, Xiao-Lu; Duan, Li-Jun; Chen, Xue-Qiu; Yan, Bao-Long; Zhang, Hong-Li; Du, Ai-Fang

    2014-10-01

    Aminopeptidase H11 present in the surface of intestine microvilli in Haemonchus contortus was identified as the most effective antigen candidate. However, its recombinant forms produced in Escherichiacoli, insect cells and yeast could not provide promising protection against H. contortus challenge, probably due to the inappropriate glycosylation and/or conformational folding. Herein, partial H11 containing the potential zinc-binding domain and two predicted glycosylation sites (nt 1 bp-1710 bp, Trans-HPS) was subcloned downstream of 5' flanking region of Caenorhabditis elegans cpr-1 gene in pPD95.77 vector, with the deletion of GFP gene. The recombinant was expressed in C. elegans and verified by blotting with anti-H11 and anti-Trans-HPS rabbit polyclonal antibodies and anti-His monoclonal antibody. Stably inherited Trans-HPS in worm descendants was achieved by integration using UV irradiation. Immunization with the crude Trans-HPS extracted from transgenic worms resulted in 37.71% reduction in faecal egg counts (FEC) (Pgoats. These results suggested an apparent delay against H. contortus egg-laying in goats, which differed from that with bacteria-origin form of partial H11 (nt 670 bp-1710 bp, HPS) (26.04% reduction in FEC and 18.46% reduction in worm burden). These findings indicate the feasibility of sufficient C. elegans-expressed H11 for the immunological research and vaccine development. PMID:25128369

  4. Silencing or inhibition of endoplasmic reticulum aminopeptidase 1 (ERAP1) suppresses free heavy chain expression and Th17 responses in ankylosing spondylitis

    OpenAIRE

    Chen, Liye; Ridley, Anna; Hammitzsch, Ariane; Al-Mossawi, Mohammad Hussein; Bunting, Helen; Georgiadis, Dimitris; Chan, Antoni; Kollnberger, Simon; Bowness, Paul

    2015-01-01

    Objective Human leucocyte antigen (HLA)-B27 and endoplasmic reticulum aminopeptidase 1 (ERAP1) are strongly associated with ankylosing spondylitis (AS). ERAP1 is a key aminopeptidase in HLA class I presentation and can potentially alter surface expression of HLA-B27 free heavy chains (FHCs). We studied the effects of ERAP1 silencing/inhibition/variations on HLA-B27 FHC expression and Th17 responses in AS. Methods Flow cytometry was used to measure surface expression of HLA class I in peripher...

  5. The ER aminopeptidase, ERAP1, trims precursors to lengths of MHC class I peptides by a “molecular ruler” mechanism

    OpenAIRE

    Chang, Shih-Chung; Momburg, Frank; Bhutani, Nidhi; Goldberg, Alfred L.

    2005-01-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) is an IFN-γ-induced aminopeptidase in the endoplasmic reticulum that trims longer precursors to the antigenic peptides presented on MHC class I molecules. We recently reported that purified ERAP1 trimmed N-extended precursors but spared peptides of 8-9 residues, the length required for binding to MHC class I molecules. Here, we show another remarkable property of ERAP1: that it strongly prefers substrates 9-16 residues long, the lengths of peptid...

  6. Rationally designed inhibitor targeting antigen-trimming aminopeptidases enhances antigen presentation and cytotoxic T-cell responses.

    Science.gov (United States)

    Zervoudi, Efthalia; Saridakis, Emmanuel; Birtley, James R; Seregin, Sergey S; Reeves, Emma; Kokkala, Paraskevi; Aldhamen, Yasser A; Amalfitano, Andrea; Mavridis, Irene M; James, Edward; Georgiadis, Dimitris; Stratikos, Efstratios

    2013-12-01

    Intracellular aminopeptidases endoplasmic reticulum aminopeptidases 1 and 2 (ERAP1 and ERAP2), and as well as insulin-regulated aminopeptidase (IRAP) process antigenic epitope precursors for loading onto MHC class I molecules and regulate the adaptive immune response. Their activity greatly affects the antigenic peptide repertoire presented to cytotoxic T lymphocytes and as a result can regulate cytotoxic cellular responses contributing to autoimmunity or immune evasion by viruses and cancer cells. Therefore, pharmacological regulation of their activity is a promising avenue for modulating the adaptive immune response with possible applications in controlling autoimmunity, in boosting immune responses to pathogens, and in cancer immunotherapy. In this study we exploited recent structural and biochemical analysis of ERAP1 and ERAP2 to design and develop phosphinic pseudopeptide transition state analogs that can inhibit this family of enzymes with nM affinity. X-ray crystallographic analysis of one such inhibitor in complex with ERAP2 validated our design, revealing a canonical mode of binding in the active site of the enzyme, and highlighted the importance of the S2' pocket for achieving inhibitor potency. Antigen processing and presentation assays in HeLa and murine colon carcinoma (CT26) cells showed that these inhibitors induce increased cell-surface antigen presentation of transfected and endogenous antigens and enhance cytotoxic T-cell responses, indicating that these enzymes primarily destroy epitopes in those systems. This class of inhibitors constitutes a promising tool for controlling the cellular adaptive immune response in humans by modulating the antigen processing and presentation pathway. PMID:24248368

  7. Aminopeptidase B, a glucagon-processing enzyme: site directed mutagenesis of the Zn2+-binding motif and molecular modelling

    Directory of Open Access Journals (Sweden)

    Etchebest Catherine

    2007-10-01

    Full Text Available Abstract Background Aminopeptidase B (Ap-B; EC 3.4.11.6 catalyzes the cleavage of basic residues at the N-terminus of peptides and processes glucagon into miniglucagon. The enzyme exhibits, in vitro, a residual ability to hydrolyze leukotriene A4 into the pro-inflammatory lipid mediator leukotriene B4. The potential bi-functional nature of Ap-B is supported by close structural relationships with LTA4 hydrolase (LTA4H ; EC 3.3.2.6. A structure-function analysis is necessary for the detailed understanding of the enzymatic mechanisms of Ap-B and to design inhibitors, which could be used to determine the complete in vivo functions of the enzyme. Results The rat Ap-B cDNA was expressed in E. coli and the purified recombinant enzyme was characterized. 18 mutants of the H325EXXHX18E348 Zn2+-binding motif were constructed and expressed. All mutations were found to abolish the aminopeptidase activity. A multiple alignment of 500 sequences of the M1 family of aminopeptidases was performed to identify 3 sub-families of exopeptidases and to build a structural model of Ap-B using the x-ray structure of LTA4H as a template. Although the 3D structures of the two enzymes resemble each other, they differ in certain details. The role that a loop, delimiting the active center of Ap-B, plays in discriminating basic substrates, as well as the function of consensus motifs, such as RNP1 and Armadillo domain are discussed. Examination of electrostatic potentials and hydrophobic patches revealed important differences between Ap-B and LTA4H and suggests that Ap-B is involved in protein-protein interactions. Conclusion Alignment of the primary structures of the M1 family members clearly demonstrates the existence of different sub-families and highlights crucial residues in the enzymatic activity of the whole family. E. coli recombinant enzyme and Ap-B structural model constitute powerful tools for investigating the importance and possible roles of these conserved residues

  8. Aminopeptidase B, a glucagon-processing enzyme: site directed mutagenesis of the Zn2+-binding motif and molecular modelling

    Science.gov (United States)

    Pham, Viet-Laï; Cadel, Marie-Sandrine; Gouzy-Darmon, Cécile; Hanquez, Chantal; Beinfeld, Margery C; Nicolas, Pierre; Etchebest, Catherine; Foulon, Thierry

    2007-01-01

    Background Aminopeptidase B (Ap-B; EC 3.4.11.6) catalyzes the cleavage of basic residues at the N-terminus of peptides and processes glucagon into miniglucagon. The enzyme exhibits, in vitro, a residual ability to hydrolyze leukotriene A4 into the pro-inflammatory lipid mediator leukotriene B4. The potential bi-functional nature of Ap-B is supported by close structural relationships with LTA4 hydrolase (LTA4H ; EC 3.3.2.6). A structure-function analysis is necessary for the detailed understanding of the enzymatic mechanisms of Ap-B and to design inhibitors, which could be used to determine the complete in vivo functions of the enzyme. Results The rat Ap-B cDNA was expressed in E. coli and the purified recombinant enzyme was characterized. 18 mutants of the H325EXXHX18E348 Zn2+-binding motif were constructed and expressed. All mutations were found to abolish the aminopeptidase activity. A multiple alignment of 500 sequences of the M1 family of aminopeptidases was performed to identify 3 sub-families of exopeptidases and to build a structural model of Ap-B using the x-ray structure of LTA4H as a template. Although the 3D structures of the two enzymes resemble each other, they differ in certain details. The role that a loop, delimiting the active center of Ap-B, plays in discriminating basic substrates, as well as the function of consensus motifs, such as RNP1 and Armadillo domain are discussed. Examination of electrostatic potentials and hydrophobic patches revealed important differences between Ap-B and LTA4H and suggests that Ap-B is involved in protein-protein interactions. Conclusion Alignment of the primary structures of the M1 family members clearly demonstrates the existence of different sub-families and highlights crucial residues in the enzymatic activity of the whole family. E. coli recombinant enzyme and Ap-B structural model constitute powerful tools for investigating the importance and possible roles of these conserved residues in Ap-B, LTA4H and M1

  9. Expression of aminopeptidase-n (CD 13) in normal tissues and malignant neoplasms of epithelial and lymphoid origin.

    OpenAIRE

    Dixon, J.; Kaklamanis, L.; Turley, H; Hickson, I D; Leek, R. D.; Harris, A. L.; Gatter, K C

    1994-01-01

    AIMS--To provide a detailed knowledge of the distribution of the CD13 molecule, also known as the protease aminopeptidase-N, on both normal tissues and malignant neoplasms of epithelial and lymphoid origin. METHODS--CD13 antigen was examined by immunocytochemistry, using a recently produced antibody (VS5E) alongside a commercially available anti-CD13 monoclonal antibody. The VS5E recognising CD13 was produced by immunising a doxorubicin resistant breast cancer cell line (MCF-7-ADr). A strikin...

  10. MT95-4, a fully humanized antibody raised against aminopeptidase N, reduces tumor progression in a mouse model

    OpenAIRE

    Akita, Shin; HATTORI, NOBORU; Masuda, Takeshi; Horimasu, Yasushi; Nakashima, Taku; Iwamoto, Hiroshi; Fujitaka, Kazunori; Miyake, Masayuki; Kohno, Nobuoki

    2015-01-01

    Aminopeptidase N (APN/CD13) is involved in tumor cell invasion and tumor angiogenesis and is considered a promising therapeutic target in the treatment of cancer. To develop a novel monoclonal antibody-based cancer therapy targeting APN/CD13, we established a fully humanized anti-APN/CD13 monoclonal antibody, MT95-4. In vitro, MT95-4 inhibited APN/CD13 enzymatic activity on the tumor cell surface and blocked tumor cell invasion. B16 mouse melanoma cells stably expressing human APN/CD13 were a...

  11. Targeting CD13 (aminopeptidase-N) in turn downregulates ADAM17 by internalization in acute myeloid leukaemia cells

    OpenAIRE

    Bouchet, Sandrine; TANG, RUOPING; Fava, Fanny; Legrand, Ollivier; Bauvois, Brigitte

    2014-01-01

    Secreted matrix metalloproteinases (MMP)-2 and MMP-9 and membrane-anchored aminopeptidase-N/CD13 are abnormally expressed in human acute myeloid leukaemia (AML). We previously showed that CD13 ligation by anti-CD13 monoclonal antibodies can induce apoptosis in AML cells. Here, we assessed ADAM17 expression in primary blood blasts CD13+CD33+ from patients with AML. Primary AML cells expressed ADAM17 transcript and its surface expression was higher in subtype M4 (myelomonocytic) and M5 (monocyt...

  12. CD13/Aminopeptidase N overexpression by basic fibroblast growth factor mediates enhanced invasiveness of 1F6 human melanoma cells

    OpenAIRE

    Fontijn, D.; Duyndam, M.C.A.; van Berkel, M P A; Yuana, Y.; Shapiro, L H; Pinedo, H. M.; Broxterman, H.J.; Boven, E.

    2006-01-01

    CD13/Aminopeptidase N (CD13) is known to play an important role in tumour cell invasion. We examined whether basic fibroblast growth factor (bFGF) is involved in the regulation of CD13 expression in human melanoma cells. 1F6 human melanoma cells were stably transfected with constructs encoding either the 18 kDa (18kD) or all (ALL) bFGF isoform proteins. We observed highly increased CD13 mRNA and protein expression in the 1F6 clones regardless of the overexpression of either the 18kD or all is...

  13. Changes in vasopressin-converting aminopeptidase activity in the rat pineal gland during summer : Relationship to vasopressin contents

    OpenAIRE

    Liu, B; Burbach, J. P. H.

    1988-01-01

    Vasopressin (VP)-converting aminopeptidase (VP-AP) activity and VP contents were measured in single rat pineal glands during the summer of two successive years. The peptidase activity decreased significantly in August. The lowest activity (±SEM) of 0.18±0.02 pmol·hour−1 was recorded on August 14, compared to the basal activity of 0.25±0.01 pmol·hour−1 in July and September of 1986. The change with similar percentage occurred in the same period of 1987. The specific activity of the enzyme in t...

  14. Effects of polymorphic variation on the mechanism of Endoplasmic Reticulum Aminopeptidase 1.

    Science.gov (United States)

    Stamogiannos, Athanasios; Koumantou, Despoina; Papakyriakou, Athanasios; Stratikos, Efstratios

    2015-10-01

    Endoplasmic Reticulum Aminopeptidase 1 (ERAP1) generates antigenic peptides for loading onto Major Histocompatibility Class I molecules (MHCI) and can regulate adaptive immune responses. During the last few years, many genetic studies have revealed strong associations between coding Single Nucleotide Polymorphisms (SNPs) in ERAP1 and common human diseases ranging from viral infections to cancer and autoimmunity. Functional studies have established that these SNPs affect enzyme activity resulting to changes in antigenic peptide processing, presentation by MHCI and cellular cytotoxic responses. These disease-associated polymorphisms are, however, located away from the enzyme's active site and are interspersed to different structural domains. As a result, the mechanism by which these SNPs can affect function remains largely elusive. ERAP1 utilizes a complex catalytic mechanism that involves a large conformational change between inactive and active forms and has the unique property to trim larger peptides more efficiently than smaller ones. We analyzed two of the most consistently discovered disease-associated polymorphisms, namely K528R and Q730E, for their effect on the ability of the enzyme to select substrates based on length and to undergo conformational changes. By utilizing enzymatic and computational analysis we propose that disease-associated SNPs can affect ERAP1 function by influencing: (i) substrate length selection and (ii) the conformational distribution of the protein ensemble. Our results provide novel insight on the mechanisms by which polymorphic variation distal from the active site of ERAP1 can translate to changes in function and contribute to immune system variability in humans. PMID:26224046

  15. Endoplasmic reticulum aminopeptidase-1 functions regulate key aspects of the innate immune response.

    Directory of Open Access Journals (Sweden)

    Yasser A Aldhamen

    Full Text Available Endoplasmic reticulum aminopeptidase-1 (ERAP1 is a multifunctional, ubiquitously expressed enzyme whose peptide-trimming role during antigen processing for presentation by MHC I molecules is well established, however, a role for ERAP1 in modulating global innate immune responses has not been described to date. Here we demonstrate that, relative to wild type mice, mice lacking ERAP1 exhibit exaggerated innate immune responses early during pathogen recognition, as characterized by increased activation of splenic and hepatic NK and NKT cells and enhanced production of pro-inflammatory cytokines such as IL12 and MCP1. Our data also revealed that ERAP1 is playing a critical role in NK cell development and function. We observed higher frequencies of terminally matured NK cells, as well as higher frequencies of licensed NK cells (expressing the Ly49C and Ly49I receptors in ERAP1-KO mice, results that positively correlated with an enhanced NK activation and IFNγ production by ERAP1-KO mice challenged with pro-inflammatory stimuli. Furthermore, during pathogen recognition, ERAP1 regulates IL12 production by CD11c(+ DCs specifically, with increases in IL12 production positively correlated with an increased phagocytic activity of splenic DCs and macrophages. Collectively, our results demonstrate a previously unrecognized, more central role for the ERAP1 protein in modulating several aspects of both the development of the innate immune system, and its responses during the initial stages of pathogen recognition. Such a role may explain why ERAP1 has been implicated by GWAS in the pathogenesis of autoimmune diseases that may be precipitated by aberrant responses to pathogen encounters.

  16. Endoplasmic reticulum aminopeptidase-1 functions regulate key aspects of the innate immune response.

    Science.gov (United States)

    Aldhamen, Yasser A; Seregin, Sergey S; Rastall, David P W; Aylsworth, Charles F; Pepelyayeva, Yuliya; Busuito, Christopher J; Godbehere-Roosa, Sarah; Kim, Sungjin; Amalfitano, Andrea

    2013-01-01

    Endoplasmic reticulum aminopeptidase-1 (ERAP1) is a multifunctional, ubiquitously expressed enzyme whose peptide-trimming role during antigen processing for presentation by MHC I molecules is well established, however, a role for ERAP1 in modulating global innate immune responses has not been described to date. Here we demonstrate that, relative to wild type mice, mice lacking ERAP1 exhibit exaggerated innate immune responses early during pathogen recognition, as characterized by increased activation of splenic and hepatic NK and NKT cells and enhanced production of pro-inflammatory cytokines such as IL12 and MCP1. Our data also revealed that ERAP1 is playing a critical role in NK cell development and function. We observed higher frequencies of terminally matured NK cells, as well as higher frequencies of licensed NK cells (expressing the Ly49C and Ly49I receptors) in ERAP1-KO mice, results that positively correlated with an enhanced NK activation and IFNγ production by ERAP1-KO mice challenged with pro-inflammatory stimuli. Furthermore, during pathogen recognition, ERAP1 regulates IL12 production by CD11c(+) DCs specifically, with increases in IL12 production positively correlated with an increased phagocytic activity of splenic DCs and macrophages. Collectively, our results demonstrate a previously unrecognized, more central role for the ERAP1 protein in modulating several aspects of both the development of the innate immune system, and its responses during the initial stages of pathogen recognition. Such a role may explain why ERAP1 has been implicated by GWAS in the pathogenesis of autoimmune diseases that may be precipitated by aberrant responses to pathogen encounters. PMID:23894499

  17. Structural bases of coronavirus attachment to host aminopeptidase N and its inhibition by neutralizing antibodies.

    Directory of Open Access Journals (Sweden)

    Juan Reguera

    Full Text Available The coronaviruses (CoVs are enveloped viruses of animals and humans associated mostly with enteric and respiratory diseases, such as the severe acute respiratory syndrome and 10-20% of all common colds. A subset of CoVs uses the cell surface aminopeptidase N (APN, a membrane-bound metalloprotease, as a cell entry receptor. In these viruses, the envelope spike glycoprotein (S mediates the attachment of the virus particles to APN and subsequent cell entry, which can be blocked by neutralizing antibodies. Here we describe the crystal structures of the receptor-binding domains (RBDs of two closely related CoV strains, transmissible gastroenteritis virus (TGEV and porcine respiratory CoV (PRCV, in complex with their receptor, porcine APN (pAPN, or with a neutralizing antibody. The data provide detailed information on the architecture of the dimeric pAPN ectodomain and its interaction with the CoV S. We show that a protruding receptor-binding edge in the S determines virus-binding specificity for recessed glycan-containing surfaces in the membrane-distal region of the pAPN ectodomain. Comparison of the RBDs of TGEV and PRCV to those of other related CoVs, suggests that the conformation of the S receptor-binding region determines cell entry receptor specificity. Moreover, the receptor-binding edge is a major antigenic determinant in the TGEV envelope S that is targeted by neutralizing antibodies. Our results provide a compelling view on CoV cell entry and immune neutralization, and may aid the design of antivirals or CoV vaccines. APN is also considered a target for cancer therapy and its structure, reported here, could facilitate the development of anti-cancer drugs.

  18. A Novel Glutamyl (Aspartyl-Specific Aminopeptidase A from Lactobacillus delbrueckii with Promising Properties for Application.

    Directory of Open Access Journals (Sweden)

    Timo Stressler

    Full Text Available Lactic acid bacteria (LAB are auxotrophic for a number of amino acids. Thus, LAB have one of the strongest proteolytic systems to acquit their amino acid requirements. One of the intracellular exopeptidases present in LAB is the glutamyl (aspartyl specific aminopeptidase (PepA; EC 3.4.11.7. Most of the PepA enzymes characterized yet, belonged to Lactococcus lactis sp., but no PepA from a Lactobacillus sp. has been characterized so far. In this study, we cloned a putative pepA gene from Lb. delbrueckii ssp. lactis DSM 20072 and characterized it after purification. For comparison, we also cloned, purified and characterized PepA from Lc. lactis ssp. lactis DSM 20481. Due to the low homology between both enzymes (30%, differences between the biochemical characteristics were very likely. This was confirmed, for example, by the more acidic optimum pH value of 6.0 for Lb-PepA compared to pH 8.0 for Lc-PepA. In addition, although the optimum temperature is quite similar for both enzymes (Lb-PepA: 60°C; Lc-PepA: 65°C, the temperature stability after three days, 20°C below the optimum temperature, was higher for Lb-PepA (60% residual activity than for Lc-PepA (2% residual activity. EDTA inhibited both enzymes and the strongest activation was found for CoCl2, indicating that both enzymes are metallopeptidases. In contrast to Lc-PepA, disulfide bond-reducing agents such as dithiothreitol did not inhibit Lb-PepA. Finally, Lb-PepA was not product-inhibited by L-Glu, whereas Lc-PepA showed an inhibition.

  19. A Novel Glutamyl (Aspartyl)-Specific Aminopeptidase A from Lactobacillus delbrueckii with Promising Properties for Application

    Science.gov (United States)

    Stressler, Timo; Ewert, Jacob; Merz, Michael; Funk, Joshua; Claaßen, Wolfgang; Lutz-Wahl, Sabine; Schmidt, Herbert; Kuhn, Andreas; Fischer, Lutz

    2016-01-01

    Lactic acid bacteria (LAB) are auxotrophic for a number of amino acids. Thus, LAB have one of the strongest proteolytic systems to acquit their amino acid requirements. One of the intracellular exopeptidases present in LAB is the glutamyl (aspartyl) specific aminopeptidase (PepA; EC 3.4.11.7). Most of the PepA enzymes characterized yet, belonged to Lactococcus lactis sp., but no PepA from a Lactobacillus sp. has been characterized so far. In this study, we cloned a putative pepA gene from Lb. delbrueckii ssp. lactis DSM 20072 and characterized it after purification. For comparison, we also cloned, purified and characterized PepA from Lc. lactis ssp. lactis DSM 20481. Due to the low homology between both enzymes (30%), differences between the biochemical characteristics were very likely. This was confirmed, for example, by the more acidic optimum pH value of 6.0 for Lb-PepA compared to pH 8.0 for Lc-PepA. In addition, although the optimum temperature is quite similar for both enzymes (Lb-PepA: 60°C; Lc-PepA: 65°C), the temperature stability after three days, 20°C below the optimum temperature, was higher for Lb-PepA (60% residual activity) than for Lc-PepA (2% residual activity). EDTA inhibited both enzymes and the strongest activation was found for CoCl2, indicating that both enzymes are metallopeptidases. In contrast to Lc-PepA, disulfide bond-reducing agents such as dithiothreitol did not inhibit Lb-PepA. Finally, Lb-PepA was not product-inhibited by L-Glu, whereas Lc-PepA showed an inhibition. PMID:27003449

  20. Identification of alanyl aminopeptidase (CD13) as a surface marker for isolation of mature gastric zymogenic chief cells.

    Science.gov (United States)

    Moore, Benjamin D; Jin, Ramon U; Osaki, Luciana; Romero-Gallo, Judith; Noto, Jennifer; Peek, Richard M; Mills, Jason C

    2015-12-15

    Injury and inflammation in the gastric epithelium can cause disruption of the pathways that guide the differentiation of cell lineages, which in turn can cause persistent alterations in differentiation patterns, known as metaplasia. Metaplasia that occurs in the stomach is associated with increased risk for cancer. Methods for isolating distinct gastric epithelial cell populations would facilitate dissection of the molecular and cellular pathways that guide normal and metaplastic differentiation. Here, we identify alanyl aminopeptidase (CD13) as a specific surface marker of zymogenic chief cells (ZCs) in the gastric epithelium. We show that 1) among gastric epithelial cells alanyl aminopeptidase expression is confined to mature ZCs, and 2) its expression is lost en route to metaplasia in both mouse and human stomachs. With this new marker coupled with new techniques that we introduce for dissociating gastric epithelial cells and overcoming their constitutive autofluorescence, we are able to reliably isolate enriched populations of ZCs for both molecular analysis and for the establishment of ZC-derived ex vivo gastroid cultures. PMID:26514774

  1. Lactase-phlorizin hydrolase and aminopeptidase N are differentially regulated in the small intestine of the pig

    DEFF Research Database (Denmark)

    Torp, Niels; Rossi, M; Troelsen, J T;

    1993-01-01

    The longitudinal expression of two brush-border enzymes, lactase-phlorizin hydrolase (EC 3.2.1.23/62) and aminopeptidase N (EC 3.4.11.2), was studied in the small intestine of the post-weaned pig. Whereas the level of mRNA, encoding aminopeptidase N (relative to that of beta-actin), only varied......-translational processing or intracellular transport was observed along the intestine. The mRNA/specific-activity ratio for both enzymes was markedly (3-5-fold) higher in the duodenum and proximal jejunum, compared with the ileum. This indicates an increased proximal turnover rate, most likely caused by the presence in the...... gut lumen of pancreatic proteases. In neonatal animals, the level of mRNA for lactase-phlorizin hydrolase in both proximal and distal regions of the intestine was of the same magnitude as in the proximal jejunum of the post-weaned pigs. Our results point to two mechanisms that affect the expression of...

  2. Biochemical and structural analysis of a site directed mutant of manganese dependent aminopeptidase P from Streptomyces lavendulae

    Directory of Open Access Journals (Sweden)

    ARYA NANDAN

    2015-08-01

    Full Text Available Aminopeptidase P (APP removes N-terminal amino acids from peptides and proteins when the penultimate residue is proline. To understand the structure-function relationships of aminopeptidase P of Streptomyces lavendulae, a conserved arginine residue was replaced with lysine (R453K by site-directed mutagenesis. The overexpressed wild and mutant enzymes were of nearly 60 kDa and purified by nickel affinity chromatography. Kinetic analysis of R453K variant using Gly-Pro-pNA as the substrate revealed an increase in Km with a decrease in Vmax, leading to overall decrease in the catalytic efficiency, indicating that the guanidinium group of arginine plays an important role in substrate binding in APP. We constructed three dimensional models for the catalytic domains of wild and mutant enzyme and it revealed an interaction in R453 of native enzyme through hydrogen bonding with the adjacent residues making a substrate binding cavity whereas K453 did not participate in any hydrogen bonding. Hence, R453 in APP of S. lavenduale must be playing a critical role in the hydrolysis of the substrate.

  3. Isolation from a Healthy Carrier and Characterization of a Neisseria meningitidis Strain That Is Deficient in γ-Glutamyl Aminopeptidase Activity

    OpenAIRE

    Takahashi, Hideyuki; Hiroshi TANAKA; Inouye, Hiroo; Kuroki, Toshiro; Watanabe, Yuko; Yamai, Shiro; Watanabe, Haruo

    2002-01-01

    γ-Glutamyl aminopeptidase (GGT) activity is used as a specific marker for the identification of Neisseria meningitidis. We isolated from a healthy carrier and characterized an N. meningitidis isolate which lacked the activity due to the insertional mutation of the ggt gene, suggesting that naturally occurring N. meningitidis isolates do not always possess GGT activity.

  4. Unlinked genetic loci control the reduced transcription of aminopeptidase N 1 and 3 in the European corn borer and determine tolerance to Bacillus thuringiensis Cry1Ab toxin

    Science.gov (United States)

    Crystalline (Cry) toxins from Bacillus thuringiensis (Bt) control insect feeding damage on crop plants via foliar applications or by expression within transgenic plants, but continued Bt use is threatened by the buildup of insect resistance traits. Aminopeptidase N (apn) gene family members encode m...

  5. Feline and canine coronaviruses are released from the basolateral side of polarized epithelial LLC-PK1 cells expressing the recombinant feline aminopeptidase-N cDNA

    NARCIS (Netherlands)

    Rossen, J W; Kouame, J; Goedheer, A J; Vennema, H; Rottier, P J

    2001-01-01

    In this study feline (FECV and FIPV) and canine (CCoV) coronavirus entry into and release from polarized porcine epithelial LLC-PK1 cells, stably expressing the recombinant feline aminopeptidase-N cDNA, were investigated. Virus entry appeared to occur preferentially through the apical membrane, simi

  6. Molecular characterization and RNA interference of three midgut aminopeptidase N isozymes from bacillus thuringiensis-susceptible and -resistant strains of sugarcane borer diatraea saccharalis

    Science.gov (United States)

    Aminopeptidase N (APN) proteins located at the midgut epithelium of some lepidopterous species have been implicated as receptors for insecticidal proteins from Bacillus thuringiensis. cDNAs of three APN isoforms, DsAPN1, DsAPN2, and DsAPN3, from Cry1Ab-susceptible (Cry1Ab-SS) and -resistant (Cry1Ab-...

  7. A Phase Ib dose-escalation study to evaluate safety and tolerability of the addition of the aminopeptidase inhibitor tosedostat (CHR-2797) to paclitaxel in patients with advanced solid tumours

    NARCIS (Netherlands)

    C.M.L. Herpen, C.M.L. (Carla); F.A.L.M. Eskens (Ferry); M.J.A. de Jonge (Maja); I. Desar; L. Hooftman (Leon); E. Bone (Elisabeth); J.N.H. Timmerbonte (Johanna); J. Verweij (Jaap)

    2010-01-01

    textabstractBackground: This Phase Ib dose-escalating study investigated safety, maximum tolerated dose (MTD), dose-limiting toxicity (DLT), pharmacokinetics (PK) and clinical antitumour activity of tosedostat (CHR-2797), an orally bioavailable aminopeptidase inhibitor, in combination with paclitaxe

  8. A Phase Ib dose-escalation study to evaluate safety and tolerability of the addition of the aminopeptidase inhibitor tosedostat (CHR-2797) to paclitaxel in patients with advanced solid tumours.

    NARCIS (Netherlands)

    Herpen, C.M.L. van; Eskens, F.A.; Jonge, M. de; Desar, I.M.E.; Hooftman, L.; Bone, E.A.; Timmer-Bonte, J.N.H.; Verweij, J.

    2010-01-01

    BACKGROUND: This Phase Ib dose-escalating study investigated safety, maximum tolerated dose (MTD), dose-limiting toxicity (DLT), pharmacokinetics (PK) and clinical antitumour activity of tosedostat (CHR-2797), an orally bioavailable aminopeptidase inhibitor, in combination with paclitaxel. METHODS:

  9. Factors affecting susceptibility to RNA interference in Haemonchus contortus and in vivo silencing of an H11 aminopeptidase gene.

    Science.gov (United States)

    Samarasinghe, Buddhini; Knox, David P; Britton, Collette

    2011-01-01

    Gene silencing by RNA interference (RNAi) has been applied very successfully to Caenorhabditis elegans to study gene function but has proven less effective in parasitic nematodes. In the sheep gastrointestinal nematode Haemonchus contortus, previous studies demonstrated reproducible silencing of β-tubulin but not of other genes targeted. Here we aimed to examine whether the level of target transcript or site of gene expression influence susceptibility to RNAi by soaking. Target genes represented by a high number of expressed sequence tags (ESTs) in the H. contortus L3 stage were not reproducibly silenced. In contrast, four out of six genes putatively expressed in the intestine, excretory cell or amphids were consistently silenced by RNAi. This suggests that genes expressed in sites accessible to the environment are more likely to be susceptible to RNAi by soaking. Silenced genes included those encoding the highly protective gut aminopeptidase H11, secretory protein Hc-ASP-1, β-tubulin and homologues of aquaporin and RNA helicase. To determine whether RNAi silencing of H11 could mimic H11 vaccination in reducing worm and egg counts, we examined the in vivo effects of H11 RNAi. This is the first, to our knowledge, in vivo study of RNAi in an animal parasitic nematode. RNAi of the H11 gene in infective larvae prior to infection resulted in a 57% reduction in faecal egg count (FEC), 40% reduction in worm burden and 64% decrease in aminopeptidase activity compared with pre-soaking in control dsRNA. Thus, in this study we have established that RNAi is a valid and feasible approach to identify essential gene function. However, using current methods, this may be limited to genes expressed in accessible sites. PMID:20699100

  10. TsPAP1 encodes a novel plant prolyl aminopeptidase whose expression is induced in response to suboptimal growth conditions

    International Nuclear Information System (INIS)

    Highlights: ► A cDNA encoding a novel plant prolyl aminopeptidase, TsPAP1, was obtained from triticale. ► The cloned TsPAP1 cDNA is 1387 bp long and encodes a protein of 390 amino acids. ► The deduced TsPAP1 protein revealed characteristics of the monomeric bacterial PAPs. ► The TsPAP1 mRNA level increased under drought, salinity and in the presence of metal ions. -- Abstract: A triticale cDNA encoding a prolyl aminopeptidase (PAP) was obtained by RT-PCR and has been designated as TsPAP1. The cloned cDNA is 1387 bp long and encodes a protein of 390 amino acids with a calculated molecular mass of 43.9 kDa. The deduced TsPAP1 protein exhibits a considerable sequence identity with the biochemically characterized bacterial and fungal PAP proteins of small molecular masses (∼35 kDa). Moreover, the presence of conserved regions that are characteristic for bacterial monomeric PAP enzymes (the GGSWG motif, the localization of the catalytic triad residues and the segment involved in substrate binding) has also been noted. Primary structure analysis and phylogenetic analysis revealed that TsPAP1 encodes a novel plant PAP protein that is distinct from the multimeric proteins that have thus far been characterized in plants and whose counterparts have been recognized only in bacteria and fungi. A significant increase in the TsPAP1 transcript level in the shoots of triticale plants was observed under drought and saline conditions as well as in the presence of cadmium and aluminium ions in the nutrient medium. This paper is the first report describing changes in the transcript levels of any plant PAP in response to suboptimal growth conditions.

  11. Perturbation of intestinal microvillar enzyme biosynthesis by amino acid analogs. Evidence that dimerization is required for the transport of aminopeptidase N out of the endoplasmic reticulum

    DEFF Research Database (Denmark)

    Danielsen, E M

    1990-01-01

    The amino acid analogs canavanine, 3-hydroxynorvaline, thialysine, 6-fluorotryptophan, m-fluorotyrosine, and 2-fluorophenylalanine were incorporated into proteins, synthesized in pig intestinal mucosal explants, and their effect on molecular processing and intracellular transport of microvillar...... enzymes studied. Unless they were used in combination, none of the analogs drastically reduced the expression of aminopeptidase N (EC 3.4.11.2) or sucrase-isomaltase (EC 3.2.1.48, EC 3.2.1.10), but to a varying extent, they all slowed the rate of transport to the apical surface. In contrast, the cellular...... export of a secretory protein, apolipoprotein A-1, was largely unaffected. For the microvillar enzymes, all six analogs caused an accumulation of the transient, high mannose-glycosylated form, indicating an analog-sensitive stage prior to the Golgi-associated processing. For aminopeptidase N, this arrest...

  12. Proteins of the kidney microvillar membrane. Aspartate aminopeptidase: purification by immunoadsorbent chromatography and properties of the detergent- and proteinase-solubilized forms

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Norén, O; Sjöström, H;

    1980-01-01

    revealed 1 g-atom of Ca/143000 g of protein. Two forms of the enzyme were purified: an amphipathic form solubilized from the membrane by Triton X-100 (detergent form) and a hydrophilic form released by incubation with trypsin (proteinase form). The detergent form exhibited charge-shift in crossed...... substrates were hydrolysed by traces of aminopeptidase M (EC 3.4.11.2) contaminating the preparation could be excluded on several grounds. Aminopeptidase A was sensitive to inhibition by chelating agents and the inactive enzyme could be reactivated by Ca2+ or Mn2+. Atomic absorption spectrophotometry...... immunoelectrophoresis when anionic or cationic detergents were present. On gel filtration, mol.wts. of 350000--400000 and 270000 were calculated for the detergent and proteinase forms. Electron microscopy after negative staining of the proteinase form revealed a dimeric structure. Electrophoresis of either form in the...

  13. Cutting Edge: Coding Single Nucleotide Polymorphisms of Endoplasmic Reticulum Aminopeptidase 1 Can Affect Antigenic Peptide Generation In Vitro by Influencing Basic Enzymatic Properties of the Enzyme

    OpenAIRE

    Evnouchidou, Irini; Kamal, Ram P.; Seregin, Sergey S.; Goto, Yoshikuni; Tsujimoto, Masafumi; Hattori, Akira; Voulgari, Paraskevi V; Drosos, Alexandros A.; Amalfitano, Andrea; Ian A York; Stratikos, Efstratios

    2011-01-01

    ER aminopeptidase 1 (ERAP1) customizes antigenic peptide precursors for MHC class I presentation and edits the antigenic peptide repertoire. Coding single nucleotide polymorphisms (SNPs) in ERAP1 were recently linked with predisposition to autoimmune disease, suggesting a link between pathogenesis of autoimmunity and ERAP1-mediated Ag processing. To investigate this possibility, we analyzed the effect that disease-linked SNPs have on Ag processing by ERAP1 in vitro. Michaelis–Menten analysis ...

  14. Comparative expression profiling for human endoplasmic reticulum-resident aminopeptidases 1 and 2 in normal kidney versus distinct renal cell carcinoma subtypes

    OpenAIRE

    Stoehr, Christine; Buettner-Herold, Maike; Kamphausen, Esther; Bertz, Simone; Hartmann, Arndt; Seliger, Barbara

    2013-01-01

    Altered expression of the ER-resident aminopeptidases ERAP1 and ERAP2 might play an important role in shaping the MHC class I-presented peptide repertoire, but their function in tumors has not been determined in detail. Thus, the expression of ERAP1, ERAP2 and HLA class I heavy chain (HC) was analysed in various renal tumor types and corresponding kidney parenchyma by immunohistochemistry. Additionally, comparative expression profilings of untreated versus interferon (IFN)-γ-treated RCC cell ...

  15. Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims MHC class I-presented peptides in vivo and plays an important role in immunodominance

    OpenAIRE

    Ian A York; Brehm, Michael A.; Zendzian, Sophia; Towne, Charles F.; Rock, Kenneth L.

    2006-01-01

    CD8+ T cells respond to short peptides bound to MHC class I molecules. Although most antigenic proteins contain many sequences that could bind to MHC class I, few of these peptides actually stimulate CD8+ T cell responses. Moreover, the T cell responses that are generated often follow a very reproducible hierarchy to different peptides for reasons that are poorly understood. We find that the loss of a single enzyme, endoplasmic reticulum aminopeptidase 1 (ERAP1), in the antigen-processing pat...

  16. Cloning of the pig aminopeptidase N gene. Identification of possible regulatory elements and the exon distribution in relation to the membrane-spanning region

    DEFF Research Database (Denmark)

    Sjöström, H; Norén, O; Olsen, Jørgen

    We have isolated four lambda-phages covering the complete pig aminopeptidase N/CD13 gene. The sequence of 2.85 kbp encompasses 1.18 kbp of the 5' upstream region and 1.67 kbp of the structural gene. In the promoter region we find a TATA box and potential binding sites for CTF-1/NF-1 and AP-2. By...

  17. Structural analysis of inhibition of E. coli methionine aminopeptidase: implication of loop adaptability in selective inhibition of bacterial enzymes

    OpenAIRE

    Hurley Thomas D; Nan Fa-Jun; Huang Qing-Qing; Xie Sheng-Xue; Ma Ze-Qiang; Ye Qi-Zhuang

    2007-01-01

    Abstract Background Methionine aminopeptidase is a potential target of future antibacterial and anticancer drugs. Structural analysis of complexes of the enzyme with its inhibitors provides valuable information for structure-based drug design efforts. Results Five new X-ray structures of such enzyme-inhibitor complexes were obtained. Analysis of these and other three similar structures reveals the adaptability of a surface-exposed loop bearing Y62, H63, G64 and Y65 (the YHGY loop) that is an ...

  18. Development and Validation of a Whole-Cell Inhibition Assay for Bacterial Methionine Aminopeptidase by Surface-Enhanced Laser Desorption Ionization-Time of Flight Mass Spectrometry

    OpenAIRE

    Greis, Kenneth D.; Zhou, Songtao; Siehnel, Richard; Klanke, Chuck; Curnow, Alan; Jeremy HOWARD; Layh-Schmitt, Gerlinde

    2005-01-01

    Bacterial methionine aminopeptidase (MAP) is a protease that removes methionine from the N termini of newly synthesized bacterial proteins after the peptide deformylase enzyme cleaves the formyl group from the initiator formylmethionine. MAP is an essential bacterial gene product and thus represents a potential target for therapeutic intervention. A fundamental challenge in the antibacterial drug discovery field is demonstrating conclusively that compounds with in vitro enzyme inhibition acti...

  19. Utility of malignancy markers in fine-needle aspiration cytology of thyroid nodules: comparison of Hector Battifora mesothelial antigen-1, thyroid peroxidase and dipeptidyl aminopeptidase IV

    OpenAIRE

    De Micco, C; Savchenko, V.; Giorgi, R; Sebag, F; Henry, J-F

    2008-01-01

    The purpose of this study was to compare the diagnostic interest of Hector Battifora mesothelial antigen-1 (HBME-1), thyroid peroxidase (TPO), and dipeptidyl aminopeptidase IV (DPP4) in thyroid fine-needle aspirates obtained from 200 resected thyroid lesions (55 colloid nodules, 54 follicular adenomas, 59 papillary cancers, and 32 follicular carcinomas). Hector Battifora mesothelial antigen-1 or TPO expression (% positive cells) and DPP4 staining score (12-point scale) were evaluated. Receive...

  20. Characterization of a salt-tolerant aminopeptidase from marine Bacillus licheniformis SWJS33 that improves hydrolysis and debittering efficiency for soy protein isolate.

    Science.gov (United States)

    Lei, Fenfen; Zhao, Qiangzhong; Sun-Waterhouse, Dongxiao; Zhao, Mouming

    2017-01-01

    An aminopeptidase was isolated from the marine Bacillus licheniformis SWJS33 (BLAP) and purified. According to the tandem mass spectrometry, the enzyme displayed 11% amino acid identity with the aminopeptidase from Bacillus (gi|496687392). BLAP exhibited maximum activity at 60°C and pH 8.0-8.5 and had a molecular mass of 100kDa. The presence of NaCl enabled 50% improvement of enzyme activity with 10-15% NaCl being the best. The observed inactivation by EDTA and bestatin and activation by Co(2+) and Ag(+) indicated that the obtained enzyme was a metalloaminopeptidase. Such an aminopeptidase could further improve the hydrolysis degree of soy protein isolate hydrolysates catalyzed by papain, Alcalase 2.4L or Flavourzyme 500MG from 8.5%, 9.5% or 14.4-18.8%, 18.7% or 20.1%, respectively, while decreasing the bitter intensity score of the SPI hydrolysates catalyzed by Alcalase 2.4L from 3.6 to 0.4. PMID:27507484

  1. The major leucyl aminopeptidase of Trypanosoma cruzi (LAPTc assembles into a homohexamer and belongs to the M17 family of metallopeptidases

    Directory of Open Access Journals (Sweden)

    Assumpção Teresa C

    2011-08-01

    Full Text Available Abstract Background Pathogens depend on peptidase activities to accomplish many physiological processes, including interaction with their hosts, highlighting parasitic peptidases as potential drug targets. In this study, a major leucyl aminopeptidolytic activity was identified in Trypanosoma cruzi, the aetiological agent of Chagas disease. Results The enzyme was isolated from epimastigote forms of the parasite by a two-step chromatographic procedure and associated with a single 330-kDa homohexameric protein as determined by sedimentation velocity and light scattering experiments. Peptide mass fingerprinting identified the enzyme as the predicted T. cruzi aminopeptidase EAN97960. Molecular and enzymatic analysis indicated that this leucyl aminopeptidase of T. cruzi (LAPTc belongs to the peptidase family M17 or leucyl aminopeptidase family. LAPTc has a strong dependence on neutral pH, is mesophilic and retains its oligomeric form up to 80°C. Conversely, its recombinant form is thermophilic and requires alkaline pH. Conclusions LAPTc is a 330-kDa homohexameric metalloaminopeptidase expressed by all T. cruzi forms and mediates the major parasite leucyl aminopeptidolytic activity. Since biosynthetic pathways for essential amino acids, including leucine, are lacking in T. cruzi, LAPTc could have a function in nutritional supply.

  2. Enzymatic properties of the glycine D-alanine [corrected] aminopeptidase of Aspergillus oryzae and its activity profiles in liquid-cultured mycelia and solid-state rice culture (rice koji).

    Science.gov (United States)

    Marui, Junichiro; Matsushita-Morita, Mayumi; Tada, Sawaki; Hattori, Ryota; Suzuki, Satoshi; Amano, Hitoshi; Ishida, Hiroki; Yamagata, Youhei; Takeuchi, Michio; Kusumoto, Ken-Ichi

    2012-01-01

    The gdaA gene encoding S12 family glycine-D-alanine aminopeptidase (GdaA) was found in the industrial fungus Aspergillus oryzae. GdaA shares 43% amino acid sequence identity with the D-aminopeptidase of the Gram-negative bacterium Ochrobactrum anthropi. GdaA purified from an A. oryzae gdaA-overexpressing strain exhibited high D-stereospecificity and efficiently released N-terminal glycine and D-alanine of substrates in a highly specific manner. The optimum pH and temperature were 8 to 9 and 40°C, respectively. This enzyme was stable under alkaline conditions at pH 8 to 11 and relatively resistant to acidic conditions until pH 5.0. The chelating reagent EDTA, serine protease inhibitors such as AEBSF, benzamidine, TPCK, and TLCK, and the thiol enzyme inhibitor PCMB inhibited the enzyme. The aminopeptidase inhibitor bestatin did not affect the activity. GdaA was largely responsible for intracellular glycine and D-alanine aminopeptidase activities in A. oryzae during stationary-phase growth in liquid media. In addition, the activity increased in response to the depletion of nitrogen or carbon sources in the growth media, although the GdaA-independent glycine aminopeptidase activity highly increased simultaneously. Aminopeptidases of A. oryzae attract attention because the enzymatic release of a variety of amino acids and peptides is important for the enhancement of the palatability of fermented foods. GdaA activity was found in extracts of a solid-state rice culture of A. oryzae (rice koji), which is widely used as a starter culture for Japanese traditional fermented foods, and was largely responsible for the glycine and D-alanine aminopeptidase activity detected at a pH range of 6 to 9. PMID:22005737

  3. Kinetic, Spectroscopic, and X-ray Crystallographic Characterization of the Functional E151H Aminopeptidase from Aeromonas proteolytica.

    Energy Technology Data Exchange (ETDEWEB)

    Bzymek,K.; Moulin, A.; Swierczek, S.; Ringe, D.; Petsko, G.; Holz, R.

    2005-01-01

    Glutamate151 (E151) has been shown to be catalytically essential for the aminopeptidase from Vibrio proteolyticus (AAP). E151 acts as the general acid/base during the catalytic mechanism of peptide hydrolysis. However, a glutamate residue is not the only residue capable of functioning as a general acid/base during catalysis for dinuclear metallohydrolases. Recent crystallographic characterization of the D-aminopeptidase from Bacillus subtilis (DppA) revealed a histidine residue that resides in an identical position to E151 in AAP. Because the active-site ligands for DppA and AAP are identical, AAP has been used as a model enzyme to understand the mechanistic role of H115 in DppA. Substitution of E151 with histidine resulted in an active AAP enzyme exhibiting a k{sub cat} value of 2.0 min{sup -1}, which is over 2000 times slower than r AAP (4380 min{sup -1}). ITC experiments revealed that Zn{sup II} binds 330 and 3 times more weakly to E151H-AAP compared to r-AAP. UV-vis and EPR spectra of Co{sup II}-loaded E151H-AAP indicated that the first metal ion resides in a hexacoordinate/pentacoordinate equilibrium environment, whereas the second metal ion is six-coordinate. pH dependence of the kinetic parameters k{sub cat} and K{sub m} for the hydrolysis of L-leucine p-nitroanilide (L-pNA) revealed a change in an ionization constant in the enzyme-substrate complex from 5.3 in r-AAP to 6.4 in E151H-AAP, consistent with E151 in AAP being the active-site general acid/base. Proton inventory studies at pH 8.50 indicate the transfer of one proton in the rate-limiting step of the reaction. Moreover, the X-ray crystal structure of [ZnZn(E151H-AAP)] has been solved to 1.9 {angstrom} resolution, and alteration of E151 to histidine does not introduce any major conformational changes to the overall protein structure or the dinuclear Zn{sup II} active site. Therefore, a histidine residue can function as the general acid/base in hydrolysis reactions of peptides and, through analogy of

  4. Amino-terminal extension present in the methionine aminopeptidase type 1c of Mycobacterium tuberculosis is indispensible for its activity

    Directory of Open Access Journals (Sweden)

    Kumaran Sangaralingam

    2011-07-01

    Full Text Available Abstract Background Methionine aminopeptidase (MetAP is a ubiquitous enzyme in both prokaryotes and eukaryotes, which catalyzes co-translational removal of N-terminal methionine from elongating polypeptide chains during protein synthesis. It specifically removes the terminal methionine in all organisms, if the penultimate residue is non-bulky and uncharged. The MetAP action for exclusion of N-terminal methionine is mandatory in 50-70% of nascent proteins. Such an activity is required for proper sub cellular localization, additional processing and eventually for the degradation of proteins. Results We cloned genes encoding two such metalloproteases (MtMetAP1a and MtMetAP1c present in Mycobacterium tuberculosis and expressed them as histidine-tagged proteins in Escherichia coli. Although they have different substrate preferences, for Met-Ala-Ser, we found, MtMetAP1c had significantly high enzyme turnover rate as opposed to MtMetAP1a. Circular dichroism spectroscopic studies as well as monitoring of enzyme activity indicated high temperature stability (up to 50°C of MtMetAP1a compared to that of the MtMetAP1c. Modelling of MtMetAP1a based on MtMetAP1c crystal structure revealed the distinct spatial arrangements of identical active site amino acid residues and their mutations affected the enzymatic activities of both the proteins. Strikingly, we observed that 40 amino acid long N-terminal extension of MtMetAP1c, compared to its other family members, contributes towards the activity and stability of this enzyme, which has never been reported for any methionine aminopeptidase. Furthermore, mutational analysis revealed that Val-18 and Pro-19 of MtMetAP1c are crucial for its enzymatic activity. Consistent with this observation, molecular dynamic simulation studies of wild-type and these variants strongly suggest their involvement in maintaining active site conformation of MtMetAP1c. Conclusion Our findings unequivocally emphasized that N

  5. A role for naturally occurring alleles of endoplasmic reticulum aminopeptidases in tumor immunity and cancer pre-disposition.

    Science.gov (United States)

    Stratikos, Efstratios; Stamogiannos, Athanasios; Zervoudi, Efthalia; Fruci, Doriana

    2014-01-01

    Endoplasmic reticulum aminopeptidase 1 and 2 (ERAP1 and ERAP2) are key components on the pathway that generates antigenic epitopes for presentation to cytotoxic T-lymphocytes (CTLs). Coding single nucleotide polymorphisms (SNPs) in these enzymes have been associated with pre-disposition to several major human diseases including inflammatory diseases with autoimmune etiology, viral infections, and virally induced cancer. The function of these enzymes has been demonstrated to affect CTL and natural killer cell responses toward healthy and malignant cells as well as the production of inflammatory cytokines. Recent studies have demonstrated that SNPs in ERAP1 and ERAP2 can affect their ability to generate or destroy antigenic epitopes and define the immunopeptidome. In this review, we examine the potential role of these enzymes and their polymorphic states on the generation of cytotoxic responses toward malignantly transformed cells. Given the current state-of-the-art, it is possible that polymorphic variation in these enzymes may contribute to the individual's pre-disposition to cancer through altered generation or destruction of tumor antigens that can facilitate tumor immune evasion. PMID:25566501

  6. Concerted in vitro trimming of viral HLA-B27-restricted ligands by human ERAP1 and ERAP2 aminopeptidases.

    Directory of Open Access Journals (Sweden)

    Elena Lorente

    Full Text Available In the classical human leukocyte antigen (HLA class I antigen processing and presentation pathway, the antigenic peptides are generated from viral proteins by multiple proteolytic cleavages of the proteasome (and in some cases other cytosolic proteases and transported to the endoplasmic reticulum (ER lumen where they are exposed to aminopeptidase activity. In human cells, two different ER-resident enzymes, ERAP1 and ERAP2, can trim the N-terminally extended residues of peptide precursors. In this study, the possible cooperative effect of generating five naturally processed HLA-B27 ligands by both proteases was analyzed. We identified differences in the products obtained with increased detection of natural HLA-B27 ligands by comparing double versus single enzyme digestions by mass spectrometry analysis. These in vitro data suggest that each enzyme can use the degradation products of the other as a substrate for new N-terminal trimming, indicating concerted aminoproteolytic activity of ERAP 1 and ERAP2.

  7. Autoimmune disease-associated variants of extracellular endoplasmic reticulum aminopeptidase 1 induce altered innate immune responses by human immune cells.

    Science.gov (United States)

    Aldhamen, Yasser A; Pepelyayeva, Yuliya; Rastall, David P W; Seregin, Sergey S; Zervoudi, Efthalia; Koumantou, Despoina; Aylsworth, Charles F; Quiroga, Dionisia; Godbehere, Sarah; Georgiadis, Dimitris; Stratikos, Efstratios; Amalfitano, Andrea

    2015-01-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) gene polymorphisms have been linked to several autoimmune diseases; however, the molecular mechanisms underlying these associations are not well understood. Recently, we demonstrated that ERAP1 regulates key aspects of the innate immune response. Previous studies show ERAP1 to be endoplasmic reticulum-localized and secreted during inflammation. Herein, we investigate the possible roles that ERAP1 polymorphic variants may have in modulating the innate immune responses of human peripheral blood mononuclear cells (hPBMCs) using two experimental methods: extracellular exposure of hPBMCs to ERAP1 variants and adenovirus (Ad)-based ERAP1 expression. We found that exposure of hPBMCs to ERAP1 variant proteins as well as ERAP1 overexpression by Ad5 vectors increased inflammatory cytokine and chemokine production, and enhanced immune cell activation. Investigating the molecular mechanisms behind these responses revealed that ERAP1 is able to activate innate immunity via multiple pathways, including the NLRP3 (NOD-like receptor, pyrin domain-containing 3) inflammasome. Importantly, these responses varied if autoimmune disease-associated variants of ERAP1 were examined in the assay systems. Unexpectedly, blocking ERAP1 cellular internalization augmented IL-1β production. To our knowledge, this is the first report identifying ERAP1 as being involved in modulating innate responses of human immune cells, a finding that may explain why ERAP1 has been genetically associated with several autoimmune diseases. PMID:25591727

  8. Mutation of an aminopeptidase N gene is associated with Helicoverpa armigera resistance to Bacillus thuringiensis Cry1Ac toxin.

    Science.gov (United States)

    Zhang, Shaoping; Cheng, Hongmei; Gao, Yulin; Wang, Guirong; Liang, Gemei; Wu, Kongming

    2009-07-01

    A Cry1Ac-resistant strain (Bt-R) of Helicoverpa armigera, with 2971-fold resistance, was derived by selection with Cry1Ac toxin for 75 generations. We used cDNA-amplified fragment length polymorphism analysis to identify those genes differentially expressed in the Cry1Ac-resistant and -susceptible strains, which revealed 212 differentially expressed transcripts among 2000 screened cDNAs. Among these transcript-derived fragments (TDFs), 37 showed some homology to known sequences, including Aminopeptidase N (APN), which is expressed in the midgut epithelium and has been implicated as a Cry1A subfamily receptor in several moths, including H. armigera. We confirmed the TDF by RT-PCR and identified a deletion mutation of apn1 in the Bt-R strain. We expressed the TDF in bacteria. The partial HaAPN1-96S wild-type protein, bound to Cry1Ac on ligand blots, whereas HaAPN1-BtR did not. This suggested that HaAPN1 is a receptor for Bt Cry1Ac and that its deletion mutation is associated with Cry1Ac resistance in H. armigera. The absence of one binding site is responsible for its resistance to Cry1Ac. We developed an allele-specific PCR to monitor whether the apn1 gene in an H. armigera field population produced a similar mutation. No deleted mutants were found in 2250 individuals collected from the field in 2006-2007. PMID:19376227

  9. Potent dual inhibitors of Plasmodium falciparum M1 and M17 aminopeptidases through optimization of S1 pocket interactions.

    Science.gov (United States)

    Drinkwater, Nyssa; Vinh, Natalie B; Mistry, Shailesh N; Bamert, Rebecca S; Ruggeri, Chiara; Holleran, John P; Loganathan, Sasdekumar; Paiardini, Alessandro; Charman, Susan A; Powell, Andrew K; Avery, Vicky M; McGowan, Sheena; Scammells, Peter J

    2016-03-01

    Malaria remains a global health problem, and though international efforts for treatment and eradication have made some headway, the emergence of drug-resistant parasites threatens this progress. Antimalarial therapeutics acting via novel mechanisms are urgently required. Plasmodium falciparum M1 and M17 are neutral aminopeptidases which are essential for parasite growth and development. Previous work in our group has identified inhibitors capable of dual inhibition of PfA-M1 and PfA-M17, and revealed further regions within the protease S1 pockets that could be exploited in the development of ligands with improved inhibitory activity. Herein, we report the structure-based design and synthesis of novel hydroxamic acid analogues that are capable of potent inhibition of both PfA-M1 and PfA-M17. Furthermore, the developed compounds potently inhibit Pf growth in culture, including the multi-drug resistant strain Dd2. The ongoing development of dual PfA-M1/PfA-M17 inhibitors continues to be an attractive strategy for the design of novel antimalarial therapeutics. PMID:26807544

  10. Efficient inhibition of tumor angiogenesis and growth by a synthetic peptide blocking S100A4-methionine aminopeptidase 2 interaction.

    Science.gov (United States)

    Ochiya, Takahiro; Takenaga, Keizo; Asagiri, Masataka; Nakano, Kazumi; Satoh, Hitoshi; Watanabe, Toshiki; Imajoh-Ohmi, Shinobu; Endo, Hideya

    2015-01-01

    The prometastatic calcium-binding protein, S100A4, is expressed in endothelial cells, and its downregulation markedly suppresses tumor angiogenesis in a xenograft cancer model. Given that endothelial S100A4 can be a molecular target for inhibiting tumor angiogenesis, we addressed here whether synthetic peptide capable of blocking S100A4-effector protein interaction could be a novel antiangiogenic agent. To examine this hypothesis, we focused on the S100A4-binding domain of methionine aminopeptidase 2, an effector protein, which plays a role in endothelial cell growth. Overexpression of the domain in mouse endothelial MSS31 cells reduced DNA synthesis, and the corresponding synthetic peptide (named NBD) indeed interacted with S100A4 and inhibited capillary formation in vitro and new blood vessel formation in vivo. Intriguingly, a single intra-tumor administration of the NBD peptide in human prostate cancer xenografts significantly reduced vascularity, resulting in tumor regression. Mechanistically, the NBD peptide enhanced assembly of nonmuscle myosin IIA filaments along with Ser1943 phosphorylation, stimulated formation of focal adhesions without phosphorylation of focal adhesion kinase, and provoked G1/S arrest of the cell cycle. Altogether, the NBD peptide is a potent inhibitor for tumor angiogenesis, and is the first example of an anticancer peptide drug developed on the basis of an endothelial S100A4-targeted strategy. PMID:26029719

  11. Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

    Directory of Open Access Journals (Sweden)

    Jenkins Jeremy L

    2001-10-01

    Full Text Available Abstract Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm aminopeptidase N (APN and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM, and unusually tight binding to the cadherin-like receptor (2.6 nM, which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research.

  12. Construction and evaluation of a chimeric protein made from Fasciola hepatica leucine aminopeptidase and cathepsin L1.

    Science.gov (United States)

    Hernández-Guzmán, K; Sahagún-Ruiz, A; Vallecillo, A J; Cruz-Mendoza, I; Quiroz-Romero, H

    2016-01-01

    Leucine aminopeptidase (LAP) and cathepsin L1 (CL1) are important enzymes for the pathogenesis and physiology of Fasciola hepatica. These enzymes were analysed in silico to design a chimeric protein containing the most antigenic sequences of LAP (GenBank; AAV59016.1; amino acids 192-281) and CL1 (GenBank CAC12806.1; amino acids 173-309). The cloned 681-bp chimeric fragment (rFhLAP-CL1) contains 270 bp from LAP and 411 bp from CL1, comprising three epitopes, DGRVVHLKY (amino acids 54-62) from LAP, VTGYYTVHSGSEVELKNLV (amino acids 119-137) and YQSQTCLPF (amino acids 161-169) from CL1. The ~25 kDa rFhLAP-CL1 chimeric protein was expressed from the pET15b plasmid in the Rosetta (DE3) Escherichia coli strain. The chimeric protein rFhLAP-CL1, which showed antigenic and immunogenic properties, was recognized in Western blot assays using F. hepatica-positive bovine sera, and induced strong, specific antibody responses following immunization in rabbits. The newly generated chimeric protein may be used as a diagnostic tool for detection of antibodies against F. hepatica in bovine sera and as an immunogen to induce protection against bovine fasciolosis. PMID:25274570

  13. Biosynthesis of intestinal microvillar proteins. The intracellular transport of aminopeptidase N and sucrase-isomaltase occurs at different rates pre-Golgi but at the same rate post-Golgi

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M

    1985-01-01

    expression. This ratio was 0.24 +/- 0.06 (mean +/- SD) for sucrase-isomaltase as compared to 0.40 +/- 0.04 (mean +/- SD) for aminopeptidase N. Considering the slower rate of pre-Golgi transport for sucrase-isomaltase, this indicates that the two microvillar enzymes have rather similar if not identical rates...... of post-Golgi transport....... from transient (high mannose glycosylated) to mature (complex glycosylated) form was 1.7-times slower for sucrase-isomaltase than for aminopeptidase N, indicating a slower rate of migration from the rough endoplasmic reticulum to the Golgi complex. Likewise, sucrase-isomaltase appeared in the...

  14. Human cytomegalovirus microRNA miR-US4-1 inhibits CD8+ T cell response by targeting the aminopeptidase ERAP1

    OpenAIRE

    Kim, Sungchul; Lee, Sanghyun; Shin, Jinwook; Kim, Youngkyun; Evnouchidou, Irini; Kim, Donghyun; Kim, Young-Kook; Kim, Young-Eui; Ahn, Jin-Hyun; Riddell, Stanley R; Stratikos, Efstratios; Kim, V. Narry; Ahn, Kwangseog

    2011-01-01

    The major histocompatibility complex (MHC) class I molecules present peptides on the cell surface by CD8+ T cells, which is critical for killing of virally infected or transformed cells. Precursors of MHC class I-presented peptides are trimmed to mature epitopes by endoplasmic reticulum aminopeptidase 1 (ERAP1). The US2-US11 genomic region of human cytomegalovirus (HCMV) is dispensable for viral replication and harbors 3 microRNAs (miRNAs). We show here the HCMV miR-US4-1 specifically down-re...

  15. Endoplasmic reticulum aminopeptidase-1 alleles associated with increased risk of Ankylosing Spondylitis reduce HLA-B27 mediated presentation of multiple antigens

    OpenAIRE

    Seregin, Sergey S.; Rastall, David P. W.; Evnouchidou, Irini; Charles F Aylsworth; Quiroga, Dionisia; Kamal, Ram P.; Godbehere-Roosa, Sarah; Blum, Christopher F.; Ian A York; Stratikos, Efstratios; Amalfitano, Andrea

    2013-01-01

    Ankylosing spondylitis (AS) is a chronic systemic arthritic disease that leads to significant disability and loss of quality of life in the ~0.5% of the worldwide human population it affects. There is currently no cure for AS and mechanisms underlying its pathogenesis remain unclear. AS is highly genetic, with over 70% of the genetic risk being associated with the presence of HLA-B27 and endoplasmic reticulum aminopeptidase-1 (ERAP1) alleles. Furthermore, gene-gene interactions between HLA-B2...

  16. Screening the Medicines for Malaria Venture "Malaria Box" against the Plasmodium falciparum aminopeptidases, M1, M17 and M18.

    Directory of Open Access Journals (Sweden)

    Alessandro Paiardini

    Full Text Available Malaria is a parasitic disease that remains a global health burden. The ability of the parasite to rapidly develop resistance to therapeutics drives an urgent need for the delivery of new drugs. The Medicines for Malaria Venture have compounds known for their antimalarial activity, but not necessarily the molecular targets. In this study, we assess the ability of the "MMV 400" compounds to inhibit the activity of three metalloaminopeptidases from Plasmodium falciparum, PfA-M1, PfA-M17 and PfM18 AAP. We have developed a multiplex assay system to allow rapid primary screening of compounds against all three metalloaminopeptidases, followed by detailed analysis of promising compounds. Our results show that there were no PfM18AAP inhibitors, whereas two moderate inhibitors of the neutral aminopeptidases PfA-M1 and PfA-M17 were identified. Further investigation through structure-activity relationship studies and molecular docking suggest that these compounds are competitive inhibitors with novel binding mechanisms, acting through either non-classical zinc coordination or independently of zinc binding altogether. Although it is unlikely that inhibition of PfA-M1 and/or PfA-M17 is the primary mechanism responsible for the antiplasmodial activity reported for these compounds, their detailed characterization, as presented in this work, pave the way for their further optimization as a novel class of dual PfA-M1/PfA-M17 inhibitors utilising non-classical zinc binding groups.

  17. MT95-4, a fully humanized antibody raised against aminopeptidase N, reduces tumor progression in a mouse model.

    Science.gov (United States)

    Akita, Shin; Hattori, Noboru; Masuda, Takeshi; Horimasu, Yasushi; Nakashima, Taku; Iwamoto, Hiroshi; Fujitaka, Kazunori; Miyake, Masayuki; Kohno, Nobuoki

    2015-07-01

    Aminopeptidase N (APN/CD13) is involved in tumor cell invasion and tumor angiogenesis and is considered a promising therapeutic target in the treatment of cancer. To develop a novel monoclonal antibody-based cancer therapy targeting APN/CD13, we established a fully humanized anti-APN/CD13 monoclonal antibody, MT95-4. In vitro, MT95-4 inhibited APN/CD13 enzymatic activity on the tumor cell surface and blocked tumor cell invasion. B16 mouse melanoma cells stably expressing human APN/CD13 were also established and were inoculated s.c. or injected i.v. into nude mice. We found that expression of human APN/CD13 in murine melanoma cells increased the size of subcutaneous tumors, extent of lung metastasis and degree of angiogenesis in the subcutaneous tumors; these tumor-promoting and angiogenesis-promoting characteristics were reduced by the i.p. administration of MT95-4. To further verify the specificity of MT95-4 for neutralization of APN/CD13 activity, MT95-4 was administered into NOD/SCID mice inoculated s.c. with H1299 or PC14 cells, which exhibit high expression of APN/CD13, or with A549 cells, which exhibit weak expression of APN/CD13. MT95-4 reduced tumor growth and angiogenesis in mice bearing H1299-derived and PC14-derived tumors, but not in mice bearing A549-derived tumors. These results suggested that the antitumor and anti-angiogenic effects of MT95-4 were dependent on APN/CD13 expression in tumor cells. Given that MT95-4 is the first fully humanized monoclonal antibody against APN/CD13, MT95-4 should be recognized as a promising candidate for monoclonal antibody therapy against tumors expressing APN/CD13. PMID:25950387

  18. Structural insights into chaperone-activity enhancement by a K354E mutation in tomato acidic leucine aminopeptidase.

    Science.gov (United States)

    DuPrez, Kevin T; Scranton, Melissa A; Walling, Linda L; Fan, Li

    2016-05-01

    Tomato plants express acidic leucine aminopeptidase (LAP-A) in response to various environmental stressors. LAP-A not only functions as a peptidase for diverse peptide substrates, but also displays chaperone activity. A K354E mutation has been shown to abolish the peptidase activity but to enhance the chaperone activity of LAP-A. To better understand this moonlighting function of LAP-A, the crystal structure of the K354E mutant was determined at 2.15 Å resolution. The structure reveals that the K354E mutation destabilizes an active-site loop and causes significant rearrangement of active-site residues, leading to loss of the catalytic metal-ion coordination required for the peptidase activity. Although the mutant was crystallized in the same hexameric form as wild-type LAP-A, gel-filtration chromatography revealed an apparent shift from the hexamer to lower-order oligomers for the K354E mutant, showing a mixture of monomers to trimers in solution. In addition, surface-probing assays indicated that the K354E mutant has more accessible hydrophobic areas than wild-type LAP-A. Consistently, computational thermodynamic estimations of the interfaces between LAP-A monomers suggest that increased exposure of hydrophobic surfaces occurs upon hexamer breakdown. These results suggest that the K354E mutation disrupts the active-site loop, which also contributes to the hexameric assembly, and destabilizes the hexamers, resulting in much greater hydrophobic areas accessible for efficient chaperone activity than in the wild-type LAP-A. PMID:27139632

  19. Microarray analysis of tomato's early and late wound response reveals new regulatory targets for Leucine aminopeptidase A.

    Directory of Open Access Journals (Sweden)

    Melissa A Scranton

    Full Text Available Wounding due to mechanical injury or insect feeding causes a wide array of damage to plant cells including cell disruption, desiccation, metabolite oxidation, and disruption of primary metabolism. In response, plants regulate a variety of genes and metabolic pathways to cope with injury. Tomato (Solanum lycopersicum is a model for wound signaling but few studies have examined the comprehensive gene expression profiles in response to injury. A cross-species microarray approach using the TIGR potato 10-K cDNA array was analyzed for large-scale temporal (early and late and spatial (locally and systemically responses to mechanical wounding in tomato leaves. These analyses demonstrated that tomato regulates many primary and secondary metabolic pathways and this regulation is dependent on both timing and location. To determine if LAP-A, a known modulator of wound signaling, influences gene expression beyond the core of late wound-response genes, changes in RNAs from healthy and wounded Leucine aminopeptidase A-silenced (LapA-SI and wild-type (WT leaves were examined. While most of the changes in gene expression after wounding in LapA-SI leaves were similar to WT, overall responses were delayed in the LapA-SI leaves. Moreover, two pathogenesis-related 1 (PR-1c and PR-1a2 and two dehydrin (TAS14 and Dhn3 genes were negatively regulated by LAP-A. Collectively, this study has shown that tomato wound responses are complex and that LAP-A's role in modulation of wound responses extends beyond the well described late-wound gene core.

  20. Bacillus thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one of four Aminopeptidase N genes

    Directory of Open Access Journals (Sweden)

    Moar William J

    2005-06-01

    Full Text Available Abstract Background Insecticidal toxins from Bacillus thuringiensis bind to receptors on midgut epithelial cells of susceptible insect larvae. Aminopeptidases N (APNs from several insect species have been shown to be putative receptors for these toxins. Here we report the cloning and expression analysis of four APN cDNAs from Spodoptera exigua. Results Suppression Subtractive Hybridization (SSH was used to construct cDNA libraries of genes that are up-and down-regulated in the midgut of last instar larvae of beet armyworm, S. exigua exposed to B. thuringiensis Cry1Ca toxin. Among the clones from the SSH libraries, cDNA fragments coding for two different APNs were obtained (APN2 and APN4. A similar procedure was employed to compare mRNA differences between susceptible and Cry1Ca resistant S. exigua. Among the clones from this last comparison, cDNA fragments belonging to a third APN (APN1 were detected. Using sequences obtained from the three APN cDNA fragments and degenerate primers for a fourth APN (APN3, the full length sequences of four S. exigua APN cDNAs were obtained. Northern blot analysis of expression of the four APNs showed complete absence of APN1 expression in the resistant insects, while the other three APNs showed similar expression levels in the resistant and susceptible insects. Conclusion We have cloned and characterized four different midgut APN cDNAs from S. exigua. Expression analysis revealed the lack of expression of one of these APNs in the larvae of a Cry1Ca-resistant colony. Combined with previous evidence that shows the importance of APN in the mode of action of B. thuringiensis toxins, these results suggest that the lack of APN1 expression plays a role in the resistance to Cry1Ca in this S. exigua colony.

  1. Location of the Bombyx mori aminopeptidase N type 1 binding site on Bacillus thuringiensis Cry1Aa toxin.

    Science.gov (United States)

    Atsumi, Shogo; Mizuno, Eri; Hara, Hirotaka; Nakanishi, Kazuko; Kitami, Madoka; Miura, Nami; Tabunoki, Hiroko; Watanabe, Ayako; Sato, Ryoichi

    2005-07-01

    We analyzed the binding site on Cry1Aa toxin for the Cry1Aa receptor in Bombyx mori, 115-kDa aminopeptidase N type 1 (BmAPN1) (K. Nakanishi, K. Yaoi, Y. Nagino, H. Hara, M. Kitami, S. Atsumi, N. Miura, and R. Sato, FEBS Lett. 519:215-220, 2002), by using monoclonal antibodies (MAbs) that block binding between the binding site and the receptor. First, we produced a series of MAbs against Cry1Aa and obtained two MAbs, MAbs 2C2 and 1B10, that were capable of blocking the binding between Cry1Aa and BmAPN1 (blocking MAbs). The epitope of the Fab fragments of MAb 2C2 overlapped the BmAPN1 binding site, whereas the epitope of the Fab fragments of MAb 1B10 did not overlap but was located close to the binding site. Using three approaches for epitope mapping, we identified two candidate epitopes for the blocking MAbs on Cry1Aa. We constructed two Cry1Aa toxin mutants by substituting a cysteine on the toxin surface at each of the two candidate epitopes, and the small blocking molecule N-(9-acridinyl)maleimide (NAM) was introduced at each cysteine substitution to determine the true epitope. The Cry1Aa mutant with NAM bound to Cys582 did not bind either of the two blocking MAbs, suggesting that the true epitope for each of the blocking MAbs was located at the site containing Val582, which also consisted of 508STLRVN513 and 582VFTLSAHV589. These results indicated that the BmAPN1 binding site overlapped part of the region blocked by MAb 2C2 that was close to but excluded the actual epitope of MAb 2C2 on domain III of Cry1Aa toxin. We also discuss another area on Cry1Aa toxin as a new candidate site for BmAPN1 binding. PMID:16000811

  2. A structural insight into the P1S1 binding mode of diaminoethylphosphonic and phosphinic acids, selective inhibitors of alanine aminopeptidases.

    Science.gov (United States)

    Węglarz-Tomczak, Ewelina; Berlicki, Łukasz; Pawełczak, Małgorzata; Nocek, Bogusław; Joachimiak, Andrzej; Mucha, Artur

    2016-07-19

    N'-substituted 1,2-diaminoethylphosphonic acids and 1,2-diaminoethylphosphinic dipeptides were explored to unveil the structural context of the unexpected selectivity of these inhibitors of M1 alanine aminopeptidases (APNs) versus M17 leucine aminopeptidase (LAP). The diaminophosphonic acids were obtained via aziridines in an improved synthetic procedure that was further expanded for the phosphinic pseudodipeptide system. The inhibitory activity, measured for three M1 and one M17 metalloaminopeptidases of different sources (bacterial, human and porcine), revealed several potent compounds (e.g., Ki = 65 nM of 1u for HsAPN). Two structures of an M1 representative (APN from Neisseria meningitidis) in complex with N-benzyl-1,2-diaminoethylphosphonic acid and N-cyclohexyl-1,2-diaminoethylphosphonic acid were determined by the X-ray crystallography. The analysis of these structures and the models of the phosphonic acid complexes of the human ortholog provided an insight into the role of the additional amino group and the hydrophobic substituents of the ligands within the S1 active site region. PMID:27100031

  3. 3,4-diaminobenzoic acid derivatives as inhibitors of the oxytocinase subfamily of M1 aminopeptidases with immune-regulating properties.

    Science.gov (United States)

    Papakyriakou, Athanasios; Zervoudi, Efthalia; Tsoukalidou, Sofia; Mauvais, Francois-Xavier; Sfyroera, Georgia; Mastellos, Dimitrios C; van Endert, Peter; Theodorakis, Emmanuel A; Vourloumis, Dionisios; Stratikos, Efstratios

    2015-02-12

    Members of the oxytocinase subfamily of M1 aminopeptidases (ERAP1, ERAP2, and IRAP) play important roles in both the adaptive and innate human immune responses. Their enzymatic activity can contribute to the pathogenesis of several major human diseases ranging from viral and parasitic infections to autoimmunity and cancer. We have previously demonstrated that diaminobenzoic acid derivatives show promise as selective inhibitors for this group of aminopeptidases. In this study, we have thoroughly explored a series of 3,4-diaminobenzoic acid derivatives as inhibitors of this class of enzymes, achieving submicromolar inhibitors for ERAP2 (IC50 = 237 nM) and IRAP (IC50 = 105 nM). Cell-based analysis indicated that the lead compounds can be effective in downregulating macrophage activation induced by lipopolysaccharide and interferon-γ as well as cross-presentation by bone marrow-derived dendritic cells. Our results indicate that this class of inhibitors may be useful for the targeted downregulation of immune responses. PMID:25635706

  4. Experimental study of the enhancement effect of aminopeptidase N inhibitor ubenimex on the differentiation induction activity of all-trans-retinoic acid in acute promyeiocytic leukemia cells and its mechanism

    Institute of Scientific and Technical Information of China (English)

    钱习军

    2006-01-01

    Objective To investigate the effect of aminopeptidase N inhibitor ubenimex on differentiation induction of alltrans -retinoic acid (ATRA) in acute promyelocytic leukemia (APL) cells and its mechanism. Methods The expression of CD11b was analyzed by flow cytometry and nitroblue-tetrazolium (NBT) reduction assay was per-

  5. Studying progress on aminopeptidase N of insects%昆虫氨肽酶N的研究进展

    Institute of Scientific and Technical Information of China (English)

    常晓丽; 吴青君; 王少丽; 徐宝云; 张友军

    2011-01-01

    氨肽酶N(aminopeptidase N,APN)是一种偏好水解蛋白或寡肽N端中性氨基酸的酶,广泛分布于动植物中.在昆虫中,APN主要分布于中肠刷状缘膜上,涉及食物蛋白的消化以及Bt毒素对靶标害虫的作用.从APN的结构特征和分类地位、APN的分离纯化及其酶活性位点与结合位点的相关性、APN同工酶的区分特征及系统发育关系、APN同工酶的基因功能、不同APN同工酶在昆虫体内的分布及表达量、APN基因功能最新研究方法和结果以及APN与昆虫抗药性的关系等方面概述了昆虫APN的最新研究进展.鉴于昆虫体内受体的多样性、复杂性及当前研究手段的局限性,对APN功能的全面了解还有赖于研究方法的改进和提高而逐步深入.%Aminopeptidase N (APN) is an enzyme that preferentially cleaves neutral amino acids from the amino-terminus of proteins or oligopeptides. This enzyme is widely distributed in the plants and animals. In insects, APN is most abundant in the brush border membrane of the midgut and is an enzyme involved in the digestion of protein in food and the toxication of Bt for target insects. The recent research results of APNs of insects in the world were summarized. The characteristics,configuration, classification, isolation and purification, relationship between the catalytic and toxinbinding sites, phylogenetic relationship, gene function, the distribution and gene expression level, the recent studying methods and results of APNs and whether they are related between the Bt resistance of insects and APNs were elucidated. It is necessary to further study the function of APNs in view of the effect of other receptors, action complication and limited research techniques.

  6. Functional interpretation of a non-gut hemocoelic tissue aminopeptidase N (APN) in a lepidopteran insect pest Achaea janata.

    Science.gov (United States)

    Ningshen, Thuirei Jacob; Aparoy, Polamarasetty; Ventaku, Venkat Rao; Dutta-Gupta, Aparna

    2013-01-01

    Insect midgut membrane-anchored aminopeptidases N (APNs) are Zn(++) dependent metalloproteases. Their primary role in dietary protein digestion and also as receptors in Cry toxin-induced pathogenesis is well documented. APN expression in few non-gut hemocoelic tissues of lepidopteran insects has also been reported but their functions are widely unknown. In the present study, we observed specific in vitro interaction of Cry1Aa toxin with a 113 kDa AjAPN1 membrane protein of larval fat body, Malpighian tubule and salivary gland of Achaea janata. Analyses of 3D molecular structure of AjAPN1, the predominantly expressed APN isoform in these non-gut hemocoelic tissues of A. janata showed high structural similarity to the Cry1Aa toxin binding midgut APN of Bombyx mori, especially in the toxin binding region. Structural similarity was further substantiated by in vitro binding of Cry1Aa toxin. RNA interference (RNAi) resulted in significant down-regulation of AjAPN1 transcript and protein expression in fat body and Malpighian tubule but not in salivary gland. Consequently, reduced AjAPN1 expression resulted in larval mortality, larval growth arrest, development of lethal larval-pupal intermediates, development of smaller pupae and emergence of viable defective adults. In vitro Cry1Aa toxin binding analysis of non-gut hemocoelic tissues of AjAPN1 knockdown larvae showed reduced interaction of Cry1Aa toxin with the 113 kDa AjAPN1 protein, correlating well with the significant silencing of AjAPN1 expression. Thus, our observations suggest AjAPN1 expression in non-gut hemocoelic tissues to play important physiological role(s) during post-embryonic development of A. janata. Though specific interaction of Cry1Aa toxin with AjAPN1 of non-gut hemocoelic tissues of A. janata was demonstrated, evidences to prove its functional role as a Cry1Aa toxin receptor will require more in-depth investigation. PMID:24244508

  7. Functional interpretation of a non-gut hemocoelic tissue aminopeptidase N (APN in a lepidopteran insect pest Achaea janata.

    Directory of Open Access Journals (Sweden)

    Thuirei Jacob Ningshen

    Full Text Available Insect midgut membrane-anchored aminopeptidases N (APNs are Zn(++ dependent metalloproteases. Their primary role in dietary protein digestion and also as receptors in Cry toxin-induced pathogenesis is well documented. APN expression in few non-gut hemocoelic tissues of lepidopteran insects has also been reported but their functions are widely unknown. In the present study, we observed specific in vitro interaction of Cry1Aa toxin with a 113 kDa AjAPN1 membrane protein of larval fat body, Malpighian tubule and salivary gland of Achaea janata. Analyses of 3D molecular structure of AjAPN1, the predominantly expressed APN isoform in these non-gut hemocoelic tissues of A. janata showed high structural similarity to the Cry1Aa toxin binding midgut APN of Bombyx mori, especially in the toxin binding region. Structural similarity was further substantiated by in vitro binding of Cry1Aa toxin. RNA interference (RNAi resulted in significant down-regulation of AjAPN1 transcript and protein expression in fat body and Malpighian tubule but not in salivary gland. Consequently, reduced AjAPN1 expression resulted in larval mortality, larval growth arrest, development of lethal larval-pupal intermediates, development of smaller pupae and emergence of viable defective adults. In vitro Cry1Aa toxin binding analysis of non-gut hemocoelic tissues of AjAPN1 knockdown larvae showed reduced interaction of Cry1Aa toxin with the 113 kDa AjAPN1 protein, correlating well with the significant silencing of AjAPN1 expression. Thus, our observations suggest AjAPN1 expression in non-gut hemocoelic tissues to play important physiological role(s during post-embryonic development of A. janata. Though specific interaction of Cry1Aa toxin with AjAPN1 of non-gut hemocoelic tissues of A. janata was demonstrated, evidences to prove its functional role as a Cry1Aa toxin receptor will require more in-depth investigation.

  8. Identification of a novel aminopeptidase P-like gene (OnAPP) possibly involved in Bt toxicity and resistance in a major corn pest (Ostrinia nubilalis).

    Science.gov (United States)

    Khajuria, Chitvan; Buschman, Lawrent L; Chen, Ming-Shun; Siegfried, Blair D; Zhu, Kun Yan

    2011-01-01

    Studies to understand the Bacillus thuringiensis (Bt) resistance mechanism in European corn borer (ECB, Ostrinia nubilalis) suggest that resistance may be due to changes in the midgut-specific Bt toxin receptor. In this study, we identified 10 aminopeptidase-like genes, which have previously been identified as putative Bt toxin receptors in other insects and examined their expression in relation to Cry1Ab toxicity and resistance. Expression analysis for the 10 aminopeptidase-like genes revealed that most of these genes were expressed predominantly in the larval midgut, but there was no difference in the expression of these genes in Cry1Ab resistant and susceptible strains. This suggested that altered expression of these genes was unlikely to be responsible for resistance in these ECB strains. However, we found that there were changes in two amino acid residues of the aminopeptidase-P like gene (OnAPP) involving Glu(305) to Lys(305) and Arg(307) to Leu(307) in the two Cry1Ab-resistant strains as compared with three Cry1Ab-susceptible strains. The mature OnAPP contains 682 amino acid residues and has a putative signal peptide at the N-terminus, a predicted glycosylphosphatidyl-inositol (GPI)-anchor signal at the C-terminal, three predicted N-glycosylation sites at residues N178, N278 and N417, and an O-glycosylation site at residue T653. We used a feeding based-RNA interference assay to examine the role of the OnAPP gene in Cry1Ab toxicity and resistance. Bioassays of Cry1Ab in larvae fed diet containing OnAPP dsRNA resulted in a 38% reduction in the transcript level of OnAPP and a 25% reduction in the susceptibility to Cry1Ab as compared with larvae fed GFP dsRNA or water. These results strongly suggest that the OnAPP gene could be involved in binding the Cry1Ab toxin in the ECB larval midgut and that mutations in this gene may be associated with Bt resistance in these two ECB strains. PMID:21887358

  9. Endoplasmic reticulum aminopeptidase 1 function and its pathogenic role in regulating innate and adaptive immunity in cancer and major histocompatibility complex class I-associated autoimmune diseases.

    Science.gov (United States)

    Fruci, D; Romania, P; D'Alicandro, V; Locatelli, F

    2014-08-01

    Major histocompatibility complex (MHC) class I molecules present antigenic peptides on the cell surface to alert natural killer (NK) cells and CD8(+) T cells for the presence of abnormal intracellular events, such as virus infection or malignant transformation. The generation of antigenic peptides is a multistep process that ends with the trimming of N-terminal extensions in the endoplasmic reticulum (ER) by aminopeptidases ERAP1 and ERAP2. Recent studies have highlighted the potential role of ERAP1 in reprogramming the immunogenicity of tumor cells in order to elicit innate and adaptive antitumor immune responses, and in conferring susceptibility to autoimmune diseases in predisposed individuals. In this review, we will provide an overview of the current knowledge about the role of ERAP1 in MHC class I antigen processing and how its manipulation may constitute a promising tool for cancer immunotherapy and treatment of MHC class I-associated autoimmune diseases. PMID:25066018

  10. Functional co-localization of monocytic aminopeptidase N/CD13 with the Fcγ receptors CD32 and CD64

    International Nuclear Information System (INIS)

    Information about the function of aminopeptidase N/CD13 on monocytes is limited. In order to gain more insight into its interaction with other proteins, we have identified molecules that co-localize with the membrane ectoenzyme at the cell surface of monocytes. Using laser scanning and electron microscopy as well as fluorescence resonance energy transfer (FRET) measured by flow cytometry we show that monocytic CD13 co-localized with the Fcγ receptor II/CD32 after Fc receptor ligation by a CD32-specific antibody. FRET was also observed between CD13 and the Fcγ receptor I/CD64, but not with the myeloid marker CD33 representing a member of the sialoadhesin family. Our results imply a novel functional role of CD13 and Fcγ receptors as members of a multimeric receptor complex. Further studies have to be done to elucidate common signaling pathways of these molecules

  11. Functional co-localization of monocytic aminopeptidase N/CD13 with the Fc gamma receptors CD32 and CD64

    DEFF Research Database (Denmark)

    Riemann, Dagmar; Tcherkes, Anatolij; Hansen, Gert H; Wulfaenger, Jens; Blosz, Tanja; Danielsen, E Michael

    2005-01-01

    Information about the function of aminopeptidase N/CD13 on monocytes is limited. In order to gain more insight into its interaction with other proteins, we have identified molecules that co-localize with the membrane ectoenzyme at the cell surface of monocytes. Using laser scanning and electron...... microscopy as well as fluorescence resonance energy transfer (FRET) measured by flow cytometry we show that monocytic CD13 co-localized with the Fc gamma receptor II/CD32 after Fc receptor ligation by a CD32-specific antibody. FRET was also observed between CD13 and the Fc gamma receptor I/CD64, but not with...... the myeloid marker CD33 representing a member of the sialoadhesin family. Our results imply a novel functional role of CD13 and Fc gamma receptors as members of a multimeric receptor complex. Further studies have to be done to elucidate common signaling pathways of these molecules....

  12. Development of 2-thioxoquinazoline-4-one derivatives as dual and selective inhibitors of dynamin-related protein 1 (Drp1) and puromycin-sensitive aminopeptidase (PSA).

    Science.gov (United States)

    Numadate, Akiyoshi; Mita, Yusuke; Matsumoto, Yotaro; Fujii, Shinya; Hashimoto, Yuichi

    2014-01-01

    An established inhibitor of dynamin-related protein 1 (Drp1), 3-(2,4-dichloro-5-methoxyphenyl)-2-thioxoquinazoline-4-one (mdivi-1), was recently reported also to show potent puromycin-sensitive aminopeptidase (PSA)-inhibitory activity. Herein, we report structural development of mdivi-1 derivatives and structure-activity relationship (SAR) analysis of the synthesized compounds, as well as the structurally related PSA-specific inhibitor 3-(2,6-diethylphenyl)quinazoline-2,4-dione (PAQ-22), with the aim of identifying key structural features for inhibitory activity in order to develop selective inhibitors of Drp1, which is a potential target for treatment of Huntington's disease. Among the synthesized compounds, 3-(4-chloro-3-methoxyphenyl)-2-thioxoquinazoline-4-one (10g) exhibited more potent Drp1-inhibitory activity than mdivi-1 with high selectivity for Drp1 over PSA. PMID:25273056

  13. Binding of phylogenetically distant Bacillus thuringiensis cry toxins to a Bombyx mori aminopeptidase N suggests importance of Cry toxin's conserved structure in receptor binding.

    Science.gov (United States)

    Shinkawa, A; Yaoi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-07-01

    We investigated the binding proteins for three Cry toxins, Cry1Aa, Cry1Ac, and the phylogenetically distant Cry9Da, in the midgut cell membrane of the silkworm. In a ligand blot experiment, Cry1Ac and Cry9Da bound to the same 120-kDa aminopeptidase N (APN) as Cry1Aa. A competition experiment with the ligand blot indicated that the three toxins share the same binding site on several proteins. The values of the dissociation constants of the three Cry toxins and 120-kDa APN are as low as the case of other Cry toxins and receptors. These results suggest that distantly related Cry toxins bind to the same site on the same proteins, especially with APN. We propose that the conserved structure in these three toxins includes the receptor-binding site. PMID:10387111

  14. Bacillus thuringiensis insecticidal Cry1Aa toxin binds to a highly conserved region of aminopeptidase N in the host insect leading to its evolutionary success.

    Science.gov (United States)

    Nakanishi, K; Yaoi, K; Shimada, N; Kadotani, T; Sato, R

    1999-06-15

    Bacillus thuringiensis insecticidal protein, Cry1Aa toxin, binds to a specific receptor in insect midguts and has insecticidal activity. Therefore, the structure of the receptor molecule is probably a key factor in determining the binding affinity of the toxin and insect susceptibility. The cDNA fragment (PX frg1) encoding the Cry1Aa toxin-binding region of an aminopeptidase N (APN) or an APN family protein from diamondback moth, Plutella xylostella midgut was cloned and sequenced. A comparison between the deduced amino acid sequence of PX frg1 and other insect APN sequences shows that Cry1Aa toxin binds to a highly conserved region of APN family protein. In this paper, we propose a model to explain the mechanism that causes B. thuringiensis evolutionary success and differing insect susceptibility to Cry1Aa toxin. PMID:10366728

  15. cDNA cloning and expression of Bacillus thuringiensis Cry1Aa toxin binding 120 kDa aminopeptidase N from Bombyx mori.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-01-18

    Bacillus thuringiensis Cry1Aa toxin binds to a 120 kDa putative receptor protein in the Bombyx mori midgut. Recently, this protein was purified and identified as glycosyl-phosphatidylinositol (GPI) anchored aminopeptidase N (APN). In this study, a full-length cDNA thought to encode this 120 kDa APN was isolated and sequenced. It has a 2958 bp ORF encoding 986 amino acids. In the deduced amino acid sequence, we identified GPI-anchor and zinc-metallopeptidase signals, which are the same as those of APNs of other insects that are reported to be putative Cry1 toxin receptors. The B. mori APN amino acid sequence also has a high similarity with those of the other APNs. Subsequently, the recombinant APN was expressed by Escherichia coli and its Cry1Aa toxin binding ability was analyzed. Ligand blotting showed that Cry1Aa toxin bound to the recombinant APN. PMID:9931470

  16. Identification and characterization of CaApe2--a neutral arginine/alanine/leucine-specific metallo-aminopeptidase from Candida albicans.

    Science.gov (United States)

    Klinke, Thomas; Rump, Andreas; Pönisch, Roman; Schellenberger, Wolfgang; Müller, Eva-Christina; Otto, Albrecht; Klimm, Wolfgang; Kriegel, Thomas M

    2008-09-01

    The proteolytic potential of the pathogenic fungus Candida albicans was evaluated by the identification and functional characterization of a peptidolytic enzyme isolated from the cell wall of the microorganism. Determination of basic structural and kinetic data identified a neutral arginine/alanine/leucine-specific metallo-aminopeptidase of unknown function termed CaApe2, which is encoded by ORF CaO19.5197 (GenBank RefSeq XM_705313). Mass spectrometric tryptic peptide analysis and N-terminal protein sequencing revealed serine-88 to represent the N-terminus of CaApe2. Taking into account the results of DNA and protein sequence analysis including inspection of the genomic region upstream of ORF CaO19.5197, the gene CaAPE2 is likely to consist of two exons linked by a phase-2 intron with exons 1 and 2 encoding a signal peptide and the amino acids 88-954 of ORF CaO19.5197, respectively. The isolated CaApe2 protein shares an equally high similarity with the gene products ScAap1 and ScApe2, suggesting duplication of a phylogenetically ancient precursor gene in Saccharomyces cerevisiae. The observed failure to cleave human type-I and type-IV collagen in vitro challenges a direct role that secreted CaApe2 might play in the degradation of extracellular matrix components during host colonization, but does not exclude per se a contribution of the aminopeptidase to the pathogenicity of C. albicans. PMID:18637841

  17. The type II secretion system of Legionella pneumophila elaborates two aminopeptidases, as well as a metalloprotease that contributes to differential infection among protozoan hosts.

    Science.gov (United States)

    Rossier, Ombeline; Dao, Jenny; Cianciotto, Nicholas P

    2008-02-01

    Legionella pneumophila, the agent of Legionnaires' disease, is an intracellular parasite of aquatic amoebae and human macrophages. A key factor for L. pneumophila in intracellular infection is its type II protein secretion system (Lsp). In order to more completely define Lsp output, we recently performed a proteomic analysis of culture supernatants. Based upon the predictions of that analysis, we found that L. pneumophila secretes two distinct aminopeptidase activities encoded by the genes lapA and lapB. Whereas lapA conferred activity against leucine, phenylalanine, and tyrosine aminopeptides, lapB was linked to the cleavage of lysine- and arginine-containing substrates. To assess the role of secreted aminopeptidases in intracellular infection, we examined the relative abilities of lapA and lapB mutants to infect human U937 cell macrophages as well as Hartmannella vermiformis and Acanthamoeba castellanii amoebae. Although these experiments identified a dispensable role for LapA and LapB, they uncovered a previously unrecognized role for the type II-dependent ProA (MspA) metalloprotease. Whereas proA mutants were not defective for macrophage or A. castellanii infection, they (but not their complemented derivatives) were impaired for growth upon coculture with H. vermiformis. Thus, ProA represents the first type II effector implicated in an intracellular infection event. Furthermore, proA represents an L. pneumophila gene that shows differential importance among protozoan infection models, suggesting that the legionellae might have evolved some of its factors to especially target certain of their protozoan hosts. PMID:18083880

  18. The unique functional role of the C-HS hydrogen bond in the substrate specificity and enzyme catalysis of type 1 methionine aminopeptidase.

    Science.gov (United States)

    Reddi, Ravikumar; Singarapu, Kiran Kumar; Pal, Debnath; Addlagatta, Anthony

    2016-07-19

    It is intriguing how nature attains recognition specificity between molecular interfaces where there is no apparent scope for classical hydrogen bonding or polar interactions. Methionine aminopeptidase (MetAP) is one such enzyme where this fascinating conundrum is at play. In this study, we demonstrate that a unique C-HS hydrogen bond exists between the enzyme methionine aminopeptidase (MetAP) and its N-terminal-methionine polypeptide substrate, which allows specific interaction between apparent apolar interfaces, imposing a strict substrate recognition specificity and efficient catalysis, a feature replicated in Type I MetAPs across all kingdoms of life. We evidence this evolutionarily conserved C-HS hydrogen bond through enzyme assays on wild-type and mutant MetAP proteins from Mycobacterium tuberculosis that show a drastic difference in catalytic efficiency. The X-ray crystallographic structure of the methionine bound protein revealed a conserved water bridge and short contacts involving the Met side-chain, a feature also observed in MetAPs from other organisms. Thermal shift assays showed a remarkable 3.3 °C increase in melting temperature for methionine bound protein compared to its norleucine homolog, where C-HS interaction is absent. The presence of C-HS hydrogen bonding was also corroborated by nuclear magnetic resonance spectroscopy through a change in chemical shift. Computational chemistry studies revealed the unique role of the electrostatic environment in facilitating the C-HS interaction. The significance of this atypical hydrogen bond is underscored by the fact that the function of MetAP is essential for any living cell. PMID:27225936

  19. Aminopeptidases from Aspergillus niger

    NARCIS (Netherlands)

    Wijk, van D.

    2004-01-01

    Aspergillusis a filamentous fungus that can grow in many environments, on several substrates at different conditions. In the soil,Aspergillirecycle nutrients by the degradation of plant material. In particular,Aspergilliare known for their capabili

  20. Expression, purification et cristallisation de l'aminopeptidase-N humaine (APN ou CD13) : évaluation in vitro et in vivo d'inhibiteurs sélectifs

    OpenAIRE

    Schmitt, Céline

    2012-01-01

    L'Aminopeptidase-N (APN ou CD13) [EC.3.4.11.2] est une ectoenzyme homodimérique de nature glycoprotéique appartenant à la famille M1 des zinc-aminopeptidases. Elle est surexprimée à la surface des cellules endothéliales angiogéniques, ainsi que sur un certain nombre de cellules tumorales. Et il existe une corrélation étroite entre l'élévation de l'expression de l'APN, une activité enzymatique accrue et le pouvoir invasif de nombreux types de cellules tumorales. Des inhibiteurs puissants et sé...

  1. Intestinal Disaccharidases and Aminopeptidase-N in two species of Cinclodes (Passerine: Furnaridae Disacaridasas y aminopeptidasa-N en dos especies de Cinclodes (Paserine: Furnaridae

    Directory of Open Access Journals (Sweden)

    PABLO SABAT

    2000-06-01

    Full Text Available It has been postulated that both digestive capacity and intestinal biochemical features are correlated to dietary habits in birds. Therefore, it would be expected to find biochemical constraint to hydrolyze sugars in those species, which predate exclusively on marine invertebrates. In vitro intestinal activities of these enzymes were studied in Cinclodes nigrofumosus (d' Orbigny and Cinclodes patagonicus (Gmelling. Due to differences in dietary habits between species I predicted the lack of sucrase activity in C. nigrofumosus but not in C. patagonicus. Also, low activities of maltase would be expected in both species. On the other hand due to the considerable amount of proteins and trehalose present in preys, high activities of both trehalase and aminopeptidase-N were also expected. Contrary to previous reports in birds, significant activity of trehalase was found. Also lack of sucrase and small amounts of maltase were observed as well as a significant aminopeptidase-N activity in both species. Although the digestive enzyme activities of C. nigrofumosus and C. patagonicus appear to be correlated with their natural diet, the similarities between species in all enzymes activities suggest an strong effect of phylogenetic inertiaSe ha postulado que en las aves tanto la capacidad digestiva como las características bioquímicas del intestino están correlacionadas con los hábitos dietarios. Por esto, es probable que aquellas especies que se alimentan exclusivamente de invertebrados, posean una restricción bioquímica para hidrolizar azúcares. La actividad intestinal in vitro de esas enzimas se estudió en Cinclodes nigrofumosus (d' Orbigny y Cinclodes patagonicus (Gmelling.Debido a diferencias en los habitos entre las especies, se predice que sacarasa estará ausente en C. nigrofumosus, pero no en C. patagonicus. Además, se debiera encontrar una actividad maltásica baja en ambas especies. Por otro lado, debido a las considerables cantidades de

  2. An alternative methionine aminopeptidase, MAP-A, is required for nitrogen starvation and high-light acclimation in the cyanobacterium Synechocystis sp. PCC 6803.

    Science.gov (United States)

    Drath, Miriam; Baier, Kerstin; Forchhammer, Karl

    2009-05-01

    Methionine aminopeptidases (MetAPs or MAPs, encoded by map genes) are ubiquitous and pivotal enzymes for protein maturation in all living organisms. Whereas most bacteria harbour only one map gene, many cyanobacterial genomes contain two map paralogues, the genome of Synechocystis sp. PCC 6803 even three. The physiological function of multiple map paralogues remains elusive so far. This communication reports for the first time differential MetAP function in a cyanobacterium. In Synechocystis sp. PCC 6803, the universally conserved mapC gene (sll0555) is predominantly expressed in exponentially growing cells and appears to be a housekeeping gene. By contrast, expression of mapA (slr0918) and mapB (slr0786) genes increases during stress conditions. The mapB paralogue is only transiently expressed, whereas the widely distributed mapA gene appears to be the major MetAP during stress conditions. A mapA-deficient Synechocystis mutant shows a subtle impairment of photosystem II properties even under non-stressed conditions. In particular, the binding site for the quinone Q(B) is affected, indicating specific N-terminal methionine processing requirements of photosystem II components. MAP-A-specific processing becomes essential under certain stress conditions, since the mapA-deficient mutant is severely impaired in surviving conditions of prolonged nitrogen starvation and high light exposure. PMID:19359320

  3. Purification of Aminopeptidase N Protein and Differences in cDNAs Encoding APN1 Between Susceptible and Resistant Helicoverpa armigera Strains to Bacillus thuringiensis Toxins

    Institute of Scientific and Technical Information of China (English)

    LIANG Ge-mei; WANG Gui-rong; XU Guang; WU Kong-ming; GUO Yu-yuan

    2004-01-01

    The brush border membrane vesicles (BBMVs) in midgut of Helicoverpa armigera were successfully separated, and most of the Aminopeptidase N (APN) activities in BBMV were preserved. The 3-[(3-chlor-amidopropyl) dimethylammonio]-l-propane-sulphonate (CHAPS)can enhance the dissolution of BBMV, and phosphatidylinositol-specific phosopholipase C (PI-PLC) can cleave the APN from midgut membrane. The APN was primarily purified using a Mono-Q column. The results of immunoblotting showed that the 120 and 170 kDa proteins in the BBMV could bind CrylAc, and 120kDa APN was a glycosylphosphalidylinositol(GPI)anchored protein. Two Bt-resistant strains (Bt-P, Bt-M) were obtained after being selected for more than five years in laboratory using Bt insecticides and Bt transgenic cotton incorporated into diet separately. The resistance of Bt-P and Bt-M were 1 083.3and 48.7 times that of susceptible strain. The genes encoding APN1 in midgut of susceptible and resistant H.armigera were cloned by PCR and RACE techniques. The inferred amino acid sequences of APN1 possessed the common character of APN family in insects. In comparison with APN1 in susceptible strain, three nucleotide mutations were observed in the APN1 of Bt-M strain and resulted in two amino acid replace in the putative protein sequences, and eight nucleotide mutations were observed in Bt-P strain and resulted in five amino acid replace.

  4. Aminopeptidase N inhibitor 4cc synergizes antitumor effects of 5-fluorouracil on human liver cancer cells through ROS-dependent CD13 inhibition.

    Science.gov (United States)

    Sun, Zhi-Peng; Zhang, Jian; Shi, Li-Hong; Zhang, Xiu-Rong; Duan, Yu; Xu, Wen-Fang; Dai, Gong; Wang, Xue-Jian

    2015-12-01

    Aminopeptidase N (APN, also known as CD13) is involved in cellular processes of various types of tumors and a potential anti-cancer therapeutic target. Here, we report the effect of an APN inhibitor 4cc in enhancing sensitivity of hepatocellular carcinoma (HCC) cell lines and xenograft model in response to 5-fluorouracil (5-FU) in vivo and in vitro. The treatment of the combination of 4cc with 5-FU, compared to the combination of bestain with 5-FU, markedly suppressed cell growth and induced apoptosis of HCC cells, accompanying the increase in the level of reactive oxygen species (ROS) and followed by a decrease in the mitochondrial membrane potential (ΔΨM). Furthermore, the combination of 4cc and 5-FU showed a significant inhibitory effect on the growth of HCC xenograft tumors. In addition, following the treatment of 4cc, APN activity and clonogenic formation and the number of CD13-positive cells in PLC/PRF/5 cells were significantly decreased, suggesting that 4cc may also inhibit liver cancer stem cells by CD13 inhibition. These results showed that the APN inhibitor 4cc synergizes antitumor effects of 5-FU on human liver cancer cells via ROS-mediated drug resistance inhibition and concurrent activation of the mitochondrial pathways of apoptosis. PMID:26653552

  5. Expression of Aminopeptidase N1(APN1),the Main Receptor Protein for Bacillus thuringiensis Cry1A Toxin from Helicoverpa armigera Larval Midgut in Trichoplusia ni cells

    Institute of Scientific and Technical Information of China (English)

    CHANG Hong-lei; LIANG Ge-mei; WANG Gui-rong; YU Hong-kun; GUO Yu-yuan; WU Kong-ming

    2008-01-01

    The aim of this article is to successfully express the Bt(Bacillus thuringiensis)toxin receptor protein located on the internal membrane of larval midgut of cotton bollworm(Helicoverpa armigera Hiibner)within eukaryotic expression system,which is one of the key links for clarifying the relationship between receptor and Bt resistance.The fragments of aminopeptidase N1(APN1)gene without signal peptide in the susceptible and the resistant H. armigera were cloned separately using PCR method,and were separately cloned into pUC 19 vector.After sequencing the gene,the fragments encoding for APN1 without signal peptide were cloned into the Bac-to-Bac baculovirus expression system with transfer vector pFastBacHTB under the polyhedron gene promoter.The recombinant transposing plasmid pFastBacHTB/APN1 was screened and then transformed into Escherichia coli DH10Bac.It was cultured in LB medium,which contained Te, Kan,Ge,X-gal,and IPTG.The resulting recombinant bacmid was transfected into cells of the insect Trichoplusia ni and recombinant baculoviruse was obtained.The lysate of cells infected with recombinant baculoviruse was analyzed by SDS-PAGE and blot analysis.The results showed that the recombinant baculoviruse was fully capable of expressing APN1.The APN1 gene successfully expressed in T. ni cell established the base for continuing the research on its function and relationship of resistance with Bt.

  6. Comparative expression profiling for human endoplasmic reticulum-resident aminopeptidases 1 and 2 in normal kidney versus distinct renal cell carcinoma subtypes.

    Science.gov (United States)

    Stoehr, Christine G; Buettner-Herold, Maike; Kamphausen, Esther; Bertz, Simone; Hartmann, Arndt; Seliger, Barbara

    2013-01-01

    Altered expression of the ER-resident aminopeptidases ERAP1 and ERAP2 might play an important role in shaping the MHC class I-presented peptide repertoire, but their function in tumors has not been determined in detail. Thus, the expression of ERAP1, ERAP2 and HLA class I heavy chain (HC) was analysed in various renal tumor types and corresponding kidney parenchyma by immunohistochemistry. Additionally, comparative expression profilings of untreated versus interferon (IFN)-γ-treated RCC cell lines were performed applying qRT-PCR, Western blot and/or flow cytometry. Normal kidney tissues showed strong ERAP1 staining in the proximal tubules of 57.4 % of cases, in the distal tubules of 94.3 % of cases and in the medulla of 88.6 % of cases, whereas high ERAP2 levels were observed in the medulla of 77.1 % of cases and in both, proximal and distal tubules of about 88 % of cases. Imbalanced, downregulated and RCC subtype-specific ERAP1 or ERAP2 expression was detected in 12.7 % or 43.8 % of samples analyzed, respectively. A coordinated downregulation of ERAPs was found in 4.8 %, an upregulation of ERAP1 or ERAP2 in 22.8 % or 2.0 % of RCC lesions. No association exists between ERAP and HLA class I HC expression for any tissue type. A heterogeneous constitutive ERAP expression pattern was also detected in RCC cell lines with lower ERAP2 than ERAP1 expression levels, which was in 11/17 RCC cell lines inducible by IFN-γ. Conclusively, ERAP1 and ERAP2 might be involved in the development of immune escape mechanisms of RCC. PMID:23696916

  7. Endoplasmic reticulum aminopeptidase-1 alleles associated with increased risk of ankylosing spondylitis reduce HLA-B27 mediated presentation of multiple antigens.

    Science.gov (United States)

    Seregin, Sergey S; Rastall, David P W; Evnouchidou, Irini; Aylsworth, Charles F; Quiroga, Dionisia; Kamal, Ram P; Godbehere-Roosa, Sarah; Blum, Christopher F; York, Ian A; Stratikos, Efstratios; Amalfitano, Andrea

    2013-12-01

    Ankylosing spondylitis (AS) is a chronic systemic arthritic disease that leads to significant disability and loss of quality of life in the ∼0.5% of the worldwide human population it affects. There is currently no cure for AS and mechanisms underlying its pathogenesis remain unclear. AS is highly genetic, with over 70% of the genetic risk being associated with the presence of HLA-B27 and endoplasmic reticulum aminopeptidase-1 (ERAP1) alleles. Furthermore, gene-gene interactions between HLA-B27 and ERAP1 AS risk alleles have recently been confirmed. Here, we demonstrate that various ERAP1 alleles can differentially mediate surface expression of antigens presented by HLA-B27 on human cells. Specifically, for all peptides tested, we found that an ERAP1 variant containing high AS risk SNPs reduced the amount of the peptide presented by HLA-B27, relative to low AS risk ERAP1 variants. These results were further validated using peptide catalysis assays in vitro, suggesting that high AS risk alleles have an enhanced catalytic activity that more rapidly destroys many HLA-B27-destined peptides, a result that correlated with decreased HLA-B27 presentation of the same peptides. These findings suggest that one mechanism underlying AS pathogenesis may involve an altered ability for AS patients harboring both HLA-B27 and high AS risk ERAP1 alleles to correctly display a variety of peptides to the adaptive arm of the immune system, potentially exposing such individuals to higher AS risk due to abnormal display of pathogen or self-derived peptides by the adaptive immune system. PMID:24028501

  8. The proteasome immunosubunits, PA28 and ER-aminopeptidase 1 protect melanoma cells from efficient MART-126-35 -specific T-cell recognition.

    Science.gov (United States)

    Keller, Martin; Ebstein, Frédéric; Bürger, Elke; Textoris-Taube, Kathrin; Gorny, Xenia; Urban, Sabrina; Zhao, Fang; Dannenberg, Tanja; Sucker, Antje; Keller, Christin; Saveanu, Loredana; Krüger, Elke; Rothkötter, Hermann-Josef; Dahlmann, Burkhardt; Henklein, Petra; Voigt, Antje; Kuckelkorn, Ulrike; Paschen, Annette; Kloetzel, Peter-Michael; Seifert, Ulrike

    2015-12-01

    The immunodominant MART-1(26(27)-35) epitope, liberated from the differentiation antigen melanoma antigen recognized by T cells/melanoma antigen A (MART-1/Melan-A), has been frequently targeted in melanoma immunotherapy, but with limited clinical success. Previous studies suggested that this is in part due to an insufficient peptide supply and epitope presentation, since proteasomes containing the immunosubunits β5i/LMP7 (LMP, low molecular weight protein) or β1i/LMP2 and β5i/LMP7 interfere with MART-1(26-35) epitope generation in tumor cells. Here, we demonstrate that in addition the IFN-γ-inducible proteasome subunit β2i/MECL-1 (multicatalytic endopeptidase complex-like 1), proteasome activator 28 (PA28), and ER-resident aminopeptidase 1 (ERAP1) impair MART-1(26-35) epitope generation. β2i/MECL-1 and PA28 negatively affect C- and N-terminal cleavage and therefore epitope liberation from the proteasome, whereas ERAP1 destroys the MART-1(26-35) epitope by overtrimming activity. Constitutive expression of PA28 and ERAP1 in melanoma cells indicate that both interfere with MART-1(26-35) epitope generation even in the absence of IFN-γ. In summary, our results provide first evidence that activities of different antigen-processing components contribute to an inefficient MART-1(26-35) epitope presentation, suggesting the tumor cell's proteolytic machinery might have an important impact on the outcome of epitope-specific immunotherapies. PMID:26399368

  9. Endoplasmic Reticulum Aminopeptidase 1 (ERAP1) Polymorphism Relevant to Inflammatory Disease Shapes the Peptidome of the Birdshot Chorioretinopathy-Associated HLA-A*29:02 Antigen.

    Science.gov (United States)

    Alvarez-Navarro, Carlos; Martín-Esteban, Adrian; Barnea, Eilon; Admon, Arie; López de Castro, José A

    2015-07-01

    Birdshot chorioretinopathy is a rare ocular inflammation whose genetic association with HLA-A*29:02 is the highest between a disease and a major histocompatibility complex (MHC) molecule. It belongs to a group of MHC-I-associated inflammatory disorders, also including ankylosing spondylitis, psoriasis, and Behçet's disease, for which endoplasmic reticulum aminopeptidases (ERAP) 1 and/or 2 have been identified as genetic risk factors. Since both enzymes are involved in the processing of MHC-I ligands, it seems reasonable that common peptide-mediated mechanisms may underlie the pathogenesis of these diseases. In this study, comparative immunopeptidomics was used to characterize >5000 A*29:02 ligands and quantify the effects of ERAP1 polymorphism and expression on the A*29:02 peptidome in human cells. The peptides predominant in an active ERAP1 context showed a higher frequency of nonamers and bulkier amino acid side chains at multiple positions, compared with the peptides predominant in a less active ERAP1 background. Thus, ERAP1 polymorphism has a large influence, shaping the A*29:02 peptidome through length-dependent and length-independent effects. These changes resulted in increased affinity and hydrophobicity of A*29:02 ligands in an active ERAP1 context. The results reveal the nature of the functional interaction between A*29:02 and ERAP1 and suggest that this enzyme may affect the susceptibility to birdshot chorioretinopathy by altering the A*29:02 peptidome. The complexity of these alterations is such that not only peptide presentation but also other potentially pathogenic features could be affected. PMID:25892735

  10. Leucine aminopeptidase, beta-glucosidase and alkaline phosphatase activity rates and their significance in nutrient cycles in some coastal Mediterranean sites.

    Science.gov (United States)

    Caruso, Gabriella

    2010-01-01

    In aquatic microbial ecology, knowledge of the processes involved in the turnover of organic matter is of utmost importance to understand ecosystem functioning. Microorganisms are major players in the cycling of nutrients (nitrogen, phosphorus) and carbon, thanks to their enzymatic activities (leucine aminopeptidase, LAP, alkaline phosphatase, AP, and beta-glucosidase, beta-GLU) on organic polymers (proteins, organic phosphates and polysaccharides, respectively). Estimates of the decomposition rates of organic polymers are performed using fluorogenic compounds, whose hydrolysis rate allow us to obtain information on the "potential" metabolic activity of the prokaryotic community. This paper refers the enzyme patterns measured during recent oceanographic cruises performed in some coastal Mediterranean sites, not yet fully investigated in terms of microbial biogeochemical processes. Mean enzyme activity rates ranged from 5.24 to 5558.1 nM/h, from 12.68 to 244.73 nM/h and from 0.006 to 9.51 nM/h for LAP, AP and beta-GLU, respectively. The highest LAP and AP activity rates were measured in the Gulf of Milazzo (Tyrrhenian Sea) and in the Straits of Messina, in association with the lowest bacterioplankton abundance; in contrast, the lowest ones were found in the northern Adriatic Sea. beta-GLU was more active in the Straits of Messina. Activity rates were analysed in relation to the main environmental variables. Along the northern Adriatic coastal side affected by the Po river, significant inverse relationships linked LAP and AP with salinity, pointing out that fluvial inputs provided organic substrates for microbial metabolism. Both in the Gulf of Manfredonia and in the Straits of Messina, LAP and AP levels were inversely related with the concentration of nitrate and inorganic phosphorus, respectively. In the Gulf of Milazzo, high cell-specific AP measured in spite of phosphorus availability suggested the role of this enzyme not only in phosphorus, but also in carbon

  11. Leucine Aminopeptidase, β-Glucosidase and Alkaline Phosphatase Activity Rates and Their Significance in Nutrient Cycles in Some Coastal Mediterranean Sites

    Directory of Open Access Journals (Sweden)

    Gabriella Caruso

    2010-03-01

    Full Text Available In aquatic microbial ecology, knowledge of the processes involved in the turnover of organic matter is of utmost importance to understand ecosystem functioning. Microorganisms are major players in the cycling of nutrients (nitrogen, phosphorus and carbon, thanks to their enzymatic activities (leucine aminopeptidase, LAP, alkaline phosphatase, AP, and β-glucosidase, β-GLU on organic polymers (proteins, organic phosphates and polysaccharides, respectively. Estimates of the decomposition rates of organic polymers are performed using fluorogenic compounds, whose hydrolysis rate allow us to obtain information on the “potential” metabolic activity of the prokaryotic community. This paper refers the enzyme patterns measured during recent oceanographic cruises performed in some coastal Mediterranean sites, not yet fully investigated in terms of microbial biogeochemical processes. Mean enzyme activity rates ranged from 5.24 to 5558.1 nM/h, from 12.68 to 244.73 nM/h and from 0.006 to 9.51 nM/h for LAP, AP and β-GLU, respectively. The highest LAP and AP activity rates were measured in the Gulf of Milazzo (Tyrrhenian Sea and in the Straits of Messina, in association with the lowest bacterioplankton abundance; in contrast, the lowest ones were found in the northern Adriatic Sea. β-GLU was more active in the Straits of Messina. Activity rates were analysed in relation to the main environmental variables. Along the northern Adriatic coastal side affected by the Po river, significant inverse relationships linked LAP and AP with salinity, pointing out that fluvial inputs provided organic substrates for microbial metabolism. Both in the Gulf of Manfredonia and in the Straits of Messina, LAP and AP levels were inversely related with the concentration of nitrate and inorganic phosphorus, respectively. In the Gulf of Milazzo, high cell-specific AP measured in spite of phosphorus availability suggested the role of this enzyme not only in phosphorus, but also

  12. Cilium adhesin P216 (MHJ_0493) is a target of ectodomain shedding and aminopeptidase activity on the surface of Mycoplasma hyopneumoniae.

    Science.gov (United States)

    Tacchi, Jessica L; Raymond, Benjamin B A; Jarocki, Veronica M; Berry, Iain J; Padula, Matthew P; Djordjevic, Steven P

    2014-06-01

    MHJ_0493 (P216) is a highly expressed cilium adhesin in Mycoplasma hyopneumoniae. P216 undergoes cleavage at position 1074 in the S/T-X-F↓-X-D/E-like motif (1072)T-N-F↓Q-E(1076) generating N-terminal and C-terminal fragments of 120 kDa (P120) and 85 kDa (P85) on the surface of M. hyopneumoniae. Here we show that several S/T-X-F↓X-D/E-like motifs exist in P216 but only (1072)T-N-F↓Q-E(1076) and (1344)I-T-F↓A-D-Y(1349) were determined to be bona fide processing sites by identifying semitryptic peptides consistent with cleavage at the phenylalanine residue. The location of S/T-X-F↓-X-D/E-like motifs within or abutting regions of protein disorder greater than 40 consecutive amino acids is consistent with our hypothesis that site access influences the cleavage efficiency. Approximately 20 cleavage fragments of P216 were identified on the surface of M. hyopneumoniae by LC-MS/MS analysis of biotinylated proteins and 2D SDS-PAGE. LC-MS/MS analysis of semitryptic peptides within P216 identified novel cleavage sites. Moreover, detection of a series of overlapping semitryptic peptides that differed by the loss a single amino acid at their N-terminus is consistent with aminopeptidase activity on the surface of M. hyopneumoniae. P120 and P85 and their cleavage fragments bind heparin and cell-surface proteins derived from porcine epithelial-like cells, indicating that P216 cleavage fragments retain the ability to bind glycosaminoglycans. PMID:24804907

  13. Purification and Characterization of an Aminopeptidase with Highest Preference for Lysine from Paralichthys Olivaceus Skeletal Muscle%牙鲆肌肉赖氨酸氨肽酶的分离纯化与性质研究

    Institute of Scientific and Technical Information of China (English)

    陈曦; 蔡秋凤; 刘光明; 苏文金; 曹敏杰

    2012-01-01

    An aminopeptidase was purified from Paralichthys olivaceus skeletal muscle to homogeneity by ammonium sulfate fractionation and three column chromatographies, including DEAE -Sephacel, Phenyl -Sepharose, and DEAE -Sepharose Fast Flow. The molecular mass of the enzyme was approximately 100 ku. Optimum temperature and pH of the enzyme were 45 ℃ and 7.5, respectively. Metal-chelating agents such as EDTA, EGTA and 1,10-phenanthroline effectively inhibited the enzyme activity. Zn2+, Mn2+ and (or) Co2+ were quite possibly its metal cofactor(s), strongly suggesting the enzyme belong to metalloproteinase family. The enzyme purified in the present study was regarded as a lysine aminopeptidase (LysAP) according to its substrate specificity. Western blot analysis revealed that leucine aminopeptidase from red sea bream and LysAP from Paralichthys olivaceus have high homogeneity in amino acid sequences. Furthermore, LysAP distributes in tissues including skeletal muscle, heart, liver, spleen, stomach, kidney, gut and gill.%通过DEAE-Sephacel阴离子葡聚糖纤维素交换层析,Phenyl Sepharose 6-Fast Flow苯基葡聚糖凝胶疏水层析和DEAE Sepharose-Fast Flow阴离子葡聚糖凝胶交换层析,从牙鲆(Paralichthys olivaceus)肌肉中分离纯化得到1种赖氨酸氨肽酶,并对其生化性质进行研究.牙鲆赖氨酸氨肽酶的分子质量约为100 ku.该酶的最适温度45℃,最适pH 7.5,二价金属离子对酶活性有较大影响,EDTA和EGTA等金属螯合剂对其活性有抑制作用.该酶对荧光合成底物Lys-MCA分解作用最强,而对内肽酶对应的荧光底物没有分解作用.免疫印迹反应结果显示,该酶与鲤鱼肌肉中亮氨酸氨肽酶同源性较高,并在牙鲆多种器官中均有分布.

  14. Effect of Lathyrus sativus and vitamin C on the status of aromatic L-amino acid decarboxylase and dipeptidyl-aminopeptidase-IV in the central and peripheral tissues and serum of guinea pigs

    International Nuclear Information System (INIS)

    Studies on the effect of Lathyrus Sativus seeds (LLS) on aromatic L-amino acid decarboxylase (AADC) and on dipeptidyl-aminopeptidase-IV (DAP-IV) were carried out in the central and peripheral tissues and serum of LSS-treated and LSS plus vitamin C-treated guinea pigs. The feeding of LSS for 35 days decreased the AADC activity significantly in the brain and peripheral tissues, but the activity was recovered to normal level in the most tissues when vitamin C was added with the LSS. DAP-IV activity decreased in the peripheral tissues when treated with LSS, but the vitamin C administration with LSS did not recover the enzyme activity. The DAP-IV activity did not decrease significantly in any of the brain tissues of the LSS-treated group. (author). 18 refs, 2 tabs

  15. Aminopeptidase N isoforms from the midgut of Bombyx mori and Plutella xylostella -- their classification and the factors that determine their binding specificity to Bacillus thuringiensis Cry1A toxin.

    Science.gov (United States)

    Nakanishi, Kazuko; Yaoi, Katsuro; Nagino, Yasushi; Hara, Hirotaka; Kitami, Madoka; Atsumi, Shogo; Miura, Nami; Sato, Ryoichi

    2002-05-22

    Novel aminopeptidase N (APN) isoform cDNAs, BmAPN3 and PxAPN3, from the midguts of Bombyx mori and Plutella xylostella, respectively, were cloned, and a total of eight APN isoforms cloned from B. mori and P. xylostella were classified into four classes. Bacillus thuringiensis Cry1Aa and Cry1Ab toxins were found to bind to specific APN isoforms from the midguts of B. mori and P. xylostella, and binding occurred with fragments that corresponded to the BmAPN1 Cry1Aa toxin-binding region of each APN isoform. The results suggest that APN isoforms have a common toxin-binding region, and that the apparent specificity of Cry1Aa toxin binding to each intact APN isoform seen in SDS-PAGE is determined by factors such as expression level in conjunction with differences in binding affinity. PMID:12023048

  16. Characteristics of tench eggs aminopeptidases

    Czech Academy of Sciences Publication Activity Database

    Barth, Tomislav; Barthová, J.; Kronovetr, J.; Anzenbacherová, Eva; Hamáčková, J.; Hauzerová, Linda

    Oostende : European Aquaculture Society, 1998. s. 27-28. [ Aquaculture and Water: Fish Culture, Shellfisch Culture and Water Usage. 07.10.1998-10.10.1998, Oostende] R&D Projects: GA ČR GA505/94/0740 Subject RIV: CE - Biochemistry

  17. 稻纵卷叶螟氨肽酶N基因的克隆及时空表达分析%Cloning and spatio-temporal expression of aminopeptidase N encoding genes in Cnaphalocrocis medinalis (Lepidoptera:Pyralidae)

    Institute of Scientific and Technical Information of China (English)

    杜立啸; 周艳聪; 王兴云; 韩兰芝; 侯茂林; 彭于发

    2014-01-01

    【目的】昆虫中肠氨肽酶 N(Aminopeptidase N,APN)是 Bt 杀虫蛋白的重要受体之一,与Bt 蛋白的杀虫机制及昆虫对 Bt 蛋白的抗性密切相关。为阐明稻纵卷叶螟 Cnaphalocrocis medinalis (Guenée)APN基因的功能及明确Bt蛋白对稻纵卷叶螟的毒力机制,本研究系统开展了稻纵卷叶螟中肠APN基因的克隆及时空表达分析。【方法】通过简并引物 PCR 结合 RACE 技术克隆并获得4条稻纵卷叶螟 APN 基因的 cDNA 序列全长,采用实时定量PCR技术研究了APN基因在稻纵卷叶螟不同虫态及幼虫不同组织中的时空表达情况。【结果】经NCBI同源比对分析,认为这4个基因分属于APN基因家族的不同类别,分别将其命名为CmAPN1(GenBank登录号:HQ853294)、CmAPN2(GenBank登录号:HQ853295)、CmAPN3(GenBank登录号:KJ143755)、CmAPN4(GenBank登录号:HQ853296)。序列分析表明,CmAPN1-4 cDNA序列全长分别为:3698、3478、3150和3149 bp,开放阅读框分别为:3045、2877、3045和2862 bp,分别编码965、958、1014和952个氨基酸。其推导的氨基酸序列具有鳞翅目昆虫氨肽酶 N 的典型结构特征,即含有糖基化位点、N-末端信号肽序列、谷氨酸锌化氨肽酶保守结构GAMEN、锌结合位点 HEX2HX18E、C-末端糖基磷脂酰肌醇(GPI)锚信号肽。实时定量研究表明,CmAPNs在幼虫中的表达量显著高于卵、蛹和成虫;在幼虫中,CmAPN1的表达水平明显低于CmAPN2-4,且其在不同龄期中的表达差异显著;CmAPN2-4的表达量随幼虫龄期的增加而增加;CmAPNs 在幼虫肠道组织中的表达量显著高于其它组织器官,且CmAPN1和CmAPN2分别在中肠和后肠中呈现高水平表达,CmAPN3在前、中肠内均高水平表达;但CmAPN4在各个组织器官中的表达均保持较低水平。【结论】 CmAPNs 基因在稻纵卷叶螟的不同虫态和不同组织中呈现了差异显

  18. Differences between disease-associated endoplasmic reticulum aminopeptidase 1 (ERAP1) isoforms in cellular expression, interactions with tumour necrosis factor receptor 1 (TNF-R1) and regulation by cytokines.

    Science.gov (United States)

    Yousaf, N; Low, W Y; Onipinla, A; Mein, C; Caulfield, M; Munroe, P B; Chernajovsky, Y

    2015-05-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) processes peptides for major histocompatibility complex (MHC) class I presentation and promotes cytokine receptor ectodomain shedding. These known functions of ERAP1 may explain its genetic association with several autoimmune inflammatory diseases. In this study, we identified four novel alternatively spliced variants of ERAP1 mRNA, designated as ΔExon-11, ΔExon-13, ΔExon-14 and ΔExon-15. We also observed a rapid and differential modulation of ERAP1 mRNA levels and spliced variants in different cell types pretreated with lipopolysaccharide (LPS). We have studied three full-length allelic forms of ERAP1 (R127-K528, P127-K528, P127-R528) and one spliced variant (ΔExon-11) and assessed their interactions with tumour necrosis factor receptor 1 (TNF-R1) in transfected cells. We observed variation in cellular expression of different ERAP1 isoforms, with R127-K528 being expressed at a much lower level. Furthermore, the cellular expression of full-length P127-K528 and ΔExon-11 spliced variant was enhanced significantly when co-transfected with TNF-R1. Isoforms P127-K528, P127-R528 and ΔExon-11 spliced variant associated with TNF-R1, and this interaction occurred in a region within the first 10 exons of ERAP1. Supernatant-derived vesicles from transfected cells contained the full-length and ectodomain form of soluble TNF-R1, as well as carrying the full-length ERAP1 isoforms. We observed marginal differences between TNF-R1 ectodomain levels when co-expressed with individual ERAP1 isoforms, and treatment of transfected cells with tumour necrosis factor (TNF), interleukin (IL)-1β and IL-10 exerted variable effects on TNF-R1 ectodomain cleavage. Our data suggest that ERAP1 isoforms may exhibit differential biological properties and inflammatory mediators could play critical roles in modulating ERAP1 expression, leading to altered functional activities of this enzyme. PMID:25545008

  19. 大螟中肠氨肽酶 N 基因的克隆及表达谱分析%Cloning and expression profiling of aminopeptidase N encoding gene in the larval midgut of Sesamia inferens (Lepidoptera: Noctuidae)

    Institute of Scientific and Technical Information of China (English)

    王兴云; 马文静; 韩兰芝; 侯茂林

    2012-01-01

    昆虫中肠氨肽酶N是Bt毒素的重要受体之一,与Bt毒素的杀虫机制及昆虫Bt抗性的产生密切相关.本研究通过简并引物PCR结合RACE技术克隆并获得大螟Sesamia inferens Bt受体蛋白——氨肽酶N(aminopeptidase N,APN)基因的cDNA序列全长,经NCBI同源比对分析,认为该基因为APN3基因,并将其命名为SiAPN3(GenBank登录号为HQ636624).序列分析表明,该基因的cDNA序列全长为3 411 bp,开放阅读框为3 018 bp,编码1 006个氨基酸;预测蛋白质分子量为114 kD,等电点为4.95;其推导的氨基酸序列中具有鳞翅目昆虫氨肽酶N典型的结构特征,即含有1个N-和12个O-连接的糖基化位点,N-末端具有18个氨基酸的剪切信号肽,谷氨酸锌化氨肽酶保守结构GAMEN,锌结合位点HEXXHX18E,C-末端具有22个氨基酸的糖基磷脂酰肌醇(GPI)锚信号肽.采用实时定量PCR研究了SiAPN3在大螟4龄幼虫肠道不同部位和幼虫不同龄期的转录表达谱.结果表明,该基因在幼虫中肠中的表达量最高,其次为后肠,前肠中表达量最低,且中肠和后肠中的表达量显著高于前肠(P<0.05);SiAPN3在3龄幼虫中的表达量最高,1龄幼虫中最低,虽然3、4日龄之间的表达量没有显著差异,但二者均显著高于其他日龄,1,2和5日龄之间不存在显著差异(P>0.05).该研究为阐明APN基因的功能及大螟对Bt抗性产生的分子机制奠定了基础.%Aminopeptidase N (APN) is located in the brush border membrane vesicles (BBMV) of insect midgut. It is the major receptor of insecticidal crystal proteins from Bacillus thuringiensis ( Bt) and is closely related to the resistance of insects to Bt toxin. To clarify the relationship of APN and the resistance of Sesamia inferens to Bt loxin, the full-length APN-encoding cDNA sequence was cloned from BBMV of S. inferens midgut by degenerate PCR and RACE techniques and named as SiAPN3 (GenBank accession no; HQ636624). The relative expression levels of

  20. Binding of Bt Cry toxins to lepidopteran midgut aminopeptidase N and the relationship between their interactions with Bt resistance%鳞翅目昆虫氨肽酶N与Bt毒素的结合及其与Bt抗性的关系

    Institute of Scientific and Technical Information of China (English)

    马文静; 韩兰芝; 尹新明; 曹广春; 苏丽娟

    2011-01-01

    随着Bt Cry作物在我国的广泛应用和推广,靶标害虫对其抗性风险已成为Bt Cry作物生态安全研究的重要内容.氨肽酶N(Aminopeptidase N,APN)是位于昆虫中肠刷状缘膜囊泡(Brush Border Membrane Vesicles,BBMV)上Bt Cry毒素重要的受体蛋白之一,它与Bt Cry毒素的结合能力决定了Bt Cry毒素的杀虫活性及昆虫对Bt抗性的产生.本文从APN的结构特征与分类、APN与Bt Cry毒素的结合特异性、结合位点、结合过程中的分子互作机制及APN变异导致昆虫抗性产生几方面系统综述了鳞翅目昆虫中肠Bt Cry受体蛋白-氨肽酶N与Bt Cry 毒素的结合及其与Bt抗性关系的研究进展.%With the wide application and popularization of Bt Cry crop, the resistance of target pests a-gainst Bt Cry crop has become the focus of studies on its ecological safety. Aminopeptidase N (APN) is one of Bt-toxin receptor proteins located in brush border membrane vesicles ( BBMV) of insect midgut. Its binding capability with Bt Cry toxin determines the toxin's insecticidal spectrum and insect Bt resistance. This paper systemically reviews the progress of researches on APN structural characteristics and classfication, the binding feature, binding sites and interactions mechanism of Bt Cry toxin and APN as well as Bt resistance resulting from APN mutations.

  1. 家蚕氨肽酶N家族基因在5龄幼虫中肠组织的表达分析%Expression Analysis of Aminopeptidase N Family Genes in Midgut Tissue of the Fifth Instar Bombyx mori Larvae

    Institute of Scientific and Technical Information of China (English)

    王猛; 程晨; 郝碧芳; 徐安英; 沈兴家; 黄金山

    2013-01-01

    Aminopeptidase N (APN) is an enzyme that readily hydrolyzes protein or neutral amino acids at the N-terminal of an oligopeptide.It is mainly distributed in the brush border membrane vesicle of midgut epithelial cells of lepidopterous insects and is the important receptor of Bacillus thuringiensis crystal toxins (Cry).To investigate expression patterns of APN family genes,Real-time PCR was employed to analyze the differential expression of APN family genes in larva migut tissue of different silkworm (Bombyx mori) varieties and the expression level of various family members in larva midgut tissue of the same silkworm variety.The results showed that APN family genes were expressed in larva midgut of all tested silkworm varieties.The expression level of APN genes were significantly different between silkworm varieties having different voltinisms (P <0.05).However,there was little difference between silkworm varieties having the same voltinism (P >0.05).The expression levels of APN2,APN4 and APN5 genes were relatively higher in larva midgut tissue of the same silkworm variety,whereas those of APN1 and APN3 were relatively lower.The obtained results would facilitate further study on functioning mechanism of silkworm APN family genes,and provide theoretical basis for breeding silkworm strains resistant to Bacillus thuringiensis.%氨肽酶N(aminopeptidase N,APN)是一种偏好水解蛋白质或寡肽N端中性氨基酸的酶,在鳞翅目昆虫中主要分布于中肠上皮细胞的刷状缘囊膜上,是苏云金芽孢杆菌(Bacillus thuringiensis,Bt)伴孢晶体(Cry)毒素的重要受体蛋白.为了研究家蚕APN家族基因的表达特征,运用Real-time PCR技术检测分析该家族基因在不同家蚕品种幼虫中肠组织的表达差异以及同一家蚕品种幼虫中肠组织中该家族基因各个成员的表达丰度.在所有供试家蚕品种的幼虫中肠组织均可检测到APN家族基因的表达,但不同化性家蚕品种间APN基因的表

  2. Methionine AminoPeptidase Type-2 Inhibitors Targeting Angiogenesis.

    Science.gov (United States)

    Ehlers, Tedman; Furness, Scott; Robinson, Thomas Philip; Zhong, Haizhen A; Goldsmith, David; Aribser, Jack; Bowen, J Phillip

    2016-01-01

    Angiogenesis has been identified as a crucial process in the development and spread of cancers. There are many regulators of angiogenesis which are not yet fully understood. Methionine aminiopeptidase is a metalloenzyme with two structurally distinct forms in humans, Type-1 (MetAP-1) and Type-2 (MetAP-2). It has been shown that small molecule inhibitors of MetAP-2 suppress endothelial cell proliferation. The initial discovery by Donald Ingber of MetAP-2 inhibition as a potential target in angiogenesis began with a fortuitous observation similar to the discovery of penicillin activity by Sir Alexander Fleming. From a drug design perspective, MetAP-2 is an attractive target. Fumagillin and ovalicin, known natural products, bind with IC50 values in low nanomolar concentrations. Crystal structures of the bound complexes provide 3-dimensional coordinates for advanced computational studies. More recent discoveries have shown other biological activities for MetAP-2 inhibition, which has generated new interests in the design of novel inhibitors. Semisynthetic fumagillin derivatives such as AGM-1470 (TNP-470) have been shown to have better drug properties, but have not been very successful in clinical trials. The rationale and development of novel multicyclic analogs of fumagillin are reviewed. PMID:26369821

  3. Expression of aminopeptidase N (CD13) in mesenchymal tumors.

    OpenAIRE

    Mechtersheimer, G; Möller, P.

    1990-01-01

    For a long time, CD13 molecules have been considered to be restricted to myeloid cells and related neoplasms. Meanwhile, however, expression of CD13 has also been detected in some hepatocellular, gallbladder, renal, and lung carcinomas, and even in some fibrosarcomas and malignant melanomas. In this study, expression of CD13 antigen was immunohistochemically examined in non-neoplastic mesenchymal cells, along with 33 benign and 83 malignant mesenchymal tumors (MET) using CD13 monoclonal antib...

  4. 尿胞外体亮氨酸氨基肽酶及二肽基肽酶在糖尿病肾病中的变化%Changes of urinary exosomal leucine aminopeptidase and dipeptidyl peptidase 4 in diabetic nephropathy

    Institute of Scientific and Technical Information of China (English)

    孙爱丽; 胡晓燕; 关广聚; 邓浩萍; 刘元涛; 陈诗鸿; 刘军莉; 邓景惕

    2011-01-01

    AIM: To investigate the changes of urinary exosomal enzymes and the correlation with diabetic nephropathy.METHODS: Thirty - four healthy volunteers and 127 patients of type 2 diabetes mellitus ( T2DM ) were included in the study.The healthy volunteers served as control.The patients with T2DM were divided into 3 groups based on their 24 h urinary albumin/creatinine ratio ( UACR ): 50 patients with microalbuminuria in early DN group ( DN1 ), 34 patients with macroalbuminuria in overt DN group ( DN2 ) and 43 patients without albuminuria in DM group.The levels of urine exosomal leucine aminopeptidase( exosome - LAP ) and exosomal dipeptidyl peptidase 4( exosome - DPP4 ) were determined by enzyme - linked immunosorbent assay ( ELISA ).The following methods were used to determine the biochemical parameters: liquid chromatography for glycated hemoglobin ( HbA1c ), chemical modification method for cholesterol ( CH ), Jaffe - kinetic assay for creatinine ( CR ) and urease - GLDH method for blood urea nitrogen ( BUN ).Multiple stepwise linear regressions were used to analyze the relationship of exosome - LAP or exosome - DPP4 with HbA1c, CH, UACR, CR and BUN.RESULTS: The levels of exosome - LAP and exosome - DPP4 in DM, DN1 and DN2 groups were significantly higher than those in control group ( P <0.01 ).The exosome - LAP in DN2 group was significantly higher than that in DM group.Correlation analysis showed that the levels of urinary exosome - LAP and exosome - DPP4 were positively correlated with HbA1c, CH, UACR, CR and BUN.Multiple stepwise linear regression analysis showed that CH and UACR were independent determinants for exosome - LAP ( P <0.01 ), and UACR and HbAlc were independent determinants for exosome - DPP4 ( P <0.01 ).CONCLUSION: Urine exosome - LAP and exosome - DPP4 are correlated with the severity of diabetic nephropathy.These parameters may serve as clinical markers for the diagnosis and prognosis evaluation of diabetic nephropathy.%目的:探讨 2

  5. SwissProt search result: AK109252 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK109252 002-159-F03 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Mic ... rosomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  6. SwissProt search result: AK073744 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK073744 J033068J12 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  7. SwissProt search result: AK068165 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK068165 J013134N07 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  8. SwissProt search result: AK066773 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066773 J013081C24 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  9. SwissProt search result: AK066996 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066996 J013089H24 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  10. SwissProt search result: AK120068 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK120068 J013002N11 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  11. SwissProt search result: AK064900 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK064900 J013000L14 (P15684) Aminopeptidase N (EC 3.4.11.2) (rAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (CD13 ) (Aminopeptidase M) (APM) (Kidney Zn peptidase) (K ...

  12. Aminopeptidase N/CD13 is associated with raft membrane microdomains in monocytes

    DEFF Research Database (Denmark)

    Navarrete Santos, A; Roentsch, J; Danielsen, E M; Langner, J; Riemann, D

    2000-01-01

    fractions of monocytes were characterized by the presence of GM1 ganglioside as raft marker molecule and by the high level of tyrosine-phosphorylated proteins. Furthermore, similar to polarized cells, rafts in monocytic cells lack Na(+), K(+)-ATPase. Cholesterol depletion of monocytes by methyl...

  13. STRUCTURE OF A MICROSPORIDIAN METHIONINE AMINOPEPTIDASE TYPE 2 COMPLEXED WITH FUMAGILLIN AND TNP470

    OpenAIRE

    Alvarado, John Jeff; NEMKAL, ANJANA; Sauder, J. Michael; RUSSELL, MARIJANE; Akiyoshi, Donna E.; Shi, Wuxian; Almo, Steven C.; Weiss, Louis M.

    2009-01-01

    Microsporidia are protists that have been reported to cause infections in both vertebrates and invertebrates. They have emerged as human pathogens particularly in patients that are immunnosuppressed and cases of gastrointestinal infection, encephalitis, keratitis, sinusitis, myositis and disseminated infection are well described in the literature. While benzimidazoles are active against many species of Microsporidia, these drugs do not have significant activity against Enterocytozoon bieneusi...

  14. Association between endoplasmic reticulum aminopeptidase-1 (ERAP-1 and susceptibility to ankylosing spondylitis in Iran.

    Directory of Open Access Journals (Sweden)

    Mahdi Mahmoudi

    2012-12-01

    Full Text Available Ankylosing Spondylitis (AS is an inflammatory arthritis, which affects mainly spine and sacroiliac joints. According to recent studies, ERAP1 is the second most common candidate gene for  AS susceptibility after HLA-B27. The  aim of this study was to  determine the association of ERAP1 gene polymorphisms with AS in Iranian population.The study group comprised 387 Iranian AS patients and 316 healthy controls from Iran.Using Real Time PCR allelic discrimination method,  we genotyped four SNPs (rs30187, rs469876, rs13167972 and rs27434 of ERAP1.We found  that  rs30187 and rs27434 were significantly associated with AS in Iranian population (P=6×10-5, P=7×10-3,  respectively. The rs30187 T/T genotype was associated with AS compared  with C/C  genotype (P=1.5×10-5.  The  rs27434 G/G genotype was inversely associated with  AS (P=5×10-3.  Two  specific haplotypes  including:  rs30187/ rs469876/ rs13167972/ rs27434 TAAA and CAGG  were associated with increased and decreased risk of AS in Iranian population, respectively.These results indicated that ERAP1 SNPs and haplotypes were associated with AS in Iranian population.

  15. Structural Basis For Antigenic Peptide Precursor Processing by the Endoplasmic Reticulum Aminopeptidase ERAP1

    OpenAIRE

    Nguyen, Tina T.; Chang, Shih-Chung; Evnouchidou, Irini; Ian A York; Zikos, Christos; Rock, Kenneth L.; Goldberg, Alfred L.; Stratikos, Efstratios; Stern, Lawrence J.

    2011-01-01

    ERAP1 trims antigen precursors to fit into MHC class I proteins. To perform this function, ERAP1 has unique substrate preferences, trimming long peptides while sparing shorter ones. To identify the structural basis for ERAP1's unusual properties, we determined the X-ray crystal structure of human ERAP1 bound to bestatin. The structure reveals an open conformation with a large interior compartment. An extended groove originating from the enzyme's catalytic center can accommodate long peptides ...

  16. Association between endoplasmic reticulum aminopeptidase-1 (ERAP-1) and susceptibility to ankylosing spondylitis in Iran.

    OpenAIRE

    Mahdi Mahmoudi; Ahmad Reza Jamshidi; Ali Akbar Amirzargar; Elham Farhadi; Keramat Nourijelyani; Sasan Fallahi; Mona Oraei; Sahar Noori; Mohammad Hossein Nicknam

    2012-01-01

    Ankylosing Spondylitis (AS) is an inflammatory arthritis, which affects mainly spine and sacroiliac joints. According to recent studies, ERAP1 is the second most common candidate gene for  AS susceptibility after HLA-B27. The  aim of this study was to  determine the association of ERAP1 gene polymorphisms with AS in Iranian population.The study group comprised 387 Iranian AS patients and 316 healthy controls from Iran.Using Real Time PCR allelic discrimination method,  we genotyped four SNPs ...

  17. p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1

    OpenAIRE

    Wang, Bei; Niu, Dandan; Lai, Liyun; Ren, Ee Chee

    2013-01-01

    The p53 tumour suppressor has an important role in cancer cells. Here we show that p53 regulates expression of major histocompatibility complex I on the cell surface. We show that the tumour cell line HCT116, which lacks p53 exhibits significantly lower major histocompatibility complex I expression than its wild-type counterpart. Using a combination of chromatin immunoprecipitation sequencing and gene expression analysis, we demonstrate that p53 upregulates expression of endoplasmic reticulum...

  18. Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells

    International Nuclear Information System (INIS)

    Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs

  19. Alkaline phosphatases and aminopeptidases are altered in a Cry11Aa resistant strain of Aedes aegypti.

    Science.gov (United States)

    Lee, Su-Bum; Aimanova, Karlygash G; Gill, Sarjeet S

    2014-11-01

    Bacillus thuringiensis subsp. israelensis (Bti) is widely used for the biological control of mosquito populations. However, the mechanism of Bti toxins is still not fully understood. To further elucidate the mechanism of Bti toxins, we developed an Aedes aegypti resistant strain that shows high-level resistance to Cry11Aa toxin. After 27 selections with Cry11Aa toxin, the larvae showed a 124-fold resistance ratio for Cry11Aa (strain G30). G30 larvae showed cross-resistance to Cry4Aa (66-fold resistance), less to Cry4Ba (13-fold), but not to Cry11Ba (2-fold). Midguts from these resistant larvae did not show detectable difference in the processing of the Cry11Aa toxin compared to that in susceptible larvae (WT). Brush border membrane vesicles (BBMV) from resistant larvae bound slightly less Cry11Aa compared to WT BBMV. To identify potential proteins associated with Cry11A resistance, not only transcript changes in the larval midgut were analyzed using Illumina sequencing and qPCR, but alterations of previously identified receptor proteins were investigated using immunoblots. The transcripts of 375 genes were significantly increased and those of 208 genes were down regulated in the resistant larvae midgut compared to the WT. None of the transcripts for previously identified receptors of Cry11Aa (Aedes cadherin, ALP1, APN1, and APN2) were altered in these analyses. The genes for the identified functional receptors in resistant larvae midgut did not contain any mutation in their sequences nor was there any change in their transcript expression levels compared to WT. However, ALP proteins were expressed at reduced levels (∼ 40%) in the resistant strain BBMV. APN proteins and their activity were also slightly reduced in resistance strain. The transcript levels of ALPs (AAEL013330 and AAEL015070) and APNs (AAEL008158, AAEL008162) were significantly reduced. These results strongly suggest that ALPs and APNs could be associated with Cry11Aa resistance in Ae. aegypti. PMID:25242559

  20. Human myeloid plasma membrane glycoprotein CD13 (gp150) is identical to aminopeptidase N.

    OpenAIRE

    Look, A T; Ashmun, R A; Shapiro, L H; Peiper, S C

    1989-01-01

    To determine the primary structure of CD13, a 150-kD cell surface glycoprotein originally identified on subsets of normal and malignant human myeloid cells, we isolated the complete sequences encoding the polypeptide in overlapping complementary DNA (cDNA) clones. The authenticity of our cDNA clones was demonstrated by the ability of the coding sequences, subcloned in a retroviral expression vector, to mediate expression of bona fide CD13 molecules at the surface of transfected mouse fibrobla...

  1. The application of CD13/aminopeptidase N in the angiogenesis imaging

    International Nuclear Information System (INIS)

    The development and metasis of malignant tumor depend on neovascularization. CD 13 is a significant marker of cells commit to myeloid lineage to classify leukemia, meanwhile it expresses on the neovascular endothelial cells specifically but expresses barely in vascular endothelial cells. Coupling CD13 monoclonal antibody or CD13 ligand to CD13 in fluorescence, radionuclide or magnetic nanoparticles to achieve molecular imaging to probe angiogenesis and provide imaging evidence of the development of angiogenesis associated disease. Asn-Gly-Arg peptide motif compound with different anticancer drugs targeted deliver to neovascular endothelial cells and release the anticancer drugs to treat the tumor. The research of CD13 to understand, diagnose and treat the angiogenesis associated diseases has gotten breakthrough and have a promising future. (authors)

  2. MOLECULAR CLONING AND ANALYSIS OF THE CRYPTOSPORIDIUM PARVUM AMINOPEPTIDASE N GENE. (R828035)

    Science.gov (United States)

    Cryptosporidium parvum proteases have been associated with release of infective sporozoites from oocysts, and their specific inhibition blocks parasite excystation in vitro. Additionally, proteases have been implicated in the processing of parasite adhesion molecules fo...

  3. MOLECULAR CLONING AND ANALYSIS OF THE CRYPTOSPORIDIUM PARVUM AMINOPEPTIDASE N GENE. (R829180)

    Science.gov (United States)

    Cryptosporidium parvum proteases have been associated with release of infective sporozoites from oocysts, and their specific inhibition blocks parasite excystation in vitro. Additionally, proteases have been implicated in the processing of parasite adhesion molecules fo...

  4. The standalone aminopeptidase PepN catalyzes the maturation of blasticidin S from leucylblasticidin S.

    Science.gov (United States)

    Yu, Guiyang; Li, Li; Liu, Xiangyang; Liu, Guang; Deng, Zixin; Zabriskie, Mark T; Jiang, Ming; He, Xinyi

    2015-01-01

    The peptidyl nucleoside blasticidin S (BS) isolated from Streptomyces griseochromogenes was the first non-mercurial fungicide used on a large scale to prevent rice blast. In the biosynthesis of BS, leucylblasticidin S (LBS) was suggested as the penultimate metabolite with 20-fold less inhibitory activity than the final product BS. Incomplete conversion of LBS to BS at a variable efficiency ranging from 10% to 90% was observed either in the native strain S. griseochromogenes or a heterologous producer Streptomyces lividans WJ2. In this study, we determined that maturation of BS from LBS is not a spontaneous process but is governed by a standalone peptidase PepN, which hydrolyzes LBS in a pH-sensitive way with most appropriate of pH 7~8 but is inactive when the pH is below 5 or above 10. PepN1 and PepN2, two neighboring PepN homologs from Streptomyces lividans were purified in E. coli but displayed ca.100-fold difference in LBS hydrolytic activity. Overexpression of pepN1 in WJ2 enhanced BS yield by 100% and lowered the ratio of LBS to BS from 2:1 to 2:3. This work presents the expansion of the biological role for PepN in antibiotic maturation and the first report of hydrolysis of beta amide linkage by this conserved enzyme. PMID:26621790

  5. Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells

    Energy Technology Data Exchange (ETDEWEB)

    Cong, Yingying; Li, Xiaoxue; Bai, Yunyun [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); Lv, Xiaonan [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); CAS Key Lab for Biomedical Effects of Nanomaterials and Nanosafety, National Center for Nanoscience & Technology of China, Beijing 100090 (China); Herrler, Georg [Institute for Virology, University of Veterinary Medicine, Hannover D-30559 (Germany); Enjuanes, Luis [Department of Molecular and Cell Biology, Centro Nacional de Biotecnología (CNB-CSIC), Campus Universidad Autónoma de Madrid, Cantoblanco, Madrid (Spain); Zhou, Xingdong [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China); Qu, Bo [Faculty of Life Sciences, Northeast Agricultural University, Harbin 150030 (China); Meng, Fandan [Institute for Virology, University of Veterinary Medicine, Hannover D-30559 (Germany); Cong, Chengcheng [College Animal Husbandry and Veterinary Medicine, Shenyang Agricultural University, Shenyang 110161 (China); Ren, Xiaofeng; Li, Guangxing [College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030 (China)

    2015-04-15

    Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs.

  6. Structural and Biochemical Characterization of a Novel Aminopeptidase from Human Intestine

    Czech Academy of Sciences Publication Activity Database

    Tykvart, Jan; Bařinka, Cyril; Svoboda, Michal; Navrátil, Václav; Souček, Radko; Hubálek, Martin; Hradilek, Martin; Šácha, Pavel; Lubkowski, J.; Konvalinka, Jan

    2015-01-01

    Roč. 290, č. 18 (2015), s. 11321-11336. ISSN 0021-9258 R&D Projects: GA ČR GAP304/12/0847; GA MŠk LO1302; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388963 ; RVO:86652036 Keywords : glutamate carboxypeptidase II * reaction mechanism * expression Subject RIV: CE - Biochemistry Impact factor: 4.573, year: 2014

  7. EST data: 5412 [RED

    Lifescience Database Archive (English)

    Full Text Available EH1595 AU095379 AU031455 E61595 2 G DPlate 056 D05 CACAAATCAAAAGGAAGAGC AGCTAGGGCCAATGATATAC >(Q ... 42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC URSOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) ... (LEUCYL AMINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  8. SwissProt search result: AK109252 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK109252 002-159-F03 (P15541) Aminopeptidase N (EC 3.4.11.2) (rbAPN) (Alanyl aminopeptidase) (Mi ... inopeptidase) (Aminopeptidase M) (Leukemia antigen CD13 ) AMPN_RABIT 1e-103 ...

  9. SwissProt search result: AK066996 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066996 J013089H24 (P15541) Aminopeptidase N (EC 3.4.11.2) (rbAPN) (Alanyl aminopeptidase) (Mic ... inopeptidase) (Aminopeptidase M) (Leukemia antigen CD13 ) AMPN_RABIT 1e-102 ...

  10. SwissProt search result: AK120068 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK120068 J013002N11 (P15541) Aminopeptidase N (EC 3.4.11.2) (rbAPN) (Alanyl aminopeptidase) (Mic ... inopeptidase) (Aminopeptidase M) (Leukemia antigen CD13 ) AMPN_RABIT 1e-107 ...

  11. SwissProt search result: AK068165 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK068165 J013134N07 (P15541) Aminopeptidase N (EC 3.4.11.2) (rbAPN) (Alanyl aminopeptidase) (Mic ... inopeptidase) (Aminopeptidase M) (Leukemia antigen CD13 ) AMPN_RABIT 1e-105 ...

  12. Biosynthesis of intestinal microvillar proteins. Translational evidence in vitro that aminopeptidase N is synthesized as a Mr-115000 polypeptide

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Norén, O; Sjöström, H

    1982-01-01

    immunopurified from the translation mixture and analysed by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis. It was found to have an apparent Mr of 115000 regardless of whether the translation was performed in the absence or presence of proteinase inhibitors. This result contradicts the possibility of...

  13. Autoimmune disease-associated variants of extracellular endoplasmic reticulum aminopeptidase 1 induce altered innate immune responses by human immune cells

    OpenAIRE

    Aldhamen, Yasser A; Pepelyayeva, Yuliya; Rastall, David P. W.; Seregin, Sergey S.; Zervoudi, Efthalia; Koumantou, Despoina; Charles F Aylsworth; Quiroga, Dionisia; Godbehere, Sarah; Georgiadis, Dimitris; Stratikos, Efstratios; Amalfitano, Andrea

    2015-01-01

    ERAP1 gene polymorphisms have been linked to several autoimmune diseases; however, the molecular mechanisms underlying these associations are not well understood. Recently, we have demonstrated that ERAP1 regulates key aspects of the innate immune response. Moreover, previous studies show ERAP1 to be ER-localized and secreted during inflammation. Herein, we investigate the possible roles that ERAP1 polymorphic variants may have in modulating innate immune responses of human PBMCs using two ex...

  14. Expression and Purification of Active Recombinant Cathepsin C (Dipeptidyl Aminopeptidase I of Kuruma Prawn Marsupenaeus japonicus in Insect Cells

    Directory of Open Access Journals (Sweden)

    Gao-Feng Qiu

    2009-01-01

    Full Text Available Cathepsin C (CTSC is a lysosomal cysteine protease belonging to the papain superfamily. Our previous study showed that CTSC precursor (zymogen is localized exclusively in cortical rods (CRs of mature oocyte in the kuruma prawn Marsupenaeus japonicus, suggesting that CTSC might have roles on regulating release and/or formation of a jelly layer. In this study, enzymically active CTSC of the kuruma prawn was prepared by recombinant expression in the High Five insect cell line. The recombinant enzyme with a polyhistidine tag at its C-terminus was considered to be initially secreted into the culture medium as an inactive form of zymogen, because Western blot with anti-CTSC antibody detected a 51 kDa protein corresponding to CTSC precursor. After purification by affinity chromatography on nickel-iminodiacetic acid resin, the enzyme displayed three forms of 51, 31, and 30 kDa polypeptides. All of the forms can be recognized by antiserum raised against C-terminal polyhistidine tag, indicating that the 31 and 30 kDa forms were generated from 51 kDa polypeptide by removal of a portion of the N-terminus of propeptide. Following activation at pH 5.5 and 37∘C for 40 hours under native conditions, the recombinant CTSC (rCTSC exhibited increased activity against the synthetic substrate Gly-Phe-β-naphthylamide and optimal pH at around 5. The purified rCTSC will be useful for further characterization of its exact physiological role on CRs release and/or formation of a jelly layer in kuruma prawn.

  15. Expression and clinical significance of aminopeptidase N/CD13 in non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Quan Zhang

    2015-01-01

    Conclusions: Expression of APN/CD13 is a potential unfavorable factor to predict the efficacy and prognosis of post-operative chemotherapy in NSCLC patients, especially in lung adenocarcinoma patients.

  16. Efficient inhibition of tumor angiogenesis and growth by a synthetic peptide blocking S100A4-methionine aminopeptidase 2 interaction

    OpenAIRE

    Ochiya, Takahiro; Takenaga, Keizo; Asagiri, Masataka; Nakano, Kazumi; Satoh, Hitoshi; Watanabe, Toshiki; Imajoh-Ohmi, Shinobu; Endo, Hideya

    2015-01-01

    The prometastatic calcium-binding protein, S100A4, is expressed in endothelial cells, and its downregulation markedly suppresses tumor angiogenesis in a xenograft cancer model. Given that endothelial S100A4 can be a molecular target for inhibiting tumor angiogenesis, we addressed here whether synthetic peptide capable of blocking S100A4-effector protein interaction could be a novel antiangiogenic agent. To examine this hypothesis, we focused on the S100A4-binding domain of methionine aminopep...

  17. Functional Interaction of the Ankylosing Spondylitis-associated Endoplasmic Reticulum Aminopeptidase 1 Polymorphism and HLA-B27 in Vivo*

    OpenAIRE

    García-Medel, Noel; Sanz-Bravo, Alejandro; Nguyen, Dung; Galocha, Begoña; Gómez-Molina, Patricia; Martín-Esteban, Adrián; Alvarez-Navarro, Carlos; de Castro, José A. López

    2012-01-01

    The association of ERAP1 with ankylosing spondylitis (AS)1 among HLA-B27-positive individuals suggests that ERAP1 polymorphism may affect pathogenesis by altering peptide-dependent features of the HLA-B27 molecule. Comparisons of HLA-B*27:04-bound peptidomes from cells expressing different natural variants of ERAP1 revealed significant differences in the size, length, and amount of many ligands, as well as in HLA-B27 stability. Peptide analyses suggested that the mechanism of ERAP1/HLA-B27 in...

  18. SwissProt search result: AK066996 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066996 J013089H24 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 1e-101 ...

  19. SwissProt search result: AK066773 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066773 J013081C24 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 7e-14 ...

  20. SwissProt search result: AK109252 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK109252 002-159-F03 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Mic ... rosomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 1e-100 ...

  1. SwissProt search result: AK120068 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK120068 J013002N11 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 1e-106 ...

  2. SwissProt search result: AK064900 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK064900 J013000L14 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 4e-14 ...

  3. SwissProt search result: AK068165 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK068165 J013134N07 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 1e-105 ...

  4. SwissProt search result: AK073744 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK073744 J033068J12 (P97449) Aminopeptidase N (EC 3.4.11.2) (mAPN) (Alanyl aminopeptidase) (Micr ... osomal aminopeptidase) (Aminopeptidase M) (CD13 ) (Membrane protein p161) AMPN_MOUSE 3e-11 ...

  5. Probe data: 438 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  6. Proteolyse in Synechocystis sp. PCC 6803 : Funktion der Methionin-Aminopeptidase 2 und FtsH2-Protease für die Photosystem II-Stressresistenz

    OpenAIRE

    Drath, Miriam

    2008-01-01

    Methionin-Aminopeptidasen sind essentielle und haben physiologisch wichtige Bedeutung in der post- und co-translationellen regulation von Proteinen in Pro- und Eukaryonten. Zu Beginn dieser Dissertation war bekannt, dass die Methionin-Aminopeptidasen (MetAP) 1-3 in Synechocystis sp. PCC 6803 funktionale Aminopeptidasen sind, allerdings waren die physiologischen Funktionen unbekannt. Die Analyse der MetAP2-defizienten Mutante in Synechocystis sp. PCC 6803 stellte ein Ziel dieser Arbeit dar un...

  7. Peptide handling by HLA-B27 subtypes influences their biological behavior, association with ankylosing spondylitis and susceptibility to endoplasmic reticulum aminopeptidase 1 (ERAP1).

    Science.gov (United States)

    García-Medel, Noel; Sanz-Bravo, Alejandro; Alvarez-Navarro, Carlos; Gómez-Molina, Patricia; Barnea, Eilon; Marcilla, Miguel; Admon, Arie; de Castro, José A López

    2014-12-01

    HLA-B27 is strongly associated with ankylosing spondylitis (AS). We analyzed the relationship between structure, peptide specificity, folding, and stability of the seven major HLA-B27 subtypes to determine the role of their constitutive peptidomes in the pathogenicity of this molecule. Identification of large numbers of ligands allowed us to define the differences among subtype-bound peptidomes and to elucidate the peptide features associated with AS and molecular stability. The peptides identified only in AS-associated or high thermostability subtypes with identical A and B pockets were longer and had bulkier and more diverse C-terminal residues than those found only among non-AS-associated/lower-thermostability subtypes. Peptides sequenced from all AS-associated subtypes and not from non-AS-associated ones, thus strictly correlating with disease, were very rare. Residue 116 was critical in determining peptide binding, thermodynamic properties, and folding, thus emerging as a key feature that unified HLA-B27 biology. HLA-B27 ligands were better suited to TAP transport than their N-terminal precursors, and AS-associated subtype ligands were better than those from non-AS-associated subtypes, suggesting a particular capacity of AS-associated subtypes to bind epitopes directly produced in the cytosol. Peptides identified only from AS-associated/high-thermostability subtypes showed a higher frequency of ERAP1-resistant N-terminal residues than ligands found only in non-AS-associated/low-thermostability subtypes, reflecting a more pronounced effect of ERAP1 on the former group. Our results reveal the basis for the relationship between peptide specificity and other features of HLA-B27, provide a unified view of HLA-B27 biology and pathogenicity, and suggest a larger influence of ERAP1 polymorphism on AS-associated than non-AS-associated subtypes. PMID:25187574

  8. Peptide Handling by HLA-B27 Subtypes Influences Their Biological Behavior, Association with Ankylosing Spondylitis and Susceptibility to Endoplasmic Reticulum Aminopeptidase 1 (ERAP1)*

    OpenAIRE

    García-Medel, Noel; Sanz-Bravo, Alejandro; Alvarez-Navarro, Carlos; Gómez-Molina, Patricia; Barnea, Eilon; Marcilla, Miguel; Admon, Arie; de Castro, José A. López

    2014-01-01

    HLA-B27 is strongly associated with ankylosing spondylitis (AS). We analyzed the relationship between structure, peptide specificity, folding, and stability of the seven major HLA-B27 subtypes to determine the role of their constitutive peptidomes in the pathogenicity of this molecule. Identification of large numbers of ligands allowed us to define the differences among subtype-bound peptidomes and to elucidate the peptide features associated with AS and molecular stability. The peptides iden...

  9. Isolierung und Charakterisierung der ER-residenten Aminopeptidase ERMP1 und Untersuchung ihrer Funktion in der Prozessierung MHC I restringierter CTL Epitope

    OpenAIRE

    Akkad, Nadja

    2011-01-01

    Die effiziente Generierung von Peptid-Epitopen aus zelleigenen oder viralen Proteinen für die Präsentation auf „Major Histocompatibility Complex I“ (MHC I) Molekülen ist essentiell für die Aktivierung des adaptiven Immunsystems und die Effektorfunktion der CD8+ zytotoxischen T-Zellen (CTLs). CTLs erkennen diese Peptide in Kontext mit MHC I Molekülen über ihren spezifischen T-Zellrezeptor (TCR). Die Generierung dieser Epitope ist das Resultat eines komplexen proteolytischen Prozesses, der im Z...

  10. Atg21 is a phosphoinositide binding protein required for efficient lipidation and localization of Atg8 during uptake of aminopeptidase I by selective autophagy

    NARCIS (Netherlands)

    Strømhaug, Per E; Reggiori, Fulvio; Guan, Ju; Wang, Chao-Wen; Klionsky, Daniel J; Reggiori, Fulvio

    2004-01-01

    Delivery of proteins and organelles to the vacuole by autophagy and the cytoplasm to vacuole targeting (Cvt) pathway involves novel rearrangements of membrane resulting in the formation of vesicles that fuse with the vacuole. The mechanism of vesicle formation and the origin of the membrane are comp

  11. Synthese et evaluation biologique de derives de l’aminobenzosuberone, inhibiteurs puissants et selectifs de l’aminopeptidase N ou CD13

    OpenAIRE

    Alavi, Sarah

    2013-01-01

    Le mode d’action des traitements médicaux fait généralement intervenir des interactions entre une (des) molécule(s) et une (des) cible(s) protéique(s) de l’organisme. Au sein de notre équipe, le choix s’est porté vers l’APN, protéine connue depuis les années 2000, pour être impliquée dans les processus d’angiogenèse i.e. la formation de nouveaux vaisseaux sanguins à partir de vaisseaux préexistants, et de migration cellulaire. Compte tenu de la pertinence thérapeutique des fonctions de l’APN ...

  12. High Aminopeptidase N/CD13 Levels Characterize Human Amniotic Mesenchymal Stem Cells and Drive Their Increased Adipogenic Potential in Obese Women

    OpenAIRE

    Iaffaldano, Laura; Nardelli, Carmela; Raia, Maddalena; Mariotti, Elisabetta; Ferrigno, Maddalena; Quaglia, Filomena; Labruna, Giuseppe; Capobianco, Valentina; Capone, Angela; Maruotti, Giuseppe Maria; Pastore, Lucio; Di Noto, Rosa; Martinelli, Pasquale; Sacchetti, Lucia; Del Vecchio, Luigi

    2013-01-01

    Maternal obesity is associated to increased fetal risk of obesity and other metabolic diseases. Human amniotic mesenchymal stem cells (hA-MSCs) have not been characterized in obese women. The aim of this study was to isolate and compare hA-MSC immunophenotypes from obese (Ob-) and normal weight control (Co-) women, to identify alterations possibly predisposing the fetus to obesity. We enrolled 16 Ob- and 7 Co-women at delivery (mean/SEM prepregnancy body mass index: 40.3/1.8 and 22.4/1.0 kg/m...

  13. Investigations and design of pyridine-2-carboxylic acid thiazol-2-ylamide analogs as methionine aminopeptidase inhibitors using 3D-QSAR and molecular docking

    DEFF Research Database (Denmark)

    Hauser, Alexander Sebastian

    2014-01-01

    developed using 30 training set molecules. The optimum CoMFA and CoMSIA models obtained for the training set were statistically significant with cross-validated correlation coefficients (q 2) of 0.799 and 0.704 and conventional correlation coefficients (r 2) of 0.989 and 0.954, respectively. These...... inhibitors were docked into MetAP active site. The CoMFA and CoMSIA field contour maps correlate well with the structural characteristics of the binding pocket of MetAP active site. Using the knowledge of structure–activity relationship and receptor–ligand interactions from 3D-QSAR model and the docked...

  14. Syntheses,Characterization and Equilibrium between Mono—and Aqua—bridged Dicobalt(Ⅱ)Complexes.A Structural Model for Methionine Aminopeptidase

    Institute of Scientific and Technical Information of China (English)

    YE,Bao-Hui; CHEN,Xiao-Ming

    2003-01-01

    A monomeric complex[Co(Im)2(O2CMe)2](1) and a novel aquabridged dimeric complex [Co2(μ-H2O)(μ-O2CMe)2(Im)4-(O2CMe)2](2) (Im=imidazole) have been synthesized and characterized.Complexes 1 and 2 coexisted in solution.Pure forms of either complex can be obtained from the same solution by controlling the crystallization conditions.All two complexes possess a carboxylate-Im-cobalt(Ⅱ) triad system analogous to the carboxylate-histidine-metal triad systems that have been found in many zinc enzymes and coblat(Ⅱ)-substituted enzymes.In2,two Co2+ ions are conected by a wate nolecule in a bridging fasion with Co……Co[0.3687(1)nm],Co-OH2[0.2159(3)nm],and Co-OH2-Co[0.3687(1)nm],Co-OH2[0.2159(3)nm],and Co-OH2-Co[117.2(3)°],in which the water molecule is further stabilized by two intramolecular hydrogen bonds with the oxygens of the terminal monodentate acetate groups with the distance of 0……0[0.2609(7)nm].The terminal monodentate acetate groups display quite abnormal geometry due to the strong "pulling effect"on the carboxylates by intermolecular and intramolecular hydrogen bonds.Complex 2 showed weak antiferromagnetic coupling at low temperature with g=2.22 and J=-1.60 cm-1.

  15. Molecular cloning of a preprohormone from sea anemones containing numerous copies of a metamorphosis-inducing neuropeptide: a likely role for dipeptidyl aminopeptidase in neuropeptide precursor processing

    DEFF Research Database (Denmark)

    Leviev, I; Grimmelikhuijzen, C J

    1995-01-01

    Neuropeptides are an important group of hormones mediating or modulating neuronal communication. Neuropeptides are especially abundant in evolutionarily "old" nervous systems, such as those of cnidarians, the lowest animal group having a nervous system. Cnidarians often have a life cycle including...... a polyp, a medusa, and a planula larva stage. Recently, a neuropeptide, isolated from sea anemones that induces metamorphosis in a hydroid planula larva to become a hydropolyp [Leitz, T., Morand, K. & Mann, M. (1994) Dev. Biol. 163, 440-446]. Here, we have cloned...

  16. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  17. Proteases of neutrophilic granulocytes

    OpenAIRE

    Wiesława Roszkowska-Jakimiec; Anna Worowska; Marek Gacko; Tomasz Maksimowicz

    2002-01-01

    The literature referring to proteolytic enzymes of neutrophilic granulocytes was surveyed. Biosynthesis, subcellular distribution, division according to the catalytic site structure, inhibitors and methods used to determine the activity of these enzymes were discussed. The survey included metaloproteases (granulocytic collagenase, gelatinase B), serine proteases (granulocytic elastase, cathepsin G, protease 3), membraneous proteases (aminopeptidase N, aminopeptidase P, neprilisine), cysteine ...

  18. SwissProt search result: AK068165 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK068165 J013134N07 (P15144) Aminopeptidase N (EC 3.4.11.2) (hAPN) (Alanyl aminopeptidase) (Micr ... e M) (gp150) (Myeloid plasma membrane glycoprotein CD13 ) AMPN_HUMAN 1e-113 ...

  19. SwissProt search result: AK109252 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK109252 002-159-F03 (P15144) Aminopeptidase N (EC 3.4.11.2) (hAPN) (Alanyl aminopeptidase) (Mic ... e M) (gp150) (Myeloid plasma membrane glycoprotein CD13 ) AMPN_HUMAN 1e-106 ...

  20. SwissProt search result: AK120068 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK120068 J013002N11 (P15144) Aminopeptidase N (EC 3.4.11.2) (hAPN) (Alanyl aminopeptidase) (Micr ... e M) (gp150) (Myeloid plasma membrane glycoprotein CD13 ) AMPN_HUMAN 1e-111 ...

  1. SwissProt search result: AK066996 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066996 J013089H24 (P15144) Aminopeptidase N (EC 3.4.11.2) (hAPN) (Alanyl aminopeptidase) (Micr ... e M) (gp150) (Myeloid plasma membrane glycoprotein CD13 ) AMPN_HUMAN 1e-107 ...

  2. GenBank blastx search result: AK062475 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK062475 001-103-F06 CR456922.1 Homo sapiens full open reading frame cDNA clone RZP...Do834D1221D for gene XPNPEP1, X-prolyl aminopeptidase (aminopeptidase P) 1, soluble; complete cds, incl. stopcodon.|PRI PRI 6e-30 +2 ...

  3. Long-term changes in microbial and biochemical parameters in the Central Indian Basin

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Nath, B.N.; Sharma, R.; LokaBharathi, P.A.; Dalal, S.G.

    an artificial sediment disturbance was created by a hydraulic benthic disturber. Besides the above- mentioned parameters, extracellular enzymes, alkaline phosphatase, aminopeptidase and lipase were also monitored at these 9 locations. Postdisturbance (PoD1...

  4. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  5. Proteases of neutrophilic granulocytes

    Directory of Open Access Journals (Sweden)

    Wiesława Roszkowska-Jakimiec

    2002-06-01

    Full Text Available The literature referring to proteolytic enzymes of neutrophilic granulocytes was surveyed. Biosynthesis, subcellular distribution, division according to the catalytic site structure, inhibitors and methods used to determine the activity of these enzymes were discussed. The survey included metaloproteases (granulocytic collagenase, gelatinase B, serine proteases (granulocytic elastase, cathepsin G, protease 3, membraneous proteases (aminopeptidase N, aminopeptidase P, neprilisine, cysteine and aspartic cathepsins. The role of these proteases in the pathology and diagnostics of certain diseases was considered.

  6. GenBank blastx search result: AK062475 [KOME

    Lifescience Database Archive (English)

    Full Text Available kage group 14 Contains the 5' part of a novel gene similar to vertebrate XPNPEP2 (membrane bound X-prolyl am...inopeptidase (aminopeptidase P) 2) and three CpG islands, complete sequence.|VRT VRT 7e-25 +2 ... ...AK062475 001-103-F06 AL929104.3 Zebrafish DNA sequence from clone DKEY-61O11 in lin

  7. New rapid identification test for Clostridium difficile.

    OpenAIRE

    Aspinall, S T; Dealler, S. F.

    1992-01-01

    AIMS: A set of five tests were developed and tested for their ability to confirm the identity of C difficile colonies within 30 minutes. METHODS: The relevant substrates were incorporated into four filter paper squares attached to a plastic carrier (Diffstrip), five enzymes/products (prolyl aminopeptidase, galactosidase, leucine aminopeptidase, acid phosphatase and indole). The strips were inoculated, incubated for 20 minutes, and reagents added. RESULTS: 96.4% (212 of 220) strains of C diffi...

  8. Yeast Interacting Proteins Database: YHR113W, YOL082W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available cargo proteins aminopeptidase I (Lap4p) and alpha-mannosidase (Ams1p) to the phagophore assembly site for packaging...vt) pathway; delivers cargo proteins aminopeptidase I (Lap4p) and alpha-mannosidase (Ams1p) to the phagophore assembly site for packa...ging into Cvt vesicles Rows with this prey as prey (6) Rows with this prey as bait

  9. The Specificity of Trimming of MHC Class I-Presented Peptides in the Endoplasmic Reticulum1

    OpenAIRE

    Hearn, Arron; Ian A York; Rock, Kenneth L.

    2009-01-01

    Aminopeptidases in the endoplasmic reticulum (ER) can cleave antigenic peptides and in so doing either create or destroy MHC class I-presented epitopes. However the specificity of this trimming process overall and of the major ER aminopeptidase ERAP1 in particular is not well understood. This issue is important because peptide trimming influences the magnitude and specificity of CD8 T cell responses. By systematically varying the N-terminal flanking sequences of peptides in a cell free bioche...

  10. The Internal Sequence of the Peptide-Substrate Determines Its N-Terminus Trimming by ERAP1

    OpenAIRE

    Evnouchidou, Irini; Momburg, Frank; Papakyriakou, Athanasios; Chroni, Angeliki; Leondiadis, Leondios; Chang, Shih-Chung; Stratikos, Efstratios; Goldberg, Alfred L.

    2008-01-01

    Background: Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims N-terminally extended antigenic peptide precursors down to mature antigenic peptides for presentation by major histocompatibility complex (MHC) class I molecules. ERAP1 has unique properties for an aminopeptidase being able to trim peptides in vitro based on their length and the nature of their C-termini. Methodology/Principal Findings: In an effort to better understand the molecular mechanism that ERAP1 uses to trim peptides, w...

  11. GenBank blastx search result: AK062475 [KOME

    Lifescience Database Archive (English)

    Full Text Available the CXorf9 gene for chromosome X open reading frame 9, complete sequence.|PRI PRI 1e-28 +2 ... ...s the XPNPEP2 gene for X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound and ...AK062475 001-103-F06 AL023653.1 Human DNA sequence from clone RP4-753P9 on chromosome Xq25-26.1 Contain

  12. Rôle des facteurs de transcription E2F2 et ID3 dans la progression tumorale et intérêt du ciblage de l'aminopeptidase N/CD13 dans le traitement du cancer colique humain

    OpenAIRE

    Voegelin, Manon

    2012-01-01

    Une analyse génomique (Comparative Genomic Hybridization) a été réalisée sur une cohorte d'adénomes et de tumeurs coliques et a mis en évidence, parmi d'autres altérations, la délétion de la région 1p36.12 dans 23% des adénomes et 47% des carcinomes. Parmi les 15 gènes ayant une fonction connue retrouvés dans cette zone, le gène codant pour le facteur de transcription E2F2 a été retenu en raison de son implication dans des processus cellulaires clés. Une analyse de Kaplan- Meier a montré que ...

  13. Optimization of aminopeptidase-producing condition for nitrite-resistant Staphylococcus saprophyticus RG-2 isolated from Rugao ham%如皋火腿中耐亚硝酸盐腐生葡萄球菌RG-2产氨肽酶条件的优化

    Institute of Scientific and Technical Information of China (English)

    汪淼; 王敏; 张培培; 吴雪燕; 葛庆丰; 吴满刚; 于海

    2013-01-01

    氨肽酶能从多肽链的N端顺序水解并释放氨基酸,可广泛用于肉制品加工以增加肉品游离氨基酸,提高发酵肉制品品质.实验利用从如皋火腿中分离得到的l株产氨肽酶腐生葡萄球RG-2,通过单因素试验和响应曲面设计研究了pH、温度、NaCl浓度等因素对菌株RG-2产氨肽酶能力的影响.实验结果表明,最佳产氨肽酶条件为pH6.8、温度41℃、NaCl浓度1%,此条件下氨肽酶酶活达到23.85 U/mg.

  14. Enzymatic digestibility of peptides cross-linked by ionizing radiation

    International Nuclear Information System (INIS)

    Digestibility by proteolytic enzymes of peptides cross-linked by ionizing radiation was investigated. Small peptides of alanine and phenylalanine were chosen as model compounds and aminopeptidases and carboxypeptidases were used as proteolytic enzymes. Peptides exposed to γ-radiation in aqueous solution were analysed by high-performance liquid chromatography before and after hydrolysis by aminopeptidase M, leucine aminopeptidase carboxypeptidase A and carboxypeptidase Y. The results obtained clearly demonstrate the different actions of these enzymes on cross-linked aliphatic and aromatic peptides. Peptide bonds of cross-linked dipeptides of alanine were completely resistant to enzymatic hydrolysis whereas the enzymes, except for carboxypeptidase Y, cleaved all peptide bonds of cross-linked peptides of phenylalanine. The actions of the enzymes on these particular compounds are discussed in detail. (author)

  15. The efficiency of human cytomegalovirus pp65(495-503) CD8+ T cell epitope generation is determined by the balanced activities of cytosolic and endoplasmic reticulum-resident peptidases.

    Science.gov (United States)

    Urban, Sabrina; Textoris-Taube, Kathrin; Reimann, Barbara; Janek, Katharina; Dannenberg, Tanja; Ebstein, Frédéric; Seifert, Christin; Zhao, Fang; Kessler, Jan H; Halenius, Anne; Henklein, Petra; Paschke, Julia; Cadel, Sandrine; Bernhard, Helga; Ossendorp, Ferry; Foulon, Thierry; Schadendorf, Dirk; Paschen, Annette; Seifert, Ulrike

    2012-07-15

    Control of human CMV (HCMV) infection depends on the cytotoxic activity of CD8(+) CTLs. The HCMV phosphoprotein (pp)65 is a major CTL target Ag and pp65(495-503) is an immunodominant CTL epitope in infected HLA-A*0201 individuals. As immunodominance is strongly determined by the surface abundance of the specific epitope, we asked for the components of the cellular Ag processing machinery determining the efficacy of pp65(495-503) generation, in particular, for the proteasome, cytosolic peptidases, and endoplasmic reticulum (ER)-resident peptidases. In vitro Ag processing experiments revealed that standard proteasomes and immunoproteasomes generate the minimal 9-mer peptide epitope as well as N-terminal elongated epitope precursors of different lengths. These peptides are largely degraded by the cytosolic peptidases leucine aminopeptidase and tripeptidyl peptidase II, as evidenced by increased pp65(495-503) epitope presentation after leucine aminopeptidase and tripeptidyl peptidase II knockdown. Additionally, with prolyl oligopeptidase and aminopeptidase B we identified two new Ag processing machinery components, which by destroying the pp65(495-503) epitope limit the availability of the specific peptide pool. In contrast to cytosolic peptidases, silencing of ER aminopeptidases 1 and 2 strongly impaired pp65(495-503)-specific T cell activation, indicating the importance of ER aminopeptidases in pp65(495-503) generation. Thus, cytosolic peptidases primarily interfere with the generation of the pp65(495-503) epitope, whereas ER-resident aminopeptidases enhance such generation. As a consequence, our experiments reveal that the combination of cytosolic and ER-resident peptidase activities strongly shape the pool of specific antigenic peptides and thus modulate MHC class I epitope presentation efficiency. PMID:22706083

  16. Dimeric assembly of enterocyte brush border enzymes

    DEFF Research Database (Denmark)

    Danielsen, E M

    1994-01-01

    appearance of the liposome-reconstituted enzyme [Norén et al. (1986) J. Biol. Chem. 261, 12306-12309], showing only the inner, membrane-anchored domains of the monomers to be in close contact with one another while the outer domains are far apart. In contrast to the other brush border enzymes studied......The noncovalent, dimeric assembly of small intestinal brush border enzymes was studied by sedimentation analysis in density gradients of extracts of pulse-labeled pig jejunal mucosal explants. Like aminopeptidase N (EC 3.4.11.2), sucrase-isomaltase (EC 3.2.1.48-10), aminopeptidase A (EC 3...

  17. Regulation of Proteolytic Enzyme Activity in Lactococcus lactis

    OpenAIRE

    Meijer, W.; Marugg, J D; Hugenholtz, J

    1996-01-01

    Two different Lactococcus lactis host strains, L. lactis subsp. lactis MG1363 and L. lactis subsp. cremoris SK1128, both containing plasmid pNZ521, which encodes the extracellular serine proteinase (PrtP) from strain SK110, were used to study the medium and growth-rate-dependent activity of three different enzymes involved in the proteolytic system of lactococci. The activity levels of PrtP and both the intracellular aminopeptidase PepN and the X-prolyl-dipeptidyl aminopeptidase PepXP were st...

  18. Inhibition of APN/CD13 leads to suppressed progressive potential in ovarian carcinoma cells

    OpenAIRE

    Mizutani Shigehiko; Nawa Akihiro; Ino Kazuhiko; Shibata Kiyosumi; Kajiyama Hiroaki; Terauchi Mikio; Kikkawa Fumitaka

    2007-01-01

    Abstract Background Aminopeptidase N (APN/CD13), a 150-kDa metalloprotease, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression of several human malignancies. In the current study, we investigated the role of APN/CD13 in ovarian carcinoma (OVCA) progression. Methods We first examined the expression of APN/CD13 at the protein level in a variety of OVCA cell lines and tissues. We su...

  19. Dicty_cDB: Contig-U11646-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 05339 |pid:none) Trypanosoma brucei methionine amin... 55 5e-06 EU020498_1( EU020498 |pid:none) Cyprido...psis thaliana mRNA for hypo... 48 0.001 C72712( C72712 )probable methionine amin....0 AE017197_777( AE017197 |pid:none) Rickettsia typhi str. Wilmington... 36 3.0 CP000614_644( CP000614 |pid:...e: Full=Methionine aminopeptidase; Short... 92 6e-17 AL117205_..... 84 1e-14 (Q5JGD1) RecName: Full=Methionine aminopeptidase; Short... 84 1e-14 A

  20. Translational control of an intestinal microvillar enzyme

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M; Sjöström, H;

    1986-01-01

    The rates of biosynthesis of adult and foetal pig small-intestinal aminopeptidase N (EC 3.4.11.2) were compared to determine at which level the expression of the microvillar enzyme is developmentally controlled. In organ-cultured explants, the rate of biosynthesis of foetal aminopeptidase N is only...... about 3% of the adult rate. The small amount synthesized occurs in a high-mannose-glycosylated, membrane-bound, form that is processed to the mature, complex-glycosylated, form at a markedly slower rate than that of the adult enzyme. Extracts of total RNA from adult and foetal intestine contained...

  1. Caveolae/lipid rafts in fibroblast-like synoviocytes: ectopeptidase-rich membrane microdomains

    DEFF Research Database (Denmark)

    Riemann, D; Hansen, Gert Helge; Niels-Christiansen, L; Thorsen, Evy; Immerdal, Lissi; Santos, A N; Kehlen, A; Langner, J; Danielsen, E M

    from about 60 to 160 nm. Cholesterol depletion of synoviocytes by methyl-beta-cyclodextrin disrupted >90% of the caveolae and reduced the raft localization of aminopeptidase N/CD13 without affecting Ala-p-nitroanilide-cleaving activity of confluent cell cultures. In co-culture experiments with T...

  2. Aminopeptidasy vajíček raka pruhovaného Orconectes limosus (Raf)

    Czech Academy of Sciences Publication Activity Database

    Bečková, P.; Kozák, P.; Barthová, J.; Barth, Tomislav

    Vodňany : VURH, 2004, s. 51-52. [Česká ichtyologická konference /7./. Vodňany (CZ), 06.05.2004-07.05.2004] Institutional research plan: CEZ:AV0Z4055905 Keywords : aminopeptidases * Orconectes limosus Subject RIV: CE - Biochemistry

  3. Yeast Interacting Proteins Database: YKL103C, YOL082W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available go proteins aminopeptidase I (Lap4p) and alpha-mannosidase (Ams1p) to the phagophore assembly site for packaging...-mannosidase (Ams1p) to the phagophore assembly site for packaging into Cvt vesicles Rows with this prey as

  4. Proteolytic activities in yeast after UV irradiation. Pt. 1

    International Nuclear Information System (INIS)

    Specific proteolytic activities are known to be induced in Escherichia coli following irradiation. Consequently it seemed of interest to investigate whether variations in proteinase activities occur in yeast. Among the five most well known proteinases of Saccharomyces cerevisiae, we have found that proteinase B activity increases up to three times in wild-type RAD+ yeast cells after a dose of 50 Jm-2 of 254 nm ultraviolet light (40% survival). Carboxypeptidase Y and aminopeptidase I (leucin aminopeptidase) activities were only moderately increased. Proteinase A activity was only slightly enhanced, while aminopeptidase II (lysin aminopeptidase) was unaffected in both RAD+ strains studied. The observed post UV-increase in proteinase B activity was inhibited by cycloheximide and was dose dependent. Increases in proteinase B levels were independent of the activation method used to destroy the proteinase B-inhibitor complex present in the crude yeast extracts. A standard method for comparison of the postirradiation levels among different proteinases, strains and methods of activation is presented. (orig.)

  5. Arabidopsis CDS blastp result: AK066478 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK066478 J013069C16 At4g20850.1 subtilase family protein contains similarity to Tripeptidyl-pept ... idase II (EC 3.4.14.10) (TPP -II) (Tripeptidyl aminopeptidase) (Swiss-Prot:P2914 ...

  6. Arabidopsis CDS blastp result: AK067099 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK067099 J013096M07 At4g20850.1 subtilase family protein contains similarity to Tripeptidyl-pept ... idase II (EC 3.4.14.10) (TPP -II) (Tripeptidyl aminopeptidase) (Swiss-Prot:P2914 ...

  7. Structure of microvillar enzymes in different phases of their life cycles

    DEFF Research Database (Denmark)

    Sjöström, H; Norén, Ove; Danielsen, E M;

    1983-01-01

    Structural changes have been studied during the life cycles of three glycosidases: sucrase-isomaltase (EC 3.2.48-10), lactase-phlorizin hydrolase (EC 3.2.1.23-62), maltase-glucoamylase (EC 3.2.1.20); and three peptidases: aminopeptidase A (EC 3.4.11.7), aminopeptidase N (EC 3.4.11.2) and dipeptid...... aminopeptidase N are cleaved by pancreatic proteases to smaller peptides, and sucrase-isomaltase may lose its sucrase polypeptide, while both enzymes remain bound to the membrane....... peptidase IV (EC 3.4.14.5). The final forms of the enzymes can be divided into at least two groups: the sucrase-isomaltase type, characterized as dimers, which are asymmetric in their hydrophilic parts, have two types of active site and anchor only on one subunit; and the aminopeptidase N type......, characterized as dimers, which are symmetric in their hydrophilic part, have only one type of active site and anchor on both subunits. These enzymes are likely to be synthesized on rough endoplasmic reticulum and simultaneously glycosylated into endoglycosidase H-sensitive forms. They are later reglycosylated...

  8. Evidence for biosynthesis of lactase-phlorizin hydrolase as a single-chain high-molecular weight precursor

    DEFF Research Database (Denmark)

    Skovbjerg, H; Danielsen, E M; Noren, Ove;

    1984-01-01

    Precursor forms of lactase-phlorizin hydrolase, sucrase-isomaltase and aminopeptidase N were studied by pulse-labelling of organ-cultured human intestinal biopsies. After labelling the biopsies were fractionated by the Ca2+-precipitation method and the enzymes isolated by immunoprecipitation. The...

  9. Adaptation of intestinal hydrolases to starvation in rats: effect of thyroid function

    DEFF Research Database (Denmark)

    Galluser, M; Belkhou, R; Freund, J N;

    1991-01-01

    membranes was increased by starvation, and thyroidectomy caused a further elevation of the enzyme activity. Simultaneously, lactase mRNA content rose only slightly compared to the enzyme activity. Aminopeptidase activity and mRNA content decreased during starvation and thyroidectomy did not prevent this...

  10. A between-river comparison of extracellular-enzyme activity.

    Science.gov (United States)

    Chappell, K R; Goulder, R

    1995-01-01

    River-water extracellular-enzyme activity in the lowland Rivers Ouse and Derwent, northeast England, had much in common. In both rivers, the mean enzyme activities over 15 months differed in the following order: leucine aminopeptidase > phosphatase > β-D-glucosidase > β-D-galactosi-idase and β-D-xylosidase. None of the five enzymes assayed had significant between-river difference in activity, and there was significant between-river correlation of β-D-glucosidase, phosphatase, and leucine-aminopeptidase activity. The common enzyme regimes were probably more due to between-river similarity of planktonic microbiota than to similar physico-chemical conditions. The potential for glucose uptake by bacterioplankton closely followed β-D-glucosidase activity in magnitude and periodicity. The potential for leucine uptake, however, was much less than leucine-aminopeptidase activity; hence rate of leucine release probably did not limit leucine uptake. There was an appreciable and highly variable proportion of free (river water; ranges were β-D-glucosidase 10-30%, phosphatase 53% to apparently 104%, and leucine aminopeptidase 22-98%. These free enzymes did not necessarily originate from planktonic microbiota and may explain the fairly loose coupling between whole-water enzyme activity and microbial variables. Marked downstream increase in enzyme activity, along about 104 km of the River Derwent, was found on only one of three sampling days; hence the single site used for regular sampling was reasonably representative of most of the river. PMID:24186635

  11. NCBI nr-aa BLAST: CBRC-RMAC-09-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RMAC-09-0027 ref|XP_797403.2| PREDICTED: similar to Aminopeptidase N (rAPN) (Alanyl aminope ... inopeptidase M) (APM) (Kidney Zn peptidase) (KZP) (CD13 ... antigen) [Strongylocentrotus purpuratus] ref|XP_00 ... inopeptidase M) (APM) (Kidney Zn peptidase) (KZP) (CD13 ... antigen) [Strongylocentrotus purpuratus] XP_797403 ...

  12. Digestive enzymes in the gut and salivary gland of the larvae of Chilo auricilius Ddgn.

    Science.gov (United States)

    Somadder, K; Shrivastava, M

    1980-02-15

    Amylase, alpha- and beta-glucosidase, alpha- and beta-galactosidase, beta-fructosidase, trypsin, aminotripeptidase, leucine-aminopeptidase, prolinase, prolidase glycyl-L-leucine dipeptidase and glygylglycine dipeptidase are present in the 3rd instar larvae of Chilo auricilius. PMID:6989621

  13. GenBank blastx search result: AK058513 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK058513 001-016-G10 CT010237.1 Mus musculus full open reading frame cDNA clone RZP...Do836C0251D for gene Lap3, Leucine aminopeptidase 3; complete cds, incl. stopcodon.|ROD ROD 1e-51 +1 ...

  14. GenBank blastx search result: AK058513 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK058513 001-016-G10 CT010301.1 Mus musculus full open reading frame cDNA clone RZP...Do836B0352D for gene Lap3, Leucine aminopeptidase 3; complete cds, incl. stopcodon.|ROD ROD 1e-51 +1 ...

  15. GenBank blastx search result: AK058513 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK058513 001-016-G10 CR457128.1 Homo sapiens full open reading frame cDNA clone RZP...Do834G0914D for gene LAP3, leucine aminopeptidase 3; complete cds, incl. stopcodon.|PRI PRI 5e-52 +1 ...

  16. Sequence Classification: 893876 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH TMB TMB Non-TMB TMB >gi|6325306|ref|NP_015374.1| Peripheral membrane protein required for delive...ry of aminopeptidase I (Lap4p) to the vacuole in the cytoplasm-to-vacuole targeting

  17. Microvillar membrane microdomains exist at physiological temperature. Role of galectin-4 as lipid raft stabilizer revealed by "superrafts"

    DEFF Research Database (Denmark)

    Braccia, Anita; Villani, Maristella; Immerdal, Lissi; Niels-Christiansen, Lise-Lotte; Nystrøm, Birthe T; Hansen, Gert H; Danielsen, E Michael

    2003-01-01

    transmembrane aminopeptidase N, whereas the peripheral lipid raft protein annexin 2 was essentially absent. In conclusion, in the microvillar membrane, galectin-4, functions as a core raft stabilizer/organizer for other, more loosely raft-associated proteins. The superraft analysis might be applicable to other...

  18. Extracellular enzyme activities in benthic cyanobacterial mats: comparison between nutrient-enriched and control sites in marshes of northern Belize

    Czech Academy of Sciences Publication Activity Database

    Sirová, D.; Vrba, Jaroslav; Rejmánková, E.

    2006-01-01

    Roč. 44, č. 1 (2006), s. 11-20. ISSN 0948-3055 R&D Projects: GA AV ČR(CZ) IAA6017202 Grant ostatní: NSF(US) 0089211 Institutional research plan: CEZ:AV0Z60170517 Keywords : alkaline phosphatase * leucine-aminopeptidase * phosphorus Subject RIV: EE - Microbiology, Virology Impact factor: 2.209, year: 2006

  19. Biosynthesis of intestinal microvillar proteins. Role of the Golgi complex and microtubules

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M; Poulsen, S S

    1983-01-01

    The effect of monensin and colchicine on the biogenesis of aminopeptidase N (EC 3.4.11.2), aminopeptidase A (EC 3.4.11.7), dipeptidyl peptidase IV (EC 3.4.14.5), sucrase (EC 3.2.1.48)-isomaltase (EC 3.2.1.10) and maltase-glucoamylase (EC 3.2.1.20) was studied in organ-cultured pig small-intestina......The effect of monensin and colchicine on the biogenesis of aminopeptidase N (EC 3.4.11.2), aminopeptidase A (EC 3.4.11.7), dipeptidyl peptidase IV (EC 3.4.14.5), sucrase (EC 3.2.1.48)-isomaltase (EC 3.2.1.10) and maltase-glucoamylase (EC 3.2.1.20) was studied in organ-cultured pig small...... final destination. These findings suggest the involvement of the Golgi complex in the post-translational processing and transport of microvillar enzymes. The presence in the growth medium of colchicine (50 micrograms/ml) caused a significant inhibition of the appearance of newly synthesized enzymes in...... the microvillar membrane during a 3 h labelling period. Since synthesis and post-translational modification of the microvillar enzymes were largely unaffected by colchicine, the results obtained suggest that microtubules play a role in the final transport of the enzymes from the Golgi complex to the...

  20. UniProt search blastx result: AK287918 [KOME

    Lifescience Database Archive (English)

    Full Text Available dase A) (APA) (Differentiation antigen gp160) (CD249 antigen) - Homo sapiens (Human) 2.00E-16 ... ...AK287918 J065214O12 Q07075|AMPE_HUMAN Glutamyl aminopeptidase (EC 3.4.11.7) (EAP) (Aminopepti

  1. Prognostic significance of aberrantly silenced ANPEP expression in prostate cancer

    DEFF Research Database (Denmark)

    Sørensen, Karina Dalsgaard; Abildgaard, Mette Opstrup; Haldrup, Christa;

    2013-01-01

    Background:Novel biomarkers for prostate cancer (PC) are urgently needed. This study investigates the expression, epigenetic regulation, and prognostic potential of ANPEP in PC.Methods:Aminopeptidase N (APN; encoded by ANPEP) expression was analysed by immunohistochemistry using tissue microarrays...

  2. Vector analysis of ecoenzyme activities reveal constraints on coupled C, N and P dynamics

    Science.gov (United States)

    We developed a quantitative method for estimating resource allocation strategies of microbial communities based on the proportional activities of four, key extracellular enzymes, 1,4-ß-glucosidase (BG), leucine amino-peptidase (LAP), 1,4-ß-N-acetylglucosaminidase (NAG...

  3. Unigene BLAST: CBRC-HSAP-10-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-10-0001 gnl|UG|Hs#S16886872 Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly ... similar to Puromycin-sensitive aminopeptidase (EC ... 3.4.11.-) /gb=AK125832 /gi=34532075 /ug=Hs.617010 ...

  4. Fluorometric assay using naphthylamide substrates for assessing novel venom peptidase activities.

    Science.gov (United States)

    Gasparello-Clemente, Elaine; Silveira, Paulo Flávio

    2002-11-01

    In the present study we examined the feasibility of using the fluorometry of naphthylamine derivatives for revealing peptidase activities in venoms of the snakes Bothrops jararaca, Bothrops alternatus, Bothrops atrox, Bothrops moojeni, Bothrops insularis, Crotalus durissus terrificus and Bitis arietans, of the scorpions Tityus serrulatus and Tityus bahiensis, and of the spiders Phoneutria nigriventer and Loxosceles intermedia. Neutral aminopeptidase (APN) and prolyl-dipeptidyl aminopeptidase IV (DPP IV) activities were presented in all snake venoms, with the highest levels in B. alternatus. Although all examined peptidase activities showed relatively low levels in arthropod venoms, basic aminopeptidase (APB) activity from P. nigriventer venom was the exception. Compared to the other peptidase activities, relatively high levels of acid aminopeptidase (APA) activity were restricted to B. arietans venom. B. arietans also exhibited a prominent content of APB activity which was lower in other venoms. Relatively low prolyl endopeptidase and proline iminopeptidase activities were, respectively, detectable only in T. bahiensis and B. insularis. Pyroglutamate aminopeptidase activity was undetectable in all venoms. All examined peptidase activities were undetectable in T. serrulatus venom. In this study, the specificities of a diverse array of peptidase activities from representative venoms were demonstrated for the first time, with a description of their distribution which may contribute to guiding further investigations. The expressive difference between snake and arthropod venoms was indicated by APN and DPP IV activities while APA and APB activities distinguished the venom of B. arietans from those of Brazilian snakes. The data reflected the relatively uniform qualitative distribution of the peptidase activities investigated, together with their unequal quantitative distribution, indicating the evolutionary divergence in the processing of peptides in these different

  5. Screening of some Yemeni medicinal plants for inhibitory activity against peptidases.

    Science.gov (United States)

    Alasbahi, R; Melzig, M F

    2008-01-01

    Extracts of different polarities (dichloromethane, methanol, and aqueous extracts) from 5 Yemeni medicinal plants (Aspilia helianthoides, leaves; Ceropegia rupicola, whole plant; Kniphofia sumarae, whole plant; Pavetta longiflora, leaves; and Plectranthus cf barbatus, leaves) were screened for their inhibitory effects against angiotensin converting enzyme (ACE), neutral endopeptidase (NEP), and aminopeptidase N (APN) activities. Four extracts (methanol extracts of Ceropegia rupicola, Kniphofia sumarae, and Plectranthus cf barbatus, and the aqueous extract of Pavetta longiflora) were found able to inhibit the enzymatic activity of NEP. Significant reduction in the activity of NEP (p Ceropegia rupicola with IC50 of 111 microg/ml. Only the methanolic extract of Aspilia helianthoides was found to exhibit inhibitory effect against the ACE activity with IC50 = 133 microg/ml. None of the tested plant extracts was found active against the aminopeptidase N activity. PMID:18271311

  6. Tyrosine sulfation, a post-translational modification of microvillar enzymes in the small intestinal enterocyte

    DEFF Research Database (Denmark)

    Danielsen, E M

    1987-01-01

    membrane-bound components were all enriched in the microvillar fraction but either absent or barely detectable in intracellular or basolateral membranes. Immunopurification of sucrase-isomaltase, maltase-glucoamylase, aminopeptidase N and aminopeptidase A showed that these microvillar enzymes become...... sulfated. Most if not all the sulfate was bound to tyrosine residues rather than to the carbohydrate of the microvillar enzymes, showing that this type of modification can occur on plasma membrane proteins as well as on secretory proteins.......Protein sulfation in small intestinal epithelial cells was studied by labelling of organ cultured mucosal explants with [35S]-sulfate. Six bands in SDS-PAGE became selectively labelled; four, of 250, 200, 166 and 130 kd, were membrane-bound and two, of 75 and 60 kd, were soluble. The sulfated...

  7. Digestive response to restricted feeding in migratory yellow-rumped warblers.

    Science.gov (United States)

    Lee, Kelly A; Karasov, William H; Caviedes-Vidal, Enrique

    2002-01-01

    Smaller guts and slow initial mass gains at stopover sites have led to the idea that digestive physiology limits refueling rates in migrating birds. We tested the digestive-limitation hypothesis in yellow-rumped warblers using food restriction to simulate infrequent feeding during migration, which may cause a reduction in alimentary tract mass. Restricted birds had small intestine, pancreas, and liver masses 18%-22% lower than ad lib.-fed controls. Total activities of sucrase, maltase, aminopeptidase, and amylase were significantly lower in restricted birds, while those of trypsin and chymotrypsin were not. Only aminopeptidase mass-specific activity was significantly lower in restricted birds. Previously restricted birds were able to feed and digest at a high rate immediately following return to ad lib. feeding. Digestive efficiency did not differ between groups. These results suggest that before migration yellow-rumped warblers have some spare digestive capacity to compensate for declines in their digestive organ masses during migration. PMID:12177834

  8. Cholesterol depletion of enterocytes. Effect on the Golgi complex and apical membrane trafficking

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Niels-Christiansen, L L; Thorsen, Evy; Immerdal, Lissi; Danielsen, E M

    2000-01-01

    %. Morphologically, the Golgi complex/trans-Golgi network was partially transformed into numerous 100-200 nm vesicles. By immunogold electron microscopy, aminopeptidase N was localized in these Golgi-derived vesicles as well as at the basolateral cell surface, indicating a partial missorting. Biochemically, the...... rates of the Golgi-associated complex glycosylation and association with rafts of newly synthesized aminopeptidase N were reduced, and less of the enzyme had reached the brush border membrane after 2 h of labeling. In contrast, the basolateral Na(+)/K(+)-ATPase was neither missorted nor raft......-associated. Our results implicate the Golgi complex/trans-Golgi network in raft formation and suggest a close relationship between this event and apical membrane trafficking....

  9. Dicty_cDB: VHP215 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available gy vs Protein Score E Sequences producing significant alignments: (bits) Value AY631393_1( AY631393 |pid:none) Dictyostelium discoide...G19... 132 4e-29 AF350242_1( AF350242 |pid:none) Pichia angusta aminopeptidase gen...e... 130 9e-29 ( P32454 ) RecName: Full=Aminopeptidase 2, mitochondrial; ... 129 3e-28 protein update 2009....e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP2-A/VHP215Q.Seq.d/ Representati...ve seq. ID VHP215P (Link to Original site) Representative DNA sequence >VHP215 (VHP215Q) /CSM/VH/VHP2-A/VHP

  10. Dicty_cDB: Contig-U13420-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 000 ) CG32-C1-003-012-C07-CT.F Mexican lime leaf, green... 40 2e-17 4 ( DQ288245 ) Ananas comosus methionine amino...as sp. RCC299 chromosome ... 254 1e-88 FM992691_602( FM992691 |pid:none) Candida dubliniensis CD36 chromo...ei strai... 160 2e-50 AP008232_1944( AP008232 |pid:none) Sodalis glossinidius str. 'mors... 158 3e-50 AE0167...e aminopeptidase; Short... 132 5e-40 CP000647_1644( CP000647 |pid:none) Klebsiella pneumoni...... 125 3e-35 AE1288( AE1288 ) methionine aminopeptidases homolog lmo1709 [impor... 109 6e-35 BX548174_533( BX548174 |pid:non

  11. Berry and Citrus Phenolic Compounds Inhibit Dipeptidyl Peptidase IV: Implications in Diabetes Management

    OpenAIRE

    Junfeng Fan; Johnson, Michelle H.; Mary Ann Lila; Gad Yousef; Elvira Gonzalez de Mejia

    2013-01-01

    Beneficial health effects of fruits and vegetables in the diet have been attributed to their high flavonoid content. Dipeptidyl peptidase IV (DPP-IV) is a serine aminopeptidase that is a novel target for type 2 diabetes therapy due to its incretin hormone regulatory effects. In this study, well-characterized anthocyanins (ANC) isolated from berry wine blends and twenty-seven other phenolic compounds commonly present in citrus, berry, grape, and soybean, were individually investigated for thei...

  12. Estudios histológico e histoquímico del sistema digestivo de la almeja catarina Argopecten ventricosus (Sowerby, 1842)

    OpenAIRE

    Cáceres, C.; Alarcón, F.J.

    2002-01-01

    Histological and histochemical studies on the digestive system of Argopecten ventricosus (Sowerby, 1842) was carried out. Lips show a ciliated columnar epithelium with glycoproteins and acid and alkaline phosphatases, and α-D glucosidase activity. Esophagus and lips epitheliums are similar. Acid and alkaline phosphatases, α-D glucosidase and leucil aminopeptidase activities were detected. The epithelium of the stomach is ciliated and contains glands which secrete glycoproteins. Acid and alkal...

  13. An Assessment of those Metabolites Considered to be of Value in the Diagnosis of Exposure to Radiation

    International Nuclear Information System (INIS)

    Certain metabolites excreted in urine have been examined in cases of human beings exposed to X- and y-irradiation for therapeutic reasons. These patients were receiving doses of up to 5000 r over a period of three to five weeks. Urinary excretion of creatinine, creatine, total α-amino-nitrogen, β-amino-isobutyric acid, pyrrole-2-carboxylic acid, 5-hydroxyindoleacetic acid and indoxyl-sulphate were followed quantitatively during the whole course of treatment. None of the patients were exposed to total-body irradiation but it is apparent that changes in metabolic function as a result of radiation-induced damage can be reflected in urinary excretion. The biochemical rationale and interpretation of these excretion patterns is discussed in relation to that part of the body irradiated, but it is concluded at this stage of the investigation that quantitative assessment of biological damage is not possible. However, such tests can be useful as a guide to the clinician on the form of therapy. Preliminary tests on changes in certain plasma metabolites in rats exposed to single sub-lethal doses of X-irradiation are worthy of extrapolation to human studies. Plasma concentrations of 5-hydroxytryptamine, uric acid, SGOT, SGPT, globulin fractions of protein, creatine phosphokinase, leucine aminopeptidase, lysyl aminopeptidase, kallikrein, kallidin, zinc and manganese have been measured. Qualitative yet significant changes were observed in plasma levels of uric acid, leucine aminopeptidase, lysyl aminopeptidase and manganese after irradiation. The significance of this data is discussed. Emphasis in these studies has been placed upon methods which are simple and quick to perform. (author)

  14. Markers for Host-Induced Gene Expression in Trichophyton Dermatophytosis

    OpenAIRE

    Kaufman, Gil; Berdicevsky, Israela; Woodfolk, Judith A.; Horwitz, Benjamin A.

    2005-01-01

    Dermatophytes are adapted to infect keratinized tissues by their ability to utilize keratin as a nutrient source. Although there have been numerous reports that dermatophytes like Trichophyton sp. secrete proteolytic enzymes, virtually nothing is known about the patterns of gene expression in the host or even when the organisms are cultured on protein substrates in the absence of a host. We characterized the expression of an aminopeptidase gene, the Trichophyton mentagrophytes homolog of the ...

  15. Partial Purification and Characterization of Bacillus thuringiensis Cry1A Toxin Receptor A from Heliothis virescens and Cloning of the Corresponding cDNA

    OpenAIRE

    Oltean, Daniela I.; Pullikuth, Ashok K; Lee, Hyun-Ku; Gill, Sarjeet S.

    1999-01-01

    Although extensively studied, the mechanism of action of insecticidal Bacillus thuringiensis Cry toxins remains elusive and requires further elucidation. Toxin receptors in the brush border membrane demand particular attention as they presumably initiate the cascade of events leading to insect mortality after toxin activation. The 170-kDa Cry1Ac toxin-binding aminopeptidase from the tobacco budworm (Heliothis virescens) was partially purified, and its corresponding cDNA was cloned. The cDNA e...

  16. Association of ERAP1 Allelic Variants with Risk of Ankylosing Spondylitis

    OpenAIRE

    Zvyagin, I.; Dorodnykh, V.; Mamedov, I.; Staroverov, D.; Bochkova, A.; Rebrikov, D.; Lebedev, Y.

    2010-01-01

    Ankylosing spondylitis (AS) belongs to a group of autoimmune diseases affecting the axial skeleton. Beside the hla-b*27 allele, several other human genes that control the variety processes of immune homeostasis are considered to be associated with AS manifestation in different human populations. Among strong associated non-MHC genes erap 1 encoding the endoplasmic reticulum aminopeptidase 1 isoform was recently identified by single nucleotide polymorphisms (SNPs) meta analysis. In our study w...

  17. In vivo role of ER-associated peptidase activity in tailoring peptides for presentation by MHC class Ia and class Ib molecules

    OpenAIRE

    Yan, Jingbo; Parekh, Vrajesh V.; Mendez-Fernandez, Yanice; Olivares-Villagómez, Danyvid; Dragovic, Srdjan; Hill, Timothy; Roopenian, Derry C.; Joyce, Sebastian; Van Kaer, Luc

    2006-01-01

    Endoplasmic reticulum (ER)-associated aminopeptidase (ERAP)1 has been implicated in the final proteolytic processing of peptides presented by major histocompatibility complex (MHC) class I molecules. To evaluate the in vivo role of ERAP1, we have generated ERAP1-deficient mice. Cell surface expression of the class Ia molecules H-2Kb and H-2Db and of the class Ib molecule Qa-2 was significantly reduced in these animals. Although cells from mutant animals exhibited reduced capacity to present s...

  18. ERAP1 genetic variations associated with HLA-B27 interaction and disease severity of syndesmophytes formation in Taiwanese ankylosing spondylitis

    OpenAIRE

    Wang, Chin-Man; Ho, Huei-Huang; Chang, Su-Wei; Wu, Yeong-Jian Jan; Lin, Jing-Chi; Chang, Pi-Yueh; Wu, Jianming; Chen, Ji-Yih

    2012-01-01

    Introduction Ankylosing spondylitis (AS) is a familial, heritable disease specified by syndesmophyte formation leading to an ankylosed spine. Endoplasmic reticulum aminopeptidase 1 (ERAP1) genetic variations have been widely proved to be associated with AS in several ethnic populations. The aim of this study was to investigate whether ERAP1 single nucleotide polymorphisms (SNPs) are associated with AS susceptibility and disease severity in Taiwanese. Methods Four ERAP1 SNPs (rs27037, rs27980,...

  19. A functional variant in ERAP1 predisposes to multiple sclerosis

    OpenAIRE

    Guerini, F R; Cagliani, R.; De Forni, D; C. Agliardi; Caputo, D.; A. Cassinotti; Galimberti, D.; Fenoglio, C; M. Biasin; R. Asselta; Scarpini, E.; Comi, G P; Bresolin, N.; M. S. Clerici; Sironi, M

    2012-01-01

    The ERAP1 gene encodes an aminopeptidase involved in antigen processing. A functional polymorphism in the gene (rs30187, Arg528Lys) associates with susceptibility to ankylosying spondylitis (AS), whereas a SNP in the interacting ERAP2 gene increases susceptibility to another inflammatory autoimmune disorder, Crohn's disease (CD). We analysed rs30187 in 572 Italian patients with CD and in 517 subjects suffering from multiple sclerosis (MS); for each cohort, an independent sex- and age-matched ...

  20. Genetic Association with ERAP1 in Psoriasis Is Confined to Disease Onset after Puberty and Not Dependent on HLA-C*06

    OpenAIRE

    Lysell, Josefin; Padyukov, Leonid; Kockum, Ingrid; Nikamo, Pernilla; Ståhle, Mona

    2012-01-01

    HLA-C remains the strongest susceptibility candidate gene in psoriasis. Evidence for interaction between HLA-C and endoplasmic reticulum aminopeptidase 1 (ERAP1) confined to individuals carrying the HLA-C risk allele was recently reported. Psoriasis displays wide variation, and genetic heterogeneity is likely to contribute to clinical diversity. Age at disease onset is a putative discriminator, and separating psoriasis into early- (

  1. Naturally occurring ERAP1 haplotypes encode functionally distinct alleles with fine substrate specificity

    OpenAIRE

    Reeves, Emma; Edwards, Christopher J.; Elliott, Tim; James, Edward

    2013-01-01

    The aminopeptidase, ERAP1, trims peptides for MHC class I presentation, influencing the degree and specificity of CD8+ T cell responses. Single nucleotide polymorphisms (SNP) within the exons encoding ERAP1 are associated with autoimmune diseases and cervical carcinoma, but it is not known whether they act independently or as disease-associated haplotypes. We sequenced ERAP1 from 20 individuals and show that SNP occur as distinct haplotypes in the human population, and that these haplotypes e...

  2. Immune surveillance for ERAAP dysfunction

    OpenAIRE

    Nagarajan, Niranjana A.; Shastri, Nilabh

    2013-01-01

    The ER aminopeptidase associated with antigen processing, ERAAP (or ERAP1), is essential for trimming peptides that are presented by MHC class I molecules. ERAP1 is inhibited by human cytomegalovirus, and ERAP1 polymorphisms are associated with autoimmune diseases. How the immune system detects ERAAP dysfunction, however, is unknown. We have shown previously that ERAAP-deficient cells present an immunogenic pMHC I repertoire, that elicits CD8+ T cell response in WT mice. Additionally, we disc...

  3. Functionally distinct ERAP1 allotype combinations distinguish individuals with Ankylosing Spondylitis

    OpenAIRE

    Reeves, Emma; Colebatch-Bourn, Alexandra; Elliott, Tim; Edwards, Christopher J.; James, Edward

    2014-01-01

    The immune system performs surveillance to identify infected or cancerous cells through recognition of small protein fragments called antigenic peptides on their surface. To do this, the peptides must be cut to a specific length by an enzyme called endoplasmic reticulum aminopeptidase 1 (ERAP1). Variation in this enzyme has recently been linked to the inflammatory rheumatic disease Ankylosing Spondylitis (AS). We have found that ERAP1 is highly polymorphic in humans and that specific combinat...

  4. Identification and reproducibility of diagnostic DNA markers for tuber starch and yield optimization in a novel association mapping population of potato (Solanum tuberosum L.)

    OpenAIRE

    Schönhals, E. M.; Ortega, F.; Barandalla, L.; Aragones, A.; Ruiz de Galarreta, J.I.; Liao, J.-C.; Sanetomo, R.; Walkemeier, B.; Tacke, E.; Ritter, E.; Gebhardt, C.

    2016-01-01

    Key message SNPs in candidate genes Pain - 1, InvCD141 (invertases), SSIV (starch synthase), StCDF1 (transcription factor), LapN (leucine aminopeptidase), and cytoplasm type are associated with potato tuber yield, starch content and/or starch yield. Abstract Tuber yield (TY), starch content (TSC), and starch yield (TSY) are complex characters of high importance for the potato crop in general and for industrial starch production in particular. DNA markers associated with superior alleles of ge...

  5. Evaluation of the Strep-A-Fluor identification method for group A streptococci.

    OpenAIRE

    Wasilauskas, B L; Hampton, K D

    1984-01-01

    Strep-A-Fluor (Bio Spec, Inc., Dublin, Calif.) is a new test designed for the rapid identification of group A streptococci. A filter paper strip impregnated with a synthetic substrate is used to detect a specific aminopeptidase present in group A streptococci by UV fluorescence. In a blind study, 305 beta-hemolytic streptococcal isolates were correctly categorized as group A or non-group A.

  6. DOM-fold: A structure with crossing loops found in DmpA, ornithine acetyltransferase, and molybdenum cofactor-binding domain

    OpenAIRE

    Cheng, Hua; Grishin, Nick V.

    2005-01-01

    Understanding relationships between sequence, structure, and evolution is important for functional characterization of proteins. Here, we define a novel DOM-fold as a consensus structure of the domains in DmpA (L-aminopeptidase D-Ala-esterase/amidase), OAT (ornithine acetyltransferase), and MocoBD (molybdenum cofactor-binding domain), and discuss possible evolutionary scenarios of its origin. As shown by a comprehensive structure similarity search, DOM-fold distinguished by a two-layered β/α ...

  7. Relationship between carbon catabolite repression and the biosynthesis regulation of the prolidase PepQ from Lactobacillus delbrueckii ssp. bulgaricus CNRZ 397

    OpenAIRE

    Lamarque, Mauld; Morel, Fabienne; Bissardon, Isabelle; Galinier, Anne; Portalier, Raymond; Atlan, Danièle

    2001-01-01

    International audience Lactobacillus delbrueckii ssp. bulgaricus CNRZ 397 (L. bulgaricus) displays several enzymes specific of proline-containing peptides. We focused on the prolidase PepQ which specifically cleaves X-Pro dipeptides. PepQ biosynthesis was previously shown to be independent of the peptide concentration of the culture medium in contrast to the cell surface proteinase PrtB and several aminopeptidases. Regulation of PepQ biosynthesis can be explained by the genetic organizatio...

  8. Synthesis and in vitro evaluation of cyclic NGR peptide targeted thermally sensitive liposome

    OpenAIRE

    NEGUSSIE, AYELE H.; Miller, Jenna L.; Reddy, Goutham; Drake, Steven K.; Wood, Bradford J.; Dreher, Matthew R.

    2010-01-01

    The Asn-Gly-Arg (NGR) motif in both cyclic and linear form has previously been shown to specifically bind to CD13/aminopeptidase N that is selectively overexpressed in tumor vasculature and some tumor cells. However, previous versions of cyclic NGR used a liable disulfide bridge between cysteine residues that may be problematic for liposome targeting due to disulfide bond formation between adjacent peptides on the liposomal surface. In this study, we report the design, synthesis, and characte...

  9. Enhanced Expression of CD13 in Vessels of Inflammatory and Neoplastic Tissues

    OpenAIRE

    Matteo, Paola Di; Arrigoni, Gian Luigi; Alberici, Luca; Corti, Angelo; Gallo-Stampino, Corrado; Traversari, Catia; Doglioni, Claudio; Rizzardi, Gian-Paolo

    2011-01-01

    Aminopeptidase-N (CD13) is an important target of tumor vasculature-targeting drugs. The authors investigated its expression by immunohistochemistry with three anti-CD13 monoclonal antibodies (WM15, 3D8, and BF10) in normal and pathological human tissues, including 58 normal, 32 inflammatory, and 149 tumor tissue specimens. The three antibodies stained vessels in most neoplastic tissues, interestingly with different patterns. As a matter of fact, WM15 stained almost all intratumor and peritum...

  10. CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis

    OpenAIRE

    Dondossola, Eleonora; Rangel, Roberto; Guzman-Rojas, Liliana; Barbu, Elena M.; Hosoya, Hitomi; St. John, Lisa S.; Molldrem, Jeffrey J.; Corti, Angelo; Sidman, Richard L.; Arap, Wadih; Pasqualini, Renata

    2013-01-01

    The progression of many solid tumors is associated with increased vascularization. We previously recognized involvement in tumor development and angiogenesis of tumor stromal cells expressing the CD13 protease aminopeptidase. The basic biological concept of participation of nontumor cells in the cancer stroma microenvironment is strengthened in the present study by our finding that a CD11b+CD13+ myeloid subset of bone marrow-derived cells affects pericyte biology and angiogenesis and thereby ...

  11. The pro-inflammatory cytokine 14-3-3ε is a ligand of CD13 in cartilage

    OpenAIRE

    Nefla, Meriam; Sudre, Laure; Denat, Guillaume; Priam, Sabrina; André-Leroux, Gwenaelle; Jacques, Claire

    2015-01-01

    ABSTRACT Osteoarthritis is a whole-joint disease characterized by the progressive destruction of articular cartilage involving abnormal communication between subchondral bone and cartilage. Our team previously identified 14-3-3ε protein as a subchondral bone soluble mediator altering cartilage homeostasis. The aim of this study was to investigate the involvement of CD13 (also known as aminopeptidase N, APN) in the chondrocyte response to 14-3-3ε. After identifying CD13 in chondrocytes, we kno...

  12. CD13/APN regulates endothelial invasion and filopodia formation

    OpenAIRE

    Petrovic, Nenad; Schacke, Wolfgang; Gahagan, J. Reed; O'Conor, Catherine A.; Winnicka, Beata; Conway, Rebecca E.; Mina-Osorio, Paola; Shapiro, Linda H.

    2007-01-01

    CD13/aminopeptidase N is a transmembrane peptidase that is induced in the vasculature of solid tumors and is a potent angiogenic regulator. Here, we demonstrate that CD13 controls endothelial cell invasion in response to the serum peptide bradykinin by facilitating signal transduction at the level of the plasma membrane. Inhibition of CD13 abrogates bradykinin B2 receptor internalization, leading to the attenuation of downstream events such as bradykinin-induced activation of Cdc42 and filopo...

  13. Comparison of the MUREX C. albicans, Albicans-Sure, and BactiCard Candida test kits with the germ tube test for presumptive identification of Candida albicans.

    OpenAIRE

    Crist, A E; Dietz, T J; Kampschroer, K.

    1996-01-01

    The MUREX C. albicans (MC)(Murex Diagnostics), Albicans-Sure (AS) (Clinical Standards Laboratories), and BactiCard Candida (BC) (Remel) test kits were compared with the germ tube (GT) test for the rapid, presumptive identification of Candida albicans. All three test kits detect the enzymes L-proline aminopeptidase and beta-galactosaminidase in yeast cells grown on culture media and are based on the principle that C. albicans produces both enzymes whereas other yeasts produce only one or neith...

  14. Comparison among Different Gilthead Sea Bream (Sparus aurata) Farming Systems: Activity of Intestinal and Hepatic Enzymes and 13C-NMR Analysis of Lipids

    OpenAIRE

    Vincenzo Zonno; Francesco Paolo Fanizzi; Carlo Storelli; Giorgia Bressani; Pascali, Sandra A. De; Laura Del Coco; Paride Papadia

    2009-01-01

    In order to evaluate differences in general health and nutritional values of gilthead sea bream (Sparus aurata), the effects of semi-intensive, land-based tanks and sea-cages intensive rearing systems were investigated, and results compared with captured wild fish. The physiological state was determined by measuring the activity of three different intestinal digestive enzymes: alkaline phosphatase (ALP), leucine aminopeptidase (LAP) and maltase; and the activity of the hepatic ALP. Also, the ...

  15. Sosis Fermentasyonunda Proteoliz (İngilizce)

    OpenAIRE

    Candoğan, Kezban; Acton, James C.

    2001-01-01

    Proteolysis is one of the main biochemical reactions contributing to development of overall quality of fermented sausages. Proteolysis reactions are catalyzed by either endogenous enzymes inherent in the product or by enzymes from microbial origin. Meat proteins undergo hydrolysis first to polypeptides by endogenous muscle enzymes, and then further to small peptides by peptidases. Final step in proteolysis phenomena is free amino acid generation by bacterial aminopeptidases as well as aminope...

  16. Dipeptidyl peptidase-IV activity and/or structure homologues (DASH) in transformed neuroectodermal cells

    Czech Academy of Sciences Publication Activity Database

    Malík, Radek; Bušek, P.; Mareš, Vladislav; Ševčík, J.; Kleibl, Z.; Šedo, A.

    2003-01-01

    Roč. 524, - (2003), s. 95-102. ISSN 0065-2598. [International Conference on Dipeptidyl Aminopeptidases.. Berlin, 26.09.2002-28.09.2002] R&D Projects: GA ČR GA301/02/0962 Grant ostatní: GA UK(CZ) 7/2002/C Institutional research plan: CEZ:AV0Z5011922 Keywords : DASH molecules * DPP-IV activity * glioma cells Subject RIV: FD - Oncology ; Hematology

  17. Allium sativum aqueous extract prevents potassium dichromate-induced nephrotoxicity and lipid oxidation in rats

    OpenAIRE

    Sergio L. Becerra-Torres; César Soria-Fregozo; Fernando Jaramillo-Juárez; José L. Moreno-Hernández-Duque

    2014-01-01

    Context: The potassium dichromate (K2Cr2O7) induces nephrotoxicity by oxidative stress mechanisms. Aims: To study the potential protection of an aqueous extract of Allium sativum against the K2Cr2O7-induced nephrotoxicity and lipid oxidation in rats. Methods: Twenty four hours after treatment, biomarkers such as proteinuria, creatinine clearance, malondialdehyde production, specific enzyme activity of gamma glutamyl transpeptidase and alanine aminopeptidase, and renal clearance of para-...

  18. Interspecies differences in membrane-associated protease activities of thyrocytes and their relevance for thyroid cancer studies

    Directory of Open Access Journals (Sweden)

    Fröhlich Eleonore

    2012-05-01

    Full Text Available Abstract Background To understand the role of proteases involved in human thyroid cancer progression and tissue invasion, thyrocytes from other species could potentially be used provided their characteristics are similar. It is not known whether dipeptidyl peptidase IV and aminopeptidase N activities, which are overexpressed in human thyroid cancer, are, as in human, also absent in normal thyrocytes of other species, making them suitable models for studies on the regulation of these proteases. Methods To assess the role of these proteases, activity was measured in thyroid tissue of human, mouse, rat, porcine, bovine and ovine origin. The lysosomal protease, dipeptidyl peptidase II, was used for comparison. Results Murine, rat, ovine, bovine and human thyrocytes all lacked dipeptidyl peptidase IV and aminopeptidase N activity, but porcine thyrocytes were found to possess both. In contrast, lysosomal dipeptidyl peptidase II was strongly expressed in all species. These activity patterns were maintained in cultured cells. Cultured porcine thyrocytes formed follicles with typical morphology upon stimulation with TSH but differed from human thyrocytes in their response to thiamazole. Conclusions These species differences in the expression of dipeptidyl peptidase IV and aminopeptidase N, indicate that porcine thyrocytes cannot be considered appropriate for the study of proteases in human cancer development.

  19. Influence of zinc on bacterial populations and their proteolytic enzyme activities in freshwater environments: a cross-site comparison.

    Science.gov (United States)

    Rasmussen, Lauren; Olapade, Ola A

    2016-04-01

    Temporal responses of indigenous bacterial populations and proteolytic enzyme (i.e., aminopeptidase) activities in the bacterioplankton assemblages from 3 separate freshwater environments were examined after exposure to various zinc (Zn) concentrations under controlled microcosm conditions. Zn concentrations (ranging from 0 to 10 μmol/L) were added to water samples collected from the Kalamazoo River, Rice Creek, and Huron River and examined for bacterial abundance and aminopeptidase activities at various time intervals over a 48 h incubation period in the dark. The results showed that the Zn concentrations did not significantly influence total bacterial counts directly; however, aminopeptidase activities varied significantly to increasing zinc treatments over time. Also, analysis of variance and linear regression analyses revealed significant positive relationships between bacterial numbers and their hydrolytic enzyme activities, suggesting that both probably co-vary with increasing Zn concentrations in aquatic systems. The results from this study serve as additional evidence of the ecological role of Zn as an extracellular peptidase cofactor on the dynamics of bacterial assemblages in aquatic environments. PMID:26877164

  20. Preparation of Antioxidant Enzymatic Hydrolysates from Honeybee-Collected Pollen Using Plant Enzymes

    Directory of Open Access Journals (Sweden)

    Margarita D. Marinova

    2010-01-01

    Full Text Available Enzymatic hydrolysates of honeybee-collected pollen were prepared using food-grade proteinase and aminopeptidases entirely of plant origin. Bromelain from pineapple stem was applied (8 mAU/g substrate in the first hydrolysis stage. Aminopeptidase (0.05 U/g substrate and proline iminopeptidase (0.03 U/g substrate from cabbage leaves (Brassica oleracea var. capitata, and aminopeptidase (0.2 U/g substrate from chick-pea cotyledons (Cicer arietinum L. were involved in the additional hydrolysis of the peptide mixtures. The degree of hydrolysis (DH, total phenolic contents, and protein contents of these hydrolysates were as follows: DH (about 20–28%, total phenolics (15.3–27.2 μg/mg sample powder, and proteins (162.7–242.8 μg/mg sample powder, respectively. The hydrolysates possessed high antiradical scavenging activity determined with DPPH (42–46% inhibition. The prepared hydrolysates of bee-collected flower pollen may be regarded as effective natural and functional dietary food supplements due to their remarkable content of polyphenol substances and significant radical-scavenging capacity with special regard to their nutritional-physiological implications.

  1. Demonstration of de novo synthesis of enzymes by density labelling with stable isotopes

    International Nuclear Information System (INIS)

    The technique of in vivo density labelling of proteins with H218O and 2H2O has been used to investigate hormonal regulation and developmental expression of enzymes in plant cells. Buoyant density data obtained from isopycnic equilibrium centrifugation demonstrated that the cytokinine-induced nitrate reductase activity and the gibberellic acid-induced phosphatase activity in isolated embryos of Agrostemma githago are activities of enzymes synthesized de novo. The increase in alanine-specific aminopeptidase in germinating A. githago seeds is not due to de novo synthesis but to the release of preformed enzyme. On the basis of this result it is possible to apply the enzyme aminopeptidase as an internal density standard in equilibrium centrifugation. Density labelling experiments on proteins in pea cotyledons have been used to study the change in the activity of acid phosphatase, alanine-specific aminopeptidase, and peroxidase during germination. The activities of these enzymes increase in cotyledons of Pisum sativum. Density labelling by 18O and 2H demonstrates de novo synthesis of these three enzymes. The differential time course of enzyme induction shows the advantage of using H218O as labelling substance in cases when the enzyme was synthesized immediately at the beginning of germination. At this stage of development the amino-acid pool available for synthesis is formed principally by means of hydrolysis of storage proteins. The incorporation of 2H into the new proteins takes place in a measurable amount at a stage of growth in which the amino acids are also synthesized de novo. The enzyme acid phosphatase of pea cotyledons was chosen to demonstrate the possibility of using the density labelling technique to detect protein turnover. (author)

  2. The internal sequence of the peptide-substrate determines its N-terminus trimming by ERAP1.

    Directory of Open Access Journals (Sweden)

    Irini Evnouchidou

    Full Text Available BACKGROUND: Endoplasmic reticulum aminopeptidase 1 (ERAP1 trims N-terminally extended antigenic peptide precursors down to mature antigenic peptides for presentation by major histocompatibility complex (MHC class I molecules. ERAP1 has unique properties for an aminopeptidase being able to trim peptides in vitro based on their length and the nature of their C-termini. METHODOLOGY/PRINCIPAL FINDINGS: In an effort to better understand the molecular mechanism that ERAP1 uses to trim peptides, we systematically analyzed the enzyme's substrate preferences using collections of peptide substrates. We discovered strong internal sequence preferences of peptide N-terminus trimming by ERAP1. Preferences were only found for positively charged or hydrophobic residues resulting to trimming rate changes by up to 100 fold for single residue substitutions and more than 40,000 fold for multiple residue substitutions for peptides with identical N-termini. Molecular modelling of ERAP1 revealed a large internal cavity that carries a strong negative electrostatic potential and is large enough to accommodate peptides adjacent to the enzyme's active site. This model can readily account for the strong preference for positively charged side chains. CONCLUSIONS/SIGNIFICANCE: To our knowledge no other aminopeptidase has been described to have such strong preferences for internal residues so distal to the N-terminus. Overall, our findings indicate that the internal sequence of the peptide can affect its trimming by ERAP1 as much as the peptide's length and C-terminus. We therefore propose that ERAP1 recognizes the full length of its peptide-substrate and not just the N- and C- termini. It is possible that ERAP1 trimming preferences influence the rate of generation and the composition of antigenic peptides in vivo.

  3. The analgesic activity of Bestatin as a potent APN inhibitor

    Directory of Open Access Journals (Sweden)

    Mei-RongJia

    2010-06-01

    Full Text Available Bestatin, a small molecular weight dipeptide, is a potent inhibitor of various aminopeptidases as well as LTA4 hydrolase. Various physiological functions of Bestatin have been identified, viz.: (1 an immunomodifier for enhancing the proliferation of normal human bone marrow granulocyte–macrophage progenitor cells to form CFU-GM colonies; Bestatin exerts a direct stimulating effect on lymphocytes via its fixation on the cell surface and an indirect effect on monocytes via aminopeptidase B inhibition of tuftsin catabolism; (2 an immunorestorator and curative or preventive agent for spontaneous tumor; Bestatin alone or its combination with chemicals can prolongate the disease-free interval and survival period in adult acute or chronic leukemia, therefore, it was primarily marketed in 1987 in Japan as an anticancer drug and servers as the only marketed inhibitor of Aminopeptidase N (APN/CD13 to cure leukemia to date; (3 a pan-hematopoietic stimulator and restorator; Bestatin promotes granulocytopoiesis and thrombocytopoiesis in vitro and restores them in myelo-hypoplastic men; (4 an inhibitor of several natural opioid peptides. Based on the knowledge that APN can cleave several bioactive neuropeptides such as Met-enkaphalins, Leu-enkaphalins, β-Endorphin, and so on, the antiaminopeptidase action of Bestatin also allows it to protect endopeptides against their catabolism, exhibiting analgesic activity. Although many scientific studies and great accomplishments have been achieved in this field, a large amount of problems are unsolved. This article reviews the promising results obtained for future development of the analgesic activity of Bestatin that can be of vital interest in a number of severe and chronic pain syndromes.

  4. Characterization of two uterine proteases and their actions on the estrogen receptor

    International Nuclear Information System (INIS)

    We have characterized two previously undetected proteases from the calf uterine cytosol and measured their actions on the estrogen receptor. One is an exopeptidase, purified 60-fold, that hydrolyzed amino acid (lysine-, and alanine-, or leucine-) p-nitroanilide substrates and leucyl-glycylglycine, did not hydrolyze [14C]methemoglobin, was completely inhibited by 1 mM bestatin or puromycin (specific inhibitors of leucine aminopeptidase like enzymes), and was unable to influence the sedimentation of the 8S form of the estrogen receptor in sucrose gradients containing dilute Tris buffer. A commercial porcine leucine aminopeptidase, like the calf uterine aminopeptidase, did not convert the 8S estrogen receptor to a 4S form. Evidently, removal of the N-terminal amino acid(s) from the estrogen receptor by exopeptidase action cannot alter the sedimentation of the 8S form of the receptor, or the N-terminal amino acid(s) of the receptor is (are) unaccessible or resistant to exopeptidase activity. The second, a receptor-active protease, is an endopeptidase that did not hydrolyze any of the synthetic amide or peptide substrates tested but did possess [14C]methemoglobin-degrading activity and the ability to convert the 8S estrogen receptor to a modified 4S form in sucrose gradients containing dilute Tris buffer. The modified 4S receptor was separable from the native receptor by DEAE-cellulose chromatography. The endopeptidase did not require Ca2+ for activity, and its chromatographic properties were distinctly different from a previously isolated Ca2+-activated protease. It was inhibited by leupeptin or dipyridyl disulfide, suggesting the presence of a thiol group that is essential for its activity

  5. Apical Plasma Membrane Proteins and Endolyn-78 Travel through a Subapical Compartment in Polarized WIF-B Hepatocytes

    OpenAIRE

    Ihrke, Gudrun; Martin, Greg V.; Shanks, Michael R.; Schrader, Michael; Schroer, Trina A.; Hubbard, Ann L.

    1998-01-01

    We studied basolateral-to-apical transcytosis of three classes of apical plasma membrane (PM) proteins in polarized hepatic WIF-B cells and then compared it to the endocytic trafficking of basolaterally recycling membrane proteins. We used antibodies to label the basolateral cohort of proteins at the surface of living cells and then followed their trafficking at 37°C by indirect immunofluorescence. The apical PM proteins aminopeptidase N, 5′nucleotidase, and the polymeric IgA receptor were ef...

  6. The coronavirus transmissible gastroenteritis virus causes infection after receptor-mediated endocytosis and acid-dependent fusion with an intracellular compartment

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Delmas, B; Besnardeau, L;

    1998-01-01

    Aminopeptidase N is a species-specific receptor for transmissible gastroenteritis virus (TGEV), which infects piglets, and for the 229E virus, which infects humans. It is not known whether these coronaviruses are endocytosed before fusion with a membrane of the target cell, causing a productive...... and bafilomycin A1 markedly inhibited the TGEV infection as judged from virus production and protein biosynthesis analyses but did so only when added early in the course of the infection, i.e., about 1 h after the start of endocytosis. Together our results point to an acid intracellular compartment as...... the site of fusion for TGEV....

  7. PLAP efficiently generates mature antigenic peptides in vitro but in patterns distinct from ERAP11

    OpenAIRE

    Georgiadou, Dimitra; Hearn, Arron; Evnouchidou, Irini; Chroni, Angeliki; Leondiadis, Leondios; Ian A York; Rock, Kenneth L.; Stratikos, Efstratios

    2010-01-01

    All three members of the oxytocinase sub-family of M1 aminopeptidases, ERAP1 (ERAAP), ERAP2 and PLAP (IRAP), have been implicated in the generation of MHC class I-presented peptides. ERAP1 and 2 trim peptides in the endoplasmic reticulum for direct presentation whereas PLAP has been recently implicated in cross presentation. The best characterized member of the family, ERAP1, has unique enzymatic properties that fit well with its role in antigen processing. ERAP1 can trim a large variety of l...

  8. Correlation of tumor growth suppression and methionine aminopetidase-2 activity blockade using an orally active inhibitor

    OpenAIRE

    Wang, Jieyi; Tucker, Lora A; Stavropoulos, Jason; Qian ZHANG; Wang, Yi-Chun; Bukofzer, Gail; Niquette, Amanda; Meulbroek, Jonathan A; Barnes, David M; Shen, Jianwei; Bouska, Jennifer; Donawho, Cherrie; Sheppard, George S.; Bell, Randy L.

    2008-01-01

    This laboratory and others have shown that agents that inhibit the in vitro catalytic activity of methionine aminopeptidase-2 (MetAP2) are effective in blocking angiogenesis and tumor growth in preclinical models. However, these prototype MetAP2 inhibitors are clearly not optimized for therapeutic use in the clinic. We have discovered an orally active class of MetAP2 inhibitors, the anthranilic acid sulfonamides exemplified by A-800141, which is highly specific for MetAP2. This orally bioavai...

  9. Biosynthesis of intestinal microvillar proteins. Processing of N-linked carbohydrate is not required for surface expression

    DEFF Research Database (Denmark)

    Danielsen, Erik Michael; Cowell, G M

    1986-01-01

    Castanospermine, an inhibitor of glucosidase I, the initial enzyme in the trimming of N-linked carbohydrate, was used to study the importance of carbohydrate processing in the biosynthesis of microvillar enzymes in organ-cultured pig intestinal explants. For aminopeptidase N (EC 3...... microvillar enzymes, it does not receive post-translational O-linked carbohydrate. Castanospermine suppressed the synthesis of the four enzymes, but did not block their transport to the microvillar membrane, showing that processing of N-linked carbohydrate is not required for microvillar expression. The...

  10. Biosynthesis of intestinal microvillar proteins. Further characterization of the intracellular processing and transport

    DEFF Research Database (Denmark)

    Danielsen, E M; Cowell, G M

    1984-01-01

    The effect of tunicamycin on synthesis and intracellular transport of pig small intestinal aminopeptidase N (EC 3.4.11.2), sucrase-isomaltase (EC 3.2.1.48-10) and maltase-glucoamylase (EC 3.2.1.20) was studied by labelling of mucosal explants with [35S]methionine. The expression of the microvilla...... presence of tunicamycin. The complex forms were also sensitive to endo F but did not coincide with the high mannose forms after treatment, indicating that the size difference cannot alone be ascribed to processing of N-linked carbohydrate....

  11. Antitumor Activity of Antimicrobial Peptides Containing CisoDGRC in CD13 Negative Breast Cancer Cells

    OpenAIRE

    Hou, Lei; ZHAO, XINHAN; Wang, Pei; Ning, Qian; Meng, Min; Liu, Caigang

    2013-01-01

    Backgroud isoAsp-Gly-Arg (isoDGR) is a derivative of the Asn-Gly-Arg (NGR) motif, which is used as a targeted delivery tool to aminopeptidase N (CD13) positive cells. Recent studies have shown that cyclic isoDGR (CisoDGRC) has a more efficient affinity with αvβ3, a type of integrin that overexpresses in tumor cells. Antimicrobial peptides (AMPs) are an efficient antitumor peptide that specifically kills tumor cells. In the present study, we designed antimicrobial peptides containing the CisoD...

  12. Bone marrow-derived CD13+ cells sustain tumor progression: A potential non-malignant target for anticancer therapy

    OpenAIRE

    Dondossola, Eleonora; Corti, Angelo; Sidman, Richard L.; Arap, Wadih; Pasqualini, Renata

    2014-01-01

    Non-malignant cells found within neoplastic lesions express alanyl (membrane) aminopeptidase (ANPEP, best known as CD13), and CD13-null mice exhibit limited tumor growth and angiogenesis. We have recently demonstrated that a subset of bone marrow-derived CD11b+CD13+ myeloid cells accumulate within neoplastic lesions in several murine models of transplantable cancer to promote angiogenesis. If these findings were confirmed in clinical settings, CD11b+CD13+ myeloid cells could become a non-mali...

  13. 68Ga-Labeled Cyclic NGR Peptide for MicroPET Imaging of CD13 Receptor Expression

    OpenAIRE

    Yahui Shao; Wansheng Liang; Fei Kang; Weidong Yang; Xiaowei Ma; Guiyu Li; Shu Zong; Kai Chen; Jing Wang

    2014-01-01

    Peptides containing the asparagines-glycine-arginine (NGR) motif have been identified as specific ligands binding to CD13/aminopeptidase N (APN) receptor, a tumor neovascular biomarker. In this study, we synthesized a novel NGR-containing peptide (NOTA-G3-NGR), and labeled NOTA-G3-NGR with 68Ga (t1/2 = 67.7 min). The resulting 68Ga-NOTA-G3-NGR peptide was subject to in vitro and in vivo characterization. The microPET imaging results revealed that the 68Ga-NOTA-G3-NGR peptide exhibits rapid an...

  14. Control of APN/CD13 and NEP/CD10 on sperm motility

    OpenAIRE

    Subirán, Nerea; Pinto, Francisco M; Agirregoitia, Ekaitz; Candenas, Luz; Irazusta, Jon

    2010-01-01

    Aminopeptidase N (APN/CD13) and neutral endopeptidase (NEP/CD10) are enzymes present in human sperm cells and involved in regulation of sperm motility of noncapacitated spermatozoa. We investigated the involvement of APN/CD13 and NEP/CD10 in motility and in kinematic parameters of human capacitated spermatozoa. Sperm cells isolated by a discontinuous Percoll gradient (40%–80%) followed up by swim-up techniques were incubated with the APN/CD13-specific inhibitor, leuhistin (100 μmol L−1), and ...

  15. Bone marrow-derived CD13+ cells sustain tumor progression

    OpenAIRE

    Dondossola, Eleonora; Corti, Angelo; Sidman, Richard L.; Arap, Wadih; Pasqualini, Renata

    2014-01-01

    Non-malignant cells found within neoplastic lesions express alanyl (membrane) aminopeptidase (ANPEP, best known as CD13), and CD13-null mice exhibit limited tumor growth and angiogenesis. We have recently demonstrated that a subset of bone marrow-derived CD11b+CD13+ myeloid cells accumulate within neoplastic lesions in several murine models of transplantable cancer to promote angiogenesis. If these findings were confirmed in clinical settings, CD11b+CD13+ myeloid cells could become a non-mali...

  16. Nanoparticles Targeted With NGR Motif Deliver c-myc siRNA and Doxorubicin for Anticancer Therapy

    OpenAIRE

    Chen, Yunching; Wu, Jinzi J.; Huang, Leaf

    2010-01-01

    We have designed a PEGylated LPD (liposome-polycation-DNA) nanoparticle for systemic, specific, and efficient delivery of small interfering RNA (siRNA) into solid tumors in mice by modification with NGR (aspargine–glycine–arginine) peptide, targeting aminopeptidase N (CD13) expressed in the tumor cells or tumor vascular endothelium. LPD-PEG-NGR efficiently delivered siRNA to the cytoplasm and downregulated the target gene in the HT-1080 cells but not CD13− HT-29 cells, whereas nanoparticles c...

  17. The Saccharomyces cerevisiae v-SNARE Vti1p Is Required for Multiple Membrane Transport Pathways to the Vacuole

    OpenAIRE

    von Mollard, Gabriele Fischer; Stevens, Tom H.

    1999-01-01

    The interaction between v-SNAREs on transport vesicles and t-SNAREs on target membranes is required for membrane traffic in eukaryotic cells. Here we identify Vti1p as the first v-SNARE protein found to be required for biosynthetic traffic into the yeast vacuole, the equivalent of the mammalian lysosome. Certain vti1-ts yeast mutants are defective in alkaline phosphatase transport from the Golgi to the vacuole and in targeting of aminopeptidase I from the cytosol to the vacuole. VTI1 interact...

  18. Acyl-CoA-binding protein, Acb1p, is required for normal vacuole function and ceramide synthesis in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Færgeman, Nils J.; Feddersen, Søren; Christiansen, Janne K;

    2004-01-01

    In the present study, we show that depletion of acyl-CoA-binding protein, Acb1p, in yeast affects ceramide levels, protein trafficking, vacuole fusion and structure. Vacuoles in Acb1p-depleted cells are multi-lobed, contain significantly less of the SNAREs (soluble N -ethylmaleimide......-sensitive fusion protein attachment protein receptors) Nyv1p, Vam3p and Vti1p, and are unable to fuse in vitro. Mass spectrometric analysis revealed a dramatic reduction in the content of ceramides in whole-cell lipids and in vacuoles isolated from Acb1p-depleted cells. Maturation of yeast aminopeptidase I and...

  19. Biosynthesis of intestinal microvillar proteins. Low temperature arrests both processing and intracellular transport

    DEFF Research Database (Denmark)

    Danielsen, E M; Hansen, Gert Helge; Cowell, G M

    1989-01-01

    mannose-glycosylated form characteristic of the newly synthesized enzymes prior to the molecular processing taking place in the Golgi complex. The general morphology of the enterocyte was unaffected by culture at low temperature except for the Golgi complex where the cisternae appeared condensed and...... surrounded by numerous vesicles of 50 to 55 nm. Both molecular processing and microvillar expression could be restored by shifting the temperature to 37 degrees C. Culture at low temperature did not induce any missorting of newly synthesized aminopeptidase N, but both molecular processing and microvillar...

  20. Environmental variability in a transitional Mediterranean system (Oliveri-Tindari, Italy): Focusing on the response of microbial activities and prokaryotic abundance

    Science.gov (United States)

    Caruso, Gabriella; Azzaro, Filippo; Azzaro, Maurizio; Decembrini, Franco; La Ferla, Rosabruna; Maimone, Giovanna; De Pasquale, Francesca; Monticelli, Luis Salvador; Zaccone, Renata; Zappalà, Giuseppe; Leonardi, Marcella

    2013-12-01

    The response of both microbial activities and prokaryotic abundances to environmental variability was studied in a transitional Mediterranean system (Oliveri-Tindari, Italy) during two yearly surveys (1997-'98 and 2005-'06). The total enzymatic (leucine aminopeptidase, β-glucosidase, alkaline phosphatase) and respiratory activity rates as well as of the abundances of total prokaryotes, culturable heterotrophic bacteria, faecal coliforms and enterococci were measured in surface waters of four brackish ponds, together with temperature, salinity, dissolved oxygen, pH, inorganic nutrients, chlorophyll-a and particulate organic carbon and particulate nitrogen determinations. The seasonal and interannual patterns of microbial parameters were investigated in relation to environmental variations.

  1. Faecal excretion of brush border membrane enzymes in patients with clostridium difficile diarrhoea

    Directory of Open Access Journals (Sweden)

    Katyal R

    2002-01-01

    Full Text Available PURPOSE: To look for the presence of intestinal brush border membrane (BBM enzymes in the faecal samples of patients with Clostridium difficile association. METHODS: One hundred faecal samples were investigated for C.difficile toxin (CDT. Simultaneous assays for faecal excretion of intestinal BBM enzymes viz., disaccharidases, alkaline phosphatase (AP and leucine aminopeptidase (LAP were also done. RESULTS: C.difficile toxin was detected in 25 (25% of the samples with a titre ranging from 10 to 160. No significant difference (p>0.05 was seen between the CDT positive and negative groups with any of the disaccharidases studied. However, significant increase (pC.difficile diarrhoea.

  2. Isolation of L-3-phenyllactyl-Phe-Lys-Ala-NH2 (Antho-KAamide), a novel neuropeptide from sea anemones

    DEFF Research Database (Denmark)

    Nothacker, H P; Rinehart, K L; Grimmelikhuijzen, C J

    1991-01-01

    We have isolated and sequenced the neuropeptide L-3-phenyllactyl-Phe-Lys-Ala-NH2 from the sea anemone Anthopleura elegantissima. This neuropeptide (named Antho-KAamide) has the unusual N-terminal L-3-phenyllactyl blocking group which has recently also been discovered in 2 other neuropeptides from...... sea anemones. We propose that the L-3-phenyllactyl residue renders Antho-KAamide resistant to nonspecific aminopeptidases, thereby increasing the stability of the neuropeptide after neuronal release. The existence of the L-3-phenyllactyl residue in 3 neuropeptides isolated so far suggests...... that this blocking group is more generally occurring....

  3. 第八届中国药理学会SERVIER青年药理学工作者奖获奖者论文摘要

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Effect of Amyloid Precursor Protein 17mer Peptide on Microtubule Structure and Tau Protein Hyperphosphorylation in Hippocampal Neurons of Experimental Diabetic Mice,Naunyn Schmiedebergs Arch Pharmacol. 2003; 368 (6) : 457-62. The serotonergic system may be involved in the sleep-inducing action of oleamide in rats.,Intercellular adhesion molecule-1 and vascular endothelial growth factor expression kinetics in macrophage-derived foam cells,Mutations at the S1 Site of Methionine Aminopeptidases from Escherichia coli and Homo sapiens Reveal the Residues Critical for Substrate Specificity……

  4. Report for an accreditation to supervise research

    International Nuclear Information System (INIS)

    After indications of his scientific publications, of his published posters, and of his activities of supervision of students and researchers, the author proposes an overview of his research works since 1987. His first works related biochemical and immuno-cyto-chemical characterisation of the neutral aminopeptidase (a marker in epithelial cells), and then (for his research thesis), to the study of membrane mechanisms during zinc intestinal absorption, and after that, to a study of divalent cation transport mechanisms. More recent works (1994-2000) addressed molecular mechanisms of water and solute transports by aqua-porins. Project on a medium term are presented. Published articles are proposed in appendix

  5. Simple enzymatic procedure for l‐carnosine synthesis: whole‐cell biocatalysis and efficient biocatalyst recycling

    OpenAIRE

    Heyland, Jan; Antweiler, Nicolai; Lutz, Jochen; Heck, Tobias; Geueke, Birgit; Kohler, Hans‐Peter E.; Blank, Lars M.; Schmid, Andreas

    2009-01-01

    Summary β‐Peptides and their derivates are usually stable to proteolysis and have an increased half‐life compared with α‐peptides. Recently, β‐aminopeptidases were described as a new enzyme class that enabled the enzymatic degradation and formation of β‐peptides. As an alternative to the existing chemical synthesis routes, the aim of the present work was to develop a whole‐cell biocatalyst for the synthesis and production of β‐peptides using this enzymatic activity. For the optimization of th...

  6. Inhibition of p38 MAPK Phosphorylation Is Critical for Bestatin to Enhance ATRA-Induced Cell Differentiation in Acute Promyelocytic Leukemia NB4 Cells.

    Science.gov (United States)

    Qian, Xijun; He, Jingsong; Zhao, Yi; Lin, Maofang

    2016-01-01

    Bestatin has been known as an immunomodulating agent in anti-leukemia treatment. The mechanism by which Bestatin enhances all-trans retinoic acid (ATRA)-induced cell differentiation of acute promyelocytic leukemia (APL) cells is generally attributed to inhibition of cell surface CD13/aminopeptidase N activity. Bestatin also exerts its biological activities besides its ability to inhibit aminopeptidase N enzymatic activity. This article provides data to support an alternative mechanism regarding an important role of inhibition of p38 mitogen-activated protein kinase (MAPK) signal pathway in Bestatin's anti-leukemia effect. Bestatin enhanced ATRA-induced differentiation and inhibited ATRA-driven phosphorylation of p38 MAPK in ATRA-sensitive APL NB4 cells. In contrast, Bestatin could not reverse the differentiation block in ATRA-resistant APL MR2 cells, in which ATRA was unable to induce phosphorylation of p38 MAPK. Moreover, CD13 ligation with anti-CD13 antibody WM-15 resulted in phosphorylation of p38 MAPK, reduced the inhibition of Bestatin on the phosphorylation of p38 MAPK, and completely abolished the enhancement of Bestatin on ATRA-inducing differentiation in NB4 cells. This study shows that inhibition of p38 MAPK phosphorylation is critical for Bestatin to enhance ATRA-induced cell differentiation in ATRA-sensitive APL NB4 cells. Results suggested that pharmacological inhibition of the p38 MAPK pathway might enhance ATRA-dependent differentiation. PMID:24141198

  7. COMPARATIVE ELECTROPHORETIC PATTERNS OF ALBUMINS/ GLOBULINS EXTRACTED FROM DRY GRAINS AND GREEN MALTS OF BARLEY VARIETIES

    Directory of Open Access Journals (Sweden)

    Ivica Strelec

    2012-12-01

    Full Text Available Applicability of electrophoretic separations of albumins/globulins, followed by nonspecific protein staining and specific glycoprotein and aminopeptidase detection has been examined for barley variety discrimination. Albumins/globulins extracted from dry grains and green malt of six barley varieties were separated by polyacrylamide gel electrophoresis (10 % T, pH=8.9 of native and sodium dodecyl sulfate denatured proteins, and by isoelectric focusing in pH gradient of 3.5-9.5 and 4.0-6.5. Analysis of dry grain extracts gave better results than green malt extracts. Obtained data indicate that SDS-PAGE of albumins/globulins and IEF in pH gradient 3.5-9.5 followed by Coomassie Blue staining could be useful in Croatian barley variety discrimination. Angora barley could be clearly distinguished from the other varieties which were grouped as follows: Rodnik/Sladoran, Barun/Rex, and Martin. Glycoprotein patterns did not improve the recognition of individual varieties. Broad specificity, phenylalanine and leucine preferring, and arginine specific aminopeptidase were not found as applicable markers for discrimination of examined barley varieties.

  8. CHANGES IN LEVELS OF ACTIVITY OF SERINE PROTEASES ACCOMPANY THE EXPOSURE OF COMMON BEAN (PHASEOLUS VULGARIS L. TO WATER DEFICIT

    Directory of Open Access Journals (Sweden)

    M. Budič

    2008-09-01

    Full Text Available A wide variety of proteolytic enzymes exist in plants. On their levels depends protein turnover, a fundamental component in plant development and adaptation to environmental conditions. Cysteine proteases have frequently been reported to be influenced by drought, but only a few serine proteases (SP, among them the trypsin-like enzyme and two aminopeptidases from bean leaves (Bartels and Sunkar, 2005; Hieng et al., 2004. Our starting point was to identify proteolytic activities assigned to SPs that change with drought and then to characterize the corresponding proteases. A quantitative, analytical one-step method was used to separate endopeptidases and aminopeptidases active against a range of substrates in leaf extracts of plants grown in the field (FC. The influence of drought was determined for those of these activities which were confirmed as SPs, based on their inhibition by specific inhibitors. Under water deficit in plants grown under controlled conditions (CC their levels changed in different ways. The levels of SP activities in FC plants, observed during a period of relative drought, were similar to those measured in mildly stressed CC plants. The partial characterisations of some of these SPs will be presented. Our results point to a number of roles for different SPs in the plant response to water stress, which could range from enhanced protein turnover to limited proteolysis at specific sites.

  9. Functionally distinct ERAP1 allotype combinations distinguish individuals with Ankylosing Spondylitis.

    Science.gov (United States)

    Reeves, Emma; Colebatch-Bourn, Alexandra; Elliott, Tim; Edwards, Christopher J; James, Edward

    2014-12-01

    For more than 40 y, expression of HLA-B27 has been strongly associated with the chronic inflammatory disease Ankylosing Spondylitis (AS); however, the mechanisms underlying this association are still unknown. Single nucleotide polymorphisms within the aminopeptidase endoplasmic reticulum aminopeptidase 1 (ERAP1), which is essential for trimming peptides before they are presented to T cells by major histocompatibility complex (MHC) class I molecules, have been linked with disease. We show that ERAP1 is a highly polymorphic molecule comprising allotypes of single nucleotide polymorphisms. The prevalence of specific ERAP1 allotypes is different between AS cases and controls. Both chromosomal copies of ERAP1 are codominantly expressed, and analysis of allotype pairs provided clear stratification of individuals with AS versus controls. Functional analyses demonstrated that ERAP1 allotype pairs seen in AS cases were poor at generating optimal peptide ligands for binding to murine H-2K(b) and -D(b) and the AS-associated HLA-B*2705. We therefore provide strong evidence that polymorphic ERAP1 alters protein function predisposing an individual to AS via its influence on the antigen processing pathway. PMID:25422414

  10. Age-related changes in protein metabolism of beech (Fagus sylvatica L.) seeds during alleviation of dormancy and in the early stage of germination.

    Science.gov (United States)

    Ratajczak, Ewelina; Kalemba, Ewa M; Pukacka, Stanislawa

    2015-09-01

    The long-term storage of seeds generally reduces their viability and vigour. The aim of this work was to evaluate the effect of long-term storage on beech (Fagus sylvatica L.) seeds at optimal conditions, over 9 years, on the total and soluble protein levels and activity of proteolytic enzymes, including endopeptidases, carboxypeptidases and aminopeptidases, as well as free amino acid levels and protein synthesis, in dry seeds, after imbibition and during cold stratification leading to dormancy release and germination. The same analyses were conducted in parallel on seeds gathered from the same tree in the running growing season and stored under the same conditions for only 3 months. The results showed that germination capacity decreased from 100% in freshly harvested seeds to 75% in seeds stored for 9 years. The levels of total and soluble proteins were highest in freshly harvested seeds and decreased significantly during storage, these proportions were retained during cold stratification and germination of seeds. Significant differences between freshly harvested and stored seeds were observed in the activities of proteolytic enzymes, including endopeptidases, aminopeptidases and carboxypeptidases, and in the levels of free amino acids. The neosynthesis of proteins during dormancy release and in the early stage of seed germination was significantly weaker in stored seeds. These results confirm the importance of protein metabolism for seed viability and the consequences of its reduction during seed ageing. PMID:26071872

  11. The activities of six exo-and endopeptidases in the substantia nigra, neostriatum, and cortex of the rat brain.

    Science.gov (United States)

    Gallegos, M E; Zannatha, M M; Osornio, E G; Sánchez, A S; Posadas del rio, F A

    1999-12-01

    We determined the enzymatic activity and crude subcellular distribution of four exopeptidases: Dipeptidylaminopeptidase IV (DAP-IV), Alanyl aminopeptidase (AAP), Prolyl aminopeptidase (PAP) and gamma-Glutamyl transpeptidase (gammaGTP), and two endopeptidases: Postproline endopeptidase (PEP) and "Trypsin-like" peptidase ("T-L" P) in pars compacta (SNPC) and pars reticulata (SNPR) of substantia nigra, caudate-putamen (CAU) and cerebral cortex (CC) of the rat brain. We found: 1) DAP-IV activity is comparatively higher in SNPC and it is equally distributed in the postmitochondrial precipitate (PR) and supernatant (SN) fractions of SNPC, CAU and CC but higher in the SN from SNPR. 2) CC shows the highest activity of AAP and its activity is mainly located in the SN from all areas. 3) The activity of PAP is comparatively higher in SNPC and it is exclusively located in the SN from all areas. 4) gammaGTP activity is similar in all areas but its predominance is in the SN for SNPC and SNPR, and in the PR for CAU and CC. 5) CAU has higher PEP activity (higher in the PR) than CC (higher in the SN); no activity is detected in the substantia nigra. 6) The activity of a "Trypsin-like" peptidase is the highest in SNPC and SNPR; this activity have some predominance in the SN and higher predominance in the same fraction from CAU and CC. PMID:10591406

  12. Effect of land use on microbial biomass and enzyme activities in tropical soil

    Science.gov (United States)

    Maharjan, Menuka; Sanaullah, Muhammad; Kuzyakov, Yakov

    2016-04-01

    Land use change especially from forest to intensive agriculture for sustaining livelihood causing severe consequence on soil quality. Soil microbial biomass and enzyme activities are very sensitive to change in environment. The objective was to assess effects of three land uses i.e. forest, organic and conventional farming on microbial biomass C and N and enzymes involved in C-cycle (β-glucosidase), N-cycle (leucine-aminopeptidase), P-cycle (Phosphatase) and S-cycle (Sulphatase) at different depth (0-100 cm with 10 cm in interval) of soil in Chitwan, Nepal. The result showed that both carbon and nitrogen content (%) was significantly higher in organic farming than conventional farming and forest. However, the trend decreased in lower depth. Significantly high microbial biomass C and N (μg C and N g-1 soil) were found in organic farming than conventional farming and forest at 0-10 cm but the trend was inconsistent in lower depth. β-glucosidase, leucine-aminopeptidase and sulphatase (nmol g-1 soil) activities were higher in organic and conventional farming compared to forest at 0-20 cm. Phosphatase activity was higher in conventional farming than forest and organic farming at 0-20cm. The activities were inconsistent below 20 cm. Application of farmyard manure and organic matter from the vegetation contributes the higher microbial biomass and enzyme activities in organic farming.

  13. Technological characterization of lactococci isolated from traditional Chinese fermented milks.

    Science.gov (United States)

    Ma, C L; Zhang, L W; Yi, H X; Du, M; Han, X; Zhang, L L; Feng, Z; Zhang, Y C; Li, Q

    2011-04-01

    To screen lactic acid bacteria for starter cultures in cheese production, 21 Lactococcus strains previously isolated from natural fermented milk and koumiss made by herdsman families in the Xinjiang, Gansu, and Qinghai provinces of China were evaluated for optimal growth temperature, acidification activity, proteolytic activity, aminopeptidase activity, and autolytic activity. All isolates presented low acidification rates, and the pH value did not reach 5.3 after 6 h of inoculation in sterile reconstituted skim milk at 30°C. Strains X9C2 and T7C showed the highest proteolytic activity of 24.67 and 23.58 mg of glycine/L of milk, respectively. For aminopeptidase activity, strains X9C2 and T1C2 displayed the highest activities of 30.56 and 27.70 U/mg of protein using L-leucine-p-nitroanilide as substrate, respectively. Autolytic activity in simulated cheese-like buffer ranged from 7.45 to 34.76%, and strains Q14C2 and Q16C showed the highest values of 34.76 and 34.20%, respectively. Collectively, one main finding is that some technological characteristics of Lactococcus isolates from Chinese traditional fermented products varied greatly. Some isolates with potentially important properties could be valuable for application as starter cultures of cheese or could constitute a mixed culture. PMID:21426956

  14. The pro-inflammatory cytokine 14-3-3ε is a ligand of CD13 in cartilage.

    Science.gov (United States)

    Nefla, Meriam; Sudre, Laure; Denat, Guillaume; Priam, Sabrina; Andre-Leroux, Gwenaëlle; Berenbaum, Francis; Jacques, Claire

    2015-09-01

    Osteoarthritis is a whole-joint disease characterized by the progressive destruction of articular cartilage involving abnormal communication between subchondral bone and cartilage. Our team previously identified 14-3-3ε protein as a subchondral bone soluble mediator altering cartilage homeostasis. The aim of this study was to investigate the involvement of CD13 (also known as aminopeptidase N, APN) in the chondrocyte response to 14-3-3ε. After identifying CD13 in chondrocytes, we knocked down CD13 with small interfering RNA (siRNA) and blocking antibodies in articular chondrocytes. 14-3-3ε-induced MMP-3 and MMP-13 was significantly reduced with CD13 knockdown, which suggests that it has a crucial role in 14-3-3ε signal transduction. Aminopeptidase N activity was identified in chondrocytes, but the activity was unchanged after stimulation with 14-3-3ε. Direct interaction between CD13 and 14-3-3ε was then demonstrated by surface plasmon resonance. Using labeled 14-3-3ε, we also found that 14-3-3ε binds to the surface of chondrocytes in a manner that is dependent on CD13. Taken together, these results suggest that 14-3-3ε might directly bind to CD13, which transmits its signal in chondrocytes to induce a catabolic phenotype similar to that observed in osteoarthritis. The 14-3-3ε-CD13 interaction could be a new therapeutic target in osteoarthritis. PMID:26208633

  15. Odontogenic keratocysts: a clinical and histological study with special reference to enzyme histochemistry.

    Science.gov (United States)

    Magnusson, B C

    1978-02-01

    Of a total of 1,420 odontogenic cysts, 52 (3.3%) were diagnosed as odontogenic keratocysts. Clinical and histological findings in these 52 cysts are reported. Frozen sections of 26 of the keratocysts were incubated to show the following enzyme activities: NADH2- and NADPH2-diaphorase, glucose-6-phosphate dehydrogenase, glutamate dehydrogenase, acid phosphatase, leucine aminopeptidase and ATPase. Furthermore, keratinization was studied with the rhodamine B method and lipids with the oil red O, the OTAN and the acid hematein methods. Sections from epidermis, oral mucosa, radicular cysts, residual cysts and follicular cysts served as reference material. The oxidative enzymes showed strong activity in the keratocyst epithelium which contrasted with weak activity in the reference cysts. Acid phosphatase activity was weak in all epithelia except that in keratocysts, which displayed a marked activity. In the fibrous capsule of the keratocyst a high activity of leucine aminopeptidase was recorded. This high activity contrasted with a weak activity in the reference material. The significance of the histochemical results in relation to the aggressive behavior of the keratocyst is discussed. PMID:148497

  16. Proteinase-producing halophilic lactic acid bacteria isolated from fish sauce fermentation and their ability to produce volatile compounds.

    Science.gov (United States)

    Udomsil, Natteewan; Rodtong, Sureelak; Tanasupawat, Somboon; Yongsawatdigul, Jirawat

    2010-07-15

    Halophilic lactic acid bacteria were isolated from fish sauce mashes fermented at 1 to 12 months. Seven out of sixty-four isolates were selected according to their proteolytic activity and growth at 25% NaCl for characterization and investigation of volatile compound production. All selected isolates were Gram-positive cocci with pairs/tetrads and grew at 0-25% NaCl, pH 4.5-9.0. Results of 16S rRNA gene sequence analysis showed 99% homology to Tetragenococcus halophilus ATCC 33315. The restriction fragment length polymorphism (RFLP) patterns of all isolates were also similar to those of T. halophilus ATCC 33315. These isolates were, thus, identified as T. halophilus. All isolates hydrolyzed fish protein in the medium containing 25% NaCl. Intracellular aminopeptidase of 7 isolates exhibited the highest activity of 2.85-3.67 U/ml toward Ala-p-nitroanilide (Ala-pNA). T.halophilus strains MS33 and M11 showed the highest alanyl aminopeptidase activity (Phalophilus MS33 and MRC5-5-2 were 1-propanol, 2-methylpropanal, and benzaldehyde, corresponding to major volatile compounds in fish sauce. T.halophilus appeared to play an important role in volatile compound formation during fish sauce fermentation. PMID:20541276

  17. Prolonged ingestion of prehydrolyzed whey protein induces little or no change in digestive enzymes, but decreases glutaminase activity in exercising rats.

    Science.gov (United States)

    Nery-Diez, Ana Cláudia C; Carvalho, Iara R; Amaya-Farfán, Jaime; Abecia-Soria, Maria Inés; Miyasaka, Célio K; Ferreira, Clécio da S

    2010-08-01

    Because consumption of whey protein hydrolysates is on the increase, the possibility that prolonged ingestion of whey protein hydrolysates affect the digestive system of mammals has prompted us to evaluate the enzymatic activities of pepsin, leucine-aminopeptidase, chymotrypsin, trypsin, and glutaminase in male Wistar rats fed diets containing either a commercial whey isolate or a whey protein hydrolysate with medium degree of hydrolysis and to compare the results with those produced by physical training (sedentary, sedentary-exhausted, trained, and trained-exhausted) in the treadmill for 4 weeks. The enzymatic activities were determined by classical procedures in all groups. No effect due to the form of the whey protein in the diet was seen in the activities of pepsin, trypsin, chymotrypsin, and leucine-aminopeptidase. Training tended to increase the activity of glutaminase, but exhaustion promoted a decrease in the trained animals, and consumption of the hydrolysate decreased it even further. The results are consistent with the conclusion that chronic consumption of a whey protein hydrolysate brings little or no modification of the proteolytic digestive system and that the lowering of glutaminase activity may be associated with an antistress effect, counteracting the effect induced by training in the rat. PMID:20482282

  18. The pro-inflammatory cytokine 14-3-3ε is a ligand of CD13 in cartilage

    Science.gov (United States)

    Nefla, Meriam; Sudre, Laure; Denat, Guillaume; Priam, Sabrina; Andre-Leroux, Gwenaëlle; Berenbaum, Francis; Jacques, Claire

    2015-01-01

    ABSTRACT Osteoarthritis is a whole-joint disease characterized by the progressive destruction of articular cartilage involving abnormal communication between subchondral bone and cartilage. Our team previously identified 14-3-3ε protein as a subchondral bone soluble mediator altering cartilage homeostasis. The aim of this study was to investigate the involvement of CD13 (also known as aminopeptidase N, APN) in the chondrocyte response to 14-3-3ε. After identifying CD13 in chondrocytes, we knocked down CD13 with small interfering RNA (siRNA) and blocking antibodies in articular chondrocytes. 14-3-3ε-induced MMP-3 and MMP-13 was significantly reduced with CD13 knockdown, which suggests that it has a crucial role in 14-3-3ε signal transduction. Aminopeptidase N activity was identified in chondrocytes, but the activity was unchanged after stimulation with 14-3-3ε. Direct interaction between CD13 and 14-3-3ε was then demonstrated by surface plasmon resonance. Using labeled 14-3-3ε, we also found that 14-3-3ε binds to the surface of chondrocytes in a manner that is dependent on CD13. Taken together, these results suggest that 14-3-3ε might directly bind to CD13, which transmits its signal in chondrocytes to induce a catabolic phenotype similar to that observed in osteoarthritis. The 14-3-3ε–CD13 interaction could be a new therapeutic target in osteoarthritis. PMID:26208633

  19. Studies of the radioprotective properties of nicotinyl compounds, aspartic acid, glutamic acid and methionine

    International Nuclear Information System (INIS)

    Radioprotective properties of sodium salts of nicotinyl aspartic acid, nicotinyl methionyl aspartic acid and nicotinyl glutamic acid were tested in mice (NMRI). Experimental animals were irradiated by rayage (9,5 Gy). Parameters were: survival rate, peritoneal fluid cell count, weight and DNA concentration of spleen, hepatic DNA polymerase activity and rate of protein synthesis, lactate dehydrogenase activity in serum, maltase, sucrase and leucine aminopeptidase activitiy in duodenum and jejunum. Following results were obtained: 1. There was no significant difference in survival rate of treated and untreated animals. In treated animals only a short prolongation of survival time was observed. 2. After irradiation a quick reduction of splenic weight and DNA concentration was measured. 3. A reduction of DNA polymerase activity in liver was observed in treated and untreated mice. The rate of hepatic protein synthesis was similar in all animals. A final decrease was observed. 4. Variable activities of maltase, sucrase and leucine aminopeptidase activity in duodenum and jejunum indicated no radioprotective effect of tested substances. In conclusion of these results the tested substances show no significant radioprotective properties. (orig.)

  20. Regulation of bacterioplankton activity in Fram Strait (Arctic Ocean) during early summer: The role of organic matter supply and temperature

    Science.gov (United States)

    Piontek, Judith; Sperling, Martin; Nöthig, Eva-Maria; Engel, Anja

    2014-04-01

    The bacterial turnover of organic matter was investigated in Fram Strait at 79°N. Both Atlantic Water (AW) inflow and exported Polar Water (PW) were sampled along a transect from Spitsbergen to the eastern Greenland shelf during a late successional stage of the main annual phytoplankton bloom in summer. AW showed higher concentrations of amino acids than PW, while organic matter in PW was enriched in combined carbohydrates. Bacterial growth and degradation activity in AW and PW were related to compositional differences of organic matter. Bacterial production and leucine-aminopeptidase along the transect were significantly correlated with concentrations of amino acids. Activity ratios between the extracellular enzymes β-glucosidase and leucine-aminopeptidase indicate the hydrolysis potential for polysaccharides relative to proteins. Along the transect, these ratios showed a higher hydrolysis potential for polysaccharides relative to proteins in PW than in AW, thus reflecting the differences in organic matter composition between the water masses. Q10 values for bacterial production ranged from 2.4 (± 0.8) to 6.0 (± 6.8), while those for extracellular enzymes showed a broader range of 1.5 (± 0.5) to 23.3 (± 11.8). Our results show that in addition to low seawater temperature also organic matter availability contributes to the regulation of bacterial growth and enzymatic activity in the Arctic Ocean.

  1. Vimentin binds IRAP and is involved in GLUT4 vesicle trafficking

    International Nuclear Information System (INIS)

    Research highlights: → Vimentin is shown to bind to the N-terminus of insulin-responsive aminopeptidase (IRAP), a major cargo protein of GLUT4 vesicles in 3T3-L1 adipocytes. → GLUT4 translocation to the plasma membrane by insulin is decreased in vimentin-depleted adipocytes. → An interaction between vimentin and IRAP functions to sequester GLUT4 vesicles to the peri-nuclear region of the cell. -- Abstract: Insulin-responsive aminopeptidase (IRAP) and GLUT4 are two major cargo proteins of GLUT4 storage vesicles (GSVs) that are translocated from a postendosomal storage compartment to the plasma membrane (PM) in response to insulin. The cytoplasmic region of IRAP is reportedly involved in retention of GSVs. In this study, vimentin was identified using the cytoplasmic domain of IRAP as bait. The validity of this interaction was confirmed by pull-down assays and immunoprecipitation in 3T3-L1 adipocytes. In addition, it was shown that GLUT4 translocation to the PM by insulin was decreased in vimentin-depleted adipocytes, presumably due to dispersing GSVs away from the cytoskeleton. These findings suggest that the IRAP binding protein, vimentin, plays an important role in retention of GSVs.

  2. Structure of the human histone chaperone FACT Spt16 N-terminal domain

    Energy Technology Data Exchange (ETDEWEB)

    Marcianò, G.; Huang, D. T., E-mail: d.huang@beatson.gla.ac.uk [Cancer Research UK Beatson Institute, Garscube Estate, Switchback Road, Glasgow G61 1BD, Scotland (United Kingdom)

    2016-01-22

    The Spt16–SSRP1 heterodimer is a histone chaperone that plays an important role in regulating chromatin assembly. Here, a crystal structure of the N-terminal domain of human Spt16 is presented and it is shown that this domain may contribute to histone binding. The histone chaperone FACT plays an important role in facilitating nucleosome assembly and disassembly during transcription. FACT is a heterodimeric complex consisting of Spt16 and SSRP1. The N-terminal domain of Spt16 resembles an inactive aminopeptidase. How this domain contributes to the histone chaperone activity of FACT remains elusive. Here, the crystal structure of the N-terminal domain (NTD) of human Spt16 is reported at a resolution of 1.84 Å. The structure adopts an aminopeptidase-like fold similar to those of the Saccharomyces cerevisiae and Schizosaccharomyces pombe Spt16 NTDs. Isothermal titration calorimetry analyses show that human Spt16 NTD binds histones H3/H4 with low-micromolar affinity, suggesting that Spt16 NTD may contribute to histone binding in the FACT complex. Surface-residue conservation and electrostatic analysis reveal a conserved acidic patch that may be involved in histone binding.

  3. Radiation-induced products of peptides and their enzymatic digestibility

    International Nuclear Information System (INIS)

    Chemical characterization of radiation-induced products of peptides and proteins is essential for understanding the effect of ionizing radiation on peptides and proteins. Furthermore, peptides containing radiation-altered amino acid residues might not be completely digestible by proteolytic enzymes. In this work, small homopeptides of Ala, Phe and Met were chosen as model peptides. Lysozyme was used to investigate the effect of ionizing radiation on a small protein. All peptides and lysozyme were irradiated in diluted, oxygen free, N2O-saturated aqueous solutions, using a 60Co-γ-source. HPLC, capillary GC and GC-MS were applied to isolate and characterize the radiation-induced products. The enzymatic digestibility of the products was investigated using aminopeptidase M, leucine aminopeptidase, carboxypeptidase A and carboxypeptidase Y. It was found that irradiation of peptides examined in this work leads to racemization and alteration of amino acid residues and crosslinks between the peptide chains. In addition, it was established that exopeptidases act differently on radiation-induced dimers of peptides composed of aliphatic, aromatic and sulfur-containing amino acids

  4. 棉铃虫中肠氨肽酶 APN4与 Cry1Ac、Cry2Aa 结合能力的比较%Comparison of the binding affinity of the APN4 receptor in Helicoverpa armigera (Hübner) to the Cry1Ac and Cry2Aa insecticidal proteins

    Institute of Scientific and Technical Information of China (English)

    袁向东; 葛朝虹; 肖玉涛; 梁革梅

    2015-01-01

    Objectives] Bt (Bacillus thuringiensis) insecticidal proteins have been widely adopted to control agricultural pests because of their high target specificity. The binding of a Bt insecticidal protein to its specific receptor in the insect midgut plays a key role in the insecticidal action process. Aminopeptidase N (APN) is one of the major Bt protein receptors. To better characterize the molecular mechanism underlying the insecticidal activity of different Bt insecitcidal proteins, and lay the foundation for Bt resistance management and novel Bt insecticidal protein development, we analyzed the binding affinity of aminopeptidase N4 (APN4) to the Cry1Ac and Cry2Aa insecitcidal proteins in Helicoverpa armigera. [Methods] The binding affinity of aminopeptidase N4 (APN4) was assessed using ligand blot analysis and an ELISA binding assay, respectively. [Results] The results show that recombinant APN4 could bind to both Cry1Ac and Cry2A; their respective dissociation constants were 46.7 nmol/L and 26.5 nmol/L. [Conclusion] The results suggest that there was no significant difference in the binding affinity of APN4 to Cry1Ac and Cry2Aa in H. armigera.%【目的】 Bt 杀虫蛋白(Bacillus thuringiensis)具有高度的靶标特异性,已经被广泛用于农业害虫防治。Bt 杀虫蛋白要发挥杀虫活性,必须首先与其受体蛋白结合,氨肽酶 N(Aminopeptidase N)是一类重要的 Bt 受体蛋白。因此,分析该受体与 Bt 杀虫蛋白的结合能力,可为进一步明确不同 Bt 的分子作用机制、Bt 的抗性治理以及新 Bt 的开发应用等提供借鉴。【方法】本文利用 Ligand blot 和 Elisa 方法比较了棉铃虫 Helicoverpa armigera 中肠 APN4(Aminopeptidase N4,APN4)与 Cry1Ac、Cry2Aa 的结合能力。【结果】原核表达的 APN4片段与活化的 Cry1Ac、Cry2Aa 都可以结合,解离常数(Kd)分别是48.59 nmol/L和21.73 nmol/L。【结论】 APN4片段与 Cry1Ac、Cry2Aa 的结合能力

  5. Dicty_cDB: VSJ753 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0.00 m2 : 0.00 mNt: 0.00 m3a: 0.00 m3b: 0.00 m_ : 1.00 80.0 %: nuclear 8.0 %: mitochondrial 4.0 %: cytoskeletal 4.0 %: plasma membra...llus cereus subsp. cytotoxi... 32 6.4 DQ374391_1( DQ374391 |pid:none) Branchiostoma floridae amilorid...nslated Amino Acid sequence (All Frames) Frame A: inyyymh*rkevpitlvlsllfckkrklkpqp*hhty...um cysteine aminopeptidase (pepC) gene, partial cds; phospho-beta-glucosidase BglB (bglB), beta-glucoside specific tra...vs Protein Score E Sequences producing significant alignments: (bits) Value CP000764_1849( CP000764 |pid:none) Baci

  6. Comparison among Different Gilthead Sea Bream (Sparus aurata Farming Systems: Activity of Intestinal and Hepatic Enzymes and 13C-NMR Analysis of Lipids

    Directory of Open Access Journals (Sweden)

    Vincenzo Zonno

    2009-12-01

    Full Text Available In order to evaluate differences in general health and nutritional values of gilthead sea bream (Sparus aurata, the effects of semi-intensive, land-based tanks and sea-cages intensive rearing systems were investigated, and results compared with captured wild fish. The physiological state was determined by measuring the activity of three different intestinal digestive enzymes: alkaline phosphatase (ALP, leucine aminopeptidase (LAP and maltase; and the activity of the hepatic ALP. Also, the hepatic content in protein, cholesterol, and lipid were assessed. 13C-NMR analysis for qualitative and quantitative characterization of the lipid fraction extracted from fish muscles for semiintensive and land based tanks intensive systems was performed. The lipid fraction composition showed small but significant differences in the monounsaturated/saturated fatty acid ratio, with the semi-intensive characterized by higher monounsaturated and lower saturated fatty acid content with respect to land based tanks intensive rearing system.

  7. Enzymatic activity of "high-mannose" glycosylated forms of intestinal microvillar hydrolases

    DEFF Research Database (Denmark)

    Sjöström, H; Norén, Ove; Danielsen, E M

    1985-01-01

    glycosylated form, whereas no difference was observed for the two other enzymes. The change in glycosylation from high-mannose to complex form thus seems to be of importance for the enzymatic activity of sucrase-isomaltase either by direct structural involvement or by a general stabilization effect on the......The "high-mannose" glycosylated forms of aminopeptidase N (EC 3.4.11.2), maltase-glucoamylase (EC 3.2.1.20), and sucrase-isomaltase (EC 3.2.1.48, EC 3.2.1.10) have been purified. The high-mannose glycosylated form of sucrase-isomaltase was found to have a lower specific activity than the complex...

  8. HYDROPHOBICALLY MODIFIED PECTATES AS NOVEL FUNCTIONAL POLYMERS IN FOOD AND NON-FOOD APPLICATIONS

    Directory of Open Access Journals (Sweden)

    Zdenka Hromádková

    2008-02-01

    Full Text Available Butyl and hexyl amides of pectate with various amidation degrees were prepared from citrus pectin by means of alkylamidation of methyl-esterified pectins, followed by the total alkaline pectin methyl esters hydrolysis. These water soluble derivatives were characterized chem-ically as well as by elementary analysis and FT-IR spectroscopy. All prepared pectate amides exhibited the excellent emulsifying efficiency, and pectate hexyl amide also the ability to form stable foam. As the results of the study on the effect of pectin with DE 66% on the function of small intestine in pectin fed rats, the increase of specific activity of alkaline phosphatase, maltase, and aminopeptidase and the decrease of food utilization was demonstrated. The pectin derivatives might serve as emulsifiers and foaming additives in food production and other areas as well as nutraceuticals for obesity treatment.

  9. Deep-apical tubules: dynamic lipid-raft microdomains in the brush-border region of enterocytes

    DEFF Research Database (Denmark)

    Hansen, Gert H; Pedersen, Jens; Niels-Christiansen, Lise-Lotte;

    2003-01-01

    raft microdomains. Deep-apical tubules were positioned close to the actin rootlets of adjacent microvilli in the terminal web region, which had a diameter of 50-100 nm, and penetrated up to 1 microm into the cytoplasm. Markers for transcytosis, IgA and the polymeric immunoglobulin receptor, as well as...... lipid raft-containing compartments, but little is otherwise known about these raft microdomains. We therefore studied in closer detail apical lipid-raft compartments in enterocytes by immunogold electron microscopy and biochemical analyses. Novel membrane structures, deep-apical tubules, were visualized...... the resident brush-border enzyme aminopeptidase N, were present in these deep-apical tubules. We propose that deep-apical tubules are a specialized lipid-raft microdomain in the brush-border region functioning as a hub in membrane trafficking at the brush border. In addition, the sensitivity to...

  10. Activity and stability of recombinant human superoxide dismutase in buffer solutions and hypothermic perfusates.

    Directory of Open Access Journals (Sweden)

    Senoo,Yoshimasa

    1988-06-01

    Full Text Available The stability of recombinant human superoxide dismutase (r-hSOD in buffer solutions was studied in solutions at various pH and temperatures. Additionally, we studied the effects of incubation with proteases, serum and two types of hypothermic perfusates. R-hSOD was stable in the pH range of 6-11 and at temperatures up to 80 degrees C for 30 min. R-hSOD activity was not affected by incubation with trypsin, aminopeptidase M or serum for 2 h. R-hSOD activity determined at various temperatures (4-37 degrees C did not vary remarkably. R-hSOD in hypothermic perfusates was stable at 4-37 degrees C for 24 h.

  11. Proteomic Analysis of Responsive Proteins Induced in Japanese Birch Plantlet Treated with Salicylic Acid

    Directory of Open Access Journals (Sweden)

    Hiromu Suzuki

    2014-07-01

    Full Text Available The present study was performed to unravel the mechanisms of systemic acquired resistance (SAR establishment and resistance signaling pathways against the canker-rot fungus (Inonotus obliquus strain IO-U1 infection in Japanese birch plantlet No.8. Modulation of protein-profile induced by salicylic acid (SA-administration was analyzed, and SA-responsive proteins were identified. In total, 5 specifically expressed, 3 significantly increased, and 3 significantly decreased protein spots were identified using liquid chromatography/tandem mass spectrometry (LC/MS/MS and the sequence tag method. These proteins were malate dehydrogenase, succinate dehydrogenase, phosphoglycerate kinase, diaminopimalate decarboxylase, arginase, chorismate mutase, cyclophilin, aminopeptidase, and unknown function proteins. These proteins are considered to be involved in SAR-establishment mechanisms in the Japanese birch plantlet No 8.

  12. Enzyme Activities in Waste Water and Activated Sludge

    DEFF Research Database (Denmark)

    Nybroe, Ole; Jørgensen, Per Elberg; Henze, Mogens

    1992-01-01

    measured as colony forming units of heterotrophic bacteria. A panel of four enzyme activity assays, α-glucosidase, alanine-aminopeptidase, esterase and dehydrogenase were used to characterize activated sludge and anaerobic hydrolysis sludge from a pilot scale plant. The enzymatic activity profiles were...... distinctly different, suggesting that microbial populations were different, or had different physiological properties, in the two types of sludge. Enzyme activity profiles in activated sludge from four full-scale plants seemed to be highly influenced by the composition of the inlet. Addition of hydrolysed......The purpose of the present study was to evaluate the potential of selected enzyme activity assays to determine microbial abundance and heterotrophic activity in waste water and activated sludge. In waste water, esterase and dehydrogenase activities were found to correlate with microbial abundance...

  13. Characterization of the proteases in the midgut of the xylophagous larvae of Oemona hirta (Coleoptera:Cerambycidae)

    Institute of Scientific and Technical Information of China (English)

    Brian David Shaw; John Tane Christeller

    2009-01-01

    The protein digestive capability oftbe larvae of the longhorn beetle (Oemona hirta,Coleoptera:Cerambycidae,Fabricius,1775) was investigated.This species feeds only on wood where there is a high proportion of vascular tissue.The pH of the midgut,the major digestive organ,was alkaline and protein hydrolysis was maximal at alkaline pH.Use of specific synthetic peptide substrates showed that the major protease activities were the endopeptidases,trypsin and chymotrypsin-like activity,and the exopeptidase,leucine aminopeptidase and the pH curves corresponded to that with protein substrate.Studies using a range ofsefine protease inhibitors as well as specific inhibitors ofmetalloproteases,cysteine proteases and aspartate proteases confirmed a serine protease-based digestive system similar to earlier reports of sapwood-feeding Cerambycids.Control of these insect pests using protease inhibitors is discussed.

  14. A importância de ERAP1 e PPARץ para o desenvolvimento de artrite

    OpenAIRE

    Freire, Patrícia Colchete

    2013-01-01

    A inflamação das articulações, conhecida por artrite, é uma doença que afecta mais de 175 milhões de pessoas no mundo e, além de ter um grande impacto na qualidade de vida dos doentes, constitui uma carga monetária elevada. Mutações em ERAP1 – uma aminopeptidase comummente encontrada no RE e responsável pela apresentação de péptidos ao sistema imunitário – e PPARγ – um receptor nuclear mais frequentemente associado com o processamento de ácidos gordos e glucose – foram previamente associadas ...

  15. ERAP1-ERAP2 dimerization increases peptide-trimming efficiency.

    Science.gov (United States)

    Evnouchidou, Irini; Weimershaus, Mirjana; Saveanu, Loredana; van Endert, Peter

    2014-07-15

    The endoplasmic reticulum aminopeptidases (ERAP)1 and ERAP2 play a critical role in the production of final epitopes presented by MHC class I molecules. Formation of heterodimers by ERAP1 and ERAP2 has been proposed to facilitate trimming of epitope precursor peptides, but the effects of dimerization on ERAP function remain unknown. In this study, we produced stabilized ERAP1-ERAP2 heterodimers and found that they produced several mature epitopes more efficiently than a mix of the two enzymes unable to dimerize. Physical interaction with ERAP2 changes basic enzymatic parameters of ERAP1 and improves its substrate-binding affinity. Thus, by bringing the two enzymes in proximity and by producing allosteric effects on ERAP1, dimerization of ERAP1/2 creates complexes with superior peptide-trimming efficacy. Such complexes are likely to enhance Ag presentation by cells displaying coordinated expression of the two enzymes. PMID:24928998

  16. Folding of intestinal brush border enzymes. Evidence that high-mannose glycosylation is an essential early event

    DEFF Research Database (Denmark)

    Danielsen, E M

    1992-01-01

    enzymes. In pulse-labeled mucosal explants, complete synthesis of the polypeptide chains of aminopeptidase N and sucrase-isomaltase required about 2 and 4 min, respectively, whereas maximal antiserum precipitation was acquired with half-times of 4-5 and 8 min, respectively. Fructose, which induces a...... posttranslational process. In the presence of fructose, not only the malglycosylated forms but also the electrophoretically normal, high-mannose-glycosylated form of the brush border enzymes were retained in the endoplasmic reticulum and proteolytically degraded. The results obtained demonstrate an intimate...... interrelationship between glycosylation and polypeptide folding in the synthesis of membrane glycoproteins and, more specifically, indicate that the timing of these two early biosynthetic events is essential for correct polypeptide folding....

  17. Galectin-4 and small intestinal brush border enzymes form clusters

    DEFF Research Database (Denmark)

    Danielsen, E M; van Deurs, B

    1997-01-01

    lacking a N-terminal signal peptide for membrane translocation, was discovered in these complexes as well, and in gradient centrifugation brush border enzymes and galectin-4 formed distinct soluble high molecular weight clusters. Immunoperoxidase cytochemistry and immunogold electron microscopy showed......Detergent-insoluble complexes prepared from pig small intestine are highly enriched in several transmembrane brush border enzymes including aminopeptidase N and sucrase-isomaltase, indicating that they reside in a glycolipid-rich environment in vivo. In the present work galectin-4, an animal lectin...... that galectin-4 is indeed an intestinal brush border protein; we also localized galectin-4 throughout the cell, mainly associated with membraneous structures, including small vesicles, and to the rootlets of microvillar actin filaments. This was confirmed by subcellular fractionation, showing about...

  18. Distribution of three microvillar enzymes along the small intestinal crypt-villus axis

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Niels-Christiansen, L L; Poulsen, M D;

    1994-01-01

    of the axis, whereas ApN is found mainly in the villar and upper crypt enterocytes. All three enzymes are detected in the basolateral membrane at all levels along the crypt-villus axis, although ApN and S-I only occurred at low intensities in the villus region. The microvillar/basolateral labelling...... ratio for the three enzymes increases to a varying degree for the three enzymes along the axis suggesting that the sorting efficiency to the apical membrane improves at least for ApN and S-I as the cells mature. These findings might indicate that the enterocytes change from a transcytotic to a direct......Aminopeptidase N (ApN), dipeptidyl peptidase IV (DPP IV) and sucrose-isomaltase (S-I) are differentially expressed along the pig jejunum crypt-villus axis. Quantitative immunoelectron microscopy and enzyme cytochemistry show that DPP IV and S-I are expressed in enterocytes along the entire length...

  19. Enzyme Activities in Waste Water and Activated Sludge

    DEFF Research Database (Denmark)

    Nybroe, Ole; Jørgensen, Per Elberg; Henze, Mogens

    1992-01-01

    The purpose of the present study was to evaluate the potential of selected enzyme activity assays to determine microbial abundance and heterotrophic activity in waste water and activated sludge. In waste water, esterase and dehydrogenase activities were found to correlate with microbial abundance...... measured as colony forming units of heterotrophic bacteria. A panel of four enzyme activity assays, α-glucosidase, alanine-aminopeptidase, esterase and dehydrogenase were used to characterize activated sludge and anaerobic hydrolysis sludge from a pilot scale plant. The enzymatic activity profiles were...... distinctly different, suggesting that microbial populations were different, or had different physiological properties, in the two types of sludge. Enzyme activity profiles in activated sludge from four full-scale plants seemed to be highly influenced by the composition of the inlet. Addition of hydrolysed...

  20. Characterisation and partial purification of proteolytic enzymes from sardine by-products to obtain concentrated hydrolysates.

    Science.gov (United States)

    Castro-Ceseña, Ana Bertha; del Pilar Sánchez-Saavedra, M; Márquez-Rocha, Facundo J

    2012-11-15

    A procedure to recover proteases and lipases from the by-products of Monterey sardine (Sardinops sagax caerulea) has been developed, comprising 2 steps: a centrifugation at low temperature to eliminate more than 90% of the initial fat content, and an acetone precipitation step. After this treatment, enzymatic activity increased by 33.8% for lipase, 15.5% for trypsin, 14.8% for chymotrypsin, 93.4% for aminopeptidase, and 19.7% for pepsin. The extents of hydrolysis of fish by-product proteins by endogenous enzyme by-product extract, viscera concentrate extract, and commercial Alcalase® were 62%, 85%, and 28%, respectively. The two extract preparations from sardine by-product (viscera and by-product concentrate extracts) produced 3-fold greater hydrolysis than with the commercial enzyme. The recovery of enzyme concentrates from sardine waste has both ecological and economical advantages for the fish industry. PMID:22868132

  1. Seasonal patterns of nitrogen cycling in subtropical short-hydroperiod wetlands: Effects of precipitation and restoration.

    Science.gov (United States)

    Liao, Xiaolin; Inglett, Patrick W; Inglett, Kanika S

    2016-06-15

    In the event of increased frequency of extreme wet or dry events resulting from climate change, it becomes more important to understand the temporal dynamics of soil nitrogen (N) processes in ecosystems. Here, seasonal patterns of N cycling were characterized in subtropical wetlands in Everglades National Park, Florida, USA. Two restored sites and one reference site with different nutrient status, soil depth, and vegetation communities, were selected. Soil available N, microbial biomass, potential N mineralization and denitrification rates, enzyme activities of leucine aminopeptidase (LAP) and N-acetyl-β-d-glucosaminidase (NAG) were measured across the wet and dry seasons from 2010 to 2011. In general, most N processes were significantly correlated with soil water contents (Pcycling. PMID:26971214

  2. Superoxide dismutase activity as a function of culture aging of B-16 mouse melanoma cells

    Directory of Open Access Journals (Sweden)

    JOVANA B. SIMIC-KRSTIC

    2004-12-01

    Full Text Available The C3 clone of B-16 mouse melanoma was cultured for 1, 6 and 9 days and analysed. The changes which are not directly linked to melanogenesis in the B-16 / C3 cultures during their maturation were characterized. Early (1 day, confluent (6 days and old (9 days cell cultures are distinguished by their leucine aminopeptidase (LAP and a-naphthyl acetate esterase (ANAE isoenzyme patterns. Both quantitative and qualitative changes in LAP and ANAE isoenzyme can be observed during culture maturation. There is an increase in the activity of the enzyme copper, zinc-containing superoxide-dismutase (CuZn SOD. The increaase in the CuZn SOD enzyme activity might be related to B-16/C3 cell melanogenesis and / or to differentiation.

  3. 68Ga-Labeled Cyclic NGR Peptide for MicroPET Imaging of CD13 Receptor Expression

    Directory of Open Access Journals (Sweden)

    Yahui Shao

    2014-08-01

    Full Text Available Peptides containing the asparagines-glycine-arginine (NGR motif have been identified as specific ligands binding to CD13/aminopeptidase N (APN receptor, a tumor neovascular biomarker. In this study, we synthesized a novel NGR-containing peptide (NOTA-G3-NGR, and labeled NOTA-G3-NGR with 68Ga (t1/2 = 67.7 min. The resulting 68Ga-NOTA-G3-NGR peptide was subject to in vitro and in vivo characterization. The microPET imaging results revealed that the 68Ga-NOTA-G3-NGR peptide exhibits rapid and specific tumor uptake, and high tumor-to-background contrast in a subcutaneous HT-1080 fibrosarcoma mouse model. We concluded that the 68Ga-NOTA-G3-NGR peptide has potential in the diagnosis of CD13-targeted tumor angiogenesis.

  4. Sialic Acid Binding Properties of Soluble Coronavirus Spike (S1 Proteins: Differences between Infectious Bronchitis Virus and Transmissible Gastroenteritis Virus

    Directory of Open Access Journals (Sweden)

    Christine Winter

    2013-07-01

    Full Text Available The spike proteins of a number of coronaviruses are able to bind to sialic acids present on the cell surface. The importance of this sialic acid binding ability during infection is, however, quite different. We compared the spike protein of transmissible gastroenteritis virus (TGEV and the spike protein of infectious bronchitis virus (IBV. Whereas sialic acid is the only receptor determinant known so far for IBV, TGEV requires interaction with its receptor aminopeptidase N to initiate infection of cells. Binding tests with soluble spike proteins carrying an IgG Fc-tag revealed pronounced differences between these two viral proteins. Binding of the IBV spike protein to host cells was in all experiments sialic acid dependent, whereas the soluble TGEV spike showed binding to APN but had no detectable sialic acid binding activity. Our results underline the different ways in which binding to sialoglycoconjugates is mediated by coronavirus spike proteins.

  5. Endocytic trafficking from the small intestinal brush border probed with FM dye

    DEFF Research Database (Denmark)

    Hansen, Gert H; Rasmussen, Karina; Niels-Christiansen, Lise-Lotte;

    2009-01-01

    The small intestinal brush border functions as the body's main portal for uptake of dietary nutrients and simultaneously acts as the largest permeability barrier against pathogens. To enable this, the digestive enzymes of the brush border are organized in lipid raft microdomains stabilized by cross...... incorporated into the brush border, and by 15 min faint but distinct punctae were detectable about 1 m beneath the brush border, indicative of a constitutive endocytosis. The punctae represented a subpopulation of early endosomes confined to the actomyosin-rich terminal web region, and their number...... localized deeper into the cytoplasm of the enterocytes. Two major raft-associated brush border enzymes, alkaline phosphatase and aminopeptidase N, were excluded from endocytosis. We propose that the terminal web cytoskeleton, by inhibiting traffic from apical early endosomes further into the cell...

  6. Allium sativum aqueous extract prevents potassium dichromate-induced nephrotoxicity and lipid oxidation in rats

    Directory of Open Access Journals (Sweden)

    Sergio L. Becerra-Torres

    2014-04-01

    Full Text Available Context: The potassium dichromate (K2Cr2O7 induces nephrotoxicity by oxidative stress mechanisms. Aims: To study the potential protection of an aqueous extract of Allium sativum against the K2Cr2O7-induced nephrotoxicity and lipid oxidation in rats. Methods: Twenty four hours after treatment, biomarkers such as proteinuria, creatinine clearance, malondialdehyde production, specific enzyme activity of gamma glutamyl transpeptidase and alanine aminopeptidase, and renal clearance of para-aminohippuric acid and inulin were measured. Results: The K2Cr2O7 caused significant renal dysfunction, but A. sativum extract prevented this condition by improving all measured biomarkers. Conclusions: A single injection of K2Cr2O7 induced nephrotoxicity in rats, but the supply of an Allium sativum aqueous extract prevented the disorders caused by this metal.

  7. Expressed sequence tags from larval gut of the European corn borer (Ostrinia nubilalis: Exploring candidate genes potentially involved in Bacillus thuringiensis toxicity and resistance

    Directory of Open Access Journals (Sweden)

    Crespo Andre LB

    2009-06-01

    Full Text Available Abstract Background Lepidoptera represents more than 160,000 insect species which include some of the most devastating pests of crops, forests, and stored products. However, the genomic information on lepidopteran insects is very limited. Only a few studies have focused on developing expressed sequence tag (EST libraries from the guts of lepidopteran larvae. Knowledge of the genes that are expressed in the insect gut are crucial for understanding basic physiology of food digestion, their interactions with Bacillus thuringiensis (Bt toxins, and for discovering new targets for novel toxins for use in pest management. This study analyzed the ESTs generated from the larval gut of the European corn borer (ECB, Ostrinia nubilalis, one of the most destructive pests of corn in North America and the western world. Our goals were to establish an ECB larval gut-specific EST database as a genomic resource for future research and to explore candidate genes potentially involved in insect-Bt interactions and Bt resistance in ECB. Results We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from these libraries. A total of 12,519 ESTs (83.4% appeared to be high quality with an average length of 656 bp. These ESTs represented 2,895 unique sequences, including 1,738 singletons and 1,157 contigs. Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10-3with the sequences available in GenBank. Our EST analysis revealed 52 candidate genes that potentially have roles in Bt toxicity and resistance. These genes encode 18 trypsin-like proteases, 18 chymotrypsin-like proteases, 13 aminopeptidases, 2 alkaline phosphatases and 1 cadherin-like protein. Comparisons of expression profiles of 41 selected candidate genes between Cry1Ab-susceptible and resistant strains of ECB by RT-PCR showed apparently decreased expressions in 2 trypsin-like and 2

  8. Malabsorption syndrome observed in the common octopus Octopus vulgaris infected with Aggregata octopiana (Protista: Apicomplexa).

    Science.gov (United States)

    Gestal, C; Páez de la Cadena, M; Pascual, S

    2002-08-15

    Octopus vulgaris infected with Aggregata octopiana were collected from an open-water culture system in the Ría of Aldán (NW Spain). Digestive tract infection values were determined with the use of a Neubauer chamber by counting the number of A. octopiana sporocysts. After determining enzyme activity values by the colorimetric Api-Zym system Biomerieux, one representative enzyme of glycosidases, peptid hydrolases and phosphoric hydrolases showing high activity was spectrophotometrically analysed. The enzymes were maltase and leucine-aminopeptidase (LAP) involved in the absorption process, and acid phosphatase, a lysosomic enzyme, respectively. Enzymatic activity of maltase and LAP decreased significantly, with increased sporocyst counts. However, acid phosphatase activity increased with severity of infection, indicating the presence of degradative enzymes from phagocytic cells in the infected area. A detrimental effect on gastrointestinal function may result from a decrease or malfunction of absorption enzymes. The results suggest a malabsorption syndrome resulting from parasitic infection. PMID:12240971

  9. Quantitative Enzymatic and Immunologic Histophotometry of Diseased Human Kid-Ney Tissues Using Tv-Camera and Computer Assisted Image Processing Systems.

    Science.gov (United States)

    Heinert, G.; Mondorf, W.

    1982-11-01

    High speed image processing was used to analyse morphologic and metabolic characteristics of clinically relevant kidney tissue alterations.Qualitative computer-assisted histophotometry was performed to measure alterations in levels of the enzymes alkaline phosphatase (Ap),alanine aminopeptidase (AAP),g-glutamyltranspepti-dase (GGTP) and A-glucuronidase (B-G1) and AAP and GGTP immunologically determined in prepared renal and cancer tissue sections. A "Mioro-Videomat 2" image analysis system with a "Tessovar" macroscope,a computer-assisted "Axiomat" photomicroscope and an "Interactive Image Analysis System (IBAS)" were employed for analysing changes in enzyme activities determined by changes in absorbance or transmission.Diseased kidney as well as renal neoplastic tissues could be distinguished by significantly (wilcoxon test,phuman kidney tissues.This image analysis techniques might be of potential use in diagnostic and prognostic evaluation of renal cancer and diseased kidney tissues.

  10. Pepsin Egg White Hydrolysate Ameliorates Obesity-Related Oxidative Stress, Inflammation and Steatosis in Zucker Fatty Rats.

    Directory of Open Access Journals (Sweden)

    M Garcés-Rimón

    Full Text Available The aim of this work was to evaluate the effect of the administration of egg white hydrolysates on obesity-related disorders, with a focus on lipid metabolism, inflammation and oxidative stress, in Zucker fatty rats. Obese Zucker rats received water, pepsin egg white hydrolysate (750 mg/kg/day or Rhizopus aminopeptidase egg white hydrolysate (750 mg/kg/day for 12 weeks. Lean Zucker rats received water. Body weight, solid and liquid intakes were weekly measured. At the end of the study, urine, faeces, different organs and blood samples were collected. The consumption of egg white hydrolysed with pepsin significantly decreased the epididymal adipose tissue, improved hepatic steatosis, and lowered plasmatic concentration of free fatty acids in the obese animals. It also decreased plasma levels of tumor necrosis factor-alpha and reduced oxidative stress. Pepsin egg white hydrolysate could be used as a tool to improve obesity-related complications.

  11. Purification and sequencing of the active site tryptic peptide from penicillin-binding protein 1b of Escherichia coli

    International Nuclear Information System (INIS)

    This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with [14C]penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed that the serine residue in the middle of the sequence was covalently bonded to the [14C]penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented

  12. Fasciola hepatica: Avances en el empleo de candidatos vacunales (Fasciola hepatica: Advance of vaccine candidates’ employ

    Directory of Open Access Journals (Sweden)

    Naranjo, Feliciano, Dany;

    2008-04-01

    Full Text Available ResumenDiferentes estudios sugieren que la vacunación con determinados antígenos de Fasciola hepatica puede ser un medio eficaz para el control de esta enfermedad. Este artículo revisa los resultados de varios ensayos vacunales recientes con los más importantes candidatos vacunales: proteínas de unión a ácidos grasos (FABP, cisteíno proteasas (catepsinas, hemoglobina, leucin aminopeptidasa (LAP y proteínas del tipo saponina.SummarySeveral studies suggest the vaccination with determined Fasciola hepatica’s antigens can be an efficient mean for the control of this disease. This paper reviews the results of several recent vaccine trials with the major vaccine candidates: fatty acid binding protein (FABP, cysteine (cathepsins proteases, haemoglobulin, leucine aminopeptidase (LAP, and a saposin-like protein.

  13. Dicty_cDB: Contig-U16590-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ) Xenopus laevis hypothetical protei... 261 e-103 NRL( 1BLLE ) Leucine aminopeptidase (EC 3.4.11.1) complex with ama...15; ZMMBBc00... 42 0.25 4 ( AY523600 ) Synthetic construct his-tagged cytosolic leucine ... 50 0.28 1 ( U83906 ) Schistosoma ma....4 1 ( CJ394923 ) Molgula tectiformis cDNA, gonad clone:mtgd023n11,... 46 4.4 1 ( CU468230 ) Acinetobacter baumannii str. SDF, co...) Uncultured Prochlorococcus marinu... 170 1e-50 CP000116_580( CP000116 |pid:none) Thiobacillus denitrifica...gobium aromaticivorans ... 178 1e-54 CP000027_991( CP000027 |pid:none) Dehalococcoides ethenogene

  14. Isoenzymatic polymorphism in Citrus spp. and Poncirus trifoliata (L. Raf. (Rutaceae

    Directory of Open Access Journals (Sweden)

    Novelli Valdenice Moreira

    2000-01-01

    Full Text Available Isoenzymatic polymorphism analysis was used to determine genetic variability among species and hybrids of Citrus spp. and one accession of Poncirus trifoliata (L. Raf. Ten enzymatic systems aspartate aminotransferase (AAT, acid phosphatase (ACP, leucine aminopeptidase (LAP, 6-phosphogluconate dehydrogenase (6-PGD, isocitrate dehydrogenase (IDH, phosphoglucoisomerase (PGI, phosphoglucomutase (PGM, diaphorase (DIA, shikimate dehydrogenase (SKD and peroxidase (PRX were analyzed. Twenty loci and 48 alleles were identified. Sweet orange cultivars (C. sinensis (L. Osbeck showed the highest polymorphism with the largest number of heterozygous loci, although the alleles of those loci were the same in all cultivars, with the exception of Westin and Lima graúda. Mandarins (C. reticulata Blanco exhibited diverse patterns, whereas Poncirus trifoliata (L. Raf. showed high variability with all Citrus species and hybrids. Exclusive phenotypes were observed in some enzymatic systems, and similar patterns were found among interspecific hybrids and their putative parents.

  15. Optimising methodology for determining the effect of ocean acidification on bacterial extracellular enzymes

    Science.gov (United States)

    Burrell, T. J.; Maas, E. W.; Teesdale-Spittle, P.; Law, C. S.

    2015-04-01

    To fully understand the impact of ocean acidification on biogeochemical cycles, the response of bacterial extracellular enzymes needs to be considered as they play a central role in the degradation and distribution of labile organic matter. This study investigates the methodology, and potential artefacts involved in determining the response of bacterial extracellular glucosidase and protease to ocean acidification. The effect of pH on artificial fluorophores and substrates was examined, as well as the impact of three different acidification methods. The results indicate that pH has a significant effect on the fluorescence of the artificial fluorophore 4-methylumbeliferone for glucosidase activity, and 7-amino-4-methylcoumarin for protease activity, while artificial aminopeptidase substrate alters the pH of seawater, confirming previous observations. Before use in ocean acidification research these enzyme assay components must be buffered in order to stabilise sample pH. Reduction of coastal seawater pH to 7.8 was shown to increase β-glucosidase activity rapidly (0.5 h), while no significant response was detected for leucine aminopeptidase, highlighting the need for short-term direct effects of pH on enzyme activities. Bubbling with CO2 gas resulted in higher β-glucosidase activity when compared to acidification using gas-permeable silicon tubing and acidification with HCl. Although bubbling showed variable effects between two experiments conducted at different times of the year. In addition, bacterial cell numbers were 15-40% higher with bubbling relative to seawater acidified with gas-permeable silicon tubing and HCl. Artefacts associated with bubbling may lead to the overestimation of extracellular enzyme activities, and interpretation of the impacts of ocean acidification on organic matter cycling.

  16. Balancing selection maintains a form of ERAP2 that undergoes nonsense-mediated decay and affects antigen presentation.

    Directory of Open Access Journals (Sweden)

    Aida M Andrés

    2010-10-01

    Full Text Available A remarkable characteristic of the human major histocompatibility complex (MHC is its extreme genetic diversity, which is maintained by balancing selection. In fact, the MHC complex remains one of the best-known examples of natural selection in humans, with well-established genetic signatures and biological mechanisms for the action of selection. Here, we present genetic and functional evidence that another gene with a fundamental role in MHC class I presentation, endoplasmic reticulum aminopeptidase 2 (ERAP2, has also evolved under balancing selection and contains a variant that affects antigen presentation. Specifically, genetic analyses of six human populations revealed strong and consistent signatures of balancing selection affecting ERAP2. This selection maintains two highly differentiated haplotypes (Haplotype A and Haplotype B, with frequencies 0.44 and 0.56, respectively. We found that ERAP2 expressed from Haplotype B undergoes differential splicing and encodes a truncated protein, leading to nonsense-mediated decay of the mRNA. To investigate the consequences of ERAP2 deficiency on MHC presentation, we correlated surface MHC class I expression with ERAP2 genotypes in primary lymphocytes. Haplotype B homozygotes had lower levels of MHC class I expressed on the surface of B cells, suggesting that naturally occurring ERAP2 deficiency affects MHC presentation and immune response. Interestingly, an ERAP2 paralog, endoplasmic reticulum aminopeptidase 1 (ERAP1, also shows genetic signatures of balancing selection. Together, our findings link the genetic signatures of selection with an effect on splicing and a cellular phenotype. Although the precise selective pressure that maintains polymorphism is unknown, the demonstrated differences between the ERAP2 splice forms provide important insights into the potential mechanism for the action of selection.

  17. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects.

    Science.gov (United States)

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra

    2009-10-01

    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  18. Stabilizing effect of biochar on soil extracellular enzymes after a denaturing stress.

    Science.gov (United States)

    Elzobair, Khalid A; Stromberger, Mary E; Ippolito, James A

    2016-01-01

    Stabilizing extracellular enzymes may maintain enzymatic activity while protecting enzymes from proteolysis and denaturation. A study determined whether a fast pyrolysis hardwood biochar (CQuest™) would reduce evaporative losses, subsequently stabilizing soil extracellular enzymes and prohibiting potential enzymatic activity loss following a denaturing stress (microwaving). Soil was incubated in the presence of biochar (0%, 1%, 2%, 5%, or 10% by wt.) for 36 days and then exposed to microwave energies (0, 400, 800, 1600, or 3200 J g(-1) soil). Soil enzymes (β-glucosidase, β-d-cellobiosidase, N-acetyl-β-glucosaminidase, phosphatase, leucine aminopeptidase, β-xylosidase) were analyzed by fluorescence-based assays. Biochar amendment reduced leucine aminopeptidase and β-xylosidase potential activity after the incubation period and prior to stress exposure. The 10% biochar rate reduced soil water loss at the lowest stress level (400 J microwave energy g(-1) soil). Enzyme stabilization was demonstrated for β-xylosidase; intermediate biochar application rates prevented a complete loss of this enzyme's potential activity after soil was exposed to 400 (1% biochar treatment) or 1600 (5% biochar treatment) J microwave energy g(-1) soil. Remaining enzyme potential activities were not affected by biochar, and activities decreased with increasing stress levels. We concluded that biochar has the potential to reduce evaporative soil water losses and stabilize certain extracellular enzymes where activity is maintained after a denaturing stress; this effect was biochar rate and enzyme dependent. While biochar may reduce the potential activity of certain soil extracellular enzymes, this phenomenon was not universal as the majority of enzymes assayed in this study were unaffected by exposure to biochar. PMID:25840745

  19. Inhibition of APN/CD13 leads to suppressed progressive potential in ovarian carcinoma cells

    Directory of Open Access Journals (Sweden)

    Mizutani Shigehiko

    2007-07-01

    Full Text Available Abstract Background Aminopeptidase N (APN/CD13, a 150-kDa metalloprotease, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression of several human malignancies. In the current study, we investigated the role of APN/CD13 in ovarian carcinoma (OVCA progression. Methods We first examined the expression of APN/CD13 at the protein level in a variety of OVCA cell lines and tissues. We subsequently investigated whether there was a correlation between APN/CD13 expression and invasive potential of various OVCA cell lines. Moreover, we investigated the function of APN/CD13 in OVCA cells using bestatin, an APN/CD13 inhibitor, or transfection of siRNA for APN/CD13. Results We confirmed that APN/CD13 was expressed in OVCA tissues and cell lines to various extents. There was a positive correlation between APN/CD13 expression and migratory potential in various OVCA cell lines with accordingly enhanced secretion of endogenous MMP-2. Subsequently, we found a significant decrease in the proliferative and migratory abilities of OVCA cells after the addition of bestatin or the inhibition of APN/CD13 expression by siRNA. Furthermore, in an animal model, daily intraperitoneal administration of bestatin after inoculation of OVCA cells resulted in a decrease of peritoneal dissemination and in prolonged survival of nude mice. Conclusion The current data indicate the possible involvement of APN/CD13 in the development of OVCA, and suggest that clinical use of bestatin may contribute to better prognosis for ovarian carcinoma patients.

  20. Inhibition of APN/CD13 leads to suppressed progressive potential in ovarian carcinoma cells

    International Nuclear Information System (INIS)

    Aminopeptidase N (APN/CD13), a 150-kDa metalloprotease, is a multifunctional cell surface aminopeptidase with ubiquitous expression. Recent studies have suggested that APN/CD13 plays an important role in tumor progression of several human malignancies. In the current study, we investigated the role of APN/CD13 in ovarian carcinoma (OVCA) progression. We first examined the expression of APN/CD13 at the protein level in a variety of OVCA cell lines and tissues. We subsequently investigated whether there was a correlation between APN/CD13 expression and invasive potential of various OVCA cell lines. Moreover, we investigated the function of APN/CD13 in OVCA cells using bestatin, an APN/CD13 inhibitor, or transfection of siRNA for APN/CD13. We confirmed that APN/CD13 was expressed in OVCA tissues and cell lines to various extents. There was a positive correlation between APN/CD13 expression and migratory potential in various OVCA cell lines with accordingly enhanced secretion of endogenous MMP-2. Subsequently, we found a significant decrease in the proliferative and migratory abilities of OVCA cells after the addition of bestatin or the inhibition of APN/CD13 expression by siRNA. Furthermore, in an animal model, daily intraperitoneal administration of bestatin after inoculation of OVCA cells resulted in a decrease of peritoneal dissemination and in prolonged survival of nude mice. The current data indicate the possible involvement of APN/CD13 in the development of OVCA, and suggest that clinical use of bestatin may contribute to better prognosis for ovarian carcinoma patients

  1. Proteasome inhibitors alter levels of intracellular peptides in HEK293T and SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Sayani Dasgupta

    Full Text Available The proteasome cleaves intracellular proteins into peptides. Earlier studies found that treatment of human embryonic kidney 293T (HEK293T cells with epoxomicin (an irreversible proteasome inhibitor generally caused a decrease in levels of intracellular peptides. However, bortezomib (an antitumor drug and proteasome inhibitor caused an unexpected increase in the levels of most intracellular peptides in HEK293T and SH-SY5Y cells. To address this apparent paradox, quantitative peptidomics was used to study the effect of a variety of other proteasome inhibitors on peptide levels in HEK293T and SH-SY5Y cells. Inhibitors tested included carfilzomib, MG132, MG262, MLN2238, AM114, and clasto-Lactacystin β-lactone. Only MG262 caused a substantial elevation in peptide levels that was comparable to the effect of bortezomib, although carfilzomib and MLN2238 elevated the levels of some peptides. To explore off-target effects, the proteosome inhibitors were tested with various cellular peptidases. Bortezomib did not inhibit tripeptidyl peptidase 2 and only weakly inhibited cellular aminopeptidase activity, as did some of the other proteasome inhibitors. However, potent inhibitors of tripeptidyl peptidase 2 (butabindide and cellular aminopeptidases (bestatin did not substantially alter the peptidome, indicating that the increase in peptide levels due to proteasome inhibitors is not a result of peptidase inhibition. Although we cannot exclude other possibilities, we presume that the paradoxical increase in peptide levels upon treatment with bortezomib and other inhibitors is the result of allosteric effects of these compounds on the proteasome. Because intracellular peptides are likely to be functional, it is possible that some of the physiologic effects of bortezomib and carfilzomib arise from the perturbation of peptide levels inside the cell.

  2. Aurelia aurita ephyrae reshape a coastal microbial community

    Directory of Open Access Journals (Sweden)

    Luca eZoccarato

    2016-05-01

    Full Text Available Over the last two decades, increasing attention has been paid to the impact of jellyfish blooms on marine communities. Aurelia aurita is one of the most studied of the Scyphozoans, and several studies have been carried out to describe its role as a top-down controller within the classical food web. However, little data are available to define the effects of these jellyfish on microbial communities. The aims of this study were to describe the predation impact of A. aurita ephyrae on a natural microplanktonic assemblage, and to determine any reshaping effects on the prokaryote community composition and functioning. Surface coastal water was used to set up a 24-h grazing experiment in microcosms. Samples were collected to determine the variations in prey biomass, heterotrophic carbon production, extracellular leucine aminopeptidase activity, and grazing pressure. A next-generation sequencing technique was used to investigate biodiversity shifts within the prokaryote and protist communities through the small subunit rRNA tag approach. This study shows that A. aurita ephyrae were responsible for large decreases in the abundances of the more motile microplankton groups, such as tintinnids, Dinophyceae, and aloricate ciliates. Bacillariophyceae and Mediophyceae showed smaller reductions. No evidence of selective predation emerged in the analysis of the community diversity down to the family level. The heterotrophic prokaryote biomass increased significantly (by up to 45%, in parallel with increases in heterotrophic carbon production and leucine aminopeptidase activity (40%. Significant modifications were detected in prokaryotic community composition. Some classes of Gammaproteobacteria and Flavobacteriia showed higher relative abundances when exposed to A. aurita ephyrae, while there was a net decrease for Alphaproteobacteria. Overall, this study provides new insight into the effects of A. aurita on microbial communities, underlining their selective

  3. Aurelia aurita Ephyrae Reshape a Coastal Microbial Community.

    Science.gov (United States)

    Zoccarato, Luca; Celussi, Mauro; Pallavicini, Alberto; Fonda Umani, Serena

    2016-01-01

    Over the last two decades, increasing attention has been paid to the impact of jellyfish blooms on marine communities. Aurelia aurita is one of the most studied of the Scyphozoans, and several studies have been carried out to describe its role as a top-down controller within the classical food web. However, little data are available to define the effects of these jellyfish on microbial communities. The aims of this study were to describe the predation impact of A. aurita ephyrae on a natural microplanktonic assemblage, and to determine any reshaping effects on the prokaryote community composition and functioning. Surface coastal water was used to set up a 24-h grazing experiment in microcosms. Samples were collected to determine the variations in prey biomass, heterotrophic carbon production (HCP), extracellular leucine aminopeptidase activity, and grazing pressure. A next-generation sequencing technique was used to investigate biodiversity shifts within the prokaryote and protist communities through the small subunit rRNA tag approach. This study shows that A. aurita ephyrae were responsible for large decreases in the abundances of the more motile microplankton groups, such as tintinnids, Dinophyceae, and aloricate ciliates. Bacillariophyceae and Mediophyceae showed smaller reductions. No evidence of selective predation emerged in the analysis of the community diversity down to the family level. The heterotrophic prokaryote biomass increased significantly (by up to 45%), in parallel with increases in HCP and leucine aminopeptidase activity (40%). Significant modifications were detected in prokaryotic community composition. Some classes of Gammaproteobacteria and Flavobacteriia showed higher relative abundances when exposed to A. aurita ephyrae, while there was a net decrease for Alphaproteobacteria. Overall, this study provides new insight into the effects of A. aurita on microbial communities, underlining their selective predation toward the more motile groups of

  4. Harmful effects of silver nanoparticles on a complex detrital model system.

    Science.gov (United States)

    Tlili, Ahmed; Cornut, Julien; Behra, Renata; Gil-Allué, Carmen; Gessner, Mark O

    2016-08-01

    The rapid proliferation of silver nanoparticles (AgNP) in industry and the environment requires realistic toxicity assessments based on approaches that consider the biological complexity of ecosystems. Here we assessed the acute toxicity of carbonate-coated AgNP and, for comparison, AgNO3 (Ag(+)) by using a model system consisting of decomposing plant litter and the associated fungal and bacterial decomposers as central players in the functioning of stream ecosystems. Little variation in size and surface charge during the experiment indicated that the AgNP used were essentially stable. AgNP disrupted bacterial growth (≤83% reduction in protein biosynthesis, EC50 = 0.3 μM), clearly affected fungal growth (≤61% reduction in ergosterol synthesis, EC50 = 47 μM) with both endpoints more sensitive to AgNP than to Ag(+). Fungal reproduction, in contrast, was stimulated by AgNP, but not Ag(+), at concentrations up to 25 μM. Both AgNP and Ag(+ )also stimulated extracellular alkaline phosphatase but reduced leucine aminopeptidase, whereas β-glucosidase was stimulated by AgNP and reduced by Ag(+). Importantly, the provision of cysteine, a chelating ligand that complexes free Ag(+), failed to alleviate AgNP toxicity to microbial growth, clearly demonstrating particle-mediated toxicity independent of the presence of ionic silver. This contrasts with the observed inhibition of leucine aminopeptidase by Ag(+), which accounted for 2-6% of the total silver in treatments receiving AgNP. These results show that although outcomes of AgNP and Ag(+ )exposure assessed by different functional endpoints vary widely, AgNP strongly interferes with bacterial growth and a range of other microbial processes, resulting in severe consequences for natural microbial communities and ecosystem functioning. PMID:26634870

  5. Determinação do modo de reprodução em capim-gordura (Melinis minutiflora Beauv. por padrões enzimáticos Detection of the mode of reproduction in molasses grass (Melinis minutiflora Beauv. by enzyme patterns

    Directory of Open Access Journals (Sweden)

    Lia Rejane Machado Silveira

    1996-04-01

    Full Text Available Com o objetivo de determinar o modo de reprodução do capim-gordura (Melinis minutiflora Beauv., 24 ecótipos da coleção da Universidade Federal de Viçosa foram utilizados em cruzamentos, após emasculação massal por imersão da inflorescência em água quente, testando-se quatro faixas de temperatura. Analisaram-se, comparativamente, os padrões de isozimas dos progenitores e da descendência proveniente de panículas de polinização aberta e de panículas submetidas aos tratamentos de proteção; polinização e proteção; emasculação e proteção; e emasculação, polinização e proteção. A hipótese da apomixia ser o mecanismo reprodutivo operante no capim-gordura foi bastante favorecida pela extensiva uniformidade da progênie e semelhança isozimática com o progenitor feminino. Contribuiu para isso o fato de toda a população amostrada apresentar um padrão de bandas característico de heterozigotos para os sistemas enzimáticos leucina aminopeptidase e malato desidrogenase, uma vez que a apomixia, ao contrário da autofecundação, facilita a manutenção da heterozigosidade. Segregação isozimática entre plantas dos ecótipos CG4 e CG5, relativamente ao sistema fosfatase ácida, sugere, no entanto, a ocorrência de alguma porcentagem de fecundação cruzada, que foi confirmada pela detecção de hibridação entre os ecótipos CG2 e CG13 nas isoesterases. Esses resultados conduzem à conclusão de que um mecanismo facultativo (parcialmente sexual de apomixia atua na reprodução do capim-gordura.Panicles of 24 molasses grass ecotypes were used in an experiment involving: bagging before anthesis; cross-pollination and bagging; emasculation and bagging; and emasculation, cross-pollination and bagging. Emasculation was accomplished by immersing the inflorescences into warm water, four temperature levels, for 12 minutes. The breeding system was accessed by comparing the isozyme patterns of the estereases, acid phosphatases

  6. Influence of dietary zinc and copper on digestive enzyme activity and intestinal morphology in weaned pigs.

    Science.gov (United States)

    Hedemann, M S; Jensen, B B; Poulsen, H D

    2006-12-01

    The current study was conducted to investigate the effects of high dietary concentrations of Zn as zinc oxide and Cu as copper sulfate on the activity of digestive enzymes in the pancreas and the intestinal mucosa, intestinal morphology, and mucin histochemistry in pigs after weaning. Thirty-two pigs were weaned at 4 wk of age. The pigs were fed standard weaning diets supplemented with Zn (100 or 2,500 ppm) and Cu (0 or 175 ppm) in a 2 x 2 factorial arrangement of treatments for a 14-d period. In pancreatic tissue, the activity of amylase, carboxypeptidase A, chymotrypsin, trypsin, and lipase increased (P pigs fed 2,500 ppm of Zn, whereas the activity of carboxypeptidase B and carboxylester hydrolase was unaffected. Copper had no effect on the activity of pancreatic enzymes. In small intestinal contents, the total activity of amylase and carboxypeptidase A was greater in pigs fed 100 ppm of Zn (P pigs fed 100 ppm of Zn than in pigs fed 2,500 ppm of Zn, but otherwise there were no clear effects of Zn and Cu supplementation on intestinal morphology. In the cranial small intestine, the activity of maltase (P pigs fed 100 ppm of Zn, even though there was a Zn x Cu interaction (P pigs fed 100 ppm of Zn, the activity of aminopeptidase N was greater in the caudal small intestine, but dietary Zn or Cu had no effect on aminopeptidase N in the cranial and middle small intestine. No effect of dietary Zn or Cu supplementation was found on carbohydrate histochemistry in the caudal small intestine, whereas high dietary Zn increased the area of neutral, acidic, and sulfomucins in the cecum (P < 0.01) and in the colon (P < 0.001). In summary, high dietary Zn increased the activity of several enzymes in the pancreatic tissue and increased the mucin staining area in the large intestine, whereas Cu had no clear effect on these variables. However, no definite answers were found as to how the growth promoting and diarrhea reducing effects of excess dietary Zn are exerted. PMID:17093223

  7. Some physical and chemical properties of the smooth muscle inhibitory factor in extracts of the bovine retractor penis muscle.

    Science.gov (United States)

    Gillespie, J S; Hunter, J C; Martin, W

    1981-06-01

    1. A method of extracting and partially purifying a smooth muscle inhibitory factor from the bovine retractor penis is described. This consists of extraction in methanol followed by adsorption on an anion exchange resin, elution from the resin with 500 mM-sodium chloride solution and, if necessary, removal of adenine nucleotides by adsorption on alumina. 2. The inhibitory factor exists in a stable pharmacologically inactive form and an unstable pharmacologically active form. Conversion to the active form is by a brief exposure to acid at pH 2.0. 3. The inhibitory factor is insoluble in ether or acetone but soluble in methanol. Anhydrous methanol, however, irreversibly destroys pharmacological activity especially if the inhibitory factor is in the active form. This effect of methanol is prevented by the presence of 20-30-% water. 4. The inhibitory factor binds to an anion exchange resin but not to a cation exchange resin. It can be eluted from the resin by 500 mM-sodium chloride solution. 5. The molecular weight of the inhibitory factor, as judged by the ability to pass ultrafiltration membranes, is about 500. 6. Inhibitory activity is unaffected by the proteases trypsin, subtilisin or pepsin or by leucine aminopeptidase, pyroglutamate aminopeptidase or carboxypeptidase. The inhibitory effect of the extract and the inhibitory response to stimulation of the non-adrenergic, non-cholinergic nerves are also unaffected by the protease inhibitor, aprotinin. The active material, therefore, is unlikely to be a peptide. 7. Inhibitory activity is abolished by exposure of the extracts to periodic acid or sodium periodate. Acetic anhydride in pyridine also abolishes activity but the vehicle pyridine is also effective. 8. Sodium borohydride but not borate abolishes inhibitory activity when added to the acid-activated material at pH 2.0 but has no effect or may even potentiate activity if added to the stable inactive form at pH 9.0. When added to the acid-activated but

  8. Genotypic and phenotypic diversity of Lactococcus lactis isolates from Batzos, a Greek PDO raw goat milk cheese.

    Science.gov (United States)

    Psoni, L; Kotzamanidis, C; Yiangou, M; Tzanetakis, N; Litopoulou-Tzanetaki, E

    2007-03-10

    The genotypic and phenotypic variability of 40 Lactococcus lactis isolates obtained from three cheese-making trials of Batzos cheese made one in each, winter, spring and summer was investigated. RAPD-PCR, plasmid profiling and PFGE were used to study the genetic variability and distinguish closely related isolates. Results showed a high degree of heterogeneity among strains. According to PFGE data, all strains except one were clustered together (at a similarity level of approximately 50%) with the L. lactis subsp. lactis reference strain and eleven groups of isolates consisting of 2-8 strains each were distinguished. Plasmid profiling results revealed that there were eight isolates lacking plasmids and nine having unique plasmids. Twenty-three isolates were allocated into six groups. There was an interesting similarity between the plasmid profiling groups and those formed according to PFGE. Clustering of strains according to RAPD-PCR was in agreement with results obtained by both plasmid profiling and PFGE for the majority of the strains. In addition, results obtained by molecular methods indicate a grouping of most of the strains according to the season of cheese production. All strains inhibited the growth of Escherichia coli O157:H7. Their ability to affect the growth of Yersinia enterocolitica, Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes and Enterococcus faecalis was strain dependent. In 42.5% of the isolates high acidifying ability in milk after 24 h was recorded and these were isolates, mainly, from fresh cheese. The 75% of the isolates from winter cheese exhibited higher Lys- than Leu-aminopeptidase activity while the approximately 67% of the isolates from summer cheese showed higher Leu- than Lys-aminopeptidase activity. Their caseinolytic activity after growth in milk for 24 h was significant with preference for alpha(s)-casein degradation. The majority (90%) of the strains formed methanethiol from methionine and this ability was strain

  9. The Utility of a Consortium of Microbial Enzymes as an Early Warning Tool for Monitoring Soil Pollution with Heavy Metals

    Science.gov (United States)

    Wahsha, Mohammad; Bini, Claudio; Fornasier, Flavio; Al-Rshaidat, Mamoon M. D.

    2013-04-01

    Potentially Toxic Substances (PTS) in soils are of increasingly growing concern worldwide. Heavy metals are acting as one of the most serious groups of environmental contaminants, and their release into the environment has strongly increased over the last decades. Heavy metals can cause acute and long-term toxic effects on both human health and the ecosystems around. Toxic effects of heavy metals reach soil biota in general and affect the microbial community biomass and metabolic activities related to such communities. Although all members of the soil biota respond relatively to soil pollution, microbial communities are considered to be the first and most swift responders to such environmental pollutants. This study focused on the state of the art of developing a consortium of different enzymes and how their collective activities could be used for the assessment and monitoring of soil in response to heavy metal pollution. By measuring microbial community biomass and activity from soil samples from Imperina Valley; an abandoned mine in Italy. Measurements covered heavy metal concentrations; soil physiochemical parameters, and enzymatic activity and biomass of soil's microbial community. Results showed significant contamination at the sampled sites with different heavy metals (p ≤ 0.05). With averages above the allowed limits in Italy: 2.12 mg Cd kg- 1, 2.33 mg Cu kg- 1, 9.63 mg Pb kg- 1, 1.23 mg Zn kg- 1 and 3.05 mg Fe kg- 1. Enzymatic activities varied widely among the sampled sites, and were positively correlated with organic matter content. Strong positive correlation was observed between leucyl aminopeptidase/chitinase, leucyl aminopeptidase/β-glucosidase, and β-glucosidase/chitinase, (0.999), (0.992), and (0.992), respectively. The above enzymes showed positive linear correlation with the organic carbon content of the sampled soils, with alkaline phosphatase showing the most significant correlation (0.726) among all. This study clearly highlights in situ

  10. Elastinolytic and proteolytic enzymes.

    Science.gov (United States)

    Kessler, Efrat; Safrin, Mary

    2014-01-01

    Pseudomonas aeruginosa secretes into its environment at least seven extracellular proteases: pseudolysin (LasB protease; elastase), aeruginolysin (alkaline proteinase), staphylolysin (staphylolytic endopeptidase; LasA protease), lysyl endopeptidase (protease IV; PrpL), PASP (P. aeruginosa small protease), LepA (Large ExoProtease A), and an aminopeptidase. Their action on host proteins, both individually and synergistically, plays important roles in pathogenesis of P. aeruginosa infections. Methods to measure/detect their activities are fundamental for understanding their physiological functions, roles in pathogenesis, mechanisms of action, regulation, and secretion. Most assays for determination/detection of proteolytic activity employ modified/non-modified casein or gelatin as substrates. In the quantitative assay, fragments generated from azocasein are separated from undigested substrate by trichloroacetic acid precipitation and their absorbance is measured. In non-quantitative assays, proteolytic activity is detected as clearing zones around bacterial growth or samples of culture supernatants on casein containing solid media formed due to local casein degradation. In zymography, individual proteases are detected as clear bands in gelatin/casein containing gels after SDS-PAGE separation, renaturation and protein staining. The elastinolytic capacity of P. aeruginosa is reflected by clearing zones on nutrient agar plates containing insoluble elastin instead of casein. Mueller-Hinton agar plates on which S. aureus cells are grown as a lawn are used to assess the susceptibility of S. aureus isolates to staphylolysin. A clear zone around a staphylolysin-containing sample indicates inhibition of S. aureus growth. Methods for measuring the activity of individual proteases are based on their cleavage specificity. These include assays of elastinolytic activity of pseudolysin and/or staphylolysin using elastin-Congo red as a substrate, a method for determination of

  11. Stimulated Bacterial Growth under Elevated pCO2: Results from an Off-Shore Mesocosm Study

    Science.gov (United States)

    Endres, Sonja; Galgani, Luisa; Riebesell, Ulf; Schulz, Kai-Georg; Engel, Anja

    2014-01-01

    Marine bacteria are the main consumers of freshly produced organic matter. Many enzymatic processes involved in the bacterial digestion of organic compounds were shown to be pH sensitive in previous studies. Due to the continuous rise in atmospheric CO2 concentration, seawater pH is presently decreasing at a rate unprecedented during the last 300 million years but the consequences for microbial physiology, organic matter cycling and marine biogeochemistry are still unresolved. We studied the effects of elevated seawater pCO2 on a natural plankton community during a large-scale mesocosm study in a Norwegian fjord. Nine Kiel Off-Shore Mesocosms for Future Ocean Simulations (KOSMOS) were adjusted to different pCO2 levels ranging initially from ca. 280 to 3000 µatm and sampled every second day for 34 days. The first phytoplankton bloom developed around day 5. On day 14, inorganic nutrients were added to the enclosed, nutrient-poor waters to stimulate a second phytoplankton bloom, which occurred around day 20. Our results indicate that marine bacteria benefit directly and indirectly from decreasing seawater pH. During the first phytoplankton bloom, 5–10% more transparent exopolymer particles were formed in the high pCO2 mesocosms. Simultaneously, the efficiency of the protein-degrading enzyme leucine aminopeptidase increased with decreasing pH resulting in up to three times higher values in the highest pCO2/lowest pH mesocosm compared to the controls. In general, total and cell-specific aminopeptidase activities were elevated under low pH conditions. The combination of enhanced enzymatic hydrolysis of organic matter and increased availability of gel particles as substrate supported up to 28% higher bacterial abundance in the high pCO2 treatments. We conclude that ocean acidification has the potential to stimulate the bacterial community and facilitate the microbial recycling of freshly produced organic matter, thus strengthening the role of the microbial loop in the

  12. Stimulated bacterial growth under elevated p CO₂: results from an off-shore mesocosm study.

    Science.gov (United States)

    Endres, Sonja; Galgani, Luisa; Riebesell, Ulf; Schulz, Kai-Georg; Engel, Anja

    2014-01-01

    Marine bacteria are the main consumers of freshly produced organic matter. Many enzymatic processes involved in the bacterial digestion of organic compounds were shown to be pH sensitive in previous studies. Due to the continuous rise in atmospheric CO2 concentration, seawater pH is presently decreasing at a rate unprecedented during the last 300 million years but the consequences for microbial physiology, organic matter cycling and marine biogeochemistry are still unresolved. We studied the effects of elevated seawater pCO2 on a natural plankton community during a large-scale mesocosm study in a Norwegian fjord. Nine Kiel Off-Shore Mesocosms for Future Ocean Simulations (KOSMOS) were adjusted to different pCO2 levels ranging initially from ca. 280 to 3000 µatm and sampled every second day for 34 days. The first phytoplankton bloom developed around day 5. On day 14, inorganic nutrients were added to the enclosed, nutrient-poor waters to stimulate a second phytoplankton bloom, which occurred around day 20. Our results indicate that marine bacteria benefit directly and indirectly from decreasing seawater pH. During the first phytoplankton bloom, 5-10% more transparent exopolymer particles were formed in the high pCO2 mesocosms. Simultaneously, the efficiency of the protein-degrading enzyme leucine aminopeptidase increased with decreasing pH resulting in up to three times higher values in the highest pCO2/lowest pH mesocosm compared to the controls. In general, total and cell-specific aminopeptidase activities were elevated under low pH conditions. The combination of enhanced enzymatic hydrolysis of organic matter and increased availability of gel particles as substrate supported up to 28% higher bacterial abundance in the high pCO2 treatments. We conclude that ocean acidification has the potential to stimulate the bacterial community and facilitate the microbial recycling of freshly produced organic matter, thus strengthening the role of the microbial loop in the

  13. Hot experience for cold-adapted microorganisms: temperature sensitivity of soil enzymes

    Science.gov (United States)

    Liu, Shibin; Razavidezfuly, Baharsadat; Kuzyakov, Yakov

    2016-04-01

    The temperature sensitivity of enzymes responsible for organic matter decomposition in cold environment soil, where warming is expected to be greatest is crucial. Based on Michaelis-Menten kinetics and Arrhenius function, we hypothesized that cold-adapted microorganisms will produce high efficient enzymes at cold temperatures (enzymes with lower apparent activation energy (Ea) at cold temperature ranges). To test our hypothesis, 30 g soil of Tibetan Plateau (4100 m a.s.l., annual temperature 2.4 °C) in 4 replicates were incubated for one month over a temperature range of 0-40 °C (with 5 °C steps) and determined the kinetic parameters of six enzymes involved in decomposing organics: cellobiohydrolase and β-glucosidase, which are commonly measured as enzymes responsible for consecutive stages of cellulose degradation; xylanase, which is responsible for breaking down hemicelluloses; acid phosphatase, which mineralizes organic P to phosphate by hydrolyzing phosphoric (mono) ester bonds under acidic conditions. Activities of leucine aminopeptidase and tyrosine aminopeptidase were analyzed to assess the hydrolysis of L-peptide bonds. The apparent activation energy varied between enzymes from 42 (phosphatase) to 54 (cellobiohydrolase) kJ mol-1 corresponding to the Q10 values of the enzyme reactions of 1.8-2.3. The increase of substrate affinity (Km) with temperature was gradual for most tested enzymes from 0-20 °C (enzymes involved in C cycle), (proteases) and 0-40 °C (phosphatase). However, within a high range of temperatures (25-40 °C) the hydrolytic activity was governed by enzymes with nearly constant substrate affinity. Overall, for enzymes involved in C cycle and proteases, a strong increase (30-40%) in Km at high temperatures (25 °C) reflects an expression of multiple isoenzymes each with different temperature optima and probable shift of microbial community. The general trend of catalytic efficiency (Vmax/Km) demonstrated a gradual increase with

  14. Effects of human activities on the ecological processes of river biofilms in a highly urbanized river

    Science.gov (United States)

    Hung, R.; Li, M.

    2013-12-01

    Many anthropogenic disturbances and their effects of aquatic ecosystem are difficult to quantify in urbanized rivers. In past, specific taxa analysis of community structure was a common approach in river health monitoring studies. However, it is still difficult to understand stream ecosystem integrity without considering ecosystem processes. The complex species composition and metabolism of a river biofilm have the capacity to interact and/or modulate their surrounding environment. Because of their short life cycles, species richness, and worldwide distribution, structure and function of river biofilm communities are sensitive to change in environmental conditions. Therefore, biofilms are widely used as early warning systems of water pollution for water quality monitoring studies. In this study, we used river biofilms as a bioindicator by examining their extracellular enzyme activities and photosynthesis efficiency to understand human activities on the ecological processes of river ecosystem in a highly urbanized river. We sampled four sites along the Keelung River, Taiwan, based on different intensities of anthropogenic disturbances including water pollution index, population densities, land use types and types of stream habitats. Two study sites are heavily influenced by human activities and the others are not. The activities of extracellular enzymes within the biofilm play an important function for organic matter decomposition and nutrient cycling. We measured seven extracellular enzyme activities (β-d-glucosidase, phosphatase, leucine-aminopeptidase, sulfatase, peroxidase, polyphenol oxidase, and esterase) to examine specific enzyme activity changes at four study sites monthly. In addition, relative proportion of each extracellular enzyme activity on total enzyme activities was calculated in order to examine the relationship between functional biofilm profiles and different urban intensities. Among four study sites, leucine-aminopeptidase and esterase

  15. Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 2.

    Science.gov (United States)

    McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

    2016-06-15

    Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. PMID:27136719

  16. The death enzyme CP14 is a unique papain-like cysteine proteinase with a pronounced S2 subsite selectivity.

    Science.gov (United States)

    Paireder, Melanie; Mehofer, Ulrich; Tholen, Stefan; Porodko, Andreas; Schähs, Philipp; Maresch, Daniel; Biniossek, Martin L; van der Hoorn, Renier A L; Lenarcic, Brigita; Novinec, Marko; Schilling, Oliver; Mach, Lukas

    2016-08-01

    The cysteine protease CP14 has been identified as a central component of a molecular module regulating programmed cell death in plant embryos. CP14 belongs to a distinct subfamily of papain-like cysteine proteinases of which no representative has been characterized thoroughly to date. However, it has been proposed that CP14 is a cathepsin H-like protease. We have now produced recombinant Nicotiana benthamiana CP14 (NbCP14) lacking the C-terminal granulin domain. As typical for papain-like cysteine proteinases, NbCP14 undergoes rapid autocatalytic activation when incubated at low pH. The mature protease is capable of hydrolysing several synthetic endopeptidase substrates, but cathepsin H-like aminopeptidase activity could not be detected. NbCP14 displays a strong preference for aliphatic over aromatic amino acids in the specificity-determining P2 position. This subsite selectivity was also observed upon digestion of proteome-derived peptide libraries. Notably, the specificity profile of NbCP14 differs from that of aleurain-like protease, the N. benthamiana orthologue of cathepsin H. We conclude that CP14 is a papain-like cysteine proteinase with unusual enzymatic properties which may prove of central importance for the execution of programmed cell death during plant development. PMID:27246477

  17. Comparative evaluation of CO2 and iopromide as contrast agents for renal angiography in dogs

    International Nuclear Information System (INIS)

    The aim of this study was to compare the renal injury and the quality of images of iodinated contrast (iopromide) and CO2 using digital subtraction angiography in dogs. 17 dogs were randomly assigned to receive iodinated contrast (iopromide, n=5) or CO2 (n=12) using 6F pigtail catheter, which was introduced via femoral approach to perform aortogram. Serum creatinine (S.Cr.) and urinary enzymes such as N-acetyl-â-Dglucosaminidase (NAG), alanine aminopeptidase (AAP), gamma glutamyl transferase (GGT) were measured before and 0 and 48 hr after DSA to assess renal injury. PaCO2 was measured before and immediately after the procedure. There was no change in S.Cr. in both groups; however, significantly more enzymuria was seen in iodinated contrast. Images obtained with iodinated contrast agents were superior to those with CO2. However, CO2 is good alternative contrast agent in high risk individuals to reduce the risk of renal injury and quality of images is able to delineate the aorta and main renal artery

  18. Isolated tumor endothelial cells maintain specific character during long-term culture

    International Nuclear Information System (INIS)

    Tumor angiogenesis is necessary for solid tumor progression and metastasis. Increasing evidence indicates that tumor endothelial cells (TECs) are more relevant to the study of tumor angiogenesis than normal endothelial cells (NECs) because their morphologies and gene expression are different from NECs. However, it is challenging to isolate and culture large numbers of pure ECs from tumor tissue since the percentage of ECs is only about 1-2% and tumor cells and fibroblasts easily overgrow them. In addition, there has been concern that isolated TECs may lose their special phenotype once they are dissociated from tumor cells. In this study, we have successfully purified murine TECs from four different human tumor xenografts and NECs from murine dermal tissue. Isolated ECs expressed endothelial markers, such as CD31, VE-cadherin (CD144), and endoglin (CD105), for more than 3 months after isolation. TECs maintained tumor endothelial-specific markers, such as tumor endothelial marker 8 (TEM8) and aminopeptidase N (APN), as in tumor blood vessels in vivo. In addition, TECs were more proliferative and motile than NECs. TECs showed a higher response to VEGF and higher expression of VEGF receptors-1 and -2 than NECs did. Stem cell antigen-1 was up-regulated in all four TECs, suggesting that they have a kind of stemness. Cultured TECs maintain distinct biological differences from NECs as in vivo. In conclusion, it was suggested that TECs are relevant material for tumor angiogenesis research.

  19. Assembling of Holotrichia parallela (dark black chafer) midgut tissue transcriptome and identification of midgut proteins that bind to Cry8Ea toxin from Bacillus thuringiensis.

    Science.gov (United States)

    Shu, Changlong; Tan, Shuqian; Yin, Jiao; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Geng, Lili; Song, Fuping; Li, Kebin; Zhang, Jie

    2015-09-01

    Holotrichia parallela is one of the most severe crop pests in China, affecting peanut, soybean, and sweet potato crops. Previous work showed that Cry8Ea toxin is highly effective against this insect. In order to identify Cry8Ea-binding proteins in the midgut cells of H. parallela larvae, we assembled a midgut tissue transcriptome by high-throughput sequencing and used this assembled transcriptome to identify Cry8Ea-binding proteins by liquid chromatography-tandem mass spectrometry (LC-MS/MS). First, we obtained de novo sequences of cDNAs from midgut tissue of H. parallela larvae and used available cDNA data in the GenBank. In a parallel assay, we obtained 11 Cry8Ea-binding proteins by pull-down assays performed with midgut brush border membrane vesicles. Peptide sequences from these proteins were matched to the H. parallela newly assembled midgut transcriptome, and 10 proteins were identified. Some of the proteins were shown to be intracellular proteins forming part of the cell cytoskeleton and/or vesicle transport such as actin, myosin, clathrin, dynein, and tubulin among others. In addition, an apolipophorin, which is a protein involved in lipid metabolism, and a novel membrane-bound alanyl aminopeptidase were identified. Our results suggest that Cry8Ea-binding proteins could be different from those characterized for Cry1A toxins in lepidopteran insects. PMID:26135984

  20. Investigation of neutral endopeptidases (EC 3.4.24.11) and of neutral proteinases (EC 3.4.24.4) using a new sensitive two-stage enzymatic reaction.

    Science.gov (United States)

    Indig, F E; Ben-Meir, D; Spungin, A; Blumberg, S

    1989-09-25

    A sensitive two-stage enzymatic reaction for mammalian and bacterial metalloendopeptidases has been developed using the substrate 3-carboxypropanoyl-alanyl-alanyl-leucine-4-nitroanilide supplemented with Streptomyces griseus amino-peptidase. Neutral endopeptidase EC 3.4.24.11 from bovine kidney hydrolyzes the substrate (pH 7.5, 25 degrees C) with a catalytic efficiency (kcat = 1.2 x 10(2) s-1, Km = 0.15 mM) of the highest ever reported for the enzyme acting on synthetic chromophoric and fluorogenic substrates. Thermolysin hydrolyzes the substrate at a faster rate (kcat = 1.2 x 10(3) s-1) but the overall efficiency is diminished by a higher Km (4.2 mM). Suspensions of human neutrophil cells and culture filtrates of Bacillus cereus have been assayed sensitively for their neutral endopeptidases and neutral proteinase activities, respectively. The assay provides a convenient tool for the kinetic investigation of neutral endopeptidases and neutral proteinases and for assessing their function in biological systems. PMID:2507355

  1. Effects of polychlorinated biphenyls and lipemia on serum analytes

    Energy Technology Data Exchange (ETDEWEB)

    Steinberg, K.K.; Freni-Titulaer, L.W.J.; Rogers, T.N.; Burse, V.W.; Mueller, P.W.; Stehr, P.A.; Miller, D.T.; Steele, G.

    1986-01-01

    Twelve serum analytes (triglycerides, cholesterol, total and conjugated bilirubin, high-density-lipoprotein cholesterol (HDL-C) alkaline phosphatase (AP), gammaglutamyl transferase (GGT), aspartate aminotransferase (AST), alanine aminotransferase (ALT), ..beta..-glucoronidase (..beta..-glu), alanine aminopeptidase (AAP), and 5'-nucleotidase (5'nuc)) were measured to investigate their correlation with exposure to polychlorinated biphenyls (PCBs) and 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT). The relationship between serum lipids, lipophilic toxicants, and the analytes was also evaluated. The ..beta..-glue, 5'nuc, triglycerides, cholesterol, and total bilirubin correlated positively and significantly with log concentrations of serum total PCBs and 1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene (DDE), a metabolite of DDT. The more highly chlorinated PCBs had significant, positive correlations with several serum analytes, but the less chlorinated PCBs correlated significantly and negatively only with HDL-cholesterol. Triglyercide- and cholesterol-rich lipoproteins were added to serum to determine the effects of lipids on these assays. Several were spuriously elevated. AP and ..beta..-glu were not affected by lipoprotein addition with the methods used in this study. AAP was increased significantly only at triglyceide concentrations exceeding 400 mg/dl.

  2. Characterization of Lactobacillus from Algerian goat's milk based on phenotypic, 16S rDNA sequencing and their technological properties

    Directory of Open Access Journals (Sweden)

    Ahmed Marroki

    2011-03-01

    Full Text Available Nineteen strains of Lactobacillus isolated from goat's milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21 and one strain of L. rhamnosus (LbMF25 have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria.

  3. Evaluation of Genetic Variations in Maize Seedlings Exposed to Electric Field Based on Protein and DNA Markers

    Directory of Open Access Journals (Sweden)

    Asma A. AL-Huqail

    2015-01-01

    Full Text Available The current study analyzed proteins and nuclear DNA of electric fields (ELF exposed and nonexposed maize seedlings for different exposure periods using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, isozymes, random amplified polymorphic DNA (RAPD, and comet assay, respectively. SDS-PAGE analysis revealed total of 46 polypeptides bands with different molecular weights ranging from 186.20 to 36.00 KDa. It generated distinctive polymorphism value of 84.62%. Leucine-aminopeptidase, peroxidase, and catalase isozymes showed the highest values of polymorphism (100% based on zymograms number, relative front (Rf, and optical intensity while esterase isozyme generated polymorphism value of 83.33%. Amino acids were analyzed using high-performance liquid chromatography, which revealed the presence of 17 amino acids of variable contents ranging from 22.65% to 28.09%. RAPD revealed that 78 amplified DNA products had highly polymorphism value (95.08% based on band numbers, with variable sizes ranging from 120 to 992 base pairs and band intensity. Comet assay recorded the highest extent of nuclear DNA damage as percentage of tailed DNA (2.38% and tail moment unit (5.36 at ELF exposure of maize nuclei for 5 days. The current study concluded that the longer ELF exposing periods had genotoxic stress on macromolecules of maize cells and biomarkers used should be augmented for reliable estimates of genotoxicity after exposure of economic plants to ELF stressors.

  4. Molecular Basis of Prodrug Activation by Human Valacyclovirase, an [alpha]-Amino Acid Ester Hydrolase

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Longsheng; Xu, Zhaohui; Zhou, Jiahai; Lee, Kyung-Dall; Amidon, Gordon L. (Michigan)

    2008-07-08

    Chemical modification to improve biopharmaceutical properties, especially oral absorption and bioavailability, is a common strategy employed by pharmaceutical chemists. The approach often employs a simple structural modification and utilizes ubiquitous endogenous esterases as activation enzymes, although such enzymes are often unidentified. This report describes the crystal structure and specificity of a novel activating enzyme for valacyclovir and valganciclovir. Our structural insights show that human valacyclovirase has a unique binding mode and specificity for amino acid esters. Biochemical data demonstrate that the enzyme hydrolyzes esters of {alpha}-amino acids exclusively and displays a broad specificity spectrum for the aminoacyl moiety similar to tricorn-interacting aminopeptidase F1. Crystal structures of the enzyme, two mechanistic mutants, and a complex with a product analogue, when combined with biochemical analysis, reveal the key determinants for substrate recognition; that is, a flexible and mostly hydrophobic acyl pocket, a localized negative electrostatic potential, a large open leaving group-accommodating groove, and a pivotal acidic residue, Asp-123, after the nucleophile Ser-122. This is the first time that a residue immediately after the nucleophile has been found to have its side chain directed into the substrate binding pocket and play an essential role in substrate discrimination in serine hydrolases. These results as well as a phylogenetic analysis establish that the enzyme functions as a specific {alpha}-amino acid ester hydrolase. Valacyclovirase is a valuable target for amino acid ester prodrug-based oral drug delivery enhancement strategies.

  5. Immunoproteasomes edit tumors, which then escapes immune recognition.

    Science.gov (United States)

    Joyce, Sebastian

    2015-12-01

    In 1985, John Monaco--the discoverer of LMP-2 and -7, the inducible components of the immunoproteasome--asked his advanced immunology class as to why the MHC region contained not only structural genes, but several others as well, whose functions were then unknown. As we drew a blank, he quipped: perchance because many of the MHC genes are induced by IFN-γ! The ensuing three decades have witnessed the unveiling of the profound fundamental and clinical implications of that classroom tête-à-tête. Amongst its multitudinous effects, IFN-γ induces genes enhancing antigen processing and presentation to T cells; such as those encoding cellular proteases and activators of proteases. In this issue, Keller et al. [Eur. J. Immunol. 2015. 45: 3257-3268] demonstrate that the limited success of MART-1/Melan-A-targeted immunotherapy in melanoma patients could be due to inefficient MART-1(26-35) presentation, owing to the proteolytic activities of IFN-γ-inducible β2i/MECL-1, proteasome activator 28 (PA28), and endoplasmic reticulum-associated aminopeptidase-associated with antigen processing (ERAP). Specifically, whilst β2i and PA28 impede MART-1(26-35) liberation from its precursor protein, ERAP-1 degrades this epitope. Hence, critical to effective cancer immunotherapy is deep knowledge of T-cell-targeted tumor antigens and how cellular proteases generate protective epitope(s) from them, or destroy them. PMID:26527367

  6. Oral Insulin Stimulates Intestinal Department and Enzyme Maturation in Newborn Pigs

    Institute of Scientific and Technical Information of China (English)

    WANG Tian; XU Ruo-jun; HUO Yong-jiu

    2004-01-01

    The effects of oral insulin on intestinal tissue growth and brush border enzyme activities in newborn pigs were examined in this study. Newborn unsuckled pigs were bottle-fed for3 days with artificial milk(M),milk supplemented with 60mIUmL-1 of insulin(IH)or hydrolyzed milk(HM). Compared with newborn unsuckled pigs,piglets bottle-fed for 3 days all gained in intestinal weight and length significantly despite a mild loss in body weight during the experimental period. The activities of lactase and alkaline phosphatase(AKP)in the small intestinal mucosa declined markedly in pigs fed with M,but the activity of maltase increased significantly during the experimental period. Dietary protein pre-hydrolysis had no significant effect on intestinal tissue mass or length,but it moderated the decline of intestinal lactase and AKP activities. Dietary supplementation of insulin significantly increased mucosal protein content and brush border activities of lactase,maltase,AKP and aminopeptidase(AP)in the small intestine.The effect. of insulin treatment was particularly obvious at the distal region of the small intestine. These results demonstrate that oral insulin can stimulate intestinal digestive enzyme activities in newborn pigs. The finding supports the hypothesis that milk-borne insulin plays a role in regulating postnatal gut development in the suckling young.

  7. Peptide hydrolase activities in seedlings and hormone-treated cotyledons of pumpkin (Cucurbita pepo).

    Science.gov (United States)

    Weidhase, R A; Parthier, B

    1983-01-01

    Enzymes hydrolyzing Gly-Ala-, Met-Met- and Pro-4-phenylazo-phenylamides, and N-benzoyl-L-arginine-4-nitroanilide have been identified in germinating seeds and cotyledons of pumpkin (Cucurbita pepo). The enzyme activities per cotyledon increase markedly during the germination process, but the proportion of enhancement depends on the type of enzyme species. The increase in enzyme activities is due to de novo synthesis as shown by cycloheximide treatment and is influenced by phytohormones (cytokinins and abscissic acid). In isolated cotyledons exogenous cytokinin (benzyladenine) obviously can replace the effect of the embryo as the source of endogenous hormone. Abscissic acid counteracts the cytokinin effect. It is suggested that aminopeptidases have a biological function in reserve protein degradation of the cotyledons during seed germination. Our results do not support the assumption that the embryonic axis of the growing seedling serves as a "sink" of proteolytic products resulting in an activation of peptide hydrolases in the cotyledons, but rather de novo synthesis of these enzymes seems to be controlled by substances (phytohormones) originating from the embryo. PMID:6360167

  8. Response of bacterioplankton activity in an Arctic fjord system to elevated pCO2: results from a mesocosm perturbation study

    Science.gov (United States)

    Piontek, J.; Borchard, C.; Sperling, M.; Schulz, K. G.; Riebesell, U.; Engel, A.

    2013-01-01

    The effect of elevated seawater carbon dioxide (CO2) on the activity of a natural bacterioplankton community in an Arctic fjord system was investigated by a mesocosm perturbation study in the frame of the European Project on Ocean Acidification (EPOCA). A pCO2 range of 175-1085 μatm was set up in nine mesocosms deployed in the Kongsfjorden (Svalbard). The activity of natural extracellular enzyme assemblages increased in response to acidification. Rates of β-glucosidase and leucine-aminopeptidase increased along the gradient of mesocosm pCO2. A decrease in seawater pH of 0.5 units almost doubled rates of both enzymes. Heterotrophic bacterial activity was closely coupled to phytoplankton productivity in this experiment. The bacterioplankton community responded to rising chlorophyll a concentrations after a lag phase of only a few days with increasing protein production and extracellular enzyme activity. Time-integrated primary production and bacterial protein production were positively correlated, strongly suggesting that higher amounts of phytoplankton-derived organic matter were assimilated by heterotrophic bacteria at increased primary production. Primary production increased under high pCO2 in this study, and it can be suggested that the efficient heterotrophic carbon utilisation had the potential to counteract the enhanced autotrophic CO2 fixation. However, our results also show that beneficial pCO2-related effects on bacterial activity can be mitigated by the top-down control of bacterial abundances in natural microbial communities.

  9. Functional microbial community response to nutrient pulses by artificial groundwater recharge practice in surface soils and subsoils.

    Science.gov (United States)

    Schütz, Kirsten; Kandeler, Ellen; Nagel, Peter; Scheu, Stefan; Ruess, Liliane

    2010-06-01

    Subsurface microorganisms are essential constituents of the soil purification processes associated with groundwater quality. In particular, soil enzyme activity determines the biodegradation of organic compounds passing through the soil profile. Transects from surface soil to a depth of 3.5 m were investigated for microbial and chemical soil characteristics at two groundwater recharge sites and one control site. The functional diversity of the microbial community was analyzed via the activity of eight enzymes. Acid phosphomonoesterase was dominant across sites and depths, followed by L-leucine aminopeptidase and beta-glucosidase. Structural [e.g. phospholipid fatty acid (PLFA) pattern] and functional microbial diversities were linked to each other at the nonwatered site, whereas amendment with nutrients (DOC, NO(3)(-)) by flooding uncoupled this relationship. Microbial biomass did not differ between sites, whereas microbial respiration was the highest at the watered sites. Hence, excess nutrients available due to artificial groundwater recharge could not compensate for the limitation by others (e.g. phosphorus as assigned by acid phosphomonoesterase activity). Instead, at a similar microbial biomass, waste respiration via overflow metabolism occurred. In summary, ample supply of carbon by flooding led to a separation of decomposition and microbial growth, which may play an important role in regulating purification processes during groundwater recharge. PMID:20557572

  10. Extracellular enzyme activities and nutrient availability during artificial groundwater recharge.

    Science.gov (United States)

    Kolehmainen, Reija E; Korpela, Jaana P; Münster, Uwe; Puhakka, Jaakko A; Tuovinen, Olli H

    2009-02-01

    Natural organic matter (NOM) removal is the main objective of artificial groundwater recharge (AGR) for drinking water production and biodegradation plays a substantial role in this process. This study focused on the biodegradation of NOM and nutrient availability for microorganisms in AGR by the determination of extracellular enzyme activities (EEAs) and nutrient concentrations along a flow path in an AGR aquifer (Tuusula Water Works, Finland). Natural groundwater in the same area but outside the influence of recharge was used as a reference. Determination of the specific alpha-d-glucosidase (alpha-Glu), beta-d-glucosidase (beta-Glu), phosphomonoesterase (PME), leucine aminopeptidase (LAP) and acetate esterase (AEST) activities by fluorogenic model substrates revealed major increases in the enzymatic hydrolysis rates in the aquifer within a 10m distance from the basin. The changes in the EEAs along the flow path occurred simultaneously with decreases in nutrient concentrations. The results support the assumption that the synthesis of extracellular enzymes in aquatic environments is up and down regulated by nutrient availability. The EEAs in the basin sediment and pore water samples (down to 10cm) were in the same order of magnitude as in the basin water, suggesting similar nutritional conditions. Phosphorus was likely to be the limiting nutrient at this particular AGR site. Furthermore, the extracellular enzymes functioned in a synergistic and cooperative way. PMID:19028394

  11. Bioavailability and diagenetic state of dissolved organic matter in riparian groundwater

    Science.gov (United States)

    Peter, Simone; Shen, Yuan; Kaiser, Karl; Benner, Ronald; Durisch-Kaiser, Edith

    2012-12-01

    Riparian groundwater can exhibit considerable patchiness in the concentration and reactivity of dissolved organic matter (DOM), which ultimately shapes subsurface biogeochemical transformations. Free and combined amino acids are bioavailable constituents of DOM, and their concentration and composition can provide valuable information about the diagenetic state of DOM. Based on riparian groundwater samples and relevant DOM end-member samples, we adapted the amino-acid-based marine DOM degradation index (DI) to groundwater. The groundwater DI was applied to evaluate the spatial and temporal variability in the bioavailability and diagenetic state of riparian DOM in a restored and a channelized section of the River Thur, Switzerland. Among different indicators for DOM diagenetic state (total hydrolysable amino acid concentrations, C-normalized yields, and the contribution of nonprotein amino acids), the groundwater DI correlated best with the activity of the enzyme leucine-aminopeptidase and bacterial secondary production in riparian groundwater. The "freshest" DOM was consistently found in the channel and during high-flow conditions in the groundwater of the restored riparian section and was spatially constrained to a zone inhabited by a dense willow population. The use of amino acid data and the newly developed DI for DOM in groundwater is a promising approach for characterizing the spatial and temporal dynamics of DOM reactivity and diagenesis within riparian groundwater.

  12. Microbial availability and size fractionation of dissolved organic carbon after drought in an intermittent stream: biogeochemical link across the stream-riparian interface.

    Science.gov (United States)

    Romaní, Anna M; Vázquez, Eusebi; Butturini, Andrea

    2006-10-01

    The evolution of dissolved organic carbon (DOC) molecular-weight fractions, DOC biodegradability (BDOC), DOC origin [fluorescence index (FI)], and enzyme activities between the stream waters (main and ephemeral channel) and ground waters (riparian and hillslope) were analyzed during the transition from drought to precipitation in a forested Mediterranean stream. After the first rains, DOC content in stream water reached its maximum value (10-18 mg L(-1)), being explained by the leaching of deciduous leaves accumulated on the stream bed during drought. During this period, the largest molecules (>10 kDa), were the most biodegradable, as indicated by high BDOC values measured during storm events and high enzymatic activities (especially for leucine-aminopeptidase). DOC >100 kDa was strongly immobilized (78%) at the stream-riparian interface, whereas the smallest molecules (riparian interface. Microbial immobilization and fast utilization of the most biodegradable fraction at the stream-riparian interface is suggested as a relevant DOC retention mechanism just after initial recharging of the ground water compartment. Large and rapid DOC inputs entering the intermittent river system during the transition from drought to precipitation provide available N and C sources for the heterotrophs. Heterotrophs efficiently utilize these resources that were in limited supply during the period of drought. Such changes in C cycling may highlight possible changes in organic matter dynamics under the prediction of extended drying periods in aquatic ecosystems. PMID:16897299

  13. Using cornstarch in microparticulate diets for larvicultured tropical gar (Atractosteus tropicus).

    Science.gov (United States)

    Frías-Quintana, C A; Domínguez-Lorenzo, J; Álvarez-González, C A; Tovar-Ramírez, D; Martínez-García, R

    2016-04-01

    Aquaculture in Mexico has been developed by the cultivation of commercial species. In Tabasco, the cultivation of native species is mainly limited by the lack of nutrition studies to support its crop profitability. Among these species is the tropical gar (Atractosteus tropicus), which has great potential for cultivation. However, the nutritional value of carbohydrates in diets for this species which contribute to improved growth and survival, have not been evalulated,. Thus, in the present investigation, isoprotein and isolipid diets have been designed based on the substitution of cellulose by corn starch (D1: 0% starch-15% cellulose, D2: 7.5% starch-7.5% cellulose and D3: 15% starch-0% cellulose) and compared with a commercial trout diet (45% protein and 16% lipids). A total of 1800 larvae (0.008 ± 0.002 g and 10.5 ± LT 0.126 mm) were used, distributed in a recirculation system in order to evaluate growth and survival for 30 days. The results show higher growth and survival of 97% of larvae fed the D3 diet, while cannibalism in the species was mitigated. Major digestive enzyme activities occurred (acid protease, alkaline protease, trypsin, chymotrypsin, leucine aminopeptidase, carboxypeptidase A, lipase, α-glucosidase and amylase) for larvae fed D3. It is concluded that the contribution of corn starch (15%) replacing cellulose in the diet improves growth and survival of this species. PMID:26573856

  14. TPPII, MYBBP1A and CDK2 form a protein-protein interaction network.

    Science.gov (United States)

    Nahálková, Jarmila; Tomkinson, Birgitta

    2014-12-15

    Tripeptidyl-peptidase II (TPPII) is an aminopeptidase with suggested regulatory effects on cell cycle, apoptosis and senescence. A protein-protein interaction study revealed that TPPII physically interacts with the tumor suppressor MYBBP1A and the cell cycle regulator protein CDK2. Mutual protein-protein interaction was detected between MYBBP1A and CDK2 as well. In situ Proximity Ligation Assay (PLA) using HEK293 cells overexpressing TPPII forming highly enzymatically active oligomeric complexes showed that the cytoplasmic interaction frequency of TPPII with MYBBP1A increased with the protein expression of TPPII and using serum-free cell growth conditions. A specific reversible inhibitor of TPPII, butabindide, suppressed the cytoplasmic interactions of TPPII and MYBBP1A both in control HEK293 and the cells overexpressing murine TPPII. The interaction of MYBBP1A with CDK2 was confirmed by in situ PLA in two different mammalian cell lines. Functional link between TPPII and MYBBP1A has been verified by gene expression study during anoikis, where overexpression of TPP II decreased mRNA expression level of MYBBP1A at the cell detachment conditions. All three interacting proteins TPPII, MYBBP1A and CDK2 have been previously implicated in the research for development of tumor-suppressing agents. This is the first report presenting mutual protein-protein interaction network of these proteins. PMID:25303791

  15. Fluorogenic Membrane Overlays to Enumerate Total and Fecal Escherichia coli and Total Vibrionaceae in Shellfish and Seawater

    Directory of Open Access Journals (Sweden)

    Gary P. Richards

    2010-01-01

    Full Text Available Three assays were developed to enumerate total and fecal Escherichia coli and total Vibrionaceae in shellfish, seawater, and other foods and environmental samples. Assays involve membrane overlays of overnight colonies on nonselective agar plates to detect -glucuronidase and lysyl aminopeptidase activities for E. coli and Vibrionaceae, respectively. Cellulose membranes containing the substrates 4-methylumbeferyl--D-glucuronide (MUG produced a bright blue fluorescence when overlaid onto E. coli, while L-lysyl-7-amino-4-trifluoromethylcoumarin produced green fluorescent foci when overlaid onto Vibrionaceae family members. A multiplex assay was also developed for simultaneously enumerating total E. coli and total Vibrionaceae in oysters and seawater. Overall, 65% of overlaid E. coli (non-O157:H7 were MUG-positive, compared with 62% as determined by the most-probable-number-MUG assay. The overlays are rapid, simple, and cost effective for quantification purposes. This research provides practical alternatives for monitoring bacterial indicators and potential pathogens in complex samples, including molluscan shellfish.

  16. ERAP1 variants are associated with ankylosing spondylitis in East Asian population: a new Chinese case-control study and meta-analysis of published series.

    Science.gov (United States)

    Chen, C; Zhang, X

    2015-06-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) has been confirmed to be associated with ankylosing spondylitis (AS) in Caucasian. However, whether they are associated with AS in East Asian population remains unidentified. We investigated this relationship by a new Chinese case-control study and a meta-analysis of published series. 368 cases and 460 controls were recruited in the Chinese case-control study. Genotyping was completed using the chip-based matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Allelic associations were analysed using contingency tables. In the meta-analysis, up to 2748 cases and 2774 controls from seven different studies and the new Chinese study were combined using Review Manager software version 5.1.1. Mantel-Haenszel or Inverse Variance test was used to calculate fixed or random-effects pooled ORs. In the new Chinese study, strong association with AS was observed for marker rs10050860, rs27434 and rs1065407 at P value of ERAP1 variants are associated with AS in East Asian population, indicating a common pathogenic mechanism for AS in East Asians and Caucasians. PMID:25817437

  17. ERAP1 structure, function and pathogenetic role in ankylosing spondylitis and other MHC-associated diseases.

    Science.gov (United States)

    Alvarez-Navarro, Carlos; López de Castro, José A

    2014-01-01

    The endoplasmic reticulum aminopeptidase 1 (ERAP1) is a multifunctional enzyme involved in the final processing of Major Histocompatibility Complex class I (MHC-I) ligands and with a significant influence in the stability and immunological properties of MHC-I proteins. ERAP1 polymorphism is associated with ankylosing spondylitis among HLA-B27-positive individuals and the altered enzymatic activity of natural variants has significant effects on the HLA-B27 peptidome, suggesting a critical pathogenetic role of peptides in this disease. Likewise, the association of ERAP1 with other MHC-I associated disorders and its epistasis with their susceptibility MHC alleles point out to a general role of the MHC-I peptidome in these diseases. The functional interaction between ERAP1 and HLA-B27 or other MHC-I molecules may be related to the processing of specific epitopes, or to a more general peptide-dependent influence on other biological features of the MHC-I proteins. In addition, from a consideration of the reported functions of ERAP1, including its involvement in angiogenesis and macrophage activation, a more complex and multi-level influence in the inflammatory and immune pathways operating in these diseases cannot be ruled out. PMID:23916068

  18. ERAP1 in the pathogenesis of ankylosing spondylitis.

    Science.gov (United States)

    Reeves, Emma; Elliott, Tim; James, Edward; Edwards, Christopher J

    2014-12-01

    The endoplasmic reticulum aminopeptidase 1 (ERAP1) performs a major role in antigen processing, trimming N-terminally extended peptides to the final epitope for presentation by major histocompatibility complex class I molecules. Recent genome-wide association studies have identified single nucleotide polymorphisms (SNPs) within ERAP1 as being associated with disease, in particular ankylosing spondylitis (AS). AS is a polygenic chronic inflammatory disease with a strong genetic link to HLA-B27 known for over 40 years. The association of ERAP1 SNPs with AS susceptibility is only observed in HLA-B27-positive individuals, which intersect on the antigen processing pathway. Recent evidence examining the trimming activity of polymorphic ERAP1 highlights its role in generating peptides for loading onto and stabilizing HLA-B27, and the consequent alterations in the interaction of specific NK cell receptors, and the activation of the unfolded protein response as important in the mechanism of disease pathogenesis. Here, we discuss the recent genetic association findings linking ERAP1 SNPs with AS disease susceptibility and the effect of these variants on ERAP1 function, highlighting mechanisms by which AS may arise. The identification of these functional variants of ERAP1 may lead to better stratification of AS patients by providing a diagnostic tool and a potential therapeutic target. PMID:25434650

  19. ERAP1 regulates natural killer cell function by controlling the engagement of inhibitory receptors.

    Science.gov (United States)

    Cifaldi, Loredana; Romania, Paolo; Falco, Michela; Lorenzi, Silvia; Meazza, Raffaella; Petrini, Stefania; Andreani, Marco; Pende, Daniela; Locatelli, Franco; Fruci, Doriana

    2015-03-01

    The endoplasmic reticulum aminopeptidase ERAP1 regulates innate and adaptive immune responses by trimming peptides for presentation by MHC class I (MHC-I) molecules. Herein, we demonstrate that genetic or pharmacological inhibition of ERAP1 on human tumor cell lines perturbs their ability to engage several classes of inhibitory receptors by their specific ligands, including killer cell Ig-like receptors (KIR) by classical MHC-I-peptide (pMHC-I) complexes and the lectin-like receptor CD94-NKG2A by nonclassical pMHC-I complexes, in each case leading to natural killer (NK) cell killing. The protective effect of pMHC-I complexes could be restored in ERAP1-deficient settings by the addition of known high-affinity peptides, suggesting that ERAP1 was needed to positively modify the affinity of natural ligands. Notably, ERAP1 inhibition enhanced the ability of NK cells to kill freshly established human lymphoblastoid cell lines from autologous or allogeneic sources, thereby promoting NK cytotoxic activity against target cells that would not be expected because of KIR-KIR ligand matching. Overall, our results identify ERAP1 as a modifier to leverage immune functions that may improve the efficacy of NK cell-based approaches for cancer immunotherapy. PMID:25592150

  20. ERp44 Exerts Redox-Dependent Control of Blood Pressure at the ER.

    Science.gov (United States)

    Hisatsune, Chihiro; Ebisui, Etsuko; Usui, Masaya; Ogawa, Naoko; Suzuki, Akio; Mataga, Nobuko; Takahashi-Iwanaga, Hiromi; Mikoshiba, Katsuhiko

    2015-06-18

    Blood pressure maintenance is vital for systemic homeostasis, and angiotensin II is a critical regulator. The upstream mechanisms that regulate angiotensin II are not completely understood. Here, we show that angiotensin II is regulated by ERp44, a factor involved in disulfide bond formation in the ER. In mice, genetic loss of ERp44 destabilizes angiotensin II and causes hypotension. We show that ERp44 forms a mixed disulfide bond with ERAP1, an aminopeptidase that cleaves angiotensin II. ERp44 controls the release of ERAP1 in a redox-dependent manner to control blood pressure. Additionally, we found that systemic inflammation triggers ERAP1 retention in the ER to inhibit hypotension. These findings suggest that the ER redox state calibrates serum angiotensin II levels via regulation of the ERp44-ERAP1 complex. Our results reveal a link between ER function and normotension and implicate the ER redox state as a potential risk factor in the development of cardiovascular disease. PMID:25959394