WorldWideScience

Sample records for americium 243

  1. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  2. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  3. 1976 Hanford americium accident

    Energy Technology Data Exchange (ETDEWEB)

    Heid, K R; Breitenstein, B D; Palmer, H E; McMurray, B J; Wald, N

    1979-01-01

    This report presents the 2.5-year medical course of a 64-year-old Hanford nuclear chemical operator who was involved in an accident in an americium recovery facility in August 1976. He was heavily externally contaminated with americium, sustained a substantial internal deposition of this isotope, and was burned with concentrated nitric acid and injured by flying debris about the face and neck. The medical care given the patient, including the decontamination efforts and clinical laboratory studies, are discussed. In-vivo measurements were used to estimate the dose rates and the accumulated doses to body organs. Urinary and fecal excreta were collected and analyzed for americium content. Interpretation of these data was complicated by the fact that the intake resulted both from inhalation and from solubilization of the americium embedded in facial tissues. A total of 1100 ..mu..Ci was excreted in urine and feces during the first 2 years following the accident. The long-term use of diethylenetriaminepentate (DTPA), used principally as the zinc salt, is discussed including the method, route of administration, and effectiveness. To date, the patient has apparently experienced no complications attributable to this extensive course of therapy, even though he has been given approximately 560 grams of DTPA. 4 figures, 1 table.

  4. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  5. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  6. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  7. Kilogram-scale purification of americium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Wheelwright, E. J.

    1979-01-01

    Sequential anion and cation exchange processes have been used for the final purification of /sup 241/Am recovered during the reprocessing of aged plutonium metallurgical scrap. Plutonium was removed by absorption of Dowex 1, X-3.5 (30 to 50 mesh) anion exchange resin from 6.5 to 7.5 M HNO/sub 3/ feed solution. Following a water dilution to 0.75 to 1.0 M HNO/sub 3/, americium was absorbed on Dowex 50W, X-8 (50 to 100 mesh) cation exchange resion. Final purification was accomplished by elution of the absorbed band down 3 to 4 successive beds of the same resin, preloaded with Zn/sup 2 +/, with an NH/sub 4/OH buffered chelating agent. The recovery of mixed /sup 241/Am-/sup 243/Am from power reactor reprocessing waste has been demonstrated. Solvent extraction was used to recover a HNO/sub 3/ solution of mixed lanthanides and actinides from waste generated by the reprocessng of 13.5 tons of Shippingport Power Reactor blanket fuel. Sequential cation exchange band-displacement processes were then used to separate americium and curium from the lanthanides and then to separate approx. 60 g of /sup 244/Cm from 1000 g of mixed /sup 241/Am-/sup 243/Am.

  8. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  9. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  10. Gclust Server: 243 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available 243 CEL_K07E3.3_17568735 Cluster Sequences Related Sequences(40) 303 dao-3: Dauer or Aging... sequences Related Sequences(40) Sequence length 303 Representative annotation dao-3: Dauer or Aging

  11. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  12. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  13. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  14. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  15. 40 CFR 243.204 - Collection management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Collection management. 243.204 Section 243.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES... and Recommended Procedures § 243.204 Collection management....

  16. 33 CFR 117.243 - Nanticoke River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Nanticoke River. 117.243 Section 117.243 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Delaware § 117.243 Nanticoke River. (a) The draw...

  17. 40 CFR 243.201 - Safety.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Safety. 243.201 Section 243.201 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE STORAGE... Procedures § 243.201 Safety....

  18. 48 CFR 243.204 - Administration.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Administration. 243.204... OF DEFENSE CONTRACT MANAGEMENT CONTRACT MODIFICATIONS Change Orders 243.204 Administration. Follow the procedures at PGI 243.204 for administration of change orders....

  19. 7 CFR 58.243 - Checking quality.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Checking quality. 58.243 Section 58.243 Agriculture... Procedures § 58.243 Checking quality. All milk, milk products and dry milk products shall be subject to inspection and analysis by the dairy plant for quality and condition throughout each processing...

  20. 46 CFR 169.243 - Electrical.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Electrical. 169.243 Section 169.243 Shipping COAST GUARD... Certification Inspections § 169.243 Electrical. At each inspection for certification and periodic inspection... that they are in proper operating condition, in safe electrical condition, and fit for the service...

  1. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  2. Surface complexation modeling of americium sorption onto volcanic tuff.

    Science.gov (United States)

    Ding, M; Kelkar, S; Meijer, A

    2014-10-01

    Results of a surface complexation model (SCM) for americium sorption on volcanic rocks (devitrified and zeolitic tuff) are presented. The model was developed using PHREEQC and based on laboratory data for americium sorption on quartz. Available data for sorption of americium on quartz as a function of pH in dilute groundwater can be modeled with two surface reactions involving an americium sulfate and an americium carbonate complex. It was assumed in applying the model to volcanic rocks from Yucca Mountain, that the surface properties of volcanic rocks can be represented by a quartz surface. Using groundwaters compositionally representative of Yucca Mountain, americium sorption distribution coefficient (Kd, L/Kg) values were calculated as function of pH. These Kd values are close to the experimentally determined Kd values for americium sorption on volcanic rocks, decreasing with increasing pH in the pH range from 7 to 9. The surface complexation constants, derived in this study, allow prediction of sorption of americium in a natural complex system, taking into account the inherent uncertainty associated with geochemical conditions that occur along transport pathways.

  3. 37 CFR 2.43 - Service mark.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Service mark. 2.43 Section 2... COMMERCE RULES OF PRACTICE IN TRADEMARK CASES The Written Application § 2.43 Service mark. In an application to register a service mark, the application shall specify and contain all the elements required...

  4. 40 CFR 86.243-94 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.243-94 Section 86.243-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty...

  5. 7 CFR 1220.243 - Confidential treatment.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Confidential treatment. 1220.243 Section 1220.243 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH,...

  6. 27 CFR 24.243 - Filtering aids.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Filtering aids. 24.243... OF THE TREASURY LIQUORS WINE Storage, Treatment and Finishing of Wine § 24.243 Filtering aids. Inert fibers, pulps, earths, or similar materials, may be used as filtering aids in the cellar treatment...

  7. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  8. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  9. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  10. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  11. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  12. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Kyle Shelton [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-28

    These are a set of slides intended for an information session as part of recruiting activities at Brigham Young University. It gives an overview of aqueous chloride operations, specifically on plutonium and americium purification/recovery. This presentation details the steps taken perform these processes, from plutonium size reduction, dissolution, solvent extraction, oxalate precipitation, to calcination. For Americium recovery, it details the CLEAR (chloride extraction and actinide recovery) Line, oxalate precipitation and calcination.

  13. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  14. Dicty_cDB: SLA243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA243 (Link to dictyBase) - G22368 DDB0187482 Contig-U03776-1 SLA...243Z (Link to Original site) - - SLA243Z 336 - - - - Show SLA243 Library SL (Link to library) Clone ID SLA...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLA2-B/SLA243Q.Seq.d/ ...Representative seq. ID SLA243Z (Link to Original site) Representative DNA sequence >SLA243 (SLA243Q) /CSM/SL/SLA2-B/SLA...AGTTATTGGTGATACTTATATTGAAATTAA TTAAAAATTAATAATAAAAAAAAAAAAAAAAATTTTGTACAAATAA sequence update 1997. 5. 7 Transla

  15. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  16. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  17. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  18. Dicty_cDB: SSI243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 243E (Link to Original site) - - - - - - SSI243E 423 Show SSI243 Library SS (Link to library) Clone ID SSI...Representative seq. ID SSI243E (Link to Original site) Representative DNA sequence >SSI243 (SSI243Q) /CSM/SS/SSI2-B/SSI...SS (Link to library) SSI243 (Link to dictyBase) - G23726 DDB0217593 Contig-U04827-1 SSI...243 (Link to dictyBase) Atlas ID - NBRP ID G23726 dictyBase ID DDB0217593 Link to Contig Contig-U04827-1 Original si...te URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSI2-B/SSI243Q.Seq.d/

  19. Käibemaksu maksmine maksab 243 miljonit

    Index Scriptorium Estoniae

    2005-01-01

    Poliitikauuringute keskuse PRAXIS uurimus näitas, et Eesti ettevõtetel kulub käibemaksu administreerimisele ja seadustega kursis hoidmisele aastas kokku 243 miljonit krooni, mis võrdub 0,25% SKP-st. Tabel: Suurim kulu ettevõtetele on enda kursishoidmine käibemaksuküsimustes. Vt. samas: Kuidas PRAXIS halduskoormust hindas

  20. Gas Well Blowout Kills 243 People

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    @@ At least 243 people have been killed and scores of others poisoned in a devastating blowout at a natural gas field in Southwest China's Chongqing municipality on December 24. The accident happened at the Chuandongbei gas field in Kaixian county of Chongqing municipality.

  1. 28 CFR 2.43 - Early termination.

    Science.gov (United States)

    2010-07-01

    ..., YOUTH OFFENDERS, AND JUVENILE DELINQUENTS United States Code Prisoners and Parolees § 2.43 Early... score in the very good risk category and has completed two continuous years of supervision free from an incident of new criminal behavior or serious parole violation; or (ii) Has a salient factor score in a...

  2. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  3. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  4. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  5. 20 CFR 243.4 - Taxation of benefits.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Taxation of benefits. 243.4 Section 243.4 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT TRANSFER, ASSIGNMENT, OR WAIVER OF PAYMENTS § 243.4 Taxation of benefits. (a) Annuities paid by the Board are...

  6. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  7. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  8. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  9. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  10. Method for removal of plutonium impurity from americium oxides and fluorides

    Science.gov (United States)

    FitzPatrick, John R.; Dunn, Jerry G.; Avens, Larry R.

    1987-01-01

    Method for removal of plutonium impurity from americium oxides and fluorides. AmF.sub.4 is not further oxidized to AmF.sub.6 by the application of O.sub.2 F at room temperature, while plutonium compounds present in the americium sample are fluorinated to volatile PuF.sub.6, which can readily be separated therefrom, leaving the purified americium oxides and/or fluorides as the solid tetrafluoride.

  11. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  12. Dicty_cDB: VHP243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP243 (Link to dictyBase) - - - Contig-U16236-1 - (Link to Or...iginal site) VHP243F 134 - - - - - - Show VHP243 Library VH (Link to library) Clone ID VHP243 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16236-1 Original site URL http://dictycdb.b...AXXXXXXXXXX sequence update 2002.10.25 Translated Amino Acid sequence CWPTGIXKTTICT...kilsif*ynfkyyqqpkkk--- Frame B: llaywyxqnnnlyqyyyyfyl*kyflsfniilniinnpkk--- Frame C: CWPTGIXKTTICTNTTIISICKN

  13. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  14. 10 CFR 31.8 - Americium-241 and radium-226 in the form of calibration or reference sources.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Americium-241 and radium-226 in the form of calibration or... BYPRODUCT MATERIAL § 31.8 Americium-241 and radium-226 in the form of calibration or reference sources. (a..., americium-241 or radium-226 in the form of calibration or reference sources: (1) Any person in a...

  15. Uncertainty analysis of doses from ingestion of plutonium and americium.

    Science.gov (United States)

    Puncher, M; Harrison, J D

    2012-02-01

    Uncertainty analyses have been performed on the biokinetic model for americium currently used by the International Commission on Radiological Protection (ICRP), and the model for plutonium recently derived by Leggett, considering acute intakes by ingestion by adult members of the public. The analyses calculated distributions of doses per unit intake. Those parameters having the greatest impact on prospective doses were identified by sensitivity analysis; the most important were the fraction absorbed from the alimentary tract, f(1), and rates of uptake from blood to bone surfaces. Probability distributions were selected based on the observed distribution of plutonium and americium in human subjects where possible; the distributions for f(1) reflected uncertainty on the average value of this parameter for non-specified plutonium and americium compounds ingested by adult members of the public. The calculated distributions of effective doses for ingested (239)Pu and (241)Am were well described by log-normal distributions, with doses varying by around a factor of 3 above and below the central values; the distributions contain the current ICRP Publication 67 dose coefficients for ingestion of (239)Pu and (241)Am by adult members of the public. Uncertainty on f(1) values had the greatest impact on doses, particularly effective dose. It is concluded that: (1) more precise data on f(1) values would have a greater effect in reducing uncertainties on doses from ingested (239)Pu and (241)Am, than reducing uncertainty on other model parameter values and (2) the results support the dose coefficients (Sv Bq(-1) intake) derived by ICRP for ingestion of (239)Pu and (241)Am by adult members of the public.

  16. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  17. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  18. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  19. 14 CFR 243.15 - Conflict with foreign laws.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Conflict with foreign laws. 243.15 Section... PROCEEDINGS) ECONOMIC REGULATIONS PASSENGER MANIFEST INFORMATION § 243.15 Conflict with foreign laws. (a) If a... portion of this part is not required because of a conflict with applicable foreign law....

  20. 14 CFR 125.243 - Certificate holder's responsibilities.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Certificate holder's responsibilities. 125.243 Section 125.243 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... CAPACITY OF 6,000 POUNDS OR MORE; AND RULES GOVERNING PERSONS ON BOARD SUCH AIRCRAFT Maintenance §...

  1. 12 CFR 24.3 - Public welfare investments.

    Science.gov (United States)

    2010-01-01

    ... investment would receive consideration under 12 CFR 25.23 as a “qualified investment.” ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Public welfare investments. 24.3 Section 24.3 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY COMMUNITY AND...

  2. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  3. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  4. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  5. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  6. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  7. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  8. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  9. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  10. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  11. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  12. 10 CFR 32.57 - Calibration or reference sources containing americium-241 or radium-226: Requirements for license...

    Science.gov (United States)

    2010-01-01

    ... or radium-226: Requirements for license to manufacture or initially transfer. 32.57 Section 32.57... americium-241 or radium-226: Requirements for license to manufacture or initially transfer. An application... containing americium-241 or radium-226, for distribution to persons generally licensed under § 31.8 of...

  13. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  14. Preparation of americium targets for nuclear chemistry experiments at DANCE

    International Nuclear Information System (INIS)

    Using 1 gram of 241Am from LANL stocks, the purification steps required to obtain a solution of 241Am from the original material are described. Part of the purified solution was submitted for purity analysis by mass spectrometry, radiochemistry and trace metals analysis. The impurities were expected to be 239Pu and 237Np. A second fraction of this material was used for electroplating three samples onto titanium disks that were suitable for insertion into an instrument package to be placed into the DANCE detector. The purification methods used, the electroplating setup and the solutions to various problems that were encountered in making these targets are discussed. The analytical results are discussed as well as the yields from the electrodeposition process. Comparison of these yields with those from similar experiments utilizing 235U and 243Am are also discussed. (author)

  15. 48 CFR 1852.243-71 - Shared savings.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Shared savings. 1852.243-71... Shared savings. As prescribed in 1843.7102, insert the following clause: Shared Savings (MAR 1997) (a... services to be provided under the contract. (b) Definitions: (1) Cost savings, as contemplated by...

  16. 48 CFR 53.243 - Contract modifications (SF 30).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Contract modifications (SF... (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.243 Contract modifications (SF 30). SF 30 (Rev. 10/83), Amendment of Solicitation/Modification of Contract. SF 30 is prescribed for use in...

  17. 49 CFR 372.243 - Controlling distances and population data.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Controlling distances and population data. 372.243... population data. In the application of § 372.241: (a) Air-line distances or mileages about corporate limits of municipalities shall be used. (b) The population of any municipality shall be deemed to be...

  18. 48 CFR 52.243-6 - Change Order Accounting.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Change Order Accounting....243-6 Change Order Accounting. As prescribed in 43.205(f), the contracting officer may insert a clause, substantially the same as follows: Change Order Accounting (APR 1984) The Contracting Officer may require...

  19. 40 CFR 180.243 - Propazine; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Propazine; tolerances for residues...) PESTICIDE PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.243 Propazine; tolerances for residues. Tolerances are established for negligible residues (N)...

  20. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  1. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats.

    Science.gov (United States)

    Van der Meeren, A; Grémy, O

    2010-09-01

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO(2) powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO(2) with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO(2) with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO(2) powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO(2) with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO(2) aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions.

  2. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  3. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  4. Apparatus for fabrication of americium- beryllium neutron sources prevents capsule contamination

    Science.gov (United States)

    Mohr, W. C.; Van Loom, J. A.

    1967-01-01

    Modified gloved enclosure is used to fill a capsule with a mixture of americium and beryllium radioactive powders to seal weld the opening, and to test it for leaks. It contains a horizontal partition, vortex mixer, mounting press, welder, test vessel, and radiation shielding to prevent surface contamination.

  5. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  6. 30 CFR 243.2 - What leases are subject to this part?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What leases are subject to this part? 243.2 Section 243.2 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.2...

  7. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  8. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  9. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  10. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  11. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  12. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  13. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  14. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  15. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  16. Calcium and zinc DTPA administration for internal contamination with plutonium-238 and americium-241.

    Science.gov (United States)

    Kazzi, Ziad N; Heyl, Alexander; Ruprecht, Johann

    2012-08-01

    The accidental or intentional release of plutonium or americium can cause acute and long term adverse health effects if they enter the human body by ingestion, inhalation, or injection. These effects can be prevented by rapid removal of these radionuclides by chelators such as calcium or zinc diethylenetriaminepentaacetate (calcium or zinc DTPA). These compounds have been shown to be efficacious in enhancing the elimination of members of the actinide family particularly plutonium and americium when administered intravenously or by nebulizer. The efficacy and adverse effects profile depend on several factors that include the route of internalization of the actinide, the type, and route time of administration of the chelator, and whether the calcium or zinc salt of DTPA is used. Current and future research efforts should be directed at overcoming limitations associated with the use of these complex drugs by using innovative methods that can enhance their structural and therapeutic properties.

  17. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  18. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  19. 14 CFR 243.11 - Transmission of information after an aviation disaster.

    Science.gov (United States)

    2010-01-01

    ... aviation disaster. 243.11 Section 243.11 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF... of information after an aviation disaster. (a) Each covered airline shall inform the Managing... upon learning of an aviation disaster involving a covered flight segment operated by that carrier....

  20. 30 CFR 243.1 - What is the purpose of this part?

    Science.gov (United States)

    2010-07-01

    ... 243.1 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.1 What... are a lessee) have appealed under 30 CFR part 290 in effect prior to May 13, 1999 and contained in...

  1. 30 CFR 243.3 - What definitions apply to this part?

    Science.gov (United States)

    2010-07-01

    ... Section 243.3 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.3 What... assigned. MMS bond-approving officer means the Associate Director for Minerals Revenue Management or...

  2. 30 CFR 243.200 - How do I demonstrate financial solvency?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I demonstrate financial solvency? 243.200 Section 243.200 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Financial...

  3. 30 CFR 243.202 - When will MMS monitor my financial solvency?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will MMS monitor my financial solvency? 243.202 Section 243.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT...

  4. 30 CFR 243.4 - How do I suspend compliance with an order?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I suspend compliance with an order? 243.4 Section 243.4 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General...

  5. 30 CFR 243.201 - How will MMS determine if I am financially solvent?

    Science.gov (United States)

    2010-07-01

    ... solvent? 243.201 Section 243.201 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Financial... making payments found in 30 CFR 218.51. You are not required to use Electronic Funds Transfer (EFT)...

  6. 30 CFR 243.8 - When will MMS suspend my obligation to comply with an order?

    Science.gov (United States)

    2010-07-01

    ... with an order? 243.8 Section 243.8 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT... with the Bureau of Land Management for onshore leases, and MMS for OCS leases, as collateral for...

  7. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  8. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  9. MARIOS: Irradiation of UO{sub 2} containing 15% americium at well defined temperature

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E., E-mail: elio.dagata@ec.europa.eu [European Commission, Joint Research Centre, Institute for Energy - P.O. Box 2, 1755 ZG Petten (Netherlands); Hania, P.R. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bejaoui, S. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France); Sciolla, C.; Wyatt, T.; Hannink, M.H.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Herlet, N.; Jankowiak, A. [Commissariat a l' Energie Atomique DTEC CEA Marcoule, 30207 Bagnols sur Ceze Cedex (France); Klaassen, F.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bonnerot, J.-M. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer MARIOS is designed to check the behaviour of Minor Actinide Blanket Module concept. Black-Right-Pointing-Pointer Main requirement of the experiment is an accurate control of the temperature. Black-Right-Pointing-Pointer The swelling and the helium release will be the main output of the experiment. Black-Right-Pointing-Pointer A complementary experiment (DIAMINO), will be performed in the next future. - Abstract: Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors of long-lived nuclides like {sup 241}Am is, therefore, an option for the reduction of radiotoxicity and residual power packages as well as the repository area. The MARIOS irradiation experiment is the latest of a series of experiments on americium transmutation (e.g. EFTTRA-T4, EFTTRA-T4bis, HELIOS). MARIOS experiment is carried out in the framework of the 4-year project FAIRFUELS of the EURATOM 7th Framework Programme (FP7). During the past years of experimental work in the field of transmutation and tests of innovative nuclear fuel containing americium, the release or trapping of helium as well as swelling has shown to be the key issue for the design of such kinds of target. Therefore, the main objective of the MARIOS experiment is to study the in-pile behaviour of UO{sub 2} containing minor actinides (MAs) in order to gain knowledge on the role of the microstructure and of the temperature on the gas release and on fuel swelling. The MARIOS experiment will be conducted in the HFR (high flux reactor) in Petten (The Netherlands) and will start in the beginning of 2011. It has been planned that the experiment will last 11 cycles, corresponding to 11 months. This paper covers the description of the objective of the experiment, as well as a general description of the design of the experiment.

  10. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  11. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  12. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  13. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  14. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  15. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  16. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  17. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  18. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  19. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  20. Clinical analysis of 243 eases of nevus of Ota%243例太田痣临床分析

    Institute of Scientific and Technical Information of China (English)

    李林; 张丽; 谭志建

    2009-01-01

    regnancy. Conclusions Nevus of Ota may be a hereditary disease, and patients with pigmentary disorders are more likely to have descendants with nevus of Ota.%目的 对湖北及周边地区太田痣患者进行临床分析.方法 回顾分析243例太田痣患者在发病时间、色素性疾病家族史及患者母亲妊娠期间是否有用药史等方面进行统计学比较.结果 太田痣出生时发病者占58.0%,出生后发病者占42.0%,主要集中于5~15岁.有色素性疾病家族史者占60.1%,其中以雀斑和咖啡斑为主.患有太田痣与女性妊娠期间是否有用药史无明显关系.结论 太田痣可能具有遗传性,具有色素性疾病史的患者,其后代患太田痣的可能性较大.

  1. 30 CFR 243.101 - How will MMS determine the amount of my bond or other surety instrument?

    Science.gov (United States)

    2010-07-01

    ... other surety instrument? 243.101 Section 243.101 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Bonding Requirements § 243.101 How will MMS determine the amount of my bond or...

  2. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  3. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  4. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  5. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  6. Electrochemical oxidation of 243Am(III) in nitric acid by a terpyridyl-derivatized electrode

    Energy Technology Data Exchange (ETDEWEB)

    Dares, C. J.; Lapides, A. M.; Mincher, B. J.; Meyer, T. J.

    2015-11-05

    A high surface area, tin-doped indium oxide electrode surface-derivatized with a terpyridine ligand has been applied to the oxidation of trivalent americium to Am(V) and Am(VI) in nitric acid. Potentials as low as 1.8 V vs. the saturated calomel electrode are used, 0.7 V lower than the 2.6 V potential for one-electron oxidation of Am(III) to Am(IV) in 1 M acid. This simple electrochemical procedure provides, for the first time, a method for accessing the higher oxidation states of Am in non-complexing media for developing the coordination chemistries of Am(V) and Am(VI) and, more importantly, for separation of americium from nuclear waste streams.

  7. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  8. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  9. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  10. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  11. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  12. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  13. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  14. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  15. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  16. Molecular Cloning and Production of Recombinant Phytase from Bacillus subtilis ASUIA243 in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Nor Soleha Mohd Dali

    2011-12-01

    Full Text Available Phytase gene obtained from Bacillus subtilis ASUIA243 was cloned into a medium vector and transformed into E. coli. Restriction enzyme digestion was conducted to get blunt-ended phytase gene and ligated into the Pichia expression vector, pPICZαA. The recombinant vector, pPICZαA-243HPp was then linearized with PmeI and transformed into P. pastoris strain X33. Screening for multi copy gene number of transformants was done by re-plating the selected colonies on increasing concentration of zeocin. One positive clone, X243HPp#2 was then grown in BMGY media as the starting culture, followed by induction in BMMY media for protein expression study. The supernatant was then analysed by SDS-PAGE and Western blot method to check the protein expression.ABSTRAK: Gen fitase yang didapati daripada Bacillus subtilis ASUIA243 diklonkan sebagai vektor perantara dan berubah menjadi E. coli. Sekatan pencernaan enzim dijalankan untuk mendapatkan gen fitase berhujung tumpul dan diligatkan dengan vektor ekspresi Pichia, pPICZαA. Vektor rekombinan, pPICZαA-243HPp kemudian dilinearkan dengan PmeI dan berubah menjadi P. pastoris strain X33. Penyaringan untuk nombor gen berbilang salinan yang menjalani transformasi genetik dijalankan dengan menyalur semula koloni terpilih dengan penambahan kepekatan zeocin. Satu klon positif, X243HPp#2 kemudian dibiarkan hidup dalam perantara BMGY sebagai kultur permulaan, diikuti dengan aruhan dalam perantara BMMY untuk kajian penglahiran protein. Supernatan kemudian dikaji dengan SDS-PAGE dan kaedah sap Western untuk menyemak penglahiran protein.KEYWORDS:  phytase, Bacillus subtilis, Pichia pastoris, gene cloning.

  17. 30 CFR 243.12 - May I substitute a demonstration of financial solvency for a bond posted before the effective...

    Science.gov (United States)

    2010-07-01

    ... MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.12 May I substitute...

  18. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  19. Molecular Cloning and Production of Recombinant Phytase from Bacillus subtilis ASUIA243 in Pichia pastoris

    OpenAIRE

    Nor Soleha Mohd Dali; Tamrin Nuge; Mohd Hafidz Mahamad Maifiah; Faridah Yusof; Anis Shobirin Meor Hussin; Abd-Elaziem Farouk; and Hamzah Mohd. Salleh

    2011-01-01

    Phytase gene obtained from Bacillus subtilis ASUIA243 was cloned into a medium vector and transformed into E. coli. Restriction enzyme digestion was conducted to get blunt-ended phytase gene and ligated into the Pichia expression vector, pPICZαA. The recombinant vector, pPICZαA-243HPp was then linearized with PmeI and transformed into P. pastoris strain X33. Screening for multi copy gene number of transformants was done by re-plating the selected colonies on increasing concentrati...

  20. Preparation and high intensity heavy ion irradiation tests of intermetallic 243Am/Pd targets

    International Nuclear Information System (INIS)

    Previously reported preparation method for Pd-based intermetallic targets (Usoltsev, et al., 2012) [1] has been successfully applied for producing two stationary 243Am/Pd targets. Both targets have been irradiated at the U-400 cyclotron at Flerov Laboratory of Nuclear Reactions Dubna (Russian Federation) using high intensity beams (up to 0.83 μApart) of 48Ca18+. Alpha-particle spectroscopy and light microscopy allowed for a comprehensive characterization of the intermetallic targets before and after irradiation. A natNd/Pd intermetallic target and a solely electroplated 243Am/Ti target were similarly investigated for comparison

  1. Spectroscopic monitoring of the luminous blue variable Westerlund1-243 from 2002 to 2009

    OpenAIRE

    Ritchie, B.; Clark, J. S.; Negueruela,, I.; Najarro, F

    2009-01-01

    Context. The massive post-main sequence star W243 in the galactic starburst cluster Westerlund 1 has undergone a spectral transformation from a B2Ia supergiant devoid of emission features in 1981 to an A-type supergiant with a rich emission-line spectrum by 2002/03.Aims. We examine the continued evolution of W243 from 2002 to 2009 to understand its evolutionary state, current physical properties and the origin of its peculiar emission line spectrum.Methods. We used VLT/UVES and VLT/FLAMES to ...

  2. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  3. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  4. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    Energy Technology Data Exchange (ETDEWEB)

    Suneesh, A.S.; Venkatesan, K.A.; Syamala, K.V.; Antony, M.P.; Vasudeva Rao, P.R. [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.

    2012-07-01

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by {sup 1}H and {sup 13}C NMR, mass and IR spectroscopy. The extraction behaviour of {sup (152+154})Eu(III) and {sup 241}Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for {sup (152+154)}Eu(III) and HDEHSDGA shows the superior selectivity for {sup 241}Am(III). (orig.)

  5. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  6. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  7. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  8. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  9. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed.

  10. 17 CFR 243.103 - No effect on Exchange Act reporting status.

    Science.gov (United States)

    2010-04-01

    ... filings in a timely manner; or (b) There is adequate current public information about the issuer for... a public disclosure required solely by § 243.100 shall not affect whether: (a) For purposes of Forms S-2 (17 CFR 239.12), S-3 (17 CFR 239.13) and S-8 (17 CFR 239.16b) under the Securities Act,...

  11. Pesticides: Benefaction or Pandora's Box? A synopsis of the environmental aspects of 243 pesticides

    NARCIS (Netherlands)

    Linders JBHJ; Jansma JW; Mensink BJWG; Otermann K; ACT

    1994-01-01

    The report provides an overview of physical, chemical and environmental data of 243 pesticides. The data mentioned are based on confidential information supplied by the manufacturers of the pesticides. For all pesticides mentioned a Final Environmental File, which is public, is derived. Tables with

  12. 49 CFR 234.243 - Wire on pole line and aerial cable.

    Science.gov (United States)

    2010-10-01

    ... Maintenance, Inspection, and Testing Maintenance Standards § 234.243 Wire on pole line and aerial cable. Wire... transmission line operating at voltage of 750 volts or more shall be placed not less than 4 feet above the... 49 Transportation 4 2010-10-01 2010-10-01 false Wire on pole line and aerial cable....

  13. 49 CFR 173.243 - Bulk packaging for certain high hazard liquids and dual hazard materials which pose a moderate...

    Science.gov (United States)

    2010-10-01

    ... conforming to 46 CFR part 64 with design pressure of at least 172.4 kPa (25 psig) are authorized. Unless... dual hazard materials which pose a moderate hazard. 173.243 Section 173.243 Transportation Other... hazard liquids and dual hazard materials which pose a moderate hazard. When § 172.101 of this...

  14. 20 CFR 404.243 - Computation where you are eligible for a pension based on noncovered employment.

    Science.gov (United States)

    2010-04-01

    ... pension based on noncovered employment. 404.243 Section 404.243 Employees' Benefits SOCIAL SECURITY... for a pension based on noncovered employment. The provisions of § 404.213 are applicable to... of living amount), minus one-half the portion of your monthly pension which is due to noncovered...

  15. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  16. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  17. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  18. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  19. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  20. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  1. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  2. EFFECT OF COMPOSITION OF SELECTED GROUNDWATERS FROM THE BASIN AND RANGE PROVINCE ON PLUTONIUM, NEPTUNIUM, AND AMERICIUM SPECIATION.

    Science.gov (United States)

    Rees, Terry F.; Cleveland, Jess M.; Nash, Kenneth L.

    1984-01-01

    The speciation of plutonium, neptunium, and americium was determined in groundwaters from four sources in the Basin and Range Province: the lower carbonate aquifer, Nevada Test Site (NTS) (Crystal Pool); alluvial fill, Frenchman Flat, NTS (well 5C); Hualapai Valley, Arizona (Red Lake south well); and Tularosa Basin, New Mexico (Rentfrow well). The results were interpreted to indicate that plutonium and, to a lesser extent, neptunium are least soluble in reducing groundwaters containing a large concentration of sulfate ion and a small concentration of strongly complexing anions. The results further emphasize the desirability of including studies such as this among the other site-selection criteria for nuclear waste repositories.

  3. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  4. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  5. Bulk density of asteroid 243 Ida from the orbit of its satellite Dactyl

    Science.gov (United States)

    Belton, M.J.S.; Chapmant, C.R.; Thomas, P.C.; Davies, M.E.; Greenberg, R.; Klaasen, K.; Byrnes, D.; D'Amario, L.; Synnott, S.; Johnson, T.V.; McEwen, A.; Merline, W.J.; Davis, D.R.; Petit, J.-M.; Storrs, A.; Veverka, J.; Zellner, B.

    1995-01-01

    DURING its reconnaissance of the asteroid 243 Ida, the Galileo spacecraft returned images of a second object, 1993(243)1 Dactyl1 - the first confirmed satellite of an asteroid. Sufficient data were obtained on the motion of Dactyl to determine its orbit as a function of Ida's mass. Here we apply statistical and dynamical arguments to constrain the range of possible orbits, and hence the mass of Ida. Combined with the volume of Ida2, this yields a bulk density of 2.6??0.5 g cm-3. Allowing for the uncertainty in the porosity of Ida, this density range is consistent with a bulk chondritic composition, and argues against some (but not all) classes of meteoritic igneous rock types that have been suggested as compositionally representative of S-type asteroids like Ida.

  6. An Unusual Stress Metabolite from a Hydrothermal Vent Fungus Aspergillus sp. WU 243 Induced by Cobalt.

    Science.gov (United States)

    Ding, Chihong; Wu, Xiaodan; Auckloo, Bibi Nazia; Chen, Chen-Tung Arthur; Ye, Ying; Wang, Kuiwu; Wu, Bin

    2016-01-01

    A novel hybrid polyketide-terpenoid, aspergstressin (1), possessing a unique fused polycyclic structure, was induced from culture broth of strain Aspergillus sp. WU 243 by cobalt ion stimulation. The strain was isolated from the digestive gland of Xenograpsus testudinatus, a unique type of crab which dwells in the Kueishantao hydrothermal vents off Taiwan. The chemical structure and relative configuration of the stress metabolite were established by spectroscopic means. Aspergillus sp. WU 243 produced aspergstressin (1) only under cobalt stressed culture conditions. The results show that stress-driven discovery of new natural products from hydrothermal vent fungi is an effective strategy to unveil the untapped reservoir of small molecules from species found in the hydrothermal vent environment. PMID:26805789

  7. Effect of arginine on stability of GST-ZNF191(243-368)

    Institute of Scientific and Technical Information of China (English)

    Dong Xin Zhao; Zhong Xian Huang

    2007-01-01

    For better understanding the chemical or biological information of ZNF191 (243-368), we expressed the fusion protein of GST and ZNF191(243-368), and used it to obtain the binding DNA sequence of this zinc finger protein. But in the process of expression and purification, we found this fusion protein slowly degradated. For resolving this problem, we simultaneously added charged amino acids L-Arg and L-Glu to the solution of fusion protein, and demonstrated that this method can dramatically increase the stability of this fusion protein. This method can make the fusion protein suitable for the continuous works, especially for situations where high protein concentration and long-term stability without precipitate and degradation of protein are required.

  8. Yb fiber amplifier at 972.5 nm with frequency quadrupling to 243.1 nm

    CERN Document Server

    Burkley, Z; Cooper, S F; Brandt, A D; Yost, D C

    2016-01-01

    We demonstrate a continuous-wave ytterbium-doped fiber amplifier which produces 6.3 W at a wavelength of 972.5 nm. We frequency quadruple this source in two resonant doubling stages to produce 530 mW at 243.1 nm. Radiation at this wavelength is required to excite the 1S-2S transition in atomic hydrogen and could therefore find application in experimental studies of hydrogen and anti-hydrogen.

  9. Spectroscopic monitoring of the luminous blue variable Westerlund1-243 from 2002 to 2009

    CERN Document Server

    Ritchie, B W; Negueruela, I; Najarro, F

    2009-01-01

    The massive post-Main Sequence star W243 in the galactic starburst cluster Westerlund 1 has undergone a spectral transformation from a B2Ia supergiant devoid of emission features in 1981 to an A-type supergiant with a rich emission-line spectrum by 2002/03. We used VLT/UVES and VLT/FLAMES to obtain high-resolution spectra on six epochs in 2003/04 (UVES) and ten epochs in 2008/09 (FLAMES). These spectra are used alongside other VLT/FLAMES and NTT/EMMI spectra to follow the evolution of W243 from 2002 to 2009. W243 displays a complex, time-varying spectrum with emission lines of Hydrogen, Helium and Lyman-pumped metals, forbidden lines of Nitrogen and Iron, and a large number of absorption lines from neutral and singly-ionized metals. Many lines are complex emission/absorption blends. The LBV has a current temperature of ~8500K (spectral type A3Ia+), and displays signs of photospheric pulsations and weak episodic mass loss. Nitrogen is highly overabundant, with Carbon and Oxygen depleted, indicative of surface ...

  10. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  11. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  12. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  13. LIBS Spectral Data for a Mixed Actinide Fuel Pellet Containing Uranium, Plutonium, Neptunium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Judge, Elizabeth J. [Los Alamos National Laboratory; Berg, John M. [Los Alamos National Laboratory; Le, Loan A. [Los Alamos National Laboratory; Lopez, Leon N. [Los Alamos National Laboratory; Barefield, James E. [Los Alamos National Laboratory

    2012-06-18

    Laser-induced breakdown spectroscopy (LIBS) was used to analyze a mixed actinide fuel pellet containing 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2}. The preliminary data shown here is the first report of LIBS analysis of a mixed actinide fuel pellet, to the authors knowledge. The LIBS spectral data was acquired in a plutonium facility at Los Alamos National Laboratory where the sample was contained within a glove box. The initial installation of the glove box was not intended for complete ultraviolet (UV), visible (VIS) and near infrared (NIR) transmission, therefore the LIBS spectrum is truncated in the UV and NIR regions due to the optical transmission of the window port and filters that were installed. The optical collection of the emission from the LIBS plasma will be optimized in the future. However, the preliminary LIBS data acquired is worth reporting due to the uniqueness of the sample and spectral data. The analysis of several actinides in the presence of each other is an important feature of this analysis since traditional methods must chemically separate uranium, plutonium, neptunium, and americium prior to analysis. Due to the historic nature of the sample fuel pellet analyzed, the provided sample composition of 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2} cannot be confirm without further analytical processing. Uranium, plutonium, and americium emission lines were abundant and easily assigned while neptunium was more difficult to identify. There may be several reasons for this observation, other than knowing the exact sample composition of the fuel pellet. First, the atomic emission wavelength resources for neptunium are limited and such techniques as hollow cathode discharge lamp have different dynamics than the plasma used in LIBS which results in different emission spectra. Secondly, due to the complex sample of four actinide elements, which all have very dense electronic energy levels, there may be reactions and

  14. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  15. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state propertie...

  16. Measurements of neutron cross section of the {sup 243}Am(n,{gamma}){sup 244}Am reaction

    Energy Technology Data Exchange (ETDEWEB)

    Hatsukawa, Yuichi; Shinohara, Nobuo; Hata, Kentaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-03-01

    The effective thermal neutron cross section of {sup 243}Am(n,{gamma}){sup 244}Am reaction was measured by the activation method. Highly-purified {sup 243}Am target was irradiated in an aluminum capsule by using a research reactor JRR-3M. The tentative effective thermal neutron cross sections are 3.92 b, and 84.44 b for the production of {sup 244g}Am and {sup 244m}Am, respectively. (author)

  17. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Science.gov (United States)

    Jandel, M.; Bredeweg, T. A.; Stoyer, M. A.; Wu, C. Y.; Fowler, M. M.; Becker, J. A.; Bond, E. M.; Couture, A.; Haight, R. C.; Haslett, R. J.; Henderson, R. A.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.; Wouters, J. M.

    2009-01-01

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 10 eV and 250 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented where the fission events were actively triggered during the experiments. In these experiments, a Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) events from (n,f) events. The first direct observation of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  18. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, Marian [Los Alamos National Laboratory

    2008-01-01

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for {sup 241}Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for {sup 243}Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on {sup 242m}Am will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,{gamma}) from (n,f) events. The first evidence of neutron capture on {sup 242m}Am in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  19. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    International Nuclear Information System (INIS)

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) from (n,f) events. The first evidence of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  20. ESO 243-49 HLX-1: scaling of X-ray spectral properties and black hole mass determination

    CERN Document Server

    Titarchuk, Lev

    2016-01-01

    We report the results of Swift/XRT observations (2008-2015) of a hyper-luminous X-ray source, ESO 243-49 HLX-1. We found a strong observational evidence that ESO 243-49 HLX-1 underwent spectral transitions from the low/hard state to the high/soft state during these observations. The spectra of ESO 243-49 HLX-1 are well fitted by the so-{called} bulk motion Comptonization model for all spectral states. We have established the photon index Gamma saturation level, Gamma_{sat}$=3.0+/-0.1, in the correlation of Gamma versus mass accretion rate dot M. This Gamma-dot M correlation allows us to estimate the black hole (BH) mass in ESO 243-49 HLX-1 to be M_{BH}~ 7x 10^4 solar masses, assuming the distance to ESO 243-49 of 95 Mpc. For the BH mass estimate we used the scaling method, taking Galactic BHs XTE~J1550-564, H~1743-322 and 4U~1630-472, and an extragalactic BH source, M101 ULX-1 as reference sources. The Gamma-dot M correlation revealed in ESO 243-49 HLX-1 is similar to those in a number of Galactic and extraga...

  1. 腹腔镜胆囊切除术243例护理分析%Nursing Analysis of 243 Laparoscopic Cholecystectomy Cases

    Institute of Scientific and Technical Information of China (English)

    王岩

    2015-01-01

    目的:探讨围手术期护理干预对腹腔镜胆囊切除术患者的临床意义。方法选择本院收治的需进行腹腔镜胆囊切除术的患者243例,随机分为对照组与观察组,对照组采用常规护理模式,观察组采用整体护理干预进行护理,对比观察两组患者的护理满意度,及手术时间、术中出血量和住院时间情况。结果观察组护理满意度显著高于对照组,差异有统计学意义(P<0.05);与对照组相比,观察组的手术时间、术中出血量、患者住院时间均具有明显优势,差异具有显著性(P<0.05)。结论完整的围术期护理干预模式可以降低腹腔镜胆囊切除术手术时间,提高患者康复速度,且减少并发症,患者满意度普遍较高。%Objective To study the clinical significance of nursing operation in peri-operation in patients with laparoscopic cholecystectomy.Methods Choose 243 patients who were treated with laparoscopic cholecystectomy in our hospital, randomly divided into control group and observation group, control group adopted the conventional care, observation group were treated with the whole nursing operation in peri-operation, observed patients satisfaction with nursing, the operation time, peri-operative bleeding and length of hospital stay.Results Compared with control group, the observation group had significantly advantage in clinical nursing satisfaction, the operation time, peri-operative bleeding and length of hospital stay. The difference was statistically significant(P<0.05).Conclusion Complete perioperative nursing intervention mode can reduce the operation time of laparoscopic cholecystectomy, improve patient recovery rate, reduce the complications, and improve patient satisfaction.

  2. A monolithic collapse origin for the thin/thick disc structure of ESO~243-49

    CERN Document Server

    Comerón, S; Peletier, R F; Mentz, J

    2016-01-01

    ESO 243-49 is a high-mass (circular velocity $v_{\\rm c}\\approx200\\,{\\rm km\\,s^{-1}}$) edge-on S0 galaxy in the Abell 2877 cluster at a distance of $\\sim95\\,{\\rm Mpc}$. To elucidate the origin of its thick disc, we use MUSE science verification data to study its kinematics and stellar populations. The thick disc emits $\\sim80\\%$ of the light at heights in excess of $3.5^{\\prime\\prime}$ ($1.6\\,{\\rm kpc}$). The rotation velocities of its stars lag by $30-40\\,{\\rm km\\,s^{-1}}$ compared to those in the thin disc, which is compatible with the asymmetric drift. The thick disc is found to be more metal-poor than the thin disc, but both discs have old ages. We suggest an internal origin for the thick disc stars in high-mass galaxies. We propose that the thick disc formed either ${\\rm a)}$ first in a turbulent phase with a high star formation rate and that a thin disc formed shortly afterwards, or ${\\rm b)}$ because of the dynamical heating of a thin pre-existing component. Either way, the star formation in ESO 243-49 ...

  3. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  4. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  5. THE FIRST ISOLATION OF AMERICIUM IN THE FORM OF PURE COMPOUNDS - THE SPECIFIC ALPHA-ACTIVITY AND HALF-LIFE OF Am241

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, B.B.; Asprey, L.B.

    1950-07-20

    The microgram scale isolation and preparation of pure compounds of americium is described. Data are presented to show that the alpha-half-life of the isotope Am{sup 241} is 490 {+-} 14 years. The absorption spectrum of Am(III) in 1M nitric acid in the range 3500-8000 mu is given. The wave lengths of 10 of the most prominent lines in the copper spark emission spectrum of americium are given to the nearest 0.01 {angstrom}. Evidence is presented to show that the potential for the Am(III)-Am(IV) couple in acid solution is more negative than -2v and that the potential for the Am(II)-Am(III) couple is more positive than +0.9v.

  6. 30 CFR 243.7 - What must a person do when posting a bond or other surety instrument or demonstrating financial...

    Science.gov (United States)

    2010-07-01

    ....7 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.7...

  7. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  8. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  9. Lipoprotein Lipase Deficiency (R243H) in a Type 2 Diabetes Patient with Multiple Arterial Aneurysms.

    Science.gov (United States)

    Suzuki, Toru; Sawada, Shojiro; Ishigaki, Yasushi; Tsukita, Sohei; Kodama, Shinjiro; Sugisawa, Takashi; Imai, Junta; Yamada, Tetsuya; Yamaguchi, Takashi; Murano, Takeyoshi; Katagiri, Hideki

    2016-01-01

    Lipoprotein lipase (LPL) deficiency is a rare monogenic disorder that manifests as severe hypertriglyceridemia. Whether or not LPL deficiency accelerates the development of atherosclerosis remains controversial. We herein report a 66-year-old woman who was homozygous for the R243H LPL mutation. She had developed multiple arterial aneurysms and systemic atherosclerosis despite good control of other atherogenic risk factors, including diabetes. Furthermore, although intensive pharmaceutical therapies had been minimally effective, medium chain triglyceride (MCT) therapy reduced the serum triglyceride levels. Thus, this case suggests important role that mutated LPL protein plays in the progression of atherosclerosis and that MCT therapy is potentially effective, even for severe hypertriglyceridemia due to LPL deficiency. PMID:27150867

  10. Measurement of fission cross section with pure Am-243 sample using lead slowing-down spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Katsuhei; Yamamoto, Shuji; Kai, T.; Fujita, Yoshiaki; Yamamoto, Hideki; Kimura, Itsuro [Kyoto Univ. (Japan); Shinohara, Nobuo

    1997-03-01

    By making use of back-to-back type double fission chambers and a lead slowing-down spectrometer coupled to an electron linear accelerator, the fission cross section for the {sup 243}Am(n,f) reaction has been measured relative to that for the {sup 235}U(n,f) reaction in the energy range from 0.1 eV to 10 keV. The measured result was compared with the evaluated nuclear data appeared in ENDF/B-VI and JENDL-3.2, whose evaluated data were broadened by the energy resolution function of the spectrometer. General agreement was seen between the evaluated data and the measurement except that the ENDF/B-VI data were lower in the range from 15 to 60 eV and that the JENDL-3.2 data seemed to be lower above 100 eV. (author)

  11. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  12. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  13. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  14. 30 CFR 243.10 - When will MMS collect against a bond or other surety instrument or a person demonstrating...

    Science.gov (United States)

    2010-07-01

    ... MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.10 When will MMS collect against... that decision to the IBLA under 43 CFR part 4, subpart E; (2) If the IBLA, the Director of the...

  15. Measurement and analysis of the $^{243}$Am neutron capture cross section at the n_TOF facility at CERN

    CERN Document Server

    Mendoza, E; Guerrero, C; Berthoumieux, E; Abbondanno, U; Aerts, G; Alvarez-Velarde, F; Andriamonje, S; Andrzejewski, J; Assimakopoulos, P; Audouin, L; Badurek, G; Balibrea, J; Baumann, P; Becvar, F; Belloni, F; Calvino, F; Calviani, M; Capote, R; Carrapico, C; Carrillo de Albornoz, A; Cennini, P; Chepel, V; Chiaveri, E; Colonna, N; Cortes, G; Couture, A; Cox, J; Dahlfors, M; David, S; Dillmann, I; Dolfini, R; Domingo-Pardo, C; Dridi, W; Duran, I; Eleftheriadis, C; Ferrant†, L; Ferrari, A; Ferreira-Marques, R; Fitzpatrick, L; Frais-Koelbl, H; Fujii, K; Furman, W; Goncalves, I; Gonz alez-Romero, E; Goverdovski, A; Gramegna, F; Griesmayer, E; Gunsing, F; Haas, B; Haight, R; Heil, M; Herrera-Martinez, A; Igashira, M; Isaev, S; Jericha, E; Kappeler, F; Kadi, Y; Karadimos, D; Karamanis, D; Ketlerov, V; Kerveno, M; Koehler, P; Konovalov, V; Kossionides, E; Krticka, M; Lampoudis, C; Leeb, H; Lindote, A; Lopes, I; Lossito, R; Lozano, M; Lukic, S; Marganiec, J; Marques, L; Marrone, S; Martınez, T; Massimi, C; Mastinu, P; Mengoni, A; Milazzo, P M; Moreau, C; Mosconi, M; Neves, F; Oberhummer, H; O’Brien, S; Oshima, M; Pancin, J; Papachristodoulou, C; Papadopoulos, C; Paradela, C; Patronis, N; Pavlik, A; Pavlopoulos, P; Perrot, L; Pigni, M T; Plag, R; Plompen, A; Plukis, A; Poch, A; Praena, J; Pretel, C; Quesada, J; Rauscher, T; Reifarth, R; Rosetti, M; Rubbia, C; Rudolf, G; Rullhusen, P; Salgado, J; Santos, C; Sarchiapone, L; Savvidis, I; Stephan, C; Tagliente, G; Tain, J L; Tassan-Got, L; Tavora, L; Terlizzi, R; Vannini, G; Vaz, P; Ventura, A; Villamarin, D; Vicente, M C; Vlachoudis, V; Vlastou, R; Voss, F; Walter, S; Wendler, H; Wiescher, M; Wisshak, K

    2014-01-01

    Background:The design of new nuclear reactors and transmutation devices requires to reduce the present neutron cross section uncertainties of minor actinides. Purpose: Reduce the $^{243}$Am(n,$\\gamma$) cross section uncertainty. Method: The $^{243}$Am(n,$\\gamma$) cross section has been measured at the n_TOF facility at CERN with a BaF$_{2}$ Total Absorption Calorimeter, in the energy range between 0.7 eV and 2.5 keV. Results: The $^{243}$Am(n,$\\gamma$) cross section has been successfully measured in the mentioned energy range. The resolved resonance region has been extended from 250 eV up to 400 eV. In the unresolved resonance region our results are compatible with one of the two incompatible capture data sets available below 2.5 keV. The data available in EXFOR and in the literature has been used to perform a simple analysis above 2.5 keV. Conclusions: The results of this measurement contribute to reduce the $^{243}$Am(n,$\\gamma$) cross section uncertainty and suggest that this cross section is underestimate...

  16. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  17. Intramolecular sensitization of americium luminescence in solution: shining light on short-lived forbidden 5f transitions.

    Science.gov (United States)

    Sturzbecher-Hoehne, M; Yang, P; D'Aléo, A; Abergel, R J

    2016-06-14

    The photophysical properties and solution thermodynamics of water soluble trivalent americium (Am(III)) complexes formed with multidentate chromophore-bearing ligands, 3,4,3-LI(1,2-HOPO), Enterobactin, and 5-LIO(Me-3,2-HOPO), were investigated. The three chelators were shown to act as antenna chromophores for Am(III), generating sensitized luminescence emission from the metal upon complexation, with very short lifetimes ranging from 33 to 42 ns and low luminescence quantum yields (10(-3) to 10(-2)%), characteristic of Near Infra-Red emitters in similar systems. The specific emission peak of Am(III) assigned to the (5)D1 → (7)F1 f-f transition was exploited to characterize the high proton-independent stability of the complex formed with the most efficient sensitizer 3,4,3-LI(1,2-HOPO), with a log β110 = 20.4 ± 0.2 value. In addition, the optical and solution thermodynamic features of these Am(III) complexes, combined with density functional theory calculations, were used to probe the influence of electronic structure on coordination properties across the f-element series and to gain insight into ligand field effects.

  18. Nano-cerium vanadate: a novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste.

    Science.gov (United States)

    Banerjee, Chayan; Dudwadkar, Nilesh; Tripathi, Subhash Chandra; Gandhi, Pritam Maniklal; Grover, Vinita; Kaushik, Chetan Prakash; Tyagi, Avesh Kumar

    2014-09-15

    Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides (233)U (4.82 MeV α) and (241)Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr(2+), Ru(3+), Fe(3+), etc., in the uptake process indicated CeVO4 nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  19. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  20. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  1. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  2. Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes.

    Directory of Open Access Journals (Sweden)

    Szu-Wei Chang

    Full Text Available The papillomavirus E2 protein is involved in the maintenance of persistent infection and known to bind either to cellular factors or directly to mitotic chromosomes in order to partition the viral genome into the daughter cells. However, how the HPV-16 E2 protein acts to facilitate partitioning of the viral genome remains unclear. In this study, we found that serine 243 of HPV-16 E2, located in the hinge region, is crucial for chromosome binding during mitosis. Bromodomain protein 4 (Brd4 has been identified as a cellular binding target through which the E2 protein of bovine papillomavirus type 1 (BPV-1 tethers the viral genome to mitotic chromosomes. Mutation analysis showed that, when the residue serine 243 was substituted by glutamic acid or aspartic acid, whose negative charges mimic the effect of constitutive phosphorylation, the protein still can interact with Brd4 and colocalize with Brd4 in condensed metaphase and anaphase chromosomes. However, substitution by the polar uncharged residues asparagine or glutamine abrogated Brd4 and mitotic chromosome binding. Moreover, following treatment with the inhibitor JQ1 to release Brd4 from the chromosomes, Brd4 and E2 formed punctate foci separate from the chromosomes, further supporting the hypothesis that the association of the HPV-16 E2 protein with the chromosomes is Brd4-dependent. In addition, the S243A E2 protein has a shorter half-life than the wild type, indicating that phosphorylation of the HPV-16 E2 protein at serine 243 also increases its half-life. Thus, phosphorylation of serine 243 in the hinge region of HPV-16 E2 is essential for interaction with Brd4 and required for host chromosome binding.

  3. Expansion parallax for the compact planetary nebula M2-43

    Directory of Open Access Journals (Sweden)

    L. Guzmán

    2006-01-01

    Full Text Available Presentamos observaciones de alta calidad en radiocontinuo hechas a 3.6 cm con el Very Large Array en dos épocas hacia la nebulosa planetaria M2-43. La comparación de las dos épocas, obtenidas con una separación de 4.07 años, muestra claramente la expansión de la nebulosa planetaria con una velocidad angular de 0.61_0.09 mas año_1. Suponiendo que la velocidad de expansión en el plano del cielo (determinada de estas mediciones y la velocidad de expansión en la línea de visión (determinada a partir de espectroscopía óptica disponible en la literatura son iguales, encontramos una distancia de 6.9 1.5 kpc a la nebulosa planetaria. Esta es la mayor distancia a una nebulosa planetaria medida hasta ahora con esta técnica.

  4. Physiological roles for two periplasmic nitrate reductases in Rhodobacter sphaeroides 2.4.3 (ATCC 17025).

    Science.gov (United States)

    Hartsock, Angela; Shapleigh, James P

    2011-12-01

    The metabolically versatile purple bacterium Rhodobacter sphaeroides 2.4.3 is a denitrifier whose genome contains two periplasmic nitrate reductase-encoding gene clusters. This work demonstrates nonredundant physiological roles for these two enzymes. One cluster is expressed aerobically and repressed under low oxygen while the second is maximally expressed under low oxygen. Insertional inactivation of the aerobically expressed nitrate reductase eliminated aerobic nitrate reduction, but cells of this strain could still respire nitrate anaerobically. In contrast, when the anaerobic nitrate reductase was absent, aerobic nitrate reduction was detectable, but anaerobic nitrate reduction was impaired. The aerobic nitrate reductase was expressed but not utilized in liquid culture but was utilized during growth on solid medium. Growth on a variety of carbon sources, with the exception of malate, the most oxidized substrate used, resulted in nitrite production on solid medium. This is consistent with a role for the aerobic nitrate reductase in redox homeostasis. These results show that one of the nitrate reductases is specific for respiration and denitrification while the other likely plays a role in redox homeostasis during aerobic growth. PMID:21949073

  5. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  6. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1991-12-01

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref.

  7. Nano-cerium vanadate: A novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Chayan; Dudwadkar, Nilesh [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tripathi, Subhash Chandra, E-mail: sctri001@gmail.com [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Gandhi, Pritam Maniklal [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Grover, Vinita [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kaushik, Chetan Prakash [Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tyagi, Avesh Kumar, E-mail: aktyagi@barc.gov.in [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2014-09-15

    Highlights: • Template free, low temperature synthesis of CeVO{sub 4} nanopowders. • Thermodynamically and kinetically favourable uptake of Am(III) and U(VI) exhibited. • K{sub d} and ΔG° values for Am(III) and U(VI) uptake in pH 1–6 are reported. • Interdiffusion coefficients and zeta potential values in pH 1–6 are reported. • Possible application in low level aqueous nuclear waste remediation. - Abstract: Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides {sup 233}U (4.82 MeV α) and {sup 241}Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3 h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr{sup 2+}, Ru{sup 3+}, Fe{sup 3+}, etc., in the uptake process indicated CeVO{sub 4} nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  8. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  9. D2-43病毒E蛋白在酵母细胞表面的展示%Display of the envelope protein of D2-43 on yeast cells surface

    Institute of Scientific and Technical Information of China (English)

    陈水平; 范宝昌; 姜涛; 秦成峰; 邓永强; 彭文明; 段鸿元; 秦鄂德

    2004-01-01

    目的:在酵母细胞表面展示登革2型病毒43株(D2-43)的E基因,探索利用酵母表面展示系统建立DNA改组筛选平台的可行性.方法:通过RT-PCR扩增获得D2-43的E基因,将该基因亚克隆至T载体后,再克隆至酵母表面展示载体pYD1,于酿酒酵母EBY100中利用半乳糖进行诱导表达.表达产物采用间接免疫荧光法和FACS进行检测.结果:酵母表面展示产物可与D2-43的腹水抗体特异性地结合;在半乳糖诱导后24 h,展示E蛋白的酵母细胞百分数达22.07%.结论:本研究为建立基于酵母表面展示系统的DNA改组筛选平台奠定了基础.

  10. 优质花生新品种龙花243示范表现与高产栽培技术%Demonstration performance and high-yielding cultivation technique of high-quailty new variety Longhua243

    Institute of Scientific and Technical Information of China (English)

    李培德

    2011-01-01

    New peanut variety Longhua243 was bred by Longyan Agricultural Science Institute,Fujian Province and demonstrated in Shishi City.This cultivar displayed traits of high yield,good quality,uniformity of population and strong vitality.This paper concluded high-yield cultivation techniques including selection of seeds,optimization of sowing technology,fertilizer and water management,disease and pest control,etc.%龙花243系龙岩市农业科学研究所育成的优质花生新品种,在石狮市引进龙花243进行示范种植,表现丰产性和稳产性较好,植株整齐、长势较好等特点。总结出精选种子、优化播种技术、科学施肥、科学管水、加强病虫害防治等高产配套技术。

  11. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  12. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea.

    Science.gov (United States)

    Hunt, G J

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f1 values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Carastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 h samples of urine and faeces. Urine samples indicated f1 values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7 x 10(-4) with an arithmetic mean in the range (2-3) x 10(-4), and for americium up to 2.6 x 10(-4) with an arithmetic mean of 1.2 x 10(-4). Limited data based on volunteers eating cockles from the Solway suggest that f1 values for americium may be greater at distance from Sellafield. The measured values compare with 5 x 10(-4) used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f1 value in the region of 0.2, twice the value currently used by ICRP. For 137Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f1 = 1.0. Technetium-99 gave f1 values up to about 0.6, in reasonable conformity with the ICRP value of 0.5.

  13. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, G.J. [CEFAS Laboratory, Lowestoft, Suffolk NR33 0HT (United Kingdom)

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f{sub L} values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Cerastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 samples of urine and faeces. Urine samples indicated f{sub L} values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7x10{sup -4} with an arithmetic mean in the range (2-3)x10{sup -4}, and for americium up to 2.6x10{sup -4} with an arithmetic mean of 1.2x10{sup -4}. Limited data based on volunteers eating cockles from the Solway suggest that f{sub L} values for americium may be greater at distance from Sellafield. The measured values compare with 5x10{sup -4} used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f{sub L} value in the region of 0.2, twice the value currently used by ICRP. For {sup 137}Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f{sub L}=1.0. Technetium-99 gave f{sub L} values up to about 0.6, in reasonable conformity with the ICRP value of 0.5. (author)

  14. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  15. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1993-01-01

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of {sup 241} Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention.

  16. The influence of impurities for cross section measurement of {sup 241,243}Am(n,f) reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kai, Tetsuya; Kobayashi, Katsuhei; Yamamoto, Shuji; Fujita, Yoshiaki; Kimura, Itsuro; Miyoshi, Mitsuharu; Yamamoto, Hideki [Kyoto Univ. (Japan); Shinohara, Nobuo

    1997-03-01

    The influence of the impurities on the fission cross section measurements for {sup 241}Am and {sup 243}Am has been investigated with the practical results. Following cases have been considered as the influence of impurities; (a) experiments with the {sup 241}Am sample that contains impurities originally, and (b) experiments with the {sup 243}Am sample that contains impurities produced by {alpha}, {beta} decays after the chemical purification. The present study has demonstrated the usefulness of pure samples by the comparison of the experiments using the sample on the market with those using the pure sample processed by the authors. Particularly on the case (b), the correction of the impurity through the periodical measurements was experimentally performed (about 18% around 0.3 eV in 4 weeks after the chemical purification). (author)

  17. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  18. Reaction mechanisms in 24.3 MeV/nucleon 238U induced reactions through a comprehensive study of fission

    International Nuclear Information System (INIS)

    Nuclear reaction mechanisms for system characterized by very different asymmetries (U+C, Si, Ni, Au) have been investigated at 24.3 MeV/nucleon, using as observables both the fission products and the neutron multiplicity. It is clearly observed that the fusion process-whatever its completeness- can only occur with rather light target nuclei, indicating the persistence of potential energy effects much above the interaction barrier. (authors). 22 refs., 1 fig

  19. Overview of NATO/AC 243/Panel 3 activities concerning radiowave propagation in coastal environments

    Science.gov (United States)

    Christophe, F.; Douchin, N.; Hurtaud, Y.; Dion, D.; Makaruschka, R.; Heemskerk, H.; Anderson, K.

    1995-02-01

    The performances of most systems operating at RF and millimeter waves can be seriously affected by propagation effects. That is the reason why NATO established the Research Study group No. 8 (RSG8) within Panel 3 (physics and electronics) of Defense Research Group (AC 243), with its Propagation Subgroup (PSG) responsible for the propagation aspects. Comparison of mm and other wavelengths was to be considered. In maritime and coastal environments, the use of such wavelengths for various military applications like anti-ship seekers, fire control radars, ship to ship communications or Electronic Support Measurements (ESM) led to the setting up of specific measurement campaigns; the last three are reported hereafter. The first two experiments used facilities close to Lorient, on the Atlantic coast, and Toulon, on the Mediterranean coast of France, with the purpose of documenting the refractive effects for medium range over the horizon paths. These experiments where are referred to as Lorient 89 and Toulon 90 campaigns, are described in this paper, and some typical results are presented. The latest cooperative work of RSG8/PSG took place recently (fall 1993) near Lorient, on a line-of-sight 10 km path over seawater. This experiment, referred to as Lorient 93 campaign, was devoted to the analysis of phase-front distortions due to multipath along with refractive effects, and to the assessment of performances for naval systems like short range tracking radars. Analysis of the data, either on a statistical base or as specific case studies, is being performed presently, but some early typical results will be given in this paper after a detailed description of the experiment.

  20. Investigating SLIM Disk Solutions FOR HLX-1 IN ESO 243-49

    Science.gov (United States)

    Godet, O.; Plazolles, B.; Kawaguchi, T.; Lasota, J.-P; Barret, d.; Farrell, S. A.; Braito, V.; Servillat, M.; Webb, N.; Gehrels, N.

    2012-01-01

    The hyperluminous X-ray source HLX-1 in the galaxy ESO 243-49, currently the best intermediate-mass blackhole (BH) candidate, displays spectral transitions similar to those observed in Galactic BH binaries, but with aluminosity 100-1000 times higher. We investigated the X-ray properties of this unique source by fitting multiepochdata collected by Swift, XMM-Newton, and Chandra with a disk model computing spectra for a wide rangeof sub- and super-Eddington accretion rates assuming a non-spinning BH and a face-on disk (i=0 deg.). Under theseassumptions we find that the BH in HLX-1 is in the intermediate-mass range (approximately 2 x 10(exp 4) solar mass) and the accretionflow is in the sub-Eddington regime. The disk radiation efficiency is eta = 0.11 plus or minus 0.03. We also show that the source does follow the LX is proportional to T(exp 4) relation for our mass estimate. At the outburst peaks, the source radiates near the Eddington limit. The accretion rate then stays constant around 4 x 10(exp 4) solar mass yr (sup -1) for several days and then decreases exponentially. Such plateaus in the accretion rate could be evidence that enhanced mass-transfer rateis the driving outburst mechanism in HLX-1. We also report on the new outburst observed in 2011 August by theSwift X-Ray Telescope. The time of this new outburst further strengthens the approximately 1 year recurrence timescale.

  1. 30 CFR 243.6 - When must I or another person meet the bonding or financial solvency requirements under this part?

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.6 When must I or another person meet...

  2. 30 CFR 243.9 - Will MMS continue to suspend my obligation to comply with an order if I seek judicial review in a...

    Science.gov (United States)

    2010-07-01

    ... MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.9 Will MMS continue to suspend...

  3. 30 CFR 243.5 - May another person post a bond or other surety instrument or demonstrate financial solvency on my...

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.5 May another person post a bond or...

  4. The chiral transition on a 243 x 10 lattice with Nf = 2 clover sea quarks studied by overlap valence quarks

    International Nuclear Information System (INIS)

    Overlap fermions are particularly well suited to study the finite temperature dynamics of the chiral symmetry restoration transition of QCD, which might be just an analytic crossover. Using gauge field configurations on a 243 x 10 lattice with Nf=2 flavours of dynamical Wilson-clover quarks generated by the DIK collaboration, we compute the lowest 50 eigenmodes of the overlap Dirac operator and try to locate the transition by fermionic means. We analyse the spectral density, local chirality and localisation properties of the low-lying modes and illustrate the changing topological and (anti-) selfdual structure of the underlying gauge fields across the transition. (orig.)

  5. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  6. Chandra and Swift Follow-up Observations of the Intermediate Mass Black Hole in ESO243-49

    CERN Document Server

    Webb, N A; Godet, O; Servillat, M; Farrell, S A; Oates, S R

    2010-01-01

    The brightest Ultra-Luminous X-ray source HLX-1 in the galaxy ESO 243-49 provides strong evidence for the existence of intermediate mass black holes. As the luminosity and thus the mass estimate depend on the association of HLX-1 with ESO 243-49, it is essential to confirm its affiliation. This requires follow-up investigations at wavelengths other than X-rays, which in-turn needs an improved source position. To further reinforce the intermediate mass black hole identification, it is necessary to determine HLX-1's environment to establish whether it could potentially form and nourish a black hole at the luminosities observed. Using the High Resolution Camera onboard Chandra, we determine a source position of RA=01h10m28.3s and Dec=-46d04'22.3". A conservative 95% error of 0.3" was found following a boresight correction by cross-matching the positions of 3 X-ray sources in the field with the 2MASS catalog. Combining all Swift UV/Optical Telescope uvw2 images, we failed to detect a UV source at the Chandra posi...

  7. Discovery of an optical counterpart to the hyperluminous X-ray source in ESO 243-49

    CERN Document Server

    Soria, Roberto; Graham, Alister W; Kong, Albert K H; Kuin, N Paul M; Li, I-Hui; Liu, Ji-Feng; Wu, Kinwah

    2009-01-01

    The existence of black holes of masses ~ 10^3-10^4 Msun has important implications for the formation and evolution of star clusters and galaxies. The strongest candidate so far is the hyperluminous X-ray source HLX1, apparently located in the S0-a galaxy ESO 243-49, but the lack of an identifiable optical counterpart had hampered its interpretation. Using the Magellan telescope, we discovered an unresolved optical source with R = (24.6 +/- 0.2) mag and V = (25.4 +/- 0.3) mag within the X-ray error circle. This implies an X-ray/optical flux ratio ~ 1000. Taking the same distance as ESO 243-49, we obtain an intrinsic brightness M_R = (-10.2 +/- 0.3) mag. With the combined optical and X-ray measurements, we put constraints on the nature of HLX1. We rule out a foreground star and a background AGN. A foreground accreting neutron star is unlikely but cannot be completely ruled out. We also examined the properties of the host galaxy by combining Swift/UVOT observations with stellar population modelling. We found tha...

  8. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  9. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  10. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 L.kg-1. A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  11. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    CERN Document Server

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2015-01-01

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  12. Viscosity Measurements of Ethyl Fluoride (R161) from 243 K to 363 K at Pressures up to 30 MPa

    Science.gov (United States)

    Meng, Xianyang; Gu, Xiaoyun; Wu, Jiangtao; Bi, Shengshan

    2015-11-01

    The Montreal Protocol and its subsequent amendments have created a schedule to replace ozone depletion substances, such as chlorofluorocarbons and hydrochlorofluorocarbons, with chlorine-free molecules in several industrial applications. Ethyl fluoride (R161, C2H5F, 353-36-6) was found to be a potential alternative refrigerant for the replacement of controlled substances, such as R22 with excellent cycle performance. In this work, the viscosity of ethyl fluoride is reported at temperatures from 243 K to 363 K and at pressures from saturation pressure to 30 MPa. The experiment was performed with a calibrated vibrating-wire viscometer, which exhibited a combined expanded uncertainty of 2.5 % with a level of confidence of 0.95 (k = 2) for such a fluid. A scheme based on a hard-spheres model was used to correlate the experimental results. The average absolute deviation of the experimental results from the correlations for R161 is 0.88 %.

  13. A monolithic collapse origin for the thin and thick disc structure of the S0 galaxy ESO 243-49

    Science.gov (United States)

    Comerón, S.; Salo, H.; Peletier, R. F.; Mentz, J.

    2016-09-01

    ESO 243-49 is a high-mass (circular velocity vc ≈ 200 km s-1), edge-on S0 galaxy in the Abell 2877 cluster at a distance of ~95 Mpc. To elucidate the origin of the thick disc of this S0 galaxy, we use Multi Unit Spectroscopic Explorer (MUSE) science verification data to study its kinematics and stellar populations. The thick disc emits ~80% of the light at heights in excess of 3.5 arcsec (1.6 kpc). The rotation velocities of its stars lag by 30-40 km s-1 compared to those in the thin disc, which is compatible with the asymmetric drift. The thick disc is found to be more metal-poor than the thin disc, but both discs have old ages. We suggest an internal origin for the thick disc stars in high-mass galaxies. We propose that the thick disc formed either a) first in a turbulent phase with a high star formation rate and that a thin disc formed shortly afterwards, or b) because of the dynamical heating of a thin pre-existing component. Either way, the star formation in ESO 243-49 was quenched just a few Gyr after the galaxy was born and the formation of a thin and a thick disc must have occurred before the galaxy stopped forming stars. The formation of the discs was so fast that it could be described as a monolithic collapse where several generations of stars formed in rapid succession. Based on observations made at the European Southern Observatory using the Very Large Telescope under programme 60.A-9328(A).

  14. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  15. Synthesis of 24S and 24R-hydroxy-[24-3H] vitamin D3 and their metabolism in rachitic rats

    International Nuclear Information System (INIS)

    An epimeric mixture of 24-hydroxy-[24-3H] vitamin D3 was synthesized by the reduction of 24-ketovitamin D3 by sodium borotritide. The epimeric mixture was converted to the trimethylsilylether derivatives and subjected to high-pressure liquid chromatography using silica gel columns to separate the 24-hydroxy-[24-3H] vitamin D3 isomers. The 24R-hydroxy-[24-3H]vitamin D3 induced calcification in rachitic rats while the 24S-hydroxy-[24-3H]vitamin D3 had little or no such activity. As both isomers of 24-hydroxy-vitamin D3 are metabolized to 24,25-dihydroxyvitamin D3, it appears that the 24-hydroxyvitamin D3-25-hydroxylase does not discriminate between the isomers. Only the R-isomer of 24-hydroxyvitamin D3 is metabolized to 1,24-dihydroxyvitamin D3, although only trace amounts of this compound were found 2 days after the administration of 24-hydroxyvitamin D3. The striking difference in the metabolism of the isomers is the high selectivity of the 1-hydroxylase for the R-isomer. It is suggested that the high specificity of biological activity for the R-isomer of 24-hydroxyvitamin D3 is because of the specificity of the 1-hydroxylation of 24,25-dihydroxyvitamin D3 for the R configuration

  16. 243例双J管内引流的并发症和处置%Complications and treatment for internal drainage with double-J tube in 243 cases

    Institute of Scientific and Technical Information of China (English)

    鄢俊安; 杨超; 张恒; 沈文浩; 李龙坤; 陈志文; 周占松; 李为兵

    2011-01-01

    Objective To anatyze the comptications of internat drainage with doubte-J tube and to discuss ihe disposat programs. Methods The comptications of 243 patients who underwent internat drainage with doubte-J tube from 2008 to 2010 in our institute were ret-rospectivety anatyzed and the disposat programs were discussed. Resutts There were seven kinds of comptications inctuding discomfort of tocation (72 cases,29. 6% ) , bteeding (34 cases, 14. 0% ) , catcutus in tube watt( 19 cases,7. 8% ) , reftux ( 32 cases, 13. 2% ) , infection (47 cases,19. 3% ) ,painfutness (36 cases, 14. 8% ) ,doubte-J tube rupture (3 cases, 1. 2% ) , etc. Att of them were given symptomatic treatment. Conctusion The tocations shoutd be adjusted according to the conditions in the ptacement of doubte-J tube. The doubte-J tube shoutd be removed immediatety if comptications of severe infection,urinary reftux and hematuria occurred.%目的 分析双J管内引流的并发症,探讨其处置方案.方法 对2008年至2010年在我院诊治置入双J管的部分病例所发的并发症进行回顾性分析,探讨和总结处置方式.结果 243例双J管内引流所致的并发症主要有7种,包括位置不适(72例,29.6%)、出血(34例,14.0%)、管壁伴发结石(19例,7.8%)、返流(32例,13.2%)、感染(47例,19.3%)、疼痛(36例,14.8%)、双J管断裂(3例,1.2%)等,分别给予了对症处理.结论 在双J管留置体内过程中根据情况调整双J管的位置,若产生严重的感染、尿液返流、血尿等并发症时,宜尽早拔除双J管.

  17. Hidrocefalia derivada na infância: um estudo clínico-epidemiológico de 243 observações consecutivas Shunted hydrocephalus in childhood: an epidemiological study of 243 consecutive observations

    Directory of Open Access Journals (Sweden)

    Susana Ely Kliemann

    2005-06-01

    Full Text Available Os objetivos deste estudo foram analisar as características epidemiológicas e clínicas de 243 crianças com hidrocefalia derivada, acompanhadas durante 1 a 27 anos, assim como identificar os fatores relacionados aos distúrbios psicomotores, epilepsia e ao óbito. A meningite pós-derivação e os distúrbios mecânicos do sistema foram as complicações mais freqüentes (22,3% e 30,7%, respectivamente. A média de derivação por paciente foi 1,47. Distúrbios motores graves ocorreram em 34,3%, déficit cognitivo em 58,5% e epilepsia em 43,6% dos pacientes. Os distúrbios motores correlacionaram-se positivamente com o grau da hidrocefalia. Houve maior incidência de déficit cognitivo e epilepsia nos casos de hidrocefalia pós-meningite. O óbito ocorreu em 52 pacientes e estes apresentaram um percentual maior de neoplasia do sistema nervoso central e de distúrbios motores na última avaliação, assim como de retirada da primeira derivação por meningite precoce, ocorrida até 2 meses após a derivação.This study aimed to evaluate the epidemiological and clinical data of 243 children with shunted hydrocephalus, followed-up during 1 to 27 years, as well as to identify the risk factors for psychomotor disturbances, epilepsy and death. Postoperative meningitis and mechanical problems were the most frequent complications (22.3% and 30.7%, respectively. There was an average of 1.47 shunt per patient. Severe motor disturbances occurred in 34.3%, cognitive deficits in 58.5% and epilepsy in 43.6%. Motor disturbances correlated positively with the degree of hydrocephalus. The majority of patients with hydrocephalus due to meningitis presented cognitive deficits and a significant incidence of epilepsy. Death occurred in 52 patients and there was a higher percentage of brain tumours in this group, as well as the replacement of the first shunt device due to precocious postoperative meningitis.

  18. 243例乳腺癌患者配偶照顾负担及影响因素研究%The level and influencing factors of caregiver burden among 243 spouses of women with breast cancer

    Institute of Scientific and Technical Information of China (English)

    邾萍; 付菊芳; 王波; 林静; 凌瑞; 郭丝锦; 房宁宁; 王丹丹

    2013-01-01

    Objective To investigate the level and influencing factors of spouse caregiver burden of women with breast cancer.Methods Totally 243 spouses of women with breast cancer were investigated with Zarit Burden Interview (ZBI)and Social Support Rating Scale (SSRS).The patients were investigated with M.D.Anderson Symptom Inventory(MDASI-C).Results The spouse caregiver burden was in the middle level with a total score of 33.99±14.28.The influencing factors were life stress events,subjective support,daily sleep time of spouses,the symptom severity and cancer stage of patients and monthly family income.Conclusion The spouse caregivers of women with breast cancer suffer from middle level of burden.Nurses should assess the caregiver burden and provide targeted interventions to relieve spouse caregiver burden and promote their quality of life.%目的 了解乳腺癌患者配偶照顾负担现状及影响因素.方法 对243例乳腺癌患者配偶照顾者采用照顾负担量表(ZBI)、社会支持量表(SSRS)进行调查,对患者采用安德森症状量表(MDSAI-C)进行调查.结果 配偶照顾负担总分为(33.99±14.28)分,为中度负担水平.影响因素为配偶生活应激事件、主观支持、睡眠时间、患者症状严重程度和肿瘤分期、家庭人均月收入.结论 乳腺癌患者配偶存在中度照顾负担,护理人员应通过同步评估患者与配偶,了解配偶的照顾负担,主动给予配偶照顾者针对性的护理服务,从而减轻其照顾负担,提高其生活质量.

  19. Experimental and theoretical study of the photodissociation reaction of thiophenol at 243 nm: Intramolecular orbital alignment of the phenylthiyl radical

    International Nuclear Information System (INIS)

    The photoinduced hydrogen (or deuterium) detachment reaction of thiophenol (C6H5SH) or thiophenol-d1 (C6H5SD) pumped at 243 nm has been investigated using the H (D) ion velocity map imaging technique. Photodissociation products, corresponding to the two distinct and anisotropic rings observed in the H (or D) ion images, are identified as the two lowest electronic states of phenylthiyl radical (C6H5S·). Ab initio calculations show that the singly occupied molecular orbital of the phenylthiyl radical is localized on the sulfur atom and it is oriented either perpendicular or parallel to the molecular plane for the ground (B1) and the first excited state (B2) species, respectively. The experimental energy separation between these two states is 2600±200 cm-1 in excellent agreement with the authors' theoretical prediction of 2674 cm-1 at the CASPT2 level. The experimental anisotropy parameter (β) of -1.0±0.05 at the large translational energy of D from the C6H5SD dissociation indicates that the transition dipole moment associated with this optical transition at 243 nm is perpendicular to the dissociating S-D bond, which in turn suggests an ultrafast D+C6H5S·(B1) dissociation channel on a repulsive potential energy surface. The reduced anisotropy parameter of -0.76±0.04 observed at the smaller translational energy of D suggests that the D+C6H5S·(B2) channel may proceed on adiabatic reaction paths resulting from the coupling of the initially excited state to other low-lying electronic states encountered along the reaction coordinate. Detailed high level ab initio calculations adopting multireference wave functions reveal that the C6H5S·(B1) channel may be directly accessed via a 1(nπ,σ*) photoexcitation at 243 nm while the key feature of the photodissociation dynamics of the C6H5S·(B2) channel is the involvement of the 3(nπ,π*)→3(nσ,σ*) profile as well as the spin-orbit induced avoided crossing between the ground and the 3(nπ,σ*) state. The S-D bond

  20. 一种利用HCIC快速纯化抗rhTF243单克隆抗体方法的研究%Study on fast purification of monoclonal antibody against rhTF243 protein with the technique of HCIC

    Institute of Scientific and Technical Information of China (English)

    赵峰梅; 齐延红; 何永吉; 潘薇薇; 卢晓霞; 粱雅丽; 赵邑

    2010-01-01

    目的:建立从小鼠腹水中快速纯化抗人重组组织因子243(recombine human tissue factor 243,rhTF243)单克隆抗体(monoclonal antibody,mAb)的方法.方法:含抗rhTF243单克隆抗体的腹水经离心、过滤及缓冲溶液变换等预处理后,先经疏水电荷诱导层析纯化处理,去除大部分杂蛋白,再经Protein A-Sepharose CL-4B亲和层析柱进一步纯化.结果:经两步纯化后获得抗rhTF243 单克隆抗体,其生物学活性高、纯度大于95%,抗体效价保持良好,抗体总回收率达73%,且具有明显的抗促凝作用.结论:建立的单克隆抗体纯化方法简便、高效,所得mAb的纯度高、生物学活性好.

  1. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  2. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  3. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  4. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.

    2004-07-01

    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  5. On the radio properties of the intermediate-mass black hole candidate ESO 243-49 HLX-1

    CERN Document Server

    Cseh, D; Godet, O; Barret, D; Corbel, S; Coriat, M; Falcke, H; Farrell, S A; Koerding, E; Lenc, E; Wrobel, J M

    2014-01-01

    We present follow-up radio observations of ESO 243-49 HLX-1 from 2012 using the Australia Telescope Compact Array (ATCA) and the Karl G. Jansky Very Large Array (VLA). We report the detection of radio emission at the location of HLX-1 during its hard X-ray state using the ATCA. Assuming that the `Fundamental Plane' of accreting black holes is applicable, we provide an independent estimate of the black hole mass of $M_{\\rm{BH}}\\leq2.8^{+7.5}_{-2.1} \\times 10^{6}$ M$_{\\odot}$ at 90% confidence. However, we argue that the detected radio emission is likely to be Doppler-boosted and our mass estimate is an upper limit. We discuss other possible origins of the radio emission such as being due to a radio nebula, star formation, or later interaction of the flares with the large-scale environment. None of these were found adequate. The VLA observations were carried out during the X-ray outburst. However, no new radio flare was detected, possibly due to a sparse time sampling. The deepest, combined VLA data suggests a ...

  6. Physiological Roles for Two Periplasmic Nitrate Reductases in Rhodobacter sphaeroides 2.4.3 (ATCC 17025)▿

    Science.gov (United States)

    Hartsock, Angela; Shapleigh, James P.

    2011-01-01

    The metabolically versatile purple bacterium Rhodobacter sphaeroides 2.4.3 is a denitrifier whose genome contains two periplasmic nitrate reductase-encoding gene clusters. This work demonstrates nonredundant physiological roles for these two enzymes. One cluster is expressed aerobically and repressed under low oxygen while the second is maximally expressed under low oxygen. Insertional inactivation of the aerobically expressed nitrate reductase eliminated aerobic nitrate reduction, but cells of this strain could still respire nitrate anaerobically. In contrast, when the anaerobic nitrate reductase was absent, aerobic nitrate reduction was detectable, but anaerobic nitrate reduction was impaired. The aerobic nitrate reductase was expressed but not utilized in liquid culture but was utilized during growth on solid medium. Growth on a variety of carbon sources, with the exception of malate, the most oxidized substrate used, resulted in nitrite production on solid medium. This is consistent with a role for the aerobic nitrate reductase in redox homeostasis. These results show that one of the nitrate reductases is specific for respiration and denitrification while the other likely plays a role in redox homeostasis during aerobic growth. PMID:21949073

  7. Preliminary results on ^241,243Am and ^235U (n,γ) cross sections measured at DANCE

    Science.gov (United States)

    Jandel, M.; Bredeweg, T. A.; Fowler, M. M.; Bond, E. M.; O'Donnell, J. M.; Reifarth, R.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.; Wouters, J. M.; Macri, R. A.; Wu, C.-Y.; Becker, J. A.

    2006-10-01

    The Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory (LANL) was used for neutron capture cross sections measurements. Its high granularity of 160 BaF2 detectors allows for highly efficient detection of prompt gamma-rays following a neutron capture. DANCE is located on the 20.26 m neutron flight path 14 at the Manuel Lujan Jr. Neutron Scattering Center at the Los Alamos Neutron Science Center (LANSCE). The moderated production target provides neutrons in the 0.02 eV - 500 keV energy range. An analysis of neutron capture measurements on ^241,243Am and ^235U targets will be presented. The experiments were carried out using a customized Parallel-Plate Avalanche Counter (PPAC) detector installed in the center of the DANCE array. The PPAC was used as a fission-tagging detector to separate (n,γ) from (n,fission) events. Preliminary results of (n,γ) cross sections will be presented and compared with the available evaluated data for neutron energies from 0.02 eV to 1 keV. Additional neutron capture measurements with DANCE will be briefly discussed.

  8. Autosomal recessive spastic paraplegia (SPG45) with mental retardation maps to 10q24.3-q25.1.

    Science.gov (United States)

    Dursun, Umut; Koroglu, Cigdem; Kocasoy Orhan, Elif; Ugur, Sibel Aylin; Tolun, Aslihan

    2009-10-01

    Hereditary spastic paraplegias (HSPs) are characterized by progressive spasticity in the lower limbs. They are clinically heterogeneous, and pure forms as well as complicated forms with other accompanying clinical findings are known. HSPs are also genetically heterogeneous. We performed clinical and genetic studies in a consanguineous family with five affected members. A genome scan using 405 microsatellite markers for eight members of the family identified candidate gene loci, and subsequent fine mapping in 16 members identified the gene locus responsible for the HSP. The clinical manifestations were very early onset spastic paraplegia (SPG) accompanied by mental retardation and ocular signs. The gene locus was identified as the interval 102.05-106.64 Mbp on chromosome 10. Gene MRPL43 was analyzed in the patients. No mutation but high levels of mRNA were detected. We have mapped a novel autosomal recessive complicated form of HSP (SPG45) to a 4.6-Mbp region at 10q24.3-q25.1 with multipoint logarithm of odds scores >4.5.

  9. Neutron capture cross section measurements of $^{238}$U, $^{241}$Am and $^{243}$Am at n_TOF

    CERN Multimedia

    Koehler, P E; Plag, R

    The increase of the world energy demand and the need of low carbon energy sources have triggered the renaissance and/or enhancement of nuclear energy in many countries. Fundamental nuclear physics can contribute in a practical way to the sustainability and safety of the nuclear energy production and the management of the nuclear waste. There exists a series of recent studies which address the most relevant isotopes, decay data, nuclear reaction channels and energy ranges which have to be investigated in more detail for improving the design of different advanced nuclear systems [1] and nuclear fuel cycles [2]. In this proposal, we aim at the measurement of the neutron capture cross sections of $^{238}$U, $^{241}$Am and $^{243}$Am. All three isotopes are listed in the NEA High Priority Request List [37], are recommended for measurements [1] and play an important role in the nuclear energy production and fuel cycle scenarios. The measurements will provide as well valuable nuclear structure data necessary for the...

  10. Gender Difference in Prevalence of Signs and Symptoms of Temporomandibular Joint Disorders: A Retrospective Study on 243 Consecutive Patients

    Directory of Open Access Journals (Sweden)

    Bora Bagis, Elif Aydogan Ayaz, Sedanur Turgut, Rukiye Durkan, Mutlu Özcan

    2012-01-01

    Full Text Available Background: This study evaluated the prevalence of the signs and symptoms of temporomandibular joint disorder (TMD among patients with TMD symptoms. Methods: Between September 2011 and December 2011, 243 consecutive patients (171 females, 72 males, mean age 41 years who were referred to the Department of Prosthodontics, Faculty of Dentistry, Karadeniz Technical University, Trabzon were examined physically and completed a questionnaire regarding age, gender, social status, general health, antidepressant drug usage, dental status, limited mouth opening, temporomandibular joint (TMJ sounds, and parafunctions (bruxism, clenching. The data were analyzed using the chi-square test and binary logistic regression model (alpha = 0.05. Results: With a frequency of 92%, pain in the temporal muscle was the most common symptom, followed by pain during mouth opening (89% in both genders. TMJ pain at rest, pain in the masseter muscle, clicking, grinding, and anti-depressant use were significantly more frequent in females than males. Age (p=0.006; odds ratio 0.954; 95% CI 0.922-0.987 and missing teeth (p=0.003; odds ratio 3.753; 95% CI 1.589-8.863 had significant effects on the prevalence of TMD. Conclusion: Females had TMD signs and symptoms more frequently than males in the study population. The most common problem in both genders was pain.

  11. 243株肠球菌属临床分离株分布及抗菌药物敏感性分析%Distribution and antibiotics sensitivity status of 243 strains of enterococcus from clinical samples

    Institute of Scientific and Technical Information of China (English)

    钱扬会; 郭建巍; 马骢; 郝秀红; 刘丽娟; 李艳君; 马学斌

    2011-01-01

    OBJECTIVE To explore the distribution and antibiotic sensitivity of 243 strains Enterococcus from clinical samples in navy general hospital from 2008 to 2010, to offer evidence for drug resistant monitoring and clinical antibiotics usage. METHODS All clinical specimens were isolated and cultured conforms to Standard Operation. The bacteria were identified by using the automatic microorganism analyzer VITEK, and bacteria's drug susceptibility tests were performed using K-B methods and Bio-Mic drug sensitivity analyzer. All the results were analyzed by Whonet 5.4 soft ware. RESULTS Totally 243 strains of Enterococcus were isolated in navy general hospital form 2008 to 2010. Enterococcus faecium and Enterococcus faecalis with a high incidence rate of 56.0% and 28.8%. Enterococcus casseli f avus , Enterococcus gallinarum , Enterococcus avium , Enterococcus durans and Enterococcus hirae with the incidence rates of 7.0%, 4.1 %, 2.1 %, 1.6% and 0.4% respectively.Urine, secretion and blood were the major samples accounted for 84.8%. E. faecalis was the major pathogenic bacteria causing urinary tract infection and then E. faecium and E. casselifavus which with high drug resistance rates. ICU, department of urinary surgery and department of Respiratory Medicine were main award sickroom of Enterococcus infection. Drug resistances of E. faecium were higher than E. faecalis. The top three resistance antibiotics against E. faecium were ampicillin, penicillin and erythromycin and with a resistance rate of 100.0%,97.1% and 93.4%. for E. faecalis, erythromycin, tetracycline and levofloxacin were major resistance antibiotics with a resistance rate of 80.0%, 42.9 % and 38.6% respectively. CONCLUSION Most of Enterococcus infection is due to E. faecium and there are a lot of differences for drug resistance in the strains of Enterococcus. The hospital administers should strengthen the management of antibiotics usage, it is necessary to rationally use

  12. Fission-product yields for thermal-neutron fission of 243Cm determined from measurements with a high-resolution low-energy germanium gamma-ray detector

    International Nuclear Information System (INIS)

    Cumulative fission-product yields have been determined for 13 gamma rays emitted during the decay of 12 fission products created by thermal-neutron fission of 243Cm. A high-resolution low-energy germanium detector was used to measure the pulse-height spectra of gamma rays emitted from a 77-nanogram sample of 243Cm after the sample had been irradiated by thermal neutrons. Analysis of the data resulted in the identification and matching of gamma-ray energies and half-lives to individual radioisotopes. From these results, 12 cumulative fission product yields were deduced for radionuclides with half-lives between 4.2 min and 84.2 min. 7 references

  13. Reaction mechanisms in 24.3 MeV/nucleon {sup 238}U induced reactions through a comprehensive study of fission

    Energy Technology Data Exchange (ETDEWEB)

    Chbihi, A.; Galin; Guerreau, D.; Lewitowicz, M.; Morjean, M.; Pouthas, J. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France); Piasecki, E.; Kordyasz, A.; Iwanicki, J.; Jastrzebski, J.; Pienkowski, L. [Warsaw Univ. (Poland); Crema, E. [Sao Paulo Univ., SP (Brazil). Inst. de Fisica; Czarnacki, W.; Kisielinski, M.; Tucholski, A. [Soltan Inst. for Nuclear Studies, Otwock-Swierk (Poland); Gatty, B.; Jacquet, D. [Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Jahnke, U. [Hahn-Meitner-Institut Berlin GmbH (Germany); Muchorowska, M.

    1994-12-31

    Nuclear reaction mechanisms for system characterized by very different asymmetries (U+C, Si, Ni, Au) have been investigated at 24.3 MeV/nucleon, using as observables both the fission products and the neutron multiplicity. It is clearly observed that the fusion process-whatever its completeness- can only occur with rather light target nuclei, indicating the persistence of potential energy effects much above the interaction barrier. (authors). 22 refs., 1 fig.

  14. Novel heterozygous C243Y A20/TNFAIP3 gene mutation is responsible for chronic inflammation in autosomal-dominant Behçet's disease

    Science.gov (United States)

    Shigemura, Tomonari; Kaneko, Naoe; Kobayashi, Norimoto; Kobayashi, Keiko; Takeuchi, Yusuke; Nakano, Naoko; Masumoto, Junya; Agematsu, Kazunaga

    2016-01-01

    Objective Although Behçet's disease (BD) is a chronic inflammatory disorder of uncertain aetiology, the existence of familial BD with autosomal-dominant traits suggests that a responsibility gene (or genes) exists. We investigated a Japanese family with a history of BD to search for pathogenic mutations underlying the biological mechanisms of BD. Methods 6 patients over 4 generations who had suffered from frequent oral ulcers, genital ulcers and erythaema nodosum-like lesions in the skin were assessed. Whole-exome sequencing was performed on genomic DNA, and cytokine production was determined from stimulated mononuclear cells. Inflammatory cytokine secretion and Nod2-mediated NF-κB activation were analysed using the transfected cells. Results By whole-exome sequencing, we identified a common heterozygous missense mutation in A20/TNFAIP3, a gene known to regulate NF-κB signalling, for which all affected family members carried a heterozygous C243Y mutation in the ovarian tumour domain. Mononuclear cells obtained from the proband and his mother produced large amounts of interleukin 1β, IL-6 and tumour necrosis factor α (TNF-a) on stimulation as compared with those from normal controls. Although inflammatory cytokine secretion was suppressed by wild-type transfected cells, it was suppressed to a much lesser extent by mutated C243Y A20/TNFAIP3-transfected cells. In addition, impaired suppression of Nod2-mediated NF-κB activation by C243Y A20/TNFAIP3 was observed. Conclusions A C243Y mutation in A20/TNFAIP3 was likely responsible for increased production of human inflammatory cytokines by reduced suppression of NF-κB activation, and may have accounted for the autosomal-dominant Mendelian mode of BD transmission in this family. PMID:27175295

  15. De Novo 17q24.2-q24.3 microdeletion presenting with generalized hypertrichosis terminalis, gingival fibromatous hyperplasia, and distinctive facial features.

    Science.gov (United States)

    Afifi, Hanan H; Fukai, Ryoko; Miyake, Noriko; Gamal El Din, Amina A; Eid, Maha M; Eid, Ola M; Thomas, Manal M; El-Badry, Tarek H; Tosson, Angie M S; Abdel-Salam, Ghada M H; Matsumoto, Naomichi

    2015-10-01

    Generalized hypertrichosis is a feature of several genetic disorders, and the nosology of these entities is still provisional. Recent studies have implicated chromosome 17q24.2-q24.3 microdeletion and the reciprocal microduplication in a very rare form of congenital generalized hypertrichosis terminalis (CGHT) with or without gingival hyperplasia. Here, we report on a 5-year-old Egyptian girl born to consanguineous parents. The girl presented with CGHT and gingival hyperplasia for whom we performed detailed clinical, pathological, and molecular studies. The girl had coarse facies characterized by bilateral epicanthic folds, thick and abundant eyelashes, a broad nose, full cheeks, and lips that constituted the distinctive facial features for this syndrome. Biopsy of the gingiva showed epithelial marked acanthosis and hyperkeratosis with hyperplastic thick collagen bundles and dense fibrosis in the underlying tissues. Array analysis indicated a 17q24.2-q24.3 chromosomal microdeletion. We validated this microdeletion by real-time quantitative PCR and confirmed a perfect co-segregation of the disease phenotype within the family. In summary, this study indicates that 17q24.2-q24.3 microdeletion caused CGHT with gingival hyperplasia and distinctive facies, which should be differentiated from the autosomal recessive type that lacks the distinctive facies.

  16. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  17. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  18. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide

    Science.gov (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri

    2015-01-01

    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  19. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  20. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  1. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  2. Measurement of the neutron-induced fission cross-section of {sup 243}Am relative to {sup 235}U from 0.5 to 20 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Belloni, F.; Milazzo, P.M.; Abbondanno, U.; Fujii, K.; Moreau, C. [Istituto Nazionale di Fisica Nucleare, Trieste (Italy); Calviani, M. [Laboratori Nazionali di Legnaro, Istituto Nazionale di Fisica Nucleare, Legnaro (Italy); CERN, Geneva (Switzerland); Colonna, N.; Barbagallo, M.; Marrone, S.; Meaze, M.H.; Tagliente, G.; Terlizzi, R. [Istituto Nazionale di Fisica Nucleare, Bari (Italy); Mastinu, P.; Gramegna, F. [Lab. Nazionali di Legnaro, Istituto Nazionale di Fisica Nucleare, Legnaro (Italy); Aerts, G.; Andriamonje, S.; Berthoumieux, E.; Dridi, W.; Gunsing, F.; Pancin, J.; Perrot, L.; Plukis, A. [Irfu, CEA, Gif-sur-Yvette (France); Alvarez, H.; Cano-Ott, D.; Duran, I.; Embid-Segura, M.; Gonzalez-Romero, E.; Paradela, C.; Tarrio, D. [Univ. de Santiago de Compostela, Galicia (Spain); Alvarez-Velarde, F.; Guerrero, C.; Martinez, T.; Villamarin, D.; Vincente, M.C. [Centro de Investigaciones Energeticas Medioambientales y Technologicas, Madrid (Spain); Andrzejewski, J.; Marganiec, J. [Univ. of Lodz (Poland); Audouin, L.; Dillmann, I.; Heil, M.; Kaeppeler, F.; Mosconi, M.; Plag, R.; Voss, F.; Walter, S.; Wisshak, K. [Karlsruhe Inst. of Technology, Eggenstein-Leopoldshafen (Germany). Inst. fuer Kernphysik; Badurek, G.; Jericha, E.; Leeb, H.; Oberhummer, H. [Technische Univ. Wien, Atominstitut der Oesterreichischen Universitaeten, Wien (Austria); Baumann, P.; David, S.; Kerveno, M.; Lukic, S.; Rudolf, G. [IReS, Centre National de la Recherche Scientifique/IN2P3, Strasbourg (France); Becvar, F.; Krticka, M. [Charles Univ., Faculty of Mathematics and Physics, Prague (Czech Republic); Calvino, F.; Cortes, G.; Poch, A.; Pretel, C. [Univ. Politecnica de Catalunya, Barcelona (Spain); Capote, R. [NAPC/Nuclear Data Section, International Atomic Energy Agency, Vienna (Austria); Univ. de Sevilla (Spain); Carrapico, C.; Goncalves, I.; Salgado, J.; Santos, C.; Tavora, L.; Vaz, P. [Inst. Tecnologico e Nuclear, Lisbon (Portugal)] [and others

    2011-12-15

    The ratio of the neutron-induced fission cross-sections of {sup 243}Am and {sup 235}U was measured in the energy range from 0.5 to 20 MeV with uncertainties of {approx} 4%. The experiment was performed at the CERN n{sub T}OF facility using a fast ionization chamber. With the good counting statistics that could be achieved thanks to the high instantaneous flux and the low backgrounds, the present results are useful for resolving discrepancies in previous data sets and are important for future reactors with improved fuel burn-up. (orig.)

  3. Partial monosomy 8q and partial trisomy 9q due to the maternal translocation t(8;9(q24.3;q34.1)

    DEFF Research Database (Denmark)

    Tos, T; Alp, M Y; Eker, H K;

    2014-01-01

    Partial trisomy 9q34-qter and partial monosomy 8q24.3-qter are very rare chromosomal abnormalities. Characteristic features of partial trisomy 9q34-qter are hypotonia, developmental delay, mild intellectual disability, dolichocephaly, distinct facial phenotype, long and thin fingers, and cardiac......, brachycephaly, facial dysmorphism, hand and foot anomalies, bilateral hearing loss, cardiac defect and abnormal brain MRI findings. To the best of our knowledge, this is the first report of the combination of partial trisomy 9q and partial monosomy 8q....

  4. Neutron-induced fission cross sections of 233U and 243Am in the energy range 0.5 Mev En 20 MeV @ n_TOF

    CERN Document Server

    Belloni, F; Milazzo, P M; Calviani, M; Colonna, N; Mastinu, P; Abbondanno, U; Aerts, G; Álvarez, H; Álvarez-Velarde, F; Andriamonje, S; Andrzejewski, J; Assimakopoulos, P; Audouin, L; Badurek, G; Baumann, P; Becvár, F; Berthoumieux, E; Calviño, F; Cano-Ott, D; Capote, R; Carrapiço, C; Cennini, P; Chepel, V; Chiaveri, E; Cortes, G; Couture, A; Cox, J; Dahlfors, M; David, S; Dillmann, I; Domingo-Pardo, C; Dridi, W; Duran, I; Eleftheriadis, C; Embid-Segura, M; Ferrant, L; Ferrari, A; Ferreira-Marques, R; Fujii, K; Furman, W; Goncalves, I; González-Romero, E; Gramegna, F; Guerrero, C; Gunsing, F; Haas, B; Haight, R; Heil, M; Herrera-Martinez, A; Igashira, M; Jericha, E; Käppeler, F; Kadi, Y; Karadimos, D; Karamanis, D; Kerveno, M; Koehler, P; Kossionides, E; Krticka, M; Lampoudis, C; Leeb, H; Lindote, A; Lopes, I; Lozano, M; Lukic, S; Marganiec, J; Marrone, S; Martínez, T; Massimi, C; Mengoni, A; Moreau, C; Mosconi, M; Neves, F; Oberhummer, H; O'Brien, S; Pancin, J; Papachristodoulou, C; Papadopoulos, C; Paradela, C; Patronis, N; Pavlik, A; Pavlopoulos, P; Perrot, L; Pigni, M T; Plag, R; Plompen, A; Plukis, A; Poch, A; Praena, J; Pretel, C; Quesada, J; Rauscher, T; Reifarth, R; Rubbia, C; Rudolf, G; Rullhusen, P; Salgado, J; Santos, C; Sarchiapone, L; Savvidis, I; Stephan, C; Tagliente, G; Tain, J L; Tassan-Got, L; Tavora, L; Terlizzi, R; Vannini, G; Vazl, P; Ventura, A; Villamarin, D; Vincente, M C; Vlachoudis, V; Vlastou, R; Voss, F; Walter, S; Wiescher, M; Wisshak, K

    2011-01-01

    Neutron-induced fission cross-sections of actinides have been recently measured at the neutron time of flight facility n_TOF at CERN in the frame of a research project involving isotopes relevant for nuclear astrophysics and nuclear technologies. Fission fragments are detected by a gas counter with good discrimination between nuclear fission products and background events. Neutron-induced fission cross-sections of 233U and 243Am were determined relative to 235U. The present paper reports the results obtained at neutron energies between 0.5 and 20 MeV.

  5. Sequential isotopic determination of plutonium, thorium, americium and uranium in the air filter and drinking water samples around the WIPP site

    International Nuclear Information System (INIS)

    The simultaneous determination of actinides in air filter and water samples around the WIPP site have been demonstrated. The analytical method is based on the selective separation and purification by anion exchange and Eichrome-TEVA, TRU and DGA-resin followed by determination of actinides by alpha spectrometry. Counting sources for alpha spectrometric measurements were prepared by microcoprecipitation on neodymium fluoride (NdF3). Radiochemical yields were determined using 242Pu, 229Th, 243Am and 232U as tracers. The validation of the method is performed through the analysis of reference materials or participating in laboratory intercomparison programs. The plutonium concentrations in aerosols varied seasonally, being highest in spring and summer due to the spring-time enhanced wind-storm transportation of radioactive aerosols from the stratosphere to the troposphere. The 238Pu/239+240Pu activity ratio in the aerosol samples is typically close to that of global fallout from historic above-ground nuclear weapons testing. The results presented here indicate that the source of plutonium in the WIPP environment results mainly from global nuclear fallout and there is no evidence of increases in radiological contaminants in the region that could be attributed to releases from the WIPP. (author)

  6. Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.

    Science.gov (United States)

    Willemsen, Marjolein H; Fernandez, Bridget A; Bacino, Carlos A; Gerkes, Erica; de Brouwer, Arjan P M; Pfundt, Rolph; Sikkema-Raddatz, Birgit; Scherer, Stephen W; Marshall, Christian R; Potocki, Lorraine; van Bokhoven, Hans; Kleefstra, Tjitske

    2010-04-01

    The clinical use of array comparative genomic hybridization in the evaluation of patients with multiple congenital anomalies and/or mental retardation has recently led to the discovery of a number of novel microdeletion and microduplication syndromes. We present four male patients with overlapping molecularly defined de novo microdeletions of 16q24.3. The clinical features observed in these patients include facial dysmorphisms comprising prominent forehead, large ears, smooth philtrum, pointed chin and wide mouth, variable cognitive impairment, autism spectrum disorder, structural anomalies of the brain, seizures and neonatal thrombocytopenia. Although deletions vary in size, the common region of overlap is only 90 kb and comprises two known genes, Ankyrin Repeat Domain 11 (ANKRD11) (MIM 611192) and Zinc Finger 778 (ZNF778), and is located approximately 10 kb distally to Cadherin 15 (CDH15) (MIM 114019). This region is not found as a copy number variation in controls. We propose that these patients represent a novel and distinctive microdeletion syndrome, characterized by autism spectrum disorder, variable cognitive impairment, facial dysmorphisms and brain abnormalities. We suggest that haploinsufficiency of ANKRD11 and/or ZNF778 contribute to this phenotype and speculate that further investigation of non-deletion patients who have features suggestive of this 16q24.3 microdeletion syndrome might uncover other mutations in one or both of these genes.

  7. Thermal neutron capture cross-section measurements of 243Am and 242Pu using the new mini-INCA α- and γ-spectroscopy station

    International Nuclear Information System (INIS)

    In the framework of the Mini-INCA project, dedicated to the study of Minor Actinide transmutation process in high neutron fluxes, an α- and γ-spectroscopy station has been developed and installed at the High Flux Reactor of the Laue-Langevin Institut. This set-up allows short irradiations as well as long irradiations in a high quasi-thermal neutron flux and post-irradiation spectroscopy analysis. It is well suited to measure precisely, in reference to 59Co cross-section, neutron capture cross-sections, for all the actinides, in the thermal energy region. The first measurements using this set-up were done on 243Am and 242Pu isotopes. Cross-section values, at En=0.025eV, were found to be (81.8+/-3.6)b for 243Am and (22.5+/-1.1)b for 242Pu. These values differ from evaluated data libraries by a factor of 9% and 17%, respectively, but are compatible with the most recent measurements, validating by the way the experimental apparatus

  8. The use of isotopic correlation technique for determination of sup(241)Am and sup(243)Am concentration in nuclear irradiated fuels

    International Nuclear Information System (INIS)

    In the last years the isotopic correlation technique is emerging as a powerful tool for the determination of concentration and isotopic composition of heavy nuclides in the nuclear fuel cycle. Accordingly, this technique has gained significant importance for the safeguard of the nuclear materials as well as for the accounting and build up of actinides elements in the irradiated nuclear fuels. In this work 42 isotopic correlations between the nuclides sup(241)Am and sup(243)Am and post irradiation isotopic data of 7 samples from fuel element BE-124 and 1 sample from fuel element BE-120 from the Obrigheim pressurized water nuclear power reactor, Federal Republic of Germany, were proposed. These isotopic correlations allowed to estimate the isotopic concentrations of sup(241)Am and sup(243)Am with an average deviation, relative to the experimental data obtained from isotopic dilution mass spectrometry technique, of 10%. These results are more precise than those found using the computer code ORIGEN 2 demonstrating the great potential of this technique for the determination of isotopic concentration and build up of those nuclides in irradiated nuclear fuels. The analytical and other experimental aspects of the post irradiation isotopic analysis of nuclear fuels are also discussed. (author)

  9. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)

    2010-07-15

    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  10. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.

    2013-07-01

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  11. Critical and shielding parametric studies with the Monte Carlo code TRIPOLI to identify the key points to take into account during the transportation of blanket assemblies with high ratio of americium

    International Nuclear Information System (INIS)

    In the framework of French research program on Generation IV sodium cooled fast reactor, one possible option consists in burning minor actinides in this kind of Advanced Sodium Technological Reactor. Two types of transmutation mode are studied in the world : the homogeneous mode of transmutation where actinides are scattered with very low enrichment ratio in fissile assemblies and the heterogeneous mode where fissile core is surrounded by blanket assemblies filled with minor actinides with ratio of incorporated actinides up to 20%. Depending on which element is considered to be burnt and on its content, these minor actinides contents imply constraints on assemblies' transportation between Nuclear Power Plants and fuel cycle facilities. In this study, we present some academic studies in order to identify some key constraints linked to the residual power and neutron/gamma load of such kind of blanket assemblies. To simplify the approach, we considered a modeling of a 'model cask' dedicated to the transportation of a unique irradiated blanket assembly loaded with 20% of Americium and basically inspired from an existent cask designed initially for the damaged fissile Superphenix assembly transport. Thermal calculations performed with EDF-SYRTHES code have shown that due to thermal limitations on cladding temperature, the decay time to be considered before transportation is 20 years. This study is based on explicit 3D representations of the cask and the contained blanket assembly with the Monte Carlo code TRIPOLI/JEFF3.1.1 library and concludes that after such a decay time, the transportation of a unique Americium radial blanket is feasible only if the design of our model cask is modified in order to comply with the dose limitation criterion. (author)

  12. Synthesis, characterization and biological activity of new cyclization products of 3-(4-substituted benzylidene)-2-pyrido[1,2-]pyrimidine 2,4-(3)-diones

    Indian Academy of Sciences (India)

    Abha Bishnoi; Suruchi Singh; Anil K Tiwari; Krishna Srivastava; Ram Raghuvir; Chandrakant M Tripathi

    2013-03-01

    A method is presented for the synthesis of 4-(substituted phenyl)-3-(3-substituted phenyl)4-spiro[isoxazole-5,3'-pyrido[1,2-]pyrimidine]-2',4'-dione (3), 3-(4-substituted phenyl)-3-isoxazole[3, 4-]pyrido[1,2-]pyrimidin-4-(3a)-one (4) and 3-(4-substituted phenyl) 3,3a-dihydropyrazolo[3,4-]pyrido[1,2-]pyrimidin-4-(2)-one (5) which consists of the conversion of 2-pyrido[1,2-]pyrimidine-2,4(3)-dione (1) to chalcones (2) and their 1,3-dipolar cycloaddition with appropriate aldoximes to give spiro compounds and heterocyclization using amines to yield isoxazolines and pyrazolines. All the compounds were screened for their antimicrobial and antitubercular activity.

  13. Study of the Beta-delayed multiple particle break-up of the 2.43 MeV state in Be-9

    Science.gov (United States)

    Madurga Flores, Miguel; Borge, M. J. G.; Fynbo, H. O. U.; Jonson, B.; Nyman, G.; Prezado, Y.; Riisager, K.

    The aim of this work is to study the β -delayed multiparticle break-up of the 5/2- state in 9 Be at 2.43 MeV excitation energy. This process is relevant as it has been proposed recently that this level plays a role in the α(αn,γ)9 Be reaction. This state breaks-up in 2α+n, and sequential as well as direct ("democratic") decay have previously been considered. In our work energy and direction of the two emitted α particles has been measured, while those of the neutron have been reconstructed. The sequential decay is considered using the R-matrix formalism. For the democratic decay the hyper-spherical harmonics functions are used. The different decay processes are compared with the data using the Monte-Carlo method. Our preliminary results indicate that the data is better described when democratic decay is assumed.

  14. Fission Cross-section Measurements of (233)U, (245)Cm and (241,243)Am at CERN n_TOF Facility

    CERN Document Server

    Calviani, M; Andriamonje, S; Chiaveri, E; Vlachoudis, V; Colonna, N; Meaze, M H; Marrone, S; Tagliente, G; Terlizzi, R; Belloni, F; Abbondanno, U; Fujii, K; Milazzo, P M; Moreau, C; Aerts, G; Berthoumieux, E; Dridi, W; Gunsing, F; Pancin, J; Perrot, L; Plukis, A; Alvarez, H; Duran, I; Paradela, C; Alvarez-Velarde, F; Cano-Ott, D; Gonzalez-Romero, E; Guerrero, C; Martinez, T; Villamarin, D; Vicente, M C; Andrzejewski, J; Marganiec, J; Assimakopoulos, P; Karadimos, D; Karamanis, D; Papachristodoulou, C; Patronis, N; Audouin, L; David, S; Ferrant, L; Isaev, S; Stephan, C; Tassan-Got, L; Badurek, G; Jericha, E; Leeb, H; Oberhummer, H; Pigni, M T; Baumann, P; Kerveno, M; Lukic, S; Rudolf, G; Becvar, F; Krticka, M; Calvino, F; Capote, R; Carrillo De Albornoz, A; Marques, L; Salgado, J; Tavora, L; Vaz, P; Cennini, P; Dahlfors, M; Ferrari, A; Gramegna, F; Herrera-Martinez, A; Kadi, Y; Mastinu, P; Praena, J; Sarchiapone, L; Wendler, H; Chepel, V; Ferreira-Marques, R; Goncalves, I; Lindote, A; Lopes, I; Neves, F; Cortes, G; Poch, A; Pretel, C; Couture, A; Cox, J; O'brien, S; Wiescher, M; Dillman, I; Heil, M; Kappeler, F; Mosconi, M; Plag, R; Voss, F; Walter, S; Wisshak, K; Dolfini, R; Rubbia, C; Domingo-Pardo, C; Tain, J L; Eleftheriadis, C; Savvidis, I; Frais-Koelbl, H; Griesmayer, E; Furman, W; Konovalov, V; Goverdovski, A; Ketlerov, V; Haas, B; Haight, R; Reifarth, R; Igashira, M; Koehler, P; Kossionides, E; Lampoudis, C; Lozano, M; Quesada, J; Massimi, C; Vannini, G; Mengoni, A; Oshima, M; Papadopoulos, C; Vlastou, R; Pavlik, A; Pavlopoulos, P; Plompen, A; Rullhusen, P; Rauscher, T; Rosetti, M; Ventura, A

    2011-01-01

    Neutron-induced fission cross-sections of minor actinides have been measured using the n_TOF white neutron source at CERN, Geneva, as part of a large experimental program aiming at collecting new data relevant for nuclear astrophysics and for the design of advanced reactor systems. The measurements at n_TOF take advantage of the innovative features of the n_TOF facility, namely the wide energy range, high instantaneous neutron flux and good energy resolution. Final results on the fission cross-section of 233U, 245Cm and 243Am from thermal to 20 MeV are here reported, together with preliminary results for 241Am. The measurement have been performed with a dedicated Fast Ionization Chamber (FIC), a fission fragment detector with a very high efficiency, relative to the very well known cross-section of 235U, measured simultaneously with the same detector.

  15. Deletions in 14q24.1q24.3 are associated with congenital heart defects, brachydactyly, and mild intellectual disability.

    Science.gov (United States)

    Oehl-Jaschkowitz, Barbara; Vanakker, Olivier M; De Paepe, Anne; Menten, Björn; Martin, Thomas; Weber, Georg; Christmann, Alexander; Krier, Romain; Scheid, Simone; McNerlan, Susan E; McKee, Shane; Tzschach, Andreas

    2014-03-01

    Interstitial deletions of chromosome band 14q24.1q24.3 are apparently very rare. We report on three unrelated patients with overlapping de novo deletions of sizes 5.4, 2.8, and 2.3 Mb in this region. While some clinical problems such as intestinal malrotation, cryptorchidism, and ectopic kidney were only observed in single patients, all three patients had mild intellectual disability, congenital heart defects (truncus arteriosus, pulmonary atresia, atrial septal defect, and/or ventricular septal defect), brachydactyly, hypertelorism, broad nasal bridge, and thin upper lips. Likely haploinsufficiency of one or several of the 19 genes in the common deleted interval (ACTN1, DCAF5, EXD2, GALNTL1, ERH, SLC39A9, PLEKHD1, CCDC177, KIAA0247, LOC100289511, SRSF5, SLC10A1, SMOC1, SLC8A3, ADAM21P1, COX16, SYNJ2BP, SYNJ2BP-COX16, ADAM21) was responsible for these manifestations, but apart from SMOC1, mutations in which cause autosomal recessive Waardenburg anophthalmia syndrome, and ACTN1, mutations in which are associated with congenital macrothrombocytopenia, no disease associations have so far been reported for the other genes. Functional studies and a systematic search for mutations or chromosome aberrations in this region will elucidate the role of individual genes in the clinical manifestations and will provide insight into the underlying biological mechanisms. PMID:24357125

  16. X-ray outbursts of ESO 243-49 HLX-1: comparison with Galactic low-mass X-ray binary transients

    CERN Document Server

    Yan, Zhen; Soria, Roberto; Altamirano, Diego; Yu, Wenfei

    2015-01-01

    We studied the outburst properties of the hyper-luminous X-ray source ESO 243-49 HLX-1, using the full set of Swift monitoring observations. We quantified the increase in the waiting time, recurrence time and e-folding rise timescale along the outburst sequence, and the corresponding decrease in outburst duration, total radiated energy, and e-folding decay timescale, which confirms previous findings. HLX-1 spends less and less time in outburst and more and more time in quiescence, but its peak luminosity remains approximately constant. We compared the HLX-1 outburst properties with those of bright Galactic low-mass X-ray binary transients (LMXBTs). Our spectral analysis strengthens the similarity between state transitions in HLX-1 and those in Galactic LMXBTs. We also found that HLX-1 follows the nearly linear correlations between the hard-to-soft state transition luminosity and the peak luminosity, and between the rate of change of X-ray luminosity during the rise phase and the peak luminosity, which indicat...

  17. A novel autosomal recessive non-syndromic hearing impairment locus (DFNB47) maps to chromosome 2p25.1-p24.3.

    Science.gov (United States)

    Hassan, Muhammad Jawad; Santos, Regie Lyn P; Rafiq, Muhammad Arshad; Chahrour, Maria H; Pham, Thanh L; Wajid, Muhammad; Hijab, Nadine; Wambangco, Michael; Lee, Kwanghyuk; Ansar, Muhammad; Yan, Kai; Ahmad, Wasim; Leal, Suzanne M

    2006-01-01

    Hereditary hearing impairment (HI) displays extensive genetic heterogeneity. Autosomal recessive (AR) forms of prelingual HI account for approximately 75% of cases with a genetic etiology. A novel AR non-syndromic HI locus (DFNB47) was mapped to chromosome 2p25.1-p24.3, in two distantly related Pakistani kindreds. Genome scan and fine mapping were carried out using microsatellite markers. Multipoint linkage analysis resulted in a maximum LOD score of 4.7 at markers D2S1400 and D2S262. The three-unit support interval was bounded by D2S330 and D2S131. The region of homozygosity was found within the three-unit support interval and flanked by markers D2S2952 and D2S131, which corresponds to 13.2 cM according to the Rutgers combined linkage-physical map. This region contains 5.3 Mb according to the sequence-based physical map. Three candidate genes, KCNF1, ID2 and ATP6V1C2 were sequenced, and were found to be negative for functional sequence variants. PMID:16261342

  18. Low-Redshift Damped Lyman Alpha Galaxies Towards the Quasars B2 0827+243, PKS 0952+179, PKS 1127-145, and PKS 1629+120

    CERN Document Server

    Rao, S M; Turnshek, D A; Lane, W M; Monier, E M; Bergeron, J; Rao, Sandhya M.; Nestor, Daniel B.; Turnshek, David A.; Lane, Wendy M.; Monier, Eric M.; Bergeron, Jacqueline

    2003-01-01

    We present optical and near-infrared ground-based imaging results on four low-redshift damped Lyman alpha (DLA) galaxies. The corresponding DLA systems were discovered in our Hubble Space Telescope spectroscopic surveys for DLAs in known strong MgII absorption-line systems towards the quasars B2 0827+243 (z{DLA}=0.525), PKS 0952+179 (z{DLA}=0.239), PKS 1127-145 (z_{DLA}=0.313), and PKS 1629+120 (z{DLA}=0.532). The DLA galaxies span a mixture of morphological types from patchy, irregular, and low-surface-brightness to spiral galaxies. The luminosities range from 0.02L_K^* to 1.2L_K^*. We also discovered several extremely red objects (EROs) in two of these fields and discuss the possibility that they are associated with the DLA galaxies. These observations add to the small but growing list of DLA galaxies at low redshift. At the present time, 14 DLA galaxies in the redshift range $0.05 \\lesssim z \\lesssim 1$ have been studied. The distributions of DLA galaxy properties for these 14 cases are discussed and some ...

  19. Comment on ”John’s stone: A possible fragment of the 1908 Tunguska meteorite” (Anfinogenov et al., 2014, Icarus 243, 139-147)

    DEFF Research Database (Denmark)

    Haack, Henning; Greenwood, Richard; Busemann, Henner

    2016-01-01

    Anfinogenov et al. (Anfinogenov et al. [2014]. Icarus 243, 139–147) argue that a highly silicified gravelite sandstone referred to as “John’s stone” could be a fragment of the long-sought-after impactor from the 1908 Tunguska event. We have analyzed the oxygen isotopic composition of two distinct...... samples of John’s stone both kindly provided by Dr Yana Anfingenova. Both samples had very similar isotopic compositions, such that the average of the two was as follows: δ17O = 6.67 ± 0.15‰; δ18O = 12.78 ± 0.28‰; Δ17O = −0.01 ± 0.01 (errors 1SD). This value is well within the range for samples...... of terrestrial quartz-bearing sedimentary and metamorphic rocks. John’s stone has an oxygen isotope composition and mineralogy that is unlike any known group of meteorites. If John’s stone is extraterrestrial this would imply that it represents a previously unknown type of meteorite, as suggested by Anfinogenov...

  20. Susceptibility to insulin-dependent diabetes mellitus maps to a locus (IDDM11) on human chromosome 14q24.3-q31

    Energy Technology Data Exchange (ETDEWEB)

    Field, L.L.; Tobias, R. [Univ. of Calgary, Alberta (Canada); Thomson, G. [Univ. of California, Berkeley, CA (United States)] [and others

    1996-04-01

    To locate genes predisposing to insulin-dependent diabetes mellitus (IDDM), an autoimmune disorder resulting from destruction of the insulin-producing pancreatic cells, we are testing linkage of IDDM susceptibility to polymorphic markers across the genome using families with two or more IDDM children. A new susceptibility locus (IDDM11) has been localized to chromosome 14q24.3-q31 by detection of significant linkage to microsatellite D14S67, using both maximum likelihood methods D14S67, using both maximum likelihood methods (LOD{sub max} = 4.0 at {theta} = 0.20) and affected sib pair (ASP) methods (P = 1 x 10{sup -5}). This represents the strongest reported evidence for linkage to any IDDM locus outside the HLA region. The subset of families in which affected children did not show increased sharing of HLA genes (HLA sharing {le}50%) provided most of the support for D14S67 linkage (LOD{sub max}4.6 at {theta} = 0.12;ASP P < 5 x 10{sup -6}). There was significant linkage heterogeneity between the HLA-defined subsets of families (P = 0.009), suggesting that IDDM11 may be an important susceptibility locus in families lacking strong HLA region predisposition. 52 refs., 2 figs., 3 tabs.

  1. Expression and purification of a novel ZNF191 zinc finger protein——ZNF191 protein and its truncated zinc finger region ZNF191 (243—368)

    Institute of Scientific and Technical Information of China (English)

    刘玉奇; 余龙; 余文浩; 施少林; 孙炳耘; 吴国俊; 黄仲贤

    1999-01-01

    ZNF191 is a new zine finger gene whieh has a 1107 bp open reading frame (ORF) and eneodes a 368 amino avid protein including a putative DNA-binding domain of four Cys2 His2 zine finger motifs at its C-terminal region. The ZNF191 cDNA is loeated in the chromosome 18q12.1 region where it is known that a variety of hereditary diseases are related to. Probably, this protein has potential function of stimulating the gene franscription. In order to examine the function and structure of ZNF191 protein, the ORF of ZNF191 and its zine finger region ZNF191(243--368) genes were inserted into PTSA-18 expression vector by PCR amplification, then the constructed genes were expressed in the PTSA-18/B121 (DE3) system. The two proteins were purified by DEAE-52, CM-23 and Heparin-Sepharose 4B columns. The pooled proteins showed a single band as assayed by Coomasie Brillian Blue Staining of an SDS/polyacryamide gel.

  2. Discovery of very high energy gamma-ray emission from the BL Lac object PKS 0301-243 with H.E.S.S

    CERN Document Server

    Abramowski, A; Aharonian, F; Ait, F; Akhperjanian, A G; Angüner, E; Anton, G; Balenderan, S; Balzer, A; Barnacka, A; Becherini, Y; Becker, J; Bernlöhr, K; Birsin, E; Bissaldi, E; Biteau, J; Böttcher, M; Boisson, C; Bolmont, J; Bordas, P; Brucker, J; Brun, F; Brun, P; Bulik, T; Carrigan, S; Casanova, S; Cerruti, M; Chadwick, P M; Chalme-Calvet, R; Chaves, R C G; Cheesebrough, A; Chrétien, M; Colafrancesco, S; Cologna, G; Conrad, J; Couturier, C; Dalton, M; Daniel, M K; Davids, I D; Degrange, B; Deil, C; deWilt, P; Dickinson, H J; Djannati-Ataï, A; Domainko, W; Drury, L O'C; Dubus, G; Dutson, K; Dyks, J; Dyrda, M; Edwards, T; Egberts, K; Eger, P; Espigat, P; Farnier, C; Fegan, S; Feinstein, F; Fernandes, M V; Fernandez, D; Fiasson, A; Fontaine, G; Förster, A; Füssling, M; Gajdus, M; Gallant, Y A; Garrigoux, T; Giebels, B; Glicenstein, J F; Grondin, M -H; Grudzìnska, M; Häffner, S; Hague, J D; Hahn, J; Harris, J; Heinzelmann, G; Henri, G; Hermann, G; Hervet, O; Hillert, A; Hinton, J A; Hofmann, W; Hofverberg, P; Holler, M; Horns, D; Jacholkowska, A; Jahn, C; Jamrozy, M; Janiak, M; Jankowsky, F; Jung, I; Kastendieck, M A; Katarzyński, K; Katz, U; Kaufmann, S; Khélifi, B; Kieffer, M; Klepser, S; Klochkov, D; Kluźniak, W; Kneiske, T; Kolitzus, D; Komin, Nu; Kosack, K; Krakau, S; Krayzel, F; Krüger, P P; Laffon, H; Lamanna, G; Lefaucheur, J; Lemoine-Goumard, M; Lenain, J -P; Lennarz, D; Lohse, T; Lopatin, A; Lu, C -C; Marandon, V; Marcowith, A; Marx, R; Maurin, G; Maxted, N; Mayer, M; McComb, T J L; Medina, M C; Méhault, J; Menzler, U; Meyer, M; Moderski, R; Mohamed, M; Moulin, E; Murach, T; Naumann, C L; de Naurois, M; Nedbal, D; Niemiec, J; Nolan, S J; Oakes, L; Ohm, S; Wilhelmi, E de Oña; Opitz, B; Ostrowski, M; Oya, I; Panter, M; Parsons, R D; Arribas, M Paz; Pekeur, N W; Pelletier, G; Perez, J; Petrucci, P -O; Peyaud, B; Pita, S; Poon, H; Pühlhofer, G; Punch, M; Quirrenbach, A; Raab, S; Raue, M; Reimer, A; Reimer, O; Renaud, M; Reyes, R de los; Rieger, F; Rob, L; Rosier-Lees, S; Rowell, G; Rudak, B; Rulten, C B; Sahakian, V; Sanchez, D A; Santangelo, A; Schlickeiser, R; Schüssler, F; Schulz, A; Schwanke, U; Schwarzburg, S; Schwemmer, S; Sol, H; Spengler, G; Spies, F; Stawarz, L; Steenkamp, R; Stegmann, C; Stinzing, F; Stycz, K; Sushch, I; Szostek, A; Tavernet, J -P; Terrier, R; Tluczykont, M; Trichard, C; Valerius, K; van Eldik, C; Vasileiadis, G; Venter, C; Viana, A; Vincent, P; Völk, H J; Volpe, F; Vorster, M; Wagner, S J; Wagner, P; Ward, M; Weidinger, M; Weitzel, Q; White, R; Wierzcholska, A; Willmann, P; Wörnlein, A; Wouters, D; Zacharias, M; Zajczyk, A; Zdziarski, A A; Zech, A; Zechlin, H -S

    2013-01-01

    The active galactic nucleus PKS 0301-243 (z=0.266) is a high-synchrotron-peaked BL Lac object that is detected at high energies (HE, 100 MeV 100 GeV) by the High Energy Stereoscopic System (H.E.S.S.) from observations between September 2009 and December 2011 for a total live time of 34.9 hours. Gamma rays above 200 GeV are detected at a significance of 9.4{\\sigma}. A hint of variability at the 2.5{\\sigma} level is found. An integral flux I(E > 200 GeV) = (3.3 +/- 1.1_stat +/- 0.7_syst)e-12 ph cm^-2s^-1 and a photon index {\\Gamma} = 4.6 +/- 0.7_stat +/- 0.2_syst are measured. Multi-wavelength light curves in HE, X-ray and optical bands show strong variability, and a minimal variability timescale of eight days is estimated from the optical light curve. A single-zone leptonic synchrotron self-Compton scenario satisfactorily reproduces the multi-wavelength data. In this model, the emitting region is out of equipartition and the jet is particle dominated. Because of its high redshift compared to other sources obse...

  3. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive; Utilizacao de metodos radioanaliticos para determinacao de isotopos de uranio, netunio, plutonio, americio e curio em rejeitos radioativos

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca

    2012-07-01

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  4. Discovery of a Neuroprotective Chemical, (S)-N-(3-(3,6-Dibromo-9H-carbazol-9-yl)-2-fluoropropyl)-6-methoxypyridin-2-amine [(−)-P7C3-S243], with Improved Druglike Properties

    OpenAIRE

    Naidoo, Jacinth; De Jesus-Cortes, Hector; Huntington, Paula; Estill, Sandi; Morlock, Lorraine K.; Starwalt, Ruth; Mangano, Thomas J.; Williams, Noelle S.; Pieper, Andrew A.; Ready, Joseph M.

    2014-01-01

    (−)-P7C3-S243 is a neuroprotective aminopropyl carbazole with improved druglike properties compared with previously reported compounds in the P7C3 class. It protects developing neurons in a mouse model of hippocampal neurogenesis and protects mature neurons within the substantia nigra in a mouse model of Parkinson’s disease. A short, enantioselective synthesis provides the neuroprotective agent in optically pure form. It is nontoxic, orally bioavailable, metabolically stable, and able to cros...

  5. Comment on "John's stone: A possible fragment of the 1908 Tunguska meteorite" (Anfinogenov et al., 2014, Icarus 243, 139-147)

    Science.gov (United States)

    Haack, Henning; Greenwood, Richard C.; Busemann, Henner

    2016-02-01

    Anfinogenov et al. (Anfinogenov et al. [2014]. Icarus 243, 139-147) argue that a highly silicified gravelite sandstone referred to as "John's stone" could be a fragment of the long-sought-after impactor from the 1908 Tunguska event. We have analyzed the oxygen isotopic composition of two distinct samples of John's stone both kindly provided by Dr Yana Anfingenova. Both samples had very similar isotopic compositions, such that the average of the two was as follows: δ17O = 6.67 ± 0.15‰; δ18O = 12.78 ± 0.28‰; Δ17O = -0.01 ± 0.01 (errors 1SD). This value is well within the range for samples of terrestrial quartz-bearing sedimentary and metamorphic rocks. John's stone has an oxygen isotope composition and mineralogy that is unlike any known group of meteorites. If John's stone is extraterrestrial this would imply that it represents a previously unknown type of meteorite, as suggested by Anfinogenov et al. However, since sandstones can only form on a parent body with liquid water and by inference, also an atmosphere, we argue that there are only two possible parent bodies in the Solar System: the Earth and Mars. Mars can be ruled out for several reasons, including the oxygen isotopic and noble gas composition of John's stone, which is clearly distinct from martian meteorites. Consistent with the O study, the noble gases do not provide any evidence for an extraterrestrial origin of the samples. The lack of any cosmogenic noble gases (particularly striking in 3He, 21Ne, 38Ar) is consistent with a terrestrial origin or an extraterrestrial origin under large shielding. Based on the combined evidence obtained in this study we infer that John's stone is a terrestrial rock unrelated to the Tunguska impactor.

  6. Solubility and speciation studies of waste radionuclides pertinent to geologic disposal at Yucca Mountain: Results on neptunium, plutonium and americium in J-13 groundwater; Letter report (R707): Reporting period, October 1, 1985--September 30, 1987

    Energy Technology Data Exchange (ETDEWEB)

    Nitsche, H.; Standifer, E.M.; Lee, S.C.; Gatti, R.C.; Tucker, D.B.

    1988-01-01

    We have studied the solubilities of neptunium, plutonium, and americium in J-13 groundwater from Yucca Mountain (Nevada) at three temperatures and hydrogen ion concentrations. They are 25{degree}, 60{degree}C, and 90{degree}C and pH 5.9, 7.0, and 8.5. The results for 25{degree}C are from a study which we did during FY 1984. We included these previous results in the tables to give more information on the solubility temperature dependence; they were, however, done at only one pH (7.0). The solubilities were studied from oversaturation. The nuclides were added at the beginning of each experiment as NpO{sub 2}{sup +}, Pu{sup 4+}, and Am{sup 3+}. The neptunium solubility decreased with increasing temperature and with increasing pH. The soluble neptunium did not change oxidation state at steady state. The pentavalent neptunium was increasingly complexed by carbonate with increasing pH. All solids were crystalline and contained carbonate, except the solid formed at 90{degree}C and pH 5.9. We identified this solid as crystalline Np{sub 2}P{sub 5}. The 25{degree}C, pH 7 solid was Na{sub 3}NpO{sub 2}(CO{sub 3}){sub 2} {center_dot} nH{sub 2}O. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. Pu(V) and Pu(VI) were the dominant oxidation states in the supernatant solution; as the amount of Pu(V) increased with pH, Pu(VI) decreed. The steady-state solids were mostly amorphous, although some contained a crystalline component. They contained Pu(IV) polymer and unknown carbonates.

  7. A DETAILED GRAVITATIONAL LENS MODEL BASED ON SUBMILLIMETER ARRAY AND KECK ADAPTIVE OPTICS IMAGING OF A HERSCHEL-ATLAS SUBMILLIMETER GALAXY AT z = 4.243 {sup ,} {sup ,}

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, R. S.; Gurwell, M. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Fu Hai; Cooray, A. [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Smith, D. J. B.; Bonfield, D.; Dunne, L. [Centre for Astrophysics, Science and Technology Research Institute, University of Hertfordshire, Hatfield, Herts AL10 9AB (United Kingdom); Dye, S.; Eales, S. [School of Physics and Astronomy, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Auld, R. [Cardiff University, School of Physics and Astronomy, Queens Buildings, The Parade, Cardiff CF24 3AA (United Kingdom); Baes, M.; Fritz, J. [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Baker, A. J. [Department of Physics and Astronomy, Rutgers, the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854-8019 (United States); Cava, A. [Departamento de Astrofisica, Facultad de CC. Fisicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Clements, D. L.; Dariush, A. [Imperial College London, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Coppin, K. [Department of Physics, McGill University, Ernest Rutherford Building, 3600 Rue University, Montreal, Quebec, H3A 2T8 (Canada); Dannerbauer, H. [Universitaet Wien, Institut fuer Astronomie, Tuerkenschanzstrasse 17, 1180 Wien, Oesterreich (Austria); De Zotti, G. [Universita di Padova, Dipto di Astronomia, Vicolo dell' Osservatorio 2, IT 35122, Padova (Italy); Hopwood, R., E-mail: rbussmann@cfa.harvard.edu [Department of Physics and Astronomy, Open University, Walton Hall, Milton Keynes, MK7 6AA (United Kingdom); and others

    2012-09-10

    We present high-spatial resolution imaging obtained with the Submillimeter Array (SMA) at 880 {mu}m and the Keck adaptive optics (AO) system at the K{sub S}-band of a gravitationally lensed submillimeter galaxy (SMG) at z = 4.243 discovered in the Herschel Astrophysical Terahertz Large Area Survey. The SMA data (angular resolution Almost-Equal-To 0.''6) resolve the dust emission into multiple lensed images, while the Keck AO K{sub S}-band data (angular resolution Almost-Equal-To 0.''1) resolve the lens into a pair of galaxies separated by 0.''3. We present an optical spectrum of the foreground lens obtained with the Gemini-South telescope that provides a lens redshift of z{sub lens} = 0.595 {+-} 0.005. We develop and apply a new lens modeling technique in the visibility plane that shows that the SMG is magnified by a factor of {mu} = 4.1 {+-} 0.2 and has an intrinsic infrared (IR) luminosity of L{sub IR} = (2.1 {+-} 0.2) Multiplication-Sign 10{sup 13} L{sub Sun }. We measure a half-light radius of the background source of r{sub s} = 4.4 {+-} 0.5 kpc which implies an IR luminosity surface density of {Sigma}{sub IR} (3.4 {+-} 0.9) Multiplication-Sign 10{sup 11} L{sub Sun} kpc{sup -2}, a value that is typical of z > 2 SMGs but significantly lower than IR luminous galaxies at z {approx} 0. The two lens galaxies are compact (r{sub lens} Almost-Equal-To 0.9 kpc) early-types with Einstein radii of {theta}{sub E1} 0.57 {+-} 0.01 and {theta}{sub E2} = 0.40 {+-} 0.01 that imply masses of M{sub lens1} = (7.4 {+-} 0.5) Multiplication-Sign 10{sup 10} M{sub Sun} and M{sub lens2} = (3.7 {+-} 0.3) Multiplication-Sign 10{sup 10} M{sub Sun }. The two lensing galaxies are likely about to undergo a dissipationless merger, and the mass and size of the resultant system should be similar to other early-type galaxies at z {approx} 0.6. This work highlights the importance of high spatial resolution imaging in developing models of strongly lensed galaxies

  8. 232Th、233U、238Pu、240Pu、242Pu、241Am、242Cm、243Cm和244Cm的裂变释放热能研究%Thermal Energy Released in Fission of 232 Th,233 U,238 Pu, 240 Pu,242 Pu,241 Am,242 Cm,243 Cm and 244 Cm

    Institute of Scientific and Technical Information of China (English)

    赵艳飞; 马续波; 陈义学

    2013-01-01

    In the nuclear reactor design ,the precise calculation of thermal fission energy is of great significance .In the pressurized water reactor ,high energy neutron-induced fission rarely occurs ,the isotopes including 233 U ,241 Am and 243 Cm are mostly induced by thermal neutrons ,while the other isotopes such as 232Th ,238Pu ,240Pu ,242Pu ,242Cm and 244 Cm are by fast neutron . In order to carry out this work , the nuclear data extracted from the latest evaluated nuclear data file (ENDF/B-Ⅶ ) were adopted ,and the energy-conservation law for the calculation of total fission energy were used , meanw hile ,with the consideration of capture energy and the correction of βand γ ,the thermal fission energy of nine isotopes was obtained .Compared with the data excerpted from IAEA issued WIMS-D database ,the results are reasonable .The thermal fission energy and its uncertainties of the nine isotopes are :(193.939 ± 0.176) MeV for 232 Th , (200.063 ± 0.084) MeV for 233 U ,(208.786 ± 1.133 ) MeV for 238 Pu ,(211.266 ± 0.220 ) MeV for 240 Pu ,(213.862 ± 0.299 ) MeV for 242 Pu ,(215.077 ± 0.210 ) MeV for 241 Am ,(218.821 ± 0.159) MeV for 242Cm ,(218.525 ± 0.388) MeV for 243Cm ,and (220.067 ± 0.131) MeV for 244 Cm ,respectively .%在核反应堆设计中,对每次裂变释放热能进行精确计算具有重要意义。在压水堆内,高能中子诱发核裂变份额很小,233 U、241 Am、243 Cm主要由热中子诱发裂变,232 T h、238 Pu、240 Pu、242 Pu、242 Cm、244 Cm主要由快中子诱发裂变。本文采用最新的核评价数据库 ENDF/B-Ⅶ,利用质量守恒法计算裂变释放总能,同时研究了中微子带走的能量,中子俘获能及β、γ修正项,最终给出了9种核素裂变释放热能。与IAEA颁布的WIMS-D格式数据库中的裂变释放热能数据的对比表明,本文所用方法计算结果合理。9种核素每次裂变释放热能分别为:232 Th ,(193.939±0.176) MeV ;233 U ,(200.063

  9. The real part of the forward elastic scattering amplitude for pp and /ovr/p//p at √s = 24.3 GeV from experiment UA6

    International Nuclear Information System (INIS)

    Preliminary results for the ratio of the real part to the imaginary part of the forward elastic scattering amplitude are presented for both pp and /ovr/p/p scattering at √s = 24.3 GeVc. The elastic differential cross section was measured in the four-momentum transfer range 0.001 2 using a position sensitive silicon detector to detect the recoil proton. The values found are /rho/(pp) = 0.014 +- 0.007 +- 0.007 and /rho/(/ovr/p//p) = 0.045 +- 0.007 +- 0.007

  10. Impaction grafting in the femur in cementless modular revision total hip arthroplasty: a descriptive outcome analysis of 243 cases with the MRP-TITAN revision implant

    Directory of Open Access Journals (Sweden)

    Wimmer Matthias D

    2013-01-01

    Full Text Available Abstract Background We present a descriptive and retrospective analysis of revision total hip arthroplasties (THA using the MRP-TITAN stem (Peter Brehm, Weisendorf, GER with distal diaphyseal fixation and metaphyseal defect augmentation. Our hypothesis was that the metaphyseal defect augmentation (Impaction Bone Grafting improves the stem survival. Methods We retrospectively analyzed the aggregated and anonymized data of 243 femoral stem revisions. 68 patients with 70 implants (28.8% received an allograft augmentation for metaphyseal defects; 165 patients with 173 implants (71.2% did not, and served as controls. The mean follow-up was 4.4 ± 1.8 years (range, 2.1–9.6 years. There were no significant differences (p > 0.05 between the study and control group regarding age, body mass index (BMI, femoral defects (types I-III as described by Paprosky, and preoperative Harris Hip Score (HHS. Postoperative clinical function was evaluated using the HHS. Postoperative radiologic examination evaluated implant stability, axial implant migration, signs of implant loosening, periprosthetic radiolucencies, as well as bone regeneration and resorption. Results There were comparable rates of intraoperative and postoperative complications in the study and control groups (p > 0.05. Clinical function, expressed as the increase in the postoperative HHS over the preoperative score, showed significantly greater improvement in the group with Impaction Bone Grafting (35.6 ± 14.3 vs. 30.8 ± 15.8; p ≤ 0.05. The study group showed better outcome especially for larger defects (types II C and III as described by Paprosky and stem diameters ≥ 17 mm. The two groups did not show significant differences in the rate of aseptic loosening (1.4% vs. 2.9% and the rate of revisions (8.6% vs. 11%. The Kaplan-Meier survival for the MRP-TITAN stem in both groups together was 93.8% after 8.8 years. [Study group 95.7% after 8.54 years ; control group 93

  11. Soja transgênica BRS 243 RR: determinação de macronutrientes e das isoflavonas daidzeína e genisteína por Cromatografia Líquida de Alta Eficiência (CLAE Transgenic soybean BRS 243 RR: determination of macronutrients and isoflavones daidzein and genistein by High Performance Liquid Chromatography (HPLC

    Directory of Open Access Journals (Sweden)

    Marcela Roquim Alezandro

    2008-09-01

    Full Text Available Este trabalho teve por objetivo determinar a composição centesimal e o conteúdo de Daidzeína (D e Genisteína (G da cultivar BRS 243 RR por CLAE. O preparo da amostra para cromatografia envolveu a remoção da gordura com hexano . Os analitos foram extraídos com etanol 70% acrescido de 0,1% de ácido acético. As condições cromatográficas otimizadas foram: coluna C18, fase móvel metanol: ácido acético 5% (1:1 v/v, vazão 0,5 mL/minuto, temperatura da coluna 30 °C, volume de injeção 40 µL e leitura em 254 nm. Os parâmetros de validação avaliados foram: linearidade y = 11242 x -37433, r = 0,9976 (D e y = 18510 x -66761, r = 0,9980 (G; coeficientes de variação dos estudos de precisão intradia CV = 5,3% (D, CV = 6,7% (G e interdias CV = 8,7% (D, CV = 9,7% (G; limite de quantificação 10 µg.g-1; limite de detecção 5 µg.g-1 e recuperação 95,7%. Portanto, o método desenvolvido foi adequado para a determinação de daidzeína e genisteína em soja. Os níveis de carboidratos (31,4%, proteínas (35,9%, lipídios (20,9%, umidade (6,9%, cinzas (4,9%, daidzeína (44,1 µg.g-1 e genisteína (37,4 µg.g-1 determinados na soja transgênica foram similares aos de outros estudos com soja convencional.The objective of this work was to evaluate the proximate composition, as well as Daidzein (D and Genistein (G contents by HPLC, of BRS 243 RR soybean. Sample preparation for the chromatographic analysis involved the use of hexane to remove lipids. Isoflavones were extracted with 70% ethanol containing 0.1% acetic acid. The optimized chromatographic conditions were: C18 column, mobile phase methanol:5% acetic acid (1:1 v/v, flow rate 0.5 mL/minute, column temperature 30 °C, UV absorbance at 254 nm and volume injected 40 µL. The validation parameters were: linearity of daidzein (y = 11242 x -37433, r = 0.9976 and genistein (y = 18510 x -66761, r = 0.9980; variation coefficients obtained in intra-day precision assays [CV = 5.3% (D, CV = 6

  12. Measurement of the Neutron Capture Cross Sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm with a Total Absorption Calorimeter at n_TOF

    CERN Multimedia

    Beer, H; Wiescher, M; Cox, J; Rapp, W; Embid, M; Dababneh, S

    2002-01-01

    Accurate and reliable neutron capture cross section data for actinides are necessary for the poper design, safety regulation and precise performance assessment of transmutation devices such as Fast Critical Reactors or Accelerator Driven Systems (ADS). The goal of this proposal is the measurement of the neutron capture cross sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm at n_TOF with an accuracy of 5~\\%. $^{233}$U plays an essential role in the Th fuel cycle, which has been proposed as a safer and cleaner alternative to the U fuel cycle. The capture cross sections of $^{237}$Np,$^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm play a key role in the design and optimization of a strategy for the Nuclear Waste Transmutation. A high accuracy can be achieved at n_TOF in such measurements due to a combination of features unique in the world: high instantaneous neutron fluence and excellent energy resolution of the facility, innovative Data Acquisition System based on flash ADCs and t...

  13. The proliferation potential of neptunium and americium

    Energy Technology Data Exchange (ETDEWEB)

    An, J. S.; Shin, J. S.; Kim, J. S.; Kwack, E. H.; Kim, B. K

    2000-05-01

    It is recognized that some trans-uranic elements other than plutonium, in particular Np and Am, if will be available in sufficient quantities, could be used for nuclear explosive devices. The spent fuel has been accumulating in number of nuclear power plant and operation of large scale commercial reprocessing plants. However, these materials are not covered by the definition of special fissionable material in the Agency Statute. At the time when the Statute was adopted, the availability of meaningful quantities of separated Np and Am was remote and they were not included in the definition of special fissionable material. Then, IAEA Board decided a measure for control of Np and Am on September 1999. This report contains the control method and the characteristic of Np and Am for using domestic nuclear industries, and it can be useful for understanding how to report and account of Np and Am. (author)

  14. Delocalization and new phase in Americium: theory

    Energy Technology Data Exchange (ETDEWEB)

    Soderlind, P

    1999-04-23

    Density-functional electronic structure calculations have been used to investigate the high pressure behavior of Am. At about 80 kbar (8 GPa) calculations reveal a monoclinic phase similar to the ground state structure of plutonium ({alpha}-Pu). The experimentally suggested {alpha}-U structure is found to be substantially higher in energy. The phase transition from fcc to the low symmetry structure is shown to originate from a drastic change in the nature of the electronic structure induced by the elevated pressure. A calculated volume collapse of about 25% is associated with the transition. For the low density phase, an orbital polarization correction to the local spin density (LSD) theory was applied. Gradient terms of the electron density were included in the calculation of the exchange/correlation energy and potential, according to the generalized gradient approximation (GGA). The results are consistent with a Mott transition; the 5f electrons are delocalized and bonding on the high density side of the transition and chemically inert and non-bonding (localized) on the other. Theory compares rather well with recent experimental data which implies that electron correlation effects are reasonably modeled in our orbital polarization scheme.

  15. Evaluation of neutron data for americium-241

    Energy Technology Data Exchange (ETDEWEB)

    Maslov, V.M.; Sukhovitskij, E.Sh.; Porodzinskij, Yu.V.; Klepatskij, A.B.; Morogovskij, G.B. [Radiation Physics and Chemistry Problems Inst., Minsk-Sosny (Belarus)

    1997-03-01

    The evaluation of neutron data for {sup 241}Am is made in the energy region from 10{sup -5} eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Y. Kikuchi (JAERI). (author). 60 refs.

  16. Thermomechanical behavior and microstructural evolution of a Ni(Pd)-rich Ni{sub 24.3}Ti{sub 49.7}Pd{sub 26} high temperature shape memory alloy

    Energy Technology Data Exchange (ETDEWEB)

    Benafan, O., E-mail: othmane.benafan@nasa.gov [NASA Glenn Research Center, Structures and Materials Division, Cleveland, OH 44135 (United States); Garg, A. [University of Toledo, Toledo, OH 43606 (United States); NASA Glenn Research Center, Structures and Materials Division, Cleveland, OH 44135 (United States); Noebe, R.D.; Bigelow, G.S.; Padula, S.A. [NASA Glenn Research Center, Structures and Materials Division, Cleveland, OH 44135 (United States); Gaydosh, D.J. [Ohio Aerospace Institute, Cleveland, OH 44142 (United States); NASA Glenn Research Center, Structures and Materials Division, Cleveland, OH 44135 (United States); Vaidyanathan, R. [Advanced Materials Processing and Analysis Center, Materials Science and Engineering Department, University of Central Florida, Orlando, FL 32816 (United States); Clausen, B.; Vogel, S.C. [Materials Science and Technology Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2015-09-15

    Highlights: • A Ni(Pd)-rich Ni{sub 24.3}Ti{sub 49.7}Pd{sub 26} high temperature shape memory alloy was characterized. • Aging resulted in fine dispersion of nano-sized precipitates. • Thermomechanical cycling resulted in dimensional instabilities due to lattice defects. • A two-way shape memory effect strain of 2% strain was obtained after cycling. - Abstract: The effect of thermomechanical cycling on a slightly Ni(Pd)-rich Ni{sub 24.3}Ti{sub 49.7}Pd{sub 26} (near stochiometric Ni–Ti basis with Pd replacing Ni) high temperature shape memory alloy was investigated. Aged tensile specimens (400 °C/24 h/furnace cooled) were subjected to constant-stress thermal cycling in conjunction with microstructural assessment via in situ neutron diffraction and transmission electron microscopy (TEM), before and after testing. It was shown that in spite of the slightly Ni(Pd)-rich composition and heat treatment used to precipitation harden the alloy, the material exhibited dimensional instabilities with residual strain accumulation reaching 1.5% over 10 thermomechanical cycles. This was attributed to insufficient strengthening of the material (insufficient volume fraction of precipitate phase) to prevent plasticity from occurring concomitant with the martensitic transformation. In situ neutron diffraction revealed the presence of retained martensite while cycling under 300 MPa stress, which was also confirmed by transmission electron microscopy of post-cycled samples. Neutron diffraction analysis of the post-thermally-cycled samples under no-load revealed residual lattice strains in the martensite and austenite phases, remnant texture in the martensite phase, and peak broadening of the austenite phase. Texture developed in the martensite phase was composed mainly of those martensitic tensile variants observed during thermomechanical cycling. Presence of a high density of dislocations, deformation twins, and retained martensite was revealed in the austenite state via in

  17. Identification of ZCCHC8 as fusion partner of ROS1 in a case of congenital glioblastoma multiforme with a t(6;12)(q21;q24.3).

    Science.gov (United States)

    Coccé, Mariela C; Mardin, Balca R; Bens, Susanne; Stütz, Adrian M; Lubieniecki, Fabiana; Vater, Inga; Korbel, Jan O; Siebert, Reiner; Alonso, Cristina N; Gallego, Marta S

    2016-09-01

    Congenital gliobastoma multiforme (GBM) is rare and little is known about the molecular defects underlying the initiation and progression of this tumor type. We present a case of congenital GBM analyzed by conventional cytogenetics, fluorescence in situ hybridization, array comparative genomic hybridization and next generation sequencing. On cytogenetic analysis we detected a reciprocal translocation t(6;12)(q21;q24.3). By sequencing, the translocation was shown to form a fusion between the 5' region of ZCCHC8 and the 3' region of ROS1. RT-PCR analyses confirmed the existence of an in-frame fusion transcript with ZCCHC8 exons 1-3 joined to ROS1 exons 36-43. In addition to the ZCCHC8-ROS1 fusion, we detected a deletion in the short arm of chromosome 9, including homozygous loss of the CDKN2A/2B locus in 9p21.3 and heterozygous deletion of the HAUS6 gene in 9p22.1. The latter encodes a protein involved in faithful chromosome segregation by regulating microtubule nucleation and its deletion might be associated with the marked subclonal changes of ploidy observed in the tumor. This report adds the ZCCHC8-ROS1 fusion as oncogenic driver in GBM and supports the role of ROS1 activation in the pathogenesis of a subset of GBM. © 2016 Wiley Periodicals, Inc. PMID:27121553

  18. The gene for spinal cerebellar ataxia 3 (SCA3) is located in a region of {approximately} 3 cM on chromosome 14q24.3-q32.2

    Energy Technology Data Exchange (ETDEWEB)

    Stevanin, G.; Cancel, G.; Duerr, A.; Dubourg, O.; Agid, Y.; Brice, A. [Hopital de la Salpetriere, Paris (France); Chneiweiss, H.; Weissenbach, J.; Cann, H.M.

    1995-01-01

    SCA3, the gene for spinal cerebellar ataxia 3, was recently mapped to a 15-cM interval between D14S67 and D14S81 on chromosome 14q, by linkage analysis in two families of French ancestry. The SCA3 candidate region has now been refined by linkage analysis with four new microsatellite markers (D14S256, D14S291, D14S280, and AFM343vf1) in the same two families, in which 19 additional individuals were genotyped, and in a third French family. Combined two-point linkage analyses show that the new markers, D14S280 and AFM343vf1, are tightly linked to the SCA3 locus, with maximal lod scores, at recombination fraction, ({theta}) = .00, of 7.05 and 13.70, respectively. Combined multipoint and recombinant haplotype analyses localize the SCA3 locus to a 3-cM interval flanked by D14S291 and D14S81. The same allele for D14S280 segregates with the disease locus in the three kindreds. This allele is frequent in the French population, however, and linkage disequilibrium is not clearly established. The SCA3 locus remains within the 29-cM region on 14q24.3-q32.2 containing the gene for the Machado-Joseph disease, which is clinically related to the phenotype determined by SCA3, but it cannot yet be concluded that both diseases result from alterations of the same gene. 30 refs., 3 figs., 3 tabs.

  19. 15 CFR 24.3 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... Commerce and Foreign Trade Office of the Secretary of Commerce UNIFORM ADMINISTRATIVE REQUIREMENTS FOR... price of the property including the cost of modifications, attachments, accessories, or auxiliary... under the United States Housing Act of 1937) school district, special district, intrastate...

  20. 14 CFR 243.3 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... intimidation, and with wrongful intent. Aviation disaster means: (1) An occurrence associated with the... an aviation disaster. The contact need not have any particular relationship to a passenger. Covered..., the District of Columbia, and the territories and possessions of the United States, including...

  1. Galileo photometry of asteroid 243 Ida

    Science.gov (United States)

    Helfenstein, P.; Veverka, J.; Thomas, P.C.; Simonelli, D.P.; Klaasen, K.; Johnson, T.V.; Fanale, F.; Granahan, J.; McEwen, A.S.; Belton, M.; Chapman, C.

    1996-01-01

    Galileo imaging observations over phase angles 19.5?? to 109.8?? are combined with near-opposition Earth-based data to derive the photometric properties of Ida. To first order these properties are uniform over the surface and well modeled at ?? = 0.55 ??m by Hapke parameters ????0 = 0.22, h = 0.020, B0 = 1.5, g = -0.33, and ?? = 18?? with corresponding geometric albedo p = 0.21??0.030.01 and Bond albedo AB = 0.081??0.0170.008. Ida's photometric properties are more similar to those of "average S-asteroids" (P. Helfenstein and J. Veverka 1989, Asteroids II, Univ. of Arizona Press, Tucson) than are those of 951 Gaspra. Two primary color units are identified on Ida: Terrain A exhibits a spectrum with relatively shallower 1-??m absorption and a relatively steeper red spectral slope than average Ida, while Terrain B has a deeper 1-??m absorption and a less steep red slope. The average photometric properties of Ida and Terrain A are similar while those of Terrain B differ mostly in having a slightly higher value of ????0 (0.22 versus 0.21), suggesting that Terrain B consists of slightly brighter, more transparent regolith particles. Galileo observations of Ida's satellite Dactyl over phase angles 19.5?? to 47.6?? suggest photometric characteristics similar to those of Ida, the major difference being Dactyl's slightly lower albedo (0.20 compared to 0.21). ?? 1990 Academic Press, Inc.

  2. 48 CFR 52.243-4 - Changes.

    Science.gov (United States)

    2010-10-01

    ... within the general scope of the contract, including changes— (1) In the specifications (including..., or the time required for, the performance of any part of the work under this contract, whether or not... contract in writing. However, except for an adjustment based on defective specifications, no adjustment...

  3. 40 CFR 243.101 - Definitions.

    Science.gov (United States)

    2010-07-01

    ...) Generation means the act or process of producing solid waste. (n) Hazardous waste means a waste or... uncontrolled and unauthorized removal of materials at any point in the solid waste management system. (x... demolition wastes; and infectious wastes. (z) Stationary compactor means a powered machine which is...

  4. Historical Review of Californium-252 Discovery and Development

    Science.gov (United States)

    Stoddard, D. H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed. (PLG)

  5. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  6. Study of the electrochemical oxidation of Am with lacunary heteropolyanions and silver nitrate; Etude de l'oxydation electrochimique de l'americium en presence d'heteropolyanions lacunaires et de nitrate d'argent en milieu aqueux acide

    Energy Technology Data Exchange (ETDEWEB)

    Chartier, D

    1999-07-01

    Electrochemical oxidation of Am(III) with certain lacunary heteropolyanions (LHPA {alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}{sup 10-} or {alpha}SiW{sub 11}O{sub 39}{sup 8-}) and silver nitrate is an efficient way to prepare Am(VI). This document presents bibliographic data and an experimental study of the process. Thus, it has been established that Am(IV) is an intermediate species in the reaction and occurs in 1:1 (Amt{sup IV}LHPA) or 1:2 (Am {sup IV}(LHAP){sub 2}) complexes with the relevant LHPA. These 1:1 complexes of Am(IV) have been identified and isolated in this work whereas 1:2 complexes were known from previous studies. The reactivity of these complexes in oxidation shows that 1:1 complexes of Am(IV) are oxidised much more quickly than 1:2 complexes. Apparent stability constants of Am(III) and Am(IV) complexes with the relevant LHPA have been measured for a 1 M nitric acid medium. Thermodynamic data of the reaction are then assessed: redox potentials of Am pairs are computed for a 1 M nitric acid medium containing various amount of LHPA ligands. Those results show that the role of LHPA is to stabilize the intermediate species Am(IV) by lowering the Am(IV)/Am(III) pair potential of about 1 Volt. Nevertheless, if this stabilisation is too strong (i.e. of tungsto-silicate), the oxidation of Am(IV) requires high anodic potential (more than 2 V/ENH). Then, the faradic yield of the oxidation of americium is poor because of water oxidation. This study has also shown that the main role of silver is to catalyze the electrochemical oxidation of Am{sup IV}(LHPA){sub X} complexes. Indeed, these oxidations without silver are extremely slow. An oxygen tracer experiment has been performed during the oxidation of Am(III) in Am(VI). It has been shown that the oxygen atoms of Am(VI) (AMO{sub 2}{sup 2+}) come from water molecules of the solvent and not from the complexing oxygen atoms of the ligands. (author)

  7. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions; Fabricacion de blancos para la transmutacion de americio: sintesis de matrices inertes por el metodo sol-gel. Estudio del procedimiento de infiltracion de disoluciones radiactivas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Carretero, A. [Universidad Complutense de Madrid (Spain)

    2002-07-01

    made. In addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  8. Metal-ligand interaction of lanthanides with coumarin derivatives. Part I. Complexation of 3-(1-aminoethylidene)-2H-chromene-2,4(3H)-dione with La(III), Ce(III), Nd(III) and Ho(III).

    Science.gov (United States)

    Swiatek, Mirosława; Kufelnicki, Aleksander

    2012-01-01

    Solutions of lanthanum(III), cerium(III), neodymium(III) and holmium(III) nitrates with 3-(1-aminoethylidene)-2H-chromene-2,4(3H)-dione (1) in 10% v/v dioxane-water medium were used. Coordination modes of 1 with the selected lanthanides have been examined. Hydroxo-complexes with deprotonated water molecules from the inner coordination sphere have been stated in basic medium. Stability constants of the forming complex species were determined by potentiometric titrations using Superquad and Hyperquad2003 programs. The most stable complexes are formed with La(III). The UV-Vis spectra of the Nd(III)-1 system confirmed the L:M = 1:1 stoichiometry evaluated potentiometrically.

  9. Americium separation from nuclear fuel dissolution using higher oxidation states.

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher

    2009-09-01

    Much of the complexity in current AFCI proposals is driven by the need to separate the minor actinides from the lanthanides. Partitioning and recycling Am, but not Cm, would allow for significant simplification because Am has redox chemistry that may be exploited while Cm does not. Here, we have explored methods based on higher oxidation states of Am (AmV and AmVI) to partition Am from the lanthanides. In a separate but related approach we have also initiated an investigation of the utility of TRUEX Am extraction from thiocyanate solution. The stripping of loaded TRUEX by Am oxidation or SCN- has not yet proved successful; however, the partitioning of inextractable AmV by TRUEX shows promise.

  10. Recovery of neptunium, plutonium, and americium from highly active waste

    International Nuclear Information System (INIS)

    Trialkylphosphine oxides (TRPO) (alkyl is 6c-C8) were chosen as the extractant for the recovery of Np, Pu, and Am from highly active waste (HAW) because of its extraction ability, excellent solvent behavior, high radiolytic stability, and low cost. Process chemistry based on 30 vol % TRPO-kerosene as solvent is presented. Extraction of Am in the presence of macro amounts of neodymium, adjustment of Np valence by electrolytic reduction, selective stripping of actinides from loaded organic phase, and loading capacity of the solvent are included. Process parameters of multistage countercurrent extraction and stripping and the results of experimental verification are given. From HAW with ∼1 M nitric acid concentration, recovery of actinides is higher than 99.9%. The actinides extracted can be stripped out separately into Am, Np-Pu, and U fractions. The behavior of nonactinide HAW constituents, including Tc, is discussed

  11. Property Data for Simulated Americium/Curium Glasses

    International Nuclear Information System (INIS)

    The authors studied the properties of mixed lanthanide-alumino-borosilicate glasses. Fifty-five glasses were designed to augment a previous, Phase I, study by systematically varying the composition of Ln2O3 and the concentrations of Ln2O3, SiO2, B2O3, Al2O3, and SrO in glass. These glasses were designed and fabricated at the Savannah River Technology Center and tested at the Pacific Northwest National Laboratory. The properties measured include the high-temperature viscosity (η) as a function of temperature (T) and the liquidus temperature (TL) of Phase II test glasses

  12. The vapour pressure of americium(III) chloride

    International Nuclear Information System (INIS)

    Based on the method described by Fischer, an ultramicro-size appratus was developed for static determination of the saturation vapour pressure of highly radioactive materials. The apparatus was tested with MgCl2, MnCl2, HoCl3 and ScF3. The vapour pressure curves of MgCl2 and MnCl2 were in good agreement with other publications and thus proved the efficiency of the apparatus in spite of its difficulties of handling. The values measured for HoCl3 and ScF3 differed from those of earlier publications. However, these deviations have been observed before and may be the result of the different measuring principles of static and dynamic methods. For AmCl3, the following vapour pressure equation was established: log psub(Torr)=-(11826/T)+10.7. The thermodynamic parameters of the evaporation process were calculated on this basis, and the values for AmBr3 and PnCl3 were determined by extrapolation. (orig.)

  13. 1976 Hanford americium-exposure incident: accident description

    International Nuclear Information System (INIS)

    An accident is described, involving the explosion of an ion-exchange column containing about 100 g of 241Am. A chemical operator was injured in this accident, receiving acid burns and superficial cuts on the upper part of his body. From 1 to 5 curies of 241Am is estimated to have been deposited on the injured worker and on his clothing

  14. Further Studies of Plutonium and Americium at Thule, Greenland

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Dahlgaard, Henning; Nilsson, Karen Kristina;

    1984-01-01

    Eleven years after the accidental loss of nuclear weapons in 1968, the fourth scientific expedition to Thule occurred. The estimated inventory of 1 TBq 239,240Pu in the marine sediments was unchanged when compared with the estimate based on the 1974 data. Plutonium from the accident had moved...

  15. Dicty_cDB: VHH243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available nce update 2002.10.25 Translated Amino Acid sequence kccstinptfmink*KRREKKMNVKEMDFNDLSNKSNQIINRISSFSSPIGLSSF...leisllsfkhtltsllnntiy*itltnllivvpyllvvnkpfk ifnlelnvllcllvk*isqclvisylv* Frame B: kccstinptfmink*KRREKKMNVKE

  16. Dicty_cDB: CHE243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ae genes during infection and propagation_sML Phytophthora sojae cDNA clone sML00...jae genes during infection and propagation_sZG Phytophthora sojae cDNA clone sZG001H24 5, mRNA sequence. 64 ...ojae genes during infection and propagation_sZS Phytophthora sojae cDNA clone sZS009J21 5, mRNA sequence. 64

  17. 1935 15' Quad #243 Aerial Photo Mosaic Index

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Aerial Photo Reference Mosaics contain aerial photographs that are retrievable on a frame by frame basis. The inventory contains imagery from various sources that...

  18. Motivation for New Measurements on 241, 242, 243Am Isotopes

    International Nuclear Information System (INIS)

    The initial objective of this work was an updated review on the Am isotopes data since the next official release (3.1) of the JEFF3 evaluated data file is foreseen around June 2005. Alternatively, this work searches for the possible reasons of the observed discrepancies between differential and integral measurement results. In particular, strong differences are encountered on σγth values and epithermal branching ratio values for the 241Am. Although the JEF2.2 validation is used as guide in parallel with a systematic study of all differential and integral results available, the need for new measurements clearly shows up. This paper finally draws up a list of desired and feasible new differential and integral measurements on the Am isotopes

  19. 7 CFR 2.43 - Administrator, Foreign Agricultural Service.

    Science.gov (United States)

    2010-01-01

    ... Development, the European Union, the Food and Agriculture Organization of the United Nations, the... International Coffee Agreement or any such future agreement. (6) Administer functions of the Department relating... functions with respect to the International Sugar Agreement or any such future agreements. (12) Exercise...

  20. Dicty_cDB: SHL243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available plete sequence. 48 0.54 1 AJ410884 |AJ410884.1 Influenza A virus (swine/Cotes d'Armor/1515/99 (H1N1...za A virus (swine/Cotes d'Armor/1482/99 (H1N1)) partial N1NA gene for Neuraminidase, genomic RNA. 42 1.0 2 A

  1. 26 CFR 1.243-4 - Qualifying dividends.

    Science.gov (United States)

    2010-04-01

    .... (iii) Other members. The consent of each member of the affiliated group (other than a wholly owned... account number, and taxable year of each corporation (including wholly-owned subsidiaries) that is a...) Wholly owned subsidiary. If all of the stock of a corporation is owned by a member or members of...

  2. 26 CFR 1.243-5 - Effect of election.

    Science.gov (United States)

    2010-04-01

    ... member under the plan. (5) Consent of wholly owned subsidiaries. If all the stock of a corporation which is a member of the affiliated group on each day of its matching taxable year is owned on each such... matching taxable year, such corporation (hereinafter in this paragraph referred to as a “wholly...

  3. Dicty_cDB: SHB243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available R103667 |CR103667.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering... in 3'HPRT insertion targeting and chromosome engineering clone MHPP186g09. 50 0.13 1 dna update 2005.12.21

  4. 48 CFR 52.243-7 - Notification of Changes.

    Science.gov (United States)

    2010-10-01

    ... (including actions, inactions, and written or oral communications) that the Contractor regards as a change to... substance of any oral communication involved in such conduct; (4) In the instance of alleged acceleration of..., means any person the Contracting Officer has so designated by written notice (a copy of which shall...

  5. Dicty_cDB: CHS243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FM992695_70( FM992695 |pid:none) Candida dubliniensis CD36 chromos... 35 1.5 EU361927_1( EU361927 |pid:none)... Daniellia klainei tRNA-Lys (trnK) ... 34 1.9 FM992689_882( FM992689 |pid:none) Candida dubli

  6. 12 CFR 303.243 - Brokered deposit waivers.

    Science.gov (United States)

    2010-01-01

    ... the institution's lending and investment activities, including a detailed discussion of asset growth... applicant is notified in writing to the contrary and provided with the basis for that decision. For the... decision is rendered. (g) Conditions for approval. A waiver issued pursuant to this section shall: (1)...

  7. Dicty_cDB: VFL243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available kllkrlvmmthqkvlitklamf*lqlnnnhqillkvstl vkltqkilvlvikvtclvmpptkpql*chllisspln*stn...vklppkptltikklfvkllkrlvmmthqkvlitklamf*lqlnnnhqillkvstl vkltqkilvlvikvtclvmpptkpql*chllisspln*stn*lnyvtmvp*P

  8. 19 CFR 10.243 - Articles eligible for preferential treatment.

    Science.gov (United States)

    2010-04-01

    ... produced from fabric, all dyeing, printing, and finishing of that knitted or crocheted or woven fabric or... countries, or in the United States, or in both, exclusively from any one of the following: (i) Fabrics or fabric components wholly formed, or components knit-to-shape, in the United States, from yarns...

  9. 9 CFR 354.243 - Operations and procedures.

    Science.gov (United States)

    2010-01-01

    ... INSPECTION AND CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Maintenance of..., and insects), considering the means intended to be employed in transporting the product from the plant... hygiene of personnel: (1) All employees coming in contact with exposed edible products or edible...

  10. 48 CFR 52.243-2 - Changes-Cost-Reimbursement.

    Science.gov (United States)

    2010-10-01

    ... the time required for, performance of any part of the work under this contract, whether or not changed... this contract and, if this contract is incrementally funded, the funds allotted for the performance of... the general scope of this contract in the plans and specifications or instructions incorporated in...

  11. 48 CFR 52.243-1 - Changes-Fixed-Price.

    Science.gov (United States)

    2010-10-01

    ... cost of, or the time required for, performance of any part of the work under this contract, whether or..., etc.). (3) Place of performance of the services. (4) Drawings, designs, or specifications when the... Officer shall make an equitable adjustment in (1) the contract price, the time of performance, or...

  12. 19 CFR 24.3 - Bills and accounts; receipts.

    Science.gov (United States)

    2010-04-01

    ... account for money due the United States shall be rendered by an authorized Customs officer or employee on... constitute evidence of such payment to Customs. Should a payer desire evidence of receipt, both the...

  13. 47 CFR 24.243 - The cost-sharing formula.

    Science.gov (United States)

    2010-10-01

    ...—antenna, necessary feed lines, MUX/Modems); towers and/or modifications; back-up power equipment... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PERSONAL COMMUNICATIONS... control; power plant upgrade (if required); electrical grounding systems; Heating Ventilation and...

  14. 40 CFR 98.243 - Calculating GHG emissions.

    Science.gov (United States)

    2010-07-01

    ... produced each calendar month with a flow meter by following the procedures specified in § 98.244(b)(2... subpart C of this part (General Stationary Fuel Combustion Sources)). You are not required to use the same Tier for each stationary combustion unit that burns ethylene process off-gas. For each flare,...

  15. Editorial: phys. stat. sol. (b) 243/1

    Science.gov (United States)

    Stutzmann, Martin

    2006-01-01

    Dear Colleagues and Friends,on behalf of the Publishers, the Editorial Office, and the Editors of physica status solidi we wish you all the best for the coming year 2006! It is our sincere hope that your personal and professional experience with our journal has been a positive one and that you will continue to choose physica status solidi for the publication of your scientific findings in solid state physics also in the future.In doing so, you will be in increasingly good company! As a matter of fact, 2005 has been a year of exceptional growth in the number of manuscripts submitted to physica status solidi . Thus, the number of Original Papers which have reached our Editorial Office in Berlin has increased by as much as 30% compared to the long term average over the last ten years. For the Rapid Research Letter section, the corresponding increase has been even more impressive: more than +100% just in the last two years. We view this development as a confirmation of our longstanding efforts to ensure a timely publication service of high scientific quality. One relevant indicator for the high scientific standards expected from articles which are submitted for publication in physica status solidi is the average acceptance rate, which currently is less than 40%. This rate has continuously decreased from a value of about 60% ten years ago and bears witness to our efforts to strive for quality rather than quantity.Also, physica status solidi has been able to continue its long tradition as a truly international journal, despite of the strong competition in an established field such as solid state physics. In 2005, submitted papers have originated almost equally from the Americas, Europe, and Asia, with a clearly growing contribution from China, India, and Japan. We are actively working together with our international Editorial Boards and the Regional Editors to maintain a reasonable balance among papers from different parts of the world. The increasing international visibility of physica status solidi is impressively documented by the ever rising numbers of article downloads via the internet: on the average, each of the 2000 articles published annually in physica status solidi is presently accessed about 100 times via the www.Finally, let me mention some other recent developments, which are not so directly visible from the outside. Thus, a new all electronic publishing system has become operative in our Berlin Editorial Office in 2005, which allows a more efficient and timely handling of manuscripts from submission to publication (www.manuscriptXpress.com) and is particularly valuable for the editing of conference proceedings (conferences.wiley-vch.de). In addition, the functionality of the journal within the Wiley InterScience website has been enhanced by new features such as Citation Tracking. Together with the ongoing digitization of all physica status solidi issues since the 1960s, which is expected to be complete in 2006, this makes the physica status solidi homepage at Wiley InterScience a very valuable tool for literature search in solid state physics, past and present. Try it out at www.interscience.wiley.com!All of us from physica status solidi would like to convey to you our very best wishes for good health and success in the coming year 2006!

  16. 29 CFR 1910.243 - Guarding of portable powered tools.

    Science.gov (United States)

    2010-07-01

    ...) of this section does not apply to circular saws used in the meat industry for meat cutting purposes... care appliances, medical or dental equipment, or to fixed machinery. (3) Portable belt sanding machines... machinery. Natural sandstone wheels and metal, wooden, cloth, or paper discs, having a layer of abrasive...

  17. Investigation of the retention and distribution of americium-241 in the baboon and the enhanced removal of americium-241 from the body by diethylenetriaminepentaacetic acid (DTPA)

    International Nuclear Information System (INIS)

    Experiments were performed to study the metabolism and distribution of intravenously administered 241Am in the adult and juvenile baboon; in addition, decorporation therapy using Na3-CaDTPA was performed on selected baboons to assess the efficacy of this drug in removing systemic burdens of 241Am from this primate species. Determination of the kinetics of 241Am was accomplished principally by in vivo methodologies and by radiochemical analysis of 241Am activity of biological material. The use of Na3-CaDTPA as a therapeutic agent for the removal of 241Am from the body proved to be an effective form of treatment in the case of early administration. (U.S.)

  18. Determination of the first ionization potential of actinides by resonance ionization mass spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Koehler, S. [Institut fuer Kernchemie Universitaet Mainz, Mainz (Germany); Albus, F. [Institu fuer Physik, Universitaet Mainz, Mainz (Germany); Dibenberger, R.; Erdmann, N.; Funk, H. [Institut fuer Kernchemiess Universitaet Mainz, Mainz (Germany); Hasse, H. [Institut fuer Physik, Universitaet Mainz, Mainz (Germany); Herrmann, G. [Institut fuer Kernchemiess Universitaet Mainz, Mainz (Germany); Huber, G.; Kluge, H.; Nunnemann, M.; Passler, G. [Institut fuer Physik, Universitaet Mainz, Mainz (Germany); Rao, P.M. [Bhabha Atomic Research Centre Bombay (India); Riegel, J.; Trautmann, N. [Institut fuer Kernchemie Universitaet Mainz, Mainz (Germany); Urban, F. [Institut fuer Physik, Universitaet Mainz, Mainz (Germany)

    1995-04-01

    Resonance ionization mass spectroscopy (RIMS) is used for the precise determination of the first ionization potential of transuranium elements. The first ionization potentials (IP) of americium and curium have been measured for the first time to IP{sub {ital Am}}=5.9738(2) and IP{sub {ital Cm}}=5.9913(8) eV, respectively, using only 10{sup 12} atoms of {sup 243}Am and {sup 248}Cm. The same technique was applied to thorium, neptunium, and plutonium yielding IP{sub T{sub H}}=6.3067(2), IP{sub N{sub P}}=6.2655(2), and IP{sub {ital Pu}}=6.0257(8) eV. The good agreement of our results with the literature data proves the precision of the method which was additionally confirmed by the analysis of Rydberg seris of americium measured by RIMS. {copyright}American Institute of Physics 1995

  19. Americium-Curium Stabilization - 5'' Cylindrical Induction Melter System Design Basis

    Energy Technology Data Exchange (ETDEWEB)

    Witt, D.C.

    1999-11-08

    Approximately 11,000 liters (3,600) gallons of solution containing isotopes of Am and Cm are currently stored in F-Canyon Tank 17.1. These isotopes were recovered during plutonium-242 production campaigns in the mid- and late-1970s. Experimental work for the project began in 1995 by the Savannah River Technology Center (SRTC). Details of the process are given in the various sections of this document.

  20. Biosorption of radionuclide Americium-241 by A. niger spore and hyphae

    International Nuclear Information System (INIS)

    The biosorption of radionuclide 241Am from solution was studied by a. niger spore and hyphae, and the effects of the operational conditions on the treatment were investigated. The results showed the treatment by A. niger spore and hyphae were very efficient. An average of 96% of the total 241Am was removed from 241Am solutions of 5.6-111 MBq/L (C0), with adsorption capacities (W) of 7.2-142.4 MBq/g biomass, 5.2-106.5 MBq/g, respectively. The biosorption equilibrium was achieved within 1 h and the optimum pH value ranged 3-0.1 mol/L HNO3 and 3-2 for spore and hyphae of A. niger, respectively. No significant effects on 241Am biosorption were observed at 15 degree C-45 degree C, or challenged with containing Au3+ or Ag+, even 2000 times above 241Am amount. the index relationship between concentrations and adsorption capacities of 241Am indicated that the 241Am biosorption by A. niger spore and hyphae obey to Freundlich adsorption equation. The adsorption behavior of A. niger spore and hyphae were basically coincident

  1. Americium and plutonium release behavior from irradiated mixed oxide fuel during heating

    Science.gov (United States)

    Sato, I.; Suto, M.; Miwa, S.; Hirosawa, T.; Koyama, S.

    2013-06-01

    The release behavior of Pu and Am was investigated under the reducing atmosphere expected in sodium cooled fast reactor severe accidents. Irradiated Pu and U mixed oxide fuels were heated at maximum temperatures of 2773 K and 3273 K. EPMA, γ-ray spectrometry and α-ray spectrometry for released and residual materials revealed that Pu and Am can be released more easily than U under the reducing atmosphere. The respective release rate coefficients for Pu and Am were obtained as 3.11 × 10-4 min-1 and 1.60 × 10-4 min-1 at 2773 K under the reducing atmosphere with oxygen partial pressure less than 0.02 Pa. Results of thermochemical calculations indicated that the main released chemical forms would likely be PuO for Pu and Am for Am under quite low oxygen partial pressure.

  2. Fabrication of uranium-americium mixed oxide fuels: thermodynamical modeling and materials properties

    International Nuclear Information System (INIS)

    Fuel irradiation in pressurized water reactors lead to the formation of fission products and minor actinides (Np, Am, Cm) which can be transmuted in fast neutrons reactors. In this context, the aim of this work was to study the fabrication conditions of the U1-yAmyO2+x fuels which exhibit particular thermodynamical properties requiring an accurate monitoring of the oxygen potential during the sintering step. For this reason, a thermodynamical model was developed to assess the optimum sintering conditions for these materials. From these calculations, U1-yAmyO2+x (y=0.10; 0.15; 0.20; 0.30) were sintered in two range of atmosphere. In hyper-stoichiometric conditions at low temperature, porous and multiphasic compounds are obtained whereas in reducing conditions at high temperature materials are dense and monophasic. XAFS analyses were performed in order to obtain additional experimental data for the thermodynamical modeling refinement. These characterizations also showed the reduction of Am(+IV) to Am(+III) and the partial oxidation of U(+IV) to U(+V) due to a charge compensation mechanism occurring during the sintering. Finally, taking into account the high - activity of Am, self-irradiation effects were studied for two types of microstructures and two Am contents (10 and 15%). For each composition, a lattice parameter increase was observed without structural change coupled with a macroscopic swelling of the pellet diameter up to 1.2% for the dense compounds and 0.6% for the tailored porosity materials. (author)

  3. Chemical behaviour of americium in natural aquatic solutions: Hydrolysis, radiolysis and redox reactions

    International Nuclear Information System (INIS)

    Hydrolysis and redox reactions of the Am(III) and Am(V) ions have been investigated in NaClO4 and NaCl solutions as well as in natural saline groundwaters. The hydrolysis constants of Am(OH)n3-n species and the solubility product of Am(OH)3(s) have been determined in 0.1 M NaClO4, 0.1 M NaCl and 0.6 M NaCl solutions. As observed in concentrated NaCl solutions (> 3 M), the α-radiation induces the radiolytic oxidation of the Cl--ion to produce Cl2, HClO, ClO- and other oxidized species, which result in a strongly oxidizing medium. Consequently Am(III) is oxidized to Am(V). Under these conditions the hydrolysis constants of AmO2(OH)n1-n species and the solubility product are also determined. The α-radiation induced radiolysis reactions in NaCl solution and the subsequent oxidation reaction of Am(III) have been systematically investigated by varying pH, NaCl concentration and specific α-activity. Also included in the investigation are a few selected groundwaters of relatively high salinity from the Gorleben aquifer systems. (orig.)

  4. Effect of solvent on in vitro dissolution: Summary of results for uranium, americium, and cobalt aerosols

    International Nuclear Information System (INIS)

    The revised 10 CFR Part 20 has adopted the ICRP Publication 30 method for calculating the committed effective dose equivalent from intakes of radionuclides. This dosimetry scheme requires knowledge or assumptions about the chemical form of the radionuclide, its particle size, and its known or assumed solubility. The solubility is classified as being either D (relatively soluble), W, or Y (relatively insoluble), depending on whether the material dissolves over periods of days, weeks, or years. Although Nuclear Regulatory Commission licensees may wish to take advantage of material-specific knowledge in order to adjust annual limits on intake and derived air concentrations, relatively few radioactive materials to which workers and the general population may be exposed have been adequately characterized either in terms of physicochemical form or solubility. Experimental measurement of solubility using some type of in vitro dissolution measurement system is therefore needed. However, there is currently no clear consensus regarding the appropriate design of in vitro dissolution systems, particularly when considering the range of different radionuclides to be studied, and the complexity of the biological mechanisms involved in the retention and clearance of inhaled deposited radioactive particles. The purpose of this study was to evaluate the effect of the several solvents on the dissolution of four test aerosols (57Co3O4, 241AmO2, ammonium diuranate [ADU], and U3O8) selected to encompass a variety of chemical and biochemical properties in vivo. The results of this study provide some guidance on the usefulness of in vitro dissolution tests for estimating the solubility of unknown radionuclide particles within the context of a simple model such as the class D, W, and Y formulation of ICRP 30

  5. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kazi, Zakir H. [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Cornett, Jack R., E-mail: jack.cornett@uottawa.ca [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Zhao, Xaiolei; Kieser, Liam [Department of Physics, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada)

    2014-06-01

    Highlights: • Am and Pu were adsorbed and separated using a single extraction chromatography DGA column. • Pu was eluted from the column completely using on-column reduction of Pu(IV) to Pu(III). • ²⁴¹Am and 239,240Pu measurements by accelerator mass spectrometry (AMS) agree with the certified values in two SRMs. Abstract: A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8 M HNO₃ with 0.05 M NaNO₂ before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO₃, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl₃ facilitated the complete desorption of Pu. Interferences (e.g. Ca²⁺, Fe³⁺) were washed off from the resin bed with excess HNO₃. Using NdF₃, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7 ± 5.3% and 95.5 ± 4.6% for ²⁴¹Am and ²⁴²Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1 ± 6.0 and 96.8 ± 5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1–100 Bq kg⁻¹. The single column separation of Pu and Am saves reagents, separation time, and cost.

  6. New Synthetic Methods and Structure-Property Relationships in Neptunium, Plutonium, and Americium Borates. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas Edward

    2013-09-14

    The past three years of support by the Heavy Elements Chemistry Program have been highly productive in terms of advanced degrees awarded, currently supported graduate students, peer-reviewed publications, and presentations made at universities, national laboratories, and at international conferences. Ph.D. degrees were granted to Shuao Wang and Juan Diwu, who both went on to post-doctoral appointments at the Glenn T. Seaborg Center at Lawrence Berkeley National Laboratory with Jeff Long and Ken Raymond, respectively. Pius Adelani completed his Ph.D. with me and is now a post-doc with Peter C. Burns. Andrea Alsobrook finished her Ph.D. and is now a post-doc at Savannah River with Dave Hobbs. Anna Nelson completed her Ph.D. and is now a post-doc with Rod Ewing at the University of Michigan. As can be gleaned from this list, students supported by the Heavy Elements Chemistry grant have remained interested in actinide science after leaving my program. This follows in line with previous graduates in this program such as Richard E. Sykora, who did his post-doctoral work at Oak Ridge National Laboratory with R. G. Haire, and Amanda C. Bean, who is a staff scientist at Los Alamos National Laboratory, and Philip M. Almond and Thomas C. Shehee, who are both staff scientists at Savannah River National Laboratory, Gengbang Jin who is a staff scientist at Argonne National Lab, and Travis Bray who has been a post-doc at both LBNL and ANL. Clearly this program is serving as a pipe-line for students to enter into careers in the national laboratories. About half of my students depart the DOE complex for academia or industry. My undergraduate researchers also remain active in actinide chemistry after leaving my group. Dan Wells was a productive undergraduate of mine, and went on to pursue a Ph.D. on uranium and neptunium chalcogenides with Jim Ibers at Northwestern. After earning his Ph.D., he went directly into the nuclear industry.

  7. Separation of Americium from Fission Product Lanthanides Using Cyanex 301 Extraction

    Institute of Scientific and Technical Information of China (English)

    ZHU Yongjun; CHEN Jing

    2001-01-01

    The extraction behavior of bis (2,4,4-trimethylpentyl)dithiophosphinic acid (HBTMPDTP),purified from Cyanex 301,was studied for extracting Am3+ and trivalent lanthanides (Lns).HBTMPDTP shows very high selectivity for Am.Separation factor(SF)of Am and Eu,SF Am/Eu,(trace amount)reaches a high value of 5.9×103 and SF Am/(Pr+Nd) (macro amount)is about 2×103.The mathematical model for the distribution ratios and process parameters calculated for HBTMPDTP extraction was established and the calculated results were verified experimentally.In a five-stage countercurrent process,the extraction rates of Am and Lns were >99.999% and 0.14%,respectively,to fulfill the separation requirements.The efficiency of this process was also verified in a cross-flow extraction experiment using a genuine Am-FPLns fraction.In the presence of TBP,the extraction of Am and Eu is enhanced,but their separation is reduced to some extent.A fairly good separation was achieved in a fractional extraction process using a mixture of HBTMPDTP and TBP in kerosene at low pH.

  8. Plutonium and americium in air on the coasts of the Irish Sea

    International Nuclear Information System (INIS)

    Measurements of artificial radionuclides in air, deposition and seawater were carried out at coastal and inland locations in Cumbria, south-west Scotland, Northern Ireland and North Wales. The measurements were undertaken to determine the distribution of artificial radionuclides in the coastal environment attributable to discharges from Sellafield and to investigate the mechanisms responsible for the increased radionuclide concentration in the marine aerosol and their subsequent transfer to land. A number of different sampling methods were used and the contribution each method could make to the understanding of the marine aerosol was assessed. Measurements of the size distribution of the marine aerosol was also undertaken. The measurements demonstrated that the actinide concentrations measured in the air and deposition at coastal locations could be related to near shore sea water concentrations, but that no direct proportionality existed. It was also determined that a significant proportion of the material transferred from sea to land was associated with larger particulate present in the marine aerosol during conditions of above average onshore winds. (author)

  9. Concordant plutonium-241-americium-241 dating of environmental samples: results from forest fire ash

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Steven J [Los Alamos National Laboratory; Oldham, Warren J [Los Alamos National Laboratory; Murrell, Michael T [Los Alamos National Laboratory; Katzman, Danny [Los Alamos National Laboratory

    2010-12-07

    We have measured the Pu, {sup 237}Np, {sup 241}Am, and {sup 151}Sm isotopic systematics for a set of forest fire ash samples from various locations in the western U.S. including Montana, Wyoming, Idaho, and New Mexico. The goal of this study is to develop a concordant {sup 241}Pu (t{sub 1/2} = 14.4 y)-{sup 241}Am dating method for environmental collections. Environmental samples often contain mixtures of components including global fallout. There are a number of approaches for subtracting the global fallout component for such samples. One approach is to use {sup 242}/{sup 239}Pu as a normalizing isotope ratio in a three-isotope plot, where this ratio for the nonglobal fallout component can be estimated or assumed to be small. This study investigates a new, complementary method of normalization using the long-lived fission product, {sup 151}Sm (t{sub 1/2} = 90 y). We find that forest fire ash concentrates actinides and fission products with {approx}1E10 atoms {sup 239}Pu/g and {approx}1E8 atoms {sup 151}Sm/g, allowing us to measure these nuclides by mass spectrometric (MIC-TIMS) and radiometric (liquid scintillation counting) methods. The forest fire ash samples are characterized by a western U.S. regional isotopic signature representing varying mixtures of global fallout with a local component from atmospheric testing of nuclear weapons at the Nevada Test Site (NTS). Our results also show that {sup 151}Sm is well correlated with the Pu nuclides in the forest fire ash, suggesting that these nuclides have similar geochemical behavior in the environment. Results of this correlation indicate that the {sup 151}Sm/{sup 239}Pu atom ratio for global fallout is {approx}0.164, in agreement with an independent estimate of 0.165 based on {sup 137}Cs fission yields for atmospheric weapons tests at the NTS. {sup 241}Pu-{sup 241}Am dating of the non-global fallout component in the forest fire ash samples yield ages in the late 1950's-early 1960's, consistent with a peak in NTS weapons testing at that time. The age results for this component are in agreement using both {sup 242}Pu and {sup 151}Sm normalizations, although the errors for the {sup 151}Sm correction are currently larger due to the greater uncertainty of their measurements. Additional efforts to develop a concordant {sup 241}Pu-{sup 241}Am dating method for environmental collections are underway with emphasis on soil cores.

  10. Mean squared slowing-down distance and age of americium-beryllium neutrons in perspex

    International Nuclear Information System (INIS)

    THe mean squared slowing-down distance 2>, and the age to thermal capture (Migration Area), M2, are direct measures of the slowing.down, and the spreading out, processes of neutrons in a medium. They also enter directly into reactor calculations. These parameters have been determined experimentally for Am-Be neutrons (mean energy 4.46 MeV), in a block of perspex, using the activities induced in thin indium foils from the 115In(n,γ)116In reactions. (author) 13 refs.; 5 figs.; 2 tabs

  11. Americium-Curium Stabilization - 5'' Cylindrical Induction Melter System Design Basis

    International Nuclear Information System (INIS)

    Approximately 11,000 liters (3,600) gallons of solution containing isotopes of Am and Cm are currently stored in F-Canyon Tank 17.1. These isotopes were recovered during plutonium-242 production campaigns in the mid- and late-1970s. Experimental work for the project began in 1995 by the Savannah River Technology Center (SRTC). Details of the process are given in the various sections of this document

  12. Effect of solvent on in vitro dissolution: Summary of results for uranium, americium, and cobalt aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Guilmette, R.A.; Hoover, M.D.

    1995-12-01

    The revised 10 CFR Part 20 has adopted the ICRP Publication 30 method for calculating the committed effective dose equivalent from intakes of radionuclides. This dosimetry scheme requires knowledge or assumptions about the chemical form of the radionuclide, its particle size, and its known or assumed solubility. The solubility is classified as being either D (relatively soluble), W, or Y (relatively insoluble), depending on whether the material dissolves over periods of days, weeks, or years. Although Nuclear Regulatory Commission licensees may wish to take advantage of material-specific knowledge in order to adjust annual limits on intake and derived air concentrations, relatively few radioactive materials to which workers and the general population may be exposed have been adequately characterized either in terms of physicochemical form or solubility. Experimental measurement of solubility using some type of in vitro dissolution measurement system is therefore needed. However, there is currently no clear consensus regarding the appropriate design of in vitro dissolution systems, particularly when considering the range of different radionuclides to be studied, and the complexity of the biological mechanisms involved in the retention and clearance of inhaled deposited radioactive particles. The purpose of this study was to evaluate the effect of the several solvents on the dissolution of four test aerosols ({sup 57}Co{sub 3}O{sub 4}, {sup 241}AmO{sub 2}, ammonium diuranate [ADU], and U{sub 3}O{sub 8}) selected to encompass a variety of chemical and biochemical properties in vivo. The results of this study provide some guidance on the usefulness of in vitro dissolution tests for estimating the solubility of unknown radionuclide particles within the context of a simple model such as the class D, W, and Y formulation of ICRP 30.

  13. Distribution of plutonium and americium in human and animal tissues after chronic exposures

    International Nuclear Information System (INIS)

    The distribution of plutonium in the tissues of a group of southern Finns was determined. Their Pu intake had been solely from fallout via inhalation. A group of northern Finns was also studied. They obtain most of the Pu from inhalation, but also some from their diet which is rich in reindeer liver. Reindeer obtain large amounts of transuranium elements in their natural winter diet, which mainly consists of lichen. Pu-239, 240 and Am-241 were also analyzed in elk because it is closely related to reindeer but does not feed on lichen. It was found that much of the Am-241 in reindeer tissues is due to ingrowth from Pu-241 in the animal. The aim of this study to establish whether this situation is also true for the human bone. (H.K.)

  14. Separation of americium(III) from lanthanides(III) by nanofiltration-complexation in aqueous medium

    International Nuclear Information System (INIS)

    The separation of Am(III) from a mixture of lanthanides(III) was performed in aqueous medium by nanofiltration combined with a complexation step using a DTPA derivative as selective complexing agent. (author)

  15. Optimization of TRPO Process Parameters for Americium Extraction from High Level Waste

    Institute of Scientific and Technical Information of China (English)

    CHEN Jing; WANG Jianchen; SONG Chongli

    2001-01-01

    The numerical calculations for Am multistage fractional extraction by trialkyl phosphine oxide (TRPO) were verified by a hot test.1750 L/t-U high level waste (HLW) was used as the feed to the TRPO process.The analysis used the simple objective function to minimize the total waste content in the TRPO process streams.Some process parameters were optimized after other parameters were selected.The optimal process parameters for Am extraction by TRPO are:10 stages for extraction and 2 stages for scrubbing;a flow rate ratio of 0.931 for extraction and 4.42 for scrubbing;nitric acid concentration of 1.35 mol/L for the feed and 0.5 mol/L for the scrubbing solution.Finally,the nitric acid and Am concentration profiles in the optimal TRPO extraction process are given.

  16. Functional sorbents for selective capture of plutonium, americium, uranium, and thorium in blood.

    Science.gov (United States)

    Yantasee, Wassana; Sangvanich, Thanapon; Creim, Jeffery A; Pattamakomsan, Kanda; Wiacek, Robert J; Fryxell, Glen E; Addleman, R Shane; Timchalk, Charles

    2010-09-01

    Self-assembled monolayer on mesoporous supports (SAMMS) are hybrid materials created from attachment of organic moieties onto very high surface area mesoporous silica. SAMMS with surface chemistries including three isomers of hydroxypyridinone, diphosphonic acid, acetamide phosphonic acid, glycinyl urea, and diethylenetriamine pentaacetate (DTPA) analog were evaluated for chelation of actinides ((239)Pu, (241)Am, uranium, thorium) from blood. Direct blood decorporation using sorbents does not have the toxicity or renal challenges associated with traditional chelation therapy and may have potential applications for critical exposure cases, reduction of nonspecific dose during actinide radiotherapy, and for sorbent hemoperfusion in renal insufficient patients, whose kidneys clear radionuclides at a very slow rate. Sorption affinity (K(d)), sorption rate, selectivity, and stability of SAMMS were measured in batch contact experiments. An isomer of hydroxypyridinone (3,4-HOPO) on SAMMS demonstrated the highest affinity for all four actinides from blood and plasma and greatly outperformed the DTPA analog on SAMMS and commercial resins. In batch contact, a fifty percent reduction of actinides in blood was achieved within minutes, and there was no evidence of protein fouling or material leaching in blood after 24 h. The engineered form of SAMMS (bead format) was further evaluated in a 100-fold scaled-down hemoperfusion device and showed no blood clotting after 2 h. A 0.2 g quantity of SAMMS could reduce 50 wt.% of 100 ppb uranium in 50 mL of plasma in 18 min and that of 500 dpm mL(-1) in 24 min. 3,4-HOPO-SAMMS has a long shelf-life in air and at room temperature for at least 8 y, indicating its feasibility for stockpiling in preparedness for an emergency. The excellent efficacy and stability of SAMMS materials in complex biological matrices suggest that SAMMS can also be used as orally administered drugs and for wound decontamination. By changing the organic groups of SAMMS, they can be used not only for actinides but also for other radionuclides. By using the mixture of these SAMMS materials, broad spectrum decorporation of radionuclides is very feasible.

  17. Sorption of americium in tuff and pure minerals using synthetic and natural groundwaters

    International Nuclear Information System (INIS)

    The distribution of Am between selected solid and liquid phases has been studied using initial 241Am solutions with a molarity smaller than 1 x 10-11. The synthetic and natural groundwaters used have pH values in the 7--8 range and a total alkalinity of approximately 1 mN which is mainly due to bicarbonate. Mass spectrometric isotope dilution was utilized to determine the amount of Am in the solution phase initially and after equilibrium was attained. Using this sensitive technique, 7 x 108 atoms of 241Am were accurately measured. Our results indicate that the percent of Am lost to the walls of the container in the absence of geologic material varies from 35 to 84. The Am sorption coefficient determined is on the order of 103 ml/g for clinoptilolite, 104 ml/g for tuff consisting mainly of alkali feldspar and cristobalite, and 105 ml/g for romanechite. 12 refs

  18. Americium-241 and plutonium-237 turnover in mussels ( Mytilus galloprovincialis) living in field enclosures

    Science.gov (United States)

    Guary, J. C.; Fowler, S. W.

    1981-02-01

    Loss of 241Am and 237Pu from contaminated mussels ( Mytilus galloprovincialis) living in situ in the Mediterranean Sea is described as the sum of three exponential functions. In the case of 241Am, two short-lived compartments representing a total of 80% of the incorporated radionuclide turned over rapidly with biological half-lives of 2 and 3 weeks. The remaining fraction of 241Am, associated with a long-lived compartment, was lost at an extremely slow rate ( Tb1/2=1·3 years). Plutonium-237 turnover in the two short-lived compartments (containing 70% of the Pu) was more rapid ( Tb1/2=1-2 days and 2 weeks) than that of 241Am; however, there was some indication that subsequent loss rates of the two radionuclides in long-lived compartments may be similar if determined over comparable periods of time. Loss rates of 241Am differed for the various tissues, with the most rapid rates occurring in gill, viscera and shell. Abrupt changes in loss observed in muscle and mantle suggested a translocation of 241Am to muscle and mantle during depuration. Whole shell contained by far the largest fraction (˜90%) of both 241Am and 237Pu taken up; in addition, these radionuclides are not irreversibly bound to mussel shell but readily leach into the water. These observations suggest that mollusc shell may influence the biogeochemistry of transuranic elements in littoral zones.

  19. New Synthetic Methods and Structure-Property Relationships in Neptunium, Plutonium, and Americium Borates. Final report

    International Nuclear Information System (INIS)

    The past three years of support by the Heavy Elements Chemistry Program have been highly productive in terms of advanced degrees awarded, currently supported graduate students, peer-reviewed publications, and presentations made at universities, national laboratories, and at international conferences. Ph.D. degrees were granted to Shuao Wang and Juan Diwu, who both went on to post-doctoral appointments at the Glenn T. Seaborg Center at Lawrence Berkeley National Laboratory with Jeff Long and Ken Raymond, respectively. Pius Adelani completed his Ph.D. with me and is now a post-doc with Peter C. Burns. Andrea Alsobrook finished her Ph.D. and is now a post-doc at Savannah River with Dave Hobbs. Anna Nelson completed her Ph.D. and is now a post-doc with Rod Ewing at the University of Michigan. As can be gleaned from this list, students supported by the Heavy Elements Chemistry grant have remained interested in actinide science after leaving my program. This follows in line with previous graduates in this program such as Richard E. Sykora, who did his post-doctoral work at Oak Ridge National Laboratory with R. G. Haire, and Amanda C. Bean, who is a staff scientist at Los Alamos National Laboratory, and Philip M. Almond and Thomas C. Shehee, who are both staff scientists at Savannah River National Laboratory, Gengbang Jin who is a staff scientist at Argonne National Lab, and Travis Bray who has been a post-doc at both LBNL and ANL. Clearly this program is serving as a pipe-line for students to enter into careers in the national laboratories. About half of my students depart the DOE complex for academia or industry. My undergraduate researchers also remain active in actinide chemistry after leaving my group. Dan Wells was a productive undergraduate of mine, and went on to pursue a Ph.D. on uranium and neptunium chalcogenides with Jim Ibers at Northwestern. After earning his Ph.D., he went directly into the nuclear industry

  20. Study on the uptake of Americium using PC88A - impregnated macroporous polymeric beads

    International Nuclear Information System (INIS)

    The prime objective of radioactive waste treatment in nuclear industry is to minimize the waste volume by efficient process without generating secondary radioactive waste for its final disposal. Among the currently available technologies, for separation and recovery of metal ions, solvent extraction, ion-exchange, membrane based technologies and solid sorbent materials are more popular means. Though, all these technologies play major role in all the bulk separation processes, their marked limitations force the separation scientists to think of advance, more efficient and technically feasible alternatives. The extractant impregnated polymeric beads (EIMPBs), impregnated with metal-specific extractants, exhibit reliable separation performances under column operation, and hence bridge the gap between solvent extraction and ion exchange techniques. In the present work, PC88A impregnated PES beads are prepared and the sorption of Am (III) from aqueous waste solutions is investigated. The synthesized EIMPBs were characterized by FTIR, TGA and SEM techniques. The physiochemical strength of the beads was found to be excellent. The sorption study of Am (III), using these beads, was carried out by batch equilibration method and the effect of various parameters, like pH, equilibration time, Am (III) concentration, etc., on the sorption process, was investigated. The synthesized polymeric beads presented fairly higher sorption capacity for Am (III) at pH 3. The kinetics of extraction is very fast. The saturation of sorption is achieved in about 60 minutes of equilibration. The sorption kinetics data fits well in the pseudo second-order model, indicating that the sorption is dominated by chemisorptions. The sorption of Am (III) is observed to follow Langmuir isotherm and the monolayer capacity was calculated as 2.498 mg/g. The quantitative stripping of the extracted Am (III) can be achieved by using 0.1M oxalic acid. The blank polymeric beads, without PC88A,have shown negligible sorption of Am (III) under the similar experimental conditions

  1. Americium and plutonium release behavior from irradiated mixed oxide fuel during heating

    International Nuclear Information System (INIS)

    The release behavior of Pu and Am was investigated under the reducing atmosphere expected in sodium cooled fast reactor severe accidents. Irradiated Pu and U mixed oxide fuels were heated at maximum temperatures of 2773 K and 3273 K. EPMA, γ-ray spectrometry and α-ray spectrometry for released and residual materials revealed that Pu and Am can be released more easily than U under the reducing atmosphere. The respective release rate coefficients for Pu and Am were obtained as 3.11 × 10−4 min−1 and 1.60 × 10−4 min−1 at 2773 K under the reducing atmosphere with oxygen partial pressure less than 0.02 Pa. Results of thermochemical calculations indicated that the main released chemical forms would likely be PuO for Pu and Am for Am under quite low oxygen partial pressure

  2. Kinetics of the oxidation-reduction reactions of uranium, neptunium, plutonium, and americium in aqueous solutions

    International Nuclear Information System (INIS)

    This is a review with about 250 references. Data for 240 reactions are cataloged and quantitative activation parameters are tabulated for 79 of these. Some empirical correlations are given. Twelve typical reactions are discussed in detail, along with the effects of self-irradiation and ionic strength. (U.S.)

  3. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry.

    Science.gov (United States)

    Kazi, Zakir H; Cornett, Jack R; Zhao, Xaiolei; Kieser, Liam

    2014-06-01

    A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8M HNO3 with 0.05 M NaNO2 before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO3, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl3 facilitated the complete desorption of Pu. Interferences (e.g. Ca(2+), Fe(3+)) were washed off from the resin bed with excess HNO3. Using NdF3, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7±5.3% and 95.5±4.6% for (241)Am and (242)Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1±6.0 and 96.8±5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1-100 Bq kg(-1). The single column separation of Pu and Am saves reagents, separation time, and cost. PMID:24856406

  4. Rapid selective separation of americium/curium from simulated nuclear forensic matrices using triazine ligands

    International Nuclear Information System (INIS)

    In analysis of complex nuclear forensic samples containing lanthanides, actinides and matrix elements, rapid selective extraction of Am/Cm for quantification is challenging, in particular due the difficult separation of Am/Cm from lanthanides. Here we present a separation process for Am/Cm(III) which is achieved using a combination of AG1-X8 chromatography followed by Am/Cm extraction with a triazine ligand. The ligands tested in our process were CyMe4-BTPhen, CyMe4-BTBP, CA-BTP and CA-BTPhen. Our process allows for purification and quantification of Am and Cm (recoveries 80% - 100%) and other major actinides in < 2 d without the use of multiple columns or thiocyanate. The process is unaffected by high level Ca(II)/Fe(III)/Al(III) (10 mg mL-1) and thus requires little pre-treatment of samples.

  5. Rapid selective separation of americium/curium from simulated nuclear forensic matrices using triazine ligands

    Energy Technology Data Exchange (ETDEWEB)

    Higginson, Matthew A.; Livens, Francis R.; Heath, Sarah L. [Manchester Univ. (United Kingdom). Centre for Radiochemistry Research; Thompson, Paul; Marsden, Olivia J. [AWE, Aldermaston, Reading (United Kingdom); Harwood, Laurence M.; Hudson, Michael J. [Reading Univ. (United Kingdom). Dept. of Chemistry; Lewis, Frank W. [Reading Univ. (United Kingdom). Dept. of Chemistry; Northumbria Univ., Newcastle upon Tyne (United Kingdom). Dept. of Chemical and Forensic Sciences

    2015-07-01

    In analysis of complex nuclear forensic samples containing lanthanides, actinides and matrix elements, rapid selective extraction of Am/Cm for quantification is challenging, in particular due the difficult separation of Am/Cm from lanthanides. Here we present a separation process for Am/Cm(III) which is achieved using a combination of AG1-X8 chromatography followed by Am/Cm extraction with a triazine ligand. The ligands tested in our process were CyMe{sub 4}-BTPhen, CyMe{sub 4}-BTBP, CA-BTP and CA-BTPhen. Our process allows for purification and quantification of Am and Cm (recoveries 80% - 100%) and other major actinides in < 2 d without the use of multiple columns or thiocyanate. The process is unaffected by high level Ca(II)/Fe(III)/Al(III) (10 mg mL{sup -1}) and thus requires little pre-treatment of samples.

  6. Subsurface Behavior of Plutonium and Americium at Non-Hanford Sites and Relevance to Hanford

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Riley, Robert G.

    2008-02-01

    Seven sites where Pu release to the environment has raised significant environmental concerns have been reviewed. A summary of the most significant hydrologic and geochemical features, contaminant release events and transport processes relevant to Pu migration at the seven sites is presented.

  7. Transuranium analysis methodologies for biological and environmental samples

    International Nuclear Information System (INIS)

    Analytical procedures for the most abundant transuranium nuclides in the environment (i.e., plutonium and, to a lesser extent, americium) are available. There is a lack of procedures for doing sequential analysis for Np, Pu, Am, and Cm in environmental samples, primarily because of current emphasis on Pu and Am. Reprocessing requirements and waste disposal connected with the fuel cycle indicate that neptunium and curium must be considered in environmental radioactive assessments. Therefore it was necessary to develop procedures that determine all four of these radionuclides in the environment. The state of the art of transuranium analysis methodology as applied to environmental samples is discussed relative to different sample sources, such as soil, vegetation, air, water, and animals. Isotope-dilution analysis with 243Am (239Np) and 236Pu or 242Pu radionuclide tracers is used. Americium and curium are analyzed as a group, with 243Am as the tracer. Sequential extraction procedures employing bis(2-ethyl-hexyl)orthophosphoric acid (HDEHP) were found to result in lower yields and higher Am--Cm fractionation than ion-exchange methods

  8. 25 CFR 243.4 - Who can own or possess Alaskan reindeer?

    Science.gov (United States)

    2010-04-01

    ... reindeer must, by the last day of September each year: (1) Provide us a copy of the contract with the Native reindeer owner; and (2) Provide us a written report of all Alaskan reindeer kept, born, died or...). (3) The permit-holder must report to us in writing by the last day of September each year on...

  9. 40 CFR 761.243 - Standard wipe sample method and size.

    Science.gov (United States)

    2010-07-01

    ... surface areas, when small diameter pipe, a small valve, or a small regulator. When smaller surfaces are sampled, convert the... pipe segment or pipeline section using a standard wipe test as defined in § 761.123. Detailed...

  10. Non-abelian representations of the slim dense near hexagons on 81 and 243 points

    CERN Document Server

    De Bruyn, B; Sastry, N S N

    2010-01-01

    We prove that the near hexagon $Q(5,2) \\times \\mathbb{L}_3$ has a non-abelian representation in the extra-special 2-group $2^{1+12}_+$ and that the near hexagon $Q(5,2) \\otimes Q(5,2)$ has a non-abelian representation in the extra-special 2-group $2^{1+18}_-$. The description of the non-abelian representation of $Q(5,2) \\otimes Q(5,2)$ makes use of a new combinatorial construction of this near hexagon.

  11. 19 CFR 24.3a - CBP bills; interest assessment; delinquency; notice to principal and surety.

    Science.gov (United States)

    2010-04-01

    ..., DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CUSTOMS FINANCIAL AND ACCOUNTING PROCEDURE § 24... obtained from the IRS or the CBP Office of Finance, Indianapolis, Indiana. For the convenience of...

  12. 48 CFR 52.243-3 - Changes-Time-and-Materials or Labor-Hours.

    Science.gov (United States)

    2010-10-01

    ... performance of the services. (4) Drawings, designs, or specifications when the supplies to be furnished are to..., or the time required for performance of any part of the work under this contract, whether or not... REGULATION (CONTINUED) CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions...

  13. Radiocaesium, plutonium and americium partitioning and solid speciation in sized, inter-tidal sediments from Strangford Lough

    International Nuclear Information System (INIS)

    Fine-grained surface (0-2 cm) sediment was collected at an inter-tidal site (Mahee Island) in Strangford Lough, on the NE coast of Ireland in September 1997. The sediment was wet-sieved into standard sized fractions using Endecott test sieves and the fractions assayed for 137Cs, 239,240Pu and 241Am content. Sub-samples of each fraction were measured with a Malvern 2600 laser diffraction analyser, which confirmed that >90% of the particles in each fraction was in the defined size range

  14. Speciation of plutonium and americium in the soils affected by Kraton-3 accidental underground nuclear explosion in Yakutia (Russia)

    International Nuclear Information System (INIS)

    In calcareous soils from Yakutia only 0.1 % or less 239Pu and 241Am exist in water-soluble form, i.e., the mobility of these radionuclides is relatively low. In the top humus-containing layer (0-4 cm) 239Pu and 241Am are distributed uniformly between organic and inorganic soil components. In the bottom soil layer (20-30 cm) the radionuclides are present mainly in inorganic soil components. The estimation of the radionuclide mobility demonstrates that 241Am is potentially a more mobile element than 239Pu. In the considered calcareous soils collected from the top layer 239Pu and 241Am exist both in humic and fulvic acids (FA). 241Am is much stronger bound to the group of mobile FA than 239Pu. In the bottom soil layer 239Pu and 241Am have been found mainly in FA. (author)

  15. LITERATURE REVIEW ON THE SORPTION OF PLUTONIUM, URANIUM, NEPTUNIUM, AMERICIUM AND TECHNETIUM TO CORROSION PRODUCTS ON WASTE TANK LINERS

    Energy Technology Data Exchange (ETDEWEB)

    Li, D.; Kaplan, D.

    2012-02-29

    The Savannah River Site (SRS) has conducted performance assessment (PA) calculations to determine the risk associated with closing liquid waste tanks. The PA estimates the risk associated with a number of scenarios, making various assumptions. Throughout all of these scenarios, it is assumed that the carbon-steel tank liners holding the liquid waste do not sorb the radionuclides. Tank liners have been shown to form corrosion products, such as Fe-oxyhydroxides (Wiersma and Subramanian 2002). Many corrosion products, including Fe-oxyhydroxides, at the high pH values of tank effluent, take on a very strong negative charge. Given that many radionuclides may have net positive charges, either as free ions or complexed species, it is expected that many radionuclides will sorb to corrosion products associated with tank liners. The objective of this report was to conduct a literature review to investigate whether Pu, U, Np, Am and Tc would sorb to corrosion products on tank liners after they were filled with reducing grout (cementitious material containing slag to promote reducing conditions). The approach was to evaluate radionuclides sorption literature with iron oxyhydroxide phases, such as hematite ({alpha}-Fe{sub 2}O{sub 3}), magnetite (Fe{sub 3}O{sub 4}), goethite ({alpha}-FeOOH) and ferrihydrite (Fe{sub 2}O{sub 3} {center_dot} 0.5H{sub 2}O). The primary interest was the sorption behavior under tank closure conditions where the tanks will be filled with reducing cementitious materials. Because there were no laboratory studies conducted using site specific experimental conditions, (e.g., high pH and HLW tank aqueous and solid phase chemical conditions), it was necessary to extend the literature review to lower pH studies and noncementitious conditions. Consequently, this report relied on existing lower pH trends, existing geochemical modeling, and experimental spectroscopic evidence conducted at lower pH levels. The scope did not include evaluating the appropriateness of K{sub d} values for the Fe-oxyhydroxides, but instead to evaluate whether it is a conservative assumption to exclude this sorption process of radionuclides onto tank liner corrosion products in the PA model. This may identify another source for PA conservatism since the modeling did not consider any sorption by the tank liner.

  16. A Review of Subsurface Behavior of Plutonium and Americium at the 200-PW-1/3/6 Operable Units

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Riley, Robert G.

    2008-01-31

    This report begins with a brief summary of the history and current status of 200-PW-1/3/6 OUs in section 2.0. This is followed by a description of our concentual model of Pu/Am migration at the 200-PW-1/3/6 OUs, during both past artificial recharge conditions and current natural recharge condictions (section 3.0). Section 4.0 discusses data gaps and information needs. The final section (section 5.0) provides recommendations for futher work to address the data gaps and information needs identified in section 4.0.

  17. Study of plutonium and americium contamination in agricultural area, radiological impact caused by consumption of vegetables of this area

    International Nuclear Information System (INIS)

    The transuranide concentration has been studied for 30 years in vegetable production, crops in wide extensions and in private-owned farms, all of them situated within the Pu-contaminated area of Palomares due to an air accident in 1966. Based on these studies, a preliminary estimation of the radiological risk caused by the consumption of these products by the inhabitants was possible. The results show that most of the fruits present a surface contamination, which disappears or is significantly reduced when they are washed. The contamination present in edible parts of the vegetables, as well as the contamination of other products included in the diet, has facilitated the estimation of the effective dose for ingestion and the committed effective dose for 50 years for the inhabitants. The main conclusions are: those plants, whose cultivation period is less than a year, present a low level of contamination; the green parts of the plants have a higher contamination than the fruits; the Pu soil to plant transfer factor is very low. In general, those plants that have remained in the contaminated land for several years present a high contamination level; the ingestion of products from Palomares does not represent an important risk for the population, even in the case that the products were totally consumed by a critical group.( author)

  18. The determination of alpha-emitting nuclides of plutonium, americium and curium in environmental materials: Pt. 1

    International Nuclear Information System (INIS)

    Within the Aquatic Environment Protection Division of the Directorate of Fisheries Research (DFR), the Radioanalytical Group routinely analyses a wide range of environmental materials for a substantial number of radionuclides. A wide variety of radiochemical procedures have been developed at different laboratories but there are no 'standard' methods because the methods are continually developing. Nevertheless, it is useful, as in this present series, periodically to draw together the methods which are in routine use at a laboratory and to discuss their development and application. (author)

  19. Studies on the binding and transport processes of americium-241 hydroxide polymers in rat lung and bovine alveolar macrophages

    International Nuclear Information System (INIS)

    The binding of Am-241 hydroxide polymers to the cell components of rat lung was investigated using differential centrifugation, density gradient centrifugation with different media, gel chromatography, free flow electrophoresis and electron microscopic autoradiography with Pu-241. The bovine alveolar macrophage cultures were introduced as an in vitro test system for Am-241 uptake. Form the biochemical and electron microscopic studies it can be concluded that Am-241 is taken up by pulmonary macrophages, where its first storage site is probably the lysosome. Then the Am-241 seems to be solubilized in the lysosomes and to be bound to the cytosolic ferritin of macrophages. Am-241 might be released from the cells and crosses the alveolar membranes as bound to transferrin or as low molecular weight form. (orig.)

  20. Oxidation-reduction properties of americium, curium, berkelium, californium, einsteinium and fermium, and thermodynamic consequences for the 5f series

    International Nuclear Information System (INIS)

    The amalgamation of 5f elements from Am to Fm has been studied by using 241Am, 244Cm, 249Bk, 249Cf, 252Cf, 253Es, 254Es, 252Fm and 255Fm with two electrochemical methods, radiocoulometry and radiopolarography, perfectly adapted to investigate extremely diluted solutions when the concentration of electroactive species is as low as 10-16M. The theory of radiocoulometry has been developed in the general cases of reversible and irreversible electrode process. It has been used to interpret the experimental data on the kinetic curves of amalgamation, and to estimate the standard rate constant of the electrode process in complexing medium (citric). On the other hand the radiopolarographic method has been applied to study the mechanism of reduction at the dropping mercury electrode of cations M3+ in aqueous medium to the metal M with formation of amalgam. The results are exploited into two directions: 1- Acquisition of some data concerning the oxidation-reduction properties of elements from Am to Fm. Therefore the standard electrode E0 [M(III-0)] potentials for Bk, Cf and Es, and the standard electrode E0 [M(II-0)] potential for Fm are estimated and the relative stability of each oxidation state (from II to VII) of 5f elements is discussed; 2- Acquisition of unknown thermodynamic data on transcalifornium elements. Correlations between 4f and 5f elements are precised and some divergences appear for the second half of 4f and 5f series (i.e. for 65<=Z<=71 and 97<=Z<=103)

  1. Effects of americium-241 and humic substances on Photobacterium phosphoreum: Bioluminescence and diffuse reflectance FTIR spectroscopic studies

    Science.gov (United States)

    Kamnev, Alexander A.; Tugarova, Anna V.; Selivanova, Maria A.; Tarantilis, Petros A.; Polissiou, Moschos G.; Kudryasheva, Nadezhda S.

    The integral bioluminescence (BL) intensity of live Photobacterium phosphoreum cells (strain 1883 IBSO), sampled at the stationary growth stage (20 h), was monitored for further 300 h in the absence (control) and presence of 241Am (an α-emitting radionuclide of a high specific activity) in the growth medium. The activity concentration of 241Am was 2 kBq l-1; [241Am] = 6.5 × 10-11 M. Parallel experiments were also performed with water-soluble humic substances (HS, 2.5 mg l-1; containing over 70% potassium humate) added to the culture medium as a possible detoxifying agent. The BL spectra of all the bacterial samples were very similar (λmax = 481 ± 3 nm; FWHM = 83 ± 3 nm) showing that 241Am (also with HS) influenced the bacterial BL system at stages prior to the formation of electronically excited states. The HS added per se virtually did not influence the integral BL intensity. In the presence of 241Am, BL was initially activated but inhibited after 180 h, while the system 241Am + HS showed an effective activation of BL up to 300 h which slowly decreased with time. Diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy, applied to dry cell biomass sampled at the stationary growth phase, was used to control possible metabolic responses of the bacteria to the α-radioactivity stress (observed earlier for other bacteria under other stresses). The DRIFT spectra were all very similar showing a low content of intracellular poly-3-hydroxybutyrate (at the level of a few percent of dry biomass) and no or negligible spectroscopic changes in the presence of 241Am and/or HS. This assumes the α-radioactivity effect to be transmitted by live cells mainly to the bacterial BL enzyme system, with negligible structural or compositional changes in cellular macrocomponents at the stationary growth phase.

  2. Assessment of americium and curium transmutation in magnesia based targets in different spectral zones of an experimental accelerator driven system

    Science.gov (United States)

    Haeck, W.; Malambu, E.; Sobolev, V. P.; Aït Abderrahim, H.

    2006-06-01

    The potential to incinerate minor actinides (MA) in a sub-critical accelerator-driven system (ADS) is a subject of study in several countries where nuclear power plants are present. The performance of the MYRRHA experimental ADS, as to the transmutation of Am and Cm in the inert matrix fuel (IMF) samples consisting of 40 vol.% (Cm0.1Am0.5Pu0.4)O1.88 fuel and 60 vol.% MgO matrix with a density of 6.077 g cm-3 in three various spectrum regions, were analysed at the belgian nuclear research centre SCK · CEN. The irradiation period of 810 effective full power days (EFPD) followed by a storage period of 2 years was considered. The ALEPH code system currently under development at SCK · CEN was used to carry out this study. The total amount of MA is shown to decrease in all three considered cases. For Am, the decrease is the largest in the reflector (89% decrease) but at the cost of a net Cm production (92% increase). In the two other positions (inside the core region), 20-30% of Am has disappeared but with a lower production of Cm (between 7% and 11%). In the reflector, a significant build-up of long-lived 245Cm, 246Cm, 247Cm and 248Cm was also observed while the production of these isotopes is 10-1000 times smaller in the core. The reduction of the Pu content is also the highest in the reflector position (41%). In the other positions the incinerated amount of Pu is much smaller: 1-5%.

  3. UNDERSTANDING VARIATION IN PARTITION COEFFICIENT KD, VALUES, VOLUME III: AMERICIUM, ARSENIC, CURIUM, IODINE, NEPTUNIUM, RADIUM, AND TECHNETIUM

    Science.gov (United States)

    This report describes the conceptualization, measurement, and use of the partition (or distribution) coefficient, Kd, parameter, and the geochemical aqueous solution and sorbent properties that are most important in controlling adsorption/retardation behavior of selected contamin...

  4. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4. (author)

  5. Salicylic acid failed to increase the efficacy of Ca-DTPA in the decorporation of plutonium and americium

    International Nuclear Information System (INIS)

    Male and female C57BL/Do mice were each given a single i.p. injection of 237+239Pu + 241Am as the citrate complex at 45 days of age. Twice weekly i.p. injecctions of either 500 μmol/kg Ca-DTPA or 500 μmol/kg Ca-DTPA, mixed just before injection with 2000 μmol/kg salicylic acid (SA), were begun 3 days after nuclide administration and continued for 5 weeks. Control mice were injected each time with isotonic saline. Nuclide retention was determined by in vivo counting using NaI(T1) spectrometry. At the end of treatment, total-body retention of Pu or Am in the mice given Ca-DTPA was significantly lower (P < 0.001) than in the control animals. Mice treated with Ca-DTPA + SA were statistically indistinguishable from mice treated with Ca-DTPA

  6. Salicylic acid failed to increase the efficacy of Ca-DTPA in the decorporation of plutonium and americium

    International Nuclear Information System (INIS)

    Male and female C57BL/Do mice were each given a single ip injection of /sup 237 + 239/Pu + 241Am as the citrate complex at 45 days of age. Twice-weekly ip injections of either 500 μmole/kg Ca-DTPA or 500 μmole/kg Ca-DTPA mixed just before injection with 2000 μmole/kg salicylic acid (SA) were begun 3 days after nuclide administration and continued for 5 weeks. Control mice were injected each time with isotonic saline. Nuclide retention was determined by in vivo γ-ray counting using a NaI(Tl) crystal spectrometer. At the end of treatment, total-body retention of Pu or Am in the mice given Ca-DTPA was significantly lower (P < 0.001) than that in the control animals. Mice treated with Ca-DTPA plus SA were statistically indistinguishable from mice treated with Ca-DTPA alone

  7. Handling of a glove box accident. Surgical treatment of a wound contaminated by a mixture of plutonium-239 and americium

    International Nuclear Information System (INIS)

    An employee of the Valduc Centre (France) suffered an injury to his right thumb when working in a glove-box on a pipeline which had contained a solution of 239Pu and Am. The lesion was slight but attempts at decontamination were fruitless. The contamination was deep-seated (activity of not less than 18nCi). DTPA was injected intravenously, and it was decided to excise the lesion surgically. Thanks to the quality of its physical facilities and the professional quality of its radiation medicine and surgery team, the Valduc Centre was able to carry out the operation successfully. The result was excellent, and the contamination was eliminated to the satisfaction of both the patient and the physician. (author)

  8. Effects of Hanford high-level waste components on the solubility and sorption of cobalt, strontium, neptunium, plutonium, and americium

    International Nuclear Information System (INIS)

    High-level radioactive defense waste solutions, originating from plutonium recovery and waste processing operations at the U.S. Department of Energy's Hanford Site, currently are stored in mild steel-lined concrete tanks located in thick sedimentary beds of sand and gravel. Statistically designed experiments were used to identify the effects of 12 major chemical components of Hanford waste solution on radionuclide solubility and sorption. The chemical components with the most effect on radioelement solubility and sorption were NaOH, NaAl0/sub 2/, EDTA, and HEDTA. The EDTA and HEDTA increased Co, Sr, and Am solubility and decreased sorption for almost all radioelements studied. Sodium hydroxide and NaAlO/sub 2/ increased Pu solubility and decreased Np and Pu sorption. Sodium nitride decreased Np solubility, while Na/sub 2/CO/sub 3/ and HEDTA increased it. These observations give evidence for the formation of radioelement complexes which are soluble and are not strongly sorbed by the sediments near the waste tanks

  9. Nuclear chemistry project. Progress report, April 1, 1981-March 31, 1982

    International Nuclear Information System (INIS)

    Investigation of the mu-mesic x-ray spectrum of the Americium isotopes 241 and 243 is discussed. Difficulties in appropriately shielding the low-energy target x-rays while allowing the higher energy mesic x-rays to pass are discussed. The experiment was run at the Stopping Muon Channel of the LAMPF accelerator during July 1981. Appendices to the document include the research proposed, an article on the synthesis of volatile lanthanides (Ln, Ho, and Tb 2,2,6,6-tetramethyl-3,5-heptanedione, and Ho 1,1,1,2,2,3,3-heptafluoro-7,7-dimethyl-4,6-heptanedione chelates), and an article on the muonic Lyman x-ray intensities in pure elements

  10. ASSESSMENT OF THE RADIONUCLIDE COMPOSITION OF "HOT PARTICLES" SAMPLED IN THE CHERNOBYL NUCLEAR POWER PLANT FOURTH REACTOR UNIT

    Energy Technology Data Exchange (ETDEWEB)

    Farfan, E.; Jannik, T.; Marra, J.

    2011-10-01

    Fuel-containing materials sampled from within the Chernobyl Nuclear Power Plant (ChNPP) 4th Reactor Unit Confinement Shelter were spectroscopically studied for gamma and alpha content. Isotopic ratios for cesium, europium, plutonium, americium, and curium were identified and the fuel burnup in these samples was determined. A systematic deviation in the burnup values based on the cesium isotopes, in comparison with other radionuclides, was observed. The conducted studies were the first ever performed to demonstrate the presence of significant quantities of {sup 242}Cm and {sup 243}Cm. It was determined that there was a systematic underestimation of activities of transuranic radionuclides in fuel samples from inside of the ChNPP Confinement Shelter, starting from {sup 241}Am (and going higher), in comparison with the theoretical calculations.

  11. Separation and determination of 241Am in urine samples from radiation workers using PC88-A and alpha spectrometry

    International Nuclear Information System (INIS)

    Bioassay technique is used for the estimation of actinides present in the body based on their excretion rate through body fluids. For occupational radiation workers urine assay is the preferred method for monitoring of chronic internal exposure. Determination of low concentrations of actinides such as plutonium, americium and uranium at low level of mBq in urine by alpha spectrometry requires pre-concentration of large volumes of urine. This article deals with standardization of analytical method for the determination of 241Am isotope in urine samples using Extraction Chromatography (EC) and 243Am tracer for radiochemical recovery. The method involves oxidation of urine followed by co-precipitation of americium along with calcium phosphate. This precipitate after treatment is further subjected to calcium oxalate co-precipitation. Separation of Am was carried out by EC column prepared by PC88-A (2-ethyl hexyl phosphonic acid 2-ethyl hexyl monoester) adsorbed on microporous resin XAD-7 (PC88A-XAD7). Am-fraction was electro-deposited and activity estimated using tracer recovery by alpha spectrometer. Ten routine urine samples of radiation workers were analyzed and consistent radiochemical recovery was obtained in the range 44-60% with a mean and standard deviation of 51 and 4.7% respectively. (author)

  12. Investigation of neutronic behavior in a CANDU reactor with different (Am, Th, 235U)O2 fuel matrixes

    International Nuclear Information System (INIS)

    Recently thorium-based fuel matrixes are taken into consideration for nuclear waste incineration because of thorium proliferation resistance feature moreover its breeding or convertor ability in both thermal and fast reactors. In this work, neutronic influences of adding Am to (Th-235U)O2 on effective delayed neutron fraction, reactivity coefficients and burn up of a fed CANDU core has been studied using MCNPX 2.6.0 computational code. Different atom fractions of Am have been introduced in the fuel matrix to evaluate its effects on neutronic parameters of the modeled core. The computational data show that adding 2% atom fraction of Am to thorium-based fuel matrix won't noticeably change reactivity coefficients in comparison with the fuel matrix containing 1% atom fraction of Am. The use of 2% atom fraction of Am resulted in a higher delayed neutron fraction. According to the obtained data, 32.85 GWd burn up of the higher Americium-containing fuel matrix resulted in 55.2%, 26.5%, 41.9% and 2.14% depletion of 241Am, 243Am, 235U and 232Th respectively. 132.8 kg of 233U fissile element is produced after the burn up time and the nuclear core multiplication factor increases in rate of 2390 pcm. The less americium-containing fuel matrix resulted in higher depletion of 241/243Am, 235U and 232Th while the nuclear core effective multiplication factor increases in rate of 5630 pcm after the burn up time with 9.8 kg additional 233U production.

  13. Geologic interpretation of seismic data relocation Route 2, Littleton Road grade separation stations 243-252 in Harvard, Mass.

    Science.gov (United States)

    May, James E.; Linehan, Rev. Daniel

    1950-01-01

    During parts of June and July 1949 nine seismic traverses were made at this site. Upon preliminary office development, the velocity data for some of these traverses were though to be inadequate and it was recommended that these lines be re-surveyed. Later surveys (March 1950), however, of nearby sites indicated that the original data were reliable and that a re-survey was unnecessary. The work was done as part of a cooperative program of the Massachusetts Department of Public Works and the United States Geological Survey.

  14. Treatment of cryptorchidism with human chorionic gonadotropin or gonadotropin releasing hormone. A double-blind controlled study of 243 boys

    DEFF Research Database (Denmark)

    Christiansen, P; Müller, J; Buhl, S;

    1988-01-01

    We have conducted a modified double-blind study on the effect of human chorionic gonadotropin (hCG), gonadotropin releasing hormone (GnRH) and placebo on bilateral and unilateral maldescended testes. One hundred and fifty-five boys with bilateral and 88 boys with unilateral cryptorchidism fulfilled...... = 0.0009). Both testes descended in 25% of the boys following treatment with hCG, and improvement in the position of the testes was obtained in a further 25% of the cases. hCG administration resulted in complete testicular descent in 14% of boys with unilateral cryptorchidism compared with 3 and 0...... the use of hCG in the treatment of maldescended testes, whereas the study did not support a general use of GnRH administered intranasally....

  15. Intra-operative frozen section diagnosis of breast lesions: a retrospective analysis of 13 243 Chinese patients

    Institute of Scientific and Technical Information of China (English)

    NIU Yun; FU Xi-lin; YU Yong; Peizhong Peter Wang; CAO Xu-chen

    2007-01-01

    Background Although cytological methods for breast oncology have been used in recent decades, intra-operative frozen section has been playing a vital role in making therapeutic decisions. We analyzed a large series of frozen section diagnoses for Chinese cases of breast lesion within the last 15 years. The experience was expected to increase the diagnostic accuracy of cases with breast lesions.Methods The data from consecutive 13243 cases of breast lesions diagnosed with intra-operative frozen sections between 1988 to 2002 were compared with paraffin sections in a case by case manner. The causes of false negative and positive diagnoses as well as delayed diagnoses were analyzed.Results One hundred and seventeen cases (0.9%) were falsely diagnosed, with one false positive case and 116 false negative cases. The diagnosis of 47 cases (0.4%) was delayed. The proportion of several lesions had the features of the patients'ages. Six types (false invasion, peri-papilloma, adenoma of nipple duct, florid adenosis, sclerosing adenosis,and granulose cell tumor) of lesions may lead to false positive, and four types (morphological changes responding chemotherapy, well differentiated papillary carcinoma, invasive lobular carcinoma, and tubular carcinoma) to a false negative. Gross and microscopic findings may be inconsistent in two types of lesions (radial scar and florid adenosis)microscopic and clinical findings in three types (ganulomatous mastitis mammary, duct ectasia, and fat necrosis), and three types (abundant fat or sclerous tissues; borderline lesions and changes of post-chemotherapy) were likely wrongly classified.Conclusions Intra-operative frozen section can accurately identify breast lesions in many instances, leading to fewer errors on account of more diagnostic experience and understanding of diagnostic limitations.

  16. Protective efficacy of P7C3-S243 in the 6-hydroxydopamine model of Parkinson’s disease

    OpenAIRE

    De Jesús-Cortés, Héctor; Miller, Adam D.; Jeremiah K Britt; DeMarco, Anthony J; De Jesús-Cortés, Mayralis; Stuebing, Emily; Naidoo, Jacinth; Vázquez-Rosa, Edwin; Morlock, Lorraine; Williams, Noelle S.; Ready, Joseph M.; Narayanan, Nandakumar S.; Pieper, Andrew A.

    2015-01-01

    BACKGROUND There are currently no therapeutic options for patients with Parkinson’s disease that prevent or slow the death of dopaminergic neurons. We have recently identified the novel P7C3 class of neuroprotective molecules that blocks neuron cell death. AIMS The aim of this study was to determine whether treatment with highly active members of the P7C3 series blocks dopaminergic neuron cell death and associated behavioral and neurochemical deficits in the rat 6-hydroxydopamine (6-OHDA) mod...

  17. Angelman syndrome associated with an inversion of chromosome 15q11.2q24.3

    Energy Technology Data Exchange (ETDEWEB)

    Greger, V.; Knoll, J.H.M.; Wagstaff, J.; Lalande, M. [and others

    1997-03-01

    Angelman syndrome (AS) most frequently results from large ({ge}5 Mb) de novo deletions of chromosome 15q11-q13. The deletions are exclusively of maternal origin, and a few cases of paternal uniparental disomy of chromosome 15 have been reported. The latter finding indicates that AS is caused by the absence of a maternal contribution to the imprinted 15q11-q13 region. Failure to inherit a paternal 15q11-q13 contribution results in the clinically distinct disorder of Prader-Willi syndrome. Cases of AS resulting from translocations or pericentric inversions have been observed to be associated with deletions, and there have been no confirmed reports of balanced rearrangements in AS. We report the first such case involving a paracentric inversion with a breakpoint located {approximately}25 kb proximal to the reference marker D15S10. This inversion has been inherited from a phenotypically normal mother. No deletion is evident by molecular analysis in this case, by use of cloned fragments mapped to within {approximately}1 kb of the inversion breakpoint. Several hypotheses are discussed to explain the relationship between the inversion and the AS phenotype. 47 refs., 3 figs.

  18. 75 FR 60655 - Airworthiness Directives; Airbus Model A330-201, -202, -203, -223, and -243 Airplanes; Airbus...

    Science.gov (United States)

    2010-10-01

    ... Inspection Requirements'' (66 FR 23086, May 7, 2001). In addition to new airworthiness standards for... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic... power unit (APU) bleed leak detection system could result in overheat of the fuel tank located in...

  19. 76 FR 432 - Airworthiness Directives; Airbus Model A330-201, -202, -203, -223, and -243 Airplanes; Airbus...

    Science.gov (United States)

    2011-01-05

    ... October 1, 2010 (75 FR 60655). That NPRM proposed to correct an unsafe condition for the specified...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have... definition review against explosion hazards. * * * * * Failure of the auxiliary power unit (APU) bleed...

  20. Beliefs and opinions in caregiving of elderly with AIDS: an exploratory study - doi:10.5020/18061230.2010.p243

    Directory of Open Access Journals (Sweden)

    Raquel Farias Diniz

    2012-01-01

    Full Text Available Objective: To explore what informal caregivers of elderly with AIDS think about the disease itself, the infection in elderly people, and about being a caregiver. Methods: A qualitative study in which the thematic content analysis of interviews resulted in the emergence of three categories: “conceptions about AIDS”, “AIDS in old age” and “being a caregiver”. Results: We observed the emergence of issues related to the three aspects, which must be considered in a broader analysis within the patient-caregiver relationship. Such questions involve information about the disease, living with the patient, gender differences and the specificities resulting from the infection at this stage of life. Conclusion: From this study, it is expected that greater attention be given to relationships of care provided by informal network of support to elderly people living with AIDS, in order to foster researches on social, affective, motivational and behavior aspects of caregivers.

  1. Association of bta-miR-24-3p with serum antibody response to Mycoplasma spp. in beef cattle

    Science.gov (United States)

    The objective of this study was to identify microRNAs associated with a serum antibody response to Mycoplasma spp. in beef cattle. Serum from sixteen beef calves was collected at three points: summer of 2013, after calves were born; fall of the same year at weaning; and spring, 2014. All sera collec...

  2. Luminescence study on solvation of americium(III), curium(III) and several lanthanide(III) ions in nonaqueous and binary mixed solvents

    International Nuclear Information System (INIS)

    The luminescence lifetimes of An(III) and Ln(III) ions [An=Am and Cm; Ln=Nd, Sm, Eu, Tb and Dy] were measured in dimethyl sulfoxide(DMSO), N,N-dimethylformamide(DMF), methanol(MeOH), water and their perdeuterated solvents. Nonradiative decay rates of the ions were in the order of H2O > MeOH > DMF > DMSO, indicating that O-H vibration is more effective quencher than C-H, C=O, and S=O vibrations in the solvent molecules. Maximal lifetime ratios τD/τH were observed for Eu(III) in H2O, for Sm(III) in MeOH and DMF, and for Sm(III) and Dy(III) in DMSO. The solvent composition in the first coordination sphere of Cm(III) and Ln(III) in binary mixed solvents was also studied by measuring the luminescence lifetime. Cm(III) and Ln(III) were preferentially solvated by DMSO in DMSO-H2O, by DMF in DMF-H2O, and by H2O in MeOH-H2O over the whole range of the solvent composition. The order of the preferential solvation, i.e., DMSO > DMF > H2O > MeOH, correlates with the relative basicity of these solvents. The Gibbs free energy of transfer of ions from water to nonaqueous solvents was further estimated from the degree of the preferential solvation. (orig.)

  3. Studies on the feasibility of using completely incinerable reagents for the single-cycle separation of americium(III) from simulated high-level liquid waste

    Energy Technology Data Exchange (ETDEWEB)

    Nayak, P.K.; Kumaresan, R.; Venkatesan, K.A.; Subramanian, G.G.S.; Prathibha, T.; Syamala, K.V.; Selvan, B. Robert; Rajeswari, S.; Antony, M.P.; Rao, P.R. Vasudeva [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.; Chaurasia, Shivkumar; Bhanage, B.M. [Institute of Chemical Technology, Mumbai (India)

    2015-06-01

    The extraction and stripping behavior of various metal ions present in the fast reactor simulated high-level liquid waste (FR-SHLLW) was studied using a solvent phase composed of a neutral extractant, N,N,-didodecyl-N',N'-dioctyl-3-oxapentane-1,5-diamide (D{sup 3}DODGA) and an acidic extractant, di-2-ethylhexyl diglycolamic acid (HDEHDGA) in n-dodecane (n-DD). The third phase formation behavior of the solvent formulation D{sup 3}DODGA + HDEHDGA/n-DD, was studied when it was contacted with FR-SHLLW, and the concentration of neutral and acidic extractant needed to avoid the third phase formation was optimized. The distribution ratio of various metal ions present in FR-SHLLW was measured in a solution of 0.1 M D{sup 3}DODGA + 0.2 M HDEHDGA/n-DD. The extraction of Am(III) was accompanied by the co-extraction of lanthanides and unwanted metal ions such as Zr(IV), Y(III), and Pd(II). A procedure was developed to minimize the extraction of unwanted metal ions by using aqueous soluble complexing agents in FR-SHLLW. Based on those results, the counter-current mixer-settler run was performed in a 20-stage mixer-settler. Quantitative extraction of Am(III), Ln(III), Y(III), and Sr(II) in 0.1 M D{sup 3}DODGA + 0.2 M HDEHDGA/n-DD was observed. The recovery of Am(III) from the loaded organic phase was carried out by the optimized aqueous formulation composed of 0.01 M diethylenetriaminepentaacetic acid (DTPA) + 0.5 M citric acid (CA) at pH 1.5. The stripping of Am(III) was accompanied by co-stripping of some early lanthanides. However the later lanthanides (Eu(III) and beyond) were not back extracted to Am(III) product. Therefore, the studies foresee the possibility of intra-lanthanides as well as lanthanide-actinide separation in a single-processing cycle.

  4. Chemical speciation of strontium, americium, and curium in high level waste: Predictive modeling of phase partitioning during tank processing. Annual progress report, October 1996--September 1997

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, A.R. [Pacific Northwest National Lab., Richland, WA (US); Choppin, G. [Florida State Univ., Tallahassee, FL (US)

    1997-12-31

    'The program at Florida State University was funded to collaborate with Dr. A. Felmy (PNNL) on speciation in high level wastes and with Dr. D. Rai (PNNL) on redox of Pu under high level waste conditions. The funding provided support for 3 research associates (postdoctoral researchers) under Professor G. R. Choppin as P.I. Dr. Kath Morris from U. Manchester (Great Britain), Dr. Dean Peterman and Dr. Amy Irwin (both from U. Cincinnati) joined the laboratory in the latter part of 1996. After an initial training period to become familiar with basic actinide chemistry and radiochemical techniques, they began their research. Dr. Peterman was assigned the task of measuring Th-EDTA complexation prior to measuring Pu(IV)-EDTA complexation. These studies are associated with the speciation program with Dr. Felmy. Drs. Morris and Irwin initiated research on redox of plutonium with agents present in the Hanford Tanks as a result of radiolysis or from use in separations. The preliminary results obtained thus far are described in this report. It is expected that the rate of progress will continue to increase significantly as the researchers gain more experience with plutonium chemistry.'

  5. Experimental studies and thermodynamic modelling of volatilities of uranium, plutonium, and americium from their oxides and from their oxides interacted with ash

    Energy Technology Data Exchange (ETDEWEB)

    Krikorian, O.H.; Ebbinghaus, B.B.; Adamson, M.G.; Fontes, A.S. Jr.; Fleming, D.L.

    1993-09-15

    The purpose of this study is to identify the types and amounts of volatile gaseous species of U, Pu, and Am that are produced in the combustion chamber offgases of mixed waste oxidation processors. Primary emphasis is on the Rocky Flats Plant Fluidized Bed Incinerator. Transpiration experiments have been carried out on U{sub 3}O{sub 8}(s), U{sub 3}O{sub 8} interacted with various ash materials, PuO{sub 2}(s), PuO{sub 2} interacted with ash materials, and a 3%PuO{sub 2}/0.06%AmO{sub 2}/ash material, all in the presence of steam and oxygen, and at temperatures in the vicinity of 1,300 K. UO{sub 3}(g) and UO{sub 2}(OH){sub 2}(g) have been identified as the uranium volatile species and thermodynamic data established for them. Pu and Am are found to have very low volatilities, and carryover of Pu and Am as fine dust particulates is found to dominate over vapor transport. The authors are able to set upper limits on Pu and Am volatilities. Very little lowering of U volatility is found for U{sub 3}O{sub 8} interacted with typical ashes. However, ashes high in Na{sub 2}O (6.4 wt %) or in CaO (25 wt %) showed about an order of magnitude reduction in U volatility. Thermodynamic modeling studies were carried out that show that for aluminosilicate ash materials, it is the presence of group I and group II oxides that reduces the activity of the actinide oxides. K{sub 2}O is the most effective followed by Na{sub 2}O and CaO for common ash constituents. A more major effect in actinide activity lowering could be achieved by adding excess group I or group II oxides to exceed their interaction with the ash and lead to direct formation of alkali or alkaline earth uranates, plutonates, and americates.

  6. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10-15 and 3.2 x 10-14, for strontium between 3.5 x 10-14 and 2.1 x 10-13 m2/s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10-17 m2/s. 241Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  7. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 2

    International Nuclear Information System (INIS)

    Theoretical studies on geological disposal of radioactive waste in fractured crystalline rock and migration of radionuclides in groundwater circulating through the fractured zones have indicated the importance of diffusion into the rock matrix. Samples chosen for this study were filled and unfilled natural fracture surfaces and drill cores having a central drilled cavity ('drill core cups'). Samples originated from the two nuclear power plant sites in Finland: mica gneiss and tonalite from Olkiluoto and rapakivi granite from Haestholmen in Loviisa. An autoradiographic method was used for determination of the penetration depths and calculation of diffusion coefficients of Cs-134, Sr-90, Co-60, Ni-63, I-125 and Am-241. Emphasis was also directed to testing the quantitative autoradiographic method for diffusion coefficient measurements. After one year's contact time the penetration depths of strontium in tonalite were 15 mm and 10 mm for the filled and unfilled natural fracture surface samples and 5 mm for drill core cups. In the filled natural fracture surface sample of rapakivi granite the penetration depth of strontium was 35 mm. For cesium penetration depths in tonalite from 2.0 mm (unfilled natural surface) to 3.0 mm (drill core cup) were observed. For cobalt a penetration depth of 0.9 mm was found in the drill core cup sample of tonalite after contact time of one year and 1.5 mm in the filled natural fracture surface of rapakivi granite after contact time of six months. The range of Da-values of strontium was 1.4 x 10-14 - 1.1 x 10-13 m2/s. The Da-values for cesium and cobalt in tonalite (drill core cup samples) were 7 x 10-15 m2/s and 5 x 10-16 m2/s, respectively

  8. Americium(III) oxidation by copper(III) periodate in nitric acid solution as compared with the action of Bi(V) compounds of sodium, lithium, and potassium

    Energy Technology Data Exchange (ETDEWEB)

    Sinkov, Sergey I.; Lumetta, Gregg J. [Pacific Northwest National Laboratory, Radiochemical Processing Lab., Richland, WA (United States)

    2015-07-01

    The oxidative action of a Cu(III) periodate compound toward Am(III) in nitric acid was studied. The extent of oxidation of Am(III) to Am(VI) was investigated using a constant initial Cu(III)-to-Am(III) molar ratio of 10:1 and varying nitric acid concentrations from 0.25 to 3.5 mol/L. From 0.25 to 3 mol/L HNO3, more than 98% of the Am(III) was oxidized to Am(VI); however, at 3.5 mol/L HNO{sub 3}, the conversion to Am(VI) was only 80%. Increasing the Cu(III)-to-Am(III) molar ratio to 20:1 in 3.5 mol/L HNO{sub 3} resulted in 98% conversion to Am(VI). For comparison, oxidation of Am(III) with NaBiO{sub 3} was studied at 3.5 mol/L HNO{sub 3} and the same stoichiometric excess of Bi(V) oxidant over Am(III) (stoichiometric ratio of 3.33:1). With NaBiO{sub 3}, the extent of Am(III) conversion to Am(VI) was only 19%, while with the Cu(III) compound this value was found to be about 4 times higher under otherwise identical conditions. Similar results were obtained with other Bi(V) salts. These results show that the Cu(III) periodate compound is a superior oxidant to NaBiO{sub 3}, yielding rapid conversion to Am(VI) in a homogeneous acidic solution, and is, therefore, an excellent candidate for further development of Am separation systems.

  9. I. Nuclear Production Reaction and Chemical Isolation Procedure for Americium-240 II. New Superheavy Element Isotopes: Plutonium-242(Calcium-48,5n)(285)114

    Science.gov (United States)

    Ellison, Paul Andrew

    2011-12-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242 Pu(p, 3n)240Am nuclear reaction was measured to be lower than theoretical predictions, but high enough to be the most viable nuclear reaction for the large-scale production of 240 Am. Details of the development of a chemical separation procedure for isolating 240Am from proton-irradiated 242Pu are discussed. The separation procedure, which includes two anion exchange columns and two extraction chromatography columns, was experimentally investi- gated using tracer-level 241Am, 239Pu, and model proton-induced fission products 95Zr, 95Nb, 125Sb, and 152Eu. The separation procedure was shown to have an Am/Pu separation factor of >2x10 7 and an Am yield of ˜70%. The separation procedure was found to purify the Am sample from >99.9% of Eu, Zr, Nb, and Sb. The procedure is well suited for the processing of ˜1 gram of proton-irradiated 242Pu to produce a neutron-induced fission target consisting of tens of nanograms of 240Am. Part II describes the use of the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron for the study of the 242Pu(48Ca,5n)285114 nuclear re- action. The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV ( E* = 50 MeV). The alpha decay of 285114 was followed by the sequential alpha decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269 Sg. 265Rf was observed to decay by spontaneous fission. The measured alpha-decay Q-values were compared with those from a macroscopic-microscopic nuclear mass model to give insight into superheavy element shell effects. The 242Pu(48Ca, 5n)285114 cross section was 0.6-0.2 +1.3 pb.

  10. Methodology for the Inventory and Assessment of Americium Contamination Level in 1987 in an Area of Palomares Contaminated with Plutonium Weapon Grade

    International Nuclear Information System (INIS)

    This paper presents a methodology applied for the assessment of the ''241 Am coming from the decay of ''241 Pu isotope content in a contaminated area of Palomares, where the clean-up work done in 1966, given the negligible agricultural importance of such area at the time and its geographical characteristics, was not of the same magnitude as for the rest of the region. (Author) 4 refs

  11. DEVELOPMENT OF FUNDAMENTAL DATA ON CHEMICAL SPECIATION AND SOLUBILITY FOR STRONTIUM AND AMERICIUM IN HIGH LEVEL WASTE: PREDICTIVE MODELING OF PHASE PARTITIONING DURING TANK PROCESSING

    Science.gov (United States)

    Current strategies for reducing the total volume of radioactive tank waste requiring disposal at Hanford and other DOE sites call for the development of methods to selectively dissolve and remove non-radioactive elements such as Al, P, and Cr while retaining or precipitating the ...

  12. Studies on the feasibility of using completely incinerable reagents for the single-cycle separation of americium(III) from simulated high-level liquid waste

    International Nuclear Information System (INIS)

    The extraction and stripping behavior of various metal ions present in the fast reactor simulated high-level liquid waste (FR-SHLLW) was studied using a solvent phase composed of a neutral extractant, N,N,-didodecyl-N',N'-dioctyl-3-oxapentane-1,5-diamide (D3DODGA) and an acidic extractant, di-2-ethylhexyl diglycolamic acid (HDEHDGA) in n-dodecane (n-DD). The third phase formation behavior of the solvent formulation D3DODGA + HDEHDGA/n-DD, was studied when it was contacted with FR-SHLLW, and the concentration of neutral and acidic extractant needed to avoid the third phase formation was optimized. The distribution ratio of various metal ions present in FR-SHLLW was measured in a solution of 0.1 M D3DODGA + 0.2 M HDEHDGA/n-DD. The extraction of Am(III) was accompanied by the co-extraction of lanthanides and unwanted metal ions such as Zr(IV), Y(III), and Pd(II). A procedure was developed to minimize the extraction of unwanted metal ions by using aqueous soluble complexing agents in FR-SHLLW. Based on those results, the counter-current mixer-settler run was performed in a 20-stage mixer-settler. Quantitative extraction of Am(III), Ln(III), Y(III), and Sr(II) in 0.1 M D3DODGA + 0.2 M HDEHDGA/n-DD was observed. The recovery of Am(III) from the loaded organic phase was carried out by the optimized aqueous formulation composed of 0.01 M diethylenetriaminepentaacetic acid (DTPA) + 0.5 M citric acid (CA) at pH 1.5. The stripping of Am(III) was accompanied by co-stripping of some early lanthanides. However the later lanthanides (Eu(III) and beyond) were not back extracted to Am(III) product. Therefore, the studies foresee the possibility of intra-lanthanides as well as lanthanide-actinide separation in a single-processing cycle.

  13. Solubility limits of radionuclides in interstitial water. Americium in cement. Task 3. Characterization of radioactive waste forms. A series of final reports (1985-89). No 34

    International Nuclear Information System (INIS)

    The migration of actinides inside cement (or concrete) is very slow, even when the material is saturated with water: precipitation of actinide hydroxide explains this retention phenomenon. The aim of this work is to measure Am solubility in aqueous solutions equilibrated with CPA55 cement to: (i) compare it with thermodynamic predictions; and (ii) correlate it to (future) migration measurements of Am through cement discs. 12 figs.; 8 tabs.; 3 refs

  14. Investigation of the chemical explosion of an ion exchange resin column and resulting americium contamination of personnel in the 242-Z building, August 30, 1976

    Energy Technology Data Exchange (ETDEWEB)

    1976-10-19

    As a result of an explosion in the Waste Treatment Facility, 242-Z Building, 200 West Area of the Hanford Reservation on August 30, 1976, the Manager of the Richland Operations Office (RL), Energy Research and Development Administration (ERDA), appointed an ERDA Committee to conduct a formal investigation and to prepare a report on their findings of this occurrence. The Committee was instructed to conduct the investigation in accordance with ERDAMC 0502, insofar as circumstances would permit, to cover and explain technical elements of the casual sequence(s) of the occurrence, and to describe management systems which should have or could have prevented the occurrence. This report is the result of the investigation and presents the conclusions of the review.

  15. Separation of americium(III) and europium(III) from nitrate medium using a binary mixture of Cyanex-301 with neutral donor ligands

    International Nuclear Information System (INIS)

    Separation behaviour of Am3+ and Eu3+ was investigated from aqueous nitrate medium using a binary mixture of Cyanex-301 (bis(2,4,4- trimethylpentyl) dithiophosphinic acid) and several N, O or S donor ligands such as 1,10-phenanthroline (phen), TPTZ (2,4,6- tri(2-pyridyl)- 1,3,5- triazine), 2,2'-bipyridyl(bipy), hexa thia 18 crown 6 (S618C6), TBP (tri-n-butyl phosphate), TBTP (tri-n-butyl thiophosphate) in toluene. The S.F. values of >40,000 obtained with bipy and phen are the highest reported to date. (author)

  16. Bis(2-ethylhexyl)diglycolamic acid for the mutual separation of Europium (III) and Americium (III) from citric acid - nitric acid medium

    International Nuclear Information System (INIS)

    High-level liquid waste arises from fast reactor fuel reprocessing contains significant quantities of lanthanides and trivalent minor actinides. Recently, the partitioning of minor actinides from fast reactor-high active waste (FR-HAW) using a TRUEX solvent, composed of a solution of 0.2 M octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO)-1.2 M tri-n-butylphosphate (TBP) in n-dodecane is demonstrated. A new stripping formulation composed of a solution of 0.1 M citric acid in 0.1 M nitric acid was employed for back extraction of trivalents from the loaded TRUEX solvent. Thus the mutual separation lanthanides and actinides requires a suitable extractant for separating them from citric acid medium

  17. The role of natural organic matter in the migration behaviour of americium in the Boom clay - Part II: analysis of migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as a potential site for the disposal of radioactive waste in Belgium, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs investigation. Trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may have opposing effects. If complexed by the aqueous phase (mobile) NOM, radionuclide transport will be governed by the mobility of these dissolved radionuclide-NOM species. If complexed by the solid phase (immobile) NOM, migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier with the objective of deriving conceptual models that can be implemented in repository performance assessment (PA) models. A separate paper describes the results of column migration experiments involving the transport of 241Am-14C-NOM complexes through Boom Clay cores. This paper describes the transport model, POPCORN, that was developed to describe and evaluate the influence of NOM on radionuclide transport in clay, taking into account attachment/detachment rates of NOM to clay surfaces and the kinetics of RN complexation to, and destabilization from, NOM. The POPCORN model was used to evaluate diffusion experiments involving injection of 14C-labelled NOM in Boom Clay cores. Model fits were obtained by varying the rates of filtration of NOM by attachment to the surface of the clay matrix. POPCORN was then used to analyse the 241Am-14C-NOM migration experiments. The stability properties of the 241Am-NOM were characterised by kinetic constants, and good matches to the migration data were achieved for the experiments. The findings suggest that a small sub-population of the original 241Am-OM is the most stable, and that this sub-population has specific transport characteristics, including low dispersivity and a potential for filtering. Such characteristics may be representative of larger, more stable, but less mobile 241Am-OM complexes. In summary, the key processes governing 241Am migration are the rate of 241Am-OM destabilization and the rates of attachment and detachment of OM on the clay surfaces. Correlations between different transport parameters have been identified, and these findings offer means of extrapolating parameter values for application of the model to larger-scale problems. (authors)

  18. Aqueous complexation of citrate with neodymium(III) and americium(III): a study by potentiometry, absorption spectrophotometry, microcalorimetry, and XAFS.

    Science.gov (United States)

    Brown, M Alex; Kropf, A Jeremy; Paulenova, Alena; Gelis, Artem V

    2014-05-01

    The aqueous complexation of Nd(III) and Am(III) with anions of citrate was studied by potentiometry, absorption spectrophotometry, microcalorimetry, and X-ray absorption fine structure (XAFS). Using potentiometric titration data fitting the metal-ligand (L) complexes that were identified for Nd(III) were NdHL, NdL, NdHL2, and NdL2; a review of trivalent metal-citrate complexes is also included. Stability constants for these complexes were calculated from potentiometric and spectrophotometric titrations. Microcalorimetric results concluded that the entropy term of complex formation is much more dominant than the enthalpy. XAFS results showed a dependence in the Debye-Waller factor that indicated Nd(iii)-citrate complexation over the pH range of 1.56-6.12.

  19. Chemical speciation of strontium, americium, and curium in high level waste: Predictive modeling of phase partitioning during tank processing. Annual progress report, October 1996--September 1997

    International Nuclear Information System (INIS)

    'The program at Florida State University was funded to collaborate with Dr. A. Felmy (PNNL) on speciation in high level wastes and with Dr. D. Rai (PNNL) on redox of Pu under high level waste conditions. The funding provided support for 3 research associates (postdoctoral researchers) under Professor G. R. Choppin as P.I. Dr. Kath Morris from U. Manchester (Great Britain), Dr. Dean Peterman and Dr. Amy Irwin (both from U. Cincinnati) joined the laboratory in the latter part of 1996. After an initial training period to become familiar with basic actinide chemistry and radiochemical techniques, they began their research. Dr. Peterman was assigned the task of measuring Th-EDTA complexation prior to measuring Pu(IV)-EDTA complexation. These studies are associated with the speciation program with Dr. Felmy. Drs. Morris and Irwin initiated research on redox of plutonium with agents present in the Hanford Tanks as a result of radiolysis or from use in separations. The preliminary results obtained thus far are described in this report. It is expected that the rate of progress will continue to increase significantly as the researchers gain more experience with plutonium chemistry.'

  20. Americium, Cesium, and Plutonium Colloid-Facilitated Transport in a Groundwater/Bentonite/Fracture Fill Material System: Column Experiments and Model Results

    Science.gov (United States)

    Dittrich, T. M.; Boukhalfa, H.; Reimus, P. W.

    2014-12-01

    The objective of this study was to investigate and quantify the effects of desorption kinetics and colloid transport on radionuclides with different sorption affinities. We focused on quantifying transport mechanisms important for upscaling in time and distance. This will help determine the long-term fate and transport of radionuclides to aid in risk assessments. We selected a fractured/weathered granodiorite at the Grimsel Test Site (GTS) in Switzerland as a model crystalline rock repository system because the system has been thoroughly studied and field experiments involving radionuclides have already been conducted. Working on this system provides a unique opportunity to compare lab experiments with field-scale observations. Weathered fracture fill material (FFM) and bentonite used as backfill at the GTS were characterized (e.g., BET, SEM/EDS, QXRD), and batch and breakthrough column experiments were conducted. Solutions were prepared in synthetic groundwaters that matched the natural water chemistry. FFM samples were crushed, rinsed, sieved (150-355 μm), and equilibrated with synthetic groundwater. Bentonite was crushed, sodium-saturated, equilibrated with synthetic groundwater, and settled to yield a stable suspension. Suspensions were equilibrated with Am, Cs, or Pu. All experiments were conducted with Teflon®materials to limit sorption to system components. After radionuclide/colloid injections reached stability, radionuclide-free solutions were injected to observe the desorption and release behavior. Aliquots of effluent were measured for pH, colloid concentration, and total and dissolved radionuclides. Unanalyzed effluent from the first column was then injected through a second column of fresh material. The process was repeated for a third column and the results of all three breakthrough curves were modeled with a multi-site/multi-rate MATLAB code to elucidate the sorption rate coefficients and binding site densities of the bentonite colloids and fracture fill material. Nearly 50% of the sorbed Am was exchanged from the colloids to the fracture filling material in each of the three columns; whereas, less Cs and Pu was desorbed with each pass through a new column. Using a two-site kinetic model allowed for interrogation of desorption rates and dominant transport parameters.

  1. Uncertainty induced by chest wall thickness assessment methods on lung activity estimation for plutonium and americium: a large population-based study

    International Nuclear Information System (INIS)

    In vivo lung counting aims at assessing the retained activity in the lungs. The calibration factor relating the measured counts to the worker’s specific retained lung activity can be obtained by several means and strongly depends on the chest wall thickness. Here we compare, for 374 male nuclear workers, the activity assessed with a reference protocol, where the material equivalent chest wall thickness is known from ultrasound measurements, with two other protocols. The counting system is an array of four germanium detectors. It is found that non site-specific equations for the assessment of the chest wall thickness induce large biases in the assessment of activity. For plutonium isotopes or 241Am the proportion of workers for whom the retained activity is within ± 10% of the reference one is smaller than 10%. The use of site-specific equations raises this proportion to 20% and 58% for plutonium and 241Am, respectively. Finally, for the studied population, when site-specific equations are used for the chest wall thickness, the standard uncertainties for the lung activity are 42% and 12.5%, for plutonium and 241Am, respectively. Due to the relatively large size of the studied population, these values are a relatively robust estimate of the uncertainties due to the assessment of the chest wall thickness for the current practice at this site. (paper)

  2. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    OpenAIRE

    Ketelaer, J.

    2010-01-01

    Kernmassen sind eine wichtige Größe zur Untersuchung der Kernstruktur, da sie die Summe aller Wechselwirkungen im Atomkern widerspiegeln. Es gibt viele Möglichkeiten zur präzisen Massenmessung unter denen die Penningfalle die höchste Präzision erreicht. Darüber hinaus können damit absolute Massenmessungen unter Verwendung des atomaren Massenstandards Kohlenstoff als Referenz durchgeführt werden. Im Rahmen dieser Arbeit wurde das neue Doppel-Penningfallen-Massenspektrometer TRIGA-TRAP aufgebau...

  3. Application of a gamma spectroscopy system to the measurement of neutron cross sections necessary to the development of nuclear energy; Mise au point d'un systeme de spectroscopie pour mesurer des sections efficaces neutroniques applicables a un possible developpement du nucleaire comme source d'energie

    Energy Technology Data Exchange (ETDEWEB)

    Deruelle, O

    2002-09-01

    This work concerns the development of nuclear energy and nuclear waste management in particular. Two parts of this study can be distinguished. In the first part (theoretical), a thorium-plutonium fuel based on MOX and dedicated for PWR was investigated in order to transmute plutonium in a potentially low waste fuel cycle. It was shown that this type of fuel is not regenerative but could be used for a transition to the industrial thorium fuel cycle without building new reactors. Thanks to moderated neutron spectra and high loaded actinide mass in the core, U-233 is quickly created ({approx}300 kg/y) for a loss of about {approx}1200 kg of fissile plutonium. In the second part (experimental), we have developed and built a new reaction chamber to measure neutron cross sections of actinides by alpha-gamma spectroscopy. This experimental device (in principle transportable) was commissioned in the high flux reactor of ILL Grenoble. Neutron flux was measured by gamma spectroscopy of irradiated Al and Co samples and was found to be of the order of 6,0. 10{sup 14} n.cm{sup -2}.s{sup -1} (4%). By the irradiation of 11{mu}g of Am-243 and Pu-242, corresponding capture cross sections were measured in the thermal neutron flux at 50 deg C. These are the results: {sup 243}Am(n,{gamma}) {sup 244fond.}Am = 4,72{+-}1,42b; {sup 243}Am(n,{gamma}) {sup 244total}Am = 74,8{+-}3,25b; {sup 242}Pu (n,{gamma}){sup 243}Pu = 22,7{+-}1,09b. Uncertainties of the measurements are mostly due to the determination of the neutron flux, efficiency of the electronics and ambiguities related to the definition of the area under {alpha}-{gamma} spectra. Although our measured cross sections deviate (by 10-30%) from the corresponding values widely used in evaluated data libraries such as ENDF, JEF and JENDL, in this work we have demonstrated the feasibility and principle of our experimental method. Furthermore, the value for the 243-americium capture cross-section is in very good agreement with the last two

  4. Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome

    NARCIS (Netherlands)

    Willemsen, Marjolein H.; Fernandez, Bridget A.; Bacino, Carlos A.; Gerkes, Erica; de Brouwer, Arjan P. M.; Pfundt, Rolph; Sikkema-Raddatz, Birgit; Scherer, Stephen W.; Marshall, Christian R.; Potocki, Lorraine; van Bokhoven, Hans; Kleefstra, Tjitske

    2010-01-01

    The clinical use of array comparative genomic hybridization in the evaluation of patients with multiple congenital anomalies and/or mental retardation has recently led to the discovery of a number of novel microdeletion and microduplication syndromes. We present four male patients with overlapping m

  5. Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.

    NARCIS (Netherlands)

    Willemsen, M.H.; Fernandez, B.A.; Bacino, C.A.; Gerkes, E.; Brouwer, A.P.M. de; Pfundt, R.; Sikkema-Raddatz, B.; Scherer, S.W.; Marshall, C.R.; Potocki, L.; Bokhoven, J.H.L.M. van; Kleefstra, T.

    2010-01-01

    The clinical use of array comparative genomic hybridization in the evaluation of patients with multiple congenital anomalies and/or mental retardation has recently led to the discovery of a number of novel microdeletion and microduplication syndromes. We present four male patients with overlapping m

  6. A Rare Interstitial Duplication of 8q22.1–8q24.3 Associated with Syndromic Bilateral Cleft Lip/Palate

    Directory of Open Access Journals (Sweden)

    Regina Ferreira Rezek

    2014-01-01

    Full Text Available We present a rare case of 8q interstitial duplication derived from maternal balanced translocations in a patient with bilateral cleft lip and palate in syndromic form associated with other congenital malformations. G-banding cytogenetic analysis revealed a chromosomal abnormality in the form of the karyotype 46,XX der(22t(8;22(q22.1;p11.1mat. Chromosome microarray analysis evidenced a 49 Mb duplicated segment of chromosome 8q with no pathogenic imbalances on chromosome 22. Two siblings also carry the balanced translocation. We have compared this case with other “pure” trisomies of 8q patients reported in the literature and with genome wide association studies recently published. This work highlights the involvement of chromosome 8q in orofacial clefts.

  7. JAR 2015, 243, (rolnummer HD 200.149.163/02: Splitsing onderneming bij overgang van onderneming, Toepassing Klarenberg-arrest, Relatiebeding geldig)

    NARCIS (Netherlands)

    R.M. Beltzer

    2015-01-01

    De werknemer is in 2002 in dienst getreden bij HVB. Op 27 december 2007 is hij met HVB een relatiebeding overeengekomen. Per 1 oktober 2008 zijn de activiteiten van HVB overgenomen door Co & Co. De werknemer is verteld dat hij in dienst zou treden van Accountants & Co. Op 8 december 2008 is de naam

  8. 2.43 贲门失弛缓症患者的食管运动功能障碍的研究

    Institute of Scientific and Technical Information of China (English)

    陈焰; 宋震亚; 唐训球; 钱可大; 杜勤

    2001-01-01

    目的贲门失弛缓症是原发性食管运动功能障碍性疾病,其病因未明,多数认为是一种神经原性疾病,与食管壁肌间神经丛(Auerbach's神经丛)变性有关,患者食管体部缺少蠕动、食管下括约肌(LES)松弛不全.以往诊断主要依靠食管钡餐检查,本文研究贲门失弛缓症食管测压的改变及对诊断的价值.方法 35例贲门失弛缓症及30例健康志愿者.主要症状:吞咽困难35例,反流11例,胸痛5例,消瘦23例.所有患者均内镜检查,25例患者的食管腔扩大,11例同时伴滞留液,30例贲门区紧闭,推进胃镜时阻力感.5例可以较顺利进镜.食管钡餐表现:32例患者均显示钡剂通过贲门时的受阻,上方食管有不同程度的扩张,贲门部呈鸟嘴样改变.2 例食管钡餐无异常发现.食管测压采用液导法(仪器均是瑞典(CTD-Synectics公司产品). 测定食管下括约肌静息压(LESP)、下括约肌松弛压(LESRP),计算下括约肌松弛率(LESRR), 同时测食管上括约肌静息压(UESP)、食管上括约肌松弛压(UESRP).食管体部蠕动波幅、同步收缩波(局部或全程的同步收缩)和继发性收缩波(未吞咽时食管的收缩波)的发生百分比. 所有数据均采用x -±s表示,统计处理采用t检验.结果 1.食管体部测压表现:35例贲门失弛缓症患者体部100%均为同步收缩波,其中91.4%(32/35)为低幅同步收缩汉.8.6%(3/35)为正常幅度收缩波.85.7%(30/35 )同时存在继发性收缩,且继发性收缩也均是非传导性收缩波.静息食管压均高于胃内压.2 .食管下括约肌测定:贲门失弛缓症患者的LESP为49.0±41.3mmHg,明显高于对照的18. 7±4.5mmHg(P<0.01),82.9%(29/35)的患者的LESP明显高于对照,仅17.1%(6/35) 在正常范围内.食管下括约肌松弛率(LESRR)为69.1±16.3%,明显低于正常对照的96.0 ±0.1%(P<0.01).3.食管上括约肌测定:贲门失弛缓症患者食管上括约肌压力(UES P)为41.0±17.8mmHg,与正常对照组39.4±14.4mmHg无差异(P>0.05).结论食管测压是一种操作简便、快速而安全的食管功能检测方法,可观察食管各部位的运动功能.贲门失弛缓症患者食管体部低幅同步收缩波和LESRR增高尤其重要 ,可早期诊断及判断轻重程度,是确诊本病的可靠的方法.对所有疑为贲门失弛缓症的患者均应进行早期食管测压,不仅可早期发现疾病且对判断预后有帮助.

  9. Cavendish, Sueli & Valois, Michelle (Org. Teoria e prática da tradução literária. Recife: Editora UFPE, 2014. 243p.

    Directory of Open Access Journals (Sweden)

    Sonia Ramalho Farias

    2015-12-01

    Full Text Available Critical review of the book Theory and Practice of Literary Translation organized by Sueli Cavendish and Michelle Valois, seeking to learn simultaneously the double objective that sets the collection: the practice of translation and the need to theorize about it through the characteristic disciplinary character of several studies. Some tests were selected from a total of fourteen forming the Anthology. The review aims to detect multiple ways of thinking about translation and the extension of its concept by the various essayists. The text focuses specifically on the interchangeability of translating concepts, interpretation and criticism and dialogue that Translation Studies have with the Literary Theory, Comparative Literature and other disciplines.

  10. Interstitial deletion of 14q24.3-q32.2 in a male patient with plagiocephaly, BPES features, developmental delay, and congenital heart defects

    DEFF Research Database (Denmark)

    Cingöz, Sultan; Bache, Iben; Bjerglund, Lise;

    2011-01-01

    with developmental delay, language impairment, plagiocephaly, BPES features (blepharophimosis, ptosis, epicanthus), and congenital heart defect. The deletion breakpoints were fine mapped using fluorescence in situ hybridization (FISH) and the size of the deletion is estimated to be approximately 23¿Mb. Based...... on genotype-phenotype comparisons of the 10 previously published patients and the present case, we suggest that the shortest regions for deletion overlap may include candidate genes for speech impairment, mental retardation, and hypotonia....

  11. Comparison of direct $\\gamma$ production in $\\overline{p}p$ and $pp$ reactions at $\\sqrt{s}$=24.3-GeV

    CERN Document Server

    Camilleri, L

    1991-01-01

    Th e differenc e betwee n th e p p an d p p cros s sections , whic h i s a n estimat e o f th e annihilatio n diagra m ha s bee n measure d fo r th e first time . A preliminar y estimat e o f th e gluo n structur e functio n o f th e nucléo n i s foun d t o b e x G(x ) = A g ( 1 - x)n , wit h n = 3. 5 ± 0. 3 ± 0.5 .

  12. Decree 243/994 National Direction of Especial Subjects it create and will operate in the orbit of the External Relation Ministere

    International Nuclear Information System (INIS)

    Creates in the Ministry of External Relationships the Direction of Special Matters, to which concerns to study, to coordinate and to execute in the pertinent thing, the foreign policy of the Republic in the related with Nuclear Energy, Dismantle, human rights and Humanitarian Right, Population, Migration and Refugees, Drug traffic, Terrorism, Space Right and all those topics of political character that require to be considered in form separated by their special characteristic . The Direction of Special Political Matters in opinion of the Ministry of External Relationships will depend directly on the General Direction for Political Matters

  13. 76 FR 24832 - Airworthiness Directives; Airbus Model A330-201, -202, -203, -223, and -243 Airplanes, A330-300...

    Science.gov (United States)

    2011-05-03

    ... investigation confirmed that the surface defects were a result of de-bonding between the skin and honeycomb core... were a result of de-bonding between the skin and honeycomb core. Such reworks were also performed on... include vacuum loss and elasticity laminate checker inspections for damage including de-bonding...

  14. SU-E-J-243: Reproducibility of Radiomics Features Through Different Voxel Discretization Levels in F18-FDG PET Images of Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Altazi, B; Fernandez, D; Zhang, G; Biagioli, M; Moros, E; Moffitt, H. Lee [Cancer Center, Tampa, FL, University of South Florida, Tampa, FL (United States)

    2015-06-15

    Purpose: Site-specific investigations of the role of Radiomics in cancer diagnosis and therapy are needed. We report of the reproducibility of quantitative image features over different discrete voxel levels in PET/CT images of cervical cancer. Methods: Our dataset consisted of the pretreatment PET/CT scans from a cohort of 76 patients diagnosed with cervical cancer, FIGO stage IB-IVA, age range 31–76 years, treated with external beam radiation therapy to a dose range between 45–50.4 Gy (median dose: 45 Gy), concurrent cisplatin chemotherapy and MRI-based Brachytherapy to a dose of 20–30 Gy (median total dose: 28 Gy). Two board certified radiation oncologists delineated Metabolic Tumor volume (MTV) for each patient. Radiomics features were extracted based on 32, 64, 128 and 256 discretization levels (DL). The 64 level was chosen to be the reference DL. Features were calculated based on Co-occurrence (COM), Gray Level Size Zone (GLSZM) and Run-Length (RLM) matrices. Mean Percentage Differences (Δ) of features for discrete levels were determined. Normality distribution of Δ was tested using Kolomogorov - Smirnov test. Bland-Altman test was used to investigate differences between feature values measured on different DL. The mean, standard deviation and upper/lower value limits for each pair of DL were calculated. Interclass Correlation Coefficient (ICC) analysis was performed to examine the reliability of repeated measures within the context of the test re-test format. Results: 3 global and 5 regional features out of 48 features showed distribution not significantly different from a normal one. The reproducible features passed the normality test. Only 5 reproducible results were reliable, ICC range 0.7 – 0.99. Conclusion: Most of the radiomics features tested showed sensitivity to voxel level discretization between (32 – 256). Only 4 GLSZM, 3 COM and 1 RLM showed insensitivity towards mentioned discrete levels.

  15. Deletions in chromosome 6p22.3-p24.3, including ATXN1, are associated with developmental delay and autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Celestino-Soper Patrícia BS

    2012-04-01

    Full Text Available Abstract Interstitial deletions of the short arm of chromosome 6 are rare and have been associated with developmental delay, hypotonia, congenital anomalies, and dysmorphic features. We used array comparative genomic hybridization in a South Carolina Autism Project (SCAP cohort of 97 subjects with autism spectrum disorders (ASDs and identified an ~ 5.4 Mb deletion on chromosome 6p22.3-p23 in a 15-year-old patient with intellectual disability and ASDs. Subsequent database queries revealed five additional individuals with overlapping submicroscopic deletions and presenting with developmental and speech delay, seizures, behavioral abnormalities, heart defects, and dysmorphic features. The deletion found in the SCAP patient harbors ATXN1, DTNBP1, JARID2, and NHLRC1 that we propose may be responsible for ASDs and developmental delay.

  16. A comprehensive study of fission in 24.3 MeV/nucleon U reactions induced on C, Si, Ni, Au targets

    International Nuclear Information System (INIS)

    Fission is a powerful tool for studying the primary reaction mechanisms in nucleus-nucleus collisions involving at least one fissionable nucleus. This is well shown when an additional information on the violence of the collision is provided by a totally independent observable such as the neutron multiplicity. The mass asymmetry in the entrance channel and the impact parameter are shown to have a decisive influence on the fate of the collision leading to either fusion or a two-body deeply inelastic reaction, analogous to what is known at lower bombarding energies. The experimental approach allows also to single out electromagnetic fission of U after interaction with Au and to provide some characteristics of such a process. (author)

  17. Neutron Fission of 235,237,239U and 241,243Pu: Cross Sections, Integral Cross Sections and Cross Sections on Excited States

    Energy Technology Data Exchange (ETDEWEB)

    Younes, W; Britt, H C

    2003-07-10

    In a recent paper submitted to Phys. Rev. C they have presented estimates for (n,f) cross sections on a series of Thorium, Uranium and Plutonium isotopes over the range E{sub n} = 0.1-2.5 MeV. The (n,f) cross sections for many of these isotopes are difficult or impossible to measure in the laboratory. The cross sections were obtained from previous (t,pf) reaction data invoking a model which takes into account the differences between (t,pf) and (n,f) reaction processes, and which includes improved estimates for the neutron compound formation process. The purpose of this note is: (1) to compare the estimated cross sections to current data files in both ENDF and ENDL databases; (2) to estimate ratios of cross sections relatively to {sup 235}U integrated over the ''tamped flattop'' critical assembly spectrum that was used in the earlier {sup 237}U report; and (3) to show the effect on the integral cross sections when the neutron capturing state is an excited rotational state or an isomer. The isomer and excited state results are shown for {sup 235}U and {sup 237}U.

  18. SCRIB and PUF60 are primary drivers of the multisystemic phenotypes of the 8q24.3 copy-number variant

    DEFF Research Database (Denmark)

    Dauber, Andrew; Golzio, Christelle; Guenot, Cécile;

    2013-01-01

    Copy-number variants (CNVs) represent a significant interpretative challenge, given that each CNV typically affects the dosage of multiple genes. Here we report on five individuals with coloboma, microcephaly, developmental delay, short stature, and craniofacial, cardiac, and renal defects who...

  19. Highly enriched isotope samples of uranium and transuranium elements for scientific investigation

    Science.gov (United States)

    Vesnovskii, Stanislav P.; Polynov, Vladimir N.; Danilin, Lev. D.

    1992-02-01

    The paper describes the production of highly enriched isotopes of uranium, plutonium, americium and curium by electromagnetic separation for scientific and applied researches in physics, chemistry, geology, medicine, biology and other fields. Using the equipment described, the isotopes are produced in quantities sufficient to set up nuclear physical experiments, to produce nuclear reference materials and standard sources for calibration of radiometrical and mass spectrometrical equipment, in radionuclide metrology, etc. For the following isotopes the indicated degrees of isotopic enrichment were achieved: 233U - 99.97%; 235U - 99.97%; 236U - 98.0%; 238U - 99.997%; 238Pu - 99.6%; 239Pu - 99.9977%; 240Pu - 99.9-100%; 241Pu - 96.998%; 242Pu - 97.8-99.96%; 244Pu - 96.7%; 241Am - 99.6%; 242Am - 73.6%; 243Am - 99.2-99.94%; 243Cm - 99.99%; 245Cm - 99.998%; 246Cm - 99.8%; 247Cm - 90%; 248Cm - 97%. Methods for preparing layers of highly enriched isotopes on various substances are presented: - electrochemical deposition of transuranic elements from aqueous-organic and organic media and vacuum spraying: - the method of foil and coating formation via compounds in the vapour phase; - the method of fabrication of layers of transuranic elements on superthin (1-2 μm) metal substrates with additional isolating polymer-metal coatings (0.2-0.4 μm), that substantially decrease material transfer from the active layer and increase safety of product handling.

  20. Radiological and Environmental Research Division annual report, January-December 1981: ecology

    Energy Technology Data Exchange (ETDEWEB)

    1982-07-01

    Highlights of progress accomplished during the year ending December 1981 are presented. Some of the subjects discussed are: the effects of acid deposition on crop-soil systems; the effects of energy-related pollutants on crops, including field corn, which was found to be quite resistant to both O/sub 3/ and SO/sub 2/; the synergistic effects of SO/sub 2/ and NO/sub x/ on soybean productivity; the impact of acid rain on food crops and the dependence of these effects on the chemical composition of rain; the effects of acid rain on soil systems; /sup 239/ /sup 240/Pu, /sup 241/Am, and /sup 243/ /sup 244/Am in a core from the Saquenay Fjord, Quebec; rate of removal of natural thorium isotopes from Lake Michigan water; influence of colloidal dissolved organic carbon on the sorption of plutonium on natural sediments; the behavior of americium in natural waters; and near-bottom currents and sediment resuspension in Lake Michigan. Separate abstracts have been prepared for 12 reports for inclusion in the Energy Data Base. (RJC)

  1. Sorption of americium(III) and europium(III) from nitric acid solutions by a novel diglycolamide-grafted silica-based resins. Pt. 2. Sorption isotherms, column and radiolytic stability studies

    Energy Technology Data Exchange (ETDEWEB)

    Ansari, Seraj A.; Mohapatra, Prasanta K. [Bahabha Atomic Research Centre, Trombay, Mumbai (India). Radiochemistry Div.; Iqbal, Mudassir; Huskens, Jurriaan; Verboom, Willem [Twente Univ. (Netherlands). Lab. of Molecular Nanofabrication

    2014-07-01

    Two novel diglycolamide-grafted silica-based resins (DGSRs) were used for the sorption of trivalent actinides and lanthanides from 3 M nitric acid solutions. The sorption of Am(III) onto the resin containing one diglycolamide (DGA) moiety (DGSR-I) was less efficient than the resin containing two DGA moieties (DGSR-II) with Lagergren first order rate constants of (1.20 ± 0.03) x 10{sup -3}s{sup -1} and (2.01 ± 0.05) x 10{sup -3}s{sup -1}, respectively. The maximum sorption of Eu(III) (used as a representative of the trivalent lanthanide/actinide ions in radioactive wastes) was 10.4 ± 1.1 mg g{sup -1} and 13.9 ± 1.3 mg g{sup -1} by the DGSR-I and DGSR-II, respectively. The sorption of Eu(III) on the grafted silica resins followed the Langmuir monolayer sorption phenomenon with sorption energies of 16.5 ± 2.05 and 17.8 ± 1.6 kJ mol{sup -1} for DGSR-I and DGSR-II, respectively. Column experiments revealed that the breakthrough capacity of Eu(III) on the DGSR-II column was higher than that on the DGSR-I column. Efficient elution could be achieved with a 0.01 M EDTA solution. The radiolytic stability of the resins was ascertained by exposing the resins to a gamma ray dose up to 1030 kGy resulting in a decrease of the K{sub d} values with about 50%; at doses <500 kGy the K{sub d} values remained unaffected.

  2. Study of plutonium and americium contamination in agricultural area, radiological impact caused by consumption of vegetables of this area; Estudio de la contaminacion de plutonio y americio en un area agricola, impacto radiologico ocasionado por consumo de vegetales contaminados

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa, Assuncion; Aragon, Antonio; Cruz, Berta de la; Gutierrez, Jose [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas, Madrid (Spain). Dept. de Impacto Ambiental de la Energia

    2001-07-01

    The transuranide concentration has been studied for 30 years in vegetable production, crops in wide extensions and in private-owned farms, all of them situated within the Pu-contaminated area of Palomares due to an air accident in 1966. Based on these studies, a preliminary estimation of the radiological risk caused by the consumption of these products by the inhabitants was possible. The results show that most of the fruits present a surface contamination, which disappears or is significantly reduced when they are washed. The contamination present in edible parts of the vegetables, as well as the contamination of other products included in the diet, has facilitated the estimation of the effective dose for ingestion and the committed effective dose for 50 years for the inhabitants. The main conclusions are: those plants, whose cultivation period is less than a year, present a low level of contamination; the green parts of the plants have a higher contamination than the fruits; the Pu soil to plant transfer factor is very low. In general, those plants that have remained in the contaminated land for several years present a high contamination level; the ingestion of products from Palomares does not represent an important risk for the population, even in the case that the products were totally consumed by a critical group.( author)

  3. Interaction and transport of actinides in natural clay rock with consideration of humic substances and clay organics. Characterization and quantification of the influence of clay organics on the interaction and diffusion of uranium and americium in the clay. Joint project

    Energy Technology Data Exchange (ETDEWEB)

    Bernhard, Gert [Helmholtz-Zentrum Dresden-Rossendorf e.V. (Germany). Inst. of Radiochemistry; Schmeide, Katja; Joseph, Claudia; Sachs, Susanne; Steudtner, Robin; Raditzky, Bianca; Guenther, Alix

    2011-07-01

    The objective of this project was the study of basic interaction processes in the systems actinide - clay organics - aquifer and actinide - natural clay - clay organics - aquifer. Thus, complexation, redox, sorption and diffusion studies were performed. To evaluate the influence of nitrogen, phosphorus and sulfur containing functional groups of humic acid (HA) on the complexation of actinides in comparison to carboxylic groups, the Am(III) and U(VI) complexation by model ligands was studied by UV-Vis spectroscopy and TRLFS. The results show that Am(III) is mainly coordinated via carboxylic groups, however, probably stabilized by nitrogen groups. The U(VI) complexation is dominated by carboxylic groups, whereas nitrogen and sulfur containing groups play a minor role. Phosphorus containing groups may contribute to the U(VI) complexation by HA, however, due to their low concentration in HA they play only a subordinate role compared to carboxylic groups. Applying synthetic HA with varying sulfur contents (0 to 6.9 wt.%), the role of sulfur functionalities of HA for the U(VI) complexation and Np(V) reduction was studied. The results have shown that sulfur functionalities can be involved in U(VI) humate complexation and act as redox-active sites in HA for the Np(V) reduction. However, due to the low content of sulfur in natural HA, its influence is less pronounced. In the presence of carbonate, the U(VI) complexation by HA was studied in the alkaline pH range by means of cryo-TRLFS (-120 C) and ATR FT-IR spectroscopy. The formation of the ternary UO{sub 2}(CO{sub 3}){sub 2}HA(II){sup 4-} complex was detected. The complex formation constant was determined with log {beta}{sub 0.1} M = 24.57 {+-} 0.17. For aqueous U(VI) citrate and oxalate species, luminescence emission properties were determined by cryo-TRLFS and used to determine stability constants. The existing data base could be validated. The U(VI) complexation by lactate, studied in the temperature range 7 to 65 C, was found to be endothermic and entropy-driven. In contrast, the complex stability constants determined for U(VI) humate complexation at 20 and 40 C are comparable, however, decrease at 60 C. For aqueous U(IV) citrate, succinate, mandelate and glycolate species stability constants were determined. These ligands, especially citrate, increase solubility and mobility of U(IV) in solution due to complexation. The U(VI) sorption onto crushed Opalinus Clay (OPA, Mont Terri, Switzerland) was studied in the absence and presence of HA or low molecular weight organic acids, in dependence on temperature and CO2 presence using OPA pore water as background electrolyte. Distribution coefficients (K{sub d}) were determined for the sorption of U(VI) and HA onto OPA with (0.0222 {+-} 0.0004) m{sup 3}/kg and (0.129 {+-} 0.006) m{sup 3}/kg, respectively. The U(VI) sorption is not influenced by HA ({<=}50 mg/L), however, decreased by low molecular weight organic acids ({>=} 1 x 10{sup -5} M), especially by citrate and tartrate. With increasing temperature, the U(VI) sorption increases both in the absence and in the presence of clay organics. The U(VI) diffusion in compacted OPA is not influenced by HA at 25 and 60 C. Predictions of the U(VI) diffusion show that an increase of the temperature to 60 C does not accelerate the migration of U(VI). With regard to uranium-containing waste, it is concluded that OPA is suitable as host rock for a future nuclear waste repository since OPA has a good retardation potential for U(VI). (orig.)

  4. Monitored Natural Attenuation of Inorganic Contaminants in Ground Water Volume 3 Assessment for Radionuclides IncludingTritium, Radon, Strontium, Technetium, Uranium, Iodine, Radium, Thorium, Cesium, and Plutonium-Americium

    Science.gov (United States)

    The current document represents the third volume of a set of three volumes that address the technical basis and requirements for assessing the potential applicability of MNA as part of a ground-water remedy for plumes with nonradionuclide and/or radionuclide inorganic contamina...

  5. Supported liquid inorganic membranes for nuclear waste separation

    Energy Technology Data Exchange (ETDEWEB)

    Bhave, Ramesh R; DeBusk, Melanie M; DelCul, Guillermo D; Delmau, Laetitia H; Narula, Chaitanya K

    2015-04-07

    A system and method for the extraction of americium from radioactive waste solutions. The method includes the transfer of highly oxidized americium from an acidic aqueous feed solution through an immobilized liquid membrane to an organic receiving solvent, for example tributyl phosphate. The immobilized liquid membrane includes porous support and separating layers loaded with tributyl phosphate. The extracted solution is subsequently stripped of americium and recycled at the immobilized liquid membrane as neat tributyl phosphate for the continuous extraction of americium. The sequestered americium can be used as a nuclear fuel, a nuclear fuel component or a radiation source, and the remaining constituent elements in the aqueous feed solution can be stored in glassified waste forms substantially free of americium.

  6. An unbalanced submicroscopic translocation t(8;16)(q24.3;p13.3)pat associated with tuberous sclerosis complex, adult polycystic kidney disease, and hypomelanosis of Ito

    NARCIS (Netherlands)

    H.J.F.M.M. Eussen (Bert); S. Verhoef; A. Fois; D.J.J. Halley (Dicky); G. Bartalini (Gabriella); L. Bakker (Lida); P. Balestri (Paolo); C. di Lucca; J.O. van Hemel; H. Dauwerse; A.M.W. van den Ouweland (Ans); C. Ris-Stalpers (Carolyn)

    2000-01-01

    textabstractWe report on a familial submicroscopic translocation involving chromosomes 8 and 16. The proband of the family had a clinical picture suggestive of a large deletion in the chromosome 16p13.3 area, as he was affected with tuberous sclerosis complex (TSC) and had alpha th

  7. Method validation for 243 pesticides and environmental contaminants in meats and poultry by tandem mass spectrometry coupled to low-pressure gas chromatography and ultra high-performance liquid chromatography

    Science.gov (United States)

    An easy and reliable high-throughput analysis method was developed and validated for 192 diverse pesticides and 51 environmental contaminants (13 PCB congeners, 14 PAHs, 7 PBDE congeners, and 17 novel flame retardants) in cattle, swine, and poultry muscle. Sample preparation was based on the “quick,...

  8. Monozygotic twins with a de novo 0.32 Mb 16q24.3 deletion, including TUBB3 presenting with developmental delay and mild facial dysmorphism but without overt brain malformation

    DEFF Research Database (Denmark)

    Grønborg, Sabine; Kjaergaard, Susanne; Hove, Hanne;

    2015-01-01

    Nervous system development is highly dependent on the function of microtubules, which are assembled from tubulin heterodimers containing several α- and β-tubulin isotypes encoded by separate genes. A spectrum of neurological disorders with malformations of the central nervous system has recently ...

  9. 16 CFR 24.3 - Misuse of the terms “waterproof,” “dustproof,” “warpproof,” “scuffproof,” “scratchproof,” “scuff...

    Science.gov (United States)

    2010-01-01

    ... indicating that the product is not subject to wear in any other respect, to describe an industry product unless the outside surface of the product is immune to scratches or scuff marks, or is not subject...

  10. As Aventuras de Huckleberry Finn de Mark Twain, Tradução de Rosaura Eichenberg.DOI: 10.5007/2175-7968.2011v2n28p243

    Directory of Open Access Journals (Sweden)

    Vanessa Lopes Lourenço Hanes

    2011-12-01

    Full Text Available A obra The Adventures of Huckleberry Finn é tida pela maioria dos críticos literários como a obra-prima de Mark Twain. Este livro, escrito em 1885, foi inclusive considerado a origem de toda a literatura americana moderna pelo célebre Hemingway.

  11. A rare prenatal case with two de novo inversions and a translocation: 48, XX,t(9;12)(q32;p24.3), inv(11)(p15.1q25), inv(13)(q12.q22)

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, B.; Balaban, L.; Eldred, C. [Albany Medical College, Albany, NY (United States)] [and others

    1994-09-01

    Ultrasound examination of a para 1, gravida 2, 26 y.o. showed severe hydrocephalus and polyhydramnios. Amniocentesis was performed at 27 weeks. High resolution chromosome analysis revealed a karyotype with a 9;12 translocation, a pericentric inversion of chromosome 11, and a paracentric inversion of chromosome 13. Parental chromosome studies were normal. The mother was not on medication prior to her pregnancy and there was no known exposure to radiation. Delivery was at 34 weeks gestation. The phenotype consisted of micrognathia, low set ears, hypertelorism, and hydrodcephaly. Review of the literature revealed a single report with multiple de novo aberrations consisting of a 6;14 translocation and a deleted 7. This was diagnosed in the child of a woman with systemic lupus erythematous treated with azathioprine. These types of abnormalities have been known to be induced by chemical and radiation exposure. High resolution banding combined with molecular studies presently improve our ability to detect subtle structural aberrations.

  12. El general de brigada es um tipo de caramelo – tradução automática e aprendizagem cultural.
    DOI: 10.5007/2175-7968.2011v1n27p243

    OpenAIRE

    Nylcea Thereza de Siqueira Pedra; Ruth Bohunovsky

    2011-01-01

    O presente artigo tem por objetivo averiguar o papel assumido pela tradução (automática) no ensino/aprendizagem de línguas estrangeiras. Para tanto, discute-se, primeiramente, diferentes funções didáticas atribuídas à tradução. Entre elas, destaca-se a que objetiva a “aprendizagem cultural”, visando à sensibilização dos aprendizes para aspectos culturais relacionados à língua. Recorrendo a alguns teóricos, problematiza-se o uso de conceitos como “cultura”, “língua” e “tradução” e encontra-se ...

  13. María Teresa Pozzoli, Pensar de nuevo. Ensayos sobre pensamiento complejo (ecología, arte, psicología, educación y vida cotidiana), Editorial Universidad Bolivariana, Santiago, 2009, 243 p.

    OpenAIRE

    Cuadra, César

    2011-01-01

    María Teresa Pozzoli acaba de publicar su tercer libro de ensayos: Pensar de nuevo. Sin duda, un nuevo eslabón en su sostenida tarea por crear nuevas cartografías y nuevas rutas para el pensamiento en este nuevo milenio. Antes de éste, publicó La obediencia de Abraham (ensayo sobre el aprendizaje institucional de la obediencia patológica). Y aun antes, había publicado Complexus (un ensayo que transita por la psicología y las ciencias de la salud, y cuya propuesta apunta a un cambio cultural d...

  14. Multibeam collection for TN243: Multibeam data collected aboard Thomas G. Thompson from 2009-11-07 to 2009-11-09, departing from Seattle, WA and returning to Seattle, WA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  15. New radiochemical methods for determination of 237Np a 241Pu using extraction chromatography (Presentation)

    International Nuclear Information System (INIS)

    Thesis was focused on the development of a new methodology for the separation of anthropogenic transuranium radionuclides 237Np a 241Pu from different kinds of matrices. The analytical methods used in this study were based on extraction chromatography and were optimized according to the sample type. The proposed radiochemical procedure is a combination of two algorithms, which represent the separation of radionuclides by using extraction chromatographic sorbents TEVA resin and TRU resin supplied by Eichrom Technologies LLC. 239Np a 237Np were selectively captured on sorbent TEVA resin in oxidation state 4+. TRU resin was used for purification of plutonium fraction from interfering americium radionuclide. 242Pu and 239Np radionuclides as tracers have been used to monitor the radiochemical yields of separation. Before every radiochemical separation tracer radionuclide 239Np was obtained by separation from the parent radionuclide 243Am, which is in radioactive equilibrium to 239Np. The average yield of chemical separation was 69,3% for 239Np at 277 keV energy line and 65,9% at 228 keV energy line. The NPL AH-B08069 (2008) samples which consist of the mixture of alpha-radionuclides were used for the modification and optimization of separation method used for separation of Np and Pu in model samples. This method provided high radiochemical yields of 239,240Pu (95,0 ± 3,5)% and 237Np (87,9 ± 3,0)%.. Reliability of the method was verified by applying our modified separation procedures on reference materials IAEA-375 and IAEA-414 supplied by International Atomic Energy Agency. A good agreement between the results is obtained by this procedure and the certified values were found. Samples of contaminated soils from the area of Nuclear power plant A-1 Jaslovske Bohunice which is stored temporarily before disposal were analyzed using developed separation procedure. Specific activity of investigated radionuclides was determined in these samples. (author)

  16. New radiochemical methods for determination of 237Np a 241Pu using extraction chromatography

    International Nuclear Information System (INIS)

    Thesis was focused on the development of a new methodology for the separation of anthropogenic transuranium radionuclides 237Np a 241Pu from different kinds of matrices. The analytical methods used in this study were based on extraction chromatography and were optimized according to the sample type. The proposed radiochemical procedure is a combination of two algorithms, which represent the separation of radionuclides by using extraction chromatographic sorbents TEVA resin and TRU resin supplied by Eichrom Technologies LLC. 239Np a 237Np were selectively captured on sorbent TEVA resin in oxidation state 4+. TRU resin was used for purification of plutonium fraction from interfering americium radionuclide. 242Pu and 239Np radionuclides as tracers have been used to monitor the radiochemical yields of separation. Before every radiochemical separation tracer radionuclide 239Np was obtained by separation from the parent radionuclide 243Am, which is in radioactive equilibrium to 239Np. The average yield of chemical separation was 69,3% for 239Np at 277 keV energy line and 65,9% at 228 keV energy line. The NPL AH-B08069 (2008) samples which consist of the mixture of alpha-radionuclides were used for the modification and optimization of separation method used for separation of Np and Pu in model samples. This method provided high radiochemical yields of 239,240Pu (95,0 ± 3,5)% and 237Np (87,9 ± 3,0)%.. Reliability of the method was verified by applying our modified separation procedures on reference materials IAEA-375 and IAEA-414 supplied by International Atomic Energy Agency. A good agreement between the results is obtained by this procedure and the certified values were found. Samples of contaminated soils from the area of Nuclear power plant A-1 Jaslovske Bohunice which is stored temporarily before disposal were analyzed using developed separation procedure. Specific activity of investigated radionuclides was determined in these samples. (author)

  17. Calculated Atomic Volumes of the Actinide Metals

    DEFF Research Database (Denmark)

    Skriver, H.; Andersen, O. K.; Johansson, B.

    1979-01-01

    The equilibrium atomic volume is calculated for the actinide metals. It is possible to account for the localization of the 5f electrons taking place in americium.......The equilibrium atomic volume is calculated for the actinide metals. It is possible to account for the localization of the 5f electrons taking place in americium....

  18. Process for cleaning a nitric acid U/Pu-solution

    International Nuclear Information System (INIS)

    The impure starting solution is passed through a cation exchange column following oxidation of the U/Pu ions present to the hexavalent state. Here the impurities, in particular Americium, are retained and after subsequent elution are handled by known waste treatments or waste utilization (Americium). (orig.)

  19. Chemistry research and development progress report, May-October, 1978

    International Nuclear Information System (INIS)

    Work in progress includes: calorimetry and thermodynamics of nuclear materials; americium recovery and purification; optimization of the cation exchange process for recovering americium and plutonium from molten salt extraction residues, photochemical separations of actinides; advanced ion exchange materials and techniques; secondary actinide recovery; removal of plutonium from lathe coolant oil; evaluation of tributyl phosphate-impregnated sorbent for plutonium-uranium separations; plutonium recovery in advance size reduction facility; plutonium peroxide precipitation; decontamination of Rocky Flats soil; soil decontamination at other Department of Energy sites; recovery of actinides from combustible wastes; induction-heated, tilt-pour furnace; vacuum melting; determination of plutonium and americium in salts and alloys by calorimetry; plutonium peroxide precipitation process; silica removal study; a comparative study of annular and Raschig ring-filled tanks; recovery of plutonium and americium from a salt cleanup alloy; and process development for recovery of americium from vacuum melt furnace crucibles

  20. Industrial research for transmutation scenarios

    Science.gov (United States)

    Camarcat, Noel; Garzenne, Claude; Le Mer, Joël; Leroyer, Hadrien; Desroches, Estelle; Delbecq, Jean-Michel

    2011-04-01

    This article presents the results of research scenarios for americium transmutation in a 22nd century French nuclear fleet, using sodium fast breeder reactors. We benchmark the americium transmutation benefits and drawbacks with a reference case consisting of a hypothetical 60 GWe fleet of pure plutonium breeders. The fluxes in the various parts of the cycle (reactors, fabrication plants, reprocessing plants and underground disposals) are calculated using EDF's suite of codes, comparable in capabilities to those of other research facilities. We study underground thermal heat load reduction due to americium partitioning and repository area minimization. We endeavor to estimate the increased technical complexity of surface facilities to handle the americium fluxes in special fuel fabrication plants, americium fast burners, special reprocessing shops, handling equipments and transport casks between those facilities.

  1. Chemistry research and development progress report, May-October, 1978

    Energy Technology Data Exchange (ETDEWEB)

    Miner, F. J.

    1979-08-30

    Work in progress includes: calorimetry and thermodynamics of nuclear materials; americium recovery and purification; optimization of the cation exchange process for recovering americium and plutonium from molten salt extraction residues, photochemical separations of actinides; advanced ion exchange materials and techniques; secondary actinide recovery; removal of plutonium from lathe coolant oil; evaluation of tributyl phosphate-impregnated sorbent for plutonium-uranium separations; plutonium recovery in advance size reduction facility; plutonium peroxide precipitation; decontamination of Rocky Flats soil; soil decontamination at other Department of Energy sites; recovery of actinides from combustible wastes; induction-heated, tilt-pour furnace; vacuum melting; determination of plutonium and americium in salts and alloys by calorimetry; plutonium peroxide precipitation process; silica removal study; a comparative study of annular and Raschig ring-filled tanks; recovery of plutonium and americium from a salt cleanup alloy; and process development for recovery of americium from vacuum melt furnace crucibles.

  2. Effect of industrial pollution on the distribution of Pu and Am in soil and on soil-to-plant transfer of Pu and Am in a pine forest in SW Finland

    International Nuclear Information System (INIS)

    The effect of industrial pollution on the behavior of plutonium and americium was evaluated in a pine forest in the vicinity of a Cu-Ni smelter in SW Finland. Soil and vegetation were sampled at distances of 0.5, 2, 4 and 8 km from the smelter. The vertical distribution of plutonium and americium was studied in litter, organic layer and mineral layers. The amount of Pu and Am in the litter layer increased and that in the organic layer decreased towards the smelter. Concentrations of plutonium and americium in different vegetation species decreased in the order mushrooms > lichens (Cladina spp., Cetraria islandica) > Empetrum nigrum > Vaccinium vitis-idaea. (author)

  3. Alpha self-irradiation effects in ternary oxides of actinides elements: The zircon-like phases AmIIIVO4 and AIINpIV(VO4)2 (A=Sr, Pb)

    International Nuclear Information System (INIS)

    We report the experimental studies of irradiation damage from alpha decay in neptunium and americium vanadates versus cumulative dose. The isotopes used were the transuranium α-emitter 237Np and the α,γ-emitter 241Am. Neptunium and americium vanadates self-irradiation was studied by X-ray diffraction method (XRD). The comparison of the powder diffraction patterns reveal that the irradiation has no apparent effect on the neptunium phases while the americium vanadate swells and becomes metamict as a function of cumulative dose

  4. The behaviour of Eu, Pu, Am radionuclide at burning radioactive graphite in an oxygen atmosphere. Computer experiments

    Directory of Open Access Journals (Sweden)

    Kolbin T.S.

    2015-01-01

    Full Text Available Be means of the method of computer thermodynamic simulation we studied the behaviour of the europium, plutonium and americium from the combustion of radioactive graphite in oxygen. Europe is in the form of condensed EuOCl, Eu2O3 and vapour EuO. Pluto is in the form of condensed vapour PuO2 and PuO2. Americium is a condensed AmO2, Am2O3 and vapour Am. The basic reactions occurring compounds with europium, plutonium and americium. Equilibrium constants of the reactions have been determined.

  5. Methodology for the Inventory and Assessment of Americium Contamination Level in 1987 in an Area of Palomares Contaminated with Plutonium Weapon Grade; Estimacion del Contenido de Americio Existente en el Ano 1987 en una Zona de Palomares Contaminada en 1966 por Material de Plutonio Grado Bomba

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa, A.; Aragon, A.; Cruz de la, B.

    2001-07-01

    This paper presents a methodology applied for the assessment of the ''241 Am coming from the decay of ''241 Pu isotope content in a contaminated area of Palomares, where the clean-up work done in 1966, given the negligible agricultural importance of such area at the time and its geographical characteristics, was not of the same magnitude as for the rest of the region. (Author) 4 refs.

  6. Phytoremediation: role of terrestrial plants and aquatic macrophytes in the remediation of radionuclides and heavy metal contaminated soil and water.

    Science.gov (United States)

    Sharma, Sunita; Singh, Bikram; Manchanda, V K

    2015-01-01

    Nuclear power reactors are operating in 31 countries around the world. Along with reactor operations, activities like mining, fuel fabrication, fuel reprocessing and military operations are the major contributors to the nuclear waste. The presence of a large number of fission products along with multiple oxidation state long-lived radionuclides such as neptunium ((237)Np), plutonium ((239)Pu), americium ((241/243)Am) and curium ((245)Cm) make the waste streams a potential radiological threat to the environment. Commonly high concentrations of cesium ((137)Cs) and strontium ((90)Sr) are found in a nuclear waste. These radionuclides are capable enough to produce potential health threat due to their long half-lives and effortless translocation into the human body. Besides the radionuclides, heavy metal contamination is also a serious issue. Heavy metals occur naturally in the earth crust and in low concentration, are also essential for the metabolism of living beings. Bioaccumulation of these heavy metals causes hazardous effects. These pollutants enter the human body directly via contaminated drinking water or through the food chain. This issue has drawn the attention of scientists throughout the world to device eco-friendly treatments to remediate the soil and water resources. Various physical and chemical treatments are being applied to clean the waste, but these techniques are quite expensive, complicated and comprise various side effects. One of the promising techniques, which has been pursued vigorously to overcome these demerits, is phytoremediation. The process is very effective, eco-friendly, easy and affordable. This technique utilizes the plants and its associated microbes to decontaminate the low and moderately contaminated sites efficiently. Many plant species are successfully used for remediation of contaminated soil and water systems. Remediation of these systems turns into a serious problem due to various anthropogenic activities that have

  7. Phytoremediation: role of terrestrial plants and aquatic macrophytes in the remediation of radionuclides and heavy metal contaminated soil and water.

    Science.gov (United States)

    Sharma, Sunita; Singh, Bikram; Manchanda, V K

    2015-01-01

    Nuclear power reactors are operating in 31 countries around the world. Along with reactor operations, activities like mining, fuel fabrication, fuel reprocessing and military operations are the major contributors to the nuclear waste. The presence of a large number of fission products along with multiple oxidation state long-lived radionuclides such as neptunium ((237)Np), plutonium ((239)Pu), americium ((241/243)Am) and curium ((245)Cm) make the waste streams a potential radiological threat to the environment. Commonly high concentrations of cesium ((137)Cs) and strontium ((90)Sr) are found in a nuclear waste. These radionuclides are capable enough to produce potential health threat due to their long half-lives and effortless translocation into the human body. Besides the radionuclides, heavy metal contamination is also a serious issue. Heavy metals occur naturally in the earth crust and in low concentration, are also essential for the metabolism of living beings. Bioaccumulation of these heavy metals causes hazardous effects. These pollutants enter the human body directly via contaminated drinking water or through the food chain. This issue has drawn the attention of scientists throughout the world to device eco-friendly treatments to remediate the soil and water resources. Various physical and chemical treatments are being applied to clean the waste, but these techniques are quite expensive, complicated and comprise various side effects. One of the promising techniques, which has been pursued vigorously to overcome these demerits, is phytoremediation. The process is very effective, eco-friendly, easy and affordable. This technique utilizes the plants and its associated microbes to decontaminate the low and moderately contaminated sites efficiently. Many plant species are successfully used for remediation of contaminated soil and water systems. Remediation of these systems turns into a serious problem due to various anthropogenic activities that have

  8. Chemistry research and development. Progress report, November 1978-April 1979

    International Nuclear Information System (INIS)

    The status of the following studies is given: calorimetry and thermodynamics of nuclear materials; americium recovery and purification; optimization of the cation exchange process for recovering americium and plutonium from molten net extraction residues; evaluation and comparison of bidentate extractants and methods for actinide recovery; a combined anion exchange-bidontate organophosphorus extraction process for molten salt extraction residues; a combined anion exchange-extraction chromatography technique for secondary recovery; plutonium recovery in the Advanced Size Reduction Facility; decontamination of Rocky Flats soil; separating lead and calcium from americium by chromate and oxalate precipitation; demonstration of the pyroredox process in the induction-heated, tilt-pour furnace; process development for recovery of americium from vacuum melt furnace crucibles; plutonium peroxide precipitation process; and a comparative study of annular and Raschig ring-filled tanks

  9. Actinide recovery from pyrochemical residues

    International Nuclear Information System (INIS)

    We demonstrated a new process for recovering plutonium and americium from pyrochemical waste. The method is based on chloride solution anion exchange at low acidity, or acidity that eliminates corrosive HCl fumes. Developmental experiments of the process flow chart concentrated on molten salt extraction (MSE) residues and gave >95% plutonium and >90% americium recovery. The recovered plutonium contained 62- from high-chloride low-acid solution. Americium and other metals are washed from the ion exchange column with lN HNO3-4.8M NaCl. After elution, plutonium is recovered by hydroxide precipitation, and americium is recovered by NaHCO3 precipitation. All filtrates from the process can be discardable as low-level contaminated waste. Production-scale experiments are in progress for MSE residues. Flow charts for actinide recovery from electro-refining and direct oxide reduction residues are presented and discussed

  10. Medical grade 238Pu from 241Am: progress report

    International Nuclear Information System (INIS)

    Shielding requirements for fabrication of americium targets were evaluated, a preliminary flowsheet for processing the irradiated Am targets was developed, and the AMRAD computer program, which models the irradiation cycle, was improved

  11. Rubbia proposes a speedier voyage to Mars and back

    CERN Multimedia

    Abbott, A

    1999-01-01

    Carlo Rubbia has designed a propulsion engine that uses fission fragments of americium to directly heat a propulsion gas. He estimates it would allow a manned trip to Mars and back in around a year (8 paragraphs).

  12. An investigation into radiological health and safety at the Ministry of Defence (Procurement Executive) Atomic Weapons Research Establishment, Aldermaston

    International Nuclear Information System (INIS)

    The report is in sections, as follows: introduction; radiation exposure (sources of radiation exposure, monitoring methods, protection criteria, plutonium, uranium, americium, tritium, external exposure, environmental releases, general); problems of staffing; buildings; conclusions. (U.K.)

  13. Literatuuronderzoek plutoniumanalyses

    NARCIS (Netherlands)

    Glastra P; Kwakman PJM; LSO

    1997-01-01

    Dit rapport beschrijft de laatste ontwikkelingen in de radiochemische bepaling van plutonium in monstermatrices zoals luchtstoffilters, regenwater, gras en bodem. De radiochemische scheiding van plutonium van storende alfastralers, zoals americium en curium, is door de recente ontwikkeling van spec

  14. Ascophyllum nodosum (L.) Le Jolis as a bioindicator of radioactivity in the Irish Sea

    OpenAIRE

    Bourne, G S; Assinder, D J

    1991-01-01

    The response of Ascophyllum nodosum to a sudden increase in radioactivity analogous to a nuclear incident is examined in the field. super(137)Cs, super(241)Am and super(239+240)Pu showed net accumulation with exposure time, unlike natural super(228)Th, which was used as a control. Caesium had the highest accumulation rate followed by americium and finally plutonium. Younger plant sections were found to accumulate all the radionuclides significantly faster than older plant sections. Americium ...

  15. Sorption studies of radioelements on geological materials

    OpenAIRE

    Berry, J. A; 油井 三和; 北村 暁

    2007-01-01

    Batch sorption experiments have been carried out to study the sorption of uranium, technetium, curium, neptunium, actinium, protactinium, polonium, americium and plutonium onto bentonite, granodiorite and tuff. Mathematical modelling using the HARPHRQ program and the HATCHES database was carried out to predict the speciation of uranium and technetium in the equilibrated seawater, and neptunium, americium and plutonium in the rock equilibrated water. Review of the literature for thermodynamic ...

  16. Hybrid chemical and nondestructive analysis technique

    International Nuclear Information System (INIS)

    A hybrid chemical/NDA technique has been applied at the Los Alamos National Laboratory to the assay of plutonium in ion-exchange effluents. Typical effluent solutions contain low concentrations of plutonium and high concentrations of americium. A simple trioctylphosphine oxide (TOPO) separation can remove 99.9% of the americium. The organic phase that contains the separated plutonium can be accurately assayed by monitoring the uranium L x-ray intensities

  17. Miniature DIAMEX processes in a hollow fibre module micro-plant: process development and optimisation

    International Nuclear Information System (INIS)

    A hollow fibre module (HFM) micro-plant was built to perform continuous liquid-liquid extraction tests with very small feed volumes, using miniature HFM as phase contactors. Spiked DIAMEX tests (i.e., co-extraction of americium, curium, and lanthanides from PUREX raffinate) were performed in this plant. Following some flow sheet modifications, raffinate decontamination factors of up to 30 000 and 900 were achieved for americium and curium, respectively. (orig.)

  18. Hybrid chemical and nondestructive-analysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Hsue, S.T.; Marsh, S.F.; Marks, T.

    1982-01-01

    A hybrid chemical/NDA technique has been applied at the Los Alamos National Laboratory to the assay of plutonium in ion-exchange effluents. Typical effluent solutions contain low concentrations of plutonium and high concentrations of americium. A simple trioctylphosphine oxide (TOPO) separation can remove 99.9% of the americium. The organic phase that contains the separated plutonium can be accurately assayed by monitoring the uranium L x-ray intensities.

  19. Dynamic tests for actinide/lanthanide separation by CMPO solvent in fluorinated diluents

    International Nuclear Information System (INIS)

    Actinide and lanthanide extraction by new solvent: 0.2 M phenyl-octyl-N,N-diiso-butylcarbamoyl-phosphine oxide (CMPO) + 30% TBP + formal of octafluoro-pentanol was studied. A dynamic test with this solvent was performed. It was shown that americium and lanthanides are effectively extracted from PUREX process raffinate. The separation of americium from light lanthanides was confirmed in the modified SETFICS flowsheet with this new solvent. (authors)

  20. AM(VI) PARTITIONING STUDIES: FY14 FINAL REPORT

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J Mincher

    2014-10-01

    The use of higher oxidation states of americium in partitioning from the lanthanides is under continued investigation by the sigma team. This is based on the hypothesis that Am(VI) can be produced and remain stable in irradiated first cycle raffinate solution long enough to perform solvent extraction for separations. The stability of Am(VI) to autoreduction was measured using millimolar americium concentrations in a 1-cm cell with a Cary 6000 UV/Vis spectrophotometer for data acquisition. At millimolar americium concentrations, Am(VI) is stable enough against its own autoreduction for separations purposes. A second major accomplishment during FY14 was the hot test. Americium oxidation and extraction was performed using a centrifugal contactor-based test bed consisting of an extraction stage and two stripping stages. Sixty-three percent americium extraction was obtained in one extraction stage, in agreement with batch contacts. Promising electrochemical oxidation results have also been obtained, using terpyridine ligand derivatized electrodes for binding of Am(III). Approximately 50 % of the Am(III) was oxidized to Am(V) over the course of 1 hour. It is believed that this is the first demonstration of the electrolytic oxidation of americium in a non-complexing solution. Finally, an initial investigation of Am(VI) extraction using diethylhexylbutyramide (DEHBA) was performed.

  1. Distribution of 239Pu and 241Am in the human skeleton

    International Nuclear Information System (INIS)

    The 241Am and 239Pu distribution in the skeletons of two former nuclear workers has been measured. The skeletons of both individuals appear to be within normal limits for Caucasian men about 50 y old. Both had lower limb bones that were heavier than the age controls and Case I had upper-body bones that were lighter than the age control group. The distribution of americium in the skeleton of Case I, 25 years post exposure, indicated that a more rapid turnover of initially deposited americium on the bone surfaces of cancellous bone, as compared to that deposited on the bone surfaces of compact bone, had occurred. This resulted in a larger proportion of americium located in the compact bone of the extremities and a lesser quantity in the more cancellous bones of the vertebral column, pelvis and rib cage. A similar shift in the distribution of plutonium occurred in Case II in the 35 y since initial deposition, but at a slower rate than that for americium. The ratio of each actinide in the liver to that in the systemic system (liver content/systemic system content) was 0.065 and 0.436, for americium and plutonium, respectively, suggesting that a much more rapid turnover of americium in the liver, compared to plutonium, provided a much larger fraction of that nuclide for circulatory feedback to the remodeling skeletal system. 8 references, 3 tables

  2. Dicty_cDB: Contig-U00892-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 124 ggattattttaaagaattaaagagatatatatatttncttcatctcttttcaaccaataa 183 Query: 184 attgncaaatgaaaatgtgttaccna...|||||||||||||||| Sbjct: 184 attgncaaatgaaaatgtgttaccnataactcaaaactaaataataatattcnactttgc 243 Query: 244 naaa...aacc 303 Query: 304 cnattttaatggctgncctcccnagcttcnaactantgcttgatattatttananataaa 363 |||||||||||||||||||||||...||||||||||||||||||||||||||||||||||||| Sbjct: 304 cnattttaatggctgncctcccnagcttcnaactantgcttgatattatttananataa...Query: 184 attgncaaatgaaaatgtgttaccnataactcaaaactaaataataatattcnactttgc 243 ||||||||||||||||||||||||||||||||

  3. 77 FR 50323 - Railroad Workplace Safety; Roadway Worker Protection Miscellaneous Revisions (RRR)

    Science.gov (United States)

    2012-08-20

    ... of contractor employees at Sec. Sec. 243.1(b), 243.101(e)-(f), and 243.209. 77 FR 6453. These... Railroad Workplace Safety; Roadway Worker Protection Miscellaneous Revisions (RRR); Proposed Rule #0;#0... TRANSPORTATION Federal Railroad Administration 49 CFR Part 214 RIN 2130-AB89 Railroad Workplace Safety;...

  4. Dime, ¿y acaso tú sabes qué e' lo que e' la experiencia? : Barnet, Miguel (2012): Biografía de un cimarrón. La Habana, Editorial de Letras Cubanas, 243 pp. (Primera edición: 1966, Editorial de la Academia de Ciencias de Cuba)

    OpenAIRE

    Recchia Páez, Juan

    2014-01-01

    Me acababa de bajar del camión que nos trajo desde Santiago de Cuba y, caminando por las calles de Manzanillo, un pueblo ubicado en la costa oeste de la provincia de Granma, me adentré en una biblioteca. Enseguida una mujer me preguntó si buscaba algo particular, le conté que soy estudiante de literatura y profesor en escuelas secundarias, por lo que estaba recorriendo librerías de un modo un tanto casual, más bien para ver qué se publicaba y qué se leía en Cuba. Me habló de la circulación de...

  5. University Students Are Unaware of the Role of Academic Librarians. A Review of: Bickley, R. & Corral, S. (2011. Student perceptions of staff in the information commons: A survey at the University of Sheffield. Reference Services Review, 39(2, 223-243. doi:10.1108/00907321111135466

    Directory of Open Access Journals (Sweden)

    Kirsty Thomson

    2012-06-01

    Full Text Available Objective – To discover students’ perceptionsof information commons staff, and todetermine how these perceptions influence theuse of library resources.Design – Post-experience survey with onefollow-up interview.Setting – The University of Sheffield, a postsecondaryinstitution in England.Subjects – All undergraduate andpostgraduate students were invited to takepart. Just over 1% of the student population, or250 students, completed the survey.Methods – Information about the survey wassent to students’ institutional email addresses.One follow up interview was carried out viaemail using the critical incident technique.Main Results – Students do not understandthe academic roles of librarians. They areunlikely to approach library staff for academicsupport, preferring to turn to instructors, otherstudents, friends, and family. Most studentshad positive opinions about assistancereceived in the Information Commons, but asmall number reflected on previous badexperiences with staff, or on a fear of beingmade to feel foolish. The vast majority ofstudents who did not seek help in theInformation Commons stated that this wasbecause they did not require assistance. Most students do not perceive a difference between Information Commons staff and library staff.Conclusion – Students have positive views of Information Commons staff at the University of Sheffield, but have low awareness of the roles of professional librarians. Librarians need to develop partnerships with academic staff and strengthen their presence in both physical and online learning environments to promote their academic roles.

  6. [Dimitri Steinke: Die Zivilrechtsordnungen des Baltikums unter dem Einfluss ausländischer, insbesondere deutscher Rechtsquellen. (Osnabrücker Schriften zur Rechtsgeschichte, Bd. 16.) V&R unipress. Göttingen 2009. 243 S. ISBN 978-3-89971-573-6] / M

    Index Scriptorium Estoniae

    Luts-Sootak, Marju, 1966-

    2011-01-01

    Arvustus: Dimitri Steinke. Die Zivilrechtsordnungen des Baltikums unter dem Einfluss ausländischer, insbesondere deutscher Rechtsquellen. (Osnabrücker Schriften zur Rechtsgeschichte ; 16). Göttingen, 2009

  7. Further Study is Needed to Define and Measure the Use of Reflective Practice in Library and Information Science. A review of: Grant, Maria J. “The Role of Reflection in the Library and Information Sector: A Systematic Review.” Health Information and Libraries Journal 24.3 (2007: 155‐66.

    Directory of Open Access Journals (Sweden)

    Carol Perryman

    2008-03-01

    Full Text Available Objectives ‐ To identify and review the literature of reflective practice in library and information science (LIS in order to understand its role, particularly with regard to health libraries.Design ‐ Systematic reviewSetting ‐ LIS English‐language articles published between 1969 and 2006, and indexed in the Library and Information Science Abstracts (LISA database.Subjects ‐ 929 citations retrieved from the LISA database.Methods ‐ The author conducted free text searches in the LISA database for the terms ‘reflective,’ ‘reflection*,’ or ‘reflexion*.’ An initial search series was conducted in 2004 in order to retrieve items published between 1969‐2003, then in 2007 for articles published between 2004‐2006. In all, 929 article citations were retrieved. Exclusion criteria included those articles addressing the facilitation of reflective practices in others, as well as non‐English language materials,and those pre-dating 1969. After review, 55 articles met the author’s relevance standard.Citation tracking then added 10 articles to the total. From this dataset, full‐text articles were obtained where possible, if determined on initial scrutiny to be deserving of further examination. Thirteen articles (.013% were ultimately selected for analysis. These articles were categorized as analytical or non‐analytical, with respect to perspective (individual or organizational, and recency of events (retrospective or recent. In addition, a determination was made about whether the articles’ foci were reflection occurring on (in retrospect to or in (during practice.Main results ‐ Of thirteen articles, five were found to be non‐analytical, with the other six being analytical. Three of the non-analytical items were the reflections of an individual, while the remaining two offered an organizational perspective. The non-analytical accounts were found to be descriptive accounts by an individual, mostly retrospective and offering no consideration of implications for LIS practice. Analytical reflective accounts attempt to systematically appraise events from the recent past, and draw conclusions in order to improve future actions.Conclusion – A gradual increase in the use of analytical reflective practice is demonstrated over the period from 1969‐2006, although insufficient examples of the practice were found in the published literature. Reflective practice is likely to be beneficial to LIS practitioners, especially when time is spent in considering the implications of lessons learned from practice.

  8. Radiation protection - radionuclides - Synthesis sheets: Thorium-232 (ED 4317), Gallium-67 (ED 4314), Indium-111 (ED 4315), Chromium-51 (ED 4313), Thallium-201 (ED 4312), Phosphorus-33 (ED 4316), Fluorine- 18 (ED 4311), Yttrium-90 (ED 4310), Americium-241 (ED 4308), Strontium-90 (ED 4309), Sulfur-35 (ED 4307), Iodine-125 (ED 4306), Phosphorus-32 (ED 4305), Iodine-123 (ED 4304), Tritium (ED 4303), Carbon-14 (ED 4302), Technetium-99m (ED 4301), Iodine-131 (ED 4300)

    International Nuclear Information System (INIS)

    For each radionuclide, this document presents its characteristics (origin, radio-physical properties, biological properties), gives an overview of its uses, indicates and discusses its dosimetric parameters (for internal or external exposure), indicates radiation detection and contamination measurement techniques, gives an overview of means of protection (for premises, against external or internal exposure), describes the delimitation and control of premises, describes aspects related to personnel classification, training and medical monitoring, comments the issue of effluents and wastes, indicates administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources, addresses the issue of transport, and describes what is to be done in case of incident or accident

  9. Porous metal oxide microspheres from ion exchange resin

    Science.gov (United States)

    Picart, S.; Parant, P.; Caisso, M.; Remy, E.; Mokhtari, H.; Jobelin, I.; Bayle, J. P.; Martin, C. L.; Blanchart, P.; Ayral, A.; Delahaye, T.

    2015-07-01

    This study is devoted to the synthesis and the characterization of porous metal oxide microsphere from metal loaded ion exchange resin. Their application concerns the fabrication of uranium-americium oxide pellets using the powder-free process called Calcined Resin Microsphere Pelletization (CRMP). Those mixed oxide ceramics are one of the materials envisaged for americium transmutation in sodium fast neutron reactors. The advantage of such microsphere precursor compared to classical oxide powder is the diminution of the risk of fine dissemination which can be critical for the handling of highly radioactive powders such as americium based oxides and the improvement of flowability for the filling of compaction chamber. Those millimetric oxide microspheres incorporating uranium and americium were synthesized and characterizations showed a very porous microstructure very brittle in nature which occurred to be adapted to shaping by compaction. Studies allowed to determine an optimal heat treatment with calcination temperature comprised between 700-800 °C and temperature rate lower than 2 °C/min. Oxide Precursors were die-pressed into pellets and then sintered under air to form regular ceramic pellets of 95% of theoretical density (TD) and of homogeneous microstructure. This study validated thus the scientific feasibility of the CRMP process to prepare bearing americium target in a powder free manner.

  10. On the transmutation of Am in a fast lead-cooled system

    Indian Academy of Sciences (India)

    B P Kochurov; V N Konev; A Yu Kwaretzkheli

    2007-02-01

    Characteristics of the equilibrium fuel cycle for the core or a blanket of ADS having the structure of the core of a fast lead-cooled reactor of type BREST (Russian abbreviation for `Bystryy Reaktor so Svintsovym Teplonositelem') in a mode of americium transmutation are calculated. Americium loading was taken 5% of heavy atoms. Keeping the average multiplication factor the same as in a standard equilibrium cycle, reactivity swing over 1 year's microcycle is about 1%, that demands partial fuel reloading with a periodicity of about one month. For one year of operation, 61 kg of americium is destroyed, and due to increased 238Pu content, americium is mainly converted to fission products. Thus in a system of 1 GWt (thermal), 87 kg of americium can be transmuted yearly. The estimate of the reactivity void effect has shown that it increases to 0.6% almost linearly with the void fraction increasing up to 25% and reaches its maximum of 0.7% at a void fraction of about 50%. Application of similar strategy for ADS with a sub-criticality level ≈ 0.96–0.98 can essentially relax safety problems related to positive void effects.

  11. Development of reduction technology for oxide fuels. Lithium reduction of a simulated spent oxide fuel

    International Nuclear Information System (INIS)

    The mixed oxide pellet was reduced with lithium metal in molten lithium chloride at 923 K. The pellet was a sintered product meant to simulate spent oxide fuel containing twelve elements, which are uranium, plutonium, americium, neptunium, curium, cerium, neodymium, samarium, barium, zirconium, molybdenum, and palladium. The pellet remained intact during the reaction and most of lithium oxide, which is the by-product, dissolved in the molten salt. More than 95% of the uranium and plutonium were reduced to metal, while rare-earth elements formed an oxide solid solution in the pellet. Several percent of the initial amount of plutonium and americium was exuded from the pellet and precipitated on the bottom of the crucible. That is different from the result of the previous reduction test using a MOX (uranium-plutonium-americium ternary) pellet in which approximately 80% of the americium was exuded. The exudation of americium is considered to be suppressed by the formation of solid solution with rare-earth oxides. 10 to 30% of rare earth elements were exuded and dissolved in the molten salt. The concentrations of cerium and neodymium in the salt were consistent with the values which were calculated thermodynamically using their solubilities in lithium chloride-lithium oxide mixed molten salt. Most of the barium dissolved in the molten salt as a chloride; on the other hand, palladium remained in the pellet to form an alloy with plutonium. (author)

  12. Application of insoluble tannin adsorbent to alpha aqueous waste treatment in NUCEF

    International Nuclear Information System (INIS)

    The use of insoluble tannin adsorbent has been investigated as a means to reduce the volume of aqueous waste contaminated with americium. This work is aimed at reducing the volume of TRU waste generated within NUCEF where experiments related to back end of the nuclear fuel cycle are performed. Insoluble tannin adsorbent is a gelled material consisting of C, H and O which can be easily incinerated. The distribution coefficient and adsorption capacity of americium in insoluble tannin have been investigated and found to be 1000 ml/g in 0.02 M HNO3 and 0.013 mmol/g-dried tannin, respectively. The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (author)

  13. Transuranic separation using organophophorus extractants adsorbed onto superparamagnetic carriers

    International Nuclear Information System (INIS)

    Polymeric coated ferromagnetic carriers with an absorbed layer of octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) diluted by tributyl phosphate (TBP) are being evaluated for application in the separation and the recovery of low concentrations of americium, plutonium, and uranium from nuclear waste solutions. Due to their chemical nature, these extractants selectively complex americium and plutonium contaminants onto the particles and the complexed particles can be recovered from the solution using a magnet. Physical and chemical characterization of the extractant-absorbed particles were performed by gamma and liquid scintillation counting, scanning electron microscopic (SEM) micrograph, and other physical measurements. Plutonium, americium, and uranium separations have been performed at various HNO3 and HCl concentrations. Parameters were studied to determine the limitations and capacity of the process. The status of the chemistry and application of the process to Department of Energy (DOE) remediation efforts for actinide decontamination are discussed

  14. Facilities for preparing actinide or fission product-based targets

    CERN Document Server

    Sors, M

    1999-01-01

    Research and development work is currently in progress in France on the feasibility of transmutation of very long-lived radionuclides such as americium, blended with an inert medium such as magnesium oxide and pelletized for irradiation in a fast neutron reactor. The process is primarily designed to produce ceramics for nuclear reactors, but could also be used to produce targets for accelerators. The Actinide Development Laboratory is part of the ATALANTE complex at Marcoule, where the CEA investigates reprocessing, liquid and solid waste treatment and vitrification processes. The laboratory produces radioactive sources; after use, their constituents are recycled, notably through R and D programs requiring such materials. Recovered americium is purified, characterized and transformed for an experiment known as ECRIX, designed to demonstrate the feasibility of fabricating americium-based ceramics and to determine the reactor transmutation coefficients.

  15. Colloid formation during waste form reaction: implications for nuclear waste disposal

    Science.gov (United States)

    Bates, J. K.; Bradley, J.; Teetsov, A.; Bradley, C. R.; ten Brink, Marilyn Buchholtz

    1992-01-01

    Insoluble plutonium- and americium-bearing colloidal particles formed during simulated weathering of a high-level nuclear waste glass. Nearly 100 percent of the total plutonium and americium in test ground water was concentrated in these submicrometer particles. These results indicate that models of actinide mobility and repository integrity, which assume complete solubility of actinides in ground water, underestimate the potential for radionuclide release into the environment. A colloid-trapping mechanism may be necessary for a waste repository to meet long-term performance specifications.

  16. The influence of temperature on migration of radionuclides in deep-sea sediments: Simulation experiments concerning sorption and heat flow related to deep-sea disposal of high-level radioactive waste

    International Nuclear Information System (INIS)

    This report presents the results of a study on the effects of temperatures up to 900C on the migration of the radionuclides plutonium, neptunium and americium through marine sediments in the near field of a canister with radioactive waste. Topics entered were; (i) the influence of temperature on the distribution coefficients of the transuranics plutonium, americium and neptunium, (ii) the effect of temperature on the composition and characteristics of interstitial water and (iii) the effects of a point heat source on the temperature distributions and flow velocities in interstitial water of sediments. (Auth.)

  17. Artificial radionuclides in the atmosphere over Lithuania

    International Nuclear Information System (INIS)

    Systematic observations of radionuclide composition and concentration in the atmosphere have been carried out at the Institute of Physics in Vilnius since 1963. An increase in activity concentration of radionuclides in the atmosphere was observed after nuclear weapon tests and the Chernobyl NPP accident. At present the radiation situation in Lithuania is determined by two main sources of radionuclides, forest fire and resuspension products transferred from highly polluted region of the Ukraine and Belarus. During forest fires the increase in activity concentration of 137Cs in the atmosphere was registered in many countries and in Lithuania as well. This work summarizes the experimental data on transport of cesium, plutonium, americium from the highly contaminated territories after the Chernobyl accident. The activity concentrations of 137Cs were measured in two - three days samples while plutonium and americium in monthly samples. In addition, the analyses of the events of the increase activity concentration, meteorological situation, speciation of radionuclides and mechanisms of formation and transformation of aerosol carriers of radionuclides are presented. Aerosols were sampled on perchlorvinyl filters and the large volume air samplers with a flow rate from 2400 m3/h to about 6000 m3/h were used. The radiochemical analyses of monthly samples of aerosol ashes (about 30 g) were performed. For separation of Pu isotopes the TOPO/cyclohexane extraction and radiochemical purification using UTEVA resin were performed, Am was separated after TOPO/cyclohexane extraction using TRU and TEVA resins (100-150 μm). 242Pu and 243Am were used as tracers in the separation procedure. The alpha spectrometry measurements of Pu and Am isotopes deposited on a stainless steel disc were carried out with the Alphaquattro (Silena) spectrometer. 137Cs was determined by gamma-ray spectrometry using the high purity HPGe detector (resolution - 1.9 keV/1.33 Mev, efficiency - 42%). Accuracy

  18. Local Purchasing of Journals is Required in Addition to a Nationally Purchased Collection to Meet the Information Needs of NHS Staff. A review of: Glover, Steven William, John Addison, Colette Gleghorn, and John Bramwell. “Journal Usage in NHS Hospitals: A Comparison Report of Total Usage at an Acute NHS Trust and a Specialist NHS Trust in the North West of England.” Health Information and Libraries Journal 24.3 (2007): 193‐9.

    OpenAIRE

    Jennie Kelson

    2008-01-01

    Objective ‐ To compare journal usage between an acute National Health Service (NHS) Trust and a specialist NHS Trust located in North West England to provide some evidence as to how well the National Core Content Collection (provided by ProQuest) meets the needs of staff in these settings.Design ‐ Comparative studySetting ‐ An acute NHS Trust, comprising four hospital sites, and a cancer specialist NHS Trust based on a single site. Both Trusts are located in North West England. The cancer spe...

  19. Isolating 241Am from waste solutions containing Al, Ca, Fe, and Cr

    International Nuclear Information System (INIS)

    About 2.4 kg of 241Am contaminated with calcium and aluminum had been recovered from low-activity waste during recycle of 11% 240Pu. A process was developed and demonstrated to purify the americium before shipment as 241AmO2. The americium and some of the calcium were batch extracted into 50% TBP-n-paraffin from 2.2M Al(NO3)3 - 0.3M HNO3 solution in a canyon tank. Pregnant solvent was scrubbed first with 2.1M Al3+-0.3M Li+-6.7M NO3- and then with 7M LiNO3 to reduce the calcium content and to displace the aluminum. Americium was then stripped from the solvent with water and concentrated by evaporation. Before precipitating the americium with oxalic acid, the nitric acid was adjusted with NH4OH to yield a 1M NH4NO3 solution. Recovery across the batch extraction step was 97.8%, while 93% of the calcium and >99% of the aluminum was rejected. Recovery across precipitation averaged >96% while producing a product which was >99.3% pure 241AmO2. The major impurities were water, carbon, calcium, iron, and zinc

  20. 75 FR 34774 - Notice of Availability of Environmental Assessment and Finding of No Significant Impact for...

    Science.gov (United States)

    2010-06-18

    ...-lives greater than 120 days: Barium 133, cesium 137, americium 241, and uranium 238. Prior to performing... 20 for unrestricted release. Because NRC has not established a screening value for barium 133, the licensee developed a DCGL for barium 133 for its Facility. The Licensee developed the barium 133 DCGL...