WorldWideScience

Sample records for americium 240

  1. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  2. I. Nuclear Production Reaction and Chemical Isolation Procedure for Americium-240 II. New Superheavy Element Isotopes: Plutonium-242(Calcium-48,5n)(285)114

    Science.gov (United States)

    Ellison, Paul Andrew

    2011-12-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242 Pu(p, 3n)240Am nuclear reaction was measured to be lower than theoretical predictions, but high enough to be the most viable nuclear reaction for the large-scale production of 240 Am. Details of the development of a chemical separation procedure for isolating 240Am from proton-irradiated 242Pu are discussed. The separation procedure, which includes two anion exchange columns and two extraction chromatography columns, was experimentally investi- gated using tracer-level 241Am, 239Pu, and model proton-induced fission products 95Zr, 95Nb, 125Sb, and 152Eu. The separation procedure was shown to have an Am/Pu separation factor of >2x10 7 and an Am yield of ˜70%. The separation procedure was found to purify the Am sample from >99.9% of Eu, Zr, Nb, and Sb. The procedure is well suited for the processing of ˜1 gram of proton-irradiated 242Pu to produce a neutron-induced fission target consisting of tens of nanograms of 240Am. Part II describes the use of the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron for the study of the 242Pu(48Ca,5n)285114 nuclear re- action. The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV ( E* = 50 MeV). The alpha decay of 285114 was followed by the sequential alpha decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269 Sg. 265Rf was observed to decay by spontaneous fission. The measured alpha-decay Q-values were compared with those from a macroscopic

  3. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  4. Plutonium and americium in soil organic matter

    International Nuclear Information System (INIS)

    A gley soil from west Cumbria, with specific activities in its surface horizon of 5-10 kBq kg-1239,240Pu and comparable 241Am levels, has been used as a source of actinide-enriched organic fractions. Humic and fulvic acids were isolated by conventional alkali extraction and investigated by gel filtration, treatment with organic solvents and differential flocculation procedures. All these techniques are capable of resolving the organics into two or more fractions, with specific activities up to 80 kBq kg-239,240Pu. There is evidence for differentiation of plutonium and americium, with americium being concentrated, to some extent, in the lower molecular weight fractions from gel filtration. (author)

  5. Americium recovery from reduction residues

    Science.gov (United States)

    Conner, W.V.; Proctor, S.G.

    1973-12-25

    A process for separation and recovery of americium values from container or bomb'' reduction residues comprising dissolving the residues in a suitable acid, adjusting the hydrogen ion concentration to a desired level by adding a base, precipitating the americium as americium oxalate by adding oxalic acid, digesting the solution, separating the precipitate, and thereafter calcining the americium oxalate precipitate to form americium oxide. (Official Gazette)

  6. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  7. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  8. Americium-241 - ED 4308

    International Nuclear Information System (INIS)

    This sheet presents the characteristics of Americium-241, its origin, and its radio-physical and biological properties. It briefly describes its use in nuclear medicine. It indicates its dosimetric parameters for external exposure, cutaneous contamination, and internal exposure due to acute contamination or to chronic contamination. It indicates and comments the various exposure control techniques: ambient dose rate measurement, surface contamination measurement, atmosphere contamination. It addresses the means of protection: premise design, protection against external exposure and against internal exposure. It describes how areas are delimited and controlled within the premises: regulatory areas, controls to be performed. It addresses the personnel classification, training and medical survey. It addresses the issue of wastes and effluents. It briefly recalls the administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources. It indicates regulatory aspects related to the road transport of Americium-241, describes what is to be done in case of incident or accident (for the different types of contamination or exposure)

  9. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  10. Americium 241 in vegetation of natural biocenoses and agrocenoses on Belarus territories contaminated with Chernobyl fall-out

    International Nuclear Information System (INIS)

    As a result of beta-decay of plutonium 241 the content of americium 241 increases progressively in soils, contaminated with Chernobyl trans uranium elements. Americium 241 displayed higher (0,5 - 1,5-fold) biological mobility than isotopes of plutonium 239, 240. Activity of americium 241 in surface phyto mass of wild and cultural plants varies from 0,04 to 5,9 Bq/kg of dry weight. Americium 241 contribution to the total trans uranium elements contamination of plants made up 60 - 80% in 1996 - 1998. Investigation of trials from the areas adjacent to the 30-km zone showed that mobility of americium 241 and plutonium was 5 - 15 times as high as in the zone

  11. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  12. BIO 240 Tutorials /bio240dotcom

    OpenAIRE

    veena022

    2015-01-01

    BIO 240 Entire Course (UOP) For more course tutorials visit www.bio240.com BIO 240 Week 1 DQ 1 Cells BIO 240 Week 1 DQ 2 Virus BIO 240 Week 1 Comparing Cell Structures Worksheet  BIO 240 Week 1 Photosynthesis and Respiration Paper  BIO 240 Week 2 DQ 1 BIO 240 Week 2 DQ 2 BIO 240 Week 3 DQ 1  BIO 240 Week 3 DQ 2  BIO 240 Week 3 Learning Team Outline BIO 240 Week 3 DNA and Protein Synthesis BIO 240 Week 4 DQ 1 BIO 240 W...

  13. Science and Technology for Americium Transmutation

    International Nuclear Information System (INIS)

    Americium could be seen as the most troublesome element that is present in nuclear fuel. This thesis offers different points of view on the possibility of americium transmutation. The first point of view elaborates simulations of americium-bearing facilities, namely nuclear data, a popular computational code and modeling techniques. The second point of view is focused on practical usage of the simulations to examine upper limit of americium in a specific reactor

  14. Transmutation of Americium in Fast Neutron Facilities

    OpenAIRE

    Zhang, Youpeng

    2011-01-01

    In this thesis, the feasibility to use a medium sized sodium cooled fast reactor fully loaded with MOX fuel for efficient transmutation of americium is investigated by simulating the safety performance of a BN600-type fast reactor loaded with different fractions of americium in the fuel, using the safety parameters obtained with the SERPENT Monte Carlo code. The focus is on americium mainly due to its long-term contribution to the radiotoxicity of spent nuclear fuel and its deterioration on c...

  15. HCA 240 uop / uophelp

    OpenAIRE

    uophelp

    2015-01-01

    HCA 240 Assignment: Blood Disorders HCA 240 Exercise: Name That Pathogen HCA 240 CheckPoint: Nervous System Diseases HCA 240 CheckPoint: Nutrition and the Food Pyramid HCA 240 CheckPoint 2: Radio Ad HCA 240 WEEK 1 Discussion Question 1 HCA 240 WEEK 1 Discussion Question 2 HCA 240 WEEK 3 Discussion Question 1 HCA 240 WEEK 3 Discussion Question 2 HCA 240 WEEK 5 Discussion Question 1 HCA 240 WEEK 5 Discussion Question 2 HCA 240 WEEK 7 Discussion Questi...

  16. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  17. Production of americium isotopes in France

    International Nuclear Information System (INIS)

    The program of productions of americium 241 and 243 isotopes is based respectively on the retreatment of aged plutonium alloys or plutonium dioxide and on the treatment of plutonium targets irradiated either in CELESTIN reactors for Pu-Al alloys or OSIRIS reactor for plutonium 242 dioxide. All the operations, including americium final purifications, are carried out in hot cells equipped with remote manipulators. The chemical processes are based on the use of extraction chromatography with hydrophobic SiO2 impregnated with extracting agents. Plutonium targets and aged plutonium alloys are dissolved in nitric acid using conventional techniques while plutonium dioxide dissolutions are performed routine at 300 grams scale with electrogenerated silver II in 4M HNO3 at room temperature. The separation between plutonium and americium is performed by extraction of Pu(IV) either on TBP/SiO2 or TOAHNO3/SiO2 column. Americium recovery from waste streams rid of plutonium is realized by chromatographic extraction of Am(III) using mainly TBP and episodically DHDECMP as extractant. The final purification of both americium isotopes uses the selective extraction of Am(VI) on HDDiBMP/SiO2 column at 60 grams scale. Using the overall process a total amount of 1000 grams of americium 241 and 100 grams of americium 243 has been produced nowadays and the AmO2 final product indicates a purity better than 98.5%

  18. Determination of specific activity of americium and plutonium in selected environmental samples

    International Nuclear Information System (INIS)

    The aim of this work was development of method for determination of americium and plutonium in environmental samples. Developed method was evaluated on soil samples and after they was applied on selected samples of fishes (smoked mackerel, herring and fillet from Alaska hake). The method for separation of americium is based on liquid separation with Aliquate-336, precipitation with oxalic acid and using of chromatographic material TRU-SpecTM.The intervals of radiochemical yields were from 13.0% to 80.9% for plutonium-236 and from 10.5% to 100% for americium-241. Determined specific activities of plutonium-239,240 were from (2.3 ± 1.4) mBq/kg to (82 ± 29) mBq/kg, the specific activities of plutonium-238 were from (14.2 ± 3.7) mBq/kg to (708 ± 86) mBq/kg. The specific activities of americium-241 were from (1.4 ± 0.9) mBq/kg to (3360 ± 210) mBq/kg. The fishes from Baltic Sea as well as from North Sea show highest specific activities then fresh-water fishes from Slovakia. Therefore the monitoring of alpha radionuclides in foods imported from territories with nuclear testing is recommended

  19. Study of americium sorption by humic acids

    International Nuclear Information System (INIS)

    The results of investigation of influence of the cation content and acidity of soil solution on americium sorption by the humic acids have been shown. The most influence on the interphase distribution coefficient in the system 'humic acid - model soil solution' is caused by the presence of the iron (III), calcium ions and acidity of the solution. The increase of the sodium ions concentration in the solution makes an insignificant impact on the americium sorption. (Authors)

  20. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  1. Upper Limits to Americium Concentration in Medium Size Sodium Cooled Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.P.; Wallenius, J. [Royal Institute of Technology (KTH), AlbaNova University Centre, S-106 91, Stockholm (Sweden)

    2009-06-15

    The fastest way to realize transmutation of minor actinides would be using existing reactor types, adding some proper modifications to allow for insertion of MA in the fuel. According to calculations by Fazio and co-workers, the consumption rate of TRU in a low conversion ratio fast reactor may reach 70-75 % of that of an ADS with uranium free fuel [1]. However, americium introduction brings a negative influence on several safety parameters such as {beta}{sub eff}, Doppler coefficient, coolant temperature coefficient and void worth. Therefore the upper limit of americium that can be included into the fuel needs to be carefully evaluated. In this paper, fast reactor fuels with various minor actinide fractions are loaded into a SAS4A model of the semi-commercial BN600 reactor. Unprotected loss of flow (ULOF) and transient over power (UTOP) accidents are modelled using safety parameters obtained from Monte Carlo simulations as well as from the deterministic calculations published by Fazio et al. Applying the latter parameters (obtained with VARI3D), the upper limit to MA concentration in the fuel of a medium sized SFR of BN-600 type appears at 12%, corresponding to 8% of americium. We note however that the Doppler constants displayed by Fazio et al for MA concentrations above 10% have a considerably larger magnitude than those obtained with MCNP. Applying the safety parameters obtained with Monte Carlo simulations and updated nuclear data evaluations, we find that the upper limit to the americium concentration allowing to survive a ULOF is about half of that inferred by the use of parameters from VARI-3D. Since such a difference has a major impact on the predicted americium transmutation capability of SFR, it is of high priority to analyse the reasons for the apparent discrepancies. We note here that the major contribution to the Doppler feedback comes from capture resonance in U-238 and Pu-240 residing below the sodium scattering resonance located at 3 keV, and that

  2. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  3. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  4. Formation of americium and europium humate complexes

    International Nuclear Information System (INIS)

    Binding constants of americium and europium with a humic acid were determined to study if complex formation of trivalent actinide-humates affects dissolved species of the actinides in hydrosphere. The purified humic acid was characterized by means of UV-vis, IR, and pH titration, indicating high carboxylate capacity and low aromaticity. Binding constants of americium and europium humates were determined at pH 4.6 and 6.0 by solvent extraction using 241Am or 152Eu as a tracer. The binding constants for americium-humate obtained preliminarily suggest that complexes with humic acid are not negligible in speciation of trivalent actinides in hydrosphere. The obtained binding constants were nearly identical with those determined previously by the same procedures, but with humic acids of different origin and compositions. (author)

  5. BIO 240 Course tutorial/ indigohelp

    OpenAIRE

    ADGF

    2015-01-01

    For more classes visit www.indigohelp.com   BIO 240 Week 1 DQ 1 Cells BIO 240 Week 1 DQ 2 Virus BIO 240 Week 1 Comparing Cell Structures Worksheet BIO 240 Week 1 Photosynthesis and Respiration Paper BIO 240 Week 2 DQ 1 BIO 240 Week 2 DQ 2 BIO 240 Week 3 DQ 1 BIO 240 Week 3 DQ 2 BIO 240 Week 3 Learning Team Outline BIO 240 Week 3 DNA and Protein Synthesis BIO 240 Week 4 DQ 1 BIO 240 Week 4 DQ2 BIO 240 Week 4 Natural Selection Pap...

  6. Preparation of americium source for smoke detector

    International Nuclear Information System (INIS)

    This report describes the method developed for the preparation of 241Am source for smoke detector. Americium was electrodeposited from iso-propyl alcohol medium on silver backing. Thin layer of gold (few hundred micro gram thick) was plated on the americium source to make it safe for handling. The thickness of plated gold was such that the alpha radiations from the 241Am source could escape out of the gold layer and cause ionisation in the surrounding air. The performance of the prepared sources were checked in a smoke detector and was found to be satisfactory and comparable to the imported sources. (author). 1 refs., 2 figs., 1 tab

  7. Report of scouting study on precipitation of strontium, plutonium, and americium from Hanford complexant concentrate waste

    International Nuclear Information System (INIS)

    A laboratory scouting test was conducted of precipitation methods for reducing the solubility of radionuclides in complexant concentrate (CC) waste solution. The results show that addition of strontium nitrate solution is effective in reducing the liquid phase activity of 90Sr (Strontium) in CC waste from tank 107-AN by 94% when the total strontium concentration is adjusted to 0.1 M. Addition of ferric nitrate solution effective in reducing the 241Am (Americium) activity in CC waste by 96% under the conditions described in the report. Ferric nitrate was also marginally effective in reducing the solubility of 239/240Pu (Plutonium) in CC waste

  8. Recovery of americium-241 from raffinates of plutonium purification columns

    International Nuclear Information System (INIS)

    Recovery and purification of americium from ion exchange raffinates generated during purification of aged plutonium is described. The method consists of the following stages: (i) co-precipitation of americium with kilogramme quantities of rare earth oxalates, (ii) destruction of oxalate and removal of residual plutonium from nitric acid medium using anion exchange process, (iii) preliminary separation of americium making use of its preferential uptake on an anion exchange column from thiocyanate medium and (iv) extraction of americium and remaining rare earths into di-(2-ethyl hexyl) phosphoric acid followed by preferential back washing of americium by lactic acid medium containing DTPA. (author)

  9. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  10. Americium separations from high salt solutions

    International Nuclear Information System (INIS)

    Americium (III) exhibits an unexpectedly high affinity for anion-exchange material from the high-salt evaporator bottoms solutions--an effect which has not been duplicated using simple salt solutions. Similar behavior is observed for its lanthanide homologue, Nd(III), in complex evaporator bottoms surrogate solutions. There appears to be no single controlling factor--acid concentration, total nitrate concentration or solution ionic strength--which accounts for the approximately 2-fold increase in retention of the trivalent ions from complex solutions relative to simple solutions. Calculation of species activities (i.e., water, proton and nitrate) in such concentrated mixed salt solutions is difficult and of questionable accuracy, but it is likely that the answer to forcing formation of anionic nitrate complexes of americium lies in the relative activities of water and nitrate. From a practical viewpoint, the modest americium removal needs (ca. 50--75%) from nitric acid evaporator bottoms allow sufficient latitude for the use of non-optimized conditions such as running existing columns filled with older, well-used Reillex HPQ. Newer materials, such as HPQ-100 and the experimental bifunctional resins, which exhibit higher distribution coefficients, would allow for either increased Am removal or the use of smaller columns. It is also of interest that one of the experimental neutral-donor solid-support extractants, DHDECMP, exhibits a similarly high level of americium (total alpha) removal from EV bottoms and is much less sensitive to total acid content than commercially-available material

  11. Decontaminaion of metals containing plutonium and americium

    International Nuclear Information System (INIS)

    Melt-slagging (melt-refining) techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7 x 106 were measured with boro-silicate slag and of 3 x 106 with calcium, magnesium silicate slag. Decontamination of metals containing as much as 14,000 ppM plutonium appears to be as efficient as for metals with plutonium levels of 400 ppM. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. The second extraction is effective with either resistance-furnace melting or electric-arc melting. Slag adhering to the metal ingots and in defects within the ingots is in the important contributors to plutonium retained in processed metals. If these sources of plutonium are controlled, the melt-refining process can be used on a large scale to convert highly contaminated metals to homogeneous and compact forms with very low concentrations of plutonium and americium. A conceptual design of a melt-refining process to decontaminate plutonium- and americium-contaminated metals is described. The process includes single-stage refining of contaminated metals to produce a metal product which would have less than 10 nCi/g of TRU-element contamination. Two plant sizes were considered. The smaller conceptual plant processes 77 kg of metal per 8-h period and may be portable.The larger one processes 140 kg of metal per 8-h period, is stationary, and may be near te maximum size that is practical for a metal decontamination process

  12. Contemporary state of plutonium and americium in the soils of Palesse state radiation-ecological reserve

    International Nuclear Information System (INIS)

    Full text: At present, the most important alpha-emitting radionuclides of Chernobyl origin are Pu 238, Pu 239, Pu 240 and Am 241. They are classified as the most dangerous group of radionuclides in view of the long half-lives and high radiotoxicity. The main part of alpha-emitted radionuclides is located within the Palesse State Radiation-Ecological Reserve. One of the most important factors determining the radioecological situation in the contaminated ecosystems is the physicochemical forms of radionuclides in a soil medium. Radionuclide species determine the radionuclide entrance into the soil solutions, their redistribution in soil profiles and the 'soil - plant' and the 'soil - surface, ground or underground water' systems as well as spreading beyond the contaminated area. The present work is devoted to investigation of state and migration ability of plutonium and americium in soils of the Palesse state radiation-ecological reserve after more than 20 years from the Chernobyl accident. The objects of investigation were mineral and organic soils sampled in 2008 with the step of 5 cm to the depth of 25-30 cm. The forms of plutonium and americium distinguishing by association with the different components of soil and by potential for migration in the soil medium were studied using the method of sequential selective extraction according to the modified Tessier scheme. Activities of Pu 238, Pu 239, Pu 240 and Am 241 in the samples were determined by the method of radiochemical analysis with alpha-spectrometer radionuclide identification. The dominant part of plutonium and americium in the soils is in immobile forms. Nowadays, radionuclide portions in water soluble and reversibly bound forms do not exceed 9.4 % of radionuclide content in the soil. In mineral soil samples, the radionuclide portions in these fractions exceed the corresponding portions in organic ones. In both mineral and organic soils, the portions of mobile americium are higher than plutonium. The

  13. PSY 240 Course Tutorial / Snaptutorial

    OpenAIRE

    Aster

    2015-01-01

    PSY 240 Week 1 CheckPoint The Nature-Nurture Issue PSY 240 Week 1 DQ 1 and DQ 2 PSY 240 Week 2 CheckPoint The Nervous System PSY 240 Week 2 Assignment The Brain PSY 240 Week 3 CheckPoint Brain Studies PSY 240 Week 3 DQ 1 and DQ 2 PSY 240 Week 4 CheckPoint Eating What, When, and How Much PSY 240 Week 4 CheckPoint Set and Settling Points PSY 240 Week 4 Assignment To Eat or Not to Eat PSY 240 Week 5 CheckPoint Sexual Orientation and Identity PSY 240 Week 5...

  14. Plutonium and americium concentrations and vertical profiles in some Italian mosses used as bioindicators

    International Nuclear Information System (INIS)

    We have examined the uptake of actinide elements Am and Pu by different species of lichen and moss collected in two locations (Urbino, Central Italy; Alps region, North-east Italy). Plutonium and americium were separated and determined by extraction chromatography, electrodeposition and alpha-spectrometry. This paper summarizes our results with a special emphasis on the vertical profiles of these actinides in two different species of mosses. Several 1-2 cm depth sections were obtained and dated by 210Pb method. A typical peak for 239,240Pu and 241Am was found in the very old moss species ('Sphagnum Compactum') at a depth corresponding to the period 1960-1970 which was the period characterized by the maximum nuclear weapon tests. In a younger moss species ('Neckeria Crispa') no peak was observed and the regression curves showed that Am is more mobile than 239,240Pu and 238Pu. (author)

  15. Status of Americium-241 recovery at Rocky Flats Plant

    International Nuclear Information System (INIS)

    This paper is presented in two parts: Part I, Molten Salt Extraction of Americium from Molten Plutonium Metal, and Part II, Aqueous Recovery of Americium from Extraction Salts. The Rocky Flats recovery process used for waste salts includes (1) dilute hydrochloric acid dissolution of residues; (2) cation exchange to convert from the chloride to the nitrate system and to remove gross amounts of monovalent impurities; (3) anion exchange separation of plutonium; (4) oxalate precipitation of americium; and (5) calcination of the oxalate at 6000C to yield americium oxide. The aqueous process portion describes attempts to improve the recovery of americium. The first part deals with modifications to the cation exchange step; the second describes development of a solvent extractions process that will recovery americium from residues containing aluminium as well as other common impurities. Results of laboratory work are described. 3 figures, 6 tables. (DP)

  16. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  17. Americium transfer studies using hollow fiber/extractant membranes

    International Nuclear Information System (INIS)

    Americium can be removed from low acid/high nitrate feeds using hollow fiber membrane modules. Americium can be concentrated in the stripping solution. (Maximum observed concentration was a factor of 3.1). Accurel hollow fibers are less prone to leakage problems

  18. Electronic structure of compressed americium metal

    Czech Academy of Sciences Publication Activity Database

    Kolorenč, Jindřich; Shick, Alexander; Caciuffo, R.

    Cambridge: Cambridge University Press,, 2012 - (Anderson, D.; Boot, C.; Burns, P.), s. 177-182. (Materials Research Society Symposium Proceedings. 1444). ISBN 978-1-60511-421-7. ISSN 0272-9172. [2012 MRS Spring Meeting. Sacramento (CA), 09.04.2012-13.04.2012] R&D Projects: GA ČR(CZ) GAP204/10/0330; GA AV ČR IAA100100912 Institutional research plan: CEZ:AV0Z10100520 Keywords : americium * X-ray spectroscopy * LDA+DMFT Subject RIV: BM - Solid Matter Physics ; Magnetism http://journals.cambridge.org/article_S1946427412009463

  19. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    International Nuclear Information System (INIS)

    A dual isotope method has been used to study the transfer of 137Cs, 239/240Pu and 241Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10-5 - 10-4, with mean values of 7 x 10-5 and 4 x 10-5 obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10-4 recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  20. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.I.; Weekes, T.E.C. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Biological and Nutritional Sciences; Rimmer, D.L. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Agricultural and Environmental Science; Green, N.; Wilkins, B.T. [National Radiological Protection Board, Chilton (United Kingdom)

    1997-12-31

    A dual isotope method has been used to study the transfer of {sup 137}Cs, {sup 239/240}Pu and {sup 241}Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10{sup -5} - 10{sup -4}, with mean values of 7 x 10{sup -5} and 4 x 10{sup -5} obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10{sup -4} recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  1. NTC 240 Course Tutorial / Indigohelp

    OpenAIRE

    jeethu

    2015-01-01

    For more classes visit www.indigohelp.com   NTC 240 Week 2 Individual Assignment : OSI Model Key Terms NTC 240 Week 3 Individual Assignment : LAN Topologies NTC 240 Week 4 Individual Assignment : Vocabulary Definitions NTC 240 Week 5 Individual Assignment : Security Threats

  2. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  3. Modelling of americium stripping in the EXAm process

    International Nuclear Information System (INIS)

    The EXAm process aims at recovering americium alone contained in the PUREX raffinate. The americium stripping model has been revised to take into account a change of stripping aqueous phase and up-to-date experimental results conducted within DRCP to improve knowledge about complexes. This work represents a first approximation at modelling americium stripping. The modelling work has led to synthesize the knowledge on chemical phenomenology and adopt assumptions that best reflect experimental results. The modelling has been implemented in PAREX code in order to simulate this step to prepare and understand tests to be carried out in mixer settlers. (authors)

  4. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  5. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  6. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  7. Americium/Curium Disposition Life Cycle Planning Study

    International Nuclear Information System (INIS)

    At the request of the Department of Energy Savannah River Office (DOE- SR), Westinghouse Savannah River Company (WSRC) evaluated concepts to complete disposition of Americium and Curium (Am/Cm) bearing materials currently located at the Savannah River Site (SRS)

  8. Plutonium and americium in Arctic waters, the North Sea and Scottish and Irish coastal zones (in Fucus, Mytilus and Patella)

    International Nuclear Information System (INIS)

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were collected from the Irish coast in 1983. Fallout is found to dominate as a source of 239+240Pu north of latitude 650N, while for 238Pu a substantial fraction originates from European nuclear fuel reprocessing facilities. The 238Pu/239+240Pu isotope ratio provides clear evidence of the transport of effluent plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11-15 months in Scottish waters and, tentatively, 1.5-3 y during transport from the North Channel (north of the Irish Sea) to Spitsbergen. 241Am found in Arctic waters probably originates from the decay of fallout 241Pu and, like Pu, tentatively has a residence time of the order of several years. Americium from Sellafield has an estimated mean residence time of 4-6 months in Scottish waters. (author)

  9. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  10. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  11. 1976 Hanford americium-exposure incident: external decontamination procedures

    International Nuclear Information System (INIS)

    An accident resulted in the deposition on an injured workman's skin surfaces, in acid-burned areas and in lacerations, of something in excess of 6 mCi americium-241. The external decontamination procedures used, the change in americium content of the skin during the course of treatment, and some of the unusual problems encountered from the extrusion of foreign material and flaking of skin and scar tissue are described

  12. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  13. Americium and plutonium in water, biota, and sediment from the central Oregon coast

    International Nuclear Information System (INIS)

    Plutonium-239, 240 and americium-241 were measured in the mussel Mytilus californianus from the region of Coos Bay, OR. The flesh of this species has a plutonium concentration of about 90 fCi/kg, and an Am-241/Pu-239, 240 ratio that is high relative to mixed fallout, ranging between two and three. Transuranic concentrations in sediment, unfiltered water, and filterable particulates were also measured; none of these materials has an Am/Pu ratio as greatly elevated as the mussels, and there is no apparent difference in the Am/Pu ratio of terrestrial runoff and coastal water. Sediment core profiles do not allow accumulation rates or depositional histories to be identified, but it does not appear that material characterized by a high Am/Pu ratio has ever been introduced to this estuary. Other bivalves (Tresus capax and Macoma nasuta) and a polychaete (Abarenicola sp.) do not have an elevated Am/Pu ratio, although the absolute activity of plutonium in the infaunal bivalves is roughly four times that in the mussels

  14. Complexation of americium with humic acid

    International Nuclear Information System (INIS)

    As a part of the interlaboratory comparison exercise for the complexation of humic acid and colloid generation (COCO-Club activities) in the CEC project MIRAGE-II, the complexation of americium with humic acid has been studied in our laboratory. Two humic acids were used for the study: Aldrich-HA(H+) which is a reference humic acid of the COCO-Club and Bradford-HA(H+) from Lake Bradford, Florida. A wide concentration range of humic acid and different ratios of Am to humic acid have been investigated between pH 5 and 6 with the ionic strength of 0.1 M and 1.0 M. The complexation has been studied by UV-spectroscopy, Laser-induced Photoacoustic Spectroscopy (LPAS) and ultrafiltration. LPAS is used for the submicromolar concentration range where the sensitivity of UV spectroscopy is not accessible. Ultrafiltration is used for low Am to humic acid ratios where both spectroscopic methods are not applicable. Varying the humic acid concentration over three orders of magnitude, only a 1:1 type of binding is observed. No significant variation of the stability constant is found in the investigated range of pH and ionic strength. However, the precipitation tendency and the loading capacity of humic acid are found to depend sensitively on pH and ionic strength. The complexation study provides a deep insight into the influence of humic acid on the migration behaviour of fission products and actinides in the geosphere. (orig.)

  15. Analysis of BWR lattices to recycle americium

    International Nuclear Information System (INIS)

    This study was carried out to assess the ability to eliminate meaningful quantities of americium in a primarily thermal neutron flux by 'spiking' modern BWR fuel with this minor actinide (MA). The studies carried out so far include the simulation of modern 10 x 10 BWR lattices employing the Westinghouse lattice physics code PHOENIX-4 alongside validation studies using MCNP5 models of the same lattices that were spatially depleted via the MONTEBURNS code coupling to ORIGEN. When considering the total inventory of minor actinides in Am-spiked pins, excluding isotopes of uranium and plutonium, the results indicate that a reduction of approximately 50% or more in the total mass inventory of these minor actinides is viable within the selected pins. Therefore, these preliminary results have encouraged the extension of this work to the development of improved lattice designs to help optimize the transmutation rates as well as absolute MA inventory reductions. The ultimate goal being to design batches of these advanced BWR bundles alongside multi-cycle core reload strategies. (authors)

  16. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  17. A TRUEX-based separation of americium from the lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher; Nicholas C. Schmitt; Mary E. Case

    2011-03-01

    Abstract: The inextractability of the actinide AnO2+ ions in the TRUEX process suggests the possibility of a separation of americium from the lanthanides using oxidation to Am(V). The only current method for the direct oxidation of americium to Am(V) in strongly acidic media is with sodium bismuthate. We prepared Am(V) over a wide range of nitric acid concentrations and investigated its solvent extraction behavior for comparison to europium. While a separation is achievable in principal, the presence of macro amounts of cerium competes for the sparingly soluble oxidant and the oxidant itself competes for CMPO complexation. These factors conspire to reduce the Eu/Am separation factor from ~40 using tracer solutions to ~5 for extractions from first cycle raffinate simulant solution. To separate pentavalent americium directly from the lanthanides using the TRUEX process, an alternative oxidizing agent will be necessary.

  18. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  19. Uptake of americium-241 by algae and bacteria

    International Nuclear Information System (INIS)

    The uptake of americium by three algae, scenedesmus obliquus, selenastrum capricomutum and chlorella pyrenosdosa and a bacterium aeromonas hydrophila was studied. Live and fixed cells of each algal species and live bacterial cells were used. it is shown that algae and bacteria concentrate americium 241 to a high degree which makes them important links in the biomagnification phenomenon which may ultimately lead to a human hazard and be potentially important in recycling Am 241 in the water column and mobilization from sediments. Chemical fixation of algal cells caused increased uptake which indicated that uptake is by passive diffusion and probably due to chemical alteration of surface binding sites. (U.K.)

  20. Americium incineration by recycling in target rods using coated particles

    International Nuclear Information System (INIS)

    This paper proposes a type of target rod based on the use of coated particles, for an efficient incineration of americium in nuclear reactors. The analysis takes advantage of the experience gained in the past from long duration irradiation without damage of coated particles with plutonium oxide kernels. A conservative theoretical evaluation of the gas pressure inside the coated particles at the end of irradiation allows comparing the well known conditions of the plutonium oxide particles which were successfully irradiated to high burn-up, with a preliminary design of americium oxide particles. (authors)

  1. Uptake of americium-241 by plants from contaminated Chernobyl exclusive zone test site soils

    International Nuclear Information System (INIS)

    Americium-241 was found to accumulate in soils and biological objects of the environment. Its concentration has increased many times after the Chernobyl disaster and can be expected to increase about 40 times in the future. This research concentrated on the contaminated exclusive Chernobyl zone polluted by trace radionuclides, their behavior and accumulation by various plant species. Special attention is devoted to the bioavailability of 241Am to the plants Galium rivale, G. tinctorium, G. aparine, G. intermedium, Berteroa incana, Artemisia absinthium, A. vulgaris, Centaurea borysthenica, C. arenaria, Cirsium arvense, Succissa pratensis, Solidago virgaurea, Linaria vulgaris, Lepidium ruderale, Stenactis annua, Veronica maxima, Verbascum lychnitis, Euphorbia cyparissias, Genista tinctoria, Erigeron canadensis, Oenothera biennis, Betula pendula and Quercus robur, which were collected from the Chernobyl, Kopachi, and Yanov districts. The plant samples of Oenothera biennis, Betula pendula and Quercus robur were collected from the Yanov district, where the soil contamination by 241Am and 137Cs was at the level of 660 and 27 MBq/m2, respectively. Gamma spectroscopy and radiochemical methods were used to estimate the activity concentration of 137Cs, 90Sr, 238Pu, 239+240Pu, 241Am. The radionuclides were measured in the dry green mass of the plant samples and in the dry soils. The contamination of the Oenothera biennis, Betula pendula and Quercus robur samples by 137Cs was (5.8±1,5)x106, (7.4±1.1)x105, and (2.6±0.2)x106 Bq/kg dry mass, respectively, and contamination by 241Am was 47±5, 45±3 and 3.2±0.2 Bq/kg, respectively. The soil-to-plant transfer ratio for 137Cs ranged lay within the interval of 0.2 to 0.03 Bq/kg : Bq/m2, the the transfer ratio for 241Am did not exceed 7x10-5 Bq/kg : Bq/m2. The coefficient of the relative contents of the 241Am/239+240Pu radionuclides in the various plant samples varied from 3.2 to 8.3, while for soil from the Yanov district this

  2. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  3. Americium retention by the smectite hectorite

    International Nuclear Information System (INIS)

    Document available in extended abstract form only. Clay minerals may play an important role in a high level nuclear waste disposal site. Smectites may be major components of backfill material used to enhance the retention properties of engineered barriers. Furthermore, they have also been detected in the alteration layer of nuclear waste glass corroded in laboratory experiments. For example, the smectite hectorite (Na0.33[Mg2.67Li0.33Si4O10(OH)2]) was identified as phase forming upon waste matrix dissolution and subsequent reprecipitation. Smectites are known to be highly reactive with respect to cations in aqueous systems. Several distinct molecular scale binding mechanisms may operate, but the most effective retention may occur by incorporation in the bulk structure, especially if a (meta)stable solid solution forms. Investigations showed the possibility to incorporate Lu(III) in a clay-like octahedral site in hectorite by coprecipitation. Furthermore, luminescence studies on hectorite synthesized in the presence of Cm(III) or Eu(III) were consistent with an incorporation in the bulk structure. However, structural data such as coordination numbers and bond lengths are still missing for the actinides. In the present study, Am(III) was coprecipitated with and adsorbed on hectorite to decipher the actual retention mechanism(s). Hectorite was synthesized in the presence of Am(III) (sample AmCopHec) from an Am-containing brucite precursor phase. Briefly, brucite was freshly precipitated in the presence of Am(III) (Am:Mg molar ratio of 1:1175) and washed. The resulting sol was aged in a tightly closed vessel in the presence of LiF and silica sol for several days at 90 C. Separately, an Am-containing brucite phase (sample AmCopBru) was prepared under identical conditions as described above, and the americium aqua ions were adsorbed on hectorite (m/V = 2 g/L, [Am(III)]tot = 105 μmol/L, 0.5 mol/L NaClO4, pH = 6.4(1), sample AmSorbHec) and used as reference samples. X

  4. Plutonium and americium in fish, shellfish and seaweed in the Irish environment and their contribution to dose

    International Nuclear Information System (INIS)

    Plutonium and americium activity concentrations in fish and shellfish landed in Ireland in the period 1988 to 1997 are presented. Activity concentrations in fish are low and often below detection limits, while those in mussels and oysters sampled on the northeast coast show no significant signs of decline. The estimated doses to hypothetical typical and heavy seafood consumers remain below 1 μSv yr-1 (committed effective dose).Plutonium activity concentrations measured in Fucus vesiculosus around the Irish coastline have not fallen appreciably in the ten year period between 1986 and 1996. Furthermore, the mean 238Pu/239,240Pu ratio of 0.17±0.05 in Fucus vesiculosus from the west coast of Ireland demonstrates the increasing significance of Sellafield-derived plutonium in those waters. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  5. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  6. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  7. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  8. FIS 240 UOP course tutorial/tutorialoutlet

    OpenAIRE

    NARESH 1

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com       FIS 240 Week 1 CheckPoint: Is Time on My Side (UOP) FIS 240 Week 1 DQs (UOP) FIS 240 Week 2 CheckPoint: Risk Assessment Matrix (UOP) FIS 240 Week 2 Exercise: Risk and Reward: First 10% (UOP) FIS 240 Week 2 Assignment: What’s In It for Me? (UOP) FIS 240 Week 3 DQs (UOP) FIS 240 Week 3 CheckPoint: Primary and Secondary…Not Just Schools (UOP) FIS 240 Week 4 CheckPoint...

  9. Liquid-liquid extraction separation and determination of plutonium and americium

    International Nuclear Information System (INIS)

    A procedure is described for the determination of plutonium and americium after their initial separation on barium sulfate. The barium sulfate is dissolved in perchloric acid and the antinides and lanthanides are extracted into bis(2-ethylhexyl)phosphoric acid (HDEHP). Americium along with other tervalent actinides and lanthanides is stripped from HDEHP with nitric acid. The lanthanides are removed on a column of HDEHP supported on Teflon powder, and the americium and other tervalent actinides are electrodeposited for their determination by α spectrometry. The plutonium is stripped with nitric acid after reduction to the tervalent state with 2,5-di-tert-butylhydroquinone and electrodeposited for α spectrometry. Decontamination factors for plutonium and americium from each other and from other α emitters are 104 to 105. Two hours are required for the liquid-liquid extraction separations of plutonium and americium from eight samples. Recoveries of americium and plutonium through the HDEHP separatons are 99% and 95%, respectively

  10. Calculational study on irradiation of americium fuel samples in the Petten High Flux Reactor

    International Nuclear Information System (INIS)

    A calculational study on the irradiation of americium samples in the Petten High Flux Reactor (HFR) has been performed. This has been done in the framework of the international EFTTRA cooperation. For several reasons the americium in the samples is supposed to be diluted with a neutron inert matrix, but the main reason is to limit the power density in the sample. The low americium nuclide density in the sample (10 weight % americium oxide) leads to a low radial dependence of the burnup. Three different calculational methods have been used to calculate the burnup in the americium sample: Two-dimensional calculations with WIMS-6, one-dimensional calculations with WIMS-6, and one-dimensional calculations with SCALE. The results of the different methods agree fairly well. It is concluded that the radiotoxicity of the americium sample can be reduced upon irradiation in our scenario. This is especially the case for the radiotoxicity between 100 and 1000 years after storage. (orig.)

  11. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  12. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  13. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  14. Recycling heterogeneous americium targets in a boiling water reactor

    International Nuclear Information System (INIS)

    One of the limiting contributors to the heat load constraint for a long term spent fuel repository is the decay of americium-241. A possible option to reduce the heat load produced by Am-241 is to eliminate it via transmutation in a light water reactor thermal neutron environment, in particular, by taking advantage of the large thermal fission cross section of Am-242 and Am-242m. In this study we employ lattice loading optimization techniques to define the loadings and arrangements of fuel pins with blended americium and uranium oxide in boiling water reactor bundles, specifically, by defining the incineration of pre-loaded americium as an objective function to maximize americium transmutation. Subsequently, the viability of these optimized lattices is tested by assembling them into bundles with Am-spiked fuel pins and by loading these bundles into realistic three-dimensional BWR core-wide simulations that model multiple reload cycles and observe standard operational constraints. These simulations are possible via our collaboration with the Westinghouse Electric Co. which facilitates the use of industrial-caliber design tools such as the PHOENIX-4/POLCA-7 sequence and the Core Master 2 GUI work environment for fuel management. The resulting analysis confirms the ability to axially uniformly eliminating roughly 90% of the pre-loaded inventory of recycled Am-241 in BWR bundles with heterogeneous target pins. This high level of incineration was achieved within three to four 18-month operational cycles, which is equivalent to a typical in-core residence time of a BWR bundle.

  15. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  16. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  17. NTC 240 UOP Course Tutorial/ Tutorialrank

    OpenAIRE

    john

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A           NTC 240 Week 2 Individual Assignment : OSI Model Key Terms NTC 240 Week 3 Individual Assignment : LAN Topologies NTC 240 Week 4 Individual Assignment : Vocabulary Definitions NTC 240 Week 5 Individual Assignment : Security Threats  

  18. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  19. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  20. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  1. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  2. Plutonium and americium behavior in coral atoll environments

    International Nuclear Information System (INIS)

    Inventories of 239+240Pu and 241Am greatly in excess of global fallout levels persist in the benthic environments of Bikini and Enewetak Atolls. Quantities of 239+240Pu and lesser amounts of 241Am are continuously mobilizing from these sedimentary reservoirs. The amount of 239+240Pu mobilized to solution at any time represents 0.08 to 0.09% of the sediment inventories to a depth of 16 cm. The mobilized 239+240Pu has solute-like characteristics and different valence states coexist in solution - the largest fraction of the soluble plutonium is in an oxidized form (+V,VI). The adsorption of plutonium to sediments is not completely reversible because of changes that occur in the relative amounts of the mixed oxidation states in solution with time. Further, any characteristics of 239+240Pu described at one location may not necessarily be relevant in describing its behavior elsewhere following mobilization and migration. The relative amounts of 241Am to 239+240Pu in the sedimentary deposits at Enewetak and Bikini may be altered in future years because of mobilization and radiological decay. Mobilization of 239+240Pu is not a process unique to these atolls, and quantities in solution derived from sedimentary deposits can be found at other global sites. These studies in the equatorial Pacific have significance in assessing the long-term behavior of the transuranics in any marine environment. 22 references, 1 figure, 13 tables

  3. Characterization of uranium, plutonium, neptunium, and americium in HLW supernate for LLW certification

    International Nuclear Information System (INIS)

    The 1S Manual requires that High Level Waste (HLW) implement a waste certification program prior to sending waste packages to the E-Area vaults. To support the waste certification plan, the HLW supernate inventory of uranium, plutonium, neptunium and americium have been characterized. This characterization is based on the chemical, isotopic and radiological properties of these elements in HLW supernate. This report uses process knowledge, solubility data, isotopic inventory data and sample data to determine if any isotopes of the aforementioned elements will exceed the minimum reportable quantity (MRQ) for waste packages contaminated with HLW supernate. If the MRQ can be exceeded for a particular nuclide, then a method for estimating the waste package content is provided. Waste packages contaminated from HLW supernate do not contain sufficient U-233, U-234, U-235, U-236, U-238, Pu-239, Pu-240, Pu-241, Pu-242 or Am-241 to warrant separate reporting on the shipping manifest. Calculations show that, on average, more than 100 gallons of supernate is required to exceed the PAC (package acceptance criteria) for each of these nuclides. Thus it is highly unlikely that the PAC would be exceeded for these nuclides and unlikely that the MRQ would be exceeded. These nuclides should be manifested as zero for waste packages contaminated with HLW supernate. The only actinide isotopes that may exceed the MRQ are Np-237 and Pu-238. The recommended method to calculate the amount of these two isotopes in waste packages contaminated with HLW supernate is to ratio them to the measured Cs-137 activity

  4. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  5. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  6. Placental transfer of americium and plutonium in mice

    International Nuclear Information System (INIS)

    Actinide element release to the environment and subsequent transfer through food chains to pregnant women may present a radiation hazard to fetuses in utero. To measure americium incorporation, four groups of pregnant mice were intravenously dosed with four concentrations of 243Am citrate in late pregnancy. Concentrations of 243Am in fetuses, placentas, and maternal femur, liver, carcass and pelt were determined 48 hr after injection. Doses were chosen so that the number of atoms of 243Am in each injected dose was equal to the number of atoms of 239Pu used in an earlier study of transplacental movement. Results indicate that, atom for atom, americium is incorporated into fetal tissue in lesser amounts (10-25 times) than is plutonium when intravenously administered to pregnant mice in equal atom amounts. Tissue analyses indicated that, at low dose levels, the average fraction of the dose incorporated into the fetuses decreased as the dose to the pregnant mouse was increased. A similar pattern was noted for placentas and maternal femurs. Data indicate that one must make extrapolations from low dose data only to make reasonable and realistic estimates of the transplacental movement and fetal incorporation of environmental levels of actinide elements in man and other species. (author)

  7. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  8. 40 CFR 240.203 - General design.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false General design. 240.203 Section 240.203 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR... design....

  9. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Rudisill, T.S.

    1999-08-11

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  10. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    International Nuclear Information System (INIS)

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  11. Americium Transmutation Feasibility When Used as Burnable Absorbers - 12392

    International Nuclear Information System (INIS)

    The use of plutonium in Mixed Oxide (MOX) fuel in traditional Pressurized Water Reactor (PWR) assemblies leads to greater americium production which is not addressed in MOX recycling. The transuranic nuclides (TRU) contribute the most to the radiotoxicity of nuclear waste and a reduction of the TRU stockpile would greatly reduce the overall radiotoxicity of what must be managed. Am-241 is a TRU of particular concern because it is the dominant contributor of total radiotoxicity for the first 1000 years in a repository. This research explored the feasibility of transmuting Am-241 by using varying amounts in MOX rods being used in place of burnable absorbers and evaluated with respect to the impact on incineration and transmutation of transuranics in MOX fuel as well as the impact on safety. This research concludes that the addition of americium to a non-uniform fuel assembly is a viable method of transmuting Am-241, holding down excess reactivity in the core while serving as a burnable poison, as well as reducing the radiotoxicity of high level waste that must be managed. The use of Am/MOX hybrid fuel assemblies to transmute americium was researched using multiple computer codes. Am-241 was shown in this study to be able to hold down excess reactivity at the beginning of cycle and shape the power distribution in the core with assemblies of varying americium content loaded in a pattern similar to the traditional use of assemblies with varying amounts of burnable absorbers. The feasibility, safety, and utility of using americium to create an Am/MOX hybrid non-uniform core were also evaluated. The core remained critical to a burnup of 22,000 MWD/MTM. The power coefficient of reactivity as well as the temperature and power defects were sufficiently negative to provide a prompt feedback mechanism in case of a transient and prevent a power excursion, thus ensuring inherent safety and protection of the core. As shown here as well as many other studies, this non

  12. 12 CFR 19.240 - Inflation adjustments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Inflation adjustments. 19.240 Section 19.240... PROCEDURE Civil Money Penalty Inflation Adjustments § 19.240 Inflation adjustments. (a) The maximum amount... Civil Penalties Inflation Adjustment Act of 1990 (28 U.S.C. 2461 note) as follows: ER10NO08.001 (b)...

  13. 8 CFR 240.63 - Application process.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Application process. 240.63 Section 240.63 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS PROCEEDINGS TO DETERMINE... Cancellation of Removal Under Section 203 of Pub. L. 105-100 § 240.63 Application process. (a) Form and...

  14. 40 CFR 240.203-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.203-1 Section 240.203-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.203-1...

  15. 40 CFR 240.206-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.206-1 Section 240.206-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.206-1...

  16. 40 CFR 240.209-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.209-1 Section 240.209-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.209-1...

  17. 40 CFR 240.205-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.205-1 Section 240.205-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.205-1...

  18. 40 CFR 240.207-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.207-1 Section 240.207-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.207-1...

  19. 40 CFR 240.210-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.210-1 Section 240.210... THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.210-1 Requirement... the design requirements. An operations manual describing the various tasks to be performed,...

  20. 40 CFR 240.200-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.200-1 Section 240.200-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.200-1...

  1. 40 CFR 240.202-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.202-1 Section 240.202-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.202-1...

  2. 40 CFR 240.201-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.201-1 Section 240.201-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.201-1...

  3. 40 CFR 240.204-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.204-1 Section 240.204-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.204-1...

  4. 40 CFR 240.208-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 240.208-1 Section 240.208-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.208-1...

  5. 40 CFR 240.208 - Residue.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Residue. 240.208 Section 240.208 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.208 Residue....

  6. 40 CFR 240.204 - Water quality.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Water quality. 240.204 Section 240.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.204 Water quality....

  7. 40 CFR 240.205 - Air quality.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Air quality. 240.205 Section 240.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.205 Air quality....

  8. 40 CFR 240.206 - Vectors.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Vectors. 240.206 Section 240.206 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.206 Vectors....

  9. 21 CFR 173.240 - Isopropyl alcohol.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Isopropyl alcohol. 173.240 Section 173.240 Food and..., Lubricants, Release Agents and Related Substances § 173.240 Isopropyl alcohol. Isopropyl alcohol may be... label of the hops extract specifies the presence of the isopropyl alcohol and provides for the use...

  10. 16 CFR 240.15 - Cost justification.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Cost justification. 240.15 Section 240.15 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.15 Cost justification. It is no defense to...

  11. 21 CFR 573.240 - Calcium periodate.

    Science.gov (United States)

    2010-04-01

    ... with calcium hydroxide or calcium oxide to form a substance consisting of not less than 60 percent by... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Calcium periodate. 573.240 Section 573.240 Food... Additive Listing § 573.240 Calcium periodate. The food additive calcium periodate may be safely used...

  12. 16 CFR 240.6 - Interstate commerce.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Interstate commerce. 240.6 Section 240.6... ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.6 Interstate commerce. The term interstate commerce has not been precisely defined in the statute. In general, if there is any part of a...

  13. 40 CFR 240.209 - Safety.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Safety. 240.209 Section 240.209 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.209 Safety....

  14. 46 CFR 184.240 - Gas systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Gas systems. 184.240 Section 184.240 Shipping COAST... CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.240 Gas systems. Cooking systems... requirements: (a) The design, installation and testing of each LPG system must meet ABYC A-1, “Marine...

  15. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Noronha, Donald M.; Pius, Illipparambil C.; Chaudhury, Satyajeet [Bhabha Atomic Research Centre, Mumbai (India). Fuel Chemistry Div.

    2015-07-01

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the K{sub d} value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  16. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    International Nuclear Information System (INIS)

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the Kd value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  17. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  18. Solubility of americium collected on an aerosol filter

    International Nuclear Information System (INIS)

    Kinetics of dissolution of undefined americium aerosol in simulated serum ultrafiltrate was studied. 241Am was present in aerosol collected at a workplace, where an intake of 241Am had occurred formerly. Dissolution experiments in four parts of an aerosol filter were carried out either in ambient air or under CO2 and pH was kept within physiological range. Two?phase kinetics was found in both cases with dissolution half?times for rapid and slow phases ranging from 0.16 to 0.23 d and from 150 to 500 d, respectively. Regardless data dispersion, found half?times justify use of class M model in intake assessment. (author)

  19. The 1976 Hanford Americium Accident: Then and Now

    Energy Technology Data Exchange (ETDEWEB)

    Carbaugh, Eugene H.

    2013-10-02

    The 1976 chemical explosion of an 241Am ion exchange column at a Hanford Site waste management facility resulted in the extreme contamination of a worker with 241Am, nitric acid and debris. The worker underwent medical treatment for acid burns, as well as wound debridement, extensive personal skin decontamination and long-term DTPA chelation therapy for decorporation of americium-241. Because of the contamination levels and prolonged decontamination efforts, care was provided for the first three months at the unique Emergency Decontamination Facility with gradual transition to the patient’s home occurring over another two months. The medical treatment, management, and dosimetry of the patient have been well documented in numerous reports and journal articles. The lessons learned with regard to patient treatment and effectiveness of therapy still form the underlying philosophy of treatment for contaminated injuries. Changes in infrastructure and facilities as well as societal expectations make for interesting speculation as to how responses might differ today.

  20. Separation of americium from curium by oxidation and ion exchange.

    Science.gov (United States)

    Burns, Jonathan D; Shehee, Thomas C; Clearfield, Abraham; Hobbs, David T

    2012-08-21

    Nuclear energy has the potential to be a clean alternative to fossil fuels, but in order for it to play a major role in the US, many questions about the back end of the fuel cycle must be addressed. One of these questions is the difficult separation of americium from curium. Here, we report the oxidation of Am in two systems, perchloric acid and nitric acid and the affect of changing the acid has on the oxidation. K(d) values were observed and a direct separation factor was calculated and was seen to be as high as 20 for four metal(IV) pillared phosphate phosphonate inorganic organic hybrid ion exchange materials. These ion exchangers are characterized by very low selectivity for cations with low charge but extremely high uptake of ions of high charge. PMID:22827724

  1. Monte Carlo modeling of spallation targets containing uranium and americium

    International Nuclear Information System (INIS)

    Neutron production and transport in spallation targets made of uranium and americium are studied with a Geant4-based code MCADS (Monte Carlo model for Accelerator Driven Systems). A good agreement of MCADS results with experimental data on neutron- and proton-induced reactions on 241Am and 243Am nuclei allows to use this model for simulations with extended Am targets. It was demonstrated that MCADS model can be used for calculating the values of critical mass for 233,235U, 237Np, 239Pu and 241Am. Several geometry options and material compositions (U, U + Am, Am, Am2O3) are considered for spallation targets to be used in Accelerator Driven Systems. All considered options operate as deep subcritical targets having neutron multiplication factor of k∼0.5. It is found that more than 4 kg of Am can be burned in one spallation target during the first year of operation

  2. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  3. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  4. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  5. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  6. Radiotoxicological analyses of 239+240Pu and 241Am in biological samples by anion-exchange and extraction chromatography: a preliminary study for internal contamination evaluations

    International Nuclear Information System (INIS)

    Many biological samples (urines and faeces) have been analysed by means of chromatographic extraction columns, utilising two different resins (AG 1-X2 resin chloride and T.R.U.), in order to detect the possible internal contamination of 239+240Pu and 241Am, for some workers of a reprocessing nuclear plant in the decommissioning phase. The results obtained show on one hand the great suitability of the first resin for the determination of plutonium, and on the other the great selectivity of the second one for the determination of americium

  7. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  8. Separation of curium and americium microquantities by chromatographic method with introduction of separating ions. 2. Effect of cadmium ion quantity and method of it introduction in the system on efficiency of curium and americium separation

    International Nuclear Information System (INIS)

    Effect of fractionating cadmium ion and a method of it introduction in the system on efficiency of separation of curium and americium with the use of NTA solutions as an eluent is investigated. It is established that in contrast to mutual sorption of curium, americium and cadmium their selective sorption contributes more complete separation of curium and americium. It is shown that growth of quantity of introduced cadmium increased efficiency of separation. Elution rate not products effect on separation process

  9. Further Studies of Plutonium and Americium at Thule, Greenland

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Dahlgaard, Henning; Nilsson, Karen Kristina;

    1984-01-01

    Eleven years after the accidental loss of nuclear weapons in 1968, the fourth scientific expedition to Thule occurred. The estimated inventory of 1 TBq 239,240Pu in the marine sediments was unchanged when compared with the estimate based on the 1974 data. Plutonium from the accident had moved...

  10. Routine radiochemical method for the determination of 90Sr, 238Pu, 239+240Pu, 241Am and 244Cm in environmental samples

    International Nuclear Information System (INIS)

    Routine analytical procedures have been developed for the reliable simultaneous determination of 90Sr, 238Pu, 239+240Pu, 241Am and 242-244Cm, Chernobyl derived radioisotopes and fallout after nuclear weapon tests in a wide range of environmental samples: soil (100-200 g), sediments, aerosols, water and vegetation. This procedure has been applied to thousands of soil and sediment samples and hundreds of biological and water samples taken in the exclusive zone of Chernobyl NPP and different regions of Ukraine from 1989 to the present. After the sample has been properly prepared and isotopic tracers added, plutonium, americium and curium are precipitated with calcium oxalate and then lanthanum fluoride. Plutonium is separated from americium and curium by anion-exchange. Americium and curium are separated from rare earths by cation-exchange with gradient elute α-hydroxy-iso-butyric acid. During projects by AQCS IAEA 'Evaluation of Methods for 90Sr in a Mineral Matrix' and 'Proficiency Test for 239Pu, 241Pu and 241Am Measurement in a Mineral Matrix' accuracy and precision for 90Sr, 239Pu and 241Am by present procedure was evaluated. Advantages, difficulties and limitations of the method are discussed. (author)

  11. Americium(3) solvent extraction by oxides of dialkyl(diaryl)[dialkylcarbamoylmethyl]phosphines (CMPO) from perchloric acid solutions

    International Nuclear Information System (INIS)

    Extraction of americium(3) from perchloric acid solutions by CMPO was investigated. It is shown that americium(3) is much more effectively extracted from perchloric acid solutions, than from nitric acid ones, and increase in americium distribution coefficient depends considerably on reagent nature. As a consequence, anomalous aryl effect increases significantly in perchloric acid solutions. The value of anomalous aryl effect depends directly on stoichiometry of extracted complexes in nitric acid and perchloric acid media. Conditions for extractional concentration of americium up to the 100-fold one with small reagent consumption were suggested

  12. 7 CFR 57.240 - Detaining product.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Detaining product. 57.240 Section 57.240 Agriculture... AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) INSPECTION OF EGGS (EGG PRODUCTS INSPECTION ACT) Regulations Governing the Inspection of Eggs Administrative Detention §...

  13. 9 CFR 590.240 - Detaining product.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Detaining product. 590.240 Section 590.240 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EGG PRODUCTS INSPECTION INSPECTION OF EGGS AND EGG PRODUCTS (EGG PRODUCTS INSPECTION ACT)...

  14. 33 CFR 106.240 - Communications.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Communications. 106.240 Section... Requirements § 106.240 Communications. (a) The Facility Security Officer (FSO) must have a means to effectively notify OCS facility personnel of changes in security conditions at the OCS facility. (b)...

  15. 20 CFR 410.240 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Evidence. 410.240 Section 410.240 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK... claims, including the reasonable and necessary cost of travel incident thereto. A medical...

  16. 31 CFR 240.7 - Declination protest.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Declination protest. 240.7 Section... STATES TREASURY General Provisions § 240.7 Declination protest. (a) Who may protest. Only a presenting bank may protest the declination of a check that it has presented to a Federal Reserve Bank for...

  17. Extraction of Americium(III) by diglycolamides in ionic liquids

    International Nuclear Information System (INIS)

    In the present work, the extraction behavior of Am(lII) in the three isomeric DGAs, TODGA, DEHDODGA and TEHDGA in two ionic liquids, 1-butyl-3-methylimidazolium bis(triflouromethane sulphonyl)imide (C4mimNTf2) and 1-butyl-1-methylpyrrolidinium bis(triflouromethanesulphonyl)imide (C4mpyNTf2) is compared. The distribution ratio of americium was determined at various acidities ranging from 1M to 8M. The distribution values were found to decrease with increase in aqueous phase acidity upto 3M. The DAm values then marginally increased with increase of acidity from 3 to 4M followed by a decrease in distribution values. The distribution ratio obtained for various DGAs followed the order TEHDGA < TODGA < DEHDODGA at aqueous phase acidities ranging from 1-4 M. When the aqueous nitric acid concentration was higher than 4M, the distribution values followed the order DEHDODGA < TEHDGA < TODGA. The anomalous behaviour of unsymmetrical diglycolamide in ionic liquid medium was investigated by IR spectroscopy. The study revealed that the unprotonated fraction of DGA (i.e. the free DGA) increased in the order TEHDGA < TODGA < DEHDODGA, which seems to be responsible for the observed anomalous extraction trend in DEHDODGA in ionic liquid medium

  18. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    International Nuclear Information System (INIS)

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH2)n-NH-C(O)-CH2-P(O)Ph2] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO3 solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient DAm/DEu for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (DAm/DEu). (orig.)

  19. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  20. Americium, plutonium and uranium contamination and speciation in well waters, streams and atomic lakes in the Sarzhal region of the Semipalatinsk Nuclear Test Site, Kazakhstan

    International Nuclear Information System (INIS)

    New data are reported on the concentrations, isotopic composition and speciation of americium, plutonium and uranium in surface and ground waters in the Sarzhal region of the Semipalatinsk Test Site, and an adjacent area including the settlement of Sarzhal. The data relate to filtered water and suspended particulate from (a) streams originating in the Degelen Mountains, (b) the Tel'kem 1 and Tel'kem 2 atomic craters, and (c) wells on farms located within the study area and at Sarzhal. The measurements show that 241Am, 239,240Pu and 238U concentrations in well waters within the study area are in the range 0.04-87 mBq dm-3, 0.7-99 mBq dm-3, and 74-213 mBq dm-3, respectively, and for 241Am and 239,240Pu are elevated above the levels expected solely on the basis of global fallout. Concentrations in streams sourced in the Degelen Mountains are similar, while concentrations in the two water-filled atomic craters are somewhat higher. Suspended particulate concentrations in well waters vary considerably, though median values are very low, at 0.01 mBq dm-3, 0.08 mBq dm-3 and 0.32 mBq dm-3 for 241Am, 239,240Pu and 238U, respectively. The 235U/238U isotopic ratio in almost all well and stream waters is slightly elevated above the 'best estimate' value for natural uranium worldwide, suggesting that some of the uranium in these waters is of test-site provenance. Redox analysis shows that on average most of the plutonium present in the microfiltered fraction of these waters is in a chemically reduced form (mean 69%; 95% confidence interval 53-85%). In the case of the atomic craters, the proportion is even higher. As expected, all of the americium present appears to be in a reduced form. Calculations suggest that annual committed effective doses to individual adults arising from the daily ingestion of these well waters are in the range 11-42 μSv (mean 21 μSv). Presently, the ground water feeding these wells would not appear to be contaminated with radioactivity from past

  1. Modeling and production of 240Am by deuteron-induced activation of a 240Pu target

    Energy Technology Data Exchange (ETDEWEB)

    Finn, Erin C.; McNamara, Bruce K.; Greenwood, Lawrence R.; Wittman, Richard S.; Soderquist, Chuck Z.; Woods, Vincent T.; VanDevender, Brent A.; Metz, Lori A.; Friese, Judah I.

    2015-02-01

    A novel reaction pathway for production of 240Am is reported. Models of reaction cross-sections in EMPIRE II suggests that deuteron-induced activation of a 240Pu target produces maximum yields of 240Am from 11.5 MeV incident deuterons. This activation had not been previously reported in the literature. A 240Pu target was activated under the modeled optimum conditions to produce 240Am. The modeled cross-section for the 240Pu(d, 2n)240Am reaction is on the order of 20-30 mbarn, but the experimentally estimated value is 5.3 ± 0.2 mbarn. We discuss reasons for the discrepancy as well as production of other Am isotopes that contaminate the final product.

  2. Modeling and production of 240Am by deuteron-induced activation of a 240Pu target

    International Nuclear Information System (INIS)

    A novel reaction pathway for production of 240Am is reported. Models of reaction cross-sections in EMPIRE II suggest that deuteron-induced activation of a 240Pu target produces maximum yields of 240Am from 11.5 MeV incident deuterons. This activation had not been previously reported in the literature. A 240Pu target was activated under the modeled optimum conditions to produce 240Am. The modeled cross-section for the 240Pu(d, 2n)240Am reaction is on the order of 20–30 mbarn, but the experimentally estimated value is 5.6 ± 0.2 mbarn. We discuss reasons for the discrepancy as well as production of other Am isotopes that contaminate the final product

  3. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  4. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  5. Dicty_cDB: AFM240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM240 (Link to dictyBase) - - - - AFM240P (Link to Original site) AFM240F 638 AFM...240Z 291 AFM240P 909 - - Show AFM240 Library AF (Link to library) Clone ID AFM240 (Link ...to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-B/AFM240Q.Seq.d/ Representative seq. ID AFM240P (Link to ...Original site) Representative DNA sequence >AFM240 (AFM240Q) /CSM/AF/AFM2-B/AFM240Q.Seq.d/ TATTAAAAAAATGTACT

  6. Dicty_cDB: SLB240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB240 (Link to dictyBase) - G01905 DDB0216342 Contig-U01115-1 | Contig-U16357-1 SLB...240P (Link to Original site) SLB240F 367 SLB240Z 159 SLB240P 526 - - Show SLB240 Libra...ry SL (Link to library) Clone ID SLB240 (Link to dictyBase) Atlas ID - NBRP ID G01905 dictyBase ID DDB021634...cdb.biol.tsukuba.ac.jp/CSM/SL/SLB2-B/SLB240Q.Seq.d/ Representative seq. ID SLB240P (Link to Original site) R...epresentative DNA sequence >SLB240 (SLB240Q) /CSM/SL/SLB2-B/SLB240Q.Seq.d/ CAACAATATGAAACCTGAAGATGCAAACGCTGC

  7. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  8. Determination of trace concentration of uranium in americium oxide samples by ICP-AES

    International Nuclear Information System (INIS)

    A solvent extraction method has been developed for the determination of uranium (200-2000 ppm) in americium oxide samples. The method involves the quantitative separation of uranium from americium matrix using mixed solvent comprising 1.1M tri-n-butyl phosphate (TBP) +1% trialkyl phosphine oxide (TRPO) + 0.3 M tertiary butyl hydroquinone (TBHQ) in n-dodecane. Uranium from the organic is stripped into the aqueous phase with 0.8 M oxalic acid and determined by ICP-AES. The reliability of the method was ascertained by analytical recovery, which is found to be nearly 100%. (author)

  9. Extraction and chromatographic separation and concentration of plutonium and americium from natural matrices. Author-review of dissertation submitted for fulfillment of the scientific degree 'Philosophiae doctor' (PhD.)

    International Nuclear Information System (INIS)

    We followed the optimization of separation progress of americium (241Am) from environmental samples - soil from surroundings nuclear power plant Jaslovske Bohunice, in our work. Selection and optimization of separation progresses had to verify the condition for preparation of samples on spectral measurement with coprecipitation of americium or plutonium with NdF3 (undesirable presence of calcium, magnesium, lanthanides) and condition of spectral purity (spectral overlapping 228Th, 238Pu, 241Am and 222Rn of energy). Very important step was the realization of existing goal and learn suitable isolation techniques of plutonium. We are choosing technique separation of plutonium base upon amine liquid extraction, for a digest consider qualitative quantitative factor of separation. Extraction reagent has been Aliquat-336, which extracts nitric complex of plutonium [Pu(NO3)62-] from 7-8 M solution HNO3. Use method separate off quantitative the plutonium, thorium and uranium from americium. Background sample formed the sample of soil from surroundings Velke Kostolany. Real samples were sampling from surroundings of pollute river Dudvah. Average value mass activities of 239,240Pu in the background sample had value 0.28 ± 0.10 Bq · kg-1. Value mass activities of 239,240Pu in sample from surroundings river Dudvah were in the range (0,6 - 39.4) Bq · kg-1. Methodical side separation of americium we step by step by using ion exchange methods, liquid extraction with extraction reagent TOPO, or combination of them and extraction chromatography with TOPO. We find out: (a) on exchange procedure are suitable on obtainable basis extract tracer of radionuclide, also is very up to time. Optimal method was indicate techniques using the formation of rhodanide complex of americium, with following adsorption on stark acidity anionic exchanger (lanthanides were non-absorbing); (b) t liquid extraction formed emulsion, the third phase on the interface of phases. If we treat the molar of

  10. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  11. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  12. Impact of ionic liquids on europium and americium extraction by an upper rim phosphorylated calixarene

    International Nuclear Information System (INIS)

    The solvent extraction of europium and americium using the calixarene 5,11,17,23-tetrakis[dipropylphosphinylmethyl] 25,26,27,28-tetrapropoxycalix[4]arene (conical conformation) in the presence of ionic liquids with different natures was studied. It was shown that upper rim phosphorylated calixarene is able to extract europium and americium from nitric acid to dichloroethane by forming a 1:1 complex without the addition of ionic liquids. The distribution coefficients of americium are higher than those of europium in this case, but the isolation degrees of both elements are insufficient for this system to be useful in extraction technologies. The addition of the ionic liquid trihexyl(tetradecyl)phosphonium hexafluorophosphate increases the europium distribution coefficient by values ranging from twofold to more than two orders of magnitude at ionic liquid concentrations of 1 and 50 %, respectively. The values of the distribution coefficients for americium are increased by approximately 25-fold after a 50 % addition of the ionic liquid. (author)

  13. Understanding the Chemistry of Uncommon Americium Oxidation States for Application to Actinide/Lanthanide Separations

    Energy Technology Data Exchange (ETDEWEB)

    Leigh Martin; Bruce J. Mincher; Nicholas C. Schmitt

    2007-09-01

    A spectroscopic study of the stability of Am(V) and Am(VI) produced by oxidizing Am(III) with sodium bismuthate is presented, varying the initial americium concentration, temperature and length of the oxidation was seen to have profound effects on the resultant solutions.

  14. Speciation and bioavailability of plutonium and americium in the Irish Sea and other marine ecosystems

    International Nuclear Information System (INIS)

    Since the late 1960s, the Irish Sea has become a repository for a variety of radio-elements originating mainly in discharges from the British Nuclear Fuels (BNF) plc. Sellafield reprocessing complex located on the Cumbrian coast. In particular, transuranium nuclides such as plutonium, americium and curium (the main constituents of the α-emitting discharges) have become incorporated into every marine compartment by a variety of mechanisms, many of which are not well understood. Although extensive studies have been carried out in the near-field (eastern Irish Sea, especially in the vicinity of the discharge point and collateral muddy sediments), comparatively little had been done to assess the long-term behaviour and bioavailability of plutonium and americium in the far-field, e.g., the western Irish Sea, prior to the present study. In this dissertation, the results of an extensive research programme, undertaken in order to improve and refine our understanding of the behaviour of plutonium and americium in the marine environment, are presented. Specifically, the thesis details the results of (and conclusions deduced from) a series of experiments in which the physical and chemical speciation, colloidal association, mobility and bioavailability of plutonium and americium were examined in diverse environments including the Irish Sea and the Mediterranean. (author)

  15. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  16. Extraction chromatographic recovery of americium from acidic raffinate solutions using CMPO adsorbed on Chromosorb-102

    International Nuclear Information System (INIS)

    Microgram amounts of americium have been separated and purified from large amounts of uranium present in effluent solutions resulting from the anion-exchange columns during the purification and recovery of plutonium by using TBP extraction followed by extraction chromatography using CMPO adsorbed on Chromosorb-102. (author). 4 refs., 1 tab

  17. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  18. Development of analytical methods for the separation of plutonium, americium, curium and neptunium from environmental samples

    OpenAIRE

    Salminen, Susanna

    2009-01-01

    In this work, separation methods have been developed for the analysis of anthropogenic transuranium elements plutonium, americium, curium and neptunium from environmental samples contaminated by global nuclear weapons testing and the Chernobyl accident. The analytical methods utilized in this study are based on extraction chromatography. Highly varying atmospheric plutonium isotope concentrations and activity ratios were found at both Kurchatov (Kazakhstan), near the former Semipalatinsk...

  19. Application of hollow fiber supported liquid membrane for the separation of americium from the analytical waste

    International Nuclear Information System (INIS)

    Americium from analytical solid waste containing U and metallic impurities was separated using hollow fiber supported liquid membrane (HFSLM) technique impregnated with DHOA-TODGA from nitric acid medium. An aliquot of 5 g of the solid waste containing Am (19.95 mg) as minor actinide and of U (2,588 mg), Fe (1,360 mg), Ca (1,810 mg) and Na (3,130 mg) as major impurities was processed. The feed solution obtained after the dissolution of the residue in ∼4 M HNO3 was passed through HFSLM module. In the first stage using 1 M DHOA-dodecane was used for the separation of Am from other impurities. Though, majority of the elements were separated in this cycle, Ca was co extracted along with the americium. CMPO extraction chromatographic technique was used for further separation of americium from Ca. Significant decontamination factors were achieved in this three step separation process with respect to U, Fe, Na and Ca with ∼77 % recovery of americium. (author)

  20. Determination of α-emitters (plutonium, americium, curium ...) in feces and urine ashes

    International Nuclear Information System (INIS)

    A description is given of the methods used to determine a number of radionuclides to be found in feces and urine, and obtain samples thin enough for counting and α-spectrometry. These methods can be applied to plutonium, americium and curium especially

  1. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  2. Interaction and diffusion transport of americium in soils

    International Nuclear Information System (INIS)

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of 241Am in soils. The 241Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (Kd) and desorption percentage. Kd (Am) values ranged from 103 to 105 L kg-1 and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in 241Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between Kd (Am) values and a soil property was not found, the main properties affecting 241Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption capacity was observed in all soils due to the dissolution of soil

  3. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  4. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  5. 7 CFR 240.2 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... unmarried mothers and their infants; group homes; halfway houses; orphanages; temporary shelters for abused children and for runaway children; long-term care facilities for chronically ill children; and juvenile... CHILD NUTRITION PROGRAMS CASH IN LIEU OF DONATED FOODS § 240.2 Definitions. For the purpose of this...

  6. TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution

    DEFF Research Database (Denmark)

    Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga;

    2003-01-01

    In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported for...... Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which also contains conserved homologues of Srb8, Srb10, and Srb11. We find that spTrap240 and Sch. pombe Srb8 (sp...

  7. Metabolism of americium-241 in man: an unusual case of internal contamination of a child and his father

    International Nuclear Information System (INIS)

    The metabolism of americium-241 was studied during an 8-yr period of an adult male and his son who, at the ages of 50 and 4, respectively, were accidentally and unknowingly contaminated within their home by means of inhalation. Chelation therapy with Na3(Ca-DTPA) was more effective in enhancing the removal of americium-241 from the child than from his father

  8. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  9. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  10. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  11. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  12. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  13. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  14. Influence of some organic additives on the extractive separation of americium(III) by sulfoxides

    International Nuclear Information System (INIS)

    The solvent extraction behavior of americium(III) from aqueous nitrate media by two long-chain aliphatic sulfoxides has been examined systematically in the presence of several water-miscible organic solvents to study their possible synergistic effect on metal ion extraction. Methanol, ethanol, n- and isopropanol, n-butanol, dioxane, acetone, as well as acetonitrile, were employed as the organic component of the mixed (polar) phase. These additives affected the extraction to varying degrees. Extractability of Am increased 5 to 10-fold with increasing concentration of some of these additives, with the maximum enhancement being observed in the presence of acetone or acetonitrile. However, alcohols are generally very poor in this respect. Possible reasons for such behavior are briefly discussed. The distribution of several common contaminants was also investigated at the optimum condition for americium extraction

  15. Transmutation of americium and curium incorporated in zirconia-based host materials

    International Nuclear Information System (INIS)

    Presented are studies involving the incorporation of americium and curium in zirconia-based materials. First explored was the pseudo ternary system AmO2-ZrO2-Y2O3. It was determined that selected Y-CSZ materials can incorporate significant quantities of americium oxide and remain cubic single-phase. The cell parameters of these fluorite-type products were established to be linear with the AmO2 content. The Cm2O3-ZrO2 system was also investigated. It was found that at 25 mol% of CmO1.5, the Cm(III) stabilized zirconia in its cubic form (a = 5.21 ±0.01 Angstrom). At higher and lower concentrations, diphasic materials were encountered. At 50 mol% of CmO1.5, a pyrochlore oxide - Cm2Zr2O7 - is formed (a = 10.63 ±0.02 Angstrom). (author)

  16. Americium and samarium determination in aqueous solutions after separation by cation-exchange

    International Nuclear Information System (INIS)

    The concentration of trivalent americium and samarium in aqueous samples has been determined by means of alpha-radiometry and UV-Vis photometry, respectively, after chemical separation and pre-concentration of the elements by cation-exchange using Chelex-100 resin. Method calibration was performed using americium (241Am) and samarium standard solutions and resulted in a high chemical recovery for cation-exchange. Regarding, the effect of physicochemical parameters (e.g. pH, salinity, competitive cations and colloidal species) on the separation recovery of the trivalent elements from aqueous solutions by cation-exchange has also been investigated. The investigation was performed to evaluate the applicability of cation-exchange as separation and pre-concentration method prior to the quantitative analysis of trivalent f-elements in water samples, and has shown that the method could be successfully applied to waters with relatively low dissolved solid content. (author)

  17. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  18. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  19. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  20. Fabrication of neptunium, plutonium, americium and curium metals for fuel research

    International Nuclear Information System (INIS)

    The techniques for the fabrication of actinide metals; neptunium, americium and curium called as minor actinides, and plutonium, are surveied in a viewpoint of the preparation of starting materials for fuel property measurements. In this report, the processes of the conversion to metals, purification et al. are reviewed. The concept related to the apparatus design is also proposed and the considerable subjects are discussed. (author)

  1. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  2. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    International Nuclear Information System (INIS)

    Highlights: • Dust free process for (U,Am)O2 transmutation target fabrication. • Synthesis of U0.9Am0.1O2 mixed oxide microspheres from ion exchange resin. • Fabrication of dense U0.9Am0.1O2 pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U0.9Am0.1O2±δ is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U0.9Am0.1O2±δ. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials

  3. Influence of dissolved organic substances in groundwater on sorption behavior of americium and neptunium

    International Nuclear Information System (INIS)

    Groundwaters typically contain dissolved organic carbon consisting largely of high molecular weight compounds of humic and fulvic acids. To evaluate whether these dissolved organic substances can enhance the tranport of radionuclides through the groundwater system, experiments were conducted to examine the sorption of americium and neptunium onto crushed basalt in the presence of dissolved humic- and fulvic-acid organic carbon introduced into synthetic groundwater. The partitioning experiments with synthetic groundwater show that increasing the concentration of either humic or fulvic acid in the water has a significant inhibiting effect on sorption of both americium and neptunium. At 220C, adsorption of these radionuclides, as measured by distribution ratios (the ratio of nuclide sorbed onto the solid to nuclide in solution at the end of the experiment), decreased by 25% to 50% by addition of as little as 1 mg/L dissolved organic carbon and by one to two orders of magnitude by addition of 100 to 200 mg/L dissolved organic carbon. Distribution ratios measured in solutions reacted at 900C similarly decreased with the addition of dissolved organic carbon but generally ranged from one to two orders of magnitude higher than those determined in the 220C experiment. These results suggest that organic carbon dissolved in deep groundwaters may significantly enhance the mobility of radionuclides of americium and neptunium. 23 references, 5 figures, 11 tables

  4. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  5. Selective recovery of americium alone from PUREX or COEXTM raffinate by the EXAm process

    International Nuclear Information System (INIS)

    Americium is the main contributor to the long-term radiotoxicity and to the heat generation of glasses used for the HLW conditioning. To decrease both impact on the ultimate waste and to avoid the difficult recycling of curium, the CEA has developed the EXAm process for the the separation and the recovery of the sole americium directly from PUREX or COEXTM raffinates. The principle of the EXAm process is to extract americium and light lanthanides from high nitric acid media, leaving curium and heavy lanthanides in the raffinate. A water-soluble amide molecule, TEDGA, is added in aqueous phase to increase Am/Cm and Am/heavy lanthanides selectivity, because of the preferential complexation of curium and heavy lanthanides by this diglycolamide. Many experimental data have been acquired mainly at the extraction-scrubbing step (Am/Cm separation) and were used for the development of a phenomenological model implemented in the PAREX process simulation code. The scientific feasibility demonstration of the EXAm process was then performed on a genuine PUREX raffinate in Atalante CBP hot cell in 2010. (author)

  6. Uptake and effects of americium-241 on a brackish-water amphipod

    International Nuclear Information System (INIS)

    The present paper reports the results of experimental work undertaken using the brackish-water amphipod Gammarus duebeni duebeni and the transuranium nuclide americium-241. Data on the accumulation of this actinide showed that the larger fraction of the total body burden is associated with the exoskeleton. It was found that the body burden remained constant in the range pH 8.0-6.5 even though the water concentration changed markedly. It would thus appear that the concept of a concentration factor should be re-examined and it is proposed that a factor should be defined in terms of environmental and chemical parameters which represent the bioavailable fraction of the actinide. The effect of americium on survival and moulting was studied at two activity concentrations; the dose rates and absorbed doses under the experimental conditions employed have been estimated. The differences in survival rates between the control and irradiated groups were statistically analyzed and the significant difference at the higher concentration is believed to be due to a synergism between physiological stress and radiotoxicity of americium rather than the chemical toxicity of the element. (orig.)

  7. Retention and translocation of foliar applied {sup 239,240}Pu and {sup 241}Am, as compared to {sup 137}Cs and {sup 85}Sr, into bean plants (Phaseolus vulgaris)

    Energy Technology Data Exchange (ETDEWEB)

    Henner, P. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)]. E-mail: pascale.henner@irsn.fr; Colle, C. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France); Morello, M. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)

    2005-07-01

    Foliar transfer of {sup 241}Am, {sup 239,240}Pu, {sup 137}Cs and {sup 85}Sr was evaluated after contamination of bean plants (Phaseolus vulgaris) at the flowering development stage, by soaking their first two trifoliate leaves into contaminated solutions. Initial retentions of {sup 241}Am (27%) and {sup 239,240}Pu (37%) were higher than those of {sup 137}Cs and {sup 85}Sr (10-15%). Mean fraction of retained activity redistributed among bean organs was higher for {sup 137}Cs (20.3%) than for {sup 239,240}Pu (2.2%), {sup 241}Am (1%) or {sup 85}Sr (0.1%). Mean leaf-to-pod translocation factors (Bq kg{sup -1}dry weight pod/Bq kg{sup -1}dry weight contaminated leaves) were 5.0 x 10{sup -4} for {sup 241}Am, 2.7 x 10{sup -6} for {sup 239,240}Pu, 5.4 x 10{sup -2} for {sup 137}Cs and 3.6 x 10{sup -4} for {sup 85}Sr. Caesium was mainly recovered in pods (12.8%). Americium and strontium were uniformly redistributed among leaves, stems and pods. Plutonium showed preferential redistribution in oldest bean organs, leaves and stems, and very little redistribution in forming pods. Results for americium and plutonium were compared to those of strontium and caesium to evaluate the consistency of the attribution of behaviour of strontium to transuranium elements towards foliar transfer, based on translocation factors, as stated in two radioecological models, ECOSYS-87 and ASTRAL.

  8. Results of 90Sr and 239+240Pu, 238Pu, 241Am measurements in some samples of mushrooms and forest soil from Poland

    International Nuclear Information System (INIS)

    Strontium-90, plutonium and americium activity concentrations in a few samples of forest soils, some species of mushrooms and fern leaves were determined. These results are compared with caesium activity concentrations in the same materials obtained in a previous work. Radiochemical procedures are described. The origin of the contamination (Chernobyl accident or nuclear test explosion release) is discussed. The 90Sr activity concentration ranges from 0.6 Bq/kg (mushroom samples) to 48.4 Bq/kg (fern leaves). For 239+240Pu, it ranges from not detected above background (mushrooms, fern) to 10.8 Bq/kg (humus layer of forest soil). The maximum concentration of 241Am is found to be 2.4 Bq/kg (humus sample) and for 238Pu it is 0.85 Bq/kg (also in the humus sample). (author). 12 refs, 9 figs, 7 tabs

  9. 90Sr and 239+240Pu 238Pu 241Am in some samples of mushrooms and forest soil from Poland

    International Nuclear Information System (INIS)

    Strontium-90, plutonium and americium activity concentrations in a few samples of forest soils, some species of mushrooms and fern leaves have been determined. These results are compared with cesium activity concentrations in the same materials obtained in a previous work. Radiochemical procedures are described. The origin of the contamination (Chernobyl accident or nuclear test explosion release) is discussed. The 90Sr activity concentration ranges from 0.6 Bq/kg (mushroom samples) to 48.4 Bq/kg (fern leaves). For 239+240Pu, it ranges from not detected above background (mushrooms, fern) to 10.8 Bq/kg (humus layer of forest soil). The maximum concentration of 241Am is found to be 2.4 Bq/kg (humus sample) and for 238Pu it is 0.85 Bq/kg (also in the humus sample). (author) 16 refs.; 7 figs.; 3 tabs

  10. About the reaction between uranium-americium mixed oxides and sodium

    International Nuclear Information System (INIS)

    The recycling and fission of the highly toxic minor actinides neptunium and americium is only possible in a liquid metal cooled fast breeder reactor, for nuclear physical reasons. The present work is part of a research program dealing with the fuel-coolant interaction. Fuel pellets with equal parts of americium and uranium and varying oxygen-metal ratio were investigated. A behaviour comparable to that of uranium-plutonium mixed oxides was suggested as a first approach. The reaction of sodium with (U0.5Am0.5)O2-x results in a complete desintegration of the sintered pellet whereas (U, Pu)O2-x pellets show a small increase in volume. A first explanation of the strong reaction of uranium-americium mixed oxides compared to (U, Pu)O2-x or (U, Np)O2-x could be provided by the less negative oxygen potential of the former. Ternary and polynary oxides which are possible products of the fuel-coolant reaction were prepared and characterised by X-ray diffraction. Their oxygen potentials were measured using a solid state e.m.f. cell. Neither Na2AmO3 nor Na3AmO4 can coexist with sodium metal. The measured ΔGO2 values of the Am(IV) and Am (V)-compounds are much higher than those of the sodium uranates(VI) or sodium neptunates(VI). Only Na2O seems to be likely as product of the fuel-coolant interactions. It could be determined in reacted samples by X-ray diffraction. The relatively high oxygen potentials of (U0.5Am0.5)O2-x that are responsible for the reaction could be explained by a binding model which is based on an americium valency state of + 3 and U5+. The existence of both valency states could be proved by XPS measurements. Due to the similar behaviour of neptunium and uranium the problems that are expected for the recycling of Np are much smaller than for americium

  11. 16 CFR 240.1 - Purpose of the Guides.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Purpose of the Guides. 240.1 Section 240.1 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.1 Purpose of the Guides. The purpose of these Guides is to provide assistance...

  12. 33 CFR 162.240 - Tongass Narrows, Alaska; navigation.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Tongass Narrows, Alaska; navigation. 162.240 Section 162.240 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY INLAND WATERWAYS NAVIGATION REGULATIONS § 162.240...

  13. 16 CFR 240.4 - Definition of customer.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Definition of customer. 240.4 Section 240.4... ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.4 Definition of customer. A customer is any... “customer” is any buyer of the seller's product for resale who purchases from or through a wholesaler...

  14. 20 CFR 405.240 - Sunset of this subpart.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Sunset of this subpart. 405.240 Section 405.240 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Review of Initial Determinations by a Federal Reviewing Official § 405.240 Sunset of this subpart. (a) If you filed...

  15. Modeling and production of {sup 240}Am by deuteron-induced activation of a {sup 240}Pu target

    Energy Technology Data Exchange (ETDEWEB)

    Finn, Erin C., E-mail: Erin.Finn@pnnl.gov; McNamara, Bruce, E-mail: Bruce.McNamara@pnnl.gov; Greenwood, Larry, E-mail: Larry.Greenwood@pnnl.gov; Wittman, Richard, E-mail: Richard.Wittman@pnnl.gov; Soderquist, Charles, E-mail: Chuck.Soderquist@pnnl.gov; Woods, Vincent, E-mail: Vincent.Woods@pnnl.gov; VanDevender, Brent, E-mail: Brent.Vandevender@pnnl.gov; Metz, Lori, E-mail: Lori.Metz@pnnl.gov; Friese, Judah, E-mail: Judah.Friese@pnnl.gov

    2015-04-15

    A novel reaction pathway for production of {sup 240}Am is reported. Models of reaction cross-sections in EMPIRE II suggest that deuteron-induced activation of a {sup 240}Pu target produces maximum yields of {sup 240}Am from 11.5 MeV incident deuterons. This activation had not been previously reported in the literature. A {sup 240}Pu target was activated under the modeled optimum conditions to produce {sup 240}Am. The modeled cross-section for the {sup 240}Pu(d, 2n){sup 240}Am reaction is on the order of 20–30 mbarn, but the experimentally estimated value is 5.6 ± 0.2 mbarn. We discuss reasons for the discrepancy as well as production of other Am isotopes that contaminate the final product.

  16. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  17. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  18. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  19. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  20. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  1. Neutron nuclear data for Pu-240

    International Nuclear Information System (INIS)

    The report gives evaluated nuclear data for the isotopes 239Pu, 240Pu, 241Pu and 242Pu, in the energy region 10-5eV-15 MeV needed for reactor calculations and other applications. Tables of Q-values and threshold energies are first presented for different possible reactions of neutrons with these nuclei. Then, evaluated data for 240Pu are given for the following characteristics of possible neutron reactions: total interaction cross-section, absorption cross-section, radiative capture cross-section, elastic and inelastic scattering cross-sections, cross sections of the (n, zn) and (n, 3n) reactions, average number of neutrons per fission event and per absorption event, elastic and inelastic scattering angular distributions, energy distributions of secondary neutrons, gamma-ray spectra. In addition, group-averaged constants are given. The parameters used in the calculations in the resonance energy region, unresolved resonance region and fast neutron energy region are specified. The evaluated data constitute a nuclear constants library and have been approved as standard for use in the USSR

  2. Recovery of Americium-241 from lightning rod by the method of chemical treatment

    International Nuclear Information System (INIS)

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 (241Am), fewer and Radium 226 (226Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of 241Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The 241Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel 241Am technique was used electrodeposition. (author)

  3. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  4. Americium and curium heterogeneous transmutation in moderated S/ A in the framework of CNE scenarios studies

    International Nuclear Information System (INIS)

    This paper presents the transmutation of Americium and Curium in a heterogeneous mode in the framework of the 1991 French Law concerning waste management. Two scenarios with moderated targets are presented: a 100% frit reactor (EFR) scenario multi-recycling Pu+Np with targets of Am+Cm placed in core and a mixed PWR (UOX fuel) and fast reactor (50% of EFR) multi-recycling Pu+Np and containing targets in core and in the blanket region. The design of the target is based on classical fast fuel S/A technology (pins, spacer wires,...) and should reach the goal of 90% fission rate. (authors)

  5. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids.

    Science.gov (United States)

    Dittrich, Timothy Mark; Boukhalfa, Hakim; Ware, Stuart Douglas; Reimus, Paul William

    2015-10-01

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater-bentonite-fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L(-1)) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10(-10) M (241)Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (k(f)) of 0.01-0.02 h(-1). Am recoveries in each column were 55-60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h(-1) in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance scales because

  6. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  7. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  8. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning; Holm, E.; Boelskifte, S.; Duniec, S.; Persson, B.

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north of...

  9. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  10. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code is developed to predict the extraction behavior of americium and lanthanides in the TRUEX (TRansUranium EXtraction)process. This code gives the concentration profiles of the components at steady state. The stage efficiency is included in this code as a parameter in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated concentration profiles are compared with the experimental results. The efficiency value for the mixer-settlers, which gives good agreement between the calculated and the experimental profiles, is evaluated. (author)

  11. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code for the TRUEX (TRansUranium EXtraction) process is developed to predict the extraction behavior of americium and lanthanides. This code gives the concentrations of the components at the steady state of the TRUEX process. The stage efficiency is applied to this code in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated profiles are compared with the experimental ones. The efficiency value for the mixer-settlers, which gives the best agreement between the two profiles, is investigated

  12. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  13. Experimental and in situ investigations on americium, curium and plutonium behaviour in marine benthic species: transfer from water or sediments

    International Nuclear Information System (INIS)

    The tranfer of transuranic elements -americium, curium and plutonium- from the sediments containing them to some marine benthic species (endofauna and epifauna) was studied with a twofold approach - laboratory and in-situ investigation. The experimental investigations, divided into three parts, made it possible to specify concentration factors (F.C.), transfer factors (F.T.) and to understand the process involved for 5 benthic species. The result were refined by an in-situ study that brought new data on the marine distribution of the transuranic elements released by the La Hague plant. Finally, the localization of americium and plutonium in the tissues and cells of these species was determined by autoradiography

  14. Microscopic Calculations of 240Pu Fission

    Energy Technology Data Exchange (ETDEWEB)

    Younes, W; Gogny, D

    2007-09-11

    Hartree-Fock-Bogoliubov calculations have been performed with the Gogny finite-range effective interaction for {sup 240}Pu out to scission, using a new code developed at LLNL. A first set of calculations was performed with constrained quadrupole moment along the path of most probable fission, assuming axial symmetry but allowing for the spontaneous breaking of reflection symmetry of the nucleus. At a quadrupole moment of 345 b, the nucleus was found to spontaneously scission into two fragments. A second set of calculations, with all nuclear moments up to hexadecapole constrained, was performed to approach the scission configuration in a controlled manner. Calculated energies, moments, and representative plots of the total nuclear density are shown. The present calculations serve as a proof-of-principle, a blueprint, and starting-point solutions for a planned series of more comprehensive calculations to map out a large set of scission configurations, and the associated fission-fragment properties.

  15. Vitrification of F-area americium/curium: feasibility study and preliminary process recommendation

    International Nuclear Information System (INIS)

    Work was performed to identify a process to vitrify the contents of F- canyon Tank 17.1. Tank 17.1 contains the majority of americium (Am) and curium (Cm) contained in the DOE Complex. Oak Ridge National Laboratory (ORNL) has made a formal request for this material as fuel for production of Cf252 and other transplutonium actinides. The Am and Cm (and associated lanthanide fission products) are currently in nitric acid solution. Transportation of the intensely radioactive Am/Cm in liquid form is not considered possible. As a result, the material will either be solidified and shipped to ORNL or discarded to the Tank Farm. Nuclear Materials Processing Technology (NMPT), therefore, requested Defense Waste Processing Technology (DWPT) to determine if the Tank 17.1 material could be vitrified, and if it was vitrified could the americium and curium be successfully recovered. Research was performed to determine if the Tank 17.1 contents could indeed be mixed with glass formers and vitrified. Additional studies identified critical process parameters such as heat loading, melter requirements, off-gas evolution, etc. Discussions with NMPT personnel were initiated to determine existing facilities where this work could be accomplished safely. A process has been identified which will convert the Am/Cm material into approximately 300kg of glass

  16. Americium and europium extraction from carbonate solutions by 1-phenyl-3-methyl-4-benzoylpyrazolone -5

    International Nuclear Information System (INIS)

    Trivalent TPEs and REEs are extractable from carbonate solutions by 1-pheny-3-methyl-4-benzoylpyrazolone-5 (PMBP). The effect of concentration of KHCO3 and K2CO3, extractant, metal, and other factors on the extent of extraction of the elements has been clarified. The kinetics of extraction of the elements from carbonate solutions has been studied. It has been shown that in the KHCO3 concentration range 0.2-2.0 M americium and europium are extracted by PMBP solutions in different diluents with distribution coefficients lying within n x 102-n x 103. From K2CO3 solutions the elements are extracted better by PMBP solutions in methyl isobutyl ketone (MIBK). It has been shown that metal concentration in the range 1x10-5. 5x10-3 g-ion x liter-1 does not affect extraction (log E = 3). Extracts based on PMBP with a metal content higher than 5x10-3g-ion x liter-1 were obtained by absolute concentrating method and were used for the study of 13C NMR spectra. The composition of thecompounds extracted by PMBP from carbonate solutions was determined by 13C NMR spectroscopy and extraction. The conditions of europium and americium reextraction from extracts based on PMBP by complexones, their mixtures with alkalis and other substances were studied. The scopes for using the system PMBP-carbonate solutions to separate and concentrate TPEs and REEs has been examined

  17. Evaluation of americium-241 toxicity influence on the microbial growth of organic wastes

    International Nuclear Information System (INIS)

    Available in abstract form only. Full text of publication follows: Since the licenses for using radioactive sources in radioactive lightning rods were lifted by the Brazilian national nuclear authority, in 1989, the radioactive devices have been replaced by Franklin type and collected as radioactive waste. However, only 20 percent of the estimated total number of installed rods was delivered to Brazilian Nuclear Commission. This situation causes concern, due to, first, the possibility of the rods being disposed as domestic waste, and second, the americium, the most commonly employed radionuclide, is classified as a high-toxicity element. In the present study, Am-241 migration experiments were performed by a lysimeter system, in order to evaluate the risk of contamination caused by radioactive lightning rods disposed as a common solid waste. Besides the risk evaluation, it is important to know the mechanism of the Am-241 release or retention in waste as well as its influence in the waste decomposition processes. Many factors are involved, but microorganisms present in the waste play an important role in its degradation, which control the physical and chemical processes. The objective of this work was to evaluate the Am-241 influence on the microbial population by counting number of cells in lysimeters leachate. Preliminary results suggest that americium may influence significantly the bacteria growth in organic waste, evidenced by culture under aerobiosis and an-aerobiosis and the antimicrobial resistance test. (authors)

  18. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  19. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  20. An economic analysis of a light and heavy water moderated reactor synergy: burning americium using recycled uranium

    International Nuclear Information System (INIS)

    An economic analysis is presented for a proposed synergistic system between 2 nuclear utilities, one operating light water reactors (LWR) and another running a fleet of heavy water moderated reactors (HWR). Americium is partitioned from LWR spent nuclear fuel (SNF) to be transmuted in HWRs, with a consequent averted disposal cost to the LWR operator. In return, reprocessed uranium (RU) is supplied to the HWRs in sufficient quantities to support their operation both as power generators and americium burners. Two simplifying assumptions have been made. First, the economic value of RU is a linear function of the cost of fresh natural uranium (NU), and secondly, plutonium recycling for a third utility running a mixed oxide (MOX) fuelled reactor fleet has been already taking place, so that the extra cost of americium recycling is manageable. We conclude that, in order for this scenario to be economically attractive to the LWR operator, the averted disposal cost due to partitioning americium from LWR spent fuel must exceed 214 dollars per kg, comparable to estimates of the permanent disposal cost of the high level waste (HLW) from reprocessing spent LWR fuel. (authors)

  1. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C H; Barney, G S

    1983-03-01

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO/sub 2/, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO/sub 2/ decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition.

  2. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    International Nuclear Information System (INIS)

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO2, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO2 decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition

  3. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  4. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  5. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  6. Dicty_cDB: SHA240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHA240 (Link to dictyBase) - - - Contig-U16259-1 SHA240P (Link to Original ... ence. 44 7.6 1 CX078364 |CX078364.1 UCRCS08_8F05_b Parent ... Washington Navel Orange Callus cDNA Library UCRCS0 ...

  7. 42 CFR 455.240 - Conflict of interest resolution.

    Science.gov (United States)

    2010-10-01

    ... though the conflict of interest exists and a request for waiver is approved in accordance with 48 CFR 9... 42 Public Health 4 2010-10-01 2010-10-01 false Conflict of interest resolution. 455.240 Section... § 455.240 Conflict of interest resolution. (a) Review Board: CMS may establish a Conflicts of...

  8. 49 CFR 240.125 - Criteria for testing knowledge.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for testing knowledge. 240.125 Section... Elements of the Certification Process § 240.125 Criteria for testing knowledge. (a) Each railroad's program... locomotive service to determine that the person has sufficient knowledge of the railroad's rules...

  9. 17 CFR 240.17Ad-3 - Limitations on expansion.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Limitations on expansion. 240.17Ad-3 Section 240.17Ad-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... expansion. (a) Any registered transfer agent which is required to file any notice pursuant to §...

  10. 16 CFR 240.13 - Customer's and third party liability.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Customer's and third party liability. 240.13... ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.13 Customer's and third party liability. (a) Customer's liability: Sections 2 (d) and (e) apply to sellers and not to customers....

  11. 49 CFR 240.127 - Criteria for examining skill performance.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for examining skill performance. 240.127... Elements of the Certification Process § 240.127 Criteria for examining skill performance. (a) Each railroad... have procedures for examining the performance skills of a person being evaluated for qualification as...

  12. 17 CFR 240.17g-5 - Conflicts of interest.

    Science.gov (United States)

    2010-04-01

    ... money market instruments for which it accesses information pursuant to 17 CFR 240.17g-5(a)(3)(iii), if... market instruments; or (B) Has not accessed information pursuant to 17 CFR 240.17g-5(a)(3) 10 or more... section relating to issuing or maintaining a credit rating for a security or money market...

  13. 46 CFR 172.240 - Permeability of spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Permeability of spaces. 172.240 Section 172.240 Shipping... Permeability of spaces. When doing the calculations required in § 172.225, (a) The permeability of a floodable... space permeability of 85% unless the use of an assumed permeability of less than 85% is justified...

  14. Dicty_cDB: SLE240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLE240 (Link to dictyBase) - G24169 DDB0188248 Contig-U04015-1 SLE240E (Lin ... 78 3 ( E16012 ) Marker DNA sequence related to the sensitivity ... agai... 48 0.25 1 ( GF032701 ) pRRL2:Newb:20080411 ...

  15. 16 CFR 240.12 - Checking customer's use of payments.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Checking customer's use of payments. 240.12... ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.12 Checking customer's use of... are furnished and that the seller is not overpaying for them. The customer should expend the...

  16. Dicty_cDB: SFL240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFL240 (Link to dictyBase) - - - Contig-U16243-1 SFL240P (Link to Original ... .. 284 4e-75 X75329_1( X75329 |pid:none) M.indica (Manila ) THMF5 mRNA for 3-ket... 284 4e-75 AK222103_1( AK2 ...

  17. 46 CFR 16.240 - Serious marine incident testing requirements.

    Science.gov (United States)

    2010-10-01

    ... chemically tested for evidence of dangerous drugs and alcohol in accordance with the requirements of 46 CFR 4... 46 Shipping 1 2010-10-01 2010-10-01 false Serious marine incident testing requirements. 16.240... CHEMICAL TESTING Required Chemical Testing § 16.240 Serious marine incident testing requirements....

  18. Application of ion-exchange chromatography to eliminate the curium from americium by his determination by the method of liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    The aim of this work is to eliminate curium in determining of americium by the method of liquid scintillation spectrometry. The paper introduces a method that has been done to eliminate curium from americium by determining of americium with liquid scintillation spectrometry method. In the research we used ion-exchange chromatography and ion-exchange sorbents DOWEX. We also observed the effect of geometry organization of column on the separation course. Resources for alpha spectrometry were prepared by micro-precipitation with neodymium chloride. High radiochemical yields were achieved, but separation did not take place according to a pre-separation scheme. (authors)

  19. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  20. Imitators of plutonium and americium in a mixed uranium- plutonium nitride fuel

    Science.gov (United States)

    Nikitin, S. N.; Shornikov, D. P.; Tarasov, B. A.; Baranov, V. G.; Burlakova, M. A.

    2016-04-01

    Uranium nitride and mix uranium nitride (U-Pu)N is most popular nuclear fuel for Russian Fast Breeder Reactor. The works in hot cells associated with the radiation exposure of personnel and methodological difficulties. To know the main physical-chemical properties of uranium-plutonium nitride it necessary research to hot cells. In this paper, based on an assessment of physicochemical and thermodynamic properties of selected simulators Pu and Am. Analogues of Pu is are Ce and Y, and analogues Am - Dy. The technique of obtaining a model nitride fuel based on lanthanides nitrides and UN. Hydrogenation-dehydrogenation- nitration method of derived powders nitrides uranium, cerium, yttrium and dysprosium, held their mixing, pressing and sintering, the samples obtained model nitride fuel with plutonium and americium imitation. According to the results of structural studies have shown that all the samples are solid solution nitrides rare earth (REE) elements in UN.

  1. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed. 16 refs., 6 figs

  2. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutyl-carbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed

  3. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    International Nuclear Information System (INIS)

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by 1H and 13C NMR, mass and IR spectroscopy. The extraction behaviour of (152+154)Eu(III) and 241Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for (152+154)Eu(III) and HDEHSDGA shows the superior selectivity for 241Am(III). (orig.)

  4. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids

    International Nuclear Information System (INIS)

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater–bentonite–fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L−1) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10−10 M 241Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (kf) of 0.01–0.02 h−1. Am recoveries in each column were 55–60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h−1 in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance

  5. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    International Nuclear Information System (INIS)

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and 241Am was low, with specific activity in the tissues 241Am occurred and 241Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author)

  6. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  7. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation

    International Nuclear Information System (INIS)

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  8. Ab initio modelling of the behaviour of helium in americium and plutonium oxides

    International Nuclear Information System (INIS)

    By means of an ab initio plane wave pseudo potential method, plutonium dioxide and americium dioxide are modelled, and the behaviour of helium in both these materials is studied. We first show that a pseudo potential approach in the Generalized Gradient Approximation (GGA) can satisfactorily describe the cohesive properties of PuO2 and AmO2. We then calculate the formation energies of point defects (vacancies and interstitials), as well as the incorporation and solution energies of helium in PuO2 and AmO2. The results are discussed according to the incorporation site of the gas atom in the lattice and to the stoichiometry of PuO2±x and AmO2±x. (authors)

  9. Removal of plutonium and americium from hydrochloric acid waste stream using extraction chromatography

    International Nuclear Information System (INIS)

    Extraction chromatography is under development as a method to lower actinide activity levels in hydrochloric acid (HCl) effluent streams. Successful application of this technique would allow recycle of the largest portion of HCl, while lowering the quantity and improving the form of solid waste generated. The extraction of plutonium and americium from HCl solutions was examined for several commercial and similar laboratory-produced resins coated with n-octyl(phenyl)-N,N-diisobutylcarbamoylmethyphosphine oxide (CMPO) and either tributyl phosphate (TBP), or diamyl amylphosphonate (DAAP). Distribution coefficients for Pu and Am were measured by contact studies in hydrochloric acid solutions over the range of 0.1 - 10.0 N HCl, whole varying REDOX conditions, actinide loading levels, and contact time intervals. Significant differences in the actinide distribution coefficients, and in the kinetics of actinide removal were observed as a function of resin formulation. The usefulness of these resins for actinide removal from HCl effluent streams is discussed

  10. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  11. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  12. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  13. A double-blind, prospective, randomized, multicenter group comparison study of iopromide 240 vs iohexol 240 in myelography

    International Nuclear Information System (INIS)

    The aim of this study was to evaluate the safety and efficacy of iopromide 240 mgI/ml in comparison with iohexol 240 mgI/ml in myelography. A total of 421 patients in seven centers and four countries received an average of 11.9 ml of either iopromide 240 (278 patients) or iohexol 240 (143 patients) for X-ray and/or CT myelography in a randomized (2:1), prospective, double-blind study. All patients were followed up 3-4 h after the procedure, and 327 patients remained hospitalized for 24 h. In 82 patients an EEG was recorded prior to as well as 3-4 h and 24 h after myelography. Physical examinations, including measurement of vital signs, were performed in all patients at these time points. The results were subject to statistical analysis with the primary variable being the incidence of adverse events. Both contrast media (CM) were equally effective in terms of opacification. The rating for opacity was ''good'' or ''excellent'' in 88 % for both CM. Four patients (iopromide group: n = 3; iohexol group: n = 1) had transient EEG changes but did not show clinical symptomatology. The overall rate of patients experiencing any adverse event (AE) was 16.9 % for iopromide 240 and 14.0 % for iohexol 240. Equivalence testing was inconclusive; however, the results indicated equivalence. The rate for AEs considered as study-drug related was slightly lower with iopromide 240 than with iohexol 240 (7.2 vs 7.7 %, respectively). Neither unknown nor unexpected AEs known for myelographic X-ray CM nor serious adverse events were observed. Iopromide 240 and iohexol 240 are equally safe and effective and can be recommended for myelography. (orig.)

  14. 17 CFR 240.15g-100 - Schedule 15G-Information to be included in the document distributed pursuant to 17 CFR 240.15g-2.

    Science.gov (United States)

    2010-04-01

    ... included in the document distributed pursuant to 17 CFR 240.15g-2. 240.15g-100 Section 240.15g-100... included in the document distributed pursuant to 17 CFR 240.15g-2. SECURITIES AND EXCHANGE COMMISSION... calculated to draw the customer's attention to the language in the document, especially words that...

  15. 17 CFR 240.15c3-1g - Conditions for ultimate holding companies of certain brokers or dealers (Appendix G to 17 CFR 240...

    Science.gov (United States)

    2010-04-01

    ... application under § 240.15c3-1e(a)). (B) A graph reflecting, for each business line, the daily intra-month VaR... holding companies of certain brokers or dealers (Appendix G to 17 CFR 240.15c3-1). 240.15c3-1g Section 240... companies of certain brokers or dealers (Appendix G to 17 CFR 240.15c3-1). As a condition for a broker...

  16. Plutonium, americium and other actinides on Belarus territory: source, levels, risks

    International Nuclear Information System (INIS)

    For Belarus it was showed that in result of falling during nuclear trials happened contamination of upper soil layer by transuranium elements with medium level of contamination for 239,240Pu 53±17 Bq/m2. After Chernobyl accident this characteristic equal 1.1· Bq/m2 on the south of Belarus. In result accident it was revealed 17 actinides. For Chernobyl falling was determined big contents of 241Pu that will lead to maximum value of 241Am in 2059, which will be more in 2,5 times than 239,240Pu

  17. Dicty_cDB: AFF240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFF240 (Link to dictyBase) - - - Contig-U11212-1 AFF240Z (Link to Original ... b Zea mays genomic clone ZMMBBb0237K14 3', genomic survey ... sequence. 46 0.35 1 BZ402539 |BZ402539.1 OGAAN59TC ... ubsp. mays genomic clone ZMMBBb0577H08 5', genomic survey ... sequence. 46 0.35 1 CL261567 |CL261567.1 ZMMBBb061 ...

  18. 17 CFR 240.10A-2 - Auditor independence.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Auditor independence. 240.10A... Exchange Act of 1934 Reports Under Section 10a § 240.10A-2 Auditor independence. It shall be unlawful for an auditor not to be independent under § 210.2-01(c)(2)(iii)(B), (c)(4), (c)(6), (c)(7), and §...

  19. An electrochemical oxidation process of Am (III) into Am (VI) used to separate the americium of spent fuels reprocessing solutions

    International Nuclear Information System (INIS)

    The aim of this invention is to oxidize by an electrochemical process Am (III) to Am (VI). This process can be used to separate the americium of spent fuels reprocessing solutions. The method consists to add to the aqueous nitric solution containing Am (III) an heteropolyanion able to complex the americium (as for instance the potassium tungstophosphate) and the Ag (II) ion. The Ag (II) ion oxidizes the Am (III) and is reduced into an Ag (I) ion. It is then regenerated by the electrolysis of the solution. After the oxidation of Am (III) into Am (VI), this last ion can be extracted by an adapted organic solvent. With this electrochemical method a yield of 100% Am (VI) is obtained in half a hour. (O.M.). 5 refs., 5 figs., 2 tabs

  20. Separation of oxidized americium from lanthanides by use of pillared metal(IV) phosphate-phosphonate hybrid materials

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle in the US poses many challenges, one of which is found in the waste streams, which contain both trivalent lanthanides and actinides. The separation of americium from the raffinate will dramatically reduce the long-term radiotoxicity of the waste. The sorption of americium in both the tri- and pentavalent oxidation states was observed for four M(IV) phosphate-phosphonate ion exchange materials in nitric acid at pH 2. High selectivity was observed for reduced Am(III) with Kd values ca. 6 x 105 mL/g, while the Kd values for Am(V) were much lower. A new method of synthesizing and stabilizing AmO2+ to yield a lifetime of at least 24 h in acidic media using a combination of sodium persulfate and calcium hypochlorite will be described.

  1. Effects of impurities on the size and form of crystals of thorium and americium oxalates and oxides

    International Nuclear Information System (INIS)

    The influence of impurity salts and certain surfactants on the shape and size of thorium and americium oxalate crystals, as well as crystals of their dioxides, prepared at thermolysis of oxalate precipitates, has been investigated. It is shown that during thorium oxalate deposition from solutions, containing 0.8 mol/l thorium and 2 mol/l nitric acid at 96 deg C in the presence of ammonium salts or surfactants larger and monodisperse crystals are grown than in the absence of the above-mentioned substances. Addition of ammonium nitrate in the amount of 0.6 mol/l to solution containing 7.6x10-3 mol/l of americium dioxide particles coincides with the shape of oxalate crystals but their size is reduced by (20-25)% as compared with the initial ones

  2. Combined radiochemical procedure for determination of plutonium, americium and strontium-90 in the soil samples from SNTS

    International Nuclear Information System (INIS)

    The results of combined radiochemical procedure for the determination of plutonium, americium and 90Sr (via measurement of 90Y) in the soil samples from SNTS (Semipalatinsk Nuclear Test Site) are presented. The processes of co-precipitation of these nuclides with calcium fluoride in the strong acid solutions have been investigated. The conditions for simultaneous separation of americium and yttrium using extraction chromatography have been studied. It follows from analyses of real soil samples that the procedure developed provides the chemical recovery of plutonium and yttrium in the range of 50-95 % and 60-95 %, respectively. The execution of the procedure requires 3.5 working days including a sample decomposition study. (author)

  3. Kinetics of the oxidation-reduction reactions of uranium, neptunium, plutonium, and americium in aqueous solutions

    International Nuclear Information System (INIS)

    This is a review with about 250 references. Data for 240 reactions are cataloged and quantitative activation parameters are tabulated for 79 of these. Some empirical correlations are given. Twelve typical reactions are discussed in detail, along with the effects of self-irradiation and ionic strength. (U.S.)

  4. Extraction of americium(III) from nitric acid medium by CMPO-TBP extractants in ionic liquid diluent

    International Nuclear Information System (INIS)

    Extraction of americium(III) from nitric acid medium by a solution of tri-n-butylphosphate (TBP) and n-octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in room temperature ionic liquid, l-butyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide (bmimNTf2), was studied and the results were compared with that obtained with CMPO-TBP in n-doddecane (n-DD). The distribution ratio of 241Am(III) in TBP-CMPO/bmimNTf2 was measured as a function of various parameters such as concentrations of nitric acid, CMPO, bmimNO3, NaNO3 and TBP and temperature. Remarkably large distribution ratios were observed for the extraction of americium(III) when bmimNTf2 acted as diluent and the extraction was insignificant in the absence of CMPO. The stoichiometry of metal-solvate in organic phase was determined by the slope analysis of extraction data and it indicated the formation of 1:3 (Am: CMPO) complex in organic phase. Viscosity of TBP-CMPO/bmimNTf2 at various temperatures and enthalpy change accompanied by the extraction of americium(III) were determined and reported in this paper. (orig.)

  5. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  6. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  7. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  8. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  9. 17 CFR 240.14a-2 - Solicitations to which § 240.14a-3 to § 240.14a-15 apply.

    Science.gov (United States)

    2010-04-01

    ...) and specified in the Notice of Exempt Preliminary Roll-up Communication (§ 240.14a-104). If the communication is oral, this disclosure may be provided to the security holder orally. Whether the communication... another's behalf, the power to act as proxy for a shareholder and does not furnish or otherwise...

  10. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  11. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  12. Influence of organic additives on the colour reaction between trivalent americium and arsenazo III

    International Nuclear Information System (INIS)

    The colour reaction of Am(III) with arsenazo III in several hydroorganic media has been examined systematically on the addition of certain polar water-miscible organic solvents in the course of a search for improved and simple spectrophotometric methods for the estimation of americium. Addition of these substances resulted in the stabilization of colour and brought about a drastic enhancement in the absorbance values. The organic additives studied include acetone, acetonitrile, dimethylformamide, dioxane and ethanol. Among the many solvents tested, alcohol and dioxane proved to be the most effective, the highest sensitivity is obtained by using a 60% dioxane-ethanol (1:1) mixture. The apparent molar absorptivity based on Am content is 184616+-9931 mol-1 cm-1 at 655 nm which is about 3 times higher than that attained for the reaction in aqueous medium (65178+-1243). Moreover, this is the highest value reported as yet for its determination. Beer's law is obeyed both in mixed and aqueous media. The effects of some experimental variables on colour development have also been studied to optimize the conditions for the assay of Am. (author)

  13. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  14. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  15. Assessment of radiation doses from residential smoke detectors that contain americium-241

    International Nuclear Information System (INIS)

    External dose equivalents and internal dose commitments were estimated for individuals and populations from annual distribution, use, and disposal of 10 million ionization chamber smoke detectors that contain 110 kBq (3 μCi) americium-241 each. Under exposure scenarios developed for normal distribution, use, and disposal using the best available information, annual external dose equivalents to average individuals were estimated to range from 4 fSv (0.4 prem) to 20 nSv (2 μrem) for total body and from 7 fSv to 40 nSv for bone. Internal dose commitments to individuals under post disposal scenarios were estimated to range from 0.006 to 80 μSv (0.0006 to 8 mrem) to total body and from 0.06 to 800 μSv to bone. The total collective dose (the sum of external dose equivalents and 50-year internal dose commitments) for all individuals involved with distribution, use, or disposal of 10 million smoke detectors was estimated

  16. NMR Evidence for the 8.5 K Phase Transition in Americium Dioxide

    Science.gov (United States)

    Tokunaga, Yo; Nishi, Tsuyoshi; Kambe, Shinsaku; Nakada, Masami; Itoh, Akinori; Homma, Yoshiya; Sakai, Hironori; Chudo, Hiroyuki

    2010-05-01

    We report here the first NMR study of americium dioxide (AmO2). More than 30 years ago, a phase transition was suggested to occur in this compound at 8.5 K based on magnetic susceptibility data, while no evidence had been obtained from microscopic measurements. We have prepared a powder sample of 243AmO2 containing 90 at. % 17O and have performed 17O NMR at temperatures ranging from 1.5 to 200 K. After a sudden drop of the 17O NMR signal intensity below 8.5 K, at 1.5 K we have observed an extremely broad spectrum covering a range of ˜14 kOe in applied field. These data provide the first microscopic evidence for a phase transition as a bulk property in this system. In addition, the 17O NMR spectrum has been found to split into two peaks in the paramagnetic state, an effect which has not been reported for actinide dioxides studied up to now. We suggest that the splitting is induced by self-radiation damage from the alpha decay of 243Am.

  17. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  18. In Vitro Dissolution Tests of Plutonium and Americium Containing Contamination Originating From ZPPR Fuel Plates

    Energy Technology Data Exchange (ETDEWEB)

    William F. Bauer; Brian K. Schuetz; Gary M. Huestis; Thomas B. Lints; Brian K. Harris; R. Duane Ball; Gracy Elias

    2012-09-01

    Assessing the extent of internal dose is of concern whenever workers are exposed to airborne radionuclides or other contaminants. Internal dose determinations depend upon a reasonable estimate of the expected biological half-life of the contaminants in the respiratory tract. One issue with refractory elements is determining the dissolution rate of the element. Actinides such as plutonium (Pu) and Americium (Am) tend to be very refractory and can have biological half-lives of tens of years. In the event of an exposure, the dissolution rates of the radionuclides of interest needs to be assessed in order to assign the proper internal dose estimates. During the November 2011 incident at the Idaho National Laboratory (INL) involving a ZPPR fuel plate, air filters in a constant air monitor (CAM) and a giraffe filter apparatus captured airborne particulate matter. These filters were used in dissolution rate experiments to determine the apparent dissolution half-life of Pu and Am in simulated biological fluids. This report describes these experiments and the results. The dissolution rates were found to follow a three term exponential decay equation. Differences were noted depending upon the nature of the biological fluid simulant. Overall, greater than 95% of the Pu and 93% of the Am were in a very slow dissolving component with dissolution half-lives of over 10 years.

  19. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  20. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T.F.; Smith, J.D. (Melbourne Univ., Parkville (Australia). Dept. of Inorganic Chemistry); Fowler, S.W.; LaRosa, J.; Holm, E. (International Atomic Energy Agency, Monaco-Ville (Monaco). Lab. of Marine Radioactivity); Aarkrog, A.; Dahlgaard, H. (Risoe National Lab., Roskilde (Denmark))

    1991-01-01

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and {sup 241}Am was low, with specific activity in the tissues <1% (dry wt) than in the sediments. Over the first three months, a slight preference in transfer of plutonium over {sup 241}Am occurred and {sup 241}Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author).

  1. Pu-239 and Pu-240 inventories and Pu-240/ Pu-239 atom ratios in the water column off Sanriku, Japan.

    Science.gov (United States)

    Yamada, Masatoshi; Zheng, Jian; Aono, Tatsuo

    2013-04-01

    A magnitude 9.0 earthquake and subsequent tsunami occurred in the Pacific Ocean off northern Honshu, Japan, on 11 March 2011 which caused severe damage to the Fukushima Dai-ichi Nuclear Power Plant. This accident has resulted in a substantial release of radioactive materials to the atmosphere and ocean, and has caused extensive contamination of the environment. However, no information is available on the amounts of radionuclides such as Pu isotopes released into the ocean at this time. Investigating the background baseline concentration and atom ratio of Pu isotopes in seawater is important for assessment of the possible contamination in the marine environment. Pu-239 (half-life: 24,100 years), Pu-240 (half-life: 6,560 years) and Pu-241 (half-life: 14.325 years) mainly have been released into the environment as the result of atmospheric nuclear weapons testing. The atom ratio of Pu-240/Pu-239 is a powerful fingerprint to identify the sources of Pu in the ocean. The Pu-239 and Pu-240 inventories and Pu-240/Pu-239 atom ratios in seawater samples collected in the western North Pacific off Sanriku before the accident at Fukushima Dai-ichi Nuclear Power Plant will provide useful background baseline data for understanding the process controlling Pu transport and for distinguishing additional Pu sources. Seawater samples were collected with acoustically triggered quadruple PVC sampling bottles during the KH-98-3 cruise of the R/V Hakuho-Maru. The Pu-240/Pu-239 atom ratios were measured with a double-focusing SF-ICP-MS, which was equipped with a guard electrode to eliminate secondary discharge in the plasma and to enhance overall sensitivity. The Pu-239 and Pu-240 concentrations were 2.07 and 1.67 mBq/m3 in the surface water, respectively, and increased with depth; a subsurface maximum was identified at 750 m depth, and the concentrations decreased with depth, then increased at the bottom layer. The total Pu-239+240 inventory in the entire water column (depth interval 0

  2. Fabrication of 12% {sup 240}Pu calorimetry standards

    Energy Technology Data Exchange (ETDEWEB)

    Long, S.M.; Hildner, S.; Gutierrez, D.; Mills, C.; Garcia, W.; Gurule, C.

    1995-08-01

    Throughout the DOE complex, laboratories are performing calorimetric assays on items containing high burnup plutonium. These materials contain higher isotopic range and higher wattages than materials previously encountered in vault holdings. Currently, measurement control standards have been limited to utilizing 6% {sup 240}Pu standards. The lower isotopic and wattage value standards do not complement the measurement of the higher burnup material. Participants of the Calorimetry Exchange (CALEX) Program have identified the need for new calorimetric assay standards with a higher wattage and isotopic range. This paper describes the fabrication and verification measurements of the new CALEX standard containing 12% {sup 240}Pu oxide with a wattage of about 6 to 8 watts.

  3. Separation and activity determination of 239+240Pu, 241Am and Curium (242and244Cm) in evaporator concentrate by Alpha Spectrometry

    International Nuclear Information System (INIS)

    Alpha spectrometry analysis was used for activity determinations of Pu, Am and Cm isotopes in evaporator concentrate samples from nuclear power plants. Using a sequential procedure the first step was Pu isolation by an anion exchange column followed by an Am and Cm separation of U and Fe by a co-precipitation with oxalic acid. The precipitate was used for americium and curium separation of strontium by using a TRU resin extraction chromatography column. Due to their chemical similarities and energy difference it was seen that the simultaneous determination of 241Am, 242Cm and 243,244Cm isotopes is possible using the 243Am as tracer, once they have peaks in different region of interest (ROI) in the alpha spectrum. In this work it was used tracers, 238Pu, 243Am, 244Cm and 232U, for determination and quantification of theirs isotopes, respectively. The standard deviations for replicate analysis were calculated and for 241Am it was (1,040 ± 160 mBqKg-1), relative standard deviation 15.38%, and for 239+240Pu it was (551 +- 44 mBqKg-1), relative standard deviation 7.98%. In addition, for the 242Cm isotope the standard deviation for determinations was(75 ± 23 mBqKg-1), with the relative standard deviation 30.67% higher than for 241Am and 239+240Pu. The radiometric yields ranged from 90% to 105% and the lower limit of detection was estimated as being 2.05 mBqKg-1. (author)

  4. 40K, 137Cs, 90Sr, 238,239+240Pu and 241Am in mammals' skulls from owls' pellets and owl skeletons in Poland

    International Nuclear Information System (INIS)

    Skulls of small mammals belonging to two species of rodents and three species of insectivores collected in Eastern Poland were the subject of the present investigation. The skulls were separated from owl pellets. Activities of 40K, 137Cs, 90Sr, 238,239+240Pu and 241Am were determined by means of gamma spectrometry as well as liquid scintillation spectrometry or alpha spectrometry along with relevant radiochemical procedures. A detailed description of the procedures is provided. The research was supplied with the analysis of three skeletons of owls. No measurable difference between the skulls of rodents and insectivorous animals with regard to activity of any of the examined radionuclides was found. No accumulation effect in the owl skeletons was detected. Though measured activities of 137Cs and 40K for the skulls were of the same magnitude as those found previously for large wild herbivorous animals from typical locations in Poland, those for 90Sr were even lower than previously determined. A big difference was found for activities of plutonium and americium isotopes. Their mean activities were higher by an order of magnitude when compared to the examined previously values. The maximum 239+240Pu activity was equal to 97.5±7.7 mBq/kg, with 65% of it originating from global fallout. Relatively high content of transuranic elements found for rodents and insectivorous mammals seems to be unrelated to their feeding habits and should rather be attributed to the living conditions. It is suggested that small mammals, together with tiny soil particles present in mid-soil living tunnels, can inhale the transuranic elements

  5. Sequential leaching extraction of 239,240Pu, 238Pu, 241Pu, 237Np and 241Am from a mud sample: An intercomparison study

    International Nuclear Information System (INIS)

    The transuranics content of a mud sample taken from a nuclear waste storage container was analysed employing two different sequential extraction methods. The following fractions were isolated: (1)Water soluble (2) Readily available (3) Carbonate bound and specifically adsorbed (4) Organically bound (5) Oxide and hydroxides bound and (6) residual. Both methods differ in the reagents employed, the extraction sequence applied as well as the temperature and means of extraction. The 239,240Pu, 238Pu, 237Np and 241Am extracted in each phase were determined using standard radiochemical procedures. 241Pu was analysed through the 241Am in-growth on just one old disk of the residual fraction containing plutonium. Plutonium was mainly associated to organic-oxides fractions (89-92 %). The percentage extracted in each fraction depended on the method and the extraction sequence used. The soluble fraction of plutonium was less than 13%. Neptunium seemed to be the more soluble than the other transuranics (27%) and the americium showed a tendency to be associated to carbonates (30%). (author)

  6. Sequential determination of natural (232Th, 238U) and anthropogenic (137Cs, 90Sr, 241Am, 239+240Pu) radionuclides in environmental matrix

    International Nuclear Information System (INIS)

    A new sequential method for the determination of both natural (U, Th) and anthropogenic (Sr, Cs, Pu, Am) radionuclides has been developed for application to soil and sediment samples. The procedure was optimised using a reference sediment (IAEA-368) and reference soils (IAEA-375 and IAEA-326). Reference materials were first digested using acids (leaching), 'total' acids on hot plate, and acids in microwave in order to compare the different digestion technique. Then, the separation and purification were made by anion exchange resin and selective extraction chromatography: Transuranic (TRU) and Strontium (SR) resins. Natural and anthropogenic alpha radionuclides were separated by Uranium and Tetravalent Actinide (UTEVA) resin, considering different acid elution medium. Finally, alpha and gamma semiconductor spectrometer and liquid scintillation spectrometer were used to measure radionuclide activities. The results obtained for strontium-90, cesium-137, thorium-232, uranium- 238, plutonium-239+240 and americium-241 isotopes by the proposed method for the reference materials provided excellent agreement with the recommended values and good chemical recoveries. (authors)

  7. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  8. Sorption of plutonium and americium on repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura

    International Nuclear Information System (INIS)

    An integrated program of batch sorption experiments and mathematical modeling has been carried out to study the sorption of plutonium and americium on a series of repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura. The sorption of plutonium and americium on samples of concrete, mortar, sand/bentonite, tuff, sandstone and cover soil has been investigated. In addition, specimens of bitumen, cation and anion exchange resins, and polyester were chemically degraded. The resulting degradation product solutions, alongside solutions of humic and isosaccharinic acids were used to study the effects on plutonium sorption onto concrete, sand/bentonite and sandstone. The sorption behavior of plutonium and americium has been modeled using the geochemical speciation program HARPHRQ in conjunction with the HATCHES database

  9. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  10. Some elements for a revision of the americium reference biokinetic model

    International Nuclear Information System (INIS)

    The interpretation of individual activity measurement after a contamination by 241Am or its parent nuclide 241Pu is based on the reference americium (Am) biokinetic model published by the International Commission on Radiological Protection in 1993 [International Commission on Radiological Protection. Age-dependent doses to members of the public from intake of radionuclides: Part 2 Ingestion dose coefficients. ICRP Publication 67. Ann. ICRP 23(3/4) (1993)]. The authors analysed the new data about Am biokinetics reported afterwards to propose an update of the current model. The most interesting results, from the United States Transuranium and Uranium Registries post-mortem measurement database [Filipy, R. E. and Russel, J. J. The United States Transuranium and Uranium Registries as sources for actinide dosimetry and bio-effects. Radiat. Prot. Dosim. 105(1-4), 185-187 (2003)] and the long-term follow-up of cases of inhalation intake [Malatova, I., Foltanova, S., Beckova, V., Filgas, R., Pospisilova, H. and Hoelgye, Z. Assessment of occupational doses from internal contamination with 241Am. Radiat. Prot. Dosim. 105(1-4), 325-328 (2003)], seemed to show that the current model underestimates the retention in the massive soft tissues and overestimates the retention in the skeleton and the late urinary excretion. However, a critical review of the data demonstrated that all were not equally reliable and suggested that only a slight revision of the model, possibly involving a change in the balance of activity between massive soft tissues, cortical and trabecular bone surfaces, may be required. (authors)

  11. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  12. Reduction of. systematic error of In-vivo measurement of americium 241 activity in the skull

    International Nuclear Information System (INIS)

    Excretion analysis and in vivo measuring methods are used for estimation of internal contamination by 241Am. In vivo measurements of the lung are suitable in short time after time of intake when the way of the intake is inhalation. In vivo measurements of the activity in the liver or in the skeleton could be performed at a later time. Detection of radionuclide activity in the liver is quite difficult because it is necessary to distinguish liver activity from the activity of surrounding tissues i.e. lung and skeleton. The skull or knees are the most suitable., for activity assessment in the skeleton. The skull is the most appropriate for measurements because it represents about 15% of total skeleton mass and contributions to measured activity of surrounding tissues are small. Americium activity in the skull could be measured with different instrumentation and in various geometries. Setting of two semiconductors detectors placed 3 cm over temporal region of the skull is used in NRPI. Calibration of the system was done by several head phantoms, in this process was observed that detection efficiencies depend on size of the phantoms. The aim of the paper is to express character of the efficiency as function of the size of skull in order to obtain more accurate value of the activity and decrees its uncertainty. Simulations of head by simplified geometric shapes, i.e. spheres and rotary ellipsoids, is in coherence with phantoms of big size (UCIN, BPAM-0001), but for small phantoms occurred quite serious discrepancy. Activity of real cases determined by calibration with phantom BPAM-0001 (reference phantom) is reduced from 9 to 44 %, when eq. 2 is used and relative uncertainty is reduced from 32% to maximum 12%. (authors)

  13. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  14. 40 CFR 161.240 - Residue chemistry data requirements.

    Science.gov (United States)

    2010-07-01

    ... requirement if their residues are regulated by the Food and Drug Administration at 21 CFR 178.1010. (11... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Residue chemistry data requirements... § 161.240 Residue chemistry data requirements. (a) Table. Sections 161.100 through 161.102 describe...

  15. Evaluation of neutron nuclear data for 240Pu

    International Nuclear Information System (INIS)

    Based on the experimental data evaluation and theoretical calculation, a complete set of neutron nuclear data for 240Pu has been recommended in the incident neutron energy range from 10-5 eV to 20 MeV for CENDL-2. The comparison of present evaluation with ENDF/B-6 and JENDL-3 has been carried out

  16. 46 CFR 179.240 - Foam flotation material.

    Science.gov (United States)

    2010-10-01

    ..., see 46 CFR 175.600). The fire resistance test is not required. (2) Foam may be installed only in void spaces that are free of ignition sources, unless the foam complies with the requirements of 33 CFR 183... 46 Shipping 7 2010-10-01 2010-10-01 false Foam flotation material. 179.240 Section...

  17. Evaluation of the neutron cross sections for Pu-240

    International Nuclear Information System (INIS)

    The present evaluation is proposed to supersede the ENDF/B-V, Revision 2 file for 240Pu. In this work, resonance parameters, cross sections, energy distributions, and angular distributions have been modified. These changes are outlined in detail and appropriate references included. 37 refs., 21 figs., 2 tabs

  18. 17 CFR 240.14a-17 - Electronic shareholder forums.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Electronic shareholder forums... Securities Exchange Act of 1934 Regulation 14a: Solicitation of Proxies § 240.14a-17 Electronic shareholder forums. (a) A shareholder, registrant, or third party acting on behalf of a shareholder or registrant...

  19. Inert matrices, uranium-free plutonium fuels and americium targets. Synthesis of CAPRA, SPIN and EFTTRA studies

    International Nuclear Information System (INIS)

    A first selection of inert-matrix materials, actinide support alone (Pu and Am based), and compound materials, U free plutonium burning fuels and heterogeneous americium targets are discussed. Basic properties, fabrication, and reprocessing studies, European in-pile and out-of-pile tests, performed recently in the framework of CAPRA, SPIN and EFTTRA programs, are reviewed here. Taking into account these studies and on the bases of the different requirements to be met in each of the fuels and targets, a number of materials have been selected as 'promising candidates'. Trends for further research on these materials are established. (author)

  20. Final Report on the Demonstration of Disposal of Americium and Curium Legacy Material Through the High Level Waste System

    International Nuclear Information System (INIS)

    This report provides the results of experimental demonstrations related to processing of a legacy solution containing americium and curium through the High Level Waste (HLW) system. The testing included eight experiments covering the baseline, mitigation, and enhanced nitrate processing studies. In general, each experiment studied the mixtures generated over a period of time to emulate the lifecycle of actual sludge in the High Level Waste system. While the data in previous reports remain valid, this report supercedes all the previous reports and provides a collective overview of the work

  1. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  2. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  3. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  4. Application of slingshot model to the giant radio galaxy DA240 (Brief : DA 240 in slingshot model)

    CERN Document Server

    Muthumeenal, S

    2010-01-01

    We attempt a slingshot model interpretation of the unusual association of some 1&1/3 dozen nonstellar galaxian objects around the parent optical galaxy of the giant radio galaxy DA 240 (= 0748.6+55.8 (J2000)). Similar interpretation may be possible for another large radio galaxy 3C 31 (= NGC 383 = 0104.6+32.1 (1950.0)).

  5. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  6. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  7. Concentrations of 239,240Pu and 241Am of marine products in coastal waters of Ibaraki

    International Nuclear Information System (INIS)

    More than 200 samples of marine products have been collected and analyzed for plutonium and almost 100 samples for americium around Hitachi, Tokai and Oarai in the pacific coast of Ibaraki prefecture. The data have shown that the concentration factor (CF) values for plutonium were 330 for bivalve, 770 for abalone (muscle) and 610 for brown algae. For americium, the CF was calculated as 2400 for bivalve, 1000 for abalone (muscle) and 420 for brown algae. (author)

  8. Geographic and vertical distribution of global fallout americium 241, plutonium isotopes and cesium 137 in lake sediments

    International Nuclear Information System (INIS)

    In this study, we present results concerning the activity concentrations of 241Am, 239-240Pu, 238Pu and 137Cs in lake sediments. Bulk cores for radionuclide inventories and high resolution cores for depth distribution are analysed

  9. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  10. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  11. 17 CFR 240.17Ad-13 - Annual study and evaluation of internal accounting control.

    Science.gov (United States)

    2010-04-01

    ... internal accounting control. 240.17Ad-13 Section 240.17Ad-13 Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-13 Annual study and evaluation of internal accounting control. (a) Accountant's... accountant concerning the transfer agent's system of internal accounting control and related procedures...

  12. 17 CFR 240.12f-3 - Termination or suspension of unlisted trading privileges.

    Science.gov (United States)

    2010-04-01

    ... unlisted trading privileges. 240.12f-3 Section 240.12f-3 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Unlisted Trading § 240.12f-3 Termination or suspension of unlisted trading privileges. (a) The issuer of any security for which unlisted trading...

  13. 17 CFR 240.12f-1 - Applications for permission to reinstate unlisted trading privileges.

    Science.gov (United States)

    2010-04-01

    ... reinstate unlisted trading privileges. 240.12f-1 Section 240.12f-1 Commodity and Securities Exchanges... Rules and Regulations Under the Securities Exchange Act of 1934 Unlisted Trading § 240.12f-1 Applications for permission to reinstate unlisted trading privileges. (a) An application to reinstate...

  14. 49 CFR 240.211 - Procedures for making the determination on performance skills.

    Science.gov (United States)

    2010-10-01

    ... performance skills. 240.211 Section 240.211 Transportation Other Regulations Relating to Transportation... determination on performance skills. (a) Each railroad, prior to initially certifying or recertifying any person... demonstrated, in accordance with the requirements of § 240.127 of this part, the skills to safely...

  15. 17 CFR 240.17f-2 - Fingerprinting of securities industry personnel.

    Science.gov (United States)

    2010-04-01

    ... interests in limited partnerships, unit investment trusts or real estate investment trusts; Provided, That... industry personnel. 240.17f-2 Section 240.17f-2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... Activities § 240.17f-2 Fingerprinting of securities industry personnel. (a) Exemptions for the...

  16. 17 CFR 240.13a-20 - Plain English presentation of specified information.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Plain English presentation of specified information. 240.13a-20 Section 240.13a-20 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Other Reports § 240.13a-20 Plain English presentation...

  17. 17 CFR 240.15d-20 - Plain English presentation of specified information.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Plain English presentation of specified information. 240.15d-20 Section 240.15d-20 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Other Reports § 240.15d-20 Plain English presentation...

  18. 17 CFR 240.17Ad-21T - Operational capability in a Year 2000 environment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Operational capability in a Year 2000 environment. 240.17Ad-21T Section 240.17Ad-21T Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-21T Operational capability in a Year 2000 environment. (a) This section...

  19. 17 CFR 240.13b2-1 - Falsification of accounting records.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Falsification of accounting records. 240.13b2-1 Section 240.13b2-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... Required Reports § 240.13b2-1 Falsification of accounting records. No person shall directly or...

  20. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  1. Distribution of plutonium and americium in human and animal tissues after chronic exposures

    International Nuclear Information System (INIS)

    The distribution of plutonium in the tissues of a group of southern Finns was determined. Their Pu intake had been solely from fallout via inhalation. A group of northern Finns was also studied. They obtain most of the Pu from inhalation, but also some from their diet which is rich in reindeer liver. Reindeer obtain large amounts of transuranium elements in their natural winter diet, which mainly consists of lichen. Pu-239, 240 and Am-241 were also analyzed in elk because it is closely related to reindeer but does not feed on lichen. It was found that much of the Am-241 in reindeer tissues is due to ingrowth from Pu-241 in the animal. The aim of this study to establish whether this situation is also true for the human bone. (H.K.)

  2. Role of natural dissolved organic compounds in determining the concentrations of americium in natural waters

    International Nuclear Information System (INIS)

    Concentrations of 241Am, both in solution and bound to suspended particulate matter, have been measured in several North American lakes. Dissolved concentrations vary from 0.4 μBq/L to 85 μBq/L. The 241Am in these lakes originated solely from global fallout and hence entered all lakes in the same physiocochemical form. The observed differences in solubility behavior must, therefore, be attributable to chemical and/or hydrological differences among the lakes. Concentrations of dissolved 241Am are highly correlated with the corresponding concentrations of /sup 239, 240/Pu(III,IV), suggesting that a common factor is responsible for maintaining both in solution. The K/sub D/ values for 241Am and /sup 239, 240/Pu(III,IV) are highly correlated with the concentrations of dissolved organic carbon (DOC) in the waters, suggesting that the common factor is the formation of soluble complexes with natural DOC for both elements. This hypothesis was tested in a series of laboratory experiments in which the DOC from several of the lakes was isolated by ultrafiltration. Plots of K/sub D/, as a function of DOC concentration, show K/sub D/ to be very high (approx.106) at low DOC concentrations. Above critical concentrations (a few mg/L DOC) the K/sub D/ values begin a progressive decrease with increasing DOC. We conclude that in most surface waters, the dissolved 241Am concentration is regulated by an adsorption/desorption equilibrium with the sediments (and suspended solids) and the value of K/sub D/ that characterizes this equilibrium is largely determined by the concentration of natural DOC in the water. 11 refs., 3 figs., 2 tabs

  3. Chemical behaviour of trivalent and pentavalent americium in saline NaCl-solutions. Studies of transferability of laboratory data to natural conditions. Interim report. Reported period: 1.2.1993-31.12.1993; Chemisches Verhalten von drei- und fuenfwertigem Americium in Salinen NaCl-Loesungen. Untersuchung der Uebertragbarkeit von Labordaten auf natuerliche Verhaeltnisse. Zwischenbericht. Berichtszeitraum 1.2.1993-31.12.1993

    Energy Technology Data Exchange (ETDEWEB)

    Runde, W.; Kim, J.I.

    1994-09-15

    In order to clarify the chemical behaviour of Americium in saline aqueous systems relevant for final storage this study deals with the chemical reactions of trivalent and pentavalent Americium in NaCl-solutions under the influence of radiolysis from its own alpha radiation. The focus of the study was on investigating the geologically relevant reactions, such as hydrolysis or carbonate- and chloride complexing in solid-liquid equilibriums. Comprehensive measurements on solubility and spectroscopic studies in NaCl-solutions were carried out in a CO{sub 2}-free atmosphere and 10{sup -2} atm CO{sub 2} partial pressure. Identification and characterisation of the AM (III) and AM(V) solid phases were supplemented by structural research with the chemically analogue EU (III) and Np(V) compounds. The alpha-radiation induced radiolysis in saline NaCl solutions and the redox behaviour of Americium which was influenced thereby were spectroscopically quantified. (orig.) [Deutsch] Zur Klaerung des chemischen Verhaltens von Americium in endlagerrelevanten salinen aquatischen Systemen befasst sich die vorliegende Arbeit mit den chemischen Reaktionen des drei- und fuenfwertigen Americiums in NaCl-Loesungen unter dem Einfluss der Radiolyse durch die eigene {alpha}-Strahlung. Der Schwerpunkt dieser Arbeit lag auf der Untersuchung der geologisch relevanten Reaktionen, wie Hydrolyse sowie Carbonat- und Chloridkomplexierung in fest-fluessig Gleichgewichtssystemen. Hierzu wurden umfassende Loeslichkeitsmessungen und spektroskopische Untersuchungen in NaCl-Loesungen, sowohl unter CO{sub 2}-freier Atmosphaere als auch unter 10{sup -2} atm CO{sub 2}-Partialdruck, durchgefuehrt. Die Identifizierung und Charakterisierung der Am(III)- und Am(V)-Festphasen wurde ergaenzt durch strukturelle Untersuchungen mit den chemisch analogen Eu(III)- und Np(V)-Verbindungen. Die von der {alpha}-Strahlung induzierte Radiolyse in salinen NaCl-Loesungen und das dadurch beeinflusste Redoxverhalten von Americium

  4. Influence of an alkoxy group on bis-triazinyl-pyridines for selective extraction of americium(III)

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and lanthanides(III) from nitric acid by 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin-3-yl)-pyridine and 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin- 3-yl)-4-methoxy-pyridine was studied. The physico-chemical properties of these ligands, such as the protonation and complexation constants, were also determined to describe the influence of different substituent groups. The selectivity of substituted-BTP was confirmed both in complexation and in solvent extraction experiments. The presence of an alkoxy-group in position 4 of the pyridine decreases the BTP selectivity. Influence of a long alkyl chain on protonation and complexation constants was also studied with 2,6-bis-(5,6-dimethyl-[1,2,4]- triazin-3-yl)-4-dodecyloxy-pyridine. (authors)

  5. Solvent extraction of europium and americium into phenyltrifluoromethyl sulfone by using synergistic mixture of hydrogen dicarbollylcobaltate and 'classical' CMPO

    International Nuclear Information System (INIS)

    Extraction of microamounts of europium and americium by a phenyltrifluoromethyl sulfone (FS 13) solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of octyl-phenyl-N,N-diisobutylcarbamoylmethyl phosphine oxide ('classical' CMPO, L) has been investigated. The equilibrium data have been explained assuming that the complexes HL+, HL2+, ML23+, ML33+ and ML43+ (M3+ Eu3+, Am3+) are extracted into the organic phase. The values of extraction and stability constants of the cationic complex species in FS 13 saturated with water have been determined. It was found that the stability constants of the corresponding complexes EuLn3+ and AmLn3+, where n 2, 3, 4 and L is 'classical' CMPO, in water-saturated FS 13 are comparable. (author)

  6. Recovery, purification and concentration of plutonium and americium from the aqueous wastes discharged in the reprocessing process studies

    International Nuclear Information System (INIS)

    For recovering and purifying plutonium and americium from the aqueous wastes occurring in the process studies on reprocessing, a standard procedure has been established for use in the laboratory works, through the preliminary tests of the precipitation as hydroxides and the anion exchange in nitrate media. The procedure was proven in the treatment of actual wastes, of which the results were contributed to determine the process conditions in the plutonium purification and product concentration of the JAERI Reprocessing Test Plant. The preliminary tests also include washing of U and Am recovery from the anion-exchanger in nitrate media, direct ion-exchange recovery of Pu from the TBP phase and elution of Am from the cation-exchanger. (auth.)

  7. The bone volume effect on the dosimetry of plutonium-239 and americium-241 in the skeleton of man and baboon

    International Nuclear Information System (INIS)

    Studies were undertaken using bone removed from young adult baboons, which had been contaminated with plutonium-239 at various times prior to sacrifice, and human bone from adult male (USTR Case 246), who had received an internal deposition of americium-241 as a result of a glove-box explosion 11 years prior to his death. The baboon bone was supplied by the CEA, France, and the human bone by the United States Transuranium registry. The bone samples, examined by qualitative and quantitative autoradiography with CR 39 detectors, demonstrated the rapid redistribution of bone surface-seeking radionuclides in younger primates due to growth and the slower, bone turnover driven redistribution in the adult human bone. In both species, primary and secondary surface deposits of radionuclide remained conspicious despite bone activity; true volumization of radionuclide was seldom seen. The dosimetric implications of these findings are discussed. (author) 21 refs.; 6 figs.; 4 tabs

  8. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  9. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  10. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  11. Distribution, retention and dosimetry of plutonium and americium in the rat, dog and monkey after inhalation of an industrial-mixed uranium and plutonium oxide aerosol

    International Nuclear Information System (INIS)

    This study provides information on patterns of radiation dose in laboratory animals after inhalation exposure to an aerosol of one form of mixed uranium and plutonium oxide. The aerosol contained a mixture of UO2 and 750 deg C heat-treated PuO2 obtained from the ball milling operation in a mixed-oxide fuel fabrication process. Americium-241 from the decay of 241Pu was also present in the PuO2 matrix. Fischer-344 rats, Beagle dogs, and Cynomolgus and Rhesus monkeys inhaled aerosols re-generated from dry mixed oxide powders with particle size distribution characteristics similar to those observed in samples collected at the industrial site. Clearance from the lung and distribution in other tissues of the plutonium from this UO2 + PuO2 admixture was similar to what has been observed for PuO2 from laboratory-produced aerosols. The UO2-PuO2 aerosol was relatively insoluble in the lungs of all species. Monkeys and rats cleared plutonium and americium from their lungs faster than dogs. Very little plutonium or americium translocated within the first 2 yr after exposure to tissues other than tracheobronchial lymph nodes. The greater accumulation of plutonium and americium in the tracheobronchial lymph nodes of dogs as compared to monkeys and rats combined with the more rapid initial clearance of these radionuclides from the lungs of rats and monkeys suggests that errors could result from using data from a single animal species to estimate risk to humans from inhalation of these industrial aerosols. (author)

  12. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  13. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  14. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  15. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  16. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    International Nuclear Information System (INIS)

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1−xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1−xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions. - Graphical abstract: Formation of (UIV/V,AmIII)O2 solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • UV and AmIII are formed in equimolar proportions

  17. Dicty_cDB: VHJ240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 08 1 AQ874658 |AQ874658.1 V112D8 mTn-3xHA/lacZ Insertion Library, strain Y2278 Saccharomyces cerevisiae geno...brane 4.0 %: vesicles of secretory system 4.0 %: peroxisomal >> prediction for VHJ240 is cyt 5' end seq. ID - 5' end se...AACGCTTATAAATTCTATCAATATGATCCAACTAAATGGTTG ATCTCT Length of 3' end seq. 546 Connected seq. ID - Connected seq. - Length of connect...) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15950-1 Original site URL http://dictycdb.biol.ts...skh* rp*rrsmgyvat*tlh*nrhfygsrfpnigswfrlg*lgwwlfllwctssrysstfhilg qfigslfr*lsir**tyskgfscdcyiniw*rls*lps*ipk

  18. Preliminary results from uranium/americium affinity studies under experimental conditions for cesium removal from NPP ''Kozloduy'' simulated wastes solutions

    International Nuclear Information System (INIS)

    We use the approach described by Westinghouse Savannah River Company using ammonium molybdophosphate (AMP) to remove elevated concentrations of radioactive cesium to facilitate handling waste samples from NPP Kozloduy. Preliminary series of tests were carried out to determine the exact conditions for sufficient cesium removal from five simulated waste solutions with concentrations of compounds, whose complexing power complicates any subsequent processing. Simulated wastes solutions contain high concentrations of nitrates, borates, H2C2O4, ethylenediaminetetraacetate (EDTA) and Citric acid, according to the composition of the real waste from the NPP. On this basis a laboratory treatment protocol was created. This experiment is a preparation for the analysis of real waste samples. In this sense the results are preliminary. Unwanted removal of non-cesium radioactive species from simulated waste solutions was studied with gamma spectrometry with the aim to find a compromise between on the one hand the AMP effectiveness and on the other hand unwanted affinity to AMP of Uranium and Americium. Success for the treatment protocol is defined by proving minimal uptake of U and Am, while at the same time demonstrating good removal effectiveness through the use of AMP. Uptake of U and Am were determined as influenced by oxidizing agents at nitric acid concentrations, proposed by Savannah River National laboratory. It was found that AMP does not significantly remove U and Am when concentration of oxidizing agents is more than 0.1M for simulated waste solutions and for contact times inherent in laboratory treatment protocol. Uranium and Americium affinity under experimental conditions for cesium removal were evaluated from gamma spectrometric data. Results are given for the model experiment and an approach for the real waste analysis is chosen. Under our experimental conditions simulated wastes solutions showed minimal affinity to AMP when U and Am are most probably in the

  19. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kazi, Zakir H. [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Cornett, Jack R., E-mail: jack.cornett@uottawa.ca [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Zhao, Xaiolei; Kieser, Liam [Department of Physics, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada)

    2014-06-01

    Highlights: • Am and Pu were adsorbed and separated using a single extraction chromatography DGA column. • Pu was eluted from the column completely using on-column reduction of Pu(IV) to Pu(III). • ²⁴¹Am and 239,240Pu measurements by accelerator mass spectrometry (AMS) agree with the certified values in two SRMs. Abstract: A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8 M HNO₃ with 0.05 M NaNO₂ before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO₃, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl₃ facilitated the complete desorption of Pu. Interferences (e.g. Ca²⁺, Fe³⁺) were washed off from the resin bed with excess HNO₃. Using NdF₃, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7 ± 5.3% and 95.5 ± 4.6% for ²⁴¹Am and ²⁴²Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1 ± 6.0 and 96.8 ± 5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1–100 Bq kg⁻¹. The single column separation of Pu and Am saves reagents, separation time, and cost.

  20. Optimization of an analytical method using extraction chromatography for the determination of plutonium, americium and curium in soil samples; Optimierung eines extraktionschromatographischen Analyseverfahrens zur Bestimmung von Plutonium, Americium und Curium in Bodenproben

    Energy Technology Data Exchange (ETDEWEB)

    Gann, Cordula

    2000-09-01

    An analytical method for determination of the actinides {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am and {sup 244}Cm in soil samples was developed and optimized to allow specific immission measurements of radionuclides in the vicinity of the recently constructed radwaste facility at Wuerenlingen/Switzerland. Following a rapid extraction from the soil sample, as well as a preconcentration step via calcium oxalate precipitation, the actinides are separated using extraction chromatography. Separation of the actinides is carrie out applying the specific resins U/TEVA, TRU and TEVA (Eichrom Technologies IL/USA) and the anion exchange resin BioRAD 1-X2. Measurements are then performed using an {alpha}-spectrometer equipped with ion-implanted silicon charged particle detectors. For counting times of less than three days a detection limit of less than 0.05 Bq/kg is obtained for the actinides {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am and {sup 244}Cm. (author) [German] Im Rahmen von Immissionsmessungen auf den Radionuklidgehalt in der Umgebung des kuerzlich erbauten Zwischenlagers Wuerenlingen wurde eine Analysenmethode zur Bestimmung der Aktivitaetskonzentration der Aktiniden {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am und {sup 244}Cm in Bodenproben entwickelt und optimiert. Die Aktiniden werden nach einer kurzen Extraktion der Bodenprobe und einer Vorkonzentration durch eine Calciumoxalatfaellung mittels Extraktionschromatographie separiert. Die Bodenprobe durchlaeuft mehrere Trennungsschritte ueber die Austauscherharze U/TEVA, TRU und TEVA der Firma Eichrom (Illinois, USA) sowie eine zusaetzliche Abtrennung mit dem Harz BioRAD 1-.X2. Die Aktivitaet wird anschliessend ueber die {alpha}-Spektrometrie mit ionen-implantierten Siliziumdetektoren bestimmt. Eine Nachweisgrenze von 0.05 Bq/kg wird fuer die Aktiniden {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am und {sup 244}Cm mit Messzeiten von weniger als drei Tagen im {alpha}-Spektrometer probemlos unterschritten. (Autorin)

  1. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    Energy Technology Data Exchange (ETDEWEB)

    Burns, P.A.; Cooper, M.B.; Lokan, K.H.; Wilks, M.J.; Williams, G.A. [Australian Radiation Lab., Melbourne, VIC (Australia)

    1995-11-01

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ``one point`` safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author).

  2. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  3. Characterization of a Sealed Americium-Beryllium (AmBe) Source by Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Two Americium-Beryllium neutron sources were dismantled, sampled (sub-sampled) and analyzed via inductively coupled plasma mass spectrometry (ICP-MS). Characteristics such as 'age' since purification, actinide content, trace metal content and inter and intra source composition were determined. The 'age' since purification of the two sources was determined to be 25.0 and 25.4 years, respectively. The systematic errors in the 'age' determination were ± 4 % 2s. The amount and isotopic composition of U and Pu varied substantially between the sub-samples of Source 2 (n=8). This may be due to the physical means of sub-sampling or the way the source was manufactured. Source 1 was much more consistent in terms of content and isotopic composition (n=3 sub-samples). The Be-Am ratio varied greatly between the two sources. Source 1 had an Am-Be ratio of 6.3 ± 52 % (1s). Source 2 had an Am-Be ratio of 9.81 ± 3.5 % (1s). In addition, the trace element content between the samples varied greatly. Significant differences were determined between Source 1 and 2 for Sc, Sr, Y, Zr, Mo, Ba and W.

  4. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  5. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  6. Migration of the fission products strontium, technetium, iodine, cesium, and the actinides neptunium, plutonium, americium in granitic rock

    International Nuclear Information System (INIS)

    Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at race levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the migration into the rock was studied, by an autoradiographic technique. The cationic fission products strontium and cesium had apparent diffusivities of 10-13-10-14 m2/s. They migrate mainly in fissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with hgih capacity minerals (e.g. biotite). The anionic fission products iodine and technetium had apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. The migration of the actinides neptunium, plutonium and americium is very slow (in the mm-range after 2-3 years contact time). The apparent diffusivities were about 10-15 m2/s. The actinide migration into the rock was largely confined to fissures. (orig./HP)

  7. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  8. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  9. Measured solubilities and speciations of neptunium, plutonium, and americium in a typical groundwater (J-13) from the Yucca Mountain region

    International Nuclear Information System (INIS)

    Solubility and speciation data are important in understanding aqueous radionuclide transport through the geosphere. They define the source term for transport retardation processes such as sorption and colloid formation. Solubility and speciation data are useful in verifying the validity of geochemical codes that are part of predictive transport models. Results are presented from solubility and speciation experiments of 237NpO2+, 239Pu4+, 241Am3+/Nd3+, and 243Am3+ in J-13 groundwater (from the Yucca Mountain region, Nevada, which is being investigated as a potential high-level nuclear waste disposal site) at three different temperatures (25 degree, 60 degree, and 90 degree C) and pH values (5.9, 7.0, and 8.5). The solubility-controlling steady-state solids were identified and the speciation and/or oxidation states present in the supernatant solutions were determined. The neptunium solubility decreased with increasing temperature and pH. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. The americium solutions showed no clear solubility trend with increasing temperature and increasing pH

  10. 17 CFR 240.12d2-1 - Suspension of trading.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Suspension of trading. 240... Securities Exchange Act of 1934 Suspension of Trading, Withdrawal, and Striking from Listing and Registration § 240.12d2-1 Suspension of trading. (a) A national securities exchange may suspend from trading...

  11. 8 CFR 240.69 - Reliance on information compiled by other sources.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Reliance on information compiled by other sources. 240.69 Section 240.69 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION... Reliance on information compiled by other sources. In determining whether an applicant is eligible...

  12. 33 CFR 138.240 - Procedure for calculating limit of liability adjustments for inflation.

    Science.gov (United States)

    2010-07-01

    .... (d) 33 CFR Ch. I (7-1-10 Edition) Coast Guard, DHS ... of liability adjustments for inflation. 138.240 Section 138.240 Navigation and Navigable Waters COAST... calculating limit of liability adjustments for inflation. (a) Formula for calculating a cumulative...

  13. 10 CFR 72.240 - Conditions for spent fuel storage cask reapproval.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Conditions for spent fuel storage cask reapproval. 72.240... STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.240 Conditions for spent fuel storage cask...

  14. 40 CFR 436.240 - Applicability; description of the diatomite subcategory.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Applicability; description of the diatomite subcategory. 436.240 Section 436.240 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS MINERAL MINING AND PROCESSING POINT SOURCE CATEGORY...

  15. 17 CFR 240.17a-10 - Report on revenue and expenses.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Report on revenue and expenses. 240.17a-10 Section 240.17a-10 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION....17a-10 Report on revenue and expenses. (a)(1) Every broker or dealer exempted from the...

  16. 9 CFR 2.40 - Attending veterinarian and adequate veterinary care (dealers and exhibitors).

    Science.gov (United States)

    2010-01-01

    ... on problems of animal health, behavior, and well-being is conveyed to the attending veterinarian; (4... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Attending veterinarian and adequate veterinary care (dealers and exhibitors). 2.40 Section 2.40 Animals and Animal Products ANIMAL AND...

  17. 17 CFR 240.3b-15 - Definition of ancillary portfolio management securities activities.

    Science.gov (United States)

    2010-04-01

    ... portfolio management securities activities. 240.3b-15 Section 240.3b-15 Commodity and Securities Exchanges... ancillary portfolio management securities activities. (a) The term ancillary portfolio management securities... of incidental trading activities for portfolio management purposes; and (3) Are limited to...

  18. 49 CFR 240.121 - Criteria for vision and hearing acuity data.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for vision and hearing acuity data. 240... ENGINEERS Component Elements of the Certification Process § 240.121 Criteria for vision and hearing acuity... paragraph (e) of this section, a person's vision and hearing shall meet or exceed the standards...

  19. 49 CFR 240.207 - Procedures for making the determination on vision and hearing acuity.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Procedures for making the determination on vision and hearing acuity. 240.207 Section 240.207 Transportation Other Regulations Relating to... making the determination on vision and hearing acuity. (a) Each railroad, prior to initially...

  20. 33 CFR 96.240 - What functional requirements must a safety management system meet?

    Science.gov (United States)

    2010-07-01

    ... a safety management system meet? 96.240 Section 96.240 Navigation and Navigable Waters COAST GUARD... requirements must a safety management system meet? The functional requirements of a safety management system... vessel's safety management system, and the ISM Code; (e) Procedures to prepare for and respond...

  1. 17 CFR 240.12b-12 - Requirements as to paper, printing and language.

    Science.gov (United States)

    2010-04-01

    ..., if the filing is an HTML document, as defined in Regulation S-T Rule 11 (17 CFR 232.11). (e) Where a..., printing and language. 240.12b-12 Section 240.12b-12 Commodity and Securities Exchanges SECURITIES AND... paper, printing and language. (a) Statements and reports shall be filed on good quality, unglazed...

  2. 17 CFR 240.12b-37 - Satisfaction of filing requirements.

    Science.gov (United States)

    2010-04-01

    .... IC-25463 (March 18, 2002) (each of which may be viewed on the Commission's website at www.sec.gov... Effectiveness of Registration Source: Sections 240.12d1-1 through 240.12d-6 appear at 19 FR 670, Feb. 5,...

  3. 20 CFR 404.240 - Old-start method-general.

    Science.gov (United States)

    2010-04-01

    ....240 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Old-Start Method of Computing Primary Insurance Amounts § 404.240 Old-start method—general. If you had all or substantially all your social...

  4. Optimization of an analytical method using extraction chromatography for the determination of plutonium, americium and curium in soil samples

    International Nuclear Information System (INIS)

    An analytical method for determination of the actinides 238Pu, 239+240Pu, 241Am and 244Cm in soil samples was developed and optimized to allow specific immission measurements of radionuclides in the vicinity of the recently constructed radwaste facility at Wuerenlingen/Switzerland. Following a rapid extraction from the soil sample, as well as a preconcentration step via calcium oxalate precipitation, the actinides are separated using extraction chromatography. Separation of the actinides is carrie out applying the specific resins U/TEVA, TRU and TEVA (Eichrom Technologies IL/USA) and the anion exchange resin BioRAD 1-X2. Measurements are then performed using an α-spectrometer equipped with ion-implanted silicon charged particle detectors. For counting times of less than three days a detection limit of less than 0.05 Bq/kg is obtained for the actinides 238Pu, 239+240Pu, 241Am and 244Cm. (author)

  5. Restaurant No. 1 seating capacity increases by 240

    CERN Multimedia

    Laëtitia Pedroso

    2010-01-01

    These days you need patience when looking for a seat in Restaurant No. 1 to eat your lunch. The opening of the new dining room, which will increase the restaurant’s seating capacity by 240, should alleviate the problem and improve service.   The new restaurant area. For the past several years the number of people using Restaurant No. 1 has grown steadily. Now, for a change, the restaurant itself is growing. Luz Lopez-Hernandez, leader of the project in the GS Department, explains: “Enlarging the restaurant has been on the GS Department's agenda for several years, but the project really got off the ground in 2009. Once it was approved and the design completed, construction itself only took seven months.” Seven months later, the restaurant extension is indeed on the verge of opening. One of the people who will be particularly happy is Joël Nallet, who manages the Novae restaurant: “I am thrilled, because until now, even if we managed to increase...

  6. Design of the Atlas 240 kV Marx modules

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, D.W.; Bennett, G.; Biehl, F. [and others

    1997-06-01

    A prototype 240 kV, oil-insulated Marx module has been designed and constructed at the Los Alamos National Laboratory (LANL). The prototype will be used for testing and certifying the design of the Marx module and certain components, including the closing switches, series resistor, and the capacitors themselves. The prototype will also be used to evaluate proposed mechanical systems designs. Information gained from the construction and testing of the 4-capacitor prototype will be folded into the design of the 16-capacitor maintenance unit. The prototype module consists of four 60 kV capacitors, two closing switches, one shunt resistor, and one series resistor. Cables are used to deliver the current to a dummy load scaled to match Atlas system parameters. The Marx unit is contained in a structure made from G-10, suspended from a steel frame that also serves to support components of the trigger, charging, and control system. Appropriate safety and charging systems are an integral part of the prototype design.

  7. Human triosephosphate isomerase deficiency resulting from mutation of Phe-240

    Energy Technology Data Exchange (ETDEWEB)

    Minling Chang; Xiaoyun Wu; Maquat, L.E. (Roswell Park Cancer Inst., Buffalo, NY (United States)); Artymiuk, P.J. (Univ. of Sheffield (United Kingdom)); Hollan, S. (National Inst. of Hematology and Blood Transfusion, Budapest (Hungary)); Lammi, A. (Children' s Hospital, Sydney (Australia))

    1993-06-01

    Triosephosphate isomerase (TPI; D-glyceraldehyde-3-phosphate ketolisomerase [E.C.5.3.1.1]) deficiency is an autosomal recessive disorder that typically results in chronic, nonspherocytic hemolytic anemia and in neuromuscular impairment. The molecular basis of this disease was analyzed for one Hungarian family and for two Australian families by localizing the defects in TPI cDNA and by determining how each defect affects TPI gene expression. The Hungarian family is noteworthy in having the first reported case of an individual, A. Jo., who harbors two defective TPI alleles but who does not manifest neuromuscular disabilities. This family was characterized by two mutations that have never been described. One is a missense mutation within codon 240 (TTC [Phe][r arrow]CTC [Leu]), which creates a thermolabile protein, as indicated by the results of enzyme activity assays using cell extracts. This substitution, which changes a phylogenetically conserved amino acid, may affect enzyme activity by dusrupting intersubunit contacts or substrate binding, as deduced from enzyme structural studies. The other mutation has yet to be localized but reduces the abundance of TPI mRNA 10--20-fold. Each of the Australian families was characterized by a previously described mutation within codon 104 (GAG [Glu][r arrow]GAC [Asp]), which also results in thermolabile protein. 49 refs., 6 figs., 1 tab.

  8. Concentrations of sup(239,240)Pu and 241Am in drinking water and organic fertilizer

    International Nuclear Information System (INIS)

    As part of an investigation of the chemistry and aquatic distribution of fallout-derived sup(239,240)Pu and 241Am in the aquatic environment a study has been made of the concentration of these nuclides in the drinking water and organic fertilizer, distributed to the populace of the Chicago area. The results clearly indicate that the concentration of sup(239,240)Pu is always lower in the water which has been treated at the Chicago Central Water Filtration Plant than in the raw water before treatment. Raw water levels are consistent with normal levels of sup(239,240)PU found in Lake Michigan waters which are approx 6 orders of magnitude below the maximum permissible concentration standard for drinking water. An additional possible source of sup(239,240)Pu and 241Am to humans can be through the distribution of the organic fertilizer, 'Nu Earth', by the Metropolitan Sanitary District, free of charge, for the use in home gardens. 'Nu Earth' consists primarily of sediment from an Imhoff Process which has been air-dried and aged in large, open-air piles. Samples of this organic fertilizer were analysed for sup(239,240)Pu and 241Am. The results indicate that there is little evidence to indicate that sup(239,240)Pu in drinking water or sup(239,240)Pu and 241Am from organic sludge will be health hazards in the Chicago area under current conditions. (U.K.)

  9. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  10. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  11. 17 CFR 240.15g-2 - Penny stock disclosure document relating to the penny stock market.

    Science.gov (United States)

    2010-04-01

    ... document relating to the penny stock market. 240.15g-2 Section 240.15g-2 Commodity and Securities Exchanges... Section 15(d) of the Act § 240.15g-2 Penny stock disclosure document relating to the penny stock market... required by paragraph (a) of this section for the period specified in 17 CFR 240.17a-4(b) of this...

  12. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  13. Weldability examination of ASTM A 240 S41500 martensitic stainless steel by thermal cycles simulation testings

    OpenAIRE

    Alberto Velázquez-del Rosario; Armín Mariño-Pérez; Maritza Mariño-Cala

    2015-01-01

    The weldability assets of ASTM A 240 S41500 (ASTM A 240/A 240M) martensitic stainless steel are presented through the study of the effects of single and double thermal weld cycles on mechanical properties and microstructure of base metal (BM) and the artificial heat affected zone (HAZ) created by thermal weld simulations. For single cycles, separate peak temperatures of 1000 ºC/12 s and 1350 ºC/12 s (cooling times: 12 s in both cases) were evaluated, whilst two combinations of peak temperatur...

  14. 239+240Pu and 90Sr deposition densities in undisturbed surface soil in Vietnam

    International Nuclear Information System (INIS)

    The study's goal is determination of 239+240Pu and 90Sr deposition densities from known distribution of 137Cs deposition density. The tasks done include: simultaneous determination of 239+240Pu, 90Sr and 137Cs deposition densities in undisturbed surface soil layer having depth to 20 cm and use it as basis for determining the ratios of deposition densities 239+240Pu/137Cs and 90Sr/137Cs; studying the impact of soil parameters such as soil texture, content of organic matter, Humic, Fulvic as well as of geography parameters such as latitude, longitude, annual rainfall to the variation of these ratios. (NHA)

  15. Recovery of plutonium and americium from laboratory acidic waste solutions using tri-n-octylamine and octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide.

    Science.gov (United States)

    Michael, K M; Rizvi, G H; Mathur, J N; Kapoor, S C; Ramanujam, A; Iyer, R H

    1997-11-01

    Plutonium from acidic waste solutions has been recovered quantitatively using tri-n-octylamine (TnOA) in xylene and americium using a mixture of octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide (CMPO) and TBP in dodecane by extraction and extraction chromatographic methods. The Pu ( IV ) TnOA species extracted into the organic phase from higher nitric acid concentrations has been confirmed as (R(3)NH)(2)Pu(NO(3))(6) (where R(3)N = TnOA by employing slope analysis as well as spectrophotometric studies. PMID:18966958

  16. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state properties...... phase in order to match the experimental data. Thus, neither the GGA+U nor the HYB-DFT methods are able to describe the energetics of Am metal properly in the entire pressure range from 0 GPa to 50 GPa with a single choice of their respectiveU and α parameters. Low binding-energy peaks in the...

  17. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  18. Uptake of curium (244Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    International Nuclear Information System (INIS)

    Curium (244Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium. (author)

  19. Uptake of curium (/sup 244/Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Miramand, P.; Germain, P.; Arzur, J.C.

    1987-01-01

    Curium (/sup 244/Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium.

  20. 17 CFR 240.10b5-2 - Duties of trust or confidence in misappropriation insider trading cases.

    Science.gov (United States)

    2010-04-01

    ... in misappropriation insider trading cases. 240.10b5-2 Section 240.10b5-2 Commodity and Securities... Devices and Contrivances § 240.10b5-2 Duties of trust or confidence in misappropriation insider trading... of insider trading under Section 10(b) of the Act and Rule 10b-5. The law of insider trading...

  1. 17 CFR 240.15a-2 - Exemption of certain securities of cooperative apartment houses from section 15(a).

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption of certain securities of cooperative apartment houses from section 15(a). 240.15a-2 Section 240.15a-2 Commodity and... Securities from Section 15(a) § 240.15a-2 Exemption of certain securities of cooperative apartment...

  2. Radiocaesium, plutonium and americium partitioning and solid speciation in sized, inter-tidal sediments from Strangford Lough

    International Nuclear Information System (INIS)

    Fine-grained surface (0-2 cm) sediment was collected at an inter-tidal site (Mahee Island) in Strangford Lough, on the NE coast of Ireland in September 1997. The sediment was wet-sieved into standard sized fractions using Endecott test sieves and the fractions assayed for 137Cs, 239,240Pu and 241Am content. Sub-samples of each fraction were measured with a Malvern 2600 laser diffraction analyser, which confirmed that >90% of the particles in each fraction was in the defined size range

  3. Worldwide data on fluxes of 239,240Pu, 238Pu to the oceans

    International Nuclear Information System (INIS)

    According to measurements (GEOSECS) the world's oceans contain approximately 16 PBq 239,240Pu, of which one-fourth is in the Atlantic and three-fourths in the Pacific Ocean. The expected inventory (from nuclear weapons testing) in the world's oceans is 12 PBq 239,240Pu including local fallout at the test sites. In the Irish Sea a local contamination of 0.3 PBq 239,240Pu from the Sellafield reprocessing plant resides in the sediments. No other sources than fallout and reprocessing add significantly to the 239,240Pu inventories in the oceans. The discrepancy between measurements and expectations are assumed to be due to an underestimate of the rainfall and dry fallout (seaspray) and thus of the Pu-deposition over the oceans, but may also to some degree be due to inadequate sampling

  4. Measurement of the 240Am production cross section via proton irradiation of 242Pu

    International Nuclear Information System (INIS)

    A new nuclear reaction for the production of 240Am was experimentally investigated. Targets of 150-500 μg/cm2242Pu on 2 μm Ti were produced through molecular deposition. Five irradiations, in which 242Pu, natTi, and natNi targets were jointly activated with protons from the Lawrence Berkeley National Laboratory 88-Inch Cyclotron produced 240Am, 48V, and 57Ni, respectively. The radioactive decay of these nuclides was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. A maximum 242Pu(p, 3n)240Am nuclear reaction cross section was measured to be 45 ± 13 mb with 23 MeV protons. While this value is lower than theoretical predictions, it is high enough to be the most viable nuclear reaction for the large-scale production of 240Am. (orig.)

  5. 17 CFR 240.11a-1 - Regulation of floor trading.

    Science.gov (United States)

    2010-04-01

    ..., particularly sections 11(a) and 23(a) thereof, and Rule 11a-1 (17 CFR 240.11a-1) under the Act, deeming it... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Regulation of floor trading... Securities Exchange Act of 1934 Adoption of Floor Trading Regulation (rule 11a-1) § 240.11a-1 Regulation...

  6. 17 CFR 240.15c1-8 - Sales at the market.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Sales at the market. 240.15c1... Securities Exchange Act of 1934 Rules Relating to Over-The-Counter Markets § 240.15c1-8 Sales at the market... securities exchange that such security is being offered to such customer “at the market” or at a...

  7. Investigation of solubility of cesium, strontium, barium, rare-earth, uranium and americium fluorides in acid nitrosyl fluoride (NOFx3HF)

    International Nuclear Information System (INIS)

    Solubility of Am and other elements, which are fission products, in acid nitrosylfluoride has been studied. Cesium fluoride has maximum solubility; uranium tetrafluoride is also noticeably soluble; americium trifluoride is practically insoluble; fluorides of rare earth elements are slightly soluble in NOFx3HF. Analysis of the solid phase obtained after treating the mixture of the above fluorides with acid nitrosylfluoride has shown that cesium fluoride reacts with NOFx3HF with the formation of an acid salt (CsFxHF), whereas fluorides of alkaline and rare earth elements remain unchanged. The behaviour of a mixture of cesium, barium, and lanthanum fluorides in the process of three-multiple treating with acid nitrosylfluoride has been studied. It is shown that more than 98% of cesium fluoride and 5% of barium fluoride pass into the mother liquor while lanthanum fluoride remains completely in the solid phase. The data on americium fluoride solubility in acid nitrosylfluoride have indicated that it behaves in the same way as fluorides of rare earth elements; it is practically insoluble in HOFx3HF

  8. Determining the americium transmutation rate and fission rate by post-irradiation examination within the scope of the ECRIX-H experiment

    International Nuclear Information System (INIS)

    The ECRIX-H experiment aims to assess the feasibility of transmuting americium micro-dispersed in an inert magnesia matrix under a locally moderated neutron flux in the Phénix reactor. A first set of examinations demonstrated that pellet behaviour was satisfactory with moderate swelling at the end of the irradiation. Additional post-irradiation examinations needed to be conducted to confirm the high transmutation rate so as to definitively conclude on the success of the ECRIX-H experiment. This article presents and discusses the results of these new examinations. They confirm the satisfactory behaviour of the MgO matrix not only during the basic irradiation but also during post-irradiation thermal transients. These examinations also provide additional information on the behaviour of fission products both in the americium-based particles and in the MgO matrix. These results particularly validate the transmutation rate predicted by the calculation codes using several different analytical techniques. The fission rate is also determined

  9. Plutonium isotopes 238Pu, 239+240Pu, 241Pu and 240Pu/239Pu atomic ratios in the southern Baltic Sea ecosystem

    Directory of Open Access Journals (Sweden)

    Dagmara I. Strumińska-Parulska

    2010-09-01

    Full Text Available The paper summarizes the results of plutonium findings in atmospheric fallout samples and marine samples from the southern Baltic Sea during our research in 1986-2007. The activities of 238Pu and 239+240Pu isotopes were measured with an alpha spectrometer. The activities of 241Pu were calculated indirectly by 241Am activity measurements 16-18 years after the Chernobyl accident. The 240Pu/239Pu atomic ratios were measured using accelerator mass spectrometry (AMS. The 241Pu activities indicate that the main impact of the Chernobyl accident was on the plutonium concentration in the components of the Baltic Sea ecosystem examined in this work. The highest 241Pu/239+240Pu activity ratio was found in sea water (140 ± 33. The AMS measurements of atmospheric fallout samples collected during 1986 showed a significant increase in the 240Pu/239Pu atomic ratio from 0.29 ± 0.04 in March 1986 to 0.47 ± 0.02 in April 1986.

  10. 240例耳聋患者常见耳聋基因筛查分析%Analysis of common deafness genes screening in 240 deaf patients

    Institute of Scientific and Technical Information of China (English)

    曲长红; 张宁; 曹东华; 郝冬梅

    2014-01-01

    目的 分析非综合征型耳聋患者常见耳聋基因突变情况,探讨遗传性耳聋基因芯片检测的临床意义.方法 2013年3-8月来自沈阳市和平区残联的非综合征型耳聋患者240例,患者或监护人签署知情同意后提取被检者外周静脉血基因组DNA,采用晶芯8遗传性耳聋基因检测试剂盒对常见的4个耳聋基因(GJB2、GJB3、SLC26A4以及线粒体12S rRNA)的9个突变位点进行检测.结果 240例受检者中,102例存在被检测基因突变,其中GJB2基因突变44例(18.33%,44/240),SLC26A4基因突变38例(15.83%,38/240),线粒体12S rRNA基因突变17例(7.08%,17/240),GJB3538C>T1例(0.39%,1/240).明确诊断为遗传性耳聋60例,提示遗传性耳聋42例,占全部耳聋患者的42.5%(102/240).结论 非综合征型耳聋患者耳聋基因携带率较高,对高危人群进行耳聋基因突变的筛查和遗传咨询是防止和控制遗传性耳聋、优生优育的重要步骤.

  11. Hydrogeology of the rock mass encountered at the 240 level of Canada's Underground Research Laboratory

    International Nuclear Information System (INIS)

    The rock mass surrounding the 240 level of Canada's Underground Research Laboratory (URL) has been hydrogeologically characterized through observations made in the tunnel and room excavations and from a network of radiating low-dipping boreholes. The 240 level complex sits in a wedge of grey-to-pink granite between two important, low-dipping, hydraulically active fracture zones, known as Fracture Zone 2 (FZ2) and Fracture Zone 2.5 (FZ2.5), a splay of FZ2. There is no apparent seepage into the 240 level room and tunnel network from the surrounding rock mass except from a vertical fracture intersected by the Room 209 tunnel. Extensive hydraulic and geomechanical tests have been conducted in boreholes intersecting the Room 209 vertical fracture, and transmissivities were found to range from 10-10 to 10 -6 m2/s. FZ2 and FZ2.5 occur at the 240 m depth approximately 10 m to the west and 100 m to the south respectively of the 240 level tunnel network. Hydraulic testing within packer-isolated boreholes intersecting these fracture zones showed that transmissivities ranged from 10-7 to 10-5 m2/s in FZ2, and 10-9 to 10-7 m2/s in FZ2.5. No naturally-occurring fractures were encountered east of the 240 level complex up to 300 m away. The rock mass to the north of the 240 level is dominated by the Room 209 vertical fracture, which tends to splay with distance and has been intersected 95 m from the Room 209 tunnel. (Author) (50 figs., 5 tabs., 10 refs.)

  12. Comparative concentrations of 137Cs, 90Sr, /sup 239,240/Pu, and 241Am in tissues of fish from the Marshall Islands and calculated dose commitments from their consumption

    International Nuclear Information System (INIS)

    Body burdens of 90Sr, 137Cs, and the transuranics in bottom-feeding fish from Marshall Island atolls are derived, in part, from the quantities of the radionuclides irreversibly fixed to ingested carbonate material. Radionuclide concentration factors for different species of fish are characterized by relating tissue concentrations to those in filtered seawater. For bottom-feeding fish, the values are lower at the lesser contaminated atolls than those values determined for the same species at the more contaminated atolls. These fish have the ability to lower their gut pH during feeding. When this occurs, there is a dissolution of a fraction of the ingested calcium carbonate containing radionuclides that were fixed or fused internally to the material during nuclear testing. Fractions of the radionuclides released during solution in carbonate matrix are available for passage across the gut wall. Amounts released to solution in the gut are proportional to the levels of contamination at the different atolls. Concentration factors for higher trophic level species, which do not rely on sediments or coral for their source of food, show no such trends between differentially contaminated atolls. A two-source model used to compute the internal concentrations is described. Americium-241 seems to be more biologically available than /sup 239,240/Pu to higher trophic level species from the lagoons, whereas at lower trophic levels the opposite seems to be the case. Cesium-137 is now the largest contributor of the small radiological dose to man from the marine fish pathway, with the transuranics contributing from 2 to 30% of the total dose. 22 references, 1 figure, 19 tables

  13. Discovery and characterization of cadherin domains in Saccharophagus degradans 2-40.

    Science.gov (United States)

    Fraiberg, Milana; Borovok, Ilya; Weiner, Ronald M; Lamed, Raphael

    2010-02-01

    Saccharophagus degradans strain 2-40 is a prominent member of newly discovered group of marine and estuarine bacteria that recycle complex polysaccharides. The S. degradans 2-40 genome codes for 15 extraordinary long polypeptides, ranging from 274 to 1,600 kDa. Five of these contain at least 52 cadherin (CA) and cadherin-like (CADG) domains, the types of which were reported to bind calcium ions and mediate protein/protein interactions in metazoan systems. In order to evaluate adhesive features of these domains, recombinant CA doublet domains (two neighboring domains) from CabC (Sde_3323) and recombinant CADG doublet domains from CabD (Sde_0798) were examined qualitatively and quantitatively for homophilic and heterophilic interactions. In addition, CA and CADG doublet domains were tested for adhesion to the surface of S. degradans 2-40. Results showed obvious homophilic and heterophilic, calcium ion-dependent interactions between CA and CADG doublet domains. Likewise, CA and CADG doublet domains adhered to the S. degradans 2-40 surface of cells that were grown on xylan from birch wood or pectin, respectively, as a sole carbon source. This research shows for the first time that bacterial cadherin homophilic and heterophilic interactions may be similar in their nature to cadherin domains from metazoan lineages. We hypothesize that S. degradans 2-40 cadherin and cadherin-like multiple domains contribute to protein-protein interactions that may mediate cell-cell contact in the marine environment. PMID:20023015

  14. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  15. 17 CFR 240.15b7-3T - Operational capability in a Year 2000 environment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Operational capability in a Year 2000 environment. 240.15b7-3T Section 240.15b7-3T Commodity and Securities Exchanges SECURITIES... § 240.15b7-3T Operational capability in a Year 2000 environment. (a) This section applies to...

  16. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  17. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 L.kg-1. A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  18. An evaluation of the VM/VF ratio to standard UO2 and MOX fuel with 4,5% enrichment and 1% of americium insertion

    International Nuclear Information System (INIS)

    A growing interest exists in the development of techniques for burning and transmuting minor actinides. Some indicate the possibility of differentiated burnup when studying different VM/VF. The VM/VF ratio, moderator volume/fuel volume, is directly related with the value obtained for the multiplication factor k. There is a VM/VF for which k is maximum, and this is directly related with the fuel composition. This work is a study to find a better value of VM/VF, using the WIMS-D5 code, considering a UO2 fuel and a MOX fuel, with 1% Americium insertion. The following parameters were appraised: spectrum hardening, boron worth, and reactivity temperature coefficients. (author)

  19. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  20. Preliminary application of 241-Americium calcaneus bone mineral density measurement in osteoporosis. Comparison with double X-ray densitometry of the lumber spine

    International Nuclear Information System (INIS)

    Bone mineral density (BMD) of calcaneus in 54 normals, 45 Osteoporosis, 25 suspected osteoporosis and 16 other non-osteoporosis patients, a total of 140 cases were measured by HUAKE (HK-1) 241-Americium BMD absorpmetry, among them 43 were compared with that of lumber spine (L2 - L4) measured by Lunar Corporation's Expert-XL absorpmeter. BMD of normal group of calcaneus was (409.8 +- 79.4) mg/cm2. The BMD were decreased slowly with the increasing age. The BMD of osteoporosis, suspected osteoporosis and non-osteoporosis group were 230.3 +- 62.3, 395.7 +- 57.4 and 363.3 +- 51.9 mg/cm2 respectively. The BMD of osteoporosis group was much lower than that of normal group, and also lower than that of the other two groups, among 26 patients (57.78%) had bone fracture, all was in accordance with the clinical diagnosis of osteoporosis. The BMD of suspected osteoporosis and non-osteoporosis had no significant difference with normal group. The coefficient variation (CV) of BMD in repeated measurement in calcaneus of 4 participants was less than 1.2%. The correlative coefficient (r) between BMD of calcaneus and lumber spine (L2 - L4) group was 0.6824. The correlative coefficient of normal young adult-matched percentage and T value in 2 groups were 0.6863 and 0.6755 respectively, whereas aged-matched percentage, Z value were 0.4614 and 0.5009 respectively. In conclusion 241-Americium calcaneus BMD absorpmetry has the advantage of low price, easy to operate, reliable and valuable in diagnosis osteoporosis. The correlations of calcaneus and lumber spine BMD, normal young adult-matched percentage and T value were rather good

  1. 240Pu/239Pu atom ratios in seawater from the western North Pacific and its marginal sea

    International Nuclear Information System (INIS)

    Full text: The atom ratio of 240Pu/239Pu is known to be a useful tracer to identify the sources of plutonium in the ocean. The objectives of this study are to measure the 239+240Pu activities and 240Pu/239Pu atom ratios in seawater from the western North Pacific and its marginal sea and to discuss the transport processes of plutonium. The 240Pu/239Pu atom ratios were measured with sector-field ICPMS. The atom ratios were significantly higher than the mean global fallout ratio. These high atom ratios proved the existence of close-in fallout plutonium originating from the Pacific proving grounds. (author)

  2. Concentration and speciation of plutonium, americium, uranium, thorium, potassium and 137Cs in a venice canal sediment sample

    Science.gov (United States)

    Testa, C.; Desideri, D.; Guerra, F.; Meli, M. A.; Roselli, C.; Degetto, S.

    1999-01-01

    A sequential extraction method consisting of six operationally-defined fractions has been developed for determining the geochemical partitioning of natural (U, Th, 40K) and antropogenic (Pu, Am, 137Cs) radionuclides in a 40-50 cm deep sediment sample collected in a Venice canal. Extraction chromatography with Microthene-TOPO (U, Th), Microthene-TNOA (Pu) and Microthene-HDEHP (Am) column was used for the chemical separation of a single radionuclide; the final recoveries were calculated by adding 236U, 229Th, 242Pu and 243Am as the yield tracers. After electrodeposition the alpha spectrometry was carried out. 137Cs and 40K were measured by gamma spectrometry. The total concentrations in the wet sample (Bq/kgd), obtained by a complete disgregation of the matrix by wet and dry treatment, were the following: 239+240Pu=1.03±0.07, 238Pu=0.022±0.005, 241Am=0.337±0.027, 137Cs=9.78±0.78, 238U=28.84±1.62, 232Th=21.42±1.93, 40K=376.05±12.78. The mean ratio 238Pu/239+240Pu (0.02) shows a contamination due essentially to fall-out and U and Th alpha spectra indicate the natural origin of two elements. The absence of 134Cs in the sample proves that at 40-50 cm depth the sediment was not affected by the Chernobyl fall-out. As far as the speciation is concerned the following fractions were considered: water soluble, carbonates, Fe-Mn oxides, organic matter, acid soluble, residue. Pu (˜67%) an Am (˜95%) were present principally in the carbonate fraction; U was more distributed and about 30% and 45% appeared in the carbonate fraction and in the residue respectively; the majority of Th was present in the residue (˜60%); 40K was totally present in the residue; finally 137Cs was found mostly in the acid soluble fraction (˜53%) and in the residue (˜47%). Some stable elements (Fe, Mn, Al, Ti, Ca, Pb, Ba) were also determined in the different fractions to get more information about the chemical association of the single radionuclides.

  3. 17 CFR 240.14a-16 - Internet availability of proxy materials.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Internet availability of proxy... Under the Securities Exchange Act of 1934 Regulation 14a: Solicitation of Proxies § 240.14a-16 Internet... the security holder a Notice of Internet Availability of Proxy Materials, as described in this...

  4. Presence of plutonium isotopes, {sup 239}Pu and {sup 240}Pu, in soils from Chile

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, E., E-mail: echamizo@us.es [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Garcia-Leon, M., E-mail: manugar@us.es [Departamento de Fisica Atomica, Molecular y Nuclear, Universidad de Sevilla, Avda. Reina Mercedes sn, 41012 Seville (Spain); Peruchena, J.I., E-mail: jiperuchena@gmail.com [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Cereceda, F., E-mail: francisco.cereceda@usm.cl [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Vidal, V., E-mail: victor.vidal@usm.cl [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Pinilla, E., E-mail: epinilla@unex.es [Departamento de Quimica Analitica, Facultad de Ciencias, Universidad de Extremadura, Avda. de Elvas sn, 06071 Badajoz (Spain); Miro, C., E-mail: cmiro@unex.es [Departamento de Fisica Aplicada, Universidad de Extremadura, Avda. de la Universidad sn, 10071 Caceres (Spain)

    2011-12-15

    Plutonium is present in every environmental compartment, due to a variety of nuclear activities. The Southern Hemisphere has received about 20% of the global {sup 239}Pu and {sup 240}Pu environmental inventory, with an important contribution of the so-called tropospheric fallout from both the atmospheric nuclear tests performed in the French Polynesia and in Australia by France and United Kingdom, respectively. In this work we provide new data on the impact of these tests to South America through the study of {sup 239}Pu and {sup 240}Pu in soils from different areas of Northern, Central and Southern Chile. The obtained results point out to the presence of debris from the French tests in the 20-40 Degree-Sign Southern latitude range, with {sup 240}Pu/{sup 239}Pu atomic ratios quite heterogeneous and ranging from 0.02 to 0.23. They are significantly different from the expected one for the global fallout in the Southern Hemisphere for the 30-53 Degree-Sign S latitude range (0.185 {+-} 0.047), but they follow the same trend as the reported values by the Department of Energy of United States for other points with similar latitudes. The {sup 239+240}Pu activity inventories show as well a wider variability range in that latitude range, in agreement with the expected heterogeneity of the contamination.

  5. 17 CFR 240.15g-4 - Disclosure of compensation to brokers or dealers.

    Science.gov (United States)

    2010-04-01

    ... transactions in the penny stock reported on a Qualifying Electronic Quotation System (as defined in 17 CFR 240... or dealer to effect a transaction in any penny stock for or with the account of a customer unless... connection with such transaction. (b) Timing. (1) The information described in paragraph (a) of this...

  6. Highly accurate measurements of the spontaneous fission half-life of 240,242Pu

    Science.gov (United States)

    Salvador-Castiñeira, P.; Bryś, T.; Eykens, R.; Hambsch, F.-J.; Moens, A.; Oberstedt, S.; Sibbens, G.; Vanleeuw, D.; Vidali, M.; Pretel, C.

    2013-12-01

    Fast spectrum neutron-induced fission cross-section data for transuranic isotopes are of special demand from the nuclear data community. In particular highly accurate data are needed for the new generation IV nuclear applications. The aim is to obtain precise neutron-induced fission cross sections for 240Pu and 242Pu. To do so, accurate data on spontaneous fission half-lives must be available. Also, minimizing uncertainties in the detector efficiency is a key point. We studied both isotopes by means of a twin Frisch-grid ionization chamber with the goal of improving the present data on the neutron-induced fission cross section. For the two plutonium isotopes the high α-particle decay rates pose a particular problem to experiments due to piling-up events in the counting gas. Argon methane and methane were employed as counting gases, the latter showed considerable improvement in signal generation due to its higher drift velocity. The detection efficiency for both samples was determined, and improved spontaneous fission half-lives were obtained with very low statistical uncertainty (0.13% for 240Pu and 0.04% for 242Pu): for 240Pu, T1/2,SF=1.165×1011 yr (1.1%), and for 242Pu, T1/2,SF=6.74×1010 yr (1.3%). Systematic uncertainties are due to sample mass (0.4% for 240Pu and 0.9% for 242Pu) and efficiency (1%).

  7. The IMM Face Database - An Annotated Dataset of 240 Face Images

    DEFF Research Database (Denmark)

    Nordstrøm, Michael M.; Larsen, Mads; Sierakowski, Janusz;

    This note describes a dataset consisting of 240 annotated monocular images of 40 different human faces. Points of correspondence are placed on each image so the dataset can be readily used for building statistical models of shape. Format specifications and terms of use are also given in this note....

  8. 17 CFR 240.14a-3 - Information to be furnished to security holders.

    Science.gov (United States)

    2010-04-01

    ... Register citations affecting § 240.14a-3, see the List of CFR Sections Affected, which appears in the... security holders is delivered through an electronic medium, issuers may satisfy legibility requirements... this section, the person making the request was a beneficial owner of securities entitled to vote....

  9. 17 CFR 240.15c1-2 - Fraud and misrepresentation.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Fraud and misrepresentation... Securities Exchange Act of 1934 Rules Relating to Over-The-Counter Markets § 240.15c1-2 Fraud and... any act, practice, or course of business which operates or would operate as a fraud or deceit upon...

  10. 24 CFR 1000.240 - When is a local cooperation agreement required for affordable housing activities?

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false When is a local cooperation... ACTIVITIES Indian Housing Plan (IHP) § 1000.240 When is a local cooperation agreement required for affordable housing activities? The requirement for a local cooperation agreement applies only to rental and...

  11. 17 CFR 240.15c3-1 - Net capital requirements for brokers or dealers.

    Science.gov (United States)

    2010-04-01

    ... mortgage related securities as defined in section 3(a)(41) of the Act subject to reverse repurchase... Examining Authorities pursuant to 17 CFR 240.17a-11, if the market maker or specialist fails to deposit any... same issue and quantity. In no event may a brokers' broker exclude any overnight bank loan...

  12. Isotope ratios of 240Pu/239Pu in soil samples from different areas

    International Nuclear Information System (INIS)

    Plutonium concentrations and 240Pu/239Pu atom ratios in soil samples from Japan and other areas in the world (including IAEA standard reference materials) were determined by ICP-MS. The range of 240Pu/239Pu atom ratios observed in 21 Japanese soil samples was 0.155 - 0.194 and the average was 0.180 ± 0.011, which is comparable to the global fallout value. A low ratio of about 0.05, which is derived from Pu-bomb, was found in samples from Nishiyama (Nagasaki) and Mururoa Atoll (IAEA-368), while a high ratio of about 0.31 was found in a sample from Bikini Atoll (Marshall Islands). The ratio for Irish Sea sediment (IAEA-135) was 0.21, which was higher than the global fallout value, suggesting the influence by the contamination from the Sellafield facility. The 240Pu/239Pu atom ratios in soils from the Chernobyl area were determined, and the ratio was found to be very high (about 0.4), indicating the high burn-up grade of the reactor fuel. These results show that the 240Pu/239Pu ratio can be used as a finger print to identify the source of the contamination. (author)

  13. 17 CFR 240.14d-6 - Disclosure of tender offer information to security holders.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Disclosure of tender offer... Regulations Under the Securities Exchange Act of 1934 Regulation 14d § 240.14d-6 Disclosure of tender offer.... If a tender offer is published, sent or given to security holders on the date of commencement...

  14. 40 CFR 1065.240 - Dilution air and diluted exhaust flow meters.

    Science.gov (United States)

    2010-07-01

    ...-displacement pump (PDP), a subsonic venturi (SSV), or an ultrasonic flow meter (UFM). Combined with an upstream... dilution system, you may use a laminar flow element, an ultrasonic flow meter, a subsonic venturi, a... § 1065.240 Dilution air and diluted exhaust flow meters. (a) Application. Use a diluted exhaust...

  15. 17 CFR 240.17g-4 - Prevention of misuse of material nonpublic information.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Prevention of misuse of... Organizations § 240.17g-4 Prevention of misuse of material nonpublic information. (a) The written policies and... prevent the misuse of material, nonpublic information pursuant to section 15E(g)(1) of the Act (15...

  16. Presence of plutonium isotopes, 239Pu and 240Pu, in soils from Chile

    International Nuclear Information System (INIS)

    Plutonium is present in every environmental compartment, due to a variety of nuclear activities. The Southern Hemisphere has received about 20% of the global 239Pu and 240Pu environmental inventory, with an important contribution of the so-called tropospheric fallout from both the atmospheric nuclear tests performed in the French Polynesia and in Australia by France and United Kingdom, respectively. In this work we provide new data on the impact of these tests to South America through the study of 239Pu and 240Pu in soils from different areas of Northern, Central and Southern Chile. The obtained results point out to the presence of debris from the French tests in the 20–40° Southern latitude range, with 240Pu/239Pu atomic ratios quite heterogeneous and ranging from 0.02 to 0.23. They are significantly different from the expected one for the global fallout in the Southern Hemisphere for the 30–53°S latitude range (0.185 ± 0.047), but they follow the same trend as the reported values by the Department of Energy of United States for other points with similar latitudes. The 239+240Pu activity inventories show as well a wider variability range in that latitude range, in agreement with the expected heterogeneity of the contamination.

  17. 17 CFR 240.14a-20 - Shareholder approval of executive compensation of TARP recipients.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Shareholder approval of... § 240.14a-20 Shareholder approval of executive compensation of TARP recipients. If a solicitation is... shareholder vote to approve the compensation of executives, as disclosed pursuant to Item 402 of Regulation...

  18. Volikogu kergitas kruntide alghinna Olümpia vastas 240 miljoni kroonini / Askur Alas

    Index Scriptorium Estoniae

    Alas, Askur, 1973-

    2006-01-01

    Tallinna linnavolikogu tõstis 26. jaanuari istungil Juhkentali 1b, 3d ja 3e kruntide avaliku enampakkumise alghinna 78 miljonilt kroonilt 240 miljonile. Kruntidele on lubatud ehitada üks kuni 30-korruseline ning mitu 3-8 korruselist hoonet. Kaart: Ala detailplaneering

  19. 17 CFR 240.16a-9 - Stock splits, stock dividends, and pro rata rights.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Stock splits, stock dividends... Government Securities Dealers § 240.16a-9 Stock splits, stock dividends, and pro rata rights. The following... held as a result of a stock split or stock dividend applying equally to all securities of a...

  20. 17 CFR 240.17a-23 - Recordkeeping and reporting requirements relating to broker-dealer trading systems.

    Science.gov (United States)

    2010-04-01

    ... requirements relating to broker-dealer trading systems. 240.17a-23 Section 240.17a-23 Commodity and Securities... relating to broker-dealer trading systems. (a) Scope of section. This section shall apply to any registered broker or dealer that acts as the sponsor of a broker-dealer trading system. (b) Definitions....

  1. 17 CFR 240.3a12-8 - Exemption for designated foreign government securities for purposes of futures trading.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption for designated foreign government securities for purposes of futures trading. 240.3a12-8 Section 240.3a12-8 Commodity and... trading. (a) When used in this Rule, the following terms shall have the meaning indicated: (1) The...

  2. 17 CFR 240.11a1-5 - Transactions by registered competitive market makers and registered equity market makers.

    Science.gov (United States)

    2010-04-01

    ... competitive market makers and registered equity market makers. 240.11a1-5 Section 240.11a1-5 Commodity and... registered equity market makers. Any transaction by a New York Stock Exchange registered competitive market maker or an American Stock Exchange registered equity market maker effected in compliance with...

  3. 17 CFR 240.14e-2 - Position of subject company with respect to a tender offer.

    Science.gov (United States)

    2010-04-01

    ... with respect to a tender offer. 240.14e-2 Section 240.14e-2 Commodity and Securities Exchanges... subject company with respect to a tender offer. (a) Position of subject company. As a means reasonably... position with respect to the bidder's tender offer. Such statement shall also include the reason(s) for...

  4. 17 CFR 240.17Ad-10 - Prompt posting of certificate detail to master securityholder files, maintenance of accurate...

    Science.gov (United States)

    2010-04-01

    ... Supervised Investment Bank Holding Company Rules § 240.17Ad-10 Prompt posting of certificate detail to master... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Prompt posting of certificate..., retention of certificate detail and âbuy-inâ of physical over-issuance. 240.17Ad-10 Section...

  5. 33 CFR 334.240 - Potomac River, Mattawoman Creek and Chicamuxen Creek; U.S. Naval Surface Weapons Center, Indian...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Potomac River, Mattawoman Creek and Chicamuxen Creek; U.S. Naval Surface Weapons Center, Indian Head Division, Indian Head, Md. 334.240 Section 334.240 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED...

  6. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  7. 239+240pn as a dating marker in lake sediments: An example from Lake Chenghai, China%239+240Pu作为湖泊沉积物计年时标:以云南程海为例

    Institute of Scientific and Technical Information of China (English)

    万国江; 吴丰昌; J Zheng; 万恩源; 廖海清; Y Masatoshi; 王长生

    2011-01-01

    137 CS time mark combined with210Pb dating has been widely applied to recent sedimentation. The 137Cs specific activity is, however, hard to detect after decay for two half-lifes. Due to its comparatively long - term half - life, plutonium from global fallout is expected to provide a dating mark for sedimentation. In the present work, we discuss the vertical distribution of 239 + 240Pu and 137 Cs specific activities, and the 240 pu/239 Pu atom ratio in a sediment core of Lake Chenghai. The distribution pattern of 239 +240pu was similar to those of 137Cs specific activities( decay corrected to deposition time)in the sediment core, and also corresponded well with the annual deposition of 137Cs in the northern hemisphere. These results demonstrate that the 239 +240pu specific activity is available to construct recent chronology for lacustrine sediment. In the examined sediment core, the values of 0. 016 for average 239 +24Opu/137Cs activity ratio and 0.012 for ∑239+240Pu/∑ 137Cs, are close to that of global fallout. The vertical variation of 239+240Pu/137Cs activity ratio indicated that the postdepositional transport of plutonium is much less than radiocesium. The average 240Pu/239 Pu atom ratio is 0. 195 ±0. 021, which means plutonium in Lake Chenghai originated from global fallout. The abnormal distribution of 239+240Pu and 137Cs at 8 cm in the sediment core may be explained by the influence of Chernobyl-source radionuclides.%在近代沉积作用领域137Cs时标与210Pb计年结合,获得了广泛而有效的应用.然而,137Cs经过两个半衰期的衰变已难于辩识.环境中的Pu核素具有相对较长的半衰期,也随全球大气扩散而散落于地球表面,可望作为沉积计年的时间标志.通过程海沉积物柱芯中239+240Pu比活度、240Pu/239Pu原子比率及校正到沉积年代的137Cs比活度的对比研究表明:二者比活度的垂直剖面基本相似、239+240pu比活度与北半球137Cs逐年沉降量之间也具有很

  8. Lymphatic marker podoplanin/D2-40 in human advanced cirrhotic liver- Re-evaluations of microlymphatic abnormalities

    Directory of Open Access Journals (Sweden)

    Yoshimura Kazunori

    2010-11-01

    Full Text Available Abstract Background From the morphological appearance, it was impossible to distinguish terminal portal venules from small lymphatic vessels in the portal tract even using histochemical microscopic techniques. Recently, D2-40 was found to be expressed at a high level in lymphatic endothelial cells (LECs. This study was undertaken to elucidate hepatic lymphatic vessels during progression of cirrhosis by examining the expression of D2-40 in LECs. Methods Surgical wedge biopsy specimens were obtained from non-cirrhotic portions of human livers (normal control and from cirrhotic livers (LC (Child A-LC and Child C-LC. Immunohistochemical (IHC, Western blot, and immunoelectron microscopic studies were conducted using D2-40 as markers for lymphatic vessels, as well as CD34 for capillary blood vessels. Results Imunostaining of D2-40 produced a strong reaction in lymphatic vessels only, especially in Child C-LC. It was possible to distinguish the portal venules from the small lymphatic vessels using D-40. Immunoelectron microscopy revealed strong D2-40 expression along the luminal and abluminal portions of the cell membrane of LECs in Child C-LC tissue. Conclusion It is possible to distinguish portal venules from small lymphatic vessels using D2-40 as marker. D2-40- labeling in lymphatic capillary endothelial cells is related to the degree of fibrosis in cirrhotic liver.

  9. Contactless Investigations of Yeast Cell Cultivation in the 7 GHz and 240 GHz Ranges

    International Nuclear Information System (INIS)

    Using a microfluidic system based on PTFE tubes, experimental results of contactless and label-free characterization techniques of yeast cell cultivation are presented. The PTFE tube has an inner diameter of 0.5 mm resulting in a sample volume of 2 μ1 for 1 cm sample length. Two approaches (at frequencies around 7 GHz and 240 GHz) are presented and compared in terms of sensitivity and applicability. These frequency bands are particularly interesting to gain information on the permittivity of yeast cells in Glucose solution. Measurements from 240 GHz to 300 GHz were conducted with a continuous wave spectrometer from Toptica. At 7 GHz band, measurements have been performed using a rat-race based characterizing system realized on a printed circuit board. The conducted experiments demonstrate that by selecting the phase as characterization parameter, the presented contactless and label-free techniques are suitable for cell cultivation monitoring in a PTFE pipe based microfluidic system.

  10. The Pöschl Teller model for total cross section of neutron scattering from 240Pu

    International Nuclear Information System (INIS)

    Neutron scattering cross-section of 240Pu have been investigated using an attractive potential. On applying the modified Pöschl-Teller model, the total cross-section of the n+240Pu in the energy range of 5-20 MeV have been calculated. It was compared with the available experimental data and evaluated data of JENDL-4.0, ENDF/B-VII.0 and CENDL-3.1 as well as with the theoretical values from TALYS-1.2 Nuclear Reaction Program, EMPIRE: 2.19 Nuclear Reaction Model Code and are found to be in reasonably good agreement. This supports the validity of the present calculation. (author)

  11. MEMORIES 240

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    This holiday is very unique. On June 5,2004 (the 18th day of the fourth lunar month) the Xibe people celebrated their Western Migration Festival. This year, the celebration was grander and more enthusiastic than any before.

  12. Minimally invasive video-assisted thyroidectomy: seven-year experience with 240 cases

    OpenAIRE

    Barczyński, Marcin; Konturek, Aleksander; Stopa, Małgorzata; Papier, Aleksandra; Nowak, Wojciech

    2012-01-01

    Introduction Minimally invasive video-assisted thyroidectomy (MIVAT) has gained acceptance in recent years as an alternative to conventional thyroid surgery. Aim Assessment of our 7-year experience with MIVAT. Material and methods A retrospective study of 240 consecutive patients who underwent MIVAT at our institution between 01/2004 and 05/2011 was conducted. The inclusion criterion was a single thyroid nodule below 30 mm in diameter within the thyroid of 25 ml or less in volume. The exclusi...

  13. Skidding of fir roundwood by Timberjack 240C from selective forests of Gorski Kotar

    OpenAIRE

    Sabo, Anton; Poršinsky, Tomislav

    2005-01-01

    The aim of the research was to determine the productivity of the cable skidder Timberjack 240C equipped with double-drum winch Konrad Adler HY 16 during skidding of fir roundwood from the Croatian mountainous selective forests of fir and beech. The research took place in the area of Delnice Forest Management, at two workplaces with different degrees of stone obstacles provided with strip road network. Skidder productivity was determined by the method of time and work study. The paper shows th...

  14. Fission barriers of 237 to 240 plutonium isotopes with the 236U(α,xn) reactions

    International Nuclear Information System (INIS)

    Excitation functions for the reactions 236U(α,xn)sup(240-x)Pu have been measured for x=2, 3, 4. The production of 236U targets as well as the chemical separation of Pu from the irradied targets are given. Experimental results have been analysed using the preequilibrium mechanism (PREEQ code) and the statistical model description of fission through a double humped barrier (GIVAB code)

  15. 17 CFR 240.16a-2 - Persons and transactions subject to section 16.

    Science.gov (United States)

    2010-04-01

    ... Act of 1940 (15 U.S.C. 80a-29(h)), including any person specified in § 240.16a-8, shall be subject to... subject to section 16 of the Act unless the person otherwise is subject to section 16 of the Act. A ten... the issuer registered pursuant to section 12 of the Act. (d)(1) Transactions by a person or...

  16. Design of 240,000 orthogonal 25mer DNA barcode probes

    OpenAIRE

    Xu, Qikai; Schlabach, Michael R.; Hannon, Gregory J.; Elledge, Stephen J.

    2009-01-01

    DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the ...

  17. A 240W Monolithic Class-D Audio Amplifier Output Stage

    DEFF Research Database (Denmark)

    Nyboe, Flemming; Kaya, Cetin; Risbo, Lars;

    2006-01-01

    A single-channel class-D audio amplifier output stage outputs 240W undipped into 4Omega 0.1% open-loop THD+N allows using the device in a fully-digital audio signal path with no feedback. The output current capability is plusmn18A and the part is fabricated in a 0.4mum/1.8mum high-voltage Bi...

  18. Prompt fission γ -ray spectrum characteristics from 240Pu(sf ) and 242Pu(sf )

    Science.gov (United States)

    Oberstedt, S.; Oberstedt, A.; Gatera, A.; Göök, A.; Hambsch, F.-J.; Moens, A.; Sibbens, G.; Vanleeuw, D.; Vidali, M.

    2016-05-01

    In this paper we present first results for prompt fission γ -ray spectra (PFGS) characteristics from the spontaneous fission (sf) of 240Pu and 242Pu. For 242Pu(sf ) we obtained, after proper unfolding of the detector response, an average energy per photon ɛ¯γ=(0.843 ±0.012 ) MeV, an average multiplicity M¯γ=(6.72 ±0.07 ) , and an average total γ -ray energy release per fission E¯γ ,tot = (5.66 ± 0.06) MeV. The 240Pu(sf ) emission spectrum was obtained by applying a so-called detector-response transformation function determined from the 242Pu spectrum measured in exactly the same geometry. The results are an average energy per photon ɛ¯γ=(0.80 ±0.07 ) MeV, the average multiplicity M¯γ = (8.2 ± 0.4), and an average total γ -ray energy release per fission E¯γ ,tot = (6.6 ± 0.5) MeV. The PFGS characteristics for 242Pu(sf ) are in very good agreement with those from thermal-neutron-induced fission on 241Pu and scales well with the corresponding prompt neutron multiplicity. Our results in the case of 240Pu(sf ), although drawn from a limited number of events, show a significantly enhanced average multiplicity and average total energy, but may be understood from a different fragment yield distribution in 240Pu(sf ) compared to that of 242Pu(sf ).

  19. Weldability examination of ASTM A 240 S41500 martensitic stainless steel by thermal cycles simulation testings

    Directory of Open Access Journals (Sweden)

    Alberto Velázquez-del Rosario

    2015-07-01

    Full Text Available The weldability assets of ASTM A 240 S41500 (ASTM A 240/A 240M martensitic stainless steel are presented through the study of the effects of single and double thermal weld cycles on mechanical properties and microstructure of base metal (BM and the artificial heat affected zone (HAZ created by thermal weld simulations. For single cycles, separate peak temperatures of 1000 ºC/12 s and 1350 ºC/12 s (cooling times: 12 s in both cases were evaluated, whilst two combinations of peak temperatures: (1350 ºC/5 s + 1000 ºC/5 s ºC and (1350 ºC/12 s + 1000 ºC/12 s ºC (cooling times: 5 s and 12 s, were applied for double cycles. Post weld heat treatment (PWHT with short and long holding times were applied and Vickers hardness, impact toughness and metallographic examinations were used in order to assess mechanical and metallographic properties in the as-simulated (no heat treated and postweld heat treated conditions. Best properties of the welded joint for double thermal weld cycles with long holding times were reached, which reveals the good weldability and applicability of the tested material in post weld heat treated conditions.

  20. Background distributions of 239+240Pu and 137Cs of upland soil in Rokkasho, Japan

    International Nuclear Information System (INIS)

    The background distributions of Pu and 137Cs in soil were investigated in Rokkasho, Aomori Prefecture, where the first commercial nuclear fuel reprocessing plant in Japan is now being constructed. Soil core samples to 1 m depth were collected at 13 upland fields in Rokkasho and control sites in Hachinohe and Hirosaki. Since fields under yam (Dioscorea babatus) cultivation, which is a common crop in Rokkasho, were dug to approximately 1 m depth at harvesting, depth profiles of fallout radionuclides are heavily disturbed for most fields in Rokkasho. The mean inventories of 239+240Pu and 137Cs in three fields with no yam cultivation history were 116 Bq m-2 and 3.4 kBq m-2, respectively and similar to values in Hachinohe. However, the inventories were approximately a half of those in Hirosaki. The mean ratio of 239Pu/240Pu for all studied fields was 0.18±0.04, and similar to that of global fallout. The Pu concentrations correlate very well with 137Cs (r=0.97) in spite of heavy disturbance of soil, and the ratio of 239+240Pu/137Cs was 0.037±0.007, which is a typical value for global fallout. (author)

  1. Redshift measurement of the BL-Lac gamma-ray blazar PKS 1424+240

    CERN Document Server

    Rovero, A C; Pichel, A; Muriel, H

    2015-01-01

    PKS 1424+240 is a BL-Lac blazar with unknown redshift detected at high-energy gamma rays by Fermi-LAT with a hard spectrum. It was first detected at very-high-energy by VERITAS and latter confirmed by MAGIC. Attempts to find limits on its redshift include three estimations by modeling gamma-ray observations, and one obtained by analyzing Lyb and Lyg absorption lines observed in the far-UV spectra (from HST/COS) caused by absorbing gas along the line of sight. They allowed to constrain the redshift range to 0:6240 in the very interesting condition to be one of the few candidates to be the most distant blazars detected at very-high-energy gamma rays. Redshift determination of BL-Lac objects are difficult to achieve. We have found that redshift of blazars can be determined by its association to a galaxy group or cluster. To explore this possibility for PKS 1424+240, we have carried out spectroscopic measurements with the Gemini North telescope of galaxies in its field of view...

  2. Measurement of the ${240}$Pu(n,f) reaction cross-section

    CERN Multimedia

    Following proposal CERN-INTC-2010-042 / INTC-P-280 (“Measurement of the fission cross-section of $^{240}$Pu and $^{242}$Pu at CERN’s n_TOF Facility”), the parallel measurement of the $^{240}$Pu(n,f) and $^{242}$Pu(n,f) reaction cross-sections was carried out at n_TOF EAR-1. While the $^{242}$Pu measurement was successful, unexpected sample-induced damage to the detectors caused by the high α-activity of the 240Pu samples resulted in a deterioration of the detector performance over the data taking period of several months, which compromised the measurement. This obstacle can be eliminated by performing the measurement in EAR-2, where the higher neutron flux will allow collecting data in a much shorter time, thus preventing the degradation of the detectors. In addition to this obvious advantage, the measurement would also benefit from the stronger suppression of the sample-induced α-background, due to the shorter times-of-flight involved.

  3. Neutron-induced fission cross section of 240,242Pu up to En = 3 MeV

    OpenAIRE

    SALVADOR CASTINEIRA PAULA; BRYS TOMASZ; Hambsch, Franz-Josef; Oberstedt, Stephan; Pretel, C.; Vidali, Marzio

    2014-01-01

    The neutron-induced fission cross sections of 240,242Pu have been measured at JRC-IRMM with incident neutron energy from 0.2 MeV up to 3 MeV. A Twin-Frisch Grid Ionization Chamber (TFGIC) has been used in a back-to-back geometry. The measurements have been performed using the secondary standards 237Np and 238U as a reference. The purity of the plutonium samples was 99.89% for 240Pu and 99.97% for 242Pu. The results obtained follow the ENDF/B-VII.1 evaluation for 240Pu, but some discrepancies ...

  4. Evaluation both level and 239+240Pu spatial contamination of the Lira object and the neighbouring areas

    International Nuclear Information System (INIS)

    In the work the generalization of considerable data collection for revealing of 239+240Pu content range discriminative for Lira object and neighbouring areas is carried out. 239+240Pu mean specific activity in the soil cover surface and in the Berezovka River bottom sedimentations are determined. The correlation dependence between 239+240Pu artificial radionuclides and 137Cs is revealed. The general source of artificial radionuclide origination for examined isotopes is shown up, and it is related with global radioactive fallout

  5. 17 CFR 240.15c3-1f - Optional market and credit risk requirements for OTC derivatives dealers (Appendix F to 17 CFR...

    Science.gov (United States)

    2010-04-01

    ... risk requirements for OTC derivatives dealers (Appendix F to 17 CFR 240.15c3-1). 240.15c3-1f Section... risk requirements for OTC derivatives dealers (Appendix F to 17 CFR 240.15c3-1). Application... charges for market and credit risk pursuant to this Appendix F in lieu of computing securities...

  6. 17 CFR 240.17i-2 - Notice of intention to be supervised by the Commission as a supervised investment bank holding...

    Science.gov (United States)

    2010-04-01

    ... holding company has established to manage the risks of the affiliate group, including market, credit... supervised by the Commission as a supervised investment bank holding company. 240.17i-2 Section 240.17i-2... Supervised Investment Bank Holding Company Rules § 240.17i-2 Notice of intention to be supervised by...

  7. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.

    2004-07-01

    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  8. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  9. Actinide and lanthanum accumulation by immobilized cells of a citrobacter sp. and application to the decontamination of solutions containing americium and plutonium

    International Nuclear Information System (INIS)

    Phosphatase-mediated metal bioaccumulation by a Citrobacter sp. underlies a bioprocess for the removal of heavy metals from solution, as cell-bound metal phosphate. Deposition of uranyl ion indicated a role in the biotechnological removal of americium and plutonium from wastes generated from the nuclear fuel cycle. Preliminary studies suggested a recalcitrance of tetravalent species of U(IV), Th(IV) and Zr(IV) and, by implication, Pu(IV), probably attributable to the stability of metal-ligand complexes in solution. Trials with the trivalent model, La(III), indicated probable bioaccumulation of Pu(III) and Am(III), which was confirmed by the removal of 241Am by cells immobilized in a cartridge incorporated into a flow supplemented with Am. Pu(V) and Pu(IV) wastes may be treatable via prior reduction to Pu(III), with simultaneous removal of the latter with the co-contaminant Am(III). An oxidative route, to Pu(VI), with desolubilization as HPuO2PO4 was also considered, but experiments using the analogous U(VI) (uranyl ion) demonstrated a greater efficiency of M(III) removal. Initial experiments utilized polyacrylamide gel-immobilized cells. 241Am removal also occurred with Citrobacter sp. immobilized as biofilm on reticulated foam supports, more amenable to large-scale processes

  10. Characterization of americium(III) and lanthanide(III) complexes in mixed solvent extraction systems containing a malonamide and a dialkyl-phosphoric acid

    International Nuclear Information System (INIS)

    In order to further reduce toxicity of nuclear waste, the French Commissariat a l'energie atomique et aux energies alternatives (CEA) is developing processes that allow separation of minor actinides from fission products. The DIAMEX (Diamide extraction) - SANEX (Selective actinide extraction) process is based on a mixture of two organic extractants: a malonamide, the N,N'-dimethyl-N,N'-dioctyl-hexyl-ethoxy-malonamide (DMDOHEMA) and a dialkyl-phosphoric acid, the di(2-ethylhexyl)phosphoric acid (HDEHP), dissolved in an alkane. The mechanisms of its extraction process are still not completely understood. Various complementary analytical techniques were used to identify and characterize americium(III) and lanthanide(III) metallic complexes formed in the organic phase after solvent extraction (UV-Visible, Infrared, NMR and Time Resolved Laser-Induced Fluorescence spectroscopy, as well as Electro-spray Ionization Mass Spectrometry). These speciation studies were performed under a variety of experimental conditions (influence of the extractants concentration, acidity of the aqueous phase..) and mixed species including the two extractants were observed. (authors)

  11. Clinical significances of D2-40 expression in thymic epithelial tumors%D2-40在胸腺上皮肿瘤中的表达及临床意义

    Institute of Scientific and Technical Information of China (English)

    袁东风; 江华; 刘凡英

    2012-01-01

    目的 探讨D2-40在胸腺上皮肿瘤(TET)中的表达,分析D2-40表达与肿瘤侵袭和预后的关系.方法 采用免疫组织化学染色法观察D2-40在160例胸腺上皮肿瘤和40例正常胸腺标本中的表达情况,术后连续随访5年以上.应用统计学软件分析D2-40表达与肿瘤侵袭和预后的关系.结果 D2-40在TET及正常胸腺中的阳性表达率分别为58.8% (94/160)和20% (8/40),差异有统计学意义(P=0.013).D2-40在TET中的表达与TET侵袭性有关(P<0.01).D2-40阳性表达组和阴性表达组患者5年生存率分别为32%、90%(P<0.01).结论 D2-40在TET中的表达高于正常胸腺组织,且随着侵袭性的增强,表达也增强.D2-40表达阳性的患者预后较差.%Objective To investigate the expression of D2-40 in thymic epithelial tumors (TET) and its significance in tumor invasion and prognosis. Methods Immunohistochemical method was used to assess the expression of D240 in 160 samples of thymic epithelial tumors and 40 samples of normal thymuses. All cases were followed-up for more than 5 years after operation. Statistics softwares were used to analyze the correlation between the expression of D2-40 and the tumor invasion and prognosis. Results The positive rate of D2-40 expression in 160 TET and 40 normal thymuses were 58.8% (94/160) and20%(8/40) respectively, and the difference was statistically significant (P = 0.013). The expression of D2-40 in TET was correlated with the invasion of TET (P<0.01). The 5-year-survival rates of the patients in the D2-40 expression positive group and the negative group were 32% and 90% respectively (P<0. 01). Conclusion Expression of 02-40 is higher in the TET than in the normal thymus, which correlates with the aggression of TET. The patients with D2-40 positive expression have worse prognosis.

  12. A Design of 240 W Communication Power Based on LLC Resonant Topology%基于LLC谐振拓扑的240W通讯电源设计

    Institute of Scientific and Technical Information of China (English)

    张灵迪; 施华虎; 魏涛

    2011-01-01

    This paper analyzes the principle of new resonant topology LLC based on half bridge detailedly, then proposes the design method for calculating the three parameters of serial resonant inductance, capacitance in resonance tank and transformer excitation in%详细分析了基于半桥的新型谐振拓扑结构LLC的原理,并采用基波近似结合时域仿真的方法,给出上LLC谐振腔的串联谐振电感、串联谐振电容和变压器励磁电感等三个重要参数的设计方法,同时给出了采用锁相控制法搭建240W功率输出的通讯电源的实现方案。

  13. 17 CFR 240.3a11-1 - Definition of the term “equity security.”

    Science.gov (United States)

    2010-04-01

    ... 16 § 240.3a11-1 Definition of the term “equity security.” The term equity security is hereby defined... certificate or certificate of deposit for an equity security, limited partnership interest, interest in...

  14. Studies of the Pu-239/240 content in tissues from non-occupationally exposed individuals. Progress report

    International Nuclear Information System (INIS)

    Environmental levels of alpha-emitting actinides, specifically plutonium 239, 240 have been determined in tissues from non-occupationally exposed individuals of different ages, sexes and geographical areas and the results compared with those from other laboratories

  15. Neutron inelastic-scattering cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu

    International Nuclear Information System (INIS)

    Differential-neutron-emission cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu are measured between approx. = 1.0 and 3.5 MeV with the angle and magnitude detail needed to provide angle-integrated emission cross sections to approx. 232Th, 233U, 235U and 238U inelastic-scattering values, poor agreement is observed for 240Pu, and a serious discrepancy exists in the case of 239Pu

  16. Complete genome sequence of the complex carbohydrate-degrading marine bacterium, Saccharophagus degradans strain 2-40 T.

    OpenAIRE

    Weiner, Ronald M.; Taylor, Larry E.; Bernard Henrissat; Loren Hauser; Miriam Land; Coutinho, Pedro M; Corinne Rancurel; Saunders, Elizabeth H.; Atkinson G Longmire; Haitao Zhang; Bayer, Edward A.; Gilbert, Harry J.; Frank Larimer; Zhulin, Igor B.; Ekborg, Nathan A.

    2008-01-01

    The marine bacterium Saccharophagus degradans strain 2-40 (Sde 2-40) is emerging as a vanguard of a recently discovered group of marine and estuarine bacteria that recycles complex polysaccharides. We report its complete genome sequence, analysis of which identifies an unusually large number of enzymes that degrade >10 complex polysaccharides. Not only is this an extraordinary range of catabolic capability, many of the enzymes exhibit unusual architecture including novel combinations of catal...

  17. Determination of 240Pu/239Pu isotope ratios in Kara Sea and Novaya Zemlya sediments using accelerator mass spectrometry

    International Nuclear Information System (INIS)

    Accelerator mass spectrometry (AMS) has been used to determine Pu activity concentrations and 240Pu/239Pu isotope ratios in sediments from the Kara Sea and radioactive waste dumping sites at Novaya Zemlya. Measured 239,240Pu activities ranged from 0.06 - 9.8 Bq/kg dry weight, 240Pu/239Pu atom ratios ranged from 0.13 to 0.28, and 238Pu/239,240Pu activity ratios from 0.02 to 0.6. Perturbations from global fallout isotope ratios were evident at three sites: the Yenisey Estuary and Abrosimov Fjords where 240Pu/239Pu ratios were lower (0.13-0.14); and Stepovogo Fjord sediments where ratios were higher (up to 0.28) than fallout ratios. Based on procedural blanks, detection limits for AMS were below 1 fg Pu and the method showed good precision for isotope ratio measurements, minimal matrix, interference and memory effects. For high level samples, comparison between alpha spectrometry and AMS gave good agreement for measurement of 239,240Pu activity concentrations. (author)

  18. Precision of gamma-ray measurements of the effective specific power and effective 240Pu fraction of plutonium

    International Nuclear Information System (INIS)

    This paper uses gamma-ray spectrometry data from replicate measurements on 40 plutonium-bearing samples to examine the repeatability of the effective 240Pu fraction (240Pueff) and the effective specific power (Peff) calculated from the isotopic distribution analyzed with gamma-ray spectrometry codes. The measurements were used to identify the error component arising from repeatability in the determination of the isotopic composition of plutonium in the sample and the contribution of the error component to the uncertainty in total plutonium mass measurements from neutron coincidence counting (240Pueff) and calorimetry (Peff). The 40 samples had 240Pueff percentages ranging from 2 to 39% and Peff values ranging from 2 to 16 mW/g Pu. Four different gamma-ray spectrometry codes (FRAM, MGA, Blue Box, and PUJRC) were used to analyze the data (not all samples were analyzed with each code). All analyses showed that the % relative standard deviation of Peff was smaller than that of 240Pueff. This result coupled with a cursory examination of uncertainties in coincidence counting of well-characterized samples and water-bath calorimetry errors for the same types of samples lead to the conclusion that smaller uncertainties will be present in the total plutonium mass determined by the combination of calorimetry/gamma-ray spectrometry than in the mass determined by coincidence counting/gamma-ray spectrometry. An additional examination of the biases arising from the 240Pu correlation used in the gamma-ray spectrometry codes also supported this conclusion. 17 refs

  19. Association of fallout-derived 137Cs,90Sr and 239,240Pu with natural organic substances in soils

    International Nuclear Information System (INIS)

    Activity concentrations and associations of fallout-derived Cs, Sr and Pu in soils were investigated. The activity concentrations of 137Cs, 90Sr and 239,240Pu in volcanic ash soil were much higher than those in granite soil. They decreased with increasing depth in the soil. The activity ratios of 239,240Pu/137Cs and 90Sr/137Cs tended to increase slightly with increasing soil depth. Alkali extraction experiments with 0.1 M NaOH solution showed that the percentage activities of the fallout radionuclides found in the organic acid fractions were in the order 239,240Pu>90Sr>137Cs. The concentrations of 137Cs and 239,240Pu reacted with humic fractions were higher than those with fulvic fractions. In contrast to 137Cs and 239,240Pu,90Sr reacted more with fulvic fractions than with humic fractions. These results provide information about the effects of organic substances on the retention and migration of 137Cs,90Sr and 239,240Pu in soils under natural conditions

  20. The coagulation of dissolved sup(239,240)Pu in estuaries as determined from a mixing experiment

    International Nuclear Information System (INIS)

    A mixing experiment, using large volumes (100 l) of filtered (240Pu during estuarine mixing. An organic-rich freshwater with a relatively high concentration (0.8 dpm/100 l) of dissolved sup(239,) 240Pu was used as one end-member; Buzzards Bay seawater (dissolved sup(239,) 240Pu=0.04 dpm/100 l) was the other. The results demonstrate that dissolved sup(239,) 240Pu in the freshwater undergoes extensive and rapid coagulation under simulated estuarine conditions. There is a strong correlation between the amount of coagulation of dissolved sup(239,) 240Pu, humic acids (HA), and Fe. The extent of coagulation of all three constituents increases with increasing salinity and the net extent of their removal is 53%, 57%, and 100% for Pu, HA, and Fe respectively. As has been domented for Fe in freshwater, dissolved sup(239,) 240Pu appears to be stabilized by naturally occurring humic substances to form negatively charged colloids which are then coagulated by seawater cations. The extrapolation of these experimental results to real estuaries will require additonal research. (orig.)

  1. 重症脑瘫240例临床分析%Clinical analysis of 240 children with severe cerebral palsy

    Institute of Scientific and Technical Information of China (English)

    刘卫鹏; 屈素清; 栾佐

    2013-01-01

    [Objective] In terms of clinical features as a comprehensive observation and analysis of children with severe cerebral palsy(CP),to determine the efficacy of the results and better prevention.[Methods] A total of 240 severe CP children were examined by perinatal history,history of growth and development,symptom,signs,imaging studies,electroencephalogram,and Gross Motor Function Measure (GMFM),Peabody Developmental Motor Scale-Fine Scale (PDMSFM),to detect the clinical features.[Result] Among the 240 cases of CP,103 cases (42.9%) with spastic type CP,81 cases (33.8%) with dyskinetic type,49 cases(20.4%) with mixed type,7 cases (2.9%) with hypotonia type,gross motor function classification were than grade Ⅳ;the main risk factors for preterm delivery (37.9 %),intrauterine hypoxia (20.4%),neonatal jaundice (15.8%);90% cases with mental retardation,44% cases with visual impairment,8.3% cases with hearing impairment,27.1% cases with symptomatic epilepsy,42.9 % patients with swallowing dysfunction lead to malnutrition;brain morphological damage reduced to white matter volume,myelination delay,periventricular leukomalacia,multiple brain softening,cerebral dysplasia,basal ganglia lesions.[Conclusion] The pathogenic factors of severe cerebral palsy are complex and diversiform;severe CP patients' motor function is severely restricted;with even multiple concurrent disorders.To know these disease risk factors and complications of damage could help us to prevent and treat severe CP better.%[目的]通过对住院康复治疗240例重症脑瘫(cerebral palsy,CP)患儿临床特点进行分析,提高对重症CP的认识,并尽早防治. [方法]对资料完善的240例重症CP患儿围产史、生长发育史、症状、体征、影像学检查、电生理学检查、粗大运动功能评估量表和Peabody精细运动量表评估检查,进行回顾性研究分析. [结果]240例CP患儿中痉挛型103例(42.9%),不随意运动型81例(33.8

  2. Clinicopathological significance of D2-40 expression in craniopharyngioma%颅咽管瘤中D2-40的表达及临床意义

    Institute of Scientific and Technical Information of China (English)

    刘雪咏; 朱琼; 陈余朋; 张声; 王行富; 吴晶晶; 李国平

    2015-01-01

    目的:探讨D2-40在颅咽管瘤中的表达及与临床病理学特征的关系及意义。方法采用免疫组化法检测D2-40在126例颅咽管瘤中的表达,并复习相关文献。结果 D2-40在颅咽管瘤中的总阳性率为87.30%(110/126),其中(+)、()、()阳性率分别为44.44%(56/126)、37.30%(47/126)和5.56%(7/126)。造釉细胞型主要表达在中间层细胞,乳头瘤样型主要表达在基底层细胞,两型表达模式不同。随着肿瘤伴发炎症程度的加重,D2-40表达程度上调。在肿瘤浸润灶及侵袭前沿, D2-40常常高表达,表现为基底层细胞及中间层细胞同时弥漫表达,侵袭性颅咽管瘤中D2-40的表达程度高于非侵袭性颅咽管瘤。复发性颅咽管瘤中D2-40的表达程度高于非复发性颅咽管瘤。D2-40表达与患者性别、肿瘤组织学分型无明显相关性。结论 D2-40表达上调与颅咽管瘤的发生、发展相关,可能导致肿瘤细胞的侵袭能力增强,并可能与炎症相关机制有关。D2-40高表达可能是颅咽管瘤患者易复发的因素之一。%Purpose To investigate the expression pattern and c1inicopatho1ogica1 significance of D2-40 in craniopharyngioma( CP). Methods Immunohistochemica1 method was used to assess D2-40 expression in 126 cases of craniopharyngioma. Statistic software was used to ana1yze the corre1ation between D2-40 expression and c1inicopatho1ogica1 features. Results The overa11 positive rate of D2-40 expression in 126 craniopharyngioma was 87. 30%. The rate of +, and  were 44. 44%( 56/126 ),37. 30%( 47/126 )and 5. 56%(7/126)respective1y. In adamantinomatous CPs,D2-40 expression was observed in epithe1ia1 components corresponding to the stratum intermedium,whi1e in papi11ary CPs,it was immuno-positive in basa1 ce11s. With the increasing of the existence of inf1amma-tion in tumor,D2-40 expression was up-regu1ated. Tumor ce11s were over-expressed for D2-40 in basa1

  3. Application possibilities of Acqiris digital card DP240 for positron lifetime measurement

    Energy Technology Data Exchange (ETDEWEB)

    Petriska, M; Slugen, V [Department of Nuclear Physics and Technology, Slovak University of Technology, Ilkovicova 3, 81219 Bratislava (Slovakia); Krsjak, V [Institute for Energy, Joint Research Centre of the European Commission, PO Box 2, 1755ZG Petten (Netherlands); Zeman, A, E-mail: martin.petriska@stuba.sk [International Atomic Energy Agency, Department of Nuclear Sciences and Applications, Wagramer Strasse 5, A-1400, Vienna (Austria)

    2011-01-10

    Based on existing knowledge, a software for the digital positron lifetime (LT) spectrometer has been designed at the Slovak University of Technology. As a digitizer, Acqiris DP240 card was used. Start and stop timing signals have been digitised separately with sampling rate 1GS/s in 8 bit resolution. This sampling rate was not sufficient; therefore a joined delayed channel mode with 2GS/s sampling rate was used. Next applications for the study of advanced materials for nuclear industry are foreseen.

  4. Highly accurate measurements of the spontaneous fission half-life of 240,242Pu

    OpenAIRE

    SALVADOR CASTINEIRA PAULA; BRYS TOMASZ; EYKENS ROGER; Hambsch, Franz-Josef; MOENS Andre; Oberstedt, Stephan; SIBBENS Goedele; VANLEEUW DAVID; Vidali, Marzio; Pretel, C.

    2013-01-01

    Fast spectrum neutron-induced fission cross-section data for transuranic isotopes are of special demand from the nuclear data community. In particular highly accurate data are needed for the new generation IV nuclear applications. The aim is to obtain precise neutron-induced fission cross sections for 240Pu and 242Pu. To do so, accurate data on spontaneous fission half-lives must be available. Also, minimizing uncertainties in the detector efficiency is a key point. We studied both isotopes b...

  5. Neutron-induced fission cross section of 240,242Pu

    OpenAIRE

    Salvador Castiñeira, Paula

    2014-01-01

    A recent sensitivity analysis done for the new generation of fast reactors [1] has shown the importance of improved cross section data for several actinides. Among them, the neutron-induced fission cross section of 240,242Pu requires a level of accuracy of 1-3% and 3-5%, respectively, from the current status of 6% and 20%. Moreover, nearly all the measurements in the literature have been done relative to 235U(n,f). Therefore, using other references samples such as 237Np or 238U will provide t...

  6. {sup 239+240}Pu in the Barents Sea Regions. Sources and radioecological assessment

    Energy Technology Data Exchange (ETDEWEB)

    Iosjpe, Mikhail [Norwegian Radiation Protection Authority, P.O. Box 55, N-1332 Oesteraas (Norway)

    2014-07-01

    The radioecological assessment for {sup 239+240}Pu in the Barents sea regions was made using the compartment modelling approach. The following sources of radioactive contamination were under consideration: global fallout from atmospheric testing of nuclear weapons, transport of {sup 239+240}Pu from the Sellafield and La Hauge nuclear plants and underwater testing of nuclear weapons in Chernaya Bay, Novaya Zemlya. The box model developed at NRPA uses a modified approach for compartmental modeling, which takes into account the dispersion of radionuclides over time. The box structures for surface, mid-depth and deep water layers have been developed based on the description of polar, Atlantic and deep waters in the Arctic Ocean and the Northern Seas, as well as site-specific information for the boxes. The volume of the three water layers in each box has been calculated using detailed bathymetry together with Geographical Information Systems. The box model includes the processes of advection of radioactivity between compartments, sedimentation, diffusion of radioactivity through pore water in sediments, resuspension, mixing due to bioturbation, particle mixing and a burial process for radionuclides in deep sediment layers. Radioactive decay is calculated for all compartments. The contamination of biota is further calculated from the known radionuclide concentrations in filtered seawater in the different water regions. Doses to man are calculated on the basis of seafood consumptions, in accordance with available data for seafood catches and assumptions about human diet in the respective areas. Dose to biota are determined on the basis of calculated radionuclide concentrations in marine organisms, water and sediment, using dose conversion factors. Results of the calculations show that atmospheric deposition is the dominant source for the Barents Sea, except for the Chernaya Bay region. It is also demonstrated that the impact of the Sellafield nuclear facilities has

  7. Metamaterial composite bandpass filter with an ultra-broadband rejection bandwidth of up to 240 terahertz

    DEFF Research Database (Denmark)

    Strikwerda, Andrew; Zalkovskij, Maksim; Lorenzen, Dennis Lund;

    2014-01-01

    central frequency (f) that is scalable from 0.86–8.51 THz, that highly extinguishes other frequencies up to >240 THz. The performance of these filters is demonstrated in experiment, using both air biased coherent detection and a Fourier transform infrared spectrometer (FTIR), as well as in simulation. We...... present equations—and discuss their scaling laws—which detail the f and full width at half max (Δf) of the pass band, as well as the required geometric dimensions for their fabrication using standard UV photolithography and easily achievable fabrication linewidths. With these equations, the geometric...

  8. 64 Gbit/s Transmission over 850 m Fixed Wireless Link at 240 GHz Carrier Frequency

    Science.gov (United States)

    Kallfass, Ingmar; Boes, Florian; Messinger, Tobias; Antes, Jochen; Inam, Anns; Lewark, Ulrich; Tessmann, Axel; Henneberger, Ralf

    2015-02-01

    A directive fixed wireless link operating at a center frequency of 240 GHz achieves a data rate of 64 Gbit/s over a transmission distance of 850 m using QPSK and 8PSK modulation, in a single-channel approach without the use of spatial diversity concepts. The analog transmit and receive frontend consists of active monolithic integrated circuits including broadband RF amplification and quadrature subharmonic mixer channels. The analog frontend is addressed by 64 GSa/s ADC and DAC boards, which are amenable to real-time data transmission. A link budget calculation allows for the estimation of the performance under adverse weather conditions.

  9. Microscopic modeling of mass and charge distributions in the spontaneous fission of 240Pu

    CERN Document Server

    Sadhukhan, Jhilam; Schunck, Nicolas

    2016-01-01

    In this letter, we outline a methodology to calculate microscopically mass and charge distributions of spontaneous fission yields. We combine the multi-dimensional minimization of collective action for fission with stochastic Langevin dynamics to track the relevant fission paths from the ground-state configuration up to scission. The nuclear potential energy and collective inertia governing the tunneling motion are obtained with nuclear density functional theory in the collective space of shape deformations and pairing. We obtain a quantitative agreement with experimental data and find that both the charge and mass distributions in the spontaneous fission of 240Pu are sensitive both to the dissipation in collective motion and to adiabatic characteristics.

  10. Microscopic modeling of mass and charge distributions in the spontaneous fission of 240Pu

    Science.gov (United States)

    Sadhukhan, Jhilam; Nazarewicz, Witold; Schunck, Nicolas

    2016-01-01

    We propose a methodology to calculate microscopically the mass and charge distributions of spontaneous fission yields. We combine the multidimensional minimization of collective action for fission with stochastic Langevin dynamics to track the relevant fission paths from the ground-state configuration up to scission. The nuclear potential energy and collective inertia governing the tunneling motion are obtained with nuclear density functional theory in the collective space of shape deformations and pairing. We obtain a quantitative agreement with experimental data and find that both the charge and mass distributions in the spontaneous fission of 240Pu are sensitive both to the dissipation in collective motion and to adiabatic fission characteristics.

  11. Induced Fission of 240Plutonium within a Real-Time Microscopic Framework

    Energy Technology Data Exchange (ETDEWEB)

    Bulgac, Aurel; Magierski, Piotr; Roche, Kenneth J.; Stetcu, Ionel

    2016-03-25

    We describe the fissioning dynamics of 240Pu from a configuration in the proximity of the outer fission barrier to full scission and the formation of the fragments within an implementation of the Density Functional theory extended to superfluid systems and real-time dynamics. While the fission products emerge with properties very similar to those determined experimentally, the fission dynamics appears to be quite complex, with various shape and pairing modes being excited during the evolution. Consequently the time scale of the evolution turned out to be much slower than previously expected.

  12. Annular cylinders experimental programme containing plutonium solutions at different 240Pu contents

    International Nuclear Information System (INIS)

    From 1963 to 1976, 730 critical experiments dealing with annular cylinders containing plutonium nitrate solutions were conducted on Valduc critical facility, called 'Apparatus B'. They aimed at validating critical configurations encountered in the fuel cycle, especially in storage and also at validating the 240Pu cross-sections in thermal neutron spectrum. It is to be noticed that these experiments validate criticality codes either in configurations with reactor-grade plutonium coming from the reprocessing cycle or with weapon-grade plutonium coming from the decommissioning of nuclear weapons. (authors)

  13. A multi-radionuclide approach to evaluate the suitability of (239+240)Pu as soil erosion tracer.

    Science.gov (United States)

    Meusburger, Katrin; Mabit, Lionel; Ketterer, Michael; Park, Ji-Hyung; Sandor, Tarjan; Porto, Paolo; Alewell, Christine

    2016-10-01

    Fallout radionuclides have been used successfully worldwide as tracers for soil erosion, but relatively few studies exploit the full potential of plutonium (Pu) isotopes. Hence, this study aims to explore the suitability of the plutonium isotopes (239)Pu and (240)Pu as a method to assess soil erosion magnitude by comparison to more established fallout radionuclides such as (137)Cs and (210)Pbex. As test area an erosion affected headwater catchment of the Lake Soyang (South Korea) was selected. All three fallout radionuclides confirmed high erosion rates for agricultural sites (>25tha(-1)yr(-1)). Pu isotopes further allowed determining the origin of the fallout. Both (240)Pu/(239)Pu atomic ratios and (239+240)Pu/(137)Cs activity ratios were close to the global fallout ratio. However, the depth profile of the (239+240)Pu/(137)Cs activity ratios in undisturbed sites showed lower ratios in the top soil increments, which might be due to higher migration rates of (239+240)Pu. The activity ratios further indicated preferential transport of (137)Cs from eroded sites (higher ratio compared to the global fallout) to the depositional sites (smaller ratio). As such the (239+240)Pu/(137)Cs activity ratio offered a new approach to parameterize a particle size correction factor that can be applied when both (137)Cs and (239+240)Pu have the same fallout source. Implementing this particle size correction factor in the conversion of (137)Cs inventories resulted in comparable estimates of soil loss for (137)Cs and (239+240)Pu. The comparison among the different fallout radionuclides highlights the suitability of (239+240)Pu through less preferential transport compared to (137)Cs and the possibility to gain information regarding the origin of the fallout. In conclusion, (239+240)Pu is a promising soil erosion tracer, however, since the behaviour i.e. vertical migration in the soil and lateral transport during water erosion was shown to differ from that of (137)Cs, there is a clear

  14. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  15. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  16. Thermodynamic parameters of MeO2+ + H+ reversible MeO22+ + 1/2 H2 reaction for americium and neptunium ions in solution of potassium phosphotungstates

    International Nuclear Information System (INIS)

    Formal oxidation potentials of MeO22+-MeO2+ pair are measured for americium and neptunium ions in solutions of potassium phosphotungstates in 23-51 deg C temperature range at solution pH values equal to 1.0 and 4.0 by differential coulopotentiometric and potentiometric methods. Based on the data obtained Gibbs energy change values; enthalpies and enthropies for MeO2+ + H+ ↔ MeO22+ + 1/2H2 reaction are calculated

  17. Neutron-induced Fission Cross Section of 240,242Pu

    Science.gov (United States)

    Salvador-Castiñeira, P.; Bryś, T.; Eykens, R.; Hambsch, F.-J.; Göök, A.; Oberstedt, S.; Pretel, C.; Sibbens, G.; Vanleeuw, D.; Vidali, M.

    A sensitivity analysis for the new generation of fast reactors [Salvatores (2008)] has shown the importance of improved cross section data for several actinides. Among them, the 240,242Pu(n,f) cross sections require an accuracy improvement to 1-3% and 3-5%, respectively, from the current level of 6% and 20%. At the Van de Graaff facility of the Institute for Reference Materials and Measurements (JRC-IRMM) the fission cross section of the two isotopes was measured relative to two secondary standard reactions, 237Np(n,f) and 238U(n,f), using a twin Frisch-grid ionization chamber. The secondary standard reactions were benchmarked through measurements against the primary standard reaction 235U(n,f) in the same geometry. Sample masses were determined by means of low-geometry alpha counting or/and a 2π Frisch-grid ionization chamber, with an uncertainty lower than 2%. The neutron flux and the impact of scattering from material between source and target was examined, the largest effect having been found in cross section ratio measurements between a fissile and a fertile isotope. Our 240,242Pu(n,f) cross sections are in agreement with previous experimental results and slightly lower than present evaluations. In case of the 242Pu(n,f) reaction no evidence for a resonance at En=1.1 MeV was found.

  18. Alpha-particle emission probabilities in the decay of {sup 240}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Sibbens, G., E-mail: goedele.sibbens@ec.europa.e [European Commission, Joint Research Centre, Institute for Reference Materials and Measurements, Retieseweg 111, B-2440 Geel (Belgium); Pomme, S.; Altzitzoglou, T. [European Commission, Joint Research Centre, Institute for Reference Materials and Measurements, Retieseweg 111, B-2440 Geel (Belgium); Garcia-Torano, E. [Laboratorio de Metrologia de Radiaciones Ionizantes, CIEMAT, Avda. Complutense 22, 28040 Madrid (Spain); Janssen, H.; Dersch, R.; Ott, O. [Physikalisch-Technische Bundesanstalt (PTB), Bundesallee 100, 38116 Braunschweig (Germany); Martin Sanchez, A. [Departamento de Fisica, Universidad de Extremadura, Badajoz, E-06071 (Spain); Rubio Montero, M.P. [Departamento de Fisica Aplicada, Universidad de Extremadura, Merida, Badajoz, E-06800 (Spain); Loidl, M. [Laboratoire National Henri Becquerel, LNE/CEA-LIST, 91191 Gif-sur-Yvette (France); Coron, N.; Marcillac, P. de [Institut d' Astrophysique Spatiale, CNRS, 91405 Orsay Campus (France); Semkow, T.M. [Wadsworth Center, New York State Department of Health, Albany, NY 12201 (United States)

    2010-07-15

    Sources of enriched {sup 240}Pu were prepared by vacuum evaporation on quartz substrates. High-resolution alpha-particle spectrometry of {sup 240}Pu was performed with high statistical accuracy using silicon detectors and with low statistical accuracy using a bolometer. The alpha-particle emission probabilities of six transitions were derived from the spectra and compared with literature values. Additionally, some alpha-particle emission probabilities were derived from {gamma}-ray intensity measurements with a high-purity germanium detector. The alpha-particle emission probabilities of the three main transitions at 5168.1, 5123.6 and 5021.2 keV were derived from seven aggregate spectra analysed with five different fit functions and the results were compatible with evaluated data. Two additional weak peaks at 4863.5 and 4492.0 keV were fitted separately, using the exponential of a polynomial function to represent the underlying tailing of the larger peaks. The peak at 4655 keV could not be detected by alpha-particle spectrometry, while {gamma}-ray spectrometry confirms that its intensity is much lower than expected from literature.

  19. Transuranic concentrations in reef and pelagic fish from the Marshall Islands. [/sup 239/Pu, /sup 240/Pu

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V.E.; Eagle, R.J.; Wong, K.M.; Jokela, T.A.

    1980-09-01

    Concentrations of /sup 239 + 240/Pu are reported in tissues of several species of reef and pelagic fish caught at 14 different atolls in the northern Marshall Islands. Several regularities that are species dependent are evident in the distribution of /sup 239 + 240/Pu among different body tissues. Concentrations in liver always exceeded those in bone and concentrations were lowest in the muscle of all fish analyzed. A progressive discrimination against /sup 239 + 240/Pu was observed at successive trophic levels at all atolls except Bikini and Enewetak, where it was difficult to conclude if any real difference exists between the average concentration factor for /sup 239 + 240/Pu among all fish, which include bottom feeding and grazing herbivores, bottom feeding carnivores, and pelagic carnivores from different atoll locations. The average concentration of /sup 239 + 240/Pu in the muscle of surgeonfish from Bikini and Enewetak was not significantly different from the average concentrations determined in these fish at the other, lesser contaminated atolls. Concentrations among all 3rd, 4th, and 5th trophic level species are highest at Bikini where higher environmental concentrations are found. The reasons for the anomalously low concentrations in herbivores from Bikini and Enewetak are not known.

  20. Evaluation of 239+240Pu, 137Cs and natural 210Pb fallout in agricultural upland fields in Rokkasho, Japan

    International Nuclear Information System (INIS)

    The background distributions of 239+240Pu and 137Cs fallout in agricultural soil were investigated in Rokkasho where Japan's first commercial nuclear fuel reprocessing plant is now being constructed. The mean inventories of 239+240Pu and 137Cs in three fields with non-yam-cultivation history were 116 Bq x m-2 and 3.4 kBq x m-2, respectively. The mean atomic ratio of 240Pu/239Pu for all studied fields was 0.18±0.04, and was similar to that of global fallout. The 239+240Pu concentrations correlated very well with 137Cs (r = 0.97) in spite of heavy disturbance of the soil, and the activity ratio of 239+240Pu/137Cs was 0.037 ± 0.007, which is a typical value for global fallout. These results showed that the nuclides had similar behavior in agricultural upland fields in Rokkasho. Since 210Pb is steadily deposited from the atmosphere to the land, this nuclide could be an index for the degree of disturbance of a field and of soil lost from the field. The ratio of excess 210Pb inventory in the soil to the equivalent inventory of atmospheric 210Pb deposition was 96%, and indicated that soil was not lost from the cultivated fields. (author)

  1. The pore water chemistry of sup(239,240)Pu and 137Cs on sediments of Buzzards Bay, Massachusetts

    International Nuclear Information System (INIS)

    The collection of large volumes of pore water and low level radiochemical measurements of sup(239,240)Pu and 137Cs have been combined to produce the first study of these fallout artificial radionuclides in marine pore waters. Profiles from box cores taken in June and September 1982 from Buzzards Bay, Mass., are reported along with profiles of many diagenetic constituents (i.e. SO42-, alkalinity, Fe, Mn, DOC, and nutrients). The sup(239,240)Pu pore water profile is characterized by a subsurface maximum of about 0.28 dpm/100 kg lying between 3 to 11 cm. Overlying seawater, in contrast, has an activity of 0.01 +- 0.02 dpm/100 kg. Below about 11 cm, the pore water sup(239,240)Pu distribution follows that of the solid phase which decreases rapidly with depth. The pore water profiles of 137Cs are characterized by a broad and deeply penetrating maximum where activities of about 35 to 40 dpm/100 kg extend from 3 to 20 cm. Overlying seawater, in contrast, has an activity of 17 to 24 dpm/100 kg. The 137Cs and sup(239,240)Pu pore water data show that there is preferential downward transport of 137Cs and that sup(239,240)Pu does not have an active diagenetic chemistry and is not significantly mobile in these coastal sediments. (author)

  2. Update of JAEA-TDB. Additional selection of thermodynamic data for solid and gaseous phases on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, update of thermodynamic data on iodine, and some modifications

    International Nuclear Information System (INIS)

    We additionally selected thermodynamic data for solid and gaseous phases of nickel, selenium, zirconium, technetium, thorium, uranium, neptunium, plutonium and americium to our thermodynamic database JAEA-TDB for geological disposal of radioactive waste of high-level and TRU wastes. We thermodynamically obtained equilibrium constant from addition and subtraction of Gibbs free energy of formation on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, which were selected in the Thermochemical Database Project by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development. Furthermore, we collected and updated thermodynamic data on iodine, changed master species of technetium(IV), and added thermodynamic data on selenium due to improving reliability of the thermodynamic database. We prepared text files of the updated thermodynamic database (JAEA-TDB) for geochemical calculation programs of PHREEQC, EQ3/6 and Geochemist's Workbench. These text files are contained in the attached CD-ROM and will be available on our Website (http://migrationdb.jaea.go.jp/). (author)

  3. Impact of the cation distribution homogeneity on the americium oxidation state in the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide

    Energy Technology Data Exchange (ETDEWEB)

    Vauchy, Romain [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Robisson, Anne-Charlotte, E-mail: anne-charlotte.robisson@cea.fr [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Scheinost, Andreas C. [Helmholtz Zentrum Dresden-Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 510119, 01314 Dresden, Germany and Rossendorf Beamline at ESRF, BP 220, F-38043 Grenoble (France); Hodaj, Fiqiri [Science et Ingénierie des Matériaux et Procédés (SIMaP, associé au CNRS UMR 5266 – UJF/INP-Grenoble), Domaine Universitaire, 1130 rue de la piscine, BP 75, 38402 Saint Martin d’Hères (France)

    2015-01-15

    The impact of the cation distribution homogeneity of the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium–plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β{sup −} decay of {sup 241}Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U–Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  4. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide

    Science.gov (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri

    2015-01-01

    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  5. 17 CFR 240.10b5-1 - Trading “on the basis of” material nonpublic information in insider trading cases.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Trading âon the basis ofâ material nonpublic information in insider trading cases. 240.10b5-1 Section 240.10b5-1 Commodity and... Deceptive Devices and Contrivances § 240.10b5-1 Trading “on the basis of” material nonpublic information...

  6. Precision of gamma-ray measurements of the effective specific power and effective {sup 240}Pu fraction of plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Sampson, T.E.

    1992-05-01

    This paper uses gamma-ray spectrometry data from replicate measurements on 40 plutonium-bearing samples to examine the repeatability of the effective {sup 240}Pu fraction ({sup 240}Pu{sub eff}) and the effective specific power (P{sub eff}) calculated from the isotopic distribution analyzed with gamma-ray spectrometry codes. The measurements were used to identify the error component arising from repeatability in the determination of the isotopic composition of plutonium in the sample and the contribution of the error component to the uncertainty in total plutonium mass measurements from neutron coincidence counting ({sup 240}Pu{sub eff}) and calorimetry (P{sub eff}). The 40 samples had {sup 240}Pu{sub eff} percentages ranging from 2 to 39% and P{sub eff} values ranging from 2 to 16 mW/g Pu. Four different gamma-ray spectrometry codes (FRAM, MGA, Blue Box, and PUJRC) were used to analyze the data (not all samples were analyzed with each code). All analyses showed that the % relative standard deviation of P{sub eff} was smaller than that of {sup 240}Pu{sub eff}. This result coupled with a cursory examination of uncertainties in coincidence counting of well-characterized samples and water-bath calorimetry errors for the same types of samples lead to the conclusion that smaller uncertainties will be present in the total plutonium mass determined by the combination of calorimetry/gamma-ray spectrometry than in the mass determined by coincidence counting/gamma-ray spectrometry. An additional examination of the biases arising from the {sup 240}Pu correlation used in the gamma-ray spectrometry codes also supported this conclusion. 17 refs.

  7. Measurement of the 240,242Pu Neutron-induced Fission Cross Sections

    Science.gov (United States)

    Salvador-Castiñeira, P.; Bevilacqua, R.; Bryś, T.; Hambsch, F.-J.; Oberstedt, S.; Pretel, C.; Vidali, M.

    The neutron-induced fission cross section of 240,242Pu has been measured at the Van de Graaff facility of the Institute for Reference Materials and Measurements (JRC-IRMM). A Twin-Frisch Grid Ionization Chamber (TFGIC) has been used in a back-to-back geometry with the secondary standards 237Np and 238U to normalize the cross section. The energy range measured is from 0.2 keV up to 3 MeV. Preliminary results show some discrepancies around 1 MeV for the 242Pu with the ENDF/B-VII.1 evaluation. The spontaneous fission half-life has been measured for both isotopes, too. Preliminary results show reasonable agreement with the recommended values.

  8. Wolf River at Memphis, Tennessee: floodflow characteristics along proposed Interstate Highway 240, Shelby County

    Science.gov (United States)

    Randolph, William J.; Gamble, Charles R.

    1973-01-01

    This report has been prepared by the U.S. Geological Survey at the request of Mr. Henry Derthick, Engineer of Structures of the Tennessee Department of Transportation, under the authority of a cooperative agreement between the two agencies. It supplements information contained in a report with the same title dated September 1966. The Department of Transportation proposes to construct a segment of Interstate Highway 240 and several bridges across the Wolf River on the northern side off Memphis, Shelby Count. Mt. Derthick has requested an analysis of the 50-year flood or the maximum flood of record to determine the possible effect of the proposed construction on flood profiles along the Wolf River.

  9. 238Pu and 239+240Pu activities in lower Rhone valley in cultivated soils

    International Nuclear Information System (INIS)

    Measured 238Pu and 239+240Pu activities in French soils can be explained by the fallout from atmospheric nuclear tests and the disintegration of a US nuclear reactor satellite in 1964. However, some soil samples from the lower Rhone valley show higher mass activities, due to the Marcoule nuclear fuel reprocessing plant discharges. Soil samples from the Camargue, flooded in 1993 and 1994, where Rhone River sediments have been deposited, contain Pu from liquid effluents released by the nuclear plant. Seven samples taken near the nuclear facility show a direct influence by its atmospheric releases. Samples from soils irrigated with Rhone River water for 30 years do not show any activity significantly higher than regional means. (authors)

  10. Wide – Ranging Influence of Mischmetal on Properties of GP240GH Cast Steel

    Directory of Open Access Journals (Sweden)

    J. Kasińska

    2012-12-01

    Full Text Available This paper presents influence of rare earth metals (REM on the properties of GP240GH cast carbon steel. The research has beenperformed on successive industrial melts. Each time ca 2000 kg of liquid metal was modified. The rare earth metals were put into the ladle during tapping of heat melt from the furnace. Because of this the amount of sulphur in the cast steel was decreased and the non-metallic inclusion morphology was significantly changed. It was found that non metallic inclusions the cracking mechanism of Charpy specimens and the impact strength were all changed. The following properties were tested: mechanical properties (y, UTS, plastic properties (necking, elongation and impact strength (SCI. In the three-point bend test the KJC stress intensity factor was evaluated.

  11. Measurement of the neutron-induced fission cross-section of 240,242Pu

    International Nuclear Information System (INIS)

    Fast spectrum neutron-induced fission cross-section data for transuranic isotopes are in high demand in the nuclear data community. In particular, highly accurate data are needed for the new Generation-IV nuclear applications. The aim is to obtain precise neutron-induced fission cross-sections for 240Pu and 242Pu. In this context accurate data on spontaneous fission half-lives have also been measured. To minimise the total uncertainty on the fission cross-sections the detector efficiency has been studied in detail. Both isotopes have been measured using a twin Frisch-grid ionisation chamber (TFGIC) due to its superiority compared to other detector systems in view of radiation hardness, 2 x 2π solid angle coverage and very good energy resolution. (authors)

  12. Induced Fission of 240Pu within a Real-Time Microscopic Framework

    Science.gov (United States)

    Bulgac, Aurel; Magierski, Piotr; Roche, Kenneth J.; Stetcu, Ionel

    2016-03-01

    We describe the fissioning dynamics of 240Pu from a configuration in the proximity of the outer fission barrier to full scission and the formation of the fragments within an implementation of density functional theory extended to superfluid systems and real-time dynamics. The fission fragments emerge with properties similar to those determined experimentally, while the fission dynamics appears to be quite complex, with many excited shape and pairing modes. The evolution is found to be much slower than previously expected, and the ultimate role of the collective inertia is found to be negligible in this fully nonadiabatic treatment of nuclear dynamics, where all collective degrees of freedom (CDOF) are included (unlike adiabatic treatments with a small number of CDOF).

  13. 320×240 Pixels CMOS Digital Image Sensor with Wide Dynamic Range

    Institute of Scientific and Technical Information of China (English)

    FANG Jie; WANG Jing-guang; HONG Zhi-liang

    2004-01-01

    A 320×240 CMOS image sensor is demonstrated,which is implemented by a standard 0.6 μm 2P2M CMOS process.For reducing the chip area,each 2×2-pixel block shares a sample/hold circuit,analog-to-digital converter and 1-b memory.The 2×2 pixel pitch has an area of 40 μm×40 μm and the fill factor is about 16%.While operating at a low frame rate,the sensor dissipates a very low power by power-management circuit making pixel-level comparators in an idle state.A digital correlated double sampling,which eliminates fixed pattern noise,improves SNR of the sensor, and multiple sampling operations make the sensor have a wide dynamic range.

  14. Induced Fission of $^{240}$Plutonium within a Real-Time Microscopic Framework}

    CERN Document Server

    Bulgac, Aurel; Roche, Kenneth J; Stetcu, Ionel

    2015-01-01

    We describe the fissioning dynamics of $^{240}$Pu from a configuration in the proximity of the outer fission barrier to full scission and the formation of the fragments within an implementation of the Density Functional Theory (DFT) extended to superfluid systems and real-time dynamics. We predict the total kinetic energy released, the average proton and neutron numbers, and the excitation energies of the fission fragments. The fission fragments emerge with properties similar to those determined experimentally, while the fission dynamics appears to be quite complex, with various shape and pairing modes being excited during the evolution. The time scales of the evolution are found to be much slower than previously expected and the role of the collective inertia in the dynamics is found to be negligible.

  15. 320x240 GaAs pixel detectors with improved X-ray imaging quality

    Energy Technology Data Exchange (ETDEWEB)

    Irsigler, R.; Andersson, J.; Alverbro, J.; Fakoor-Biniaz, Z.; Froejdh, C.; Helander, P.; Martijn, H.; Meikle, D.; Oestlund, M.; O' Shea, V.; Smith, K

    2001-03-11

    We report on gain and offset corrections for GaAs X-ray pixel detectors, which were hybridised to silicon CMOS readout integrated circuits (ROICs). The whole detector array contains 320x240 square-shaped pixels with a pitch of 38 {mu}m. The GaAs pixel detectors are based on semi-insulating and VPE grown substrates. The ROIC operates in the charge integration mode and provides snapshot as well as real time video images. Previously we have reported that the image quality of semi-insulating GaAs pixel detectors suffer from local variations in X-ray sensitivity. We have now developed a method to compensate for the sensitivity variations by applying suitable offset and gain corrections. The improvement in image quality is demonstrated in the measured signal-to-noise ratio of flood exposure images.

  16. 320x240 GaAs pixel detectors with improved X-ray imaging quality

    International Nuclear Information System (INIS)

    We report on gain and offset corrections for GaAs X-ray pixel detectors, which were hybridised to silicon CMOS readout integrated circuits (ROICs). The whole detector array contains 320x240 square-shaped pixels with a pitch of 38 μm. The GaAs pixel detectors are based on semi-insulating and VPE grown substrates. The ROIC operates in the charge integration mode and provides snapshot as well as real time video images. Previously we have reported that the image quality of semi-insulating GaAs pixel detectors suffer from local variations in X-ray sensitivity. We have now developed a method to compensate for the sensitivity variations by applying suitable offset and gain corrections. The improvement in image quality is demonstrated in the measured signal-to-noise ratio of flood exposure images

  17. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  18. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  19. Assesment of Plutonium 238 and Plutonium 239+240 in soils of different agricultural regions of Guatemala

    International Nuclear Information System (INIS)

    In this report an assesment and measurement of PLUTONIUM 238, PLUTONIUM 239, and PLUTONIUM 240 are made. Samples of cultivated soils in 15 provinces of Guatemala were taken. To separate plutonium isotopes a radiochemical method was made using extraction, precipitation and ionic interchange. By electrodeposition the plutonium was measured using an alpha spectroscopy by PIPS method. The radioactivity ranges from 2.84 mBq/Kg to 36.38 mBq/Kg for plutonium 238, and 8.46 mBq/Kg to 26.61 mBq/Kg for plutonium 239+240

  20. High-power subpicosecond harmonically mode-locked Yb:YAG laser with pulse repetition rate up to 240 GHz

    International Nuclear Information System (INIS)

    We report on the operation of a high-power diode-pumped Yb:YAG self-mode-locked microchip laser with a pulse repetition rate of up to 240 GHz. The gain medium is coated to form a cavity mirror and to act as an etalon for achieving harmonic mode locking. A diamond heat spreader is employed to reduce the thermal effects for power scale-up. At an absorbed pump power of 8.3 W, an average output power of 4.6 W is achieved with a pulse duration of 630 fs and a repetition rate of 240 GHz. (letter)