WorldWideScience

Sample records for alpha gene family

  1. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  2. Thy-1 attenuates TNF-alpha-activated gene expression in mouse embryonic fibroblasts via Src family kinase.

    Directory of Open Access Journals (Sweden)

    Bin Shan

    Full Text Available Heterogeneous surface expression of Thy-1 in fibroblasts modulates inflammation and may thereby modulate injury and repair. As a paradigm, patients with idiopathic pulmonary fibrosis, a disease with pathologic features of chronic inflammation, demonstrate an absence of Thy-1 immunoreactivity within areas of fibrotic activity (fibroblast foci in contrast to the predominant Thy-1 expressing fibroblasts in the normal lung. Likewise, Thy-1 deficient mice display more severe lung fibrosis in response to an inflammatory injury than wildtype littermates. We investigated the role of Thy-1 in the response of fibroblasts to the pro-inflammatory cytokine TNF-alpha. Our study demonstrates distinct profiles of TNF-alpha-activated gene expression in Thy-1 positive (Thy-1+ and negative (Thy-1- subsets of mouse embryonic fibroblasts (MEF. TNF-alpha induced a robust activation of MMP-9, ICAM-1, and the IL-8 promoter driven reporter in Thy-1- MEFs, in contrast to only a modest increase in Thy-1+ counterparts. Consistently, ectopic expression of Thy-1 in Thy-1- MEFs significantly attenuated TNF-alpha-activated gene expression. Mechanistically, TNF-alpha activated Src family kinase (SFK only in Thy-1- MEFs. Blockade of SFK activation abrogated TNF-alpha-activated gene expression in Thy-1- MEFs, whereas restoration of SFK activation rescued the TNF-alpha response in Thy-1+ MEFs. Our findings suggest that Thy-1 down-regulates TNF-alpha-activated gene expression via interfering with SFK- and NF-kappaB-mediated transactivation. The current study provides a novel mechanistic insight to the distinct roles of fibroblast Thy-1 subsets in inflammation.

  3. Genomic organization of the rat alpha 2u-globulin gene cluster.

    Science.gov (United States)

    McFadyen, D A; Addison, W; Locke, J

    1999-05-01

    The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.

  4. Karyopherin alpha7 (KPNA7), a divergent member of the importin alpha family of nuclear import receptors.

    Science.gov (United States)

    Kelley, Joshua B; Talley, Ashley M; Spencer, Adam; Gioeli, Daniel; Paschal, Bryce M

    2010-08-11

    Classical nuclear localization signal (NLS) dependent nuclear import is carried out by a heterodimer of importin alpha and importin beta. NLS cargo is recognized by importin alpha, which is bound by importin beta. Importin beta mediates translocation of the complex through the central channel of the nuclear pore, and upon reaching the nucleus, RanGTP binding to importin beta triggers disassembly of the complex. To date, six importin alpha family members, encoded by separate genes, have been described in humans. We sequenced and characterized a seventh member of the importin alpha family of transport factors, karyopherin alpha 7 (KPNA7), which is most closely related to KPNA2. The domain of KPNA7 that binds Importin beta (IBB) is divergent, and shows stronger binding to importin beta than the IBB domains from of other importin alpha family members. With regard to NLS recognition, KPNA7 binds to the retinoblastoma (RB) NLS to a similar degree as KPNA2, but it fails to bind the SV40-NLS and the human nucleoplasmin (NPM) NLS. KPNA7 shows a predominantly nuclear distribution under steady state conditions, which contrasts with KPNA2 which is primarily cytoplasmic. KPNA7 is a novel importin alpha family member in humans that belongs to the importin alpha2 subfamily. KPNA7 shows different subcellular localization and NLS binding characteristics compared to other members of the importin alpha family. These properties suggest that KPNA7 could be specialized for interactions with select NLS-containing proteins, potentially impacting developmental regulation.

  5. The alpha-spectrin gene is on chromosome 1 in mouse and man.

    Science.gov (United States)

    Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

    1985-06-01

    By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

  6. Developmental expression of the alpha-skeletal actin gene

    Directory of Open Access Journals (Sweden)

    Vonk Freek J

    2008-06-01

    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  7. Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

    NARCIS (Netherlands)

    Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

    1999-01-01

    The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

  8. TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

    Science.gov (United States)

    Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

    2015-01-01

    A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

  9. Raffinose family oligosaccharide utilisation by probiotic bacteria: insight into substrate recognition, molecular architecture and diversity of GH36 alpha-galactosidases

    DEFF Research Database (Denmark)

    Abou Hachem, Maher; Fredslund, Folmer; Andersen, Joakim Mark

    2012-01-01

    The organisation of genes conferring utilisation of raffinose family oligosaccharides (RFOs) has been analysed in several probiotic bacteria from the Bifidobacterium and Lactobacillus genera. Glycoside hydrolase family 36 (GH36) alpha-galatosidase encoding genes occur together with sugar transpor...

  10. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  11. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS) that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of alpha2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-alpha2,8-sialylation. We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD) and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic activities, in both invertebrates and vertebrates. The

  12. Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

    OpenAIRE

    Liebhaber, S A; Cash, F E; Main, D M

    1985-01-01

    alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

  13. A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

    Science.gov (United States)

    Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

    1986-02-01

    A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

  14. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  15. The G209A mutation in the alpha-synuclein gene in Brazilian families with Parkinson's disease Mutação G209A no gene da alfa-sinucleína em famílias brasileiras com doença de Parkinson

    Directory of Open Access Journals (Sweden)

    Hélio A.G. Teive

    2001-09-01

    Full Text Available A missense G209A mutation of the alpha-synuclein gene was recently described in a large Contursi kindred with Parkinson's disease (PD. The objective of this study is to determine if the mutation G209A of the alpha-synuclein gene was present in 10 Brazilian families with PD. PD patients were recruited from movement disorders clinics of Brazil. A family history with two or more affected in relatives was the inclusion criterion for this study. The alpha-synuclein G209A mutation assay was made using polymerase chain reaction and the restriction enzyme Tsp45I. Ten patients from 10 unrelated families were studied. The mean age of PD onset was 42.7 years old. We did not find the G209A mutation in our 10 families with PD. Our results suggest that alpha-synuclein mutation G209A is uncommon in Brazilian PD families.Recentemente foi detectada mutação missense G209A no gene da alfa-sinucleína em uma grande família com doença de Parkinson (DP de Contursi, Itália. Este estudo tem o objetivo de determinar se a mutação G209A está presente em 10 famílias brasileiras com DP. Pacientes com DP foram recrutados em clínicas de distúrbio do movimento no Brasil. O critério de inclusão no estudo foi à presença de dois ou mais familiares acometidos pela DP. A mutação G209A do gene da alfa-sinucleína foi pesquisada usando a técnica de reação em cadeia de polimerase e a enzima de restrição Tsp45I. Foram estudados 10 pacientes de famílias não-relacionadas. A idade média do início dos sintomas da DP foi 42,7 anos. Não encontramos a mutação estudada neste grupo de pacientes. Nossos resultados sugerem que a mutação G209A é incomum em famílias brasileiras com DP.

  16. Variability and repertoire size of T-cell receptor V alpha gene segments.

    Science.gov (United States)

    Becker, D M; Pattern, P; Chien, Y; Yokota, T; Eshhar, Z; Giedlin, M; Gascoigne, N R; Goodnow, C; Wolf, R; Arai, K

    The immune system of higher organisms is composed largely of two distinct cell types, B lymphocytes and T lymphocytes, each of which is independently capable of recognizing an enormous number of distinct entities through their antigen receptors; surface immunoglobulin in the case of the former, and the T-cell receptor (TCR) in the case of the latter. In both cell types, the genes encoding the antigen receptors consist of multiple gene segments which recombine during maturation to produce many possible peptides. One striking difference between B- and T-cell recognition that has not yet been resolved by the structural data is the fact that T cells generally require a major histocompatibility determinant together with an antigen whereas, in most cases, antibodies recognize antigen alone. Recently, we and others have found that a series of TCR V beta gene sequences show conservation of many of the same residues that are conserved between heavy- and light-chain immunoglobulin V regions, and these V beta sequences are predicted to have an immunoglobulin-like secondary structure. To extend these studies, we have isolated and sequenced eight additional alpha-chain complementary cDNA clones and compared them with published sequences. Analyses of these sequences, reported here, indicate that V alpha regions have many of the characteristics of V beta gene segments but differ in that they almost always occur as cross-hybridizing gene families. We conclude that there may be very different selective pressures operating on V alpha and V beta sequences and that the V alpha repertoire may be considerably larger than that of V beta.

  17. Mapping of the mouse actin capping protein {alpha} subunit genes and pseudogenes

    Energy Technology Data Exchange (ETDEWEB)

    Hart, M.C.; Korshunova, Y.O.; Cooper, J.A. [Washington Univ. School of Medicine, St. Louis, MO (United States)

    1997-02-01

    Capping protein (CP), a heterodimer of {alpha} and {beta} subunits, is found in all eukaryotes. CP binds to the barbed ends of actin filaments in vitro and controls actin assembly and cell motility in vivo. Vertebrates have three {alpha} isoforms ({alpha}1, {alpha}2, {alpha}3) produced from different genes, whereas lower organisms have only one gene and one isoform. We isolated genomic clones corresponding to the a subunits of mouse CP and found three {alpha}1 genes, two of which are pseudogenes, and a single gene for both {alpha}2 and {alpha}3. Their chromosomal locations were identified by interspecies backcross mapping. The {alpha}1 gene (Cappa1) mapped to Chromosome 3 between D3Mit11 and D3Mit13. The {alpha}1 pseudogenes (Cappa1-ps1 and Cappa1-ps2) mapped to Chromosomes 1 and 9, respectively. The {alpha}2 gene (Cappa2) mapped to Chromosome 6 near Ptn. The {alpha}3 gene (Cappa3) also mapped to Chromosome 6, approximately 68 cM distal from Cappa2 near Kras2. One mouse mutation, de, maps in the vicinity of the {alpha}1 gene. No known mouse mutations map to regions near the {alpha}2 or {alpha}3 genes. 29 refs., 3 figs., 1 tab.

  18. Clinical differences between patients with MODY-3, MODY-2 and type 2 diabetes mellitus with I27L polymorphism in the HNF1alpha gene.

    Science.gov (United States)

    Pinés Corrales, Pedro José; López Garrido, María P; Aznar Rodríguez, Silvia; Louhibi Rubio, Lynda; López Jiménez, Luz M; Lamas Oliveira, Cristina; Alfaro Martínez, Jose J; Lozano García, Jose J; Hernández López, Antonio; Requejo Castillo, Ramón; Escribano Martínez, Julio; Botella Romero, Francisco

    2010-01-01

    The aim of our study was to describe and evaluate the clinical and metabolic characteristics of patients with MODY-3, MODY-2 or type 2 diabetes who presented I27L polymorphism in the HNF1alpha gene. The study included 31 previously diagnosed subjects under follow-up for MODY-3 (10 subjects from 5 families), MODY-2 (15 subjects from 9 families), or type 2 diabetes (6 subjects) with I27L polymorphism in the HNF1alpha gene. The demographic, clinical, metabolic, and genetic characteristics of all patients were analyzed. No differences were observed in distribution according to sex, age of onset, or form of diagnosis. All patients with MODY-2 or MODY-3 had a family history of diabetes. In contrast, 33.3% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene had no family history of diabetes (p MODY-3 patients, but not required by 100% of MODY-2 patients or 16.7% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene (p MODY-2, MODY-3 or type 2 diabetes of atypical characteristics, in this case patients who present I27L polymorphism in the HNF1alpha gene. Copyright 2010 Sociedad Española de Endocrinología y Nutrición. Published by Elsevier Espana. All rights reserved.

  19. A missense mutation in the alpha-actinin 1 gene (ACTN1 is the cause of autosomal dominant macrothrombocytopenia in a large French family.

    Directory of Open Access Journals (Sweden)

    Paul Guéguen

    Full Text Available Inherited thrombocytopenia is a heterogeneous group of disorders characterized by a reduced number of blood platelets. Despite the identification of nearly 20 causative genes in the past decade, approximately half of all subjects with inherited thrombocytopenia still remain unexplained in terms of the underlying pathogenic mechanisms. Here we report a six-generation French pedigree with an autosomal dominant mode of inheritance and the identification of its genetic basis. Of the 55 subjects available for analysis, 26 were diagnosed with isolated macrothrombocytopenia. Genome-wide linkage analysis mapped a 10.9 Mb locus to chromosome 14 (14q22 with a LOD score of 7.6. Candidate gene analysis complemented by targeted next-generation sequencing identified a missense mutation (c.137GA; p.Arg46Gln in the alpha-actinin 1 gene (ACTN1 that segregated with macrothrombocytopenia in this large pedigree. The missense mutation occurred within actin-binding domain of alpha-actinin 1, a functionally critical domain that crosslinks actin filaments into bundles. The evaluation of cultured mutation-harboring megakaryocytes by electron microscopy and the immunofluorescence examination of transfected COS-7 cells suggested that the mutation causes disorganization of the cellular cytoplasm. Our study concurred with a recently published whole-exome sequence analysis of six small Japanese families with congenital macrothrombocytopenia, adding ACTN1 to the growing list of thrombocytopenia genes.

  20. Tumor necrosis factor-alpha-independent downregulation of hepatic cholesterol 7alpha-hydroxylase gene in mice treated with lead nitrate.

    Science.gov (United States)

    Kojima, Misaki; Sekikawa, Kenji; Nemoto, Kiyomitsu; Degawa, Masakuni

    2005-10-01

    We previously reported that lead nitrate (LN), an inducer of hepatic tumor necrosis factor-alpha (TNF-alpha), downregulated gene expression of cholesterol 7alpha-hydroxylase. Herein, to clarify the role of TNF-alpha in LN-induced downregulation of cholesterol 7alpha-hydroxylase, effects of LN on gene expression of hepatic cholesterol 7alpha-hydroxylase (Cyp7a1) in TNF-alpha-knockout (KO) and TNF-alpha-wild-type (WT) mice were comparatively examined. Gene expression of hepatic Cyp7a1 in both WT and KO mice decreased to less than 5% of the corresponding controls at 6-12 h after treatment with LN (100 mumol/kg body weight, iv). Levels of hepatic TNF-alpha protein in either WT or KO mice were below the detection limit, although expression levels of the TNF-alpha gene markedly increased at 6 h in WT mice by LN treatment, but not in KO mice. In contrast, in both WT and KO mice, levels of hepatic IL-1beta protein, which is known to be a suppressor of the cholesterol 7alpha-hydroxylase gene in hamsters, were significantly increased 3-6 h after LN treatment. Furthermore, LN-induced downregulation of the Cyp7a1 gene did not necessarily result from altered gene expression of hepatic transcription factors, including positive regulators (liver X receptor alpha, retinoid X receptor alpha, fetoprotein transcription factor, and hepatocyte nuclear factor 4alpha) and a negative regulator small heterodimer partner responsible for expression of the Cyp7a1 gene. The present findings indicated that LN-induced downregulation of the Cyp7a1 gene in mice did not necessarily occur through a TNF-alpha-dependent pathway and might occur mainly through an IL-1beta-dependent pathway.

  1. Identification of the human ApoAV gene as a novel ROR{alpha} target gene

    Energy Technology Data Exchange (ETDEWEB)

    Lind, Ulrika [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); Nilsson, Tina [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); McPheat, Jane [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); Stroemstedt, Per-Erik [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); Bamberg, Krister [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); Balendran, Clare [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden); Kang, Daiwu [Department of Molecular Pharmacology, AstraZeneca R and D Moelndal (Sweden)

    2005-04-29

    Retinoic acid receptor-related orphan receptor-{alpha} (ROR{alpha}) (NR1F1) is an orphan nuclear receptor with a potential role in metabolism. Previous studies have shown that ROR{alpha} regulates transcription of the murine Apolipoprotein AI gene and human Apolipoprotein CIII genes. In the present study, we present evidence that ROR{alpha} also induces transcription of the human Apolipoprotein AV gene, a recently identified apolipoprotein associated with triglyceride levels. Adenovirus-mediated overexpression of ROR{alpha} increased the endogenous expression of ApoAV in HepG2 cells and ROR{alpha} also enhanced the activity of an ApoAV promoter construct in transiently transfected HepG2 cells. Deletion and mutation studies identified three AGGTCA motifs in the ApoAV promoter that mediate ROR{alpha} transactivation, one of which overlaps with a previously identified binding site for PPAR{alpha}. Together, these results suggest a novel mechanism whereby ROR{alpha} modulates lipid metabolism and implies ROR{alpha} as a potential target for the treatment of dyslipidemia and atherosclerosis.

  2. The structure of the human interferon alpha/beta receptor gene.

    Science.gov (United States)

    Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

    1992-02-05

    Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

  3. Diverse functional consequences of mutations in the Na+/K+-ATPase alpha2-subunit causing familial hemiplegic migraine type 2.

    NARCIS (Netherlands)

    Tavraz, N.N.; Friedrich, T.; Durr, K.L.; Koenderink, J.B.; Bamberg, E.; Freilinger, T.; Dichgans, M.

    2008-01-01

    Mutations in ATP1A2, the gene coding for the Na(+)/K(+)-ATPase alpha(2)-subunit, are associated with both familial hemiplegic migraine and sporadic cases of hemiplegic migraine. In this study, we examined the functional properties of 11 ATP1A2 mutations associated with familial or sporadic

  4. A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

    NARCIS (Netherlands)

    Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

    2010-01-01

    Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

  5. Mapping of HNF4alpha target genes in intestinal epithelial cells

    DEFF Research Database (Denmark)

    Boyd, Mette; Bressendorff, Simon; Moller, Jette

    2009-01-01

    ABSTRACT: BACKGROUND: The role of HNF4alpha has been extensively studied in hepatocytes and pancreatic beta-cells, and HNF4alpha is also regarded as key regulator of intestinal epithelial cell differentiation as well. The aim of the present work is to identify novel HNF4alpha target genes....... The HNF4alpha ChIP-chip data was matched with gene expression and histone H3 acetylation status of the promoters in order to identify HNF4alpha binding to actively transcribed genes with an open chromatin structure. RESULTS: 1,541 genes were identified as potential HNF4alpha targets, many of which have...

  6. A Swedish family with de novo alpha-synuclein A53T mutation: evidence for early cortical dysfunction

    DEFF Research Database (Denmark)

    Puschmann, Andreas; Ross, Owen A; Vilariño-Güell, Carles

    2009-01-01

    A de novo alpha-synuclein A53T (p.Ala53 Th; c.209G > A) mutation has been identified in a Swedish family with autosomal dominant Parkinson's disease (PD). Two affected individuals had early-onset (before 31 and 40 years), severe levodopa-responsive PD with prominent dysphasia, dysarthria, and cog......A de novo alpha-synuclein A53T (p.Ala53 Th; c.209G > A) mutation has been identified in a Swedish family with autosomal dominant Parkinson's disease (PD). Two affected individuals had early-onset (before 31 and 40 years), severe levodopa-responsive PD with prominent dysphasia, dysarthria......) and the Greek-American Family H kindreds. One unaffected family member carried the mutation haplotype without the c.209A mutation, strongly suggesting its de novo occurrence within this family. Furthermore, a novel mutation c.488G > A (p.Arg163His; R163H) in the presenilin-2 (PSEN2) gene was detected...

  7. Analysis of T cell receptor alpha beta variability in lymphocytes infiltrating melanoma primary tumours and metastatic lesions

    DEFF Research Database (Denmark)

    Schøller, J; thor Straten, P; Jakobsen, Annette Birck

    1994-01-01

    The T cell receptor (TCR) alpha beta variable (V) gene family usage of tumour-infiltrating lymphocytes (TIL) in four different primary human malignant melanomas and their corresponding metastatic lesions was characterized using a recently developed method based on the reverse-transcription-couple......The T cell receptor (TCR) alpha beta variable (V) gene family usage of tumour-infiltrating lymphocytes (TIL) in four different primary human malignant melanomas and their corresponding metastatic lesions was characterized using a recently developed method based on the reverse...... usage of the TCR V gene families V alpha 4, V alpha 5, V alpha 22 and V beta 8, whereas the V beta 3 gene family appeared to be expressed together with HLA-A1. Other highly expressed V gene families, apparently not restricted to either HLA-A1 or -A2, were V alpha 1 (expressed in three of four primary...... tumours) and V alpha 21 (expressed in two of four tumours). We found no evidence suggesting any correlations between the haplotypes HLA-A1 and -A2 and preferential V gene family expression in the metastatic lesions, and the only common feature was V alpha 8, which was found to be highly expressed in two...

  8. The tumor necrosis factor-alpha-induced protein 8 family in immune homeostasis and inflammatory cancer diseases.

    Science.gov (United States)

    Luan, Y Y; Yao, Y M; Sheng, Z Y

    2013-01-01

    Within the immune system homeostasis is maintained by a myriad of mechanisms that include the regulation of immune cell activation and programmed cell death. The breakdown of immune homeostasis may lead to fatal inflammatory diseases. We set out to identify genes of tumor necrosis factor-alpha-induced protein 8 (TNFAIP8) family that has a functional role in the process of immune homeostasis. Tumor necrosis factor-alpha-induced protein 8 (TNFAIP8), which functions as an oncogenic molecule, is also associated with enhanced cell survival and inhibition of apoptosis. Tumor necrosis factor-alpha-induced protein 8-like 2 (TIPE2) governs immune homeostasis in both the innate and adaptive immune system and prevents hyper-responsiveness by negatively regulating signaling via T cell receptors and Toll-like receptors (TLRs). There also exist two highly homologous but uncharacterized proteins, TIPE1 and TIPE3. This review is an attempt to provide a summary of TNFAIP8 family associated with immune homeostasis and inflammatory cancer diseases.

  9. Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

    African Journals Online (AJOL)

    Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

  10. Increased expression of protein kinase A inhibitor alpha (PKI-alpha) and decreased PKA-regulated genes in chronic intermittent alcohol exposure.

    Science.gov (United States)

    Repunte-Canonigo, Vez; Lutjens, Robert; van der Stap, Lena D; Sanna, Pietro Paolo

    2007-03-23

    Intermittent models of alcohol exposure that mimic human patterns of alcohol consumption produce profound physiological and biochemical changes and induce rapid increases in alcohol self-administration. We used high-density oligonucleotide microarrays to investigate gene expression changes during chronic intermittent alcohol exposure in three brain regions that receive mesocorticolimbic dopaminergic projections and that are believed to be involved in alcohol's reinforcing actions: the medial prefrontal cortex, the nucleus accumbens and the amygdala. An independent replication of the experiment was used for RT-PCR validation of the microarray results. The protein kinase A inhibitor alpha (PKI-alpha, Pkia), a member of the endogenous PKI family implicated in reducing nuclear PKA activity, was found to be increased in all three regions tested. Conversely, we observed a downregulation of the expression of several PKA-regulated transcripts in one or more of the brain regions studied, including the activity and neurotransmitter-regulated early gene (Ania) - 1, -3, -7, -8, the transcription factors Egr1 and NGFI-B (Nr4a1) and the neuropeptide NPY. Reduced expression of PKA-regulated genes in mesocorticolimbic projection areas may have motivational significance in the rapid increase in alcohol self-administration induced by intermittent alcohol exposure.

  11. Liver alpha-amylase gene expression as an early obesity biomarker.

    Science.gov (United States)

    Mojbafan, Marzieh; Afsartala, Zohreh; Amoli, Mahsa M; Mahmoudi, Mahdi; Yaghmaei, Parichehreh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2017-04-01

    Obesity is a major health problem worldwide, for which preventive and therapeutic means are still needed. Alpha-amylase is a digestive enzyme whose inhibition has been targeted as a potential anti-obesity strategy. However, alpha-amylase gene expression has not been particularly attended to, and in contrast with pancreatic and salivary amylases, fewer studies have focused on liver alpha-amylase. The present study aimed at investigating the expression of alpha-amylase gene in obese and normal mice at RNA and protein level as well as acarbose effect on this gene expression in hepatocyte cell culture. Control and case groups were fed by normal mouse pellet and high-fat diet respectively, during 8 weeks. After this period, serum biochemical parameters including glucose, cholesterol, triglycerides, AST, ALT and alpha-amylase were assayed. Liver alpha-amylase gene was analyzed by real time PCR, and liver enzyme was assayed with Bernfeld and ELISA methods Hepatocyte cell culture derived from both group were also treated by acarbose and alpha-amylase activity and gene expression was analyzed by above mentioned methods. All biochemical factors showed an increase in obese mice, but the increase in ALT and AST were not statistically significant. Alpha-amylase levels were also increased in obese mice, both at RNA and protein level, while a decrease was seen in obese mice derived hepatocytes after acarbose treatment. Elevated liver alpha-amylase levels may be indicative of initial stages of obesity and the use of acarbose could be considered as a treatment of obesity which could be potentially effective at multiple levels. Copyright © 2016. Published by Elsevier Urban & Partner Sp. z o.o.

  12. Evidence that steroid 5alpha-reductase isozyme genes are differentially methylated in human lymphocytes.

    Science.gov (United States)

    Rodríguez-Dorantes, M; Lizano-Soberón, M; Camacho-Arroyo, I; Calzada-León, R; Morimoto, S; Téllez-Ascencio, N; Cerbón, M A

    2002-03-01

    The synthesis of dihydrotestosterone (DHT) is catalyzed by steroid 5alpha-reductase isozymes 1 and 2, and this function determines the development of the male phenotype during embriogenesis and the growth of androgen sensitive tissues during puberty. The aim of this study was to determine the cytosine methylation status of 5alpha-reductase isozymes types 1 and 2 genes in normal and in 5alpha-reductase deficient men. Genomic DNA was obtained from lymphocytes of both normal subjects and patients with primary 5alpha-reductase deficiency due to point mutations in 5alpha-reductase 2 gene. Southern blot analysis of 5alpha-reductase types 1 and 2 genes from DNA samples digested with HpaII presented a different cytosine methylation pattern compared to that observed with its isoschizomer MspI, indicating that both genes are methylated in CCGG sequences. The analysis of 5alpha-reductase 1 gene from DNA samples digested with Sau3AI and its isoschizomer MboI which recognize methylation in GATC sequences showed an identical methylation pattern. In contrast, 5alpha-reductase 2 gene digested with Sau3AI presented a different methylation pattern to that of the samples digested with MboI, indicating that steroid 5alpha-reductase 2 gene possess methylated cytosines in GATC sequences. Analysis of exon 4 of 5alpha-reductase 2 gene after metabisulfite PCR showed that normal and deficient subjects present a different methylation pattern, being more methylated in patients with 5alpha-reductase 2 mutated gene. The overall results suggest that 5alpha-reductase genes 1 and 2 are differentially methylated in lymphocytes from normal and 5alpha-reductase deficient patients. Moreover, the extensive cytosine methylation pattern observed in exon 4 of 5alpha-reductase 2 gene in deficient patients, points out to an increased rate of mutations in this gene.

  13. Co-ordinate transcriptional regulation of dopamine synthesis genes by alpha-synuclein in human neuroblastoma cell lines.

    Science.gov (United States)

    Baptista, Melisa J; O'Farrell, Casey; Daya, Sneha; Ahmad, Rili; Miller, David W; Hardy, John; Farrer, Matthew J; Cookson, Mark R

    2003-05-01

    Abnormal accumulation of alpha-synuclein in Lewy bodies is a neuropathological hallmark of both sporadic and familial Parkinson's disease (PD). Although mutations in alpha-synuclein have been identified in autosomal dominant PD, the mechanism by which dopaminergic cell death occurs remains unknown. We investigated transcriptional changes in neuroblastoma cell lines transfected with either normal or mutant (A30P or A53T) alpha-synuclein using microarrays, with confirmation of selected genes by quantitative RT-PCR. Gene products whose expression was found to be significantly altered included members of diverse functional groups such as stress response, transcription regulators, apoptosis-inducing molecules, transcription factors and membrane-bound proteins. We also found evidence of altered expression of dihydropteridine reductase, which indirectly regulates the synthesis of dopamine. Because of the importance of dopamine in PD, we investigated the expression of all the known genes in dopamine synthesis. We found co-ordinated downregulation of mRNA for GTP cyclohydrolase, sepiapterin reductase (SR), tyrosine hydroxylase (TH) and aromatic acid decarboxylase by wild-type but not mutant alpha-synuclein. These were confirmed at the protein level for SR and TH. Reduced expression of the orphan nuclear receptor Nurr1 was also noted, suggesting that the co-ordinate regulation of dopamine synthesis is regulated through this transcription factor.

  14. Potential late-onset Alzheimer's disease-associated mutations in the ADAM10 gene attenuate {alpha}-secretase activity.

    Science.gov (United States)

    Kim, Minji; Suh, Jaehong; Romano, Donna; Truong, Mimy H; Mullin, Kristina; Hooli, Basavaraj; Norton, David; Tesco, Giuseppina; Elliott, Kathy; Wagner, Steven L; Moir, Robert D; Becker, K David; Tanzi, Rudolph E

    2009-10-15

    ADAM10, a member of a disintegrin and metalloprotease family, is an alpha-secretase capable of anti-amyloidogenic proteolysis of the amyloid precursor protein. Here, we present evidence for genetic association of ADAM10 with Alzheimer's disease (AD) as well as two rare potentially disease-associated non-synonymous mutations, Q170H and R181G, in the ADAM10 prodomain. These mutations were found in 11 of 16 affected individuals (average onset age 69.5 years) from seven late-onset AD families. Each mutation was also found in one unaffected subject implying incomplete penetrance. Functionally, both mutations significantly attenuated alpha-secretase activity of ADAM10 (>70% decrease), and elevated Abeta levels (1.5-3.5-fold) in cell-based studies. In summary, we provide the first evidence of ADAM10 as a candidate AD susceptibility gene, and report two potentially pathogenic mutations with incomplete penetrance for late-onset familial AD.

  15. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  16. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  17. Identification of potential target genes of ROR-alpha in THP1 and HUVEC cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Gulec, Cagri, E-mail: cagri.gulec@gmail.com; Coban, Neslihan, E-mail: neslic@istanbul.edu.tr; Ozsait-Selcuk, Bilge, E-mail: ozsaitb@istanbul.edu.tr; Sirma-Ekmekci, Sema, E-mail: semasirma@gmail.com; Yildirim, Ozlem, E-mail: ozlm-yildirim@hotmail.com; Erginel-Unaltuna, Nihan, E-mail: nihanerginel@yahoo.com

    2017-04-01

    ROR-alpha is a nuclear receptor, activity of which can be modulated by natural or synthetic ligands. Due to its possible involvement in, and potential therapeutic target for atherosclerosis, we aimed to identify ROR-alpha target genes in monocytic and endothelial cell lines. We performed chromatin immunoprecipitation (ChIP) followed by tiling array (ChIP-on-chip) for ROR-alpha in monocytic cell line THP1 and endothelial cell line HUVEC. Following bioinformatic analysis of the array data, we tested four candidate genes in terms of dependence of their expression level on ligand-mediated ROR-alpha activity, and two of them in terms of promoter occupancy by ROR-alpha. Bioinformatic analyses of ChIP-on-chip data suggested that ROR-alpha binds to genomic regions near the transcription start site (TSS) of more than 3000 genes in THP1 and HUVEC. Potential ROR-alpha target genes in both cell types seem to be involved mainly in membrane receptor activity, signal transduction and ion transport. While SPP1 and IKBKA were shown to be direct target genes of ROR-alpha in THP1 monocytes, inflammation related gene HMOX1 and heat shock protein gene HSPA8 were shown to be potential target genes of ROR-alpha. Our results suggest that ROR-alpha may regulate signaling receptor activity, and transmembrane transport activity through its potential target genes. ROR-alpha seems also to play role in cellular sensitivity to environmental substances like arsenite and chloroprene. Although, the expression analyses have shown that synthetic ROR-alpha ligands can modulate some of potential ROR-alpha target genes, functional significance of ligand-dependent modulation of gene expression needs to be confirmed with further analyses.

  18. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  19. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  20. Amylosucrase, a glucan-synthesizing enzyme from the alpha-amylase family

    DEFF Research Database (Denmark)

    Skov, L K; Mirza, Osman Asghar; Henriksen, A

    2001-01-01

    Amylosucrase (E.C. 2.4.1.4) is a member of Family 13 of the glycoside hydrolases (the alpha-amylases), although its biological function is the synthesis of amylose-like polymers from sucrose. The structure of amylosucrase from Neisseria polysaccharea is divided into five domains: an all helical N...... of amylosucrase is at the bottom of a pocket at the molecular surface. A substrate binding site resembling the amylase 2 subsite is not found in amylosucrase. The site is blocked by a salt bridge between residues in the second and eight loops of the (beta/alpha)(8)-barrel. The result is an exo-acting enzyme. Loop......-terminal domain that is not similar to any known fold, a (beta/alpha)(8)-barrel A-domain, B- and B'-domains displaying alpha/beta-structure, and a C-terminal eight-stranded beta-sheet domain. In contrast to other Family 13 hydrolases that have the active site in the bottom of a large cleft, the active site...

  1. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  2. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    Energy Technology Data Exchange (ETDEWEB)

    Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  3. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  4. DNA-binding site of major regulatory protein alpha 4 specifically associated with promoter-regulatory domains of alpha genes of herpes simplex virus type 1.

    OpenAIRE

    Kristie, T M; Roizman, B

    1986-01-01

    Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...

  5. Lack of co-ordinate expression of the alpha1(I) and alpha1(III) procollagen genes in fibroblast clonal cultures.

    Science.gov (United States)

    Yamaguchi, Y; Crane, S; Zhou, L; Ochoa, S M; Falanga, V

    2000-12-01

    Several extracellular matrix genes, most notably alpha1(I) and alpha1(III) procollagen, are reported to be co-ordinately expressed in cultures of dermal fibroblasts. However, it remains unclear whether the expression of these genes is truly co-ordinate or whether it may be the result of averaging the phenotypic expression of different fibroblast subpopulations present within each culture. Objectives To determine by Northern analysis the correlation between alpha1(I) and alpha1(III) procollagen mRNA levels in clonal populations of human dermal fibroblasts. As previously described, clonal cultures were derived from parent strains of human dermal fibroblasts by a microscopically controlled dilution technique and by stimulation of single cells with low oxygen tension in the early phases of clonal growth. In agreement with previous reports, we found that baseline steady-state levels of alpha1(I) procollagen mRNA were co-ordinately regulated with the alpha1(III) procollagen mRNA in 26 parent strains (r = 0. 9003; P ordinate regulation observed in non-clonal cultures, suggesting that these two genes operate under different sets of regulatory controls. This clonal heterogeneity may provide additional flexibility to the process of tissue repair and fibroblast clonal expansion.

  6. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha

    DEFF Research Database (Denmark)

    Hwang, C S; Mandrup, S; MacDougald, O A

    1996-01-01

    Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...

  7. Phylogenetic characterization of the ubiquitous electron transfer flavoprotein families ETF-alpha and ETF-beta.

    Science.gov (United States)

    Tsai, M H; Saier, M H

    1995-06-01

    Electron transfer flavoproteins (ETF) are alpha beta-heterodimers found in eukaryotic mitochondria and bacteria. We have identified currently sequenced protein members of the ETF-alpha and ETF-beta families. Members of these two families include (a) the ETF subunits of mammals and bacteria, (b) homologous pairs of proteins (FixB/FixA) that are essential for nitrogen fixation in some bacteria, and (c) a pair of carnitine-inducible proteins encoded by two open reading frames in Escherichia coli (YaaQ and YaaR). These three groups of proteins comprise three clusters on both the ETF-alpha and ETF-beta phylogenetic trees, separated from each other by comparable phylogenetic distances. This fact suggests that these two protein families evolved with similar overall rates of evolutionary divergence. Relative regions of sequence conservation are evaluated, and signature sequences for both families are derived.

  8. Production of enzymatically active recombinant full-length barley high pI alpha-glucosidase of glycoside family 31 by high cell-density fermentation of Pichia pastoris and affinity purification

    DEFF Research Database (Denmark)

    Næsted, Henrik; Kramhøft, Birte; Lok, F.

    2006-01-01

    Recombinant barley high pI alpha-glucosidase was produced by high cell-density fermentation of Pichia pastoris expressing the cloned full-length gene. The gene was amplified from a genomic clone and exons (coding regions) were assembled by overlap PCR. The resulting cDNA was expressed under contr...... nM x s(-1), and 85 s(-1) using maltose as substrate. This work presents the first production of fully active recombinant alpha-glucosidase of glycoside hydrolase family 31 from higher plants. (c) 2005 Elsevier Inc. All rights reserved....

  9. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    Science.gov (United States)

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

  10. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  11. Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

    OpenAIRE

    Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

    1987-01-01

    An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

  12. Characterization of class II alpha genes and DLA-D region allelic associations in the dog.

    Science.gov (United States)

    Sarmiento, U M; Storb, R F

    1988-10-01

    Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.

  13. Identification of distal regulatory regions in the human alpha IIb gene locus necessary for consistent, high-level megakaryocyte expression.

    Science.gov (United States)

    Thornton, Michael A; Zhang, Chunyan; Kowalska, Maria A; Poncz, Mortimer

    2002-11-15

    The alphaIIb/beta3-integrin receptor is present at high levels only in megakaryocytes and platelets. Its presence on platelets is critical for hemostasis. The tissue-specific nature of this receptor's expression is secondary to the restricted expression of alphaIIb, and studies of the alphaIIb proximal promoter have served as a model of a megakaryocyte-specific promoter. We have examined the alphaIIb gene locus for distal regulatory elements. Sequence comparison between the human (h) and murine (m) alphaIIb loci revealed high levels of conservation at intergenic regions both 5' and 3' to the alphaIIb gene. Additionally, deoxyribonuclease (DNase) I sensitivity mapping defined tissue-specific hypersensitive (HS) sites that coincide, in part, with these conserved regions. Transgenic mice containing various lengths of the h(alpha)IIb gene locus, which included or excluded the various conserved/HS regions, demonstrated that the proximal promoter was sufficient for tissue specificity, but that a region 2.5 to 7.1 kb upstream of the h(alpha)IIb gene was necessary for consistent expression. Another region 2.2 to 7.4 kb downstream of the gene enhanced expression 1000-fold and led to levels of h(alpha)IIb mRNA that were about 30% of the native m(alpha)IIb mRNA level. These constructs also resulted in detectable h(alpha)IIb/m(beta)3 on the platelet surface. This work not only confirms the importance of the proximal promoter of the alphaIIb gene for tissue specificity, but also characterizes the distal organization of the alphaIIb gene locus and provides an initial localization of 2 important regulatory regions needed for the expression of the alphaIIb gene at high levels during megakaryopoiesis.

  14. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  15. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    Science.gov (United States)

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

  16. Alpha-amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits alpha-amylases from the coffee berry borer pest.

    Science.gov (United States)

    Barbosa, Aulus E A D; Albuquerque, Erika V S; Silva, Maria C M; Souza, Djair S L; Oliveira-Neto, Osmundo B; Valencia, Arnubio; Rocha, Thales L; Grossi-de-Sa, Maria F

    2010-06-17

    Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an alpha-amylase inhibitor gene (alpha-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. We transformed C. arabica with the alpha-amylase inhibitor-1 gene (alpha-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the alpha-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against alpha-AI1 inhibitor showed a maximum alpha-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the alpha-AI1 protein against H. hampei alpha-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee.

  17. Tumor necrosis factor-alpha and interleukin-4 gene polymorphisms in Chinese patients with gout.

    Science.gov (United States)

    Chen, M-L; Tsai, F-J; Tsai, C-H; Huang, C-M

    2007-01-01

    The purpose of this study was to examine whether polymorphisms of interleukin-4 (IL-4) (promoter-590 and intron 3) and tumor necrosis factor-alpha (TNF-alpha) promoter-308 genes are markers of susceptibility to or clinical manifestations of gout in Taiwanese patients. The study included 196 Taiwanese patients with gout and 103 unrelated healthy control subjects living in central Taiwan. Polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha (promoter-308) genes were typed from genomic DNA. Allelic frequencies and carriage rates were then compared between gout patients and control subjects. The correlation between allelic frequencies, carriage rates and clinical manifestations of gout were evaluated. No significant differences were observed in the allelic frequencies and carriage rates of the IL-4 (promoter-590 and intron 3) and TNF-alpha gene polymorphisms between patients with gout and healthy control subjects. Furthermore, the IL-4 (promoter-590 and intron 3) and TNF-alpha genotypes were not found to be associated with the clinical and laboratory profiles in gout patients. However, there was a significant difference in the TNF-alphapolymorphism genotype between patients with and without hypertriglyceridemia (P=0.001, xi2=11.47, OR=10.3, 95%CI=3.57-29.7). The results of our study suggest that polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha promoter-308 genes are not related to gout in Chinese patients in Taiwan.

  18. Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

    OpenAIRE

    Liebhaber, S A; Kan, Y W

    1981-01-01

    The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

  19. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    Directory of Open Access Journals (Sweden)

    Maryam Rakhshandehroo

    2010-01-01

    Full Text Available The peroxisome proliferator-activated receptor alpha (PPARα is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  20. DMPD: The interferon-alpha/beta system in antiviral responses: a multimodal machineryof gene regulation by the IRF family of transcription factors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available ineryof gene regulation by the IRF family of transcription factors. Taniguchi T, Takaoka A. Curr Opin Immuno...sponses: a multimodal machineryof gene regulation by the IRF family of transcript...achineryof gene regulation by the IRF family of transcription factors. Authors Taniguchi T, Takaoka A. Publi

  1. Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.

    Science.gov (United States)

    Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu

    2018-01-20

    The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.

  2. Human CRF{sub 2} {alpha} and {beta} splice variants: pharmacological characterization using radioligand binding and a luciferase gene expression assay

    Energy Technology Data Exchange (ETDEWEB)

    Ardati, A. [Rhone-Poulenc Rorer, Cardiovascular Biology, NW4, 500 Arcola Road, Collegeville, PA (United States); Goetschy, V.; Gottowick, J.; Henriot, S.; Deuschle, U.; Kilpatrick, G.J. [Central Nervous System, Pharma Division, F. Hoffmann-La Roche AG, CH-4070 Basel (Switzerland); Valdenaire, O. [Cardiovascular Research, Pharma Division, F. Hoffmann-La Roche AG, CH-4070 Basel (Switzerland)

    1999-03-14

    Corticotropin releasing factor (CRF) receptors belong to the super-family of G protein-coupled receptors. These receptors are classified into two subtypes (CRF{sub 1} and CRF{sub 2}). Both receptors are positively coupled to adenylyl cyclase but they have a distinct pharmacology and distribution in brain. Two isoforms belonging to the CRF{sub 2} subtype receptors, CRF{sub 2{alpha}} and CRF{sub 2{beta}}, have been identified in rat and man. The neuropeptides CRF and urocortin mediate their actions through this CRF G protein-coupled receptor family. In this report, we describe the pharmacological characterization of the recently identified hCRF{sub 2{beta}} receptor. We have used radioligand binding with [{sup 125}I]-tyr{sup 0}-sauvagine and a gene expression assay in which the firefly luciferase gene expression is under the control of cAMP responsive elements. Association kinetics of [{sup 125}I]-tyr{sup 0}-sauvagine binding to the hCRF{sub 2{beta}} receptor were monophasic while dissociation kinetics were biphasic, in agreement with the kinetics results obtained with the hCRF{sub 2{alpha}} receptor. Saturation binding analysis revealed two affinity states in HEK 293 cells with binding parameters in accord with those determined kinetically and with parameters obtained with the hCRF{sub 2{alpha}} receptor. A non-hydrolysable GTP analog, Gpp(NH)p, reduced the high affinity binding of [{sup 125}I]-tyr{sup 0}-sauvagine to both hCRF{sub 2} receptor isoforms in a similar manner. The rank order of potency of CRF agonist peptides in competition experiments was identical for both hCRF{sub 2}{alpha}-helical CRF{sub (9-41)}oCRF). Similarly, agonist potency was similar for the two isoforms when studied using the luciferase gene reporter system. The peptide antagonist {alpha}-helical CRF{sub (9-41)} exhibited a non-competitive antagonism of urocortin-stimulated luciferase expression with both hCRF{sub 2} receptor isoforms. Taken together, these results indicate that the

  3. Transcriptional switch from albumin to alpha-fetoprotein and changes in transcription of other genes during carbon tetrachloride induced liver regeneration

    International Nuclear Information System (INIS)

    Panduro, A.; Shalaby, F.; Weiner, F.R.; Biempica, L.; Zern, M.A.; Shafritz, D.A.

    1986-01-01

    During liver regeneration induced by CCl 4 administration to rats, changes in the relative transcription rates of albumin and alpha-fetoprotein genes have been measured in conjunction with other liver-specific and general cellular function genes. Within 24 h following CCl 4 administration, albumin gene transcription decreases by 85%, whereas alpha-fetoprotein transcription increases from undetectable levels to 50% of that observed for albumin. These changes precede maximal [ 3 H]thymidine incorporation into DNA which peaks at 48 h. Other genes related to liver-specific functions, such as ligandin, alpha 1-antitrypsin, and cytochrome P-450's, as well as general cellular genes pro alpha 1- and pro alpha 2-collagen, beta-actin, and alpha-tubulin, respond in kinetic patterns often distinct from each other and from albumin and alpha-fetoprotein. Changes in the steady-state levels of albumin and alpha-fetoprotein mRNA correlate with changes in transcription, but there is a lag in alpha-fetoprotein mRNA accumulation, which peaks at 72 h following CCl 4 administration. These studies indicate that reciprocal changes in albumin and alpha-fetoprotein gene transcription occur during CCl 4 -induced liver regeneration, leading to changes in the level of these specific mRNAs. These changes precede DNA synthesis and would appear to represent an alteration in differentiated function of hepatocytes in conjunction with the liver regenerative process

  4. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  5. alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

    Directory of Open Access Journals (Sweden)

    M.R.S.C. Wenning

    2000-09-01

    Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

  6. Isolation, characterization, and mapping of gene encoding dihydrolipoyl succinyltransferase (E2k) of human [alpha]-ketoglutarate dehydrogenase complex

    Energy Technology Data Exchange (ETDEWEB)

    Ali, G.; Cai, Xingang; Sheu, Kwan-Fu R.; Blass, J.P. (Cornell Univ. Medical College, White Plains, NY (United States)); Wasco, W.; Gaston, S.M.; Tanzi, R.E.; Cooper, A.J.L.; Gusella, J.F. (Massachusetts General Hospital, Charleston, MA (United States)); Szabo, P. (Cornell Univ. Medical College, New York, NY (United States))

    1994-03-01

    The authors have isolated and sequenced cDNAs representing the full-length (2987-bp) gene for dihydrolipoyl succinyltransferase (E2k component) of the human [alpha]-ketoglutarate dehydrogenase complex (KHDHC) from a human fetal brain cDNA library. The E2k cDNA was mapped to human chromosome 14 using a somatic cell hybrid panel, and more precisely to band 14q24.3 by in situ hybridization. This cDNA also cross-hybridized to an apparent E2k pseudogene on chromosome 1p31. Northern analysis revealed the E2k gene to be ubiquitously expressed in peripheral tissues and brain. Interestingly, chromosome 14q24.3 has recently been reported to contain gene defects for an early-onset form of familial Alzheimer's disease and for Machado-Joseph disease. Future studies will be necessary to determine whether the E2K gene plays a role in either of these two disorders.

  7. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  8. Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination

    DEFF Research Database (Denmark)

    Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole

    2007-01-01

    Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... increased during germination. Assessing the fragment minimum chain length by peptide mass fingerprinting suggested that alpha-amylase 2 ( gi vertical bar 4699831) initially was cleaved just prior to domain B that protrudes from the (beta alpha)(8)-barrel between beta-strand 3 and alpha-helix 3, followed...... essentially only full-length alpha-amylase forms. While only products of the above three genes appeared by germination also of 15 other barley cultivars, the cultivars had distinct repertoires of charge and molecular mass variant forms. These patterns appeared not to be correlated with malt quality....

  9. Alpha thalassaemia-mental retardation, X linked

    Directory of Open Access Journals (Sweden)

    Gibbons Richard

    2006-05-01

    Full Text Available Abstract X-linked alpha thalassaemia mental retardation (ATR-X syndrome in males is associated with profound developmental delay, facial dysmorphism, genital abnormalities and alpha thalassaemia. Female carriers are usually physically and intellectually normal. So far, 168 patients have been reported. Language is usually very limited. Seizures occur in about one third of the cases. While many patients are affectionate with their caregivers, some exhibit autistic-like behaviour. Patients present with facial hypotonia and a characteristic mouth. Genital abnormalities are observed in 80% of children and range from undescended testes to ambiguous genitalia. Alpha-thalassaemia is not always present. This syndrome is X-linked recessive and results from mutations in the ATRX gene. This gene encodes the widely expressed ATRX protein. ATRX mutations cause diverse changes in the pattern of DNA methylation at heterochromatic loci but it is not yet known whether this is responsible for the clinical phenotype. The diagnosis can be established by detection of alpha thalassaemia, identification of ATRX gene mutations, ATRX protein studies and X-inactivation studies. Genetic counselling can be offered to families. Management is multidisciplinary: young children must be carefully monitored for gastro-oesophageal reflux as it may cause death. A number of individuals with ATR-X are fit and well in their 30s and 40s.

  10. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  11. How to find soluble proteins: a comprehensive analysis of alpha/beta hydrolases for recombinant expression in E. coli

    Directory of Open Access Journals (Sweden)

    Barth Sandra

    2005-04-01

    Full Text Available Abstract Background In screening of libraries derived by expression cloning, expression of active proteins in E. coli can be limited by formation of inclusion bodies. In these cases it would be desirable to enrich gene libraries for coding sequences with soluble gene products in E. coli and thus to improve the efficiency of screening. Previously Wilkinson and Harrison showed that solubility can be predicted from amino acid composition (Biotechnology 1991, 9(5:443–448. We have applied this analysis to members of the alpha/beta hydrolase fold family to predict their solubility in E. coli. alpha/beta hydrolases are a highly diverse family with more than 1800 proteins which have been grouped into homologous families and superfamilies. Results The predicted solubility in E. coli depends on hydrolase size, phylogenetic origin of the host organism, the homologous family and the superfamily, to which the hydrolase belongs. In general small hydrolases are predicted to be more soluble than large hydrolases, and eukaryotic hydrolases are predicted to be less soluble in E. coli than prokaryotic ones. However, combining phylogenetic origin and size leads to more complex conclusions. Hydrolases from prokaryotic, fungal and metazoan origin are predicted to be most soluble if they are of small, medium and large size, respectively. We observed large variations of predicted solubility between hydrolases from different homologous families and from different taxa. Conclusion A comprehensive analysis of all alpha/beta hydrolase sequences allows more efficient screenings for new soluble alpha/beta hydrolases by the use of libraries which contain more soluble gene products. Screening of hydrolases from families whose members are hard to express as soluble proteins in E. coli should first be done in coding sequences of organisms from phylogenetic groups with the highest average of predicted solubility for proteins of this family. The tools developed here can be used

  12. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    Science.gov (United States)

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  13. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  14. Macrophage inflammatory protein-1alpha: a link between innate immunity and familial Mediterranean fever?

    Science.gov (United States)

    Dizdar, Omer; Kalyoncu, Umut; Karadag, Omer; Akdogan, Ali; Kiraz, Sedat; Ertenli, Ihsan; Barista, Ibrahim; Calguneri, Meral

    2007-01-01

    The aim of this study is to investigate the relationship between chemokines and the inflammation in Familial Mediterranean Fever (FMF). Forty-nine patients with FMF (41 in remission and 8 in acute attack period) and 20 healthy controls were included in the study. Serum levels of macrophage inflammatory protein-1alpha (MIP-1alpha) were assessed in the patients and the controls, along with other parameters of disease activity, i.e., fibrinogen, C-reactive protein and erythrocyte sedimentation rate. Serum MIP-1alpha levels of the patients with FMF in acute attack period were significantly higher than the patients in remission and healthy controls (p=0.02 and p=0.038, respectively). MIP-1alpha levels were weakly correlated with CRP (r=0.32, p=0.032) levels. MIP-1alpha may have a role in the pathogenesis of FMF attacks. MIP-1alpha and other chemokines may constitute a link between the innate immune system and FMF.

  15. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  16. A biallelic RFLP of the human. alpha. 2-C4 adrenergic receptor gene (ADRA2RL2) localized on the short arm of chromosome 4 and encoding the putative. alpha. 2B receptor is identified with Bsu 36 L using a 1. 5 kb probe (p ADRA2RL2)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeche, M.R.; Berrettini, W.H. (Clinical Neurogenetics Branch, Bethesda, MD (USA)); Regan, J.W. (Duke Univ. Medical Center, Durham, NC (USA))

    1989-12-11

    A 1.5 kb Eco RI cDNA fragment representing the human alpha2-C4 adrenergic receptor (AR) gene encoding the putative alpha2B-AR, containing approximately 1270 bp of the coding and 240 bp of the 3{prime}flanking region, inserted into pSP65, was used as a probe (p ADRA2RL2). This clone was obtained by screening a human kidney lambda GT10 cDNA library with the 0.95 kb Pst I restriction fragment derived from the coding block of the gene for the human platelet alpha2-AR. Hybridization of human genomic DNA digested with Bsu 36 I identifies a two allele polymorphism with bands at 12 kb and 5.8 kb. 20 unrelated North American caucasian subjects were evaluated with frequencies of: A allele, 0.45; B allele, 0.55, heterozygosity (obs), 0.5. This alpha2-AR gene has been mapped in a separation effort in 59 CEPH reference pedigrees to the tip of the short arm of chromosome 4 just proximal to GB (4p 16.3) reported to be linked to the Huntingston's disease gene. Codominant inheritance was observed in seven families with two and three generations, respectively. The number of meioses scored was 95.

  17. Organization of genes responsible for the stereospecific conversion of hydantoins to alpha-amino acids in Arthrobacter aurescens DSM 3747.

    Science.gov (United States)

    Wiese, A; Syldatk, C; Mattes, R; Altenbuchner, J

    2001-09-01

    Arthrobacter aurescens DSM 3747 hydrolyzes stereospecifically 5'-monosubstituted hydantoins to alpha-amino acids. The genes involved in hydantoin utilization (hyu) were isolated on an 8.7-kb DNA fragment, and by DNA sequence analysis eight ORFs were identified. The hyu gene cluster includes four genes: hyuP encoding a putative transport protein, the hydantoin racemase gene hyuA, the hydantoinase gene hyuH, and the carbamoylase gene hyuC. The four genes are transcribed in the same direction. Upstream of hyuP and in opposite orientation to the hyu genes, three ORFs were found showing similarities to cytochrome P450 monooxygenase (ORF1, incomplete), to membrane proteins (ORF2), and to ferredoxin (ORF3). ORF8 was found downstream of hyuC and again in opposite orientation to the hyu genes. The gene product of ORF8 displayed similarities to the LacI/GalR family of transcriptional regulators. Reverse transcriptase PCR experiments and Northern blot analysis revealed that the genes hyuPAHC are coexpressed in A. aurescens after induction with 3-N-CH3-IMH. The expression of the hyu operon was not regulated by the putative regulator ORF8 as shown by gene disruption and mobility-shift experiments.

  18. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

    Science.gov (United States)

    Chakravorty, S; Sarkar, S; Gachhui, R

    2015-01-01

    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  19. Itai-itai disease is not associated with polymorphisms of the estrogen receptor {alpha} gene

    Energy Technology Data Exchange (ETDEWEB)

    Nishio, Hisahide; Hayashi, Chiyo; Lee, Myeongjin; Ayaki, Hitoshi; Sumino, Kimiaki [Kobe Univ. School of Medicine (Japan). Dept. of Public Health; Yamamoto, Ryoji; Ninomiya, Ruriko; Koizumi, Naoko [Hyogo College of Medicine (Japan). Dept. of Public Health

    1999-11-01

    Itai-itai (or ouch-ouch) disease is a syndrome accompanied by bone mineral disorders, and which may be related to oral cadmium exposure. Itai-itai predominantly affects postmenopausal women with a history of multiple childbirths. Recently, it has been reported that polymorphisms of the estrogen receptor {alpha} (ER{alpha}) gene are associated with postmenopausal reduction of bone mineral density in Japanese women. However, estrogen receptors have never been studied in itai-itai disease. In this study, we examined the genotypic distributions of PvuII and XbaI restriction fragment length polymorphisms (RFLPs) of the ER{alpha} gene in patients with itai-itai disease and compared them with those of control subjects. The RFLPs are represented here as P{sub p} (PvuII) and Xx (XbaI); the capital and small letters signify the absence and presence of restriction sites, respectively. The genotypic distributions of the patient group were: PP, 14.8%; Pp, 55.6%; pp, 29.6%; XX, 7.4%; Xx, 29.6%; and xx, 63.0%. These distributions were similar to those observed for the control groups, hence no pattern of genotypic distribution was observed that could be related to itai-itai disease. We conclude that RFLPs of the ER{alpha} gene may not be associated with itai-itai disease. (orig.)

  20. Pur-Alpha Induces JCV Gene Expression and Viral Replication by Suppressing SRSF1 in Glial Cells.

    Directory of Open Access Journals (Sweden)

    Ilker Kudret Sariyer

    Full Text Available PML is a rare and fatal demyelinating disease of the CNS caused by the human polyomavirus, JC virus (JCV, which occurs in AIDS patients and those on immunosuppressive monoclonal antibody therapies (mAbs. We sought to identify mechanisms that could stimulate reactivation of JCV in a cell culture model system and targeted pathways which could affect early gene transcription and JCV T-antigen production, which are key steps of the viral life cycle for blocking reactivation of JCV. Two important regulatory partners we have previously identified for T-antigen include Pur-alpha and SRSF1 (SF2/ASF. SRSF1, an alternative splicing factor, is a potential regulator of JCV whose overexpression in glial cells strongly suppresses viral gene expression and replication. Pur-alpha has been most extensively characterized as a sequence-specific DNA- and RNA-binding protein which directs both viral gene transcription and mRNA translation, and is a potent inducer of the JCV early promoter through binding to T-antigen.Pur-alpha and SRSF1 both act directly as transcriptional regulators of the JCV promoter and here we have observed that Pur-alpha is capable of ameliorating SRSF1-mediated suppression of JCV gene expression and viral replication. Interestingly, Pur-alpha exerted its effect by suppressing SRSF1 at both the protein and mRNA levels in glial cells suggesting this effect can occur independent of T-antigen. Pur-alpha and SRSF1 were both localized to oligodendrocyte inclusion bodies by immunohistochemistry in brain sections from patients with HIV-1 associated PML. Interestingly, inclusion bodies were typically positive for either Pur-alpha or SRSF1, though some cells appeared to be positive for both proteins.Taken together, these results indicate the presence of an antagonistic interaction between these two proteins in regulating of JCV gene expression and viral replication and suggests that they play an important role during viral reactivation leading to

  1. MspI and PvuII polymorphisms in the Na,K-ATPase. alpha. subunit related gene ATP1AL1

    Energy Technology Data Exchange (ETDEWEB)

    Shull, M.M.; Pugh, D.G.; Lingrel, J.B. (Univ. of Cincinnati, OH (USA))

    1990-01-11

    ATP1AL1 78-1-3 is a 0.56 kb genomic EcoRI-XbaI fragment from within the Na,K-ATPase {alpha} subunit related gene, previously referred to as {alpha}D on chromosome 13. The fragment was subcloned into pIBI31. MspI identifies a two-allele polymorphism (M1: 2.8 kb, M2: 2.5 kb). PvuII, which cuts within the probe sequence, detects two two-allele polymorphism (A1: 6.0 kb, A2: 5.7 kb, B1: 1.3 kb, B2: 1.1 kb). A1 and A2 appear to result from an insertion/deletion polymorphism that is also identified by MspI. ATP1AL1 78-1-3 has been assigned to chromosome 13q by somatic cell hybrid analysis. Codominant segregation of the RELPs was observed in 2 two-generation families.

  2. Localization of pig Na[sup +], K[sup +]-ATPase [alpha] and [beta] subunit genes to chromosome 4 by radioactive in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Lahbib-Mansais, Y.; Yerle, M.; Dalens, M.; Chevalet, C.; Gellin, J. (Centre de Recherches de Toulouse (France))

    1993-01-01

    Two genes coding for Na[sup +],K[sup +] -ATPase [alpha] and [beta] subunits are localized on pig chromosome 4, to the q1.6[yields]q2.3 and 1.3[yields]q2.1 regions, respectively, by radioactive in situ hybridization. According to nucleotide and amino acid sequence comparisons with different human isoforms of Na[sup +] ,K[sup +]-ATPase, these pig [alpha] and [beta] ATPase genes show strong homologies with human [alpha]1 and [beta] subunit ATPase genes, respectively. These results are discussed with respect to comparative mapping data of conserved genes in mammalian species. We showed that the pig cDNA probes encoding ATPase [alpha] and, [beta] genes reveal DNA polymorphism in Meishan an Large White pigs. 35 refs., 4 figs., 2 tabs.

  3. Molecular nature of alpha-globin genes in the Saudi population

    Directory of Open Access Journals (Sweden)

    J. Francis Borgio

    2015-11-01

    Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.

  4. Frequent expression loss of Inter-alpha-trypsin inhibitor heavy chain (ITIH genes in multiple human solid tumors: A systematic expression analysis

    Directory of Open Access Journals (Sweden)

    Werbowetski-Ogilvie Tamra

    2008-01-01

    Full Text Available Abstract Background The inter-alpha-trypsin inhibitors (ITI are a family of plasma protease inhibitors, assembled from a light chain – bikunin, encoded by AMBP – and five homologous heavy chains (encoded by ITIH1, ITIH2, ITIH3, ITIH4, and ITIH5, contributing to extracellular matrix stability by covalent linkage to hyaluronan. So far, ITIH molecules have been shown to play a particularly important role in inflammation and carcinogenesis. Methods We systematically investigated differential gene expression of the ITIH gene family, as well as AMBP and the interacting partner TNFAIP6 in 13 different human tumor entities (of breast, endometrium, ovary, cervix, stomach, small intestine, colon, rectum, lung, thyroid, prostate, kidney, and pancreas using cDNA dot blot analysis (Cancer Profiling Array, CPA, semiquantitative RT-PCR and immunohistochemistry. Results We found that ITIH genes are clearly downregulated in multiple human solid tumors, including breast, colon and lung cancer. Thus, ITIH genes may represent a family of putative tumor suppressor genes that should be analyzed in greater detail in the future. For an initial detailed analysis we chose ITIH2 expression in human breast cancer. Loss of ITIH2 expression in 70% of cases (n = 50, CPA could be confirmed by real-time PCR in an additional set of breast cancers (n = 36. Next we studied ITIH2 expression on the protein level by analyzing a comprehensive tissue micro array including 185 invasive breast cancer specimens. We found a strong correlation (p Conclusion Altogether, this is the first systematic analysis on the differential expression of ITIH genes in human cancer, showing frequent downregulation that may be associated with initiation and/or progression of these malignancies.

  5. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  6. Frequent expression loss of Inter-alpha-trypsin inhibitor heavy chain (ITIH) genes in multiple human solid tumors: A systematic expression analysis

    International Nuclear Information System (INIS)

    Hamm, Alexander; Knuechel, Ruth; Dahl, Edgar; Veeck, Juergen; Bektas, Nuran; Wild, Peter J; Hartmann, Arndt; Heindrichs, Uwe; Kristiansen, Glen; Werbowetski-Ogilvie, Tamra; Del Maestro, Rolando

    2008-01-01

    The inter-alpha-trypsin inhibitors (ITI) are a family of plasma protease inhibitors, assembled from a light chain – bikunin, encoded by AMBP – and five homologous heavy chains (encoded by ITIH1, ITIH2, ITIH3, ITIH4, and ITIH5), contributing to extracellular matrix stability by covalent linkage to hyaluronan. So far, ITIH molecules have been shown to play a particularly important role in inflammation and carcinogenesis. We systematically investigated differential gene expression of the ITIH gene family, as well as AMBP and the interacting partner TNFAIP6 in 13 different human tumor entities (of breast, endometrium, ovary, cervix, stomach, small intestine, colon, rectum, lung, thyroid, prostate, kidney, and pancreas) using cDNA dot blot analysis (Cancer Profiling Array, CPA), semiquantitative RT-PCR and immunohistochemistry. We found that ITIH genes are clearly downregulated in multiple human solid tumors, including breast, colon and lung cancer. Thus, ITIH genes may represent a family of putative tumor suppressor genes that should be analyzed in greater detail in the future. For an initial detailed analysis we chose ITIH2 expression in human breast cancer. Loss of ITIH2 expression in 70% of cases (n = 50, CPA) could be confirmed by real-time PCR in an additional set of breast cancers (n = 36). Next we studied ITIH2 expression on the protein level by analyzing a comprehensive tissue micro array including 185 invasive breast cancer specimens. We found a strong correlation (p < 0.001) between ITIH2 expression and estrogen receptor (ER) expression indicating that ER may be involved in the regulation of this ECM molecule. Altogether, this is the first systematic analysis on the differential expression of ITIH genes in human cancer, showing frequent downregulation that may be associated with initiation and/or progression of these malignancies

  7. Functional analysis of the Escherichia coli genome for members of the alpha/beta hydrolase family.

    Science.gov (United States)

    Zhang, L; Godzik, A; Skolnick, J; Fetrow, J S

    1998-01-01

    Database-searching methods based on sequence similarity have become the most commonly used tools for characterizing newly sequenced proteins. Due to the often underestimated functional diversity in protein families and superfamilies, however, it is difficult to make the characterization specific and accurate. In this work, we have extended a method for active-site identification from predicted protein structures. The structural conservation and variation of the active sites of the alpha/beta hydrolases with known structures were studied. The similarities were incorporated into a three-dimensional motif that specifies essential requirements for the enzymatic functions. A threading algorithm was used to align 651 Escherichia coli open reading frames (ORFs) to one of the members of the alpha/beta hydrolase fold family. These ORFs were then screened according to our three-dimensional motif and with an extra requirement that demands conservation of the key active-site residues among the proteins that bear significant sequence similarity to the ORFs. 17 ORFs from E. coli were predicted to have hydrolase activity and their putative active-site residues were identified. Most were in agreement with the experiments and results of other database-searching methods. The study further suggests that YHET_ECOLI, a hypothetical protein classified as a member of the UPF0017 family (an uncharacterized protein family), bears all the hallmarks of the alpha/beta hydrolase family. The novel feature of our method is that it uses three-dimensional structural information for function prediction. The results demonstrate the importance and necessity of such a method to fill the gap between sequence alignment and function prediction; furthermore, the method provides a way to verify the structure predictions, which enables an expansion of the applicable scope of the threading algorithms.

  8. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  9. Proteinaceous alpha-araylase inhibitors

    DEFF Research Database (Denmark)

    Svensson, Birte; Fukuda, Kenji; Nielsen, P.K.

    2004-01-01

    -amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha...

  10. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  11. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    Full Text Available Abstract Background The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of α2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-α2,8-sialylation. Results We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Conclusion Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic

  12. Structure and kinetic investigation of Streptococcus pyogenes family GH38 alpha-mannosidase.

    Directory of Open Access Journals (Sweden)

    Michael D L Suits

    2010-02-01

    Full Text Available The enzymatic hydrolysis of alpha-mannosides is catalyzed by glycoside hydrolases (GH, termed alpha-mannosidases. These enzymes are found in different GH sequence-based families. Considerable research has probed the role of higher eukaryotic "GH38" alpha-mannosides that play a key role in the modification and diversification of hybrid N-glycans; processes with strong cellular links to cancer and autoimmune disease. The most extensively studied of these enzymes is the Drosophila GH38 alpha-mannosidase II, which has been shown to be a retaining alpha-mannosidase that targets both alpha-1,3 and alpha-1,6 mannosyl linkages, an activity that enables the enzyme to process GlcNAc(Man(5(GlcNAc(2 hybrid N-glycans to GlcNAc(Man(3(GlcNAc(2. Far less well understood is the observation that many bacterial species, predominantly but not exclusively pathogens and symbionts, also possess putative GH38 alpha-mannosidases whose activity and specificity is unknown.Here we show that the Streptococcus pyogenes (M1 GAS SF370 GH38 enzyme (Spy1604; hereafter SpGH38 is an alpha-mannosidase with specificity for alpha-1,3 mannosidic linkages. The 3D X-ray structure of SpGH38, obtained in native form at 1.9 A resolution and in complex with the inhibitor swainsonine (K(i 18 microM at 2.6 A, reveals a canonical GH38 five-domain structure in which the catalytic "-1" subsite shows high similarity with the Drosophila enzyme, including the catalytic Zn(2+ ion. In contrast, the "leaving group" subsites of SpGH38 display considerable differences to the higher eukaryotic GH38s; features that contribute to their apparent specificity.Although the in vivo function of this streptococcal GH38 alpha-mannosidase remains unknown, it is shown to be an alpha-mannosidase active on N-glycans. SpGH38 lies on an operon that also contains the GH84 hexosaminidase (Spy1600 and an additional putative glycosidase. The activity of SpGH38, together with its genomic context, strongly hints at a function

  13. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  14. Studies of the Gly482Ser polymorphism of the peroxisome proliferator-activated receptor gamma coactivator 1alpha (PGC-1alpha) gene in Danish subjects with the metabolic syndrome

    DEFF Research Database (Denmark)

    Ambye, L; Rasmussen, S; Fenger, Mogens

    2005-01-01

    The peroxisome proliferator-activated receptor gamma co-activator 1alpha (PGC-1alpha) is a novel transcriptional co-activator that holds an important role in lipid and glucose metabolism. PGC-1alpha is a candidate gene for the metabolic syndrome (MS) as well as type 2 diabetes. Recent studies...... related to this syndrome. The variant was examined, using PCR-RFLP, in the DanMONICA cohort comprising a population-based sample of 2349 subjects. MS was defined using the National Cholesterol Education Program -- Adult Treatment Panel III (NCEP-ATPIII) criteria. The allelic frequency of the Ser482 allele...... and insulin secretion, 24-ambulatory blood pressure or left ventricular mass index. In conclusion, the Gly482Ser polymorphism of the PGC-1alpha gene is not associated with the metabolic syndrome, related quantitative traits or cardiac hypertrophy among Danish Caucasian subjects...

  15. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  16. Development of a chromosomally integrated metabolite-inducible Leu3p-alpha-IPM "off-on" gene switch.

    Directory of Open Access Journals (Sweden)

    Maria Poulou

    2010-08-01

    Full Text Available Present technology uses mostly chimeric proteins as regulators and hormones or antibiotics as signals to induce spatial and temporal gene expression.Here, we show that a chromosomally integrated yeast 'Leu3p-alpha-IotaRhoMu' system constitutes a ligand-inducible regulatory "off-on" genetic switch with an extensively dynamic action area. We find that Leu3p acts as an active transcriptional repressor in the absence and as an activator in the presence of alpha-isopropylmalate (alpha-IotaRhoMu in primary fibroblasts isolated from double transgenic mouse embryos bearing ubiquitously expressing Leu3p and a Leu3p regulated GFP reporter. In the absence of the branched amino acid biosynthetic pathway in animals, metabolically stable alpha-IPM presents an EC(50 equal to 0.8837 mM and fast "OFF-ON" kinetics (t(50ON = 43 min, t(50OFF = 2.18 h, it enters the cells via passive diffusion, while it is non-toxic to mammalian cells and to fertilized mouse eggs cultured ex vivo.Our results demonstrate that the 'Leu3p-alpha-IotaRhoMu' constitutes a simpler and safer system for inducible gene expression in biomedical applications.

  17. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  18. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  19. Molecular genetics and phenotypic characteristics of MODY caused by hepatocyte nuclear factor 4alpha mutations in a large European collection.

    NARCIS (Netherlands)

    Pearson, E.R.; Pruhova, S.; Tack, C.J.J.; Johansen, A.; Castleden, H.A.; Lumb, P.J.; Wierzbicki, A.S.; Clark, P.M.; Lebl, J.; Pedersen, O.; Ellard, S.; Hansen, T.; Hattersley, A.T.

    2005-01-01

    AIMS/HYPOTHESIS: Heterozygous mutations in the gene of the transcription factor hepatocyte nuclear factor 4alpha (HNF-4alpha) are considered a rare cause of MODY with only 14 mutations reported to date. The description of the phenotype is limited to single families. We investigated the genetics and

  20. The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4{alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Klapper, Maja [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Boehme, Mike [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Nitz, Inke [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Doering, Frank [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany)

    2007-04-27

    The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4{alpha} binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4{alpha} by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4{alpha}, that are both candidate genes for diabetes type 2, may be a powerful approach.

  1. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  2. Modifier Genes for Mouse Phosphatidylinositol Transfer Protein alpha (vibrator) That Bypass Juvenile Lethality

    NARCIS (Netherlands)

    Concepcion, Dorothy; Johannes, Frank; Lo, Yuan Hung; Yao, Jay; Fong, Jerry; Hamilton, Bruce A.

    Phosphatidylinositol transfer proteins (PITPs) mediate lipid signaling and membrane trafficking in eukaryotic cells. Loss-of-function mutations of the gene encoding PITP alpha in mice result in a range of dosage-sensitive phenotypes, including neurological dysfunction, neurodegeneration, and

  3. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  4. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  5. The effect of alpha-thalassemia on cord blood red cell indices and interaction with sickle cell gene

    International Nuclear Information System (INIS)

    Quadri, Mohammad I.; Islam, Sherief I.A.M.; Nasserullah, Z.

    2000-01-01

    Alpha-thalassemia is known to be prevalent in the Eastern region of Saudi Arabia. There are no large scale reports regarding the effect of alpha-thalassemia on red cell indices of cord blood from Saudi Arabia. Similarly, there are reports regarding the interaction of alpha-thalassemia and the sickle-cell gene in relation to red cell indices in cord blood. To address these issues, we undertook a study on neonatal cold blood samples. In a prospective study, cord blood samples from 504 neonates from the Qatif area of the Eastern Province of Saudi Arabia were analyzed for complete blood counts (CBC) and cellulose acetate Hb electrophoresis. Hb S was confirmed by citrate agar Hb electrophoresis. There were 243 case samples with normal Hb electrophoresis (Hb A 27.2+- 7% and Hb F 72.6+-7.7%). Their mean Hb (g/dL), RBC (x10/L), Hct (%), MCV (pg), MCHC (g/dL), RDW-SD (fl) and RDW-CV (%) were 15.05+-1.6, 4.5+-0.5, 47.4+-5.3, 106+-8, 33.6+-2.3, 31.8+-1.7, 69.2+-9.5 and 17.9+-1.7, respectively. There were 136 cases with alpha-thalassemia trait (alphaTT), 57 cases with sickle cell trait (SCT) and 50 cases of sickle cell trait with alplha-thalassemia trait (SCT/ alphaTT). There were ten cases of Hb H disease (6 definite), including one with sickle cell disease (SCD) and two with SCT, Hb Bart's 23.9%-43.6%; four probable with Hb Bart's 10.9%-16.1% and one with SCT. The effect on red cell parameters in Hb H disease were most pronounced. In addition, there seven cases of SCD, four of whom had coexistent alpha-thalassemia trait (SCD/alphaTT). The prevalence of alpha-thalassemia in this cohort of Saudi population was 39.99%. Hb H disease appeared as common as SCD. Sickle cell gene was seen in 23.4% of neonatal samples. Apha-thalassemia gene significantly reduces MCH, MCV, RDW-SD, Hct, Hb and increase RBC count in both normal or sickle cell trait neonates. Generally, the variation of red cell parameters is directly proportional to the amount of Hb Bart's in the cord blood. Sickle cell

  6. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  7. T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

    Energy Technology Data Exchange (ETDEWEB)

    Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L. (Stanford Univ., CA (USA)); Sherritt, M.; Bernard, C.C. (LaTrobe Univ., Victoria (Australia)); Begovich, A.B.; Erlich, H.A. (Cetus Corporation, Emeryville, CA (USA))

    1989-02-01

    Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.

  8. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    Science.gov (United States)

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  9. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  10. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  11. Alpha-defensin DEFA1A3 gene copy number elevation in Danish Crohn's disease patients

    DEFF Research Database (Denmark)

    Jespersgaard, Cathrine; Fode, Peder; Dybdahl, Marianne

    2011-01-01

    BACKGROUND AND PURPOSE OF STUDY: Extensive copy number variation is observed for the DEFA1A3 gene encoding alpha-defensins 1-3. The objective of this study was to determine the involvement of alpha-defensins in colonic tissue from Crohn's disease (CD) patients and the possible genetic association...... of DEFA1A3 with CD. METHODS: Two-hundred and forty ethnic Danish CD patients were included in the study. Reverse transcriptase PCR assays determined DEFA1A3 expression in colonic tissue from a subset of patients. Immunohistochemical analysis identified alpha-defensin peptides in colonic tissue. Copy...

  12. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  13. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  14. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  15. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal.

    Science.gov (United States)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth; Alifrangis, Michael; Imwong, Mallika; Bhatta, Dwij Raj; Banjara, Megha Raj

    2012-03-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within the country or between Nepal and India. Similar prevalence of the three genotypes of Pvmsp-3alpha between the two countries likely supports the latter explanation.

  16. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  17. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  18. Evidence, from family studies, for linkage disequilibrium between TGFA and a gene for nonsyndromic cleft lip with or without cleft palate

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Hongshu; Lee, A.; Gasser, D.L. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States); Sassani, R.; Bartlett, S.P. [Children`s Hospital of Philadelphia, PA (United States); Buetow, K.H. [Fox Chase Cancer Center, Philadelphia, PA (United States); Hecht, J.T. [Univ. of Texas Medical School, Houston, TX (United States); Malcolm, S.; Winter, R.M.; Vintiner, G.M. [Univ. of London (United Kingdom)

    1994-11-01

    The inheritance of alleles of the transforming growth factor alpha (TGFA) locus has been studied in families affected with cleft lip with or without cleft palate (CL/P), by using the transmission/disequilibrium test described by Spielman and colleagues. Only heterozygous parents with an affected child can be included in this test, but within such families a significantly greater frequency of C2 alleles were transmitted to affected children than would be expected by chance. There was no evidence that the total number of C2 alleles transmitted to affected and unaffected children differed significantly from random segregation. These data provide evidence from within families that a gene for susceptibility to CL/P is in significant linkage disequilibrium with the C2 allele of the TGFA locus. 30 refs., 1 fig., 2 tabs.

  19. PPAR-alpha agonist treatment increases trefoil factor family-3 expression and attenuates apoptosis in the liver tissue of bile duct-ligated rats.

    Science.gov (United States)

    Karakan, Tarkan; Kerem, Mustafa; Cindoruk, Mehmet; Engin, Doruk; Alper, Murat; Akın, Okan

    2013-01-01

    Peroxisome proliferators-activated receptor alpha activation modulates cholesterol metabolism and suppresses bile acid synthesis. The trefoil factor family comprises mucin-associated proteins that increase the viscosity of mucins and help protect epithelial linings from insults. We evaluated the effect of short-term administration of fenofibrate, a peroxisome proliferators activated receptor alpha agonist, on trefoil factor family-3 expression, degree of apoptosis, generation of free radicals, and levels of proinflammatory cytokines in the liver tissue of bile duct-ligated rats. Forty male Wistar rats were randomly divided into four groups: 1 = sham operated, 2 = bile duct ligation, 3 = bile duct-ligated + vehicle (gum Arabic), and 4 = bile duct-ligated + fenofibrate (100 mg/kg/day). All rats were sacrificed on the 7 th day after obtaining blood samples and liver tissue. Liver function tests, tumor necrosis factor-alpha and interleukin 1 beta in serum, and trefoil factor family-3 mRNA expression, degree of apoptosis (TUNEL) and tissue malondialdehyde (malondialdehyde, end-product of lipid peroxidation by reactive oxygen species) in liver tissue were evaluated. Fenofibrate administration significantly reduced serum total bilirubin, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, gamma-glutamyl transferase, and tumor necrosis factor-alpha and interleukin-1β levels. Apoptosis and malondialdehyde were significantly reduced in the fenofibrate group. Trefoil factor family-3 expression increased with fenofibrate treatment in bile duct-ligated rats. The peroxisome proliferators-activated receptor alpha agonist fenofibrate significantly increased trefoil factor family-3 expression and decreased apoptosis and lipid peroxidation in the liver and attenuated serum levels of proinflammatory cytokines in bile duct-ligated rats. Further studies are needed to determine the protective role of fenofibrate in human cholestatic disorders.

  20. Dynamic evolution of alpha-gliadin prolamin gene family in homeologous genomes of hexaploid wheat

    Science.gov (United States)

    Bread wheat is an allohexaploid species containing the three closely related A, B, and D subgenomes. Homeologous Gli-2 loci located on chromosomes 6A, 6B and 6D encode complex groups of alpha-gliadin seed storage proteins that contribute to the functional properties of wheat flour, but also trigger ...

  1. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  2. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  3. Interaction between the Gly460Trp alpha-adducin gene variant and diuretics on the risk of myocardial infarction

    NARCIS (Netherlands)

    van Wieren-de Wijer, Diane B M A; Maitland-van der Zee, Anke-Hilse; de Boer, Anthonius; Kroon, Abraham A; de Leeuw, Peter W; Schiffers, Paul; Janssen, Rob G J H; Psaty, Bruce M; van Duijn, Cornelia M; Stricker, Bruno H Ch; Klungel, Olaf H

    INTRODUCTION: The Gly460Trp variant of the alpha-adducin gene has been associated with the salt-sensitive and diuretic responsive form of hypertension. OBJECTIVE: The aim of the study was to determine whether the alpha-adducin 460Trp variant allele modifies the risk-lowering effect of diuretics on

  4. The chicken c-erbA alpha-product induces expression of thyroid hormone-responsive genes in 3,5,3'-triiodothyronine receptor-deficient rat hepatoma cells

    DEFF Research Database (Denmark)

    Muñoz, A; Höppner, W; Sap, J

    1990-01-01

    To determine the capacity of the chicken c-erbA (cTR-alpha) gene product in regulating expression of known thyroid hormone-responsive genes, both the cTR-alpha and the viral v-erbA genes were expressed in FAO cells, a rat hepatoma cell line defective for functional thyroid hormone receptors. Upon...

  5. Increased virulence and competitive advantage of a/alpha over a/a or alpha/alpha offspring conserves the mating system of Candida albicans.

    Science.gov (United States)

    Lockhart, Shawn R; Wu, Wei; Radke, Joshua B; Zhao, Rui; Soll, David R

    2005-04-01

    The majority of Candida albicans strains in nature are a/alpha and must undergo homozygosis to a/a or alpha/alpha to mate. Here we have used a mouse model for systemic infection to test the hypothesis that a/alpha strains predominate in nature because they have a competitive advantage over a/a and alpha/alpha offspring in colonizing hosts. Single-strain injection experiments revealed that a/alpha strains were far more virulent than either their a/a or alpha/alpha offspring. When equal numbers of parent a/alpha and offspring a/a or alpha/alpha cells were co-injected, a/alpha always exhibited a competitive advantage at the time of extreme host morbidity or death. When equal numbers of an engineered a/a/alpha2 strain and its isogenic a/a parent strain were co-injected, the a/a/alpha2 strain exhibited a competitive advantage at the time of host morbidity or death, suggesting that the genotype of the mating-type (MTL) locus, not associated genes on chromosome 5, provides a competitive advantage. We therefore propose that heterozygosity at the MTL locus not only represses white-opaque switching and genes involved in the mating process, but also affects virulence, providing a competitive advantage to the a/alpha genotype that conserves the mating system of C. albicans in nature.

  6. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  7. TIF1alpha: a possible link between KRAB zinc finger proteins and nuclear receptors

    DEFF Research Database (Denmark)

    Le Douarin, B; You, J; Nielsen, Anders Lade

    1998-01-01

    Ligand-induced gene activation by nuclear receptors (NRs) is thought to be mediated by transcriptional intermediary factors (TIFs), that interact with their ligand-dependent AF-2 activating domain. Included in the group of the putative AF-2 TIFs identified so far is TIF1alpha, a member of a new...... family of proteins which contains an N-terminal RBCC (RING finger-B boxes-coiled coil) motif and a C-terminal bromodomain preceded by a PHD finger. In addition to these conserved domains present in a number of transcriptional regulatory proteins, TIF1alpha was found to contain several protein......-protein interaction sites. Of these, one specifically interacts with NRs bound to their agonistic ligand and not with NR mutants that are defective in the AF-2 activity. Immediately adjacent to this 'NR box', TIF1alpha contains an interaction site for members of the chromatin organization modifier (chromo) family, HP...

  8. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  9. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  10. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  11. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  12. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  13. PGC-1alpha is not mandatory for exercise- and training-induced adaptive gene responses in mouse skeletal muscle

    DEFF Research Database (Denmark)

    Leick, Lotte; Wojtaszewski, Jørgen F P; Johansen, Sune T.

    2008-01-01

    The aim of the present study was to test the hypothesis that peroxisome proliferator activated receptor-gamma coactivator (PGC) 1alpha is required for exercise-induced adaptive gene responses in skeletal muscle. Whole body PGC-1alpha knockout (KO) and littermate wild-type (WT) mice performed....... Resting muscles of the PGC-1alpha KO mice had lower ( approximately 20%) cytochrome c (cyt c), cytochrome oxidase (COX) I, and aminolevulinate synthase (ALAS) 1 mRNA and protein levels than WT, but similar levels of AMP-activated protein kinase (AMPK) alpha1, AMPKalpha2, and hexokinase (HK) II compared...

  14. [A compound heterozygosity mutation in the interleukin-7 receptor-alpha gene resulted in severe combined immunodeficiency in a Chinese patient].

    Science.gov (United States)

    Zhang, Zhi-yong; Zhao, Xiao-dong; Wang, Mo; Yu, Jie; An, Yun-fei; Yang, Xi-qiang

    2009-09-01

    Mutation in the interleukin-7 receptor-alpha (IL-7R alpha) chain causes a rare type of severe combined immunodeficiency (SCID) with presence of NK cells in the peripheral blood. Here we report the molecular and clinical characterization of a compound heterozygosity mutation in the interleukin-7 receptor-alpha gene that resulted in SCID in a patient firstly from China. A 5 month-old male patient and his parents were enrolled in this study. Since 15 days of age, the patient had had recurrent fever, persistent cough and diarrhea. He was in poor general condition with pyorrhea and ulceration of the BCG scar. His brother died of severe infection at 4 months of age. He was initially diagnosed as SCID according to clinical manifestation and immunological analysis. A panel of SCID candidate genes including IL-2RG, RAG1/RAG2 and IL-7R alpha of patient and his parents were amplified by polymerase chain reaction (PCR) from genomic DNA. Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify the IL-7R alpha transcripts. Sequencing was performed directly on the PCR products forward and reversely. The serum immunoglobulin (Ig) profile was IgG 6867 mg/L (normal range, 3050 - 8870 mg/L); IgM 206 mg/L and IgA 249 mg/L, IgE 2.3 IU/ml (normal range microscope and by culture. The patient had a compound heterozygosity mutation in the IL-7R alpha gene:on one allele, there was a splice-junction mutation in intron 4 (intron 4(+1)G > A), for which his father was a carrier; whereas on the other allele, a nonsense mutation at position 638 in exon 5 with a premature stop codon (638 C > T, R206X) was identified, for which his mother was a carrier. The splice-junction mutation in intron 4 of IL-7R alpha was firstly reported. The IL-7R alpha mRNA expression of the patient was remarkably reduced whereas the parents had relatively normal IL-7R alpha mRNA expression. IL-7R alpha cDNA of the patient was amplified by nested PCR. The PCR products were purified, cloned with a TA

  15. Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

    Science.gov (United States)

    Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

    1995-01-01

    Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

  16. Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

    Science.gov (United States)

    Kojima, Kenji K; Kobayashi, Ichizo

    2015-10-19

    R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East

  17. Role of alpha2C-adrenoceptor subtype in spatial working memory as revealed by mice with targeted disruption of the alpha2C-adrenoceptor gene.

    Science.gov (United States)

    Tanila, H; Mustonen, K; Sallinen, J; Scheinin, M; Riekkinen, P

    1999-02-01

    The role of the alpha2C-adrenoceptor subtype in mediating the beneficial effect of alpha2-adrenoceptor agonists on spatial working memory was studied in adult mice with targeted inactivation of the alpha2C-receptor gene (KO) and their wild-type controls (WT). A delayed alternation task was run in a T-maze with mixed delays varying from 20 s to 120 s. Dexmedetomidine, a specific but subtype nonselective alpha2-adrenoceptor agonist, dose-dependently decreased the total number of errors. The effect was strongest at the dose of 5 microg/kg (s.c.), and was observed similarly in KO and WT mice. KO mice performed inferior to WT mice due to a higher number of perseverative errors. Dexmedetomidine slowed initiation of the motor response in the start phase at lower doses in WT mice than in KO mice but no such difference was observed in the return phase of the task, suggesting involvement of alpha2C-adrenoceptors in the cognitive aspect of response preparation or in response sequence initiation. According to these findings, enhancement of spatial working memory is best achieved with alpha2-adrenoceptor agonists which have neither agonistic nor antagonistic effects at the alpha2C-adrenoceptor subtype.

  18. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  19. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  20. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  1. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  2. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  3. The 5 Alpha-Reductase Isozyme Family: A Review of Basic Biology and Their Role in Human Diseases

    Directory of Open Access Journals (Sweden)

    Faris Azzouni

    2012-01-01

    Full Text Available Despite the discovery of 5 alpha-reduction as an enzymatic step in steroid metabolism in 1951, and the discovery that dihydrotestosterone is more potent than testosterone in 1968, the significance of 5 alpha-reduced steroids in human diseases was not appreciated until the discovery of 5 alpha-reductase type 2 deficiency in 1974. Affected males are born with ambiguous external genitalia, despite normal internal genitalia. The prostate is hypoplastic, nonpalpable on rectal examination and approximately 1/10th the size of age-matched normal glands. Benign prostate hyperplasia or prostate cancer does not develop in these patients. At puberty, the external genitalia virilize partially, however, secondary sexual hair remains sparse and male pattern baldness and acne develop rarely. Several compounds have been developed to inhibit the 5 alpha-reductase isozymes and they play an important role in the prevention and treatment of many common diseases. This review describes the basic biochemical properties, functions, tissue distribution, chromosomal location, and clinical significance of the 5 alpha-reductase isozyme family.

  4. Immunostimulatory effects of natural human interferon-alpha (huIFN-alpha) on carps Cyprinus carpio L.

    Science.gov (United States)

    Watanuki, Hironobu; Chakraborty, Gunimala; Korenaga, Hiroki; Kono, Tomoya; Shivappa, R B; Sakai, Masahiro

    2009-10-15

    Human interferon-alpha (huIFN-alpha) is an important immunomodulatory substance used in the treatment and prevention of numerous infectious and immune-related diseases in animals. However, the immunostimulatory effects of huIFN-alpha in fish remain to be investigated. In the current study, the immune responses of the carp species Cyprinus carpio L. to treatment with huIFN-alpha were analyzed via measurement of superoxide anion production, phagocytic activity and the expression of cytokine genes including interleukin-1beta, tumor necrosis factor-alpha and interleukin 10. Low doses of huIFN-alpha were administered orally once a day for 3 days, and sampling was carried out at 1, 3 and 5 days post-treatment. Our results indicate that a low dose of huIFN-alpha significantly increased phagocytic activity and superoxide anion production in the carp kidney. The huIFN-alpha-treated fish also displayed a significant upregulation in cytokine gene expression. The current study demonstrates the stimulatory effects of huIFN-alpha on the carp immune system and highlights the immunomodulatory role of huIFN-alpha in fish.

  5. Alternative splicing of T cell receptor (TCR) alpha chain transcripts containing V alpha 1 or V alpha 14 elements.

    Science.gov (United States)

    Mahotka, C; Hansen-Hagge, T E; Bartram, C R

    1995-10-01

    Human acute lymphoblastic leukemia cell lines represent valuable tools to investigate distinct steps of the complex regulatory pathways underlying T cell receptor recombination and expression. A case in point are V delta 2D delta 3 and subsequent V delta 2D delta 3J alpha rearrangements observed in human leukemic pre-B cells as well as in normal lymphopoiesis. The functional expression of these unusual (VD) delta (JC) alpha hybrids is almost exclusively prevented by alternative splicing events. In this report we show that alternative splicing at cryptic splice donor sites within V elements is not a unique feature of hybrid TCR delta/alpha transcripts. Among seven V alpha families analyzed by RT-PCR, alternatively spliced products were observed in TCR alpha recombinations containing V alpha 1 or V alpha 14 elements. In contrast to normal peripheral blood cells and thymocytes, the leukemia cell line JM expressing functional V alpha 1J alpha 3C alpha transcripts lacked evidence of aberrant TCR alpha RNA species.

  6. Identification of a novel bile acid in swans, tree ducks, and geese: 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid.

    Science.gov (United States)

    Kakiyama, Genta; Iida, Takashi; Goto, Takaaki; Mano, Nariyasu; Goto, Junichi; Nambara, Toshio; Hagey, Lee R; Schteingart, Claudio D; Hofmann, Alan F

    2006-07-01

    By HPLC, a taurine-conjugated bile acid with a retention time different from that of taurocholate was found to be present in the bile of the black-necked swan, Cygnus melanocoryphus. The bile acid was isolated and its structure, established by (1)H and (13)C NMR and mass spectrometry, was that of the taurine N-acyl amidate of 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid. The compound was shown to have chromatographic and spectroscopic properties that were identical to those of the taurine conjugate of authentic 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid, previously synthesized by us from ursodeoxycholic acid. By HPLC, the taurine conjugate of 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid was found to be present in 6 of 6 species in the subfamily Dendrocygninae (tree ducks) and in 10 of 13 species in the subfamily Anserinae (swans and geese) but not in other subfamilies in the Anatidae family. It was also not present in species from the other two families of the order Anseriformes. 3alpha,7alpha,15alpha-Trihydroxy-5beta-cholan-24-oic acid is a new primary bile acid that is present in the biliary bile acids of swans, tree ducks, and geese and may be termed 15alpha-hydroxy-chenodeoxycholic acid.

  7. Hepatic gene expression profiling using GeneChips in zebrafish exposed to 17{alpha}-methyldihydrotestosterone

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, J.L.; Thomason, R.G.; Lee, D.M.; Brill, J.L.; Price, B.B.; Carr, G.J. [Miami Valley Innovation Center, Procter and Gamble Company, P.O. Box 538707, Cincinnati, OH 45253-8707 (United States); Versteeg, D.J. [Miami Valley Innovation Center, Procter and Gamble Company, P.O. Box 538707, Cincinnati, OH 45253-8707 (United States)], E-mail: versteeg.dj@pg.com

    2008-04-28

    Concentration and time-dependent changes in hepatic gene expression were examined in adult, female zebrafish (Danio rerio) exposed to 0, 0.1, 0.7, 4.9 {mu}g/L of a model androgen, 17{alpha}-methyldihydrotestosterone (MDHT). At 24 and 168 h, fish were sacrificed and liver was extracted for gene expression analysis using custom Affymetrix GeneChip Zebrafish Genome Microarrays. In an effort to link gene expression changes to higher levels of biological organization, blood was collected for measurement of plasma steroid hormones (17{beta}-estradiol (E2), testosterone (T)) and vitellogenin (VTG) using ELISA. Body and ovary weight were also measured. A significant reduction in E2 occurred at 24 h (0.7 and 4.9 {mu}g/L) and 168 h (4.9 {mu}g/L) following MDHT exposure. In contrast, T was significantly increased at 24 h (4.9 {mu}g/L) and 168 h (0.1, 0.7, 4.9 {mu}g/L). 171 and 575 genes were significantly affected in a concentration-dependent manner at either 24 or 168 h by MDHT exposure at p {<=} 0.001 and p {<=} 0.01, respectively. Genes involved in retinoic acid metabolism (e.g. aldehyde dehydrogenase 8, member A1; retinol dehydrogenase 12), steroid biosynthesis and metabolism (e.g. hydroxysteroid (11{beta}) dehydrogenase 2; hydroxy-delta-5-steroid dehydrogenase, 3 beta-), hormone transport (e.g. sex hormone binding globulin), and regulation of cell growth and proliferation (e.g. N-myc downstream regulated gene 1; spermidinespermine N(1)-acetyltransferase) were affected by MDHT exposure. In this study, we identified genes involved in a variety of biological processes that have the potential to be used as markers of exposure to androgenic substances. Genes identified in this study provide information on the potential mode of action of strong androgens in female fish. In addition, when used for screening of EDC's, these genes may also serve as sensitive markers of exposure to androgenic compounds.

  8. Differential stimulation by CCAAT/enhancer-binding protein alpha isoforms of the estrogen-activated promoter of the very-low-density apolipoprotein II gene

    NARCIS (Netherlands)

    Calkhoven, CF; Snippe, L; Ab, G

    1997-01-01

    The transcription factors CCAAT/enhancer-binding proteins alpha and beta (C/EBP alpha and C/EBP beta) are highly expressed in liver and are believed to function in maintaining the differentiated state of the hepatocytes, C/EBP alpha appears to be a critical regulator of genes involved in metabolic

  9. Co-regulation of the atrial natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identification of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression.

    Science.gov (United States)

    Knowlton, K U; Baracchini, E; Ross, R S; Harris, A N; Henderson, S A; Evans, S M; Glembotski, C C; Chien, K R

    1991-04-25

    To study the mechanisms which mediate the transcriptional activation of cardiac genes during alpha adrenergic stimulation, the present study examined the regulated expression of three cardiac genes, a ventricular embryonic gene (atrial natriuretic factor, ANF), a constitutively expressed contractile protein gene (cardiac MLC-2), and a cardiac sodium channel gene. alpha 1-Adrenergic stimulation activates the expression and release of ANF from neonatal ventricular cells. As assessed by RNase protection analyses, treatment with alpha-adrenergic agonists increases the steady-state levels of ANF mRNA by greater than 15-fold. However, a rat cardiac sodium channel gene mRNA is not induced, indicating that alpha-adrenergic stimulation does not lead to an increase in the expression of all cardiac genes. Studies employing a series of rat ANF luciferase and rat MLC-2 luciferase fusion genes identify 315- and 92-base pair cis regulatory sequences within an embryonic gene (ANF) and a constitutively expressed contractile protein gene (MLC-2), respectively, which mediate alpha-adrenergic-inducible gene expression. Transfection of various ANF luciferase reporters into neonatal rat ventricular cells demonstrated that upstream sequences which mediate tissue-specific expression (-3003 to -638) can be segregated from those responsible for inducibility. The lack of inducibility of a cardiac Na+ channel gene, and the segregation of ANF gene sequences which mediate cardiac specific from those which mediate inducible expression, provides further insight into the relationship between muscle-specific and inducible expression during cardiac myocyte hypertrophy. Based on these results, a testable model is proposed for the induction of embryonic cardiac genes and constitutively expressed contractile protein genes and the noninducibility of a subset of cardiac genes during alpha-adrenergic stimulation of neonatal rat ventricular cells.

  10. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  11. Mapping of the serotonin 5-HT{sub 1D{alpha}} autoreceptor gene (HTR1D) on chromosome 1 using a silent polymorphism in the coding region

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, N.; Lappalainen, J.; Linnoila, M. [National Institute on Alcohol Abuse and Alcoholism, Rockville, MD (United States)] [and others

    1995-04-24

    Serotonin (5-HT){sub ID} receptors are 5-HT release-regulating autoreceptors in the human brain. Abnormalities in brain 5-HT function have been hypothesized in the pathophysiology of various psychiatric disorders, including obsessive-compulsive disorder, autism, mood disorders, eating disorders, impulsive violent behavior, and alcoholism. Thus, mutations occurring in 5-HT autoreceptors may cause or increase the vulnerability to any of these conditions. 5-HT{sub 1D{alpha}} and 5-HT{sub 1D{Beta}} subtypes have been previously localized to chromosomes 1p36.3-p34.3 and 6q13, respectively, using rodent-human hybrids and in situ localization. In this communication, we report the detection of a 5-HT{sub 1D{alpha}} receptor gene polymorphism by single strand conformation polymorphism (SSCP) analysis of the coding sequence. The polymorphism was used for fine scale linkage mapping of 5-HT{sub 1D{alpha}} on chromosome 1. This polymorphism should also be useful for linkage studies in populations and in families. Our analysis also demonstrates that functionally significant coding sequence variants of the 5-HT{sub 1D{alpha}} are probably not abundant either among alcoholics or in the general population. 14 refs., 1 fig., 1 tab.

  12. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  13. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  14. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  15. Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

    Directory of Open Access Journals (Sweden)

    Elza Miyuki Kimura

    2015-04-01

    Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

  16. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  17. Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

    Science.gov (United States)

    Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

    2009-12-01

    Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

  18. Two novel, putatively cell wall-associated and glycosylphosphatidylinositol-anchored alpha-glucanotransferase enzymes of Aspergillus niger.

    Science.gov (United States)

    van der Kaaij, R M; Yuan, X-L; Franken, A; Ram, A F J; Punt, P J; van der Maarel, M J E C; Dijkhuizen, L

    2007-07-01

    In the genome sequence of Aspergillus niger CBS 513.88, three genes were identified with high similarity to fungal alpha-amylases. The protein sequences derived from these genes were different in two ways from all described fungal alpha-amylases: they were predicted to be glycosylphosphatidylinositol anchored, and some highly conserved amino acids of enzymes in the alpha-amylase family were absent. We expressed two of these enzymes in a suitable A. niger strain and characterized the purified proteins. Both enzymes showed transglycosylation activity on donor substrates with alpha-(1,4)-glycosidic bonds and at least five anhydroglucose units. The enzymes, designated AgtA and AgtB, produced new alpha-(1,4)-glycosidic bonds and therefore belong to the group of the 4-alpha-glucanotransferases (EC 2.4.1.25). Their reaction products reached a degree of polymerization of at least 30. Maltose and larger maltooligosaccharides were the most efficient acceptor substrates, although AgtA also used small nigerooligosaccharides containing alpha-(1,3)-glycosidic bonds as acceptor substrate. An agtA knockout of A. niger showed an increased susceptibility towards the cell wall-disrupting compound calcofluor white, indicating a cell wall integrity defect in this strain. Homologues of AgtA and AgtB are present in other fungal species with alpha-glucans in their cell walls, but not in yeast species lacking cell wall alpha-glucan. Possible roles for these enzymes in the synthesis and/or maintenance of the fungal cell wall are discussed.

  19. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  20. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  1. Regulation of gene expression by dietary Ca2+ in kidneys of 25-hydroxyvitamin D3-1 alpha-hydroxylase knockout mice.

    NARCIS (Netherlands)

    Hoenderop, J.G.J.; Chon, H.; Gkika, D.; Bluyssen, H.A.; Holstege, F.C.; St. Arnaud, R.; Braam, B.; Bindels, R.J.M.

    2004-01-01

    BACKGROUND: Pseudovitamin D deficiency rickets (PDDR) is an autosomal disease, characterized by undetectable levels of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), rickets and secondary hyperparathyroidism. Mice in which the 25-hydroxyvitamin D3-1 alpha-hydroxylase (1 alpha-OHase) gene was inactivated,

  2. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  3. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  4. Genetic diversity of plasmodium vivax merozoite surface protein-3alpha (Pvmsp-3alpha) gene in Jhapa District of Nepal

    DEFF Research Database (Denmark)

    Adhikari, Madhav; Ranjitkar, Samir; Schousboe, Mette Leth

    2012-01-01

    In Nepal, Plasmodium vivax accounts for approximately 80-90% of the malaria cases, but limited studies have been conducted on the genetic diversity of this parasite population. This study was carried out to determine the genetic diversity of P. vivax population sampled from subjects living...... in an endemic area of Jhapa District by analyzing the polymorphic merozoite surface protein-3alpha (Pvmsp-3alpha) gene by using PCR-restriction fragment length polymorphism. Three distinct genotypes were obtained from 96 samples; type A: 40 (71%), type B: 7 (13%), and type C: 9 (16%) which could be categorized...... into 13 allelic patterns: A1-A9, B1, B2, C1 and C2. These results indicated a high genetic diversity within the studied P. vivax population. As the transmission rate of malaria is low in Nepal, the diversity is most likely due to migration of people between the malaria endemic regions, either within...

  5. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  6. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  7. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  8. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  9. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  10. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  11. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  12. Gene targeted therapeutics for liver disease in alpha-1 antitrypsin deficiency

    Directory of Open Access Journals (Sweden)

    Caitriona McLean

    2009-01-01

    Full Text Available Caitriona McLean*, Catherine M Greene*, Noel G McElvaneyRespiratory Research Division, Dept. Medicine, Royal College of Surgeons in Ireland, Education and Research Centre, Beaumont Hospital, Dublin 9, Ireland; *Each of these authors contributed equally to this workAbstract: Alpha-1 antitrypsin (A1AT is a 52 kDa serine protease inhibitor that is synthesized in and secreted from the liver. Although it is present in all tissues in the body the present consensus is that its main role is to inhibit neutrophil elastase in the lung. A1AT deficiency occurs due to mutations of the A1AT gene that reduce serum A1AT levels to <35% of normal. The most clinically significant form of A1AT deficiency is caused by the Z mutation (Glu342Lys. ZA1AT polymerizes in the endoplasmic reticulum of liver cells and the resulting accumulation of the mutant protein can lead to liver disease, while the reduction in circulating A1AT can result in lung disease including early onset emphysema. There is currently no available treatment for the liver disease other than transplantation and therapies for the lung manifestations of the disease remain limited. Gene therapy is an evolving field which may be of use as a treatment for A1AT deficiency. As the liver disease associated with A1AT deficiency may represent a gain of function possible gene therapies for this condition include the use of ribozymes, peptide nucleic acids (PNAs and RNA interference (RNAi, which by decreasing the amount of aberrant protein in cells may impact on the pathogenesis of the condition.Keywords: alpha-1 antitrypsin deficiency, siRNA, peptide nucleic acid, ribozymes

  13. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  14. Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.

    Science.gov (United States)

    Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

    2016-07-21

    Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.

  15. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  16. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  17. [Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].

    Science.gov (United States)

    Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki

    2007-01-01

    Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

  18. Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.

    Science.gov (United States)

    Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E

    1992-01-01

    In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249

  19. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  20. EIF4A2 is a positional candidate gene at the 3q27 locus linked to type 2 diabetes in French families

    DEFF Research Database (Denmark)

    Cheyssac, Claire; Dina, Christian; Leprêtre, Frédéric

    2006-01-01

    .01 at D3S3686, P = 0.0001) was identified in a set of French families. To assess genetic variation underlying both age-of-onset QTL and our previous type 2 diabetes linkage in a 3.87-Mb interval, we explored 36 single nucleotide polymorphisms (SNPs) in two biologically relevant candidate genes for glucose...... homeostasis, kininogen (KNG1), and eukaryotic translation initiation factor 4alpha2 (EIF4A2). Analysis of 148 families showed significant association of a frequent SNP, rs266714, located 2.47 kb upstream of EIF4A2, with familial type 2 diabetes (family-based association test, P = 0.0008) and early age......RNA translation and protein synthesis rate in pancreatic beta-cells, and our data indicates that EIF4A2 is downregulated by high glucose in rat beta-INS832/13 cells. The potential role of EIF4A2 in glucose homeostasis and its putative contribution to type 2 diabetes in the presence of metabolic stress...

  1. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  2. Unintended changes in protein expression revealed by proteomic analysis of seeds from transgenic pea expressing a bean alpha-amylase inhibitor gene.

    Science.gov (United States)

    Chen, Hancai; Bodulovic, Greg; Hall, Prudence J; Moore, Andy; Higgins, Thomas J V; Djordjevic, Michael A; Rolfe, Barry G

    2009-09-01

    Seeds of genetically modified (GM) peas (Pisum sativum L.) expressing the gene for alpha-amylase inhibitor-1 (alphaAI1) from the common bean (Phaseolus vulgaris L. cv. Tendergreen) exhibit resistance to the pea weevil (Bruchus pisorum). A proteomic analysis was carried out to compare seeds from GM pea lines expressing the bean alphaAI1 protein and the corresponding alphaAI1-free segregating lines and non-GM parental line to identify unintended alterations to the proteome of GM peas due to the introduction of the gene for alphaAI1. Proteomic analysis showed that in addition to the presence of alphaAI1, 33 other proteins were differentially accumulated in the alphaAI1-expressing GM lines compared with their non-GM parental line and these were grouped into five expression classes. Among these 33 proteins, only three were found to be associated with the expression of alphaAI1 in the GM pea lines. The accumulation of the remaining 30 proteins appears to be associated with Agrobacterium-mediated transformation events. Sixteen proteins were identified after MALDI-TOF-TOF analysis. About 56% of the identified proteins with altered accumulation in the GM pea were storage proteins including legumin, vicilin or convicilin, phaseolin, cupin and valosin-containing protein. Two proteins were uniquely expressed in the alphaAI1-expressing GM lines and one new protein was present in both the alphaAI1-expressing GM lines and their alphaAI1-free segregating lines, suggesting that both transgenesis and transformation events led to demonstrable changes in the proteomes of the GM lines tested.

  3. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  4. Molecular cloning of rock bream (Oplegnathus fasciatus) tumor necrosis factor-alpha and its effect on the respiratory burst activity of phagocytes.

    Science.gov (United States)

    Kim, Min Sun; Hwang, Yoon Jung; Yoon, Ki Joon; Zenke, Kosuke; Nam, Yoon Kwon; Kim, Sung Koo; Kim, Ki Hong

    2009-11-01

    Rock bream (Oplegnathus fasciatus) tumor necrosis factor-alpha (rbTNF-alpha) gene was cloned, recombinantly produced, and the effect of the recombinant rbTNF-alpha on the respiratory burst activity of rock bream phagocytes was analyzed. Structurally, genomic DNA of rbTNF-alpha was comprised with four exons and three introns, and deduced amino acid sequence of its cDNA possessed the TNF family signature, a transmembrane domain, a protease cleavage site, and two cysteine residues, which are the typical characteristics of TNF-alpha gene in mammals and fish. The chemiluminescent (CL) response of rock bream phagocytes was significantly enhanced by pre-incubation with recombinant rbTNF-alpha, when opsonized zymosan was used as a stimulant of the respiratory burst. However, CL enhancing effect of the recombinant rbTNF-alpha was very weak when the respiratory burst activity of phagocytes was triggered with phorbol-12-myristate-13-acetate (PMA) instead of zymosan. These results suggest that rock bream TNF-alpha might have an ability to prime the respiratory burst activity of phagocytes against receptor-mediated phagocytosis inducing stimulants, such as zymosan, but have little ability against stimulants not accompanying receptor-mediated phagocytosis.

  5. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  6. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  7. Accurate measurement of gene copy number for human alpha-defensin DEFA1A3.

    Science.gov (United States)

    Khan, Fayeza F; Carpenter, Danielle; Mitchell, Laura; Mansouri, Omniah; Black, Holly A; Tyson, Jess; Armour, John A L

    2013-10-20

    Multi-allelic copy number variants include examples of extensive variation between individuals in the copy number of important genes, most notably genes involved in immune function. The definition of this variation, and analysis of its impact on function, has been hampered by the technical difficulty of large-scale but accurate typing of genomic copy number. The copy-variable alpha-defensin locus DEFA1A3 on human chromosome 8 commonly varies between 4 and 10 copies per diploid genome, and presents considerable challenges for accurate high-throughput typing. In this study, we developed two paralogue ratio tests and three allelic ratio measurements that, in combination, provide an accurate and scalable method for measurement of DEFA1A3 gene number. We combined information from different measurements in a maximum-likelihood framework which suggests that most samples can be assigned to an integer copy number with high confidence, and applied it to typing 589 unrelated European DNA samples. Typing the members of three-generation pedigrees provided further reassurance that correct integer copy numbers had been assigned. Our results have allowed us to discover that the SNP rs4300027 is strongly associated with DEFA1A3 gene copy number in European samples. We have developed an accurate and robust method for measurement of DEFA1A3 copy number. Interrogation of rs4300027 and associated SNPs in Genome-Wide Association Study SNP data provides no evidence that alpha-defensin copy number is a strong risk factor for phenotypes such as Crohn's disease, type I diabetes, HIV progression and multiple sclerosis.

  8. Experimental study on the effects of recombinant adenoviral-mediated mI{kappa}B{alpha} gene combined with irradiation on the treatment of hepatocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Kejun, Zhang; Dechun, Li; Dongming, Zhu [The First Affiliated Hospital to Suzhou Univ., Suzhou (China); Caixia, Song

    2007-10-15

    Objective: To explore the effect of recombinant adenovirus vector mediated mutant I{kappa}B{alpha} (mI{kappa}B{alpha}) combined with radiation on the hepatocarcinoma. Methods: Limited dilution method was used to test the virus titer in 293 cells. The HCC9204 cells were infected with MOI 10,20,30 and 50 for 48 h, respectively. The expression of p65 and mI{kappa}B{alpha} protein was analyzed by Western blot. Transfected HCC9204 cells and controls were treated with 4 Gy {gamma} rays. The inhibition rate of HCC9204 cells was examined by MTT. Rat models of HCC9204 was constructed. AdmI{kappa}B{alpha} plasmids were injected into tumor tissue and the tumors were administered with 6 Gy {gamma} irradiation 48 hours later. Tumor growth at different time points was recorded during 28 days. Results: The titer of AdmI{kappa}B{alpha} is 1.252 x 10{sup 9} pfu/ml. The expression of mI{kappa}B{alpha} protein was increased with titer of AdmI{kappa}B{alpha}, and p65 protein began to decrease when MOI was 10, and reached the lowest when MOI was 50, they were all dose-dependent. The proliferation of HCC9204 cell lines were suppressed, as was more significant combined with radiation, and the effect was in a viral dose-dependent manner. From days 7 to 28 after AdmI{kappa}B{alpha} gene and radiotherapy, the tumor growth was significantly slower than after irradiation or gene therapy alone. Conclusions: Recombinant adenoviral-mediated mI{kappa}B{alpha} gene, combined with irradiation, can increase the cell-killing effect. It is better than that of either one alone. (authors)

  9. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  10. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Genetic analysis of the estrogen-related receptor alpha and studies of association with obesity and type 2 diabetes

    DEFF Research Database (Denmark)

    Larsen, L H; Rose, C S; Sparsø, T

    2007-01-01

    The estrogen-related receptor alpha (ERRalpha or NR3B1) is a transcription factor from the nuclear receptor super-family, group III. The gene encoding ERRalpha (ESRRA) is located on chromosome 11q13, a region showing genetic linkage to body mass index and fat percentage. Through interaction...

  12. Phospholipase C produced by Clostridium botulinum types C and D: comparison of gene, enzymatic, and biological activities with those of Clostridium perfringens alpha-toxin.

    Science.gov (United States)

    Fatmawati, Ni Nengah Dwi; Sakaguchi, Yoshihiko; Suzuki, Tomonori; Oda, Masataka; Shimizu, Kenta; Yamamoto, Yumiko; Sakurai, Jun; Matsushita, Osamu; Oguma, Keiji

    2013-01-01

    Clostridium botulinum type C and D strains recently have been found to produce PLC on egg yolk agar plates. To characterize the gene, enzymatic and biological activities of C. botulinum PLCs (Cb-PLCs), the cb-plc genes from 8 strains were sequenced, and 1 representative gene was cloned and expressed as a recombinant protein. The enzymatic and hemolytic activities of the recombinant Cb-PLC were measured and compared with those of the Clostridium perfringens alpha-toxin. Each of the eight cb-plc genes encoded a 399 amino acid residue protein preceded by a 27 residue signal peptide. The protein consists of 2 domains, the N- and C-domains, and the overall amino acid sequence identity between Cb-PLC and alpha-toxin was greater than 50%, suggesting that Cb-PLC is homologous to the alpha-toxin. The key residues in the N-domain were conserved, whereas those in the C-domain which are important in membrane interaction were different than in the alpha-toxin. As expected, Cb-PLC could hydrolyze egg yolk phospholipid, p-nitrophenylphosphorylcholine, and sphingomyelin, and also exhibited hemolytic activity;however, its activities were about 4- to over 200-fold lower than those of alpha-toxin. Although Cb-PLC showed weak enzymatic and biological activities, it is speculated that Cb-PLC might play a role in the pathogenicity of botulism or for bacterial survival.

  13. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  14. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  15. PGC-1{beta} regulates mouse carnitine-acylcarnitine translocase through estrogen-related receptor {alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Gacias, Mar; Perez-Marti, Albert; Pujol-Vidal, Magdalena; Marrero, Pedro F. [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain); Haro, Diego, E-mail: dharo@ub.edu [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain); Relat, Joana [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer The Cact gene is induced in mouse skeletal muscle after 24 h of fasting. Black-Right-Pointing-Pointer The Cact gene contains a functional consensus sequence for ERR. Black-Right-Pointing-Pointer This sequence binds ERR{alpha} both in vivo and in vitro. Black-Right-Pointing-Pointer This ERRE is required for the activation of Cact expression by the PGC-1/ERR axis. Black-Right-Pointing-Pointer Our results add Cact as a genuine gene target of these transcriptional regulators. -- Abstract: Carnitine/acylcarnitine translocase (CACT) is a mitochondrial-membrane carrier proteins that mediates the transport of acylcarnitines into the mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. CACT deficiency causes a variety of pathological conditions, such as hypoketotic hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and it can be fatal in newborns and infants. Here we report that expression of the Cact gene is induced in mouse skeletal muscle after 24 h of fasting. To gain insight into the control of Cact gene expression, we examine the transcriptional regulation of the mouse Cact gene. We show that the 5 Prime -flanking region of this gene is transcriptionally active and contains a consensus sequence for the estrogen-related receptor (ERR), a member of the nuclear receptor family of transcription factors. This sequence binds ERR{alpha}in vivo and in vitro and is required for the activation of Cact expression by the peroxisome proliferator-activated receptor gamma coactivator (PGC)-1/ERR axis. We also demonstrate that XTC790, the inverse agonist of ERR{alpha}, specifically blocks Cact activation by PGC-1{beta} in C2C12 cells.

  16. A family with Wagner syndrome with uveitis and a new versican mutation

    OpenAIRE

    Rothschild, Pierre-Rapha?l; Br?zin, Antoine P.; Nedelec, Brigitte; des Roziers, Cyril Burin; Ghiotti, Tiffany; Orhant, Lucie; Boimard, Mathieu; Valleix, Sophie

    2013-01-01

    Purpose To report the clinical and molecular findings of a kindred with Wagner syndrome (WS) revealed by intraocular inflammatory features. Methods Eight available family members underwent complete ophthalmologic examination, including laser flare cell meter measurements. Collagen, type II, alpha 1, versican (VCAN), frizzled family receptor 4, low density lipoprotein receptor-related protein 5, tetraspanin 12, and Norrie disease (pseudoglioma) genes were screened with direct sequencing. Resul...

  17. Founder Fukutin mutation causes Walker-Warburg syndrome in four Ashkenazi Jewish families.

    Science.gov (United States)

    Chang, Wendy; Winder, Thomas L; LeDuc, Charles A; Simpson, Lynn L; Millar, William S; Dungan, Jeffrey; Ginsberg, Norman; Plaga, Stacey; Moore, Steven A; Chung, Wendy K

    2009-06-01

    Walker-Warburg syndrome (WWS) is a genetically heterogeneous congenital muscular dystrophy caused by abnormal glycosylation of alpha-dystroglycan (alpha-DG) that is associated with brain malformations and eye anomalies. The Fukutin (FKTN) gene, which causes autosomal recessively inherited WWS is most often associated with Fukuyama congenital muscular dystrophy in Japan. We describe the clinical features of four nonconsanguinous Ashkenazi Jewish families with WWS and identify the underlying genetic basis for WWS. We screened for mutations in POMGnT1, POMT1, POMT2, and FKTN, genes causing WWS, by dideoxy sequence analysis. We identified an identical homozygous c.1167insA mutation in the FKTN gene on a common haplotype in all four families and identified 2/299 (0.7%) carriers for the c.1167insA mutation among normal American Ashkenazi Jewish adults. These data suggest that the c.1167insA FKTN mutation described by us is a founder mutation that can be used to target diagnostic testing and carrier screening in the Ashkenazi Jewish population. Copyright (c) 2009 John Wiley & Sons, Ltd.

  18. Differential Effects of Alpha-Particle Radiation and X-Irradiation on Genes Associated with Apoptosis

    International Nuclear Information System (INIS)

    Chauhan, V.; Howland, M.; Chen, J.; Kutzner, B.; Wilkins, R.C.

    2011-01-01

    This study examined differential effects of alpha-(α) particle radiation and X-rays on apoptosis and associated changes in gene expression. Human monocytic cells were exposed to a-particle radiation and X-rays from 0 to 1.5 Gy. Four days postexposure, cell death was measured by flow cytometry and 84 genes related to apoptosis were analyzed using real-time PCR. On average, 33% of the cells were apoptotic at 1.5 Gy of a-particle radiation. Transcript profiling showed statistical expression of 15 genes at all three doses tested. Cells exposed to X-rays were <5% apoptotic at ∼1.5 Gy and induced less than a 2-fold expression in 6 apoptotic genes at the higher doses of radiation. Among these 6 genes, Fas and TNF-α were common to the α-irradiated cells. This data suggests that α-particle radiation initiates cell death by TNF-a and Fas activation and through intermediate signalling mediators that are distinct from X-irradiated cells

  19. Inducible alpha-synuclein overexpression affects human Neural Stem Cells behavior

    OpenAIRE

    Conti, Luciano; Zasso, Jacopo; Cutarelli, Alessandro; Ahmed, Mastad

    2018-01-01

    Converging evidence suggest that levels of alpha-Synuclein (aSyn) expression play a critical role in Parkinson's disease (PD). Several mutations of the SNCA gene, encoding for aSyn have been associated to either the familial or the sporadic forms of PD. Nonetheless, the mechanism underlying wild type aSyn-mediated neurotoxicity in neuronal cells as well as its specific driving role in PD pathogenesis has yet to be fully clarified. In this view, the development of proper in vitro cellular syst...

  20. Mapping of the human cone transducin {alpha} subunit (GNAT2) gene to 1p13 and mutation analysis in patients with Stargardt`s disease

    Energy Technology Data Exchange (ETDEWEB)

    Magovcevic, I.; Weremowicz, S.; Morton, C.C. [Harvard Medical School, Boston, MA (United States)] [and others

    1994-09-01

    Transducin {alpha} subunits are members of a large family of G-proteins and play an important role in phototransduction in rod and cone photoreceptors. We report the localization of the human cone {alpha} transducin (GNAT2) gene using fluorescence in situ hybridization (FISH) on chromosome 1 in band p13. The recent assignment of a gene for Stargardt`s disease to the same chromosomal region by linkage analysis prompted us to investigate the possible role of GNAT2 in the pathogenesis of this disease. Stargardt`s disease is characterized by degeneration in late childhood or early adulthood of the macula of the retina, a region rich in cones. We screened patients with Stargardt`s disease, with or without peripheral cone involvement as monitored by the full-field ERG, for mutations in this gene. We investigated 66 unrelated patients including 22 with peripheral cone dysfunction for mutations in the coding region of the GNAT2 gene using polymerase chain reaction-single strand conformation polymorphism analysis (SSCP) and direct sequencing. One patient (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two patients, one (035-005) with peripheral cone involvement and one (071-001) without peripheral cone involvement, were heterozygous for the missense change Val124Met (GTG to ATG) in exon IV. A subsequent screen of 96 unrelated, unaffected controls revealed one individual (N10) who was also heterozygous for the Val124Met alteration. We concluded that Asp238Asp and Val124Met are rare variants not causing Stargardt`s disease. Hence, no disease-specific mutations were found indicating that GNAT2 is probably not involved in the pathogenesis of most cases of Stargardt`s disease.

  1. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  2. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  3. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  4. Alpha-1 antitrypsin protein and gene therapies decrease autoimmunity and delay arthritis development in mouse model

    Directory of Open Access Journals (Sweden)

    Atkinson Mark A

    2011-02-01

    Full Text Available Abstract Background Alpha-1 antitrypsin (AAT is a multi-functional protein that has anti-inflammatory and tissue protective properties. We previously reported that human AAT (hAAT gene therapy prevented autoimmune diabetes in non-obese diabetic (NOD mice and suppressed arthritis development in combination with doxycycline in mice. In the present study we investigated the feasibility of hAAT monotherapy for the treatment of chronic arthritis in collagen-induced arthritis (CIA, a mouse model of rheumatoid arthritis (RA. Methods DBA/1 mice were immunized with bovine type II collagen (bCII to induce arthritis. These mice were pretreated either with hAAT protein or with recombinant adeno-associated virus vector expressing hAAT (rAAV-hAAT. Control groups received saline injections. Arthritis development was evaluated by prevalence of arthritis and arthritic index. Serum levels of B-cell activating factor of the TNF-α family (BAFF, antibodies against both bovine (bCII and mouse collagen II (mCII were tested by ELISA. Results Human AAT protein therapy as well as recombinant adeno-associated virus (rAAV8-mediated hAAT gene therapy significantly delayed onset and ameliorated disease development of arthritis in CIA mouse model. Importantly, hAAT therapies significantly reduced serum levels of BAFF and autoantibodies against bCII and mCII, suggesting that the effects are mediated via B-cells, at least partially. Conclusion These results present a new drug for arthritis therapy. Human AAT protein and gene therapies are able to ameliorate and delay arthritis development and reduce autoimmunity, indicating promising potential of these therapies as a new treatment strategy for RA.

  5. Examination of chromosome 7p22 candidate genes RBaK, PMS2 and GNA12 in familial hyperaldosteronism type II.

    Science.gov (United States)

    Jeske, Y W A; So, A; Kelemen, L; Sukor, N; Willys, C; Bulmer, B; Gordon, R D; Duffy, D; Stowasser, M

    2008-04-01

    1. There are two types of familial hyperaldosteronism (FH): FH-I and FH-II. FH-I is caused by a hybrid CYP11B1/CYP11B2 gene mutation. The genetic cause of FH-II, which is more common, is unknown. Adrenal hyperplasia and adenomas are features. We previously reported linkage of FH-II to a approximately 5 Mb region on chromosome 7p22. We subsequently reported finding no causative mutations in the retinoblastoma-associated Kruppel-associated box gene (RBaK), a candidate at 7p22 involved in tumorigenesis and cell cycle control. 2. In the current study we investigated RBaK regulatory regions and two other candidate genes: postmeiotic segregation increased 2 (PMS2, involved in DNA mismatch repair and tumour predisposition) and guanine nucleotide-binding protein alpha-12 (GNA12, a transforming oncogene). 3. The GNA12 and PMS2 genes were examined in two affected (A1, A2) and two unaffected (U1, U2) subjects from a large 7p22-linked FH-II family (family 1). No mutations were found. 4. The RBaK and PMS2 distal promoters were sequenced to -2150 bp from the transcription start site for RBaK and-2800 bp for PMS2. Five unreported single nucleotide polymorphisms (SNPs) were found in subjects A1, A2 but not in U1 or U2; A(-2031 bp)T, T(-2030 bp)G, G(-834 bp)C, C(-821 bp)G in RBaK and A(-876 bp)G in PMS2. Additional affected and unaffected subjects from family 1 and from two other 7p22-linked FH-II families and 58 unrelated normotensive control subjects were genotyped for these SNPs. 5. The five novel SNPs were found to be present in a significant proportion of normotensive controls. The four RBaK promoter SNPs were found to be in linkage disequilibrium in the normal population. The RBaK promoter (-)2031T/2030G/834C/821T allele was found to be in linkage disequilibrium with the causative mutation in FH-II family 1, but not in families 2 and 3. The PMS2 promoter (-)876G allele was also found to be linked to affected phenotypes in family 1. 6. The RBaK and PMS2 promoter SNPs alter the

  6. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  7. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  8. Differential regulation of the PGC family of genes in a mouse model of Staphylococcus aureus sepsis.

    Directory of Open Access Journals (Sweden)

    Timothy E Sweeney

    2010-07-01

    Full Text Available The PGC family of transcriptional co-activators (PGC-1alpha [Ppargc1a], PGC-1beta [Ppargc1b], and PRC [Pprc] coordinates the upregulation of mitochondrial biogenesis, and Ppargc1a is known to be activated in response to mitochondrial damage in sepsis. Therefore, we postulated that the PGC family is regulated by the innate immune system. We investigated whether mitochondrial biogenesis and PGC gene expression are disrupted in an established model of Staphylococcus aureus sepsis both in mice with impaired innate immune function (TLR2-/- and TLR4-/- and in wild-type controls. We found an early up-regulation of Ppargc1a and Ppargc1b post-infection (at 6 h in WT mice, but the expression of both genes was concordantly dysregulated in TLR2-/- mice (no increase at 6 h and in TLR4-/- mice (amplified at 6 h. However, the third family member, PRC, was regulated differently, and its expression increased significantly at 24 h in all three mouse strains (WT, TLR2-/-, and TLR4-/-. In silico analyses showed that Ppargc1a and Ppargc1b share binding sites for microRNA mmu-mir-202-3p. Thus, miRNA-mediated post-transcriptional mRNA degradation could account for the failure to increase the expression of both genes in TLR2-/- mice. The expression of mmu-mir-202-3p was measured by real-time PCR and found to be significantly increased in TLR2-/- but not in WT or TLR4-/- mice. In addition, it was found that mir-202-3p functionally decreases Ppargc1a mRNA in vitro. Thus, both innate immune signaling through the TLRs and mir-202-3p-mediated mRNA degradation are implicated in the co-regulation of Ppargc1a and Ppargc1b during inflammation. Moreover, the identification of mir-202-3p as a potential factor for Ppargc1a and Ppargc1b repression in acute inflammation may open new avenues for mitochondrial research and, potentially, therapy.

  9. Exhaustive Weakly Wandering Sequences and Alpha-type Transformations

    Directory of Open Access Journals (Sweden)

    Stanley Eigen

    2015-12-01

    Full Text Available An increasing sequence of integers, $\\mathbb{B}$, is given for which there exists a family of ergodic, infinite measure preserving transformations $T_\\alpha$, $0 \\leq \\alpha \\leq 1$ so that (1 $T_\\alpha$ is of $\\alpha$-type and (2 $\\mathbb{B}$ is an exhaustive weakly wandering sequence for each $T_\\alpha$.

  10. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  11. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  12. Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil: Role of COL1A1

    Science.gov (United States)

    Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Carvalho, Edgar M; Blackwell, Jenefer M

    2015-01-01

    Previous studies have demonstrated a role for wound healing genes in resolution of cutaneous lesions caused by Leishmania spp. in both mice and humans, including the gene FLI1 encoding Friend leukaemia virus integration 1. Reduction of Fli1 expression in mice has been shown to result in up-regulation of collagen type I alpha 1 (Col1a1) and alpha 2 (Col1a2) genes and, conversely, in down-regulation of the matrix metalloproteinase 1 (Mmp1) gene, suggesting that Fli1 suppression is involved in activation of the profibrotic gene program. Here we examined single nucleotide polymorphisms (SNPs) in these genes as risk factors for cutaneous (CL) and mucosal leishmaniasis (ML), and leishmaniasis per se, caused by L. braziliensis in humans. SNPs were genotyped in 168 nuclear families (250 CL; 87 ML cases) and replicated in 157 families (402 CL; 39 ML cases). Family-based association tests (FBAT) showed the strongest association between SNPs rs1061237 (combined P=0.002) and rs2586488 (combined P=0.027) at COL1A1 and CL disease. This contributes to our further understanding of the role of wound healing in the resolution of CL disease, providing potential for therapies modulating COL1A1 via drugs acting on FLI1. PMID:25562121

  13. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  14. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  15. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  16. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  17. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  18. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  19. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  20. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  1. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  2. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  3. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  4. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  5. Method for using a yeast alpha-amylase promoter

    Science.gov (United States)

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  6. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  7. Diurnal Salivary Alpha-amylase Dynamics among Dementia Family Caregivers

    Science.gov (United States)

    Liu, Yin; Granger, Douglas A.; Kim, Kyungmin; Klein, Laura C.; Almeida, David M.; Zarit, Steven H.

    2016-01-01

    Objective The study examined diurnal regulation of salivary alpha-amylase (sAA) in association with daily stressors, adult day services (ADS) use, and other caregiving characteristics. Methods A sample of 165 family caregivers of individuals with dementia (IWD) completed an 8-day diary study. Caregivers provided 5 saliva samples across the 8 days. On some days, caregivers provided all or most of the care. On other days, their relative attended ADS for part of the day. A 3-level unconditional linear spline model was fit to describe the typical sAA diurnal rhythms. Predictors were then added to the unconditional model to test the hypotheses on ADS use and daily stressors. Results Daily ADS use did not have an effect on diurnal sAA regulation. However, controlling for daily ADS use, greater ADS use over the 8 days was associated with a more prominent rise between 30 minutes after wake-up and before lunch, and a more prominent decline between before lunch and late afternoon. Fewer ADS days were associated with a more flattened sAA diurnal rhythm. Additionally, greater daily care-related stressor exposures had a within-person association with lower sAA levels in the late afternoon. Care-related stressor exposures had significant within- and between-person associations with sAA diurnal slopes. Furthermore, daily positive experiences had a significant between-person association with sAA diurnal slopes. Conclusions Caring for a disabled family member may heighten the vulnerability to potential physiological conditions. Respite from care stressors from ADS use may have some biobehavioral benefits on sAA regulations. PMID:27786517

  8. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  9. Actin isoform and alpha 1B-adrenoceptor gene expression in aortic and coronary smooth muscle is influenced by cyclical stretch.

    Science.gov (United States)

    Lundberg, M S; Sadhu, D N; Grumman, V E; Chilian, W M; Ramos, K S

    1995-09-01

    The occurrence of vascular domains with specific biological and pharmacological characteristics suggests that smooth muscle cells in different arteries may respond differentially to a wide range of environmental stimuli. To determine if some of these vessel-specific differences may be attributable to mechano-sensitive gene regulation, the influence of cyclical stretch on the expression of actin isoform and alpha 1B-adrenoceptor genes was examined in aortic and coronary smooth muscle cells. Cells were seeded on an elastin substrate and subjected to maximal stretching (24% elongation) and relaxation cycles at a frequency of 120 cycles/min in a Flexercell strain unit for 72 h. Total RNA was extracted and hybridized to radiolabeled cDNA probes to assess gene expression. Stretch caused a greater reduction of actin isoform mRNA levels in aortic smooth muscle cells as compared to cells from the coronary artery. Steady-state mRNA levels of alpha 1B-adrenoceptor were also decreased by cyclical stretch in both cell types but the magnitude of the response was greater in coronary smooth muscle cells. No changes in alpha 1B-adrenoceptor or beta/gamma-actin steady-state mRNA levels were observed in H4IIE cells, a nonvascular, immortalized cell line. The relative gene expression of heat shock protein 70 was not influenced by the cyclic stretch regimen in any of these cell types. These results suggest that stretch may participate in the regulation of gene expression in vascular smooth muscle cells and that this response exhibits some degree of cell-specificity.

  10. The polymorphism -863C/A in tumour necrosis factor-alpha gene contributes an independent association to gout.

    Science.gov (United States)

    Chang, S-J; Tsai, P-C; Chen, C-J; Lai, H-M; Ko, Y-C

    2007-11-01

    To investigate the associations between polymorphisms in the promoter of the tumour necrosis factor-alpha (TNF-alpha) gene and gout. The polymorphisms -308G/A and -863C/A in the TNF-alpha gene were determined in 106 gout patients and 159 healthy controls among male Taiwanese using the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method. The biochemical markers, including Glutamic-oxaloacetic transaminase (GOT), Glutamic-pyruvic transaminase (GPT), uric acid, creatinine, total cholesterol (TC), triglycerides (TG), body mass index (BMI) and hypertension, as well as alcohol consumption were measured. The gout patients had 9.43% (10/106) with genotype AA at polymorphism -863C/A showing a significantly higher fraction than controls (0.63%; 1/159, P gout patients had significantly higher portions of abnormal GOT, GPT, creatinine, TC, TG, alcohol consumption, hypertension and hyperuricaemia than controls (P 0.05). After adjustment by a stepwise logistic regression method, the hyperuricaemia, creatinine, GPT, TG and alcohol consumption as well as genotype AA at polymorphism -863C/A were found to be significantly associated with gout. The genotype AA at polymorphism -863C/A in a recessive model showed a significant association with developing gout independent of hyperuricaemia, abnormal creatinine, higher TG, GPT and alcohol consumption.

  11. Genetic variants of the alpha-synuclein gene SNCA are associated with multiple system atrophy.

    Directory of Open Access Journals (Sweden)

    Ammar Al-Chalabi

    Full Text Available BACKGROUND: Multiple system atrophy (MSA is a progressive neurodegenerative disorder characterized by parkinsonism, cerebellar ataxia and autonomic dysfunction. Pathogenic mechanisms remain obscure but the neuropathological hallmark is the presence of alpha-synuclein-immunoreactive glial cytoplasmic inclusions. Genetic variants of the alpha-synuclein gene, SNCA, are thus strong candidates for genetic association with MSA. One follow-up to a genome-wide association of Parkinson's disease has identified association of a SNP in SNCA with MSA. METHODOLOGY/FINDINGS: We evaluated 32 SNPs in the SNCA gene in a European population of 239 cases and 617 controls recruited as part of the Neuroprotection and Natural History in Parkinson Plus Syndromes (NNIPPS study. We used 161 independently collected samples for replication. Two SNCA SNPs showed association with MSA: rs3822086 (P = 0.0044, and rs3775444 (P = 0.012, although only the first survived correction for multiple testing. In the MSA-C subgroup the association strengthened despite more than halving the number of cases: rs3822086 P = 0.0024, OR 2.153, (95% CI 1.3-3.6; rs3775444 P = 0.0017, OR 4.386 (95% CI 1.6-11.7. A 7-SNP haplotype incorporating three SNPs either side of rs3822086 strengthened the association with MSA-C further (best haplotype, P = 8.7 x 10(-4. The association with rs3822086 was replicated in the independent samples (P = 0.035. CONCLUSIONS/SIGNIFICANCE: We report a genetic association between MSA and alpha-synuclein which has replicated in independent samples. The strongest association is with the cerebellar subtype of MSA. TRIAL REGISTRATION: ClinicalTrials.gov NCT00211224.

  12. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  13. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    Science.gov (United States)

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  14. Causal and Synthetic Associations of Variants in the SERPINA Gene Cluster with Alpha1-antitrypsin Serum Levels

    DEFF Research Database (Denmark)

    Thun, Gian Andri; Imboden, Medea; Ferrarotti, Ilaria

    2013-01-01

    Several infrequent genetic polymorphisms in the SERPINA1 gene are known to substantially reduce concentration of alpha1-antitrypsin (AAT) in the blood. Since low AAT serum levels fail to protect pulmonary tissue from enzymatic degradation, these polymorphisms also increase the risk for early onse...

  15. The T alpha 2 nuclear protein binding site from the human T cell receptor alpha enhancer functions as both a T cell-specific transcriptional activator and repressor

    OpenAIRE

    1990-01-01

    T cell-specific expression of the human T cell receptor alpha (TCR- alpha) gene is regulated by the interaction of variable region promoter elements with a transcriptional enhancer that is located 4.5 kb 3' of the TCR-alpha constant region (C alpha) gene segment. The minimal TCR- alpha enhancer is composed of two nuclear protein binding sites, T alpha 1 and T alpha 2, that are both required for the T cell-specific activity of the enhancer. The T alpha 1 binding site contains a consensus cAMP ...

  16. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Science.gov (United States)

    Lehmann, Jason S; Fouts, Derrick E; Haft, Daniel H; Cannella, Anthony P; Ricaldi, Jessica N; Brinkac, Lauren; Harkins, Derek; Durkin, Scott; Sanka, Ravi; Sutton, Granger; Moreno, Angelo; Vinetz, Joseph M; Matthias, Michael A

    2013-01-01

    Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  17. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  18. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  19. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  20. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  1. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  2. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  3. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  4. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  5. Activity, splice variants, conserved peptide motifs, and phylogeny of two new alpha1,3-fucosyltransferase families (FUT10 and FUT11).

    Science.gov (United States)

    Mollicone, Rosella; Moore, Stuart E H; Bovin, Nicolai; Garcia-Rosasco, Marcela; Candelier, Jean-Jacques; Martinez-Duncker, Iván; Oriol, Rafael

    2009-02-13

    We report the cloning of three splice variants of the FUT10 gene, encoding for active alpha-l-fucosyltransferase-isoforms of 391, 419, and 479 amino acids, and two splice variants of the FUT11 gene, encoding for two related alpha-l-fucosyltransferases of 476 and 492 amino acids. The FUT10 and FUT11 appeared 830 million years ago, whereas the other alpha1,3-fucosyltransferases emerged 450 million years ago. FUT10-391 and FUT10-419 were expressed in human embryos, whereas FUT10-479 was cloned from adult brain and was not found in embryos. Recombinant FUT10-419 and FUT10-479 have a type II trans-membrane topology and are retained in the endoplasmic reticulum (ER) by a membrane retention signal at their NH(2) termini. The FUT10-479 has, in addition, a COOH-ER membrane retention signal. The FUT10-391 is a soluble protein without a trans-membrane domain or ER retention signal that transiently localizes to the Golgi and then is routed to the lysosome. After transfection in COS7 cells, the three FUT10s and at least one FUT11, link alpha-l-fucose onto conalbumin glycopeptides and biantennary N-glycan acceptors but not onto short lactosaminyl acceptor substrates as do classical monoexonic alpha1,3-fucosyltransferases. Modifications of the innermost core GlcNAc of the N-glycan, by substitution with ManNAc or with an opened GlcNAc ring or by the addition of an alpha1,6-fucose, suggest that the FUT10 transfer is performed on the innermost GlcNAc of the core chitobiose. We can exclude alpha1,3-fucosylation of the two peripheral GlcNAcs linked to the trimannosyl core of the acceptor, because the FUT10 fucosylated biantennary N-glycan product loses both terminal GlcNAc residues after digestion with human placenta alpha-N-acetylglucosaminidase.

  6. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  7. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  8. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  9. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  10. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  11. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  12. Dynamic evolution of the alpha (α) and beta (β) keratins has accompanied integument diversification and the adaptation of birds into novel lifestyles

    DEFF Research Database (Denmark)

    Greenwold, Matthew J.; Bao, Weier; Jarvis, Erich D.

    2014-01-01

    BACKGROUND: Vertebrate skin appendages are constructed of keratins produced by multigene families. Alpha (α) keratins are found in all vertebrates, while beta (β) keratins are found exclusively in reptiles and birds. We have studied the molecular evolution of these gene families in the genomes...... of 48 phylogenetically diverse birds and their expression in the scales and feathers of the chicken. RESULTS: We found that the total number of α-keratins is lower in birds than mammals and non-avian reptiles, yet two α-keratin genes (KRT42 and KRT75) have expanded in birds. The β-keratins, however...

  13. ANALYSIS OF STRUCTURAL ELEMENT OF FAMILY 6 CARBOHYDRATE BINDING MODULE (CTCBM6B OF ALPHA-L-ARABINOFURANOSIDASE FROM CLOSTRIDIUM THERMOCELLUM

    Directory of Open Access Journals (Sweden)

    Shadab Ahmed

    2013-06-01

    Full Text Available The amino acid sequence of a family 6 carbohydrate binding module (CtCBM6B from Clostridium thermocellum alpha-L-arabinofuranosidase showed close evolutionary relationship with some other member of family 6 carbohydrate binding modules. The CD spectrum analysis confirmed the secondary structure prediction of CtCBM6B as both showed beta-sheets (44-48% and random coils (52-54% and no alpha-helix. The hydrogen bonding plot of CtCBM6B showed many segments of parallel and anti-parallel beta-strands which was similar to the secondary structure prediction by PSIPRED VIEW. The three dimensional structure of CtCBM6B generated by MODELLER revealed a typical beta-sandwich architecture at its core, characteristic of beta-jelly roll CBM superfamily. The Ramachandran plot analysis by PROCHECK showed that out of 134 residues, 92.9% were in most favoured region, 6.2% in additionally allowed region and only 0.9% in generously allowed region which indicated a stable conformation of 3D model of CtCBM6B. The docking analysis of CtCBM6B for finding putative ligand binding sites showed that it has high binding affinity for arabinobiose, beta-L-arabinofuranose and beta-D-xylopyranose indicated by lower ligand binding energy (-14.28 kcal mol–1, -12.5 kcal mol–1 and -11.3 kcal mol–1, respectively. CtCBM6B also showed appreciable binding affinity with alpha-D-xylopyranose (–10.8 kcal mol–1, beta-L-arabinopyranose (–10.2 kcal mol-1, alpha-L-arabinopyranose (–10.0 kcal mol–1 and alpha-L-arabinofuranose (–8.75 kcal mol–1. The results indicated that CtCBM6B has high potential for binding arabinan, xylans and substituted xylans.

  14. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

    Science.gov (United States)

    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

    1998-01-01

    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  15. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  16. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  17. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  18. Interaction of a gibberellin-induced factor with the upstream region of an alpha-amylase gene in rice aleurone tissue.

    OpenAIRE

    Ou-Lee, T M; Turgeon, R; Wu, R

    1988-01-01

    The interaction between the DNA sequences of an alpha-amylase (EC 3.2.1.1) gene and a tissue-specific factor induced in rice (Oryza sativa L.) aleurone tissue by gibberellin was studied. DNA mobility-shift during electrophoresis indicated that a 500-base-pair sequence (HS500) of a rice alpha-amylase genomic clone (OSamy-a) specifically interacted with a factor from gibberellin-induced rice aleurone tissue. The amount of complex formed between the HS500 DNA fragment and the gibberellin-induced...

  19. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  20. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  1. Collagen type I alpha 1 gene polymorphism in premature ovarian failure

    Directory of Open Access Journals (Sweden)

    Vujović Svetlana

    2013-01-01

    Full Text Available Introduction. Premature ovarian failure (POF is characterized by amenorrhea, hypergonadotropism and hypoestrogenism in women bellow 40 years. Osteoporosis is one of the late complications of POF. Objective. To correlate collagen type I alpha1 (COLIA1 gene polymorphism with bone mineral density (BMD in women with POF. Methods. We determined the COLIA1 genotypes SS, Ss, ss in 66 women with POF. Single nucleotide polymorphism (G to T substitution within the Sp 1-binding site in the first intron of the COLIA1 gene was assessed by polymerase chain reaction (PCR followed by single-stranded conformation polymorphism (SSCP analysis. Bone mineral density (BMD was measured at the lumbar spine region by dual X-ray absorptiometry. Statistics: Kruskal-Wallis ANOVA, Chisquare test, Spearman correlation test. Results. The relative distribution of COLIA1 genotype alleles was SS - 54.4%, Ss - 41.0% and ss - 4.5%. No significant differences were found between genotype groups in body mass index, age, duration of amenorrhea or BMD. A significant positive correlation was observed between BMI and parity. Conclusion. The COLIA1 gene is just one of many genes influencing bone characteristics. It may act as a marker for differences in bone quantity and quality, bone fragility and accelerated bone loss in older women. However, in young women with POF, COLIA1 cannot identify those at higher risk for osteoporosis. [Projekat Ministarstva nauke Republike Srbije, br. ON 173056

  2. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  3. Expression of alpha-amylase in Bacillus licheniformis.

    OpenAIRE

    Rothstein, D M; Devlin, P E; Cate, R L

    1986-01-01

    In Bacillus licheniformis, alpha-amylase production varied more than 100-fold depending on the presence or absence of a catabolite-repressing carbon source in the growth medium. alpha-Amylase was produced during the growth phase and not at the onset of the stationary phase. Induction of alpha-amylase correlated with synthesis of mRNA initiating at the promoter of the alpha-amylase gene.

  4. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  5. Activation of peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Rino [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Takahashi, Nobuyuki, E-mail: nobu@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Murota, Kaeko [Department of Life Science, School of Science and Engineering, Kinki University, Osaka 770-8503 (Japan); Yamada, Yuko [Laboratory of Physiological Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Moriyama, Tatsuya [Department of Applied Cell Biology, Graduate School of Agriculture, Kinki University, Nara 631-8505 (Japan); Goto, Tsuyoshi; Kawada, Teruo [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan)

    2011-06-24

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. {yields} PPAR{alpha} activation also increased oxygen consumption rate and CO{sub 2} production and decreased secretion of triglyceride and ApoB from Caco-2 cells. {yields} Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO{sub 2} production in small intestinal epithelial cells. {yields} Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. {yields} It suggested that intestinal lipid metabolism regulated by PPAR{alpha} activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-{alpha} which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPAR{alpha} activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPAR{alpha} activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPAR{alpha} agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and

  6. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  7. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  8. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  9. Fasting induces basolateral uptake transporters of the SLC family in the liver via HNF4alpha and PGC1alpha.

    Science.gov (United States)

    Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas

    2007-09-01

    Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.

  10. Prevalence of alpha-1 antitrypsin deficiency and hereditary hemochromatosis gene mutations in Algarve, Portugal

    OpenAIRE

    Barreto da Silva, Marta; Gaio, Vânia; Fernandes, Aida; Mendonça, Francisco; Horta Correia, Filomena; Beleza, Álvaro; Gil, Ana Paula; Bourbon, Mafalda; Vicente, A.M.; Dias, Carlos Matias

    2012-01-01

    Alpha-1 antitrypsin (AAT) deficiency and hereditary hemochromatosis (HH) are two of the most fatal genetic disorders in adult life, affecting million individuals worldwide. They are often under-diagnosed conditions and diagnosis is only made when the patient is already in the advanced stages of damage. AAT deficiency results from mutations in one highly pleiomorphic gene located on chromosome 14, SERPINA 1, being Z and S mutations the most relevant clinically. These mutations will lead to an ...

  11. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  13. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  14. Resolution of G(s)alpha and G(q)alpha/G(11)alpha proteins in membrane domains by two-dimensional electrophoresis: the effect of long-term agonist stimulation.

    Science.gov (United States)

    Matousek, P; Novotný, J; Svoboda, P

    2004-01-01

    Low-density membrane-domain fractions were prepared from S49 lymphoma cells and clone e2m11 of HEK293 cells expressing a large number of thyrotropin-releasing hormone receptor (TRH-R) and G(11)alpha by flotation on sucrose density gradients. The intact cell structure was broken by detergent-extraction, alkaline-treatment or drastic homogenization. Three types of low-density membranes were resolved by two-dimensional electrophoresis and analyzed for G(s)alpha (S49) or G(q)alpha/G11) (e2m11) content. Four individual immunoblot signals of Gsalpha protein were identified in S49 lymphoma cells indicating complete resolution of the long G(s)alpha L+/-ser and short G(s)alpha S+/-ser variants of G(s)alpha. All these were diminished by prolonged agonist (isoprenaline) stimulation. In e2m11-HEK cells, five different immunoblot signals were detected indicating post-translational modification of G proteins of G(q)alpha/G(11)alpha family. The two major spots corresponding to exogenously (over)expressed G(11)alpha and endogenous G(q)alpha were reduced; the minor spots diminished by hormonal stimulation. Parallel analysis by silver staining of the total protein content indicated that no major changes in protein composition occurred under these conditions. Our data thus indicate that agonist-stimulation of target cells results in down-regulation of all different members of G(s) and G(q)/G(11) families. This agonist-specific effect may be demonstrated in crude membrane as well as domain/raft preparations and it is not accompanied by changes in overall protein composition.

  15. The alpha7 nicotinic receptor agonist SSR180711 increases activity regulated cytoskeleton protein (Arc) gene expression in the prefrontal cortex of the rat

    DEFF Research Database (Denmark)

    Kristensen, Søren E; Thomsen, Morten S; Hansen, Henrik H

    2007-01-01

    Nicotinic alpha7 acetylcholine receptors (alpha7 nAChR) have been shown to enhance attentional function and aspects of memory function in experimental models and in man. The protein Arc encoded by the effector immediate early gene arc or arg3.1 has been shown to be strongly implicated in long...

  16. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  17. Therapeutics: Gene Therapy for Alpha-1 Antitrypsin Deficiency.

    Science.gov (United States)

    Gruntman, Alisha M; Flotte, Terence R

    2017-01-01

    This review seeks to give an overview of alpha-1 antitrypsin deficiency, including the different disease phenotypes that it encompasses. We then describe the different therapeutic endeavors that have been undertaken to address these different phenotypes. Lastly we discuss future potential therapeutics, such as genome editing, and how they may play a role in treating alpha-1 antitrypsin deficiency.

  18. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  19. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  20. alpha-Tubulin of Histriculus cavicola (Ciliophora; Hypotrichea).

    Science.gov (United States)

    Pérez-Romero, P; Villalobo, E; Díaz-Ramos, C; Calvo, P; Santos-Rosa, F; Torres, A

    1997-03-01

    An alpha-tubulin gene fragment amplified by PCR from the hypotrichous ciliate Histriculus cavicola has been sequenced. This fragment, 1,182 bp long, contains an in-frame "stop" codon (UAA), which in other hypotrichous species codes for a glutamine residue. The comparison of the alpha-tubulin genes from several ciliates classes have revealed amino acid positions which could serve to distinguish these taxonomic groups.

  1. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Jason S Lehmann

    Full Text Available Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  2. Cloning and chromosomal localization of the three human syntrophin genes

    Energy Technology Data Exchange (ETDEWEB)

    Feener, C.A.; Anderson, M.D.S.; Selig, S. [Children`s Hospital, Boston, MA (United States)] [and others

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  3. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  4. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  5. Gene targeted therapeutics for liver disease in alpha-1 antitrypsin deficiency.

    LENUS (Irish Health Repository)

    McLean, Caitriona

    2009-01-01

    Alpha-1 antitrypsin (A1AT) is a 52 kDa serine protease inhibitor that is synthesized in and secreted from the liver. Although it is present in all tissues in the body the present consensus is that its main role is to inhibit neutrophil elastase in the lung. A1AT deficiency occurs due to mutations of the A1AT gene that reduce serum A1AT levels to <35% of normal. The most clinically significant form of A1AT deficiency is caused by the Z mutation (Glu342Lys). ZA1AT polymerizes in the endoplasmic reticulum of liver cells and the resulting accumulation of the mutant protein can lead to liver disease, while the reduction in circulating A1AT can result in lung disease including early onset emphysema. There is currently no available treatment for the liver disease other than transplantation and therapies for the lung manifestations of the disease remain limited. Gene therapy is an evolving field which may be of use as a treatment for A1AT deficiency. As the liver disease associated with A1AT deficiency may represent a gain of function possible gene therapies for this condition include the use of ribozymes, peptide nucleic acids (PNAs) and RNA interference (RNAi), which by decreasing the amount of aberrant protein in cells may impact on the pathogenesis of the condition.

  6. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  7. Linkage analysis of candidate genes in autoimmune thyroid disease. II. Selected gender-related genes and the X-chromosome. International Consortium for the Genetics of Autoimmune Thyroid Disease.

    Science.gov (United States)

    Barbesino, G; Tomer, Y; Concepcion, E S; Davies, T F; Greenberg, D A

    1998-09-01

    Hashimoto's thyroiditis (HT) and Graves' disease (GD) are autoimmune thyroid diseases (AITD) in which multiple genetic factors are suspected to play an important role. Until now, only a few minor risk factors for these diseases have been identified. Susceptibility seems to be stronger in women, pointing toward a possible role for genes related to sex steroid action or mechanisms related to genes on the X-chromosome. We have studied a total of 45 multiplex families, each containing at least 2 members affected with either GD (55 patients) or HT (72 patients), and used linkage analysis to target as candidate susceptibility loci genes involved in estrogen activity, such as the estrogen receptor alpha and beta and the aromatase genes. We then screened the entire X-chromosome using a set of polymorphic microsatellite markers spanning the whole chromosome. We found a region of the X-chromosome (Xq21.33-22) giving positive logarithm of odds (LOD) scores and then reanalyzed this area with dense markers in a multipoint analysis. Our results excluded linkage to the estrogen receptor alpha and aromatase genes when either the patients with GD only, those with HT only, or those with any AITD were considered as affected. Linkage to the estrogen receptor beta could not be totally ruled out, partly due to incomplete mapping information for the gene itself at this time. The X-chromosome data revealed consistently positive LOD scores (maximum of 1.88 for marker DXS8020 and GD patients) when either definition of affectedness was considered. Analysis of the family data using a multipoint analysis with eight closely linked markers generated LOD scores suggestive of linkage to GD in a chromosomal area (Xq21.33-22) extending for about 6 cM and encompassing four markers. The maximum LOD score (2.5) occurred at DXS8020. In conclusion, we ruled out a major role for estrogen receptor alpha and the aromatase genes in the genetic predisposition to AITD. Estrogen receptor beta remains a

  8. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  9. Functional polymorphisms in the interleukin-6 and serotonin transporter genes, and depression and fatigue induced by interferon-alpha and ribavirin treatment.

    LENUS (Irish Health Repository)

    Bull, S J

    2009-12-01

    Depression and fatigue are frequent side effects of interferon-alpha (IFN-alpha) treatment, and there is compelling evidence that the inflammatory response system (including interleukin-6, IL-6) and the serotonergic system is important in the pathophysiology of such symptoms. Functional polymorphisms in the promoter region of the IL-6 gene (rs1800795) and serotonin transporter gene (5-HTTLPR) have been identified as regulating these systems. The present study aimed to determine if these polymorphisms were associated with the development of depression and fatigue during IFN-alpha and ribavirin treatment. Ninety-eight Caucasian patients receiving pegylated IFN-alpha and ribavirin treatment for chronic hepatitis C virus at King\\'s College Hospital, London, and Emory University Hospital, Atlanta, participated in this prospective cohort study. Symptoms of depression and fatigue were measured before treatment and at weeks 4, 8, 12 and 24 during treatment. The \\'low IL-6\\' synthesizing genotype (CC) was associated with significantly fewer symptoms of depression (effect size = 0.7 at week 24; F = 9.4, d.f. = 436, P = 0.002). The \\'high transcription\\' serotonin transporter (5-HTT) genotype (LL) was also associated with significantly fewer symptoms of depression, but with a much smaller effect (effect size = 0.2 at week 24; F = 4.5, d.f. = 436, P = 0.03). Neither polymorphisms were associated with symptoms of fatigue (IL-6: F = 1.2, d.f. = 430, P = 0.2; 5-HTT: F = 0.5, d.f. = 430, P = 0.5). The smaller effects of the 5-HTT polymorphism on depression may be explained by an interaction between the genes (F = 5.0, d.f. = 434, P = 0.02): the \\'protective\\' effect of the 5-HTTLPR polymorphism was evident only in the presence of the \\'low IL-6\\' genotype (F = 5.4, d.f. = 64, P = 0.02), not in the presence of the \\'high IL-6\\' genotype (F = 2.2, d.f. = 369, P = 0.1). The association between the IL-6 polymorphism and reduced risk of depressive symptoms confirms the role

  10. Expression and secretion of Bacillus amyloliquefaciens alpha-amylase by using the yeast pheromone alpha-factor promoter and leader sequence in Saccharomyces cerevisiae.

    OpenAIRE

    Southgate, V J; Steyn, A J; Pretorius, I S; Van Vuuren, H J

    1993-01-01

    Replacement of the regulatory and secretory signals of the alpha-amylase gene (AMY) from Bacillus amylolique-faciens with the complete yeast pheromone alpha-factor prepro region (MF alpha 1p) resulted in increased levels of extracellular alpha-amylase production in Saccharomyces cerevisiae. However, the removal of the (Glu-Ala)2 peptide from the MF alpha 1 spacer region (Lys-Arg-Glu-Ala-Glu-Ala) yielded decreased levels of extracellular alpha-amylase.

  11. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  12. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  13. Estrogen receptor alpha gene polymorphism and endometrial cancer risk – a case-control study

    International Nuclear Information System (INIS)

    Wedrén, Sara; Stiger, Fredrik; Persson, Ingemar; Baron, John A; Weiderpass, Elisabete; Lovmar, Lovisa; Humphreys, Keith; Magnusson, Cecilia; Melhus, Håkan; Syvänen, Ann-Christine; Kindmark, Andreas; Landegren, Ulf; Fermér, Maria Lagerström

    2008-01-01

    Estrogen is an established endometrial carcinogen. One of the most important mediators of estrogenic action is the estrogen receptor alpha. We have investigated whether polymorphic variation in the estrogen receptor alpha gene (ESR1) is associated with endometrial cancer risk. In 702 cases with invasive endometrial cancer and 1563 controls, we genotyped five markers in ESR1 and used logistic regression models to estimate odds ratios (OR) and 95 percent confidence intervals (CI). We found an association between rs2234670, rs2234693, as well as rs9340799, markers in strong linkage disequilibrium (LD), and endometrial cancer risk. The association with rs9340799 was the strongest, OR 0.75 (CI 0.60–0.93) for heterozygous and OR 0.53 (CI 0.37–0.77) for homozygous rare compared to those homozygous for the most common allele. Haplotype models did not fit better to the data than single marker models. We found that intronic variation in ESR1 was associated with endometrial cancer risk

  14. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  15. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  16. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  17. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  18. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  19. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  20. Association study between functional polymorphisms in the TNF-alpha gene and obsessive-compulsive disorder

    Directory of Open Access Journals (Sweden)

    Carolina Cappi

    2012-02-01

    Full Text Available Obsessive-compulsive disorder (OCD is a prevalent psychiatric disorder of unknown etiology. However, there is some evidence that the immune system may play an important role in its pathogenesis. In the present study, two polymorphisms (rs1800795 and rs361525 in the promoter region of the cytokine tumor necrosis factor-alpha (TNFA gene were genotyped in 183 OCD patients and in 249 healthy controls. The statistical tests were performed using the PLINK® software. We found that the A allele of the TNFA rs361525 polymorphism was significantly associated with OCD subjects, according to the allelic χ² association test (p=0.007. The presence of genetic markers, such as inflammatory cytokines genes linked to OCD, may represent additional evidence supporting the role of the immune system in its pathogenesis.

  1. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  2. Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

    Energy Technology Data Exchange (ETDEWEB)

    Stein, J.D.; Nelson, L.D.; Conner, B.J. [Univ. of Texas, Houston (United States)] [and others

    1994-09-01

    Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B, twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.

  3. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  4. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  5. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  6. Relationship of the luminous bacterial symbiont of the Caribbean flashlight fish, Kryptophanaron alfredi (family Anomalopidae) to other luminous bacteria based on bacterial luciferase (luxA) genes.

    Science.gov (United States)

    Haygood, M G

    1990-01-01

    Flashlight fishes (family Anomalopidae) have light organs that contain luminous bacterial symbionts. Although the symbionts have not yet been successfully cultured, the luciferase genes have been cloned directly from the light organ of the Caribbean species, Kryptophanaron alfredi. The goal of this project was to evaluate the relationship of the symbiont to free-living luminous bacteria by comparison of genes coding for bacterial luciferase (lux genes). Hybridization of a lux AB probe from the Kryptophanaron alfredi symbiont to DNAs from 9 strains (8 species) of luminous bacteria showed that none of the strains tested had lux genes highly similar to the symbiont. The most similar were a group consisting of Vibrio harveyi, Vibrio splendidus and Vibrio orientalis. The nucleotide sequence of the luciferase alpha subunit gene luxA) of the Kryptophanaron alfredi symbiont was determined in order to do a more detailed comparison with published luxA sequences from Vibrio harveyi, Vibrio fischeri and Photobacterium leiognathi. The hybridization results, sequence comparisons and the mol% G + C of the Kryptophanaron alfredi symbiont luxA gene suggest that the symbiont may be considered as a new species of luminous Vibrio related to Vibrio harveyi.

  7. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  8. Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

    Science.gov (United States)

    Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

    2018-02-21

    Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

  9. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  10. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  11. A new polymorphic and multicopy MHC gene family related to nonmammalian class I

    Energy Technology Data Exchange (ETDEWEB)

    Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J. [Univ. of Western Australia, Perth (Australia); Townend, D.C. [Sir Charles Gairdner Hospital, Perth (Australia); Dawkins, R.L. [Royal Perth Hospital, Perth (Australia)]|[Univ. of Western Australia, Perth (Australia)]|[Sir Charles Gairdner Hospital, Perth (Australia)

    1994-12-31

    The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNA and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.

  12. Arabidopsis thaliana RGXT1 and RGXT2 encode Golgi-localized (1,3)-alpha-D-xylosyltransferases involved in the synthesis of pectic rhamnogalacturonan-II

    DEFF Research Database (Denmark)

    Madsen, Jack Egelund; Petersen, Bent Larsen; Motawia, Mohammed Saddik

    2006-01-01

    in rhamnogalacturonan-II, a complex polysaccharide essential to vascular plants, and is conserved across higher plant families. Rhamnogalacturonan-II isolated from both RGXT1 and RGXT2 T-DNA insertional mutants functioned as specific acceptor molecules in the xylosyltransferase assay. Expression of RGXT1- and RGXT2......Two homologous plant-specific Arabidopsis thaliana genes, RGXT1 and RGXT2, belong to a new family of glycosyltransferases (CAZy GT-family-77) and encode cell wall (1,3)-alpha-d-xylosyltransferases. The deduced amino acid sequences contain single transmembrane domains near the N terminus, indicative...

  13. Mutations in the nuclear bile acid receptor FXR cause progressive familial intrahepatic cholestasis

    Science.gov (United States)

    Gomez-Ospina, Natalia; Potter, Carol J.; Xiao, Rui; Manickam, Kandamurugu; Kim, Mi-Sun; Kim, Kang Ho; Shneider, Benjamin L.; Picarsic, Jennifer L.; Jacobson, Theodora A.; Zhang, Jing; He, Weimin; Liu, Pengfei; Knisely, A. S.; Finegold, Milton J.; Muzny, Donna M.; Boerwinkle, Eric; Lupski, James R.; Plon, Sharon E.; Gibbs, Richard A.; Eng, Christine M.; Yang, Yaping; Washington, Gabriel C.; Porteus, Matthew H.; Berquist, William E.; Kambham, Neeraja; Singh, Ravinder J.; Xia, Fan; Enns, Gregory M.; Moore, David D.

    2016-01-01

    Neonatal cholestasis is a potentially life-threatening condition requiring prompt diagnosis. Mutations in several different genes can cause progressive familial intrahepatic cholestasis, but known genes cannot account for all familial cases. Here we report four individuals from two unrelated families with neonatal cholestasis and mutations in NR1H4, which encodes the farnesoid X receptor (FXR), a bile acid-activated nuclear hormone receptor that regulates bile acid metabolism. Clinical features of severe, persistent NR1H4-related cholestasis include neonatal onset with rapid progression to end-stage liver disease, vitamin K-independent coagulopathy, low-to-normal serum gamma-glutamyl transferase activity, elevated serum alpha-fetoprotein and undetectable liver bile salt export pump (ABCB11) expression. Our findings demonstrate a pivotal function for FXR in bile acid homeostasis and liver protection. PMID:26888176

  14. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  15. Delayed changes in gene expression in human fibroblasts after alpha irradiation

    International Nuclear Information System (INIS)

    Salo, A.; Peraelae, M.; Mustonen, R.; Kadhim, M.; Marsden, S.; Sabatier, L.; Martins, L.

    2003-01-01

    endpoints with radiation-induced cancer. Gene expression changes in human fibroblast cells at delayed time points after alpha particle irradiation were studied. The aim was to identify genes playing pivotal role in inducing genomic instability. (orig.)

  16. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  17. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  18. Advances toward DNA-based identification and phylogeny of North American Armillaria species using elongation factor-1 alpha gene

    Science.gov (United States)

    Amy L. Ross-Davis; John W. Hanna; Mee-Sook Kim; Ned B. Klopfenstein

    2012-01-01

    The translation elongation factor-1 alpha gene was used to examine the phylogenetic relationships among 30 previously characterized isolates representing ten North American Armillaria species: A. solidipes (=A. ostoyae), A. gemina, A. calvescens, A. sinapina, A. mellea, A. gallica, A. nabsnona, North American biological species X, A. cepistipes, and A. tabescens. The...

  19. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  20. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  1. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  2. Renal Amyloidosis Associated With 5 Novel Variants in the Fibrinogen A Alpha Chain Protein

    Directory of Open Access Journals (Sweden)

    Dorota Rowczenio

    2017-05-01

    Discussion: We report 6 novel mutations in the FGA gene: 5 were associated with renal fibrinogen A alpha chain amyloidosis and 1 was found to be incidental to light-chain amyloid deposits discovered in a patient with a plasma cell dyscrasia. Clinical awareness and suspicion of hereditary amyloidosis corroborated by genetic analysis and adequate typing using combined immunohistochemistry and laser microdissection and mass spectrometry is valuable to avoid misdiagnosis, especially when a family history of amyloidosis is absent.

  3. Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)

    2011-07-15

    Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

  4. Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

    Directory of Open Access Journals (Sweden)

    LISTYA UTAMI KARMAWAN

    2009-03-01

    Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

  5. Relationship between iris constitution analysis and TNF-alpha gene polymorphism in hypertensives.

    Science.gov (United States)

    Yoo, Chun-Sang; Hwang, Woo-Jun; Hong, Seung-Heon; Lee, Hye-Jung; Jeong, Hyun-Ja; Kim, Su-Jin; Kim, Hyung-Min; Um, Jae-Young

    2007-01-01

    Iridology is a complementary and alternative medicine that involves the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris. Iris constitution has a strong hereditary component. Tumor necrosis factor-alpha (TNFalpha), a pleiotropic cytokine, has been implicated in many pathological processes including hypertension. In this paper, the relationship between iris constitution and TNFalpha gene polymorphism in those with hypertension is investigated. Eighty seven hypertensive individuals and 79 controls were classified according to iris constitution and the TNFalpha genotype of each individual determined. Compared to the controls, the frequency of the TNFalpha GA heterozygote was lower in the hypertensive group, although the statistical significance was marginal (p = 0.08). This result implies an association with resistance to the disease. In addition, the frequency of the cardio-renal connective tissue weakness type was significantly higher in the hypertensive group with the TNFalpha GG genotype, as compared to the controls (p = 0.001). An association is demonstrated among TNFalpha gene polymorphism, Koreans with hypertension, and iris constitution.

  6. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  7. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  8. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  9. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  10. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  11. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  12. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  13. The spatial distribution of fixed mutations within genes coding for proteins

    Science.gov (United States)

    Holmquist, R.; Goodman, M.; Conroy, T.; Czelusniak, J.

    1983-01-01

    An examination has been conducted of the extensive amino acid sequence data now available for five protein families - the alpha crystallin A chain, myoglobin, alpha and beta hemoglobin, and the cytochromes c - with the goal of estimating the true spatial distribution of base substitutions within genes that code for proteins. In every case the commonly used Poisson density failed to even approximate the experimental pattern of base substitution. For the 87 species of beta hemoglobin examined, for example, the probability that the observed results were from a Poisson process was the minuscule 10 to the -44th. Analogous results were obtained for the other functional families. All the data were reasonably, but not perfectly, described by the negative binomial density. In particular, most of the data were described by one of the very simple limiting forms of this density, the geometric density. The implications of this for evolutionary inference are discussed. It is evident that most estimates of total base substitutions between genes are badly in need of revision.

  14. Functional inhibition of NF-kappa B signal transduction in alpha v alpha beta 3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant I kappa B gene

    NARCIS (Netherlands)

    Ogawara, K; Kuldo, JM; Oosterhuis, K; Kroesen, BJ; Rots, MG; Trautwein, C; Kimura, T; Haisma, HJ; Molema, G

    2006-01-01

    In order to selectively block nuclear factor kappa B (NF-kappa B)-dependent signal transduction in angiogenic endothelial cells, we constructed an alpha v beta 3 integrin specific adenovirus encoding dominant negative I kappa B (dnI kappa B) as a therapeutic gene. By virtue of RGD modification of

  15. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  16. Genetic evidence that HNF-1alpha-dependent transcriptional control of HNF-4alpha is essential for human pancreatic beta cell function

    DEFF Research Database (Denmark)

    Hansen, Sara K; Párrizas, Marcelina; Jensen, Maria L

    2002-01-01

    Mutations in the genes encoding hepatocyte nuclear factor 4alpha (HNF-4alpha) and HNF-1alpha impair insulin secretion and cause maturity onset diabetes of the young (MODY). HNF-4alpha is known to be an essential positive regulator of HNF-1alpha. More recent data demonstrates that HNF-4alpha...... in human islets and exocrine cells is primarily mediated by the P2 promoter. Furthermore, we describe a G --> A mutation in a conserved nucleotide position of the HNF-1alpha binding site of the P2 promoter, which cosegregates with MODY. The mutation results in decreased affinity for HNF-1alpha...

  17. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  18. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  19. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  2. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  3. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  4. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  5. CNGA3 mutations in two United Arab Emirates families with achromatopsia.

    Science.gov (United States)

    Ahuja, Yachna; Kohl, Susanne; Traboulsi, Elias I

    2008-07-10

    ACHROMATOPSIA RESULTS FROM MUTATIONS IN ONE OF THREE GENES: cyclic nucleotide-gated channel, alpha-3 (CNGA3); cyclic nucleotide-gated channel, beta-3 (CNGB3); and guanine nucleotide-binding protein, alpha-transducing activity polypeptide 2 (GNAT2). We report the responsible mutations in two United Arab Emirates families who have this autosomal recessive disease. Clinical examinations were performed in seven patients from three nuclear families. Molecular genetic testing for common CNGA3 and CNGB3 mutations was undertaken using standard protocols. All patients were extremely light sensitive and had reduced visual acuity and no color perception. Fundus examinations did not show any visible abnormalities. After further pedigree analysis, two of the families were found to be linked through the paternal line. Two mutations in CNGA3 were identified: Arg283Trp and Gly397Val. Family A, the larger pedigree, had one branch in which two sisters and one brother were homozygous for the Gly397Val mutation and another branch in which a brother and sister were compound heterozygous for both aforenamed mutations. Family B, however, only had two brothers who were homozygous for the Arg283Trp mutation. Achromatopsia in these two United Arab Emirates families results from two different mutations in CNGA3. Two branches of the same pedigree had individuals with both homozygous and compound heterozygous disease, demonstrating a complex molecular pathology in this large family.

  6. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  7. Catalposide is a natural agonistic ligand of peroxisome proliferator-activated receptor-{alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Hae; Jun, Hee-jin; Hoang, Minh-Hien; Jia, Yaoyao [Division of Food Bioscience and Technology, College of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Department of Biotechnology, Graduate School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Han, Xiang Hua [College of Pharmacy, Chungbuk National University, Cheongju, Chungbuk 361-763 (Korea, Republic of); Lee, Dong-Ho [Department of Biotechnology, Graduate School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Lee, Hak-Ju [Division of Green Business Management, Department of Forest Resources Utilization, Korean Forest Research Institute, Seoul 130-712 (Korea, Republic of); Hwang, Bang Yeon, E-mail: byhwang@chungbuk.ac.kr [College of Pharmacy, Chungbuk National University, Cheongju, Chungbuk 361-763 (Korea, Republic of); Lee, Sung-Joon, E-mail: junelee@korea.ac.kr [Division of Food Bioscience and Technology, College of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Department of Biotechnology, Graduate School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer Catalposide is a novel ligand for PPAR{alpha}. Black-Right-Pointing-Pointer Cell stimulated with catalposide improved fatty acid uptake, regulated target genes in fatty acid {beta}-oxidation and synthesis. Black-Right-Pointing-Pointer Catalposdie reduces hepatic triacylglycerides. Black-Right-Pointing-Pointer Theses demonstrate catalposide could ameliorate hyperlipidemia and hepatic steatosis. -- Abstract: Peroxisome proliferator-activated receptor-alpha (PPAR{alpha}) is a nuclear receptor that regulates the expression of genes related to cellular lipid uptake and oxidation. Thus, PPAR{alpha} agonists may be important in the treatment of hypertriglyceridemia and hepatic steatosis. In this study, we demonstrated that catalposide is a novel natural PPAR{alpha} agonist, identified from reporter gene assay-based activity screening with approximately 900 natural plant and seaweed extracts. Results of time-resolved fluorescence resonance energy transfer analyses suggested that the compound interacted directly with the ligand-binding domain of PPAR{alpha}. Cultured hepatocytes stimulated with catalposide exhibited significantly reduced cellular triglyceride concentrations, by 21%, while cellular uptake of fatty acids was increased, by 70% (P < 0.05). Quantitative PCR analysis revealed that the increase in cellular fatty acid uptake was due to upregulation of fatty acid transporter protein-4 (+19% vs. the control) in cells stimulated with catalposide. Additionally, expression of genes related to fatty acid oxidation and high-density lipoprotein metabolism were upregulated, while that of genes related to fatty acid synthesis were suppressed. In conclusion, catalposide is hypolipidemic by activation of PPAR{alpha} via a ligand-mediated mechanism that modulates the expression of in lipid metabolism genes in hepatocytes.

  8. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  9. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  10. Quantitative gene-expression of the tumor angiogenesis markers vascular endothelial growth factor, integrin alphaV and integrin beta3 in human neuroendocrine tumors

    DEFF Research Database (Denmark)

    Oxboel, Jytte; Binderup, Tina; Knigge, Ulrich

    2009-01-01

    , in neuroendocrine tumors. We used quantitative real-time PCR for measuring mRNA gene-expression of vascular endothelial growth factor (VEGF), integrin alphaV, and integrin beta3, and CD34 for a group of patients with neuroendocrine tumors (n=13). Tissue from patients with colorectal cancer liver metastases (n=14...... compared to both colorectal liver metastases (p=0.10) and normal liver tissue (p=0.06). In neuroendocrine tumors, gene-expression was highly variable of VEGF (530-fold), integrin alphaV (23-fold) and integrin beta3 (106-fold). Quantitative gene-expression levels of the key angiogenesis molecules VEGF......Anti-angiogenesis treatment is a promising new therapy for cancer that recently has also been suggested for patients with neuroendocrine tumors. The aim of the present study was therefore to investigate the level of tumor angiogenesis, and thereby the molecular basis for anti-angiogenesis treatment...

  11. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  12. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  13. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  14. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  15. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  16. C. elegans model identifies genetic modifiers of alpha-synuclein inclusion formation during aging.

    Directory of Open Access Journals (Sweden)

    Tjakko J van Ham

    2008-03-01

    Full Text Available Inclusions in the brain containing alpha-synuclein are the pathological hallmark of Parkinson's disease, but how these inclusions are formed and how this links to disease is poorly understood. We have developed a C. elegans model that makes it possible to monitor, in living animals, the formation of alpha-synuclein inclusions. In worms of old age, inclusions contain aggregated alpha- synuclein, resembling a critical pathological feature. We used genome-wide RNA interference to identify processes involved in inclusion formation, and identified 80 genes that, when knocked down, resulted in a premature increase in the number of inclusions. Quality control and vesicle-trafficking genes expressed in the ER/Golgi complex and vesicular compartments were overrepresented, indicating a specific role for these processes in alpha-synuclein inclusion formation. Suppressors include aging-associated genes, such as sir-2.1/SIRT1 and lagr-1/LASS2. Altogether, our data suggest a link between alpha-synuclein inclusion formation and cellular aging, likely through an endomembrane-related mechanism. The processes and genes identified here present a framework for further study of the disease mechanism and provide candidate susceptibility genes and drug targets for Parkinson's disease and other alpha-synuclein related disorders.

  17. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  18. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  19. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  20. Frequency of distribution of inflammatory cytokines IL-1, IL-6 and TNF-alpha gene polymorphism in patients with obstructive sleep apnea.

    Science.gov (United States)

    Popko, K; Gorska, E; Potapinska, O; Wasik, M; Stoklosa, A; Plywaczewski, R; Winiarska, M; Gorecka, D; Sliwinski, P; Popko, M; Szwed, T; Demkow, U

    2008-12-01

    Obesity is one of the most commonly identified factors for the obstructive sleep apnea syndrome (OSAS). Adipose tissue is the source of many cytokines, among them there are IL-6, IL-1, and TNF-alpha. The level of inflammatory cytokines increases in people with OSAS and obesity. The aim of this study was to evaluate the distribution of genotypes in inflammatory cytokine genes in people with obesity-related OSAS. The examined group consisted of 102 person with obesity related-OSAS and 77 normal weight person without OSAS. Genotyping of DNA sequence variation was carried out by restriction enzyme (IL-1: Taq I, IL-6: Lwe I, TNF-alpha: Nco I) analysis of PCR amplified DNA. The study revealed a significant correlation between polymorphism located in the promoter region of inflammatory cytokine genes and obesity-related OSAS.

  1. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  2. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  3. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  4. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  5. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  6. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  7. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  8. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  10. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  11. The D313Y variant in the GLA gene - no evidence of a pathogenic role in Fabry disease

    DEFF Research Database (Denmark)

    Hasholt, Lis; Ballegaard, Martin; Bundgaard, Henning

    2017-01-01

    Fabry disease is an X- linked inherited lysosomal storage disease caused by mutations in the GLA gene encoding the lysosomal enzyme alpha-galactosidase A (α-Gal A). The possible pathological significance of the D313Y variant in the GLA gene has not been verified and it may be a Fabry variant. Our......, and the presence in Fabry females did not significantly enhance the phenotype of a known causative mutation in the GLA gene (G271S). Our findings indicate that the D313Y variant is not causative to nor enhancing Fabry disease phenotype. The D313Y variant in the GLA gene was not disease causative in 2 Danish...... families. Investigating male family members were crucial in excluding the Fabry phenotype, and thus very important for proper genetic counceling of all family members, as well as overdiagnosing a devastating genetic disease....

  12. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  13. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  14. A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Chen, Qiang; Ma, Junjie; Yan, Ming; Mothobi, Maneo Emily; Liu, Yuanyuan; Zheng, Fang

    2009-07-10

    To identify the genetic defects associated with autosomal dominant congenital nuclear cataract in a Chinese family. Clinical data were collected, and the phenotypes of the affected members in this family were recorded by slit-lamp photography. Genomic DNA was isolated from peripheral blood. Mutations were screened in cataract-associated candidate genes through polymerase chain reaction (PCR) analyses and sequencing. Structural models of the wild-type and mutant alphaB-crystallin were generated and analyzed by SWISS-MODEL. Mutation screening identified only one heterozygous G-->A transition at nucleotide 32 in the first exon of alphaB-crystallin (CRYAB), resulting in an amino acid change from arginine to histidine at codon 11 (R11H). This mutation segregated in all available affected family members but was not observed in any of the unaffected persons of the family. The putative mutation disrupted a restriction site for the enzyme, Fnu4HI, in the affected family members. The disruption, however, was not found in any of the randomly selected ophthalmologically normal individuals or in 40 unrelated senile cataract patients. Computer-assisted prediction suggested that this mutation affected the biochemical properties as well as the structure of alphaB-crystallin. These results supported the idea that the novel R11H mutation was responsible for the autosomal dominant nuclear congenital cataract in this pedigree.

  15. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    Science.gov (United States)

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  16. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  17. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  18. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  19. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  20. A new family of Fisher-curves estimates Fisher's alpha more accurately

    NARCIS (Netherlands)

    Schulte, R.P.O.; Lantinga, E.A.; Hawkins, M.J.

    2005-01-01

    Fisher's alpha is a satisfactory scale-independent indicator of biodiversity. However, alpha may be underestimated in communities in which the spatial arrangement of individuals is strongly clustered, or in which the total number of species does not tend to infinity. We have extended Fisher's curve

  1. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  2. Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

    Science.gov (United States)

    Formica, S; Roach, T I; Blackwell, J M

    1994-05-01

    The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic

  3. Regular endurance training reduces the exercise induced HIF-1alpha and HIF-2alpha mRNA expression in human skeletal muscle in normoxic conditions

    DEFF Research Database (Denmark)

    Lundby, Carsten; Gassmann, Max; Pilegaard, Henriette

    2005-01-01

    and 2 (HIFs) are clearly related heterodimeric transcription factors that consist of an oxygen-depended alpha-subunit and a constitutive beta-subunit. With hypoxic exposure, HIF-1alpha and HIF-2alpha protein are stabilized. Upon heterodimerization, HIFs induce the transcription of a variety of genes......Regular exercise induces a variety of adaptive responses that enhance the oxidative and metabolic capacity of human skeletal muscle. Although the physiological adjustments of regular exercise have been known for decades, the underlying mechanisms are still unclear. The hypoxia inducible factors 1...... including erythropoietin (EPO), transferrin and its receptor, as well as vascular endothelial growth factor (VEGF) and its receptor. Considering that several of these genes are also induced with exercise, we tested the hypothesis that the mRNA level of HIF-1alpha and HIF-2alpha subunits increases...

  4. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  5. in a Family of South Indian Descent

    Directory of Open Access Journals (Sweden)

    Muthiah Subramanian

    2015-01-01

    Full Text Available Inherited channelopathies are a heterogeneous group of disorders resulting from dysfunction of ion channels in cellular membranes. They may manifest as diseases affecting skeletal muscle contraction, the conduction system of the heart, nervous system function, and vision syndromes. We describe a family of South Indian descent with hypokalemic periodic paralysis in which four members also have idiopathic generalized epilepsy. Hypokalemic periodic paralysis is a genetically heterogeneous channelopathy that has been linked to mutations in genes encoding three ion channels CACNIAS, SCN4A, and KCNJ2 predominantly. Although data on specific gene in idiopathic generalized epilepsy is relatively scarce, mutations of voltage gated sodium channel subunit genes (CACNB4 and nonsense mutations in voltage gated calcium channels (CACNA1A have been linked to idiopathic generalized epilepsy in two families. We speculate that gene mutations altering the ability of the beta subunit to interact with the alpha subunit of the CaV1.1 channel and mutations in the pore-forming potassium channel subunit may be possible explanations for the combined manifestation of both diseases. Functional analysis of voltage gated calcium channel and other ion channels mutations may provide additional support and insight for the causal role of these mutations. The understanding of mutations in ion-channel genes will lead to improved diagnosis and treatment of such inherited channelopathies.

  6. Mutation analysis of the adenomatous polyposis coli (APC) gene in Danish patients with familial adenomatous polyposis (FAP)

    DEFF Research Database (Denmark)

    Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen

    2004-01-01

    Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...

  7. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  8. Stevioside counteracts the alpha cell hypersecretion caused by long-term palmitate exposure

    DEFF Research Database (Denmark)

    Hong, Jing; Chen, Jianguo; Jeppesen, Per Bendix

    2006-01-01

    Long-term exposure to fatty acids impairs beta-cell function in type 2 diabetes, but little is known about the chronic effects of fatty acids on alpha-cells. We therefore studied the prolonged impact of palmitate on alpha-cell function and on the expression of genes related to fuel metabolism. We......-activated receptor-gamma, and stearoyl-CoA desaturase gene expressions in the presence of palmitate (Pacids leads to a hypersecretion of glucagon and an accumulation of TG content in clonal alpha-TC1-6 cells. Stevioside was able to counteract the alpha......-cell hypersecretion caused by palmitate and enhanced the expression of genes involved in fatty acid metabolism. This indicates that stevioside may be a promising antidiabetic agent in treatment of type 2 diabetes....

  9. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  10. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  11. 5alphaDH-DOC (5alpha-dihydro-deoxycorticosterone) activates androgen receptor in castration-resistant prostate cancer.

    Science.gov (United States)

    Uemura, Motohide; Honma, Seijiro; Chung, Suyoun; Takata, Ryo; Furihata, Mutsuo; Nishimura, Kazuo; Nonomura, Norio; Nasu, Yasutomo; Miki, Tsuneharu; Shuin, Taro; Fujioka, Tomoaki; Okuyama, Akihiko; Nakamura, Yusuke; Nakagawa, Hidewaki

    2010-08-01

    Prostate cancer often relapses during androgen-depletion therapy, even under the castration condition in which circulating androgens are drastically reduced. High expressions of androgen receptor (AR) and genes involved in androgen metabolism indicate a continued role for AR in castration-resistant prostate cancers (CRPCs). There is increasing evidence that some amounts of 5alpha-dihydrotestosterone (DHT) and other androgens are present sufficiently to activate AR within CRPC tissues, and enzymes involved in the androgen and steroid metabolism, such as 5alpha-steroid reductases, are activated in CRPCs. In this report, we screened eight natural 5alphaDH-steroids to search for novel products of 5alpha-steroid reductases, and identified 11-deoxycorticosterone (DOC) as a novel substrate for 5alpha-steroid reductases in CRPCs. 11-Deoxycorticosterone (DOC) and 5alpha-dihydro-deoxycorticosterone (5alphaDH-DOC) could promote prostate cancer cell proliferation through AR activation, and type 1 5alpha-steroid reductase (SRD5A1) could convert from DOC to 5alphaDH-DOC. Sensitive liquid chromatography-tandem mass spectrometric analysis detected 5alphaDH-DOC in some clinical CRPC tissues. These findings implicated that under an extremely low level of DHT, 5alphaDH-DOC and other products of 5alpha-steroid reductases within CRPC tissues might activate the AR pathway for prostate cancer cell proliferation and survival under castration.

  12. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  13. Transcription regulation of the alpha-glucanase gene agn1 by cell separation transcription factor Ace2p in fission yeast

    NARCIS (Netherlands)

    Dekker, Nick; de Haan, Annett; Hochstenbach, Frans

    2006-01-01

    During the final stage of the cell division cycle in the fission yeast Schizosaccharomyces pombe, transcription factor Ace2p activates expression of genes involved in the separation of newly formed daughter cells, such as agn1+, which encodes the alpha-glucanase Agn1p. The agn1 promoter contains

  14. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  15. [Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

    Science.gov (United States)

    Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

    2002-08-01

    To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were

  16. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  17. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  18. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  19. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  20. Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

    Science.gov (United States)

    Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

    2014-10-01

    MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

  1. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  2. Modulation of renal Ca2+ transport protein genes by dietary Ca2+ and 1,25-dihydroxyvitamin D3 in 25-hydroxyvitamin D3-1alpha-hydroxylase knockout mice.

    NARCIS (Netherlands)

    Hoenderop, J.G.J.; Dardenne, O.; Abel, M. van; Kemp, J.W.C.M. van der; Os, C.H. van; Arnaud, R. St.; Bindels, R.J.M.

    2002-01-01

    Pseudovitamin D-deficiency rickets (PDDR) is an autosomal disease characterized by hyperparathyroidism, rickets, and undetectable levels of 1,25-dihydroxyvitaminD3 (1,25(OH)2D3). Mice in which the 25-hydroxyvitamin D3-1alpha-hydroxylase (1alpha-OHase) gene was inactivated presented the same clinical

  3. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  4. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  5. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  6. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  7. The chicken beta 2-microglobulin gene is located on a non-major histocompatibility complex microchromosome: a small, G+C-rich gene with X and Y boxes in the promoter

    DEFF Research Database (Denmark)

    Riegert, P; Andersen, R; Bumstead, N

    1996-01-01

    a similar genomic organization but smaller introns and higher G+C content than mammalian beta 2-microglobulin genes. The promoter region is particularly G+C-rich and contains, in addition to interferon regulatory elements, potential S/W, X, and Y boxes that were originally described for mammalian class II...... but not class I alpha or beta 2-microglobulin genes. There is a single chicken beta 2-microglobulin gene that has little polymorphism in the coding region. Restriction fragment length polymorphisms from Mhc homozygous lines, Mhc congenic lines, and backcross families, as well as in situ hybridization, show...

  8. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  9. ABNORMAL TYPE-III COLLAGEN PRODUCED BY AN EXON-17-SKIPPING MUTATION OF THE COL3A1 GENE IN EHLERS-DANLOS SYNDROME TYPE-IV IS NOT INCORPORATED INTO THE EXTRACELLULAR-MATRIX

    NARCIS (Netherlands)

    CHIODO, AA; SILLENCE, DO; COLE, WG; BATEMAN, JF

    1995-01-01

    A novel heterozygous mutation of the COL3Al gene that encodes the alpha 1(III) chains of type III collagen was identified in a family with the: acrogeric form of Ehlers-Danlos syndrome type IV (EDS-IV). Cultured dermal fibroblasts produced normal and shortened alpha 1(III) chains. The triple helix

  10. Reoxygenation of human coronary smooth muscle cells suppresses HIF-1{alpha} gene expression and augments radiation-induced growth delay and apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Grumann, T.; Arab, A.; Bode, C.; Hehrlein, C. [Dept. of Cardiology, Univ. Clinic of Freiburg (Germany); Guttenberger, R. [Dept. of Radiotherapy, Univ. Clinic of Freiburg (Germany)

    2006-01-01

    Background and Purpose: Catheter-based coronary brachytherapy with {beta}- and {gamma}-radiation is an evidence-based method to prevent restenosis after percutaneous transluminal coronary angioplasty (PTCA) and stent implantation, but the outcome may be PTCA are hypoxic. A lack of oxygen decreases the effect of low LET (linear energy transfer) irradiation. The authors assumed that reoxygenation of hypoxic human coronary smooth muscle cells (HCSMCs) improves the results of coronary brachytherapy. The expression of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}) gene, and the rates of growth and apoptosis of hypoxic and reoxygenated HCSMCs after {gamma}-iradiation were therefore analyzed. Material and Methods: An in vitro model of megacolonies of HCSMCs was developed. After exposure to chronic hypoxia the HCSMCs were irradiated with graded doses of 2, 4, 8, and 16 Gy using a {sup 60}Co source either under hypoxia (pO{sub 2}<3 mmHg) or after reoxygenation (pO{sub 2}{approx}150 mmHg). RT-PCR (reverse transcription-polymerase chain reaction) analysis was used to quantify HIF-1{alpha} gene expression and the growth of HCSMC megacolonies was measured serially. The oxygen enhancement ratio (OER) was calculate from the specific growth delay. Apoptosis of HCSMCs was quantified by counting cells with specific DNA strand breaks using the TUNEL assy. Results: HIF-1{alpha} gene expression was markedly suppressed in reoxygenated cells versus hypoxic cells 30 min after {gamma}-irradiation at all radiation doses (158{+-}46% vs. 1,675{+-}1,211%; p<0.01). Apoptosis was markedly increased in reoxygenated HCSMCs. The OER was 1.8(95% CI[confidence interval]1.3-2.4). Therefore, reoxygenated HCSMCs require 44% less radiation dose to achieve the equivalent biological radiation effect compared to hypoxic HCSMCs. Conclusion: Reoxygenation of coronary smooth muscle cells should be considered an option to increase efficacy of coronary brachytherapy. This could be used to reduce radiation dose

  11. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  12. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  13. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  14. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  15. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  17. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  18. Secondary reduction of alpha7B integrin in laminin alpha2 deficient congenital muscular dystrophy supports an additional transmembrane link in skeletal muscle.

    Science.gov (United States)

    Cohn, R D; Mayer, U; Saher, G; Herrmann, R; van der Flier, A; Sonnenberg, A; Sorokin, L; Voit, T

    1999-03-01

    The integrins are a large family of heterodimeric transmembrane cellular receptors which mediate the association between the extracellular matrix (ECM) and cytoskeletal proteins. The alpha7beta1 integrin is a major laminin binding integrin in skeletal and cardiac muscle and is thought to be involved in myogenic differentiation and migration processes. The main binding partners of the alpha7 integrin are laminin-1 (alpha1-beta1-gamma1), laminin-2 (alpha2-beta1-gamma1) and laminin-4 (alpha2-beta2-gamma1). Targeted deletion of the gene for the alpha7 integrin subunit (ITGA7) in mice leads to a novel form of muscular dystrophy. In the present study we have investigated the expression of two alternative splice variants, the alpha7B and beta1D integrin subunits, in normal human skeletal muscle, as well as in various forms of muscular dystrophy. In normal human skeletal muscle the expression of the alpha7 integrin subunit appeared to be developmentally regulated: it was first detected at 2 years of age. In contrast, the beta1D integrin could be detected in immature and mature muscle in the sarcolemma of normal fetal skeletal muscle at 18 weeks gestation. The expression of alpha7B integrin was significantly reduced at the sarcolemma in six patients with laminin alpha2 chain deficient congenital muscular dystrophy (CMD) (age >2 years). However, this reduction was not correlated with the amount of laminin alpha2 chain expressed. In contrast, the expression of the laminin alpha2 chain was not altered in the skeletal muscle of the alpha7 knock-out mice. These data argue in favor that there is not a tight correlation between the expression of the alpha7 integrin subunit and that of the laminin alpha2 chain in either human or murine dystrophic muscle. Interestingly, in dystrophinopathies (Duchenne and Becker muscular dystrophy; DMD/BMD) expression of alpha7B was upregulated irrespective of the level of dystrophin expression as shown by a strong sarcolemmal staining pattern even

  19. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  20. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  2. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  3. Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

    Energy Technology Data Exchange (ETDEWEB)

    Kooptiwut, Suwattanee, E-mail: S_kooptiwut@hotmail.com [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Sujjitjoon, Jatuporn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Plengvidhya, Nattachet [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Division of Endocrinology and Metabolism, Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Semprasert, Namoiy [Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Furuta, Hiroto; Nanjo, Kishio [The First Department, Wakayama Medical University (Japan); Banchuin, Napatawn [Department of Immunology and Immunology Graduate Program, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Yenchitsomanus, Pa-thai [Division of Medical Molecular Biology, Medicine Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Medical Biotechnology Unit, National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), Bangkok (Thailand)

    2009-05-22

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

  4. Activation of peroxisome proliferator-activated receptor-{alpha} enhances fatty acid oxidation in human adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Joo-Young; Hashizaki, Hikari; Goto, Tsuyoshi; Sakamoto, Tomoya; Takahashi, Nobuyuki [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan); Kawada, Teruo, E-mail: fat@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji, Kyoto 611-0011 (Japan)

    2011-04-22

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of adipocyte differentiation marker genes and GPDH activity in human adipocytes. {yields} PPAR{alpha} activation also increased insulin-dependent glucose uptake in human adipocytes. {yields} PPAR{alpha} activation did not affect lipid accumulation in human adipocytes. {yields} PPAR{alpha} activation increased fatty acid oxidation through induction of fatty acid oxidation-related genes in human adipocytes. -- Abstract: Peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) is a key regulator for maintaining whole-body energy balance. However, the physiological functions of PPAR{alpha} in adipocytes have been unclarified. We examined the functions of PPAR{alpha} using human multipotent adipose tissue-derived stem cells as a human adipocyte model. Activation of PPAR{alpha} by GW7647, a potent PPAR{alpha} agonist, increased the mRNA expression levels of adipocyte differentiation marker genes such as PPAR{gamma}, adipocyte-specific fatty acid-binding protein, and lipoprotein lipase and increased both GPDH activity and insulin-dependent glucose uptake level. The findings indicate that PPAR{alpha} activation stimulates adipocyte differentiation. However, lipid accumulation was not changed, which is usually observed when PPAR{gamma} is activated. On the other hand, PPAR{alpha} activation by GW7647 treatment induced the mRNA expression of fatty acid oxidation-related genes such as CPT-1B and AOX in a PPAR{alpha}-dependent manner. Moreover, PPAR{alpha} activation increased the production of CO{sub 2} and acid soluble metabolites, which are products of fatty acid oxidation, and increased oxygen consumption rate in human adipocytes. The data indicate that activation of PPAR{alpha} stimulates both adipocyte differentiation and fatty acid oxidation in human adipocytes, suggesting that PPAR{alpha} agonists could improve insulin resistance without lipid accumulation in adipocytes. The expected

  5. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  6. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  7. Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

    Science.gov (United States)

    Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

    2014-04-18

    The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Expansion of microsatellite in the thyroid hormone receptor-alpha1 gene linked to increased receptor expression and less aggressive thyroid cancer

    DEFF Research Database (Denmark)

    Onda, Masamitsu; Li, Daisy; Suzuki, Shinichi

    2002-01-01

    PURPOSE: The purpose of this study was to determine whether the length of the THRA1 microsatellite, which resides in a noncoding portion of the thyroid hormone receptor-alpha1 gene, affects receptor expression and is linked to clinicopathological parameters in thyroid cancer. EXPERIMENTAL DESIGN......: In 30 cases of surgically resected sporadic thyroid cancer, the length of the THRA1 microsatellite was determined by DNA sequence analysis, and expression of thyroid hormone receptor-alpha1 was assessed immunohistochemically in thin sections cut from tumor blocks. The length of THRA1 and expression...... of thyroid hormone receptor-alpha1 were also assessed in seven cancer cell lines. Regression analysis was used to gauge the correlation between the size of THRA1 and receptor expression. Multivariate analysis was used to test for links to the clinical parameters of gender, age, histology, stage, nodal...

  9. Relationship between intratumoral expression of genes coding for xenobiotic-metabolizing enzymes and benefit from adjuvant tamoxifen in estrogen receptor alpha-positive postmenopausal breast carcinoma

    International Nuclear Information System (INIS)

    Bièche, Ivan; Girault, Igor; Urbain, Estelle; Tozlu, Sengül; Lidereau, Rosette

    2004-01-01

    Little is known of the function and clinical significance of intratumoral dysregulation of xenobiotic-metabolizing enzyme expression in breast cancer. One molecular mechanism proposed to explain tamoxifen resistance is altered tamoxifen metabolism and bioavailability. To test this hypothesis, we used real-time quantitative RT-PCR to quantify the mRNA expression of a large panel of genes coding for the major xenobiotic-metabolizing enzymes (12 phase I enzymes, 12 phase II enzymes and three members of the ABC transporter family) in a small series of normal breast (and liver) tissues, and in estrogen receptor alpha (ERα)-negative and ERα-positive breast tumors. Relevant genes were further investigated in a well-defined cohort of 97 ERα-positive postmenopausal breast cancer patients treated with primary surgery followed by adjuvant tamoxifen alone. Seven of the 27 genes showed very weak or undetectable expression in both normal and tumoral breast tissues. Among the 20 remaining genes, seven genes (CYP2A6, CYP2B6, FMO5, NAT1, SULT2B1, GSTM3 and ABCC11) showed significantly higher mRNA levels in ERα-positive breast tumors than in normal breast tissue, or showed higher mRNA levels in ERα-positive breast tumors than in ERα-negative breast tumors. In the 97 ERα-positive breast tumor series, most alterations of these seven genes corresponded to upregulations as compared with normal breast tissue, with an incidence ranging from 25% (CYP2A6) to 79% (NAT1). Downregulation was rare. CYP2A6, CYP2B6, FMO5 and NAT1 emerged as new putative ERα-responsive genes in human breast cancer. Relapse-free survival was longer among patients with FMO5-overexpressing tumors or NAT1-overexpressing tumors (P = 0.0066 and P = 0.000052, respectively), but only NAT1 status retained prognostic significance in Cox multivariate regression analysis (P = 0.0013). Taken together, these data point to a role of genes coding for xenobiotic-metabolizing enzymes in breast tumorigenesis, NAT1 being an

  10. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  11. Identification of wild soybean (Glycine soja) TIFY family genes and their expression profiling analysis under bicarbonate stress.

    Science.gov (United States)

    Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming

    2013-02-01

    Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.

  12. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  13. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  14. Expression of human lymphotoxin alpha in Aspergillus niger

    NARCIS (Netherlands)

    Krasevec, N.; Hondel, C.A.M.J.J. van de; Komel, R.

    2000-01-01

    A gene-fusion expression strategy was applied for heterologous expression of human lymphotoxin alpha (LTα) in the Aspergillus niger AB1.13 protease-deficient strain. The LTα gene was fused with the A. niger glucoamylase GII-form as a carrier-gene, behind its transcription control and secretion

  15. A Classic Case of Maple Syrup Urine Disease and a Novel Mutation in the BCKDHA Gene

    Directory of Open Access Journals (Sweden)

    Alieh Mirzaee

    2017-09-01

    Full Text Available Background: Maple syrup urine disease (MSUD is an inherited branched-chain amino acid metabolic disorder caused by the deficiency in the branched-chain alpha-keto acid dehydrogenase (BCKD complex. In MSUD, elevation of the branched-chain amino acids, such as alpha-keto acid and alpha-hydroxy acid, occurs due to the BCKDC gene deficiency, appearing in the blood, urine, and cerebrospinal fluid, which leads to neurological damage and mental retardation. MSUD phenotypically penetrates due to the mutations in the coding genes of four subunits of the BCKD complex, including the BCKDHA, BCKDHB, DBT, and DLD genes.Case report: We aimed to report the cases of three families whose children were affected by MSUD and presented with symptomatic features during the first week of birth, which were identified by mass spectrometry. DNA study was performed as a diagnosis panel containing four encoded BCKDC subunit genes.Conclusion: In the current study, DNA analysis and phenotypic manifestations indicated a novel mutation of c.143delT, p.L48Rfs*15 in the BCKDHA gene in a homozygous state, which is a causative mutation for the classic MSUD phenotype. Early diagnosis and neonatal screening are recommended for the accurate and effective treatment of this disease

  16. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  17. Characterization of a new cell-bound alpha-amylase in Bacillus subtilis 168 Marburg that is only immunologically related to the exocellular alpha-amylase.

    OpenAIRE

    Haddaoui, E; Petit-Glatron, M F; Chambert, R

    1995-01-01

    Immunoblot analysis of Bacillus subtilis cell extracts with polyclonal antibodies, raised against purified exocellular alpha-amylase, revealed one protein species of 82,000 Da. This protein was found even in cells in which the amyE gene, encoding exocellular alpha-amylase, was disrupted. Isolated from the membrane fraction, the 82,000-M(r) protein displayed an alpha-amylase activity in vitro.

  18. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  19. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    Science.gov (United States)

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  20. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  1. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  2. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  3. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  4. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  5. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  6. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  7. General and family-specific gene expression responses to viral hemorrhagic septicaemia virus infection in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.

    2011-01-01

    challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...

  8. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  9. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  10. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  11. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  12. Mitochondrial-related gene expression profiles suggest an important role of PGC-1alpha in the compensatory mechanism of endemic dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    He, Shu-Lan [Key Laboratory of Environment and Gene Related Diseases, Xi' an Jiaotong University, Ministry Education, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Key Laboratory of Trace Elements and Endemic Diseases, Xi' an Jiaotong University, Ministry of Health, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Tan, Wu-Hong, E-mail: tanwh@mail.xjtu.edu.cn [Key Laboratory of Environment and Gene Related Diseases, Xi' an Jiaotong University, Ministry Education, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Key Laboratory of Trace Elements and Endemic Diseases, Xi' an Jiaotong University, Ministry of Health, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Zhang, Zeng-Tie; Zhang, Feng [Key Laboratory of Environment and Gene Related Diseases, Xi' an Jiaotong University, Ministry Education, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Key Laboratory of Trace Elements and Endemic Diseases, Xi' an Jiaotong University, Ministry of Health, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Qu, Cheng-Juan [Institute of Biomedicine, University of Eastern Finland, Kuopio (Finland); Lei, Yan-Xia; Zhu, Yan-He [Key Laboratory of Environment and Gene Related Diseases, Xi' an Jiaotong University, Ministry Education, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Key Laboratory of Trace Elements and Endemic Diseases, Xi' an Jiaotong University, Ministry of Health, No. 76 Yanta West Road, Xi' an, Shaanxi 710061 (China); Yu, Han-Jie [Department of Biotechnology, Northwest University, Xi' an, Shaanxi 710069 (China); Xiang, You-Zhang [Shandong Institute for prevention and Treatment of Endemic Disease, Jinan, Shandong 250014 (China); and others

    2013-10-15

    Keshan disease (KD) is an endemic dilated cardiomyopathy with unclear etiology. In this study, we compared mitochondrial-related gene expression profiles of peripheral blood mononuclear cells (PBMCs) derived from 16 KD patients and 16 normal controls in KD areas. Total RNA was isolated, amplified, labeled and hybridized to Agilent human 4×44k whole genome microarrays. Mitochondrial-related genes were screened out by the Third-Generation Human Mitochondria-Focused cDNA Microarray (hMitChip3). Quantitative real-time PCR, immunohistochemical and biochemical parameters related mitochondrial metabolism were conducted to validate our microarray results. In KD samples, 34 up-regulated genes (ratios≥2.0) were detected by significance analysis of microarrays and ingenuity systems pathway analysis (IPA). The highest ranked molecular and cellular functions of the differentially regulated genes were closely related to amino acid metabolism, free radical scavenging, carbohydrate metabolism, and energy production. Using IPA, 40 significant pathways and four significant networks, involved mainly in apoptosis, mitochondrion dysfunction, and nuclear receptor signaling were identified. Based on our results, we suggest that PGC-1alpha regulated energy metabolism and anti-apoptosis might play an important role in the compensatory mechanism of KD. Our results may lead to the identification of potential diagnostic biomarkers for KD in PBMCs, and may help to understand the pathogenesis of KD. Highlights: • Thirty-four up-regulated genes were detected in KD versus health controls. • Forty pathways and four networks were detected in KD. • PGC-1alpha regulated energy metabolism and anti-apoptosis in KD.

  13. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  14. Insights into the Evolution of a Snake Venom Multi-Gene Family from the Genomic Organization of Echis ocellatus SVMP Genes

    Directory of Open Access Journals (Sweden)

    Libia Sanz

    2016-07-01

    Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.

  15. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  16. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  17. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  19. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  20. Study on cellular genotoxicities induced by alpha particles irradiation in combination with NNK treatment

    International Nuclear Information System (INIS)

    Li Ping; Yang Zhihua; Pan Xiujie; Cao Zhenshan; Mi Na; Chen Zhongmin; Liu Gang; Wei Han; Li Huiying; Zhu Maoxiang

    2006-01-01

    Objective: To investigate cellular genotoxicities of aplha particles irradiation in combination with NNK treatment. Methods: Exponentially growing immortalized human bronchial epithelial cells were divided into the normal control group (NC), alpha particles irradiation (α), NNK administration group (NNK), NNK administration (100 μg/ml) followed by alpha particles irradiation group (NNK + α), and alpha particles irradiation followed by NNK administration (100 μg/ml) group (μ + NNK). DNA damage were detected by single cell gel electrophoresis (SCGE); multinuclear cell assay was used to detect the frequency of the HPRT gene mutation; cell micronucleus frequency were detected by cytogenetic methods. Results: In the group exposed to both alpha particles irradiation and NNK, DNA damage, HPRT gene mutation frequency, and cell micronucleus frequency were significantly higher than those in the same dose groups irradiated with alpha particles or NNK administration alone. Subtracted the NNK effect, DNA damage, HPRT gene mutation frequency and cell micronucleus frequency in the group irradiated by alpha particles in combination with NNK administration were significantly higher than those of alpha particles irradiation alone. Conclusion: The genotoxicity of alpha particles irradiation in combination with NNK administration had synergistic effect. (authors)

  1. Relation of estrogen receptor-alpha gene polymorphism and hormone replacement therapy to fall risk and muscle strength in early postmenopausal women.

    Science.gov (United States)

    Salmén, Timo; Heikkinen, Anna-Mari; Mahonen, Anitta; Kröger, Heikki; Komulainen, Marja; Saarikoski, Seppo; Honkanen, Risto; Partanen, Juhani; Mäenpää, Pekka H

    2002-01-01

    Several factors may increase fracture risk, among them reduced bone mineral density (BMD), increased bone resorption, microarchitectural deterioration of bone, increased fall risk, and decreased muscle strength. We have previously reported that PvuII polymorphism of the estrogen receptor-alpha (ER alpha) gene is associated with bone loss rate, fracture risk, and response to hormone replacement therapy (HRT) in early postmenopausal Finnish women. We studied the influence of the ER alpha genotype on fall risk and muscle strength in a 5-year randomized HRT trial of 331 early postmenopausal women (subgroup of the population-based OSTPRE study, Kuopio, Finland). A 5-year postal inquiry in May 1994 included questions on falls during the previous 12 months. Grip strength was measured with dynamometer. The ER alpha gene polymorphism was analysed using PCR and PvuII restriction enzyme digestion. RESULTS. In all, 97 out of the 331 women reported falls. Half of those (56%) were slip falls, mostly during the winter season. In the HRT group, the ER alpha genotype was associated with fall risk (P = 0.002, logistic regression). The risk of falls (RR) was higher in women with the PP genotype than in those with the Pp (RR = 5.26, 95% CI 1.98-13.94, P = 0.001) or the pp (RR = 3.84, 95% CI 1.46-10.12, P = 0.007) genotype. When the falls were divided into slip (environment-related) and non-slip (endogenous) falls, the non-slip falls were associated with the genotype (P = 0.004), but the slip falls were not so clearly (P = 0.061). When all falls and non-slip falls were adjusted to the number of chronic health disorders and the variable time-since-menopause, the difference between the genotypes persisted (P = 0.003 and P = 0.010, respectively). In the non-HRT group, the ER alpha genotype was not associated with fall risk. The baseline or the 5-year grip strength values were not influenced by the ER alpha genotype. In conclusion, ER alpha polymorphism is associated with fall risk

  2. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  3. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  4. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  5. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

    Science.gov (United States)

    Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  6. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  7. Mice with deleted multimerin 1 and alpha-synuclein genes have impaired platelet adhesion and impaired thrombus formation that is corrected by multimerin 1.

    Science.gov (United States)

    Reheman, Adili; Tasneem, Subia; Ni, Heyu; Hayward, Catherine P M

    2010-05-01

    Multimerin 1 is a stored platelet and endothelial cell adhesive protein that shows significant conservation. In vitro, multimerin 1 supports platelet adhesion and it also binds to collagen and enhances von Willebrand factor-dependent platelet adhesion to collagen. As selective, multimerin 1 deficient mice have not been generated, we investigated multimerin 1 effects on platelet adhesion using a subpopulation of C57BL/6J mice with tandem deletion of the genes for multimerin 1 and alpha-synuclein, a protein that inhibits alpha-granule release in vitro. We postulated that multimerin 1/alpha-synuclein deficient mice might show impaired platelet adhesive function from multimerin 1 deficiency and increased alpha-granule release from alpha-synuclein deficiency. Platelet function was assessed by intravital microscopy, after ferric chloride injury, using untreated and human multimerin 1-transfused multimerin 1/alpha-synuclein deficient mice, and by in vitro assays of adhesion, aggregation and thrombin-induced P-selectin release. Multimerin 1/alpha-synuclein deficient mice showed impaired platelet adhesion and their defective thrombus formation at sites of vessel injury improved with multimerin 1 transfusion. Although multimerin 1/alpha-synuclein deficient platelets showed increased P-selectin release at low thrombin concentrations, they also showed impaired adhesion to collagen, and attenuated aggregation with thrombin, that improved with added multimerin 1. Our data suggest that multimerin 1 supports platelet adhesive functions and thrombus formation, which will be important to verify by generating and testing selective multimerin 1 deficient mice. Copyright (c) 2010. Published by Elsevier Ltd.

  8. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  9. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  10. alpha7 Nicotinic acetylcholine receptor knockout selectively enhances ethanol-, but not beta-amyloid-induced neurotoxicity.

    Science.gov (United States)

    de Fiebre, Nancyellen C; de Fiebre, Christopher M

    2005-01-03

    The alpha7 subtype of nicotinic acetylcholine receptor (nAChR) has been implicated as a potential site of action for two neurotoxins, ethanol and the Alzheimer's disease related peptide, beta-amyloid. Here, we utilized primary neuronal cultures of cerebral cortex from alpha7 nAChR null mutant mice to examine the role of this receptor in modulating the neurotoxic properties of subchronic, "binge" ethanol and beta-amyloid. Knockout of the alpha7 nAChR gene selectively enhanced ethanol-induced neurotoxicity in a gene dosage-related fashion. Susceptibility of cultures to beta-amyloid induced toxicity, however, was unaffected by alpha7 nAChR gene null mutation. Further, beta-amyloid did not inhibit the binding of the highly alpha7-selective radioligand, [(125)I]alpha-bungarotoxin. On the other hand, in studies in Xenopus oocytes ethanol efficaciously inhibited alpha7 nAChR function. These data suggest that alpha7 nAChRs modulate the neurotoxic effects of binge ethanol, but not the neurotoxicity produced by beta-amyloid. It is hypothesized that inhibition of alpha7 nAChRs by ethanol provides partial protection against the neurotoxic properties of subchronic ethanol.

  11. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress.

    Science.gov (United States)

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.

  12. Genome-wide analysis of the Musa WRKY gene family: evolution and differential expression during development and stress

    Directory of Open Access Journals (Sweden)

    Ridhi eGoel

    2016-03-01

    Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.

  13. The Role of the S40 Gene Family in Leaf Senescence

    Directory of Open Access Journals (Sweden)

    Muhammad Jehanzeb

    2017-10-01

    Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.

  14. Alpha1-antitrypsin deficiency: a clinical-genetic overview

    Directory of Open Access Journals (Sweden)

    Abboud RT

    2011-03-01

    in patients with chronic irreversible airflow obstruction, especially in those with early onset of disease or positive family history. Testing is also recommended for immediate family members of those with AATD, asthmatics with persistent airflow obstruction, and infants and older subjects with unexplained liver disease. There are over 100 different AAT gene variants; most are rare and only some are associated with clinical disease.Keywords: AAT, AATD, ZZ, early onset emphysema, panacinar emphysema, neonatal jaundice and hepatitis, childhood liver disease, genetics of alpha1-antitrypsin, alpha1-antitrypsin laboratory testing and phenotyping

  15. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  16. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  17. Study of oral clefts: Indication of gene-environment interaction

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S.J.; Beaty, T.H.; Panny, S. [Johns Hopkins Univ., Baltimore, MD (United States)] [and others

    1994-09-01

    In this study of infants with isolated birth defects, 69 cleft palate-only (CPO) cases, 114 cleft lip with or without palate (CL/P), and 284 controls with non-cleft birth defects (all born in Maryland during 1984-1992) were examined to test for associations among genetic markers and different oral clefts. Modest associations were found between transforming growth factor {alpha} (TGF{alpha}) marker and CPO, as well as that between D17S579 (Mfd188) and CL/P in this study. The association between TGF{alpha} marker and CPO reflects a statistical interaction between mother`s smoking and child`s TGF{alpha} genotype. A significantly higher risk of CPO was found among those reporting maternal smoking during pregnancy and carrying less common TGF{alpha} TaqI allele (odds ratio=7.02 with 95% confidence interval 1.8-27.6). This gene-environment interaction was also found among those who reported no family history of any type of birth defect (odds ratio=5.60 with 95% confidence interval 1.4-22.9). Similar associations were seen for CL/P, but these were not statistically significant.

  18. Association between SNP and haplotypes in PPARGCl and adiponectin genes and bone mineral density in Chinese nuclear families

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU

    2007-01-01

    Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.

  19. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  20. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  1. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

    Science.gov (United States)

    Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

    2017-10-08

    The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  2. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  3. A 28-day repeat dose toxicity study of steroidal glycoalkaloids, alpha-solanine and alpha-chaconine in the Syrian Golden hamster

    DEFF Research Database (Denmark)

    Langkilde, Søren; Mandimika, T.; Schrøder, Malene

    2009-01-01

    of the glycoalkaloids. The Syrian Golden hamster was given daily doses of alpha-solanine and alpha-chaconine by gavage for 28 days. Doses of up to 33.3 mg total glycoalkaloids/kg body weight were applied in ratios of 1:3.7 and 1:70 (alpha-solanine:alpha-chaconine). Administration of the highest doses of both ratios...... intestines of the hamsters administered the highest doses of the glycoalkaloid treatments. In general, more differential gene expression was observed in the epithelial scrapings of the hamsters fed the ratio of 1:3.7. Mostly, pathways involved in lipid and energy metabolism were affected by the ratio of 1:3.7....

  4. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  5. Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

    Science.gov (United States)

    Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

    2013-09-01

    SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  6. Autosomal dominant familial neurohypophyseal diabetes insipidus caused by a mutation in the arginine-vasopressin II gene in four generations of a Korean family

    Directory of Open Access Journals (Sweden)

    Myo-Jing Kim

    2014-12-01

    Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.

  7. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  8. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    Science.gov (United States)

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  9. Transcriptome analysis of WRKY gene family in Oryza officinalis Wall ex Watt and WRKY genes involved in responses to Xanthomonas oryzae pv. oryzae stress.

    Science.gov (United States)

    Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan

    2017-01-01

    Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.

  10. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  11. A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu

    2013-12-01

    To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.

  12. Clinical and molecular analysis of the enamelin gene ENAM in Colombian families with autosomal dominant amelogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Sandra Gutiérrez

    2012-01-01

    Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.

  13. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  14. GPR39 splice variants versus antisense gene LYPD1: expression and regulation in gastrointestinal tract, endocrine pancreas, liver, and white adipose tissue

    DEFF Research Database (Denmark)

    Egerod, Kristoffer L; Holst, Birgitte; Petersen, Pia S

    2007-01-01

    nervous system as characterized with both quantitative RT-PCR and in situ hybridization analysis. A functional analysis of the GPR39 promoter region identified sites for the hepatocyte nuclear factors 1alpha and 4alpha (HNF-1alpha and -4alpha) and specificity protein 1 (SP1) transcription factors as being......G protein-coupled receptor 39 (GPR39) is a constitutively active, orphan member of the ghrelin receptor family that is activated by zinc ions. GPR39 is here described to be expressed in a full-length, biologically active seven-transmembrane form, GPR39-1a, as well as in a truncated splice variant...... five-transmembrane form, GPR39-1b. The 3' exon of the GPR39 gene overlaps with an antisense gene called LYPD1 (Ly-6/PLAUR domain containing 1). Quantitative RT-PCR analysis demonstrated that GPR39-1a is expressed selectively throughout the gastrointestinal tract, including the liver and pancreas...

  15. Gene-expression patterns in peripheral blood classify familial breast cancer susceptibility.

    Science.gov (United States)

    Piccolo, Stephen R; Andrulis, Irene L; Cohen, Adam L; Conner, Thomas; Moos, Philip J; Spira, Avrum E; Buys, Saundra S; Johnson, W Evan; Bild, Andrea H

    2015-11-04

    Women with a family history of breast cancer face considerable uncertainty about whether to pursue standard screening, intensive screening, or prophylactic surgery. Accurate and individualized risk-estimation approaches may help these women make more informed decisions. Although highly penetrant genetic variants have been associated with familial breast cancer (FBC) risk, many individuals do not carry these variants, and many carriers never develop breast cancer. Common risk variants have a relatively modest effect on risk and show limited potential for predicting FBC development. As an alternative, we hypothesized that additional genomic data types, such as gene-expression levels, which can reflect genetic and epigenetic variation, could contribute to classifying a person's risk status. Specifically, we aimed to identify common patterns in gene-expression levels across individuals who develop FBC. We profiled peripheral blood mononuclear cells from women with a family history of breast cancer (with or without a germline BRCA1/2 variant) and from controls. We used the support vector machines algorithm to differentiate between patients who developed FBC and those who did not. Our study used two independent datasets, a training set of 124 women from Utah (USA) and an external validation (test) set from Ontario (Canada) of 73 women (197 total). We controlled for expression variation associated with clinical, demographic, and treatment variables as well as lymphocyte markers. Our multigene biomarker provided accurate, individual-level estimates of FBC occurrence for the Utah cohort (AUC = 0.76 [0.67-84]) . Even at their lower confidence bounds, these accuracy estimates meet or exceed estimates from alternative approaches. Our Ontario cohort resulted in similarly high levels of accuracy (AUC = 0.73 [0.59-0.86]), thus providing external validation of our findings. Individuals deemed to have "high" risk by our model would have an estimated 2.4 times greater odds of

  16. The Plasmodium PHIST and RESA-Like Protein Families of Human and Rodent Malaria Parasites

    Science.gov (United States)

    Moreira, Cristina K.; Naissant, Bernina; Coppi, Alida; Bennett, Brandy L.; Aime, Elena; Franke-Fayard, Blandine; Janse, Chris J.; Coppens, Isabelle; Sinnis, Photini; Templeton, Thomas J.

    2016-01-01

    The phist gene family has members identified across the Plasmodium genus, defined by the presence of a domain of roughly 150 amino acids having conserved aromatic residues and an all alpha-helical structure. The family is highly amplified in P. falciparum, with 65 predicted genes in the genome of the 3D7 isolate. In contrast, in the rodent malaria parasite P. berghei 3 genes are identified, one of which is an apparent pseudogene. Transcripts of the P. berghei phist genes are predominant in schizonts, whereas in P. falciparum transcript profiles span different asexual blood stages and gametocytes. We pursued targeted disruption of P. berghei phist genes in order to characterize a simplistic model for the expanded phist gene repertoire in P. falciparum. Unsuccessful attempts to disrupt P. berghei PBANKA_114540 suggest that this phist gene is essential, while knockout of phist PBANKA_122900 shows an apparent normal progression and non-essential function throughout the life cycle. Epitope-tagging of P. falciparum and P. berghei phist genes confirmed protein export to the erythrocyte cytoplasm and localization with a punctate pattern. Three P. berghei PEXEL/HT-positive exported proteins exhibit at least partial co-localization, in support of a common vesicular compartment in the cytoplasm of erythrocytes infected with rodent malaria parasites. PMID:27022937

  17. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  18. Association of transforming growth-factor alpha gene polymorphisms with nonsyndromic cleft palate only (CPO)

    Energy Technology Data Exchange (ETDEWEB)

    Shiang, R. (Univ. of California, Irvine, CA (United States)); Lidral, A.C.; Ardinger, H.H.; Murray, J.C.; Romitti, P.A.; Munger, R.G.; Buetow, K.H.

    1993-10-01

    Genetic analysis and tissue-specific expression studies support a role for transforming growth-factor alpha (TGFA) in craniofacial development. Previous studies have confirmed an association of alleles for TGFA with nonsyndromic cleft lip with or without cleft palate (CL/P) in humans. The authors carried out a retrospective association study to determine whether specific allelic variants of the TGFA gene are also associated with cleft palate only (CPO). The PCR products from 12 overlapping sets of primers to the TGFA cDNA were examined by using single-strand conformational polymorphism analysis. Four DNA polymorphic sites for TGFA were identified in the 3[prime] untranslated region of the TGFA gene. These variants, as well as previously identified RFLPs for TGFA, were characterized in case and control populations for CPO by using X[sup 2] analysis. A significant association between alleles of TGFA and CPO was identified which further supports a role for this gene as one of the genetic determinants of craniofacial development. Sequence analysis of the variants disclosed a cluster of three variable sites within 30 bp of each other in the 3[prime] untranslated region previously associated with an antisense transcript. These studies extend the role for TGFA in craniofacial morphogenesis and support an interrelated mechanism underlying nonsyndromic forms of CL/P. 46 refs., 3 figs., 3 tabs.

  19. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  20. New insight into structure/function relationships in plant alpha-amylase family GH13 members

    DEFF Research Database (Denmark)

    Seo, Eun-Seong; Andersen, Joakim Mark; Nielsen, Morten Munch

    2010-01-01

    Two carbohydrate binding surface sites (SBSs) on barley α-amylase 1 (AMY1) of glycoside hydrolase family 13 (GH13) displayed synergy in interactions with starch granules, thus being pivotal for hydrolysis of supramolecular substrates. Mutational analysis showed that SBS1 is more critical for the ......Two carbohydrate binding surface sites (SBSs) on barley α-amylase 1 (AMY1) of glycoside hydrolase family 13 (GH13) displayed synergy in interactions with starch granules, thus being pivotal for hydrolysis of supramolecular substrates. Mutational analysis showed that SBS1 is more critical...... binding domains (SBDs) mediate binding to starch granules. SBDs are currently categorised into 9 carbohydrate binding module (CBM) families. A novel CBM20 subfamily encountered in regulatory enzymes possesses characteristically low affinity for β-CD. Although α-amylase is essential for starch mobilisation...... in germinating barley seeds, efficient degradation requires the concerted action of α-amylase, β-amylase, limit dextrinase (LD) and possibly α-glucosidase. Limit dextrinase (LD) is encoded by a single gene and represents the sole debranching activity during germination. Recent expression of functional LD...