WorldWideScience

Sample records for aldo-keto reductase akr1b10

  1. Expression of the Aldo-Keto Reductases AKR1B1 and AKR1B10 in Human Cancers.

    Directory of Open Access Journals (Sweden)

    BrianLaffin

    2012-06-01

    Full Text Available The American Cancer Society estimates that there will be more than 1.5 million new cases of cancer in 2011, underscoring the need for identification of new therapeutic targets and development of novel cancer therapies. Previous studies have implicated the human aldo-keto reductases AKR1B1 and AKR1B10 in cancer, and therefore we examined AKR1B1 and AKR1B10 expression across all major human cancer types using the Oncomine cancer gene expression database (Compendia Biosciences, www.oncomine.com. Using this database, we found that expression of of AKR1B1 and AKR1B10 varies greatly by cancer type and tissue of origin, including agreement with previous reports that AKR1B10 is significantly over-expressed in cancers of the lungs and liver. AKR1B1 is more broadly over-expressed in human cancers than AKR1B10, albeit at a generally lower magnitude. AKR1B1 over-expression was found to be associated with shortened patient survival in acute myelogenous leukemias and multiple myelomas. High AKR1B10 expression tends to predict less aggressive clinical course generally, notably within lung cancers, where it tends to be highly over-expressed compared to normal tissue. These findings suggest that AKR1B1 inhibitors in particular hold great potential as novel cancer therapeutics.

  2. The Aldo-Keto Reductase AKR1B10 Is Up-Regulated in Keloid Epidermis, Implicating Retinoic Acid Pathway Dysregulation in the Pathogenesis of Keloid Disease.

    Science.gov (United States)

    Jumper, Natalie; Hodgkinson, Tom; Arscott, Guyan; Har-Shai, Yaron; Paus, Ralf; Bayat, Ardeshir

    2016-07-01

    Keloid disease is a recurrent fibroproliferative cutaneous tumor of unknown pathogenesis for which clinical management remains unsatisfactory. To obtain new insights into hitherto underappreciated aspects of keloid pathobiology, we took a laser capture microdissection-based, whole-genome microarray analysis approach to identify distinct keloid disease-associated gene expression patterns within defined keloid regions. Identification of the aldo-keto reductase enzyme AKR1B10 as highly up-regulated in keloid epidermis suggested that an imbalance of retinoic acid metabolism is likely associated with keloid disease. Here, we show that AKR1B10 transfection into normal human keratinocytes reproduced the abnormal retinoic acid pathway expression pattern we had identified in keloid epidermis. Cotransfection of AKR1B10 with a luciferase reporter plasmid showed reduced retinoic acid response element activity, supporting the hypothesis of retinoic acid synthesis deficiency in keloid epidermis. Paracrine signals released by AKR1B10-overexpressing keratinocytes into conditioned medium resulted in up-regulation of transforming growth factor-β1, transforming growth factor-β2, and collagens I and III in both keloid and normal skin fibroblasts, mimicking the typical profibrotic keloid profile. Our study results suggest that insufficient retinoic acid synthesis by keloid epidermal keratinocytes may contribute to the pathogenesis of keloid disease. We refocus attention on the role of injured epithelium in keloid disease and identify AKR1B10 as a potential new target in future management of keloid disease. PMID:27025872

  3. Aldo-keto reductase 1B10 and its role in proliferation capacity of drug-resistant cancers

    Directory of Open Access Journals (Sweden)

    Toshiyuki eMatsunaga

    2012-01-01

    Full Text Available The human aldo-keto reductase AKR1B10, originally identified as an aldose reductase-like protein and human small intestine aldose reductase, is a cytosolic NADPH-dependent reductase that metabolizes a variety of endogenous compounds, such as aromatic and aliphatic aldehydes and dicarbonyl compounds, and some drug ketones. The enzyme is highly expressed in solid tumors of several tissues including lung and liver, and as such has received considerable interest as a relevant biomarker for the development of those tumors. In addition, AKR1B10 has been recently reported to be significantly up-regulated in some cancer cell lines (medulloblastoma D341 and colon cancer HT29 acquiring resistance towards chemotherapeutic agents (cyclophosphamide and mitomycin c, suggesting the validity of the enzyme as a chemoresistance marker. Although the detailed information on the AKR1B10-mediated mechanisms leading to the drug resistance process is not well understood so far, the enzyme has been proposed to be involved in functional regulations of cell proliferation and metabolism of drugs and endogenous lipids during the development of chemoresistance. This article reviews the current literature focusing mainly on expression profile and roles of AKR1B10 in the drug resistance of cancer cells. Recent developments of AKR1B10 inhibitors and their usefulness in restoring sensitivity to anticancer drugs are also reviewed.

  4. BIOLOGICAL ROLE OF ALDO-KETO REDUCTASES IN RETINOIC ACID BIOSYNTHESIS AND SIGNALING

    Directory of Open Access Journals (Sweden)

    F. Xavier eRuiz

    2012-04-01

    Full Text Available Several aldo-keto reductase (AKR enzymes from subfamilies 1B and 1C show retinaldehyde reductase activity, having low Km and kcat values. Only AKR1B10 and 1B12, with all-trans-retinaldehyde, and AKR1C3, with 9-cis-retinaldehyde, display high catalytic efficiency. Major structural determinants for retinaldehyde isomer specificity are located in the external loops (A and C for AKR1B10, and B for AKR1C3, as assessed by site-directed mutagenesis and molecular dynamics. Cellular models have shown that AKR1B and 1C enzymes are well suited to work in vivo as retinaldehyde reductases and to regulate retinoic acid (RA biosynthesis at hormone pre-receptor level. An additional physiological role for the retinaldehyde reductase activity of these enzymes, consistent with their tissue localization, is their participation in β-carotene absorption. Retinaldehyde metabolism may be subjected to subcellular compartmentalization, based on enzyme localization. While retinaldehyde oxidation to RA takes place in the cytosol, reduction to retinol could take place in the cytosol by AKRs or in the membranes of endoplasmic reticulum by microsomal retinaldehyde reductases. Upregulation of some AKR1 enzymes in different cancer types may be linked to their induction by oxidative stress and to their participation in different signaling pathways related to cell proliferation. AKR1B10 and AKR1C3, through their retinaldehyde reductase activity, trigger a decrease in the RA biosynthesis flow, resulting in RA deprivation and consequently lower differentiation, with an increased cancer risk in target tissues. Rational design of selective AKR inhibitors could lead to development of novel drugs for cancer treatment as well as reduction of chemotherapeutic drug resistance.

  5. Aldo-keto reductase (AKR) superfamily: Genomics and annotation

    OpenAIRE

    Mindnich Rebekka D; Penning Trevor M

    2009-01-01

    Abstract Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AK...

  6. Aldo-keto reductase family 1 B10 protein detoxifies dietary and lipid-derived alpha, beta-unsaturated carbonyls at physiological levels

    International Nuclear Information System (INIS)

    Alpha, beta-unsaturated carbonyls are highly reactive mutagens and carcinogens to which humans are exposed on a daily basis. This study demonstrates that aldo-keto reductase family 1 member B10 (AKR1B10) is a critical protein in detoxifying dietary and lipid-derived unsaturated carbonyls. Purified AKR1B10 recombinant protein efficiently catalyzed the reduction to less toxic alcohol forms of crotonaldehyde at 0.90 μM, 4-hydroxynonenal (HNE) at 0.10 μM, trans-2-hexanal at 0.10 μM, and trans-2,4-hexadienal at 0.05 μM, the concentrations at or lower than physiological exposures. Ectopically expressed AKR1B10 in 293T cells eliminated immediately HNE at 1 (subtoxic) or 5 μM (toxic) by converting to 1,4-dihydroxynonene, protecting the cells from HNE toxicity. AKR1B10 protein also showed strong enzymatic activity toward glutathione-conjugated carbonyls. Taken together, our study results suggest that AKR1B10 specifically expressed in the intestine is physiologically important in protecting the host cell against dietary and lipid-derived cytotoxic carbonyls.

  7. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    International Nuclear Information System (INIS)

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  8. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    Energy Technology Data Exchange (ETDEWEB)

    Matsunaga, Toshiyuki, E-mail: matsunagat@gifu-pu.ac.jp [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Morikawa, Yoshifumi; Haga, Mariko; Endo, Satoshi [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Soda, Midori; Yamamura, Keiko [Laboratory of Clinical Pharmacy, School of Pharmacy, Aichi Gakuin University, Nagoya 464-8650 (Japan); El-Kabbani, Ossama [Monash Institute of Pharmaceutical Sciences, Monash University, Victoria 3052 (Australia); Tajima, Kazuo [Faculty of Pharmaceutical Sciences, Hokuriku University, Kanazawa 920-1181 (Japan); Ikari, Akira [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Hara, Akira [Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan)

    2014-07-15

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  9. Aldo-keto reductase 1B10 promotes development of cisplatin resistance in gastrointestinal cancer cells through down-regulating peroxisome proliferator-activated receptor-γ-dependent mechanism.

    Science.gov (United States)

    Matsunaga, Toshiyuki; Suzuki, Ayaka; Kezuka, Chihiro; Okumura, Naoko; Iguchi, Kazuhiro; Inoue, Ikuo; Soda, Midori; Endo, Satoshi; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-08-25

    Cisplatin (cis-diamminedichloroplatinum, CDDP) is one of the most effective chemotherapeutic drugs that are used for treatment of patients with gastrointestinal cancer cells, but its continuous administration often evokes the development of chemoresistance. In this study, we investigated alterations in antioxidant molecules and functions using a newly established CDDP-resistant variant of gastric cancer MKN45 cells, and found that aldo-keto reductase 1B10 (AKR1B10) is significantly up-regulated with acquisition of the CDDP resistance. In the nonresistant MKN45 cells, the sensitivity to cytotoxic effect of CDDP was decreased and increased by overexpression and silencing of AKR1B10, respectively. In addition, the AKR1B10 overexpression markedly suppressed accumulation and cytotoxicity of 4-hydroxy-2-nonenal that is produced during lipid peroxidation by CDDP treatment, suggesting that the enzyme acts as a crucial factor for facilitation of the CDDP resistance through inhibiting induction of oxidative stress by the drug. Transient exposure to CDDP and induction of the CDDP resistance decreased expression of peroxisome proliferator-activated receptor-γ (PPARγ) in MKN45 and colon cancer LoVo cells. Additionally, overexpression of PPARγ in the cells elevated the sensitivity to the CDDP toxicity, which was further augmented by concomitant treatment with a PPARγ ligand rosiglitazone. Intriguingly, overexpression of AKR1B10 in the cells resulted in a decrease in PPARγ expression, which was recovered by addition of an AKR1B10 inhibitor oleanolic acid, inferring that PPARγ is a downstream target of AKR1B10-dependent mechanism underlying the CDDP resistance. Combined treatment with the AKR1B10 inhibitor and PPARγ ligand elevated the CDDP sensitivity, which was almost the same level as that in the parental cells. These results suggest that combined treatment with the AKR1B10 inhibitor and PPARγ ligand is an effective adjuvant therapy for overcoming CDDP resistance of

  10. Aldo keto reductases 1B in endocrinology and metabolism

    Directory of Open Access Journals (Sweden)

    AntoineMartinez

    2012-08-01

    Full Text Available The aldose reductase (human AKR1B1/mouse Akr1b3 has been the focus of many research because of its role in diabetic complications. The starting point of these alterations is the massive entry of glucose in polyol pathway where it is converted into sorbitol by this enzyme. However, the issue of aldose reductase function in non-diabetic condition remains unresolved. Aldose reductase-like enzymes (AKR1B10, Akr1b7 and Akr1b8 are highly related isoforms often co-expressed with bona fide aldose reductase, making functional analysis of one or the other isoform a challenging task. AKR1B/Akr1b members share at least 65% protein identity and the general ability to reduce many redundant substrates such as aldehydes provided from lipid peroxidation, steroids and their by-products and xenobiotics in vitro. Based on these properties, AKR1B/Akr1b are generally considered as detoxifying enzymes. Considering that divergences should be more informative than similarities to help understanding their physiological functions, we chose to review specific hallmarks of each human/mouse isoforms by focusing on tissue distribution and specific mechanisms of gene regulation. Indeed, although the aldose reductase shows ubiquitous expression, aldose reductase-like proteins exhibit tissue-specific patterns of expression. We focused on 3 organs where certain isoforms are enriched, the adrenal gland, enterohepatic and adipose tissues and tried to connect recent enzymatic and regulation data with endocrine and metabolic functions of these organs. We presented recent mouse models showing unsuspected physiological functions in the regulation of glucido-lipidic metabolism and adipose tissue homeostasis. Beyond the widely accepted idea that AKR1B/Akr1b are detoxification enzymes, these recent reports provide growing evidences that they are able to modify or generate signal molecules. This conceptually shifts this class of enzymes from unenviable status of scavenger to upper class of

  11. Aldo-keto reductase (AKR) superfamily: genomics and annotation.

    Science.gov (United States)

    Mindnich, Rebekka D; Penning, Trevor M

    2009-07-01

    Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglandins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (alpha/beta) 8 -barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega) database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/). This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]). The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised. PMID:19706366

  12. Aldo-keto reductase (AKR superfamily: Genomics and annotation

    Directory of Open Access Journals (Sweden)

    Mindnich Rebekka D

    2009-07-01

    Full Text Available Abstract Aldo-keto reductases (AKRs are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions. Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (α/(β8-barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/. This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]. The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised.

  13. Paper de les Aldo-Ceto reductases en el metabolisme de retinoides: estudi funcional i estructural de l'AKR1B10

    OpenAIRE

    Gallego Moli, Oriol

    2006-01-01

    Per primer cop, el nostre grup va identificar un enzim de la superfamilia de les aldo-ceto reductases (AKR) actiu amb retinoides. Atès que l'AKR1B12 presenta una identitat seqüencial pròxima al 70% amb l'AKR1B1 i l'AKR1B10 humanes, es va decidir ampliar l'estudi de l'activitat retinoide oxidoreductasa entre les AKR. En la present Tesi Doctoral, hem aprofundit en l'estudi de l'activitat retinal reductasa de membres de la superfamilia de les aldo-ceto reductases (AKR). El treball es va iniciar ...

  14. Berberine inhibits androgen synthesis by interaction with aldo-keto reductase 1C3 in 22Rv1 prostate cancer cells.

    Science.gov (United States)

    Tian, Yuantong; Zhao, Lijing; Wang, Ye; Zhang, Haitao; Xu, Duo; Zhao, Xuejian; Li, Yi; Li, Jing

    2016-01-01

    Aldo-keto reductase family 1 member C3 has recently been regarded as a potential therapeutic target in castrate-resistant prostate cancer. Herein, we investigated whether berberine delayed the progression of castrate-resistant prostate cancer by reducing androgen synthesis through the inhibition of Aldo-keto reductase family 1 member C3. Cell viability and cellular testosterone content were measured in prostate cancer cells. Aldo-keto reductase family 1 member C3 mRNA and protein level were detected by RT-PCR and Western bolt analyses, respectively. Computer analysis with AutoDock Tools explored the molecular interaction of berberine with Aldo-keto reductase family 1 member C3. We found that berberine inhibited 22Rv1 cells proliferation and decreased cellular testosterone formation in a dose-dependent manner. Berberine inhibited Aldo-keto reductase family 1 member C3 enzyme activity, rather than influenced mRNA and protein expressions. Molecular docking study demonstrated that berberine could enter the active center of Aldo-keto reductase family 1 member C3 and form p-p interaction with the amino-acid residue Phe306 and Phe311. In conclusion, the structural interaction of berberine with Aldo-keto reductase family 1 member C3 is attributed to the suppression of Aldo-keto reductase family 1 member C3 enzyme activity and the inhibition of 22Rv1 prostate cancer cell growth by decreasing the intracellular androgen synthesis. Our result provides the experimental basis for the design, research, and development of AKR1C3 inhibitors using berberine as the lead compound. PMID:26698234

  15. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    OpenAIRE

    Nonneman Dan J; Wise Tommy H; Ford J Joe; Kuehn Larry A; Rohrer Gary A

    2006-01-01

    Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL) for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10) near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR) gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydr...

  16. Putative Role of the Aldo-Keto Reductase from Trypanosoma cruzi in Benznidazole Metabolism.

    Science.gov (United States)

    Garavaglia, Patricia Andrea; Laverrière, Marc; Cannata, Joaquín J B; García, Gabriela Andrea

    2016-05-01

    Benznidazole (Bz), the drug used for treatment of Chagas' disease (caused by the protozoan Trypanosoma cruzi), is activated by a parasitic NADH-dependent type I nitroreductase (NTR I). However, several studies have shown that other enzymes are involved. The aim of this study was to evaluate whether the aldo-keto reductase from T. cruzi (TcAKR), a NADPH-dependent oxido-reductase previously described by our group, uses Bz as the substrate. We demonstrated that both recombinant and native TcAKR enzymes reduce Bz by using NADPH, but not NADH, as a cofactor. TcAKR-overexpressing epimastigotes showed higher NADPH-dependent Bz reductase activity and a 50% inhibitory concentration (IC50) value for Bz 1.8-fold higher than that of the controls, suggesting that TcAKR is involved in Bz detoxification instead of activation. To understand the role of TcAKR in Bz metabolism, we studied TcAKR expression and NADPH/NADH-dependent Bz reductase activities in two T. cruzi strains with differential susceptibility to Bz: CL Brener and Nicaragua. Taking into account the results obtained with TcAKR-overexpressing epimastigotes, we expected the more resistant strain, Nicaragua, to have higher TcAKR levels than CL Brener. However, the results were the opposite. CL Brener showed 2-fold higher TcAKR expression and 5.7-fold higher NADPH-Bz reduction than the Nicaragua strain. In addition, NADH-dependent Bz reductase activity, characteristic of NTR I, was also higher in CL Brener than in Nicaragua. We conclude that although TcAKR uses Bz as the substrate, TcAKR activity is not a determinant of Bz resistance in wild-type strains and may be overcome by other enzymes involved in Bz activation, such as NADPH- and NADH-dependent reductases. PMID:26856844

  17. Pyrithione-based ruthenium complexes as inhibitors of aldo-keto reductase 1C enzymes and anticancer agents.

    Science.gov (United States)

    Kljun, Jakob; Anko, Maja; Traven, Katja; Sinreih, Maša; Pavlič, Renata; Peršič, Špela; Ude, Žiga; Codina, Elisa Esteve; Stojan, Jure; Lanišnik Rižner, Tea; Turel, Iztok

    2016-08-01

    Four ruthenium complexes of clinically used zinc ionophore pyrithione and its oxygen analog 2-hydroxypyridine N-oxide were prepared and evaluated as inhibitors of enzymes of the aldo-keto reductase subfamily 1C (AKR1C). A kinetic study assisted with docking simulations showed a mixed type of inhibition consisting of a fast reversible and a slow irreversible step in the case of both organometallic compounds 1A and 1B. Both compounds also showed a remarkable selectivity towards AKR1C1 and AKR1C3 which are targets for breast cancer drug design. The organoruthenium complex of ligand pyrithione as well as pyrithione itself also displayed toxicity on the hormone-dependent MCF-7 breast cancer cell line with EC50 values in the low micromolar range. PMID:27357845

  18. Gene expression and promoter analysis of a novel tomato aldo-keto reductase in response to environmental stresses.

    Science.gov (United States)

    Suekawa, Marina; Fujikawa, Yukichi; Inada, Shuhei; Murano, Asako; Esaka, Muneharu

    2016-08-01

    The functional role of an uncharacterized tomato (Solanum lycopersicum) aldo-keto reductase 4B, denoted as SlAKR4B, was investigated. The gene expression of tomato SlAKR4B was detected at a high level in the senescent leaves and the ripening fruits of tomato. Although d-galacturonic acid reductase activities tended to be higher in tomato SlAKR4B-overexpressing transgenic tobacco BY-2 cell lines than those in control cell lines, SlAKR4B gene expression was not well correlated with l-ascorbic acid content among the cell lines. The analysis of the transgenic cell lines showed that tomato SlAKR4B has enzyme activities toward d-galacturonic acid as well as glyceraldehyde and glyoxal, suggesting that the SlAKR4B gene encodes a functional enzyme in tomato. Gene expression of SlAKR4B was induced by NaCl, H2O2, and plant hormones such as salicylic acid and jasmonic acid, suggesting that SlAKR4B is involved in the stress response. The transient expression assay using protoplasts showed the promoter activity of the SlAKR4B gene was as high as that of the cauliflower mosaic virus 35S promoter. Also, the promoter region of the SlAKR4B gene was suggested to contain cis-element(s) for abiotic stress-inducible expression. PMID:27337067

  19. Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

    International Nuclear Information System (INIS)

    Perakine reductase, a novel member of the aldo-keto reductase enzyme superfamily of higher plants, is involved in the biosynthesis of monoterpenoid indole alkaloids in the Indian medicinal plant Rauvolfia serpentina. The enzyme has been crystallized in C-centered orthorhombic space group and diffracts to 2.0 Å resolution. Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å

  20. A pathogenesis related-10 protein CaARP functions as aldo/keto reductase to scavenge cytotoxic aldehydes.

    Science.gov (United States)

    Jain, Deepti; Khandal, Hitaishi; Khurana, Jitendra Paul; Chattopadhyay, Debasis

    2016-01-01

    Pathogenesis related-10 (PR-10) proteins are present as multigene family in most of the higher plants. The role of PR-10 proteins in plant is poorly understood. A sequence analysis revealed that a large number of PR-10 proteins possess conserved motifs found in aldo/keto reductases (AKRs) of yeast and fungi. We took three PR-10 proteins, CaARP from chickpea, ABR17 from pea and the major pollen allergen Bet v1 from silver birch as examples and showed that these purified recombinant proteins possessed AKR activity using various cytotoxic aldehydes including methylglyoxal and malondialdehyde as substrates and the reduced form of nicotinamide adenine dinucleotide phosphate (NADPH) as co-factor. Essential amino acids for this catalytic activity were identified by substitution with other amino acids. CaARP was able to discriminate between the reduced and oxidized forms of NADP independently of its catalytic activity and underwent structural change upon binding with NADPH. CaARP protein was preferentially localized in cytosol. When expressed in bacteria, yeast or plant, catalytically active variants of CaARP conferred tolerance to salinity, oxidative stress or cytotoxic aldehydes. CaARP-expressing plants showed lower lipid peroxidation product content in presence or absence of stress suggesting that the protein functions as a scavenger of cytotoxic aldehydes produced by metabolism and lipid peroxidation. Our result proposes a new biochemical property of a PR-10 protein. PMID:26577640

  1. The Aldo-Keto Reductase Akr1b7 Gene Is a Common Transcriptional Target of Xenobiotic Receptors Pregnane X Receptor and Constitutive Androstane Receptor

    OpenAIRE

    Liu, Ming-Jie; Takahashi, Yuki; Wada, Taira; He, Jinhan; Gao, Jie; Tian, Yanan; Li, Song; Xie, Wen

    2009-01-01

    Aldo-keto reductase (AKR) family 1, member 7 (AKR1B7), a member of the AKR superfamily, has been suggested to play an important role in the detoxification of lipid peroxidation by-products. The nuclear receptors pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are xenosensors postulated to alleviate xeno- and endobiotic chemical insults. In this study, we show that the mouse Akr1b7 is a shared transcriptional target of PXR and CAR in the liver and i...

  2. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    Energy Technology Data Exchange (ETDEWEB)

    Hofman, Jakub; Malcekova, Beata; Skarka, Adam; Novotna, Eva; Wsol, Vladimir, E-mail: wsol@faf.cuni.cz

    2014-08-01

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  3. Role of aldo-keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization

    International Nuclear Information System (INIS)

    Since proteins involved in chemotherapy drug pharmacokinetics and pharmacodynamics have a strong impact on the uptake, metabolism, and efflux of such drugs, they likely play critical roles in resistance to chemotherapy drugs in cancer patients. To investigate this hypothesis, we conducted a whole genome microarray study to identify difference in the expression of genes between isogenic doxorubicin-sensitive and doxorubicin-resistant MCF-7 breast tumour cells. We then assessed the degree of over-representation of doxorubicin pharmacokinetic and pharmacodynamic genes in the dataset of doxorubicin resistance genes. Of 27,958 Entrez genes on the array, 7.4 per cent or 2,063 genes were differentially expressed by ≥ 2-fold between wildtype and doxorubicin-resistant cells. The false discovery rate was set at 0.01 and the minimum p value for significance for any gene within the “hit list” was 0.01. Seventeen and 43 per cent of doxorubicin pharmacokinetic genes were over-represented in the hit list, depending upon whether the gene name was identical or within the same gene family, respectively. The most over-represented genes were within the 1C and 1B families of aldo-keto reductases (AKRs), which convert doxorubicin to doxorubicinol. Other genes convert doxorubicin to other metabolites or affect the influx, efflux, or cytotoxicity of the drug. In further support of the role of AKRs in doxorubicin resistance, we observed that, in comparison to doxorubicin, doxorubincol exhibited dramatically reduced cytotoxicity, reduced DNA-binding activity, and strong localization to extra nuclear lysosomes. Pharmacologic inhibition of the above AKRs in doxorubicin-resistant cells increased cellular doxorubicin levels, restored doxorubicin cytotoxicity and re-established doxorubicin localization to the nucleus. The properties of doxorubicinol were unaffected. These findings demonstrate the utility of using curated pharmacokinetic and pharmacodynamic knowledge bases to identify

  4. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    International Nuclear Information System (INIS)

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  5. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-09-01

    Full Text Available Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10 near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydrogenases that interconvert weak steroid hormones to their more potent counterparts and regulate processes involved in development, homeostasis and reproduction. Because of their location in the swine genome and their implication in reproductive physiology, this gene cluster was characterized and evaluated for effects on reproductive traits in swine. Results Screening the porcine CHORI-242 BAC library with a full-length AKR1C4 cDNA identified 7 positive clones and sample sequencing of 5 BAC clones revealed 5 distinct AKR1C genes (AKR1CL2 and AKR1C1 through 4, which mapped to 126–128 cM on SSC10. Using the IMpRH7000rad and IMNpRH212000rad radiation hybrid panels, these 5 genes mapped between microsatellite markers SWR67 and SW2067. Comparison of sequence data with the porcine BAC fingerprint map show that the cluster of genes resides in a 300 kb region. Twelve SNPs were genotyped in gilts observed for age at first estrus and ovulation rate from the F8 and F10 generations of one-quarter Meishan descendants of the USMARC resource population. Age at puberty, nipple number and ovulation rate data were analyzed for association with genotypes by MTDFREML using an animal model. One SNP, a phenylalanine to isoleucine substitution in AKR1C2, was associated with age of puberty (p = 0.07 and possibly ovulation rate (p = 0.102. Two SNP in AKR1C4 were significantly associated with nipple number (p ≤ 0.03 and another possibly associated with age at puberty (p = 0

  6. cDNA cloning, expression and activity of a second human aflatoxin B1-metabolizing member of the aldo-keto reductase superfamily, AKR7A3.

    Science.gov (United States)

    Knight, L P; Primiano, T; Groopman, J D; Kensler, T W; Sutter, T R

    1999-07-01

    The aflatoxin B1 (AFB1) aldehyde metabolite of AFB1 may contribute to the cytotoxicity of this hepatocarcinogen via protein adduction. Aflatoxin B1 aldehyde reductases, specifically the NADPH-dependent aldo-keto reductases of rat (AKR7A1) and human (AKR7A2), are known to metabolize the AFB1 dihydrodiol by forming AFB1 dialcohol. Using a rat AKR7A1 cDNA, we isolated and characterized a distinct aldo-keto reductase (AKR7A3) from an adult human liver cDNA library. The deduced amino acid sequence of AKR7A3 shares 80 and 88% identity with rat AKR7A1 and human AKR7A2, respectively. Recombinant rat AKR7A1 and human AKR7A3 were expressed and purified from Escherichia coli as hexa-histidine tagged fusion proteins. These proteins catalyzed the reduction of several model carbonyl-containing substrates. The NADPH-dependent formation of AFB1 dialcohol by recombinant human AKR7A3 was confirmed by liquid chromatography coupled to electrospray ionization mass spectrometry. Rabbit polyclonal antibodies produced using recombinant rat AKR7A1 protein were shown to detect nanogram amounts of rat and human AKR7A protein. The amount of AKR7A-related protein in hepatic cytosols of 1, 2-dithiole-3-thione-treated rats was 18-fold greater than in cytosols from untreated animals. These antibodies detected AKR7A-related protein in normal human liver samples ranging from 0.3 to 0.8 microg/mg cytosolic protein. Northern blot analysis showed varying levels of expression of AKR7A RNA in human liver and in several extrahepatic tissues, with relatively high levels in the stomach, pancreas, kidney and liver. Based on the kinetic parameters determined using recombinant human AKR7A3 and AFB1 dihydrodiol at pH 7.4, the catalytic efficiency of this reaction (k2/K, per M/s) equals or exceeds those reported for other enzymes, for example cytochrome P450s and glutathione S-transferases, known to metabolize AFB1 in vivo. These findings indicate that, depending on the extent of AFB1 dihydrodiol formation, AKR

  7. A novel aldo-keto reductase from Jatropha curcas L. (JcAKR) plays a crucial role in the detoxification of methylglyoxal, a potent electrophile.

    Science.gov (United States)

    Mudalkar, Shalini; Sreeharsha, Rachapudi Venkata; Reddy, Attipalli Ramachandra

    2016-05-20

    Abiotic stress leads to the generation of reactive oxygen species (ROS) which further results in the production of reactive carbonyls (RCs) including methylglyoxal (MG). MG, an α, β-dicarbonyl aldehyde, is highly toxic to plants and the mechanism behind its detoxification is not well understood. Aldo-keto reductases (AKRs) play a role in detoxification of reactive aldehydes and ketones. In the present study, we cloned and characterised a putative AKR from Jatropha curcas (JcAKR). Phylogenetically, it forms a small clade with AKRs of Glycine max and Rauwolfia serpentina. JcAKR was heterologously expressed in Escherichia coli BL-21(DE3) cells and the identity of the purified protein was confirmed through MALDI-TOF analysis. The recombinant protein had high enzyme activity and catalytic efficiency in assays containing MG as the substrate. Protein modelling and docking studies revealed MG was efficiently bound to JcAKR. Under progressive drought and salinity stress, the enzyme and transcript levels of JcAKR were higher in leaves compared to roots. Further, the bacterial and yeast cells expressing JcAKR showed more tolerance towards PEG (5%), NaCl (200mM) and MG (5mM) treatments compared to controls. In conclusion, our results project JcAKR as a possible and potential target in crop improvement for abiotic stress tolerance. PMID:26995646

  8. Overexpression of Aldo-Keto-Reductase in Azole-resistant Clinical Isolates of Candida Glabrata Determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Mansour Heidari

    2013-01-01

    Full Text Available Background: Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata.Methods: The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection inimmunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazoleand itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns ofthe organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potentialgene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains.Results and conclusions: The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinicalisolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  9. Overexpression of aldo-keto-reductase in azole-resistant clinical isolates of Candida glabrata determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Farahyar Shirin

    2013-01-01

    Full Text Available Abstract Background Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata. Methods The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection in immunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazole and itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns of the organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potential gene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains. Results and conclusions The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinical isolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  10. Characterization of hamster NAD+-dependent 3(17)β-hydroxysteroid dehydrogenase belonging to the aldo-keto reductase 1C subfamily.

    Science.gov (United States)

    Endo, Satoshi; Noda, Misato; Ikari, Akira; Tatematsu, Kenjiro; El-Kabbani, Ossama; Hara, Akira; Kitade, Yukio; Matsunaga, Toshiyuki

    2015-11-01

    The cDNAs for morphine 6-dehydrogenase (AKR1C34) and its homologous aldo-keto reductase (AKR1C35) were cloned from golden hamster liver, and their enzymatic properties and tissue distribution were compared. AKR1C34 and AKR1C35 similarly oxidized various xenobiotic alicyclic alcohols using NAD(+), but differed in their substrate specificity for hydroxysteroids and inhibitor sensitivity. While AKR1C34 showed 3α/17β/20α-hydroxysteroid dehydrogenase activities, AKR1C35 efficiently oxidized various 3β- and 17β-hydroxysteroids, including biologically active 3β-hydroxy-5α/β-dihydro-C19/C21-steroids, dehydroepiandrosterone and 17β-estradiol. AKR1C35 also differed from AKR1C34 in its high sensitivity to flavonoids, which inhibited competitively with respect to 17β-estradiol (Ki 0.11-0.69 μM). The mRNA for AKR1C35 was expressed liver-specific in male hamsters and ubiquitously in female hamsters, whereas the expression of the mRNA for AKR1C34 displayed opposite sexual dimorphism. Because AKR1C35 is the first 317Β-HYDROXYSTEROID DEHYDROGENASE IN THE AKR SUPERFAMILY: , we also investigated the molecular determinants for the 3β-hydroxysteroid dehydrogenase activity by replacement of Val54 and Cys310 in AKR1C35 with the corresponding residues in AKR1C34, Ala and Phe, respectively. The mutation of Val54Ala, but not Cys310Phe, significantly impaired this activity, suggesting that Val54 plays a critical role in recognition of the steroidal substrate. PMID:26002966

  11. Expression of aldo-keto reductase family 1 member C1 (AKR1C1 gene in porcine ovary and uterine endometrium during the estrous cycle and pregnancy

    Directory of Open Access Journals (Sweden)

    Hwang Sue-Yun

    2011-10-01

    Full Text Available Abstract Background The aldo-keto reductase family 1 member C1 (AKR1C1 belongs to a superfamily of NADPH-dependent reductases that convert a wide range of substrates, including carbohydrates, steroid hormones, and endogenous prostaglandins. The 20alpha-hydroxysteroid dehydrogenase (20alpha-HSD is a member of AKR family. The aims of this study were to determine its expression in the ovary and uterus endometrium during the estrous cycle and pregnancy. Methods Rapid amplification of cDNA ends (RACE experiments were performed to obtain the 5' and 3' ends of the porcine 20alpha-HSD cDNA. Reverse-transcriptase-PCR (RT-PCR, real-time PCR, northern blot analysis, and western blot analysis were performed to examine the expression of porcine 20alpha-HSD. Immunohistochemical analysis was also performed to determine the localization in the ovary. Results The porcine 20alpha-HSD cDNA is 957 bp in length and encodes a protein of 319 amino acids. The cloned cDNA was virtually the same as the porcine AKR1C1 gene (337 amino acids reported recently, and only differed in the C-terminal region (the AKR1C1 gene has a longer C-terminal region than our sequence. The 20alpha-HSD gene (from now on referred to as AKR1C1 cloned in this paper encodes a deletion of 4 amino acids, compared with the C-terminal region of AKR1C1 genes from other animals. Porcine AKR1C1 mRNA was expressed on day 5, 10, 12, 15 of the cycle and 0-60 of pregnancy in the ovary. The mRNA was also specifically detected in the uterine endometrium on day 30 of pregnancy. Western blot analysis indicated that the pattern of AKR1C1 protein in the ovary during the estrous cycle and uterus during early pregnancy was similar to that of AKR1C1 mRNA expression. The recombinant protein produced in CHO cells was detected at approximately 37 kDa. Immunohistochemical analysis also revealed that pig AKR1C1 protein was localized in the large luteal cells in the early stages of the estrous cycle and before parturition

  12. The Role of Human Aldo-Keto Reductases (AKRs in the Metabolic Activation and Detoxication of Polycyclic Aromatic Hydrocarbons: Interconversion of PAH-catechols and PAH o-Quinones

    Directory of Open Access Journals (Sweden)

    LiZhang

    2012-11-01

    Full Text Available Polycyclic aromatic hydrocarbons (PAH are ubiquitous environmental pollutants. They are procarcinogens requiring metabolic activation to elicit their deleterious effects. Aldo-keto reductases (AKR catalyze the oxidation of proximate carcinogenic PAH trans-dihydrodiols to yield electrophilic and redox-active PAH o-quiniones. AKRs are also found to be capable of reducing PAH o-quinones to form PAH catechols. The interconversion of o-quinones and catechols results in the redox cycling of PAH o-quinones to give rise to the generation of reactive oxygen species and subsequent oxidative DNA damage. On the other hand, PAH catechols can be intercepted through phase II metabolism by which PAH o-quinones could be detoxified and eliminated. The aim of the present review is to summarize the role of human AKRs in the metabolic activation/detoxication of PAH and the relevance of phase II conjugation reactions to human lung carcinogenesis.

  13. Aldo-keto synthesis effect on Eu3+fluorescence in YBO3 compared with solid state diffusion

    Institute of Scientific and Technical Information of China (English)

    K.A. Koparkar; N.S. Bajaj; S.K. Omanwar

    2015-01-01

    The red-orange emitting phosphor YBO3:Eu3+was prepared by aldo-keto method and solid state diffusion. Aldo-keto method implied to decrease the processing time and heating temperature. The red-orange emitting phosphor was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), as well as emission and excitation photoluminescence spectra re-corded at room temperature. The result of aldo-keto method showed that the phosphor YBO3:Eu3+could be obtained at 900 °C in less time~60%as compared to solid state diffusion (SSD). The material showed that the strongest emission peak at 595 nm under excitation at 233 nm was only due to forced magnetic dipole 5D0→7F1 transition of Eu3+ions. Significantly, the emission inten-sity of YBO3:Eu3+phosphor prepared by aldo-keto method was relatively higher as compared to that obtained by the solid state diffusion.

  14. Substrate Specificity, Inhibitor Selectivity and Structure-Function Relationships of Aldo-Keto Reductase 1B15: A Novel Human Retinaldehyde Reductase

    Czech Academy of Sciences Publication Activity Database

    Giménez-Dejoz, J.; Kolář, Michal H.; Ruiz, F. X.; Crespo, I.; Cousido-Siah, A.; Podjarny, A.; Barski, O. A.; Fanfrlík, Jindřich; Parés, X.; Farrés, J.; Porté, S.

    2015-01-01

    Roč. 10, č. 7 (2015), e0134506/1-e0134506/19. E-ISSN 1932-6203 Institutional support: RVO:61388963 Keywords : retinoic acid biosynthesis * site-directed mutagenesis * tumor marker AKR1B15 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.234, year: 2014 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134506

  15. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  16. Facile fabrication of CdSe/CdS quantum dots and their application on the screening of colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Hongfeng; Dong, Quanjin, E-mail: qjdong1508@163.com [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China); Hu, Li [Nanjing University of Science and Technology, School of Environmental and Biological Engineering (China); Tu, Shiliang; Chai, Rui; Dai, Qiaoqiong [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China)

    2015-11-15

    In this paper, a facile aqueous route to water-soluble CdSe/CdS quantum dots (QDs) under mild conditions has been developed. The samples were characterized by means of transmission electron microscopy, energy-dispersive X-ray spectroscopy, and photoluminescence (PL) spectroscopy. The PL property of the QDs can be controlled by adjusting the reaction time. The CdSe/CdS QDs after 48-h reaction with size of 5 nm have the strongest PL intensity located at 553 nm, and the highest quantum yield of 19.9 %. The obtained QDs were applied for the colorectal cancer screening. The QDs could be conjugated with antibody of aldo-keto reductase family 1, member B10 (AKR1B10) for the detection of AKR1B10. The AKR1B10 in PBS/5 % serum solution with concentration of 1 ng/mL could be well calibrated, and the limit of detection could be lower than 0.05 ng/mL.

  17. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas;

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic. Furth...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  18. Long-term In Vitro Treatment of Human Glioblastoma Cells with Temozolomide Increases Resistance In Vivo through Up-regulation of GLUT Transporter and Aldo-Keto Reductase Enzyme AKR1C Expression

    Directory of Open Access Journals (Sweden)

    Benjamin Le Calvé

    2010-09-01

    Full Text Available Glioblastoma (GBM is the most frequent malignant glioma. Treatment of GBM patients is multimodal with maximum surgical resection, followed by concurrent radiation and chemotherapy with the alkylating drug temozolomide (TMZ. The present study aims to identify genes implicated in the acquired resistance of two human GBM cells of astrocytic origin, T98G and U373, to TMZ. Resistance to TMZ was induced by culturing these cells in vitro for months with incremental TMZ concentrations up to 1 mM. Only partial resistance to TMZ has been achieved and was demonstrated in vivo in immunocompromised mice bearing orthotopic U373 and T98G xenografts. Our data show that long-term treatment of human astroglioma cells with TMZ induces increased expression of facilitative glucose transporter/solute carrier GLUT/SLC2A family members, mainly GLUT-3, and of the AKR1C family of proteins. The latter proteins are phase 1 drug-metabolizing enzymes involved in the maintenance of steroid homeostasis, prostaglandin metabolism, and metabolic activation of polycyclic aromatic hydrocarbons. GLUT-3 has been previously suggested to exert roles in GBM neovascularization processes, and TMZ was found to exert antiangiogenic effects in experimental gliomas. AKR1C1 was previously shown to be associated with oncogenic potential, with proproliferative effects similar to AKR1C3 in the latter case. Both AKR1C1 and AKR1C2 proteins are involved in cancer pro-proliferative cell chemoresistance. Selective targeting of GLUT-3 in GBM and/or AKR1C proteins (by means of jasmonates, for example could thus delay the acquisition of resistance to TMZ of astroglioma cells in the context of prolonged treatment with this drug.

  19. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  20. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P212121, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  1. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    International Nuclear Information System (INIS)

    Conjugated polyketone reductase C2 from C. parapsilosis IFO 0708 was expressed, purified and crystallized by the sitting-drop vapour-diffusion method. The crystal belonged to space group P212121 and diffracted X-rays to 1.7 Å resolution. Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (VM = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit

  2. Induction and inhibition of NAD(P)H: quinone reductase in murine and human skin.

    Science.gov (United States)

    Merk, H; Jugert, F; Bonnekoh, B; Mahrle, G

    1991-01-01

    The purpose of this study was to characterize the human cutaneous NAD(P)H: quinone reductase (NQR) activity by known inhibitors of different reductases and to compare it with the murine skin and liver NQR activity. This enzyme plays a major role in the defence of cells against oxygen stress because it inhibits the 1-electron reduction of quinones to semiquinones and their subsequent oxidation to quinones termed as quinone redox cycle. It belongs to the aromatic hydrocarbon-responsive (Ah) battery. This gene battery includes Cyp1a1 (cytochrome P-450 IA1), Cyp1a2 (cytochrome P-450 IA2) and Nmo-1 [NAD(P)H: quinone reductase]. In the skin cytochrome P-450 IA1-dependent activity is about 1-5% compared to the corresponding activity in the liver, whereas NQR has the same activity in skin and liver. NQR was determined in the cytoplasm of murine skin, liver, and human keratinocytes using 2,6-dichlorophenolindophenol as the substrate. The Ah-receptor binding compounds, such as coal tar constituents, or 3-methylcholanthrene induce cytochrome P-450-dependent activities such as aryl hydrocarbon hydroxylase or 7-ethoxyresorufin-O-de-ethylase and NQR, whereas butyl hydroxytoluol, which does not bind to the Ah receptor, induces only NQR. For inhibition studies several known inhibitors of dihydrodiol dehydrogenase, aldo-keto and carbonyl reductase activities were used. There was a similar pattern of inhibition of the basal and induced activity in all tissues investigated. Pyrazole, progesterone and phenobarbital did not inhibit, whereas dicoumarol, rutin and indomethacin inhibited NQR activity in murine skin and liver as well as in human keratinocytes.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1768430

  3. Enzymes of the AKR1B and AKR1C subfamilies and uterine diseases

    Directory of Open Access Journals (Sweden)

    Tea eLanisnik Rizner

    2012-03-01

    Full Text Available Endometrial and cervical cancers, uterine myoma, and endometriosis are very common uterine diseases. Worldwide, more than 800,000 women are affected annually by gynecological cancers, as a result of which, more than 360,000 die. During their reproductive age, about 70% of women develop uterine myomas, 10% to 15% suffer from endometriosis, and 35% to 50% from infertility associated with endometriosis. Uterine diseases are associated with aberrant inflammatory responses and concomitant increased production of prostaglandins (PG. They are also related to decreased differentiation, due to low levels of protective progesterone and retinoic acid, and to enhanced proliferation, due to high local concentrations of estrogens. The pathogenesis of these diseases can thus be attributed to disturbed PG, estrogen and retinoid metabolism and actions. Five human members of the aldo-keto reductase 1B (AKR1B and 1C (AKR1C superfamilies, i.e., AKR1B1, AKR1B10, AKR1C1, AKR1C2 and AKR1C3, have roles in these processes and can thus be implicated in uterine diseases. AKR1B1 and AKR1C3 catalyze the formation of PGF2alpha which stimulates cell proliferation. AKR1C3 converts PGD2 to 9alpha,11beta-PGF2, and thus counteracts the formation of 15deoxy-PGJ2, which can activate pro-apoptotic peroxisome-proliferator-activated receptor beta. AKR1B10 catalyzes the reduction of retinal to retinol, and in thus lessens the formation of retinoic acid, with potential pro-differentiating actions. The AKR1C1-AKR1C3 enzymes also act as 17-keto- and 20-ketosteroid reductases to varying extents, and are implicated in increased estradiol and decreased progesterone levels. This review comprises a short introduction to uterine diseases, followed by an overview of the current literature on the AKR1B and AKR1C expression in the uterus and in uterine diseases. The potential implications of the AKR1B and AKR1C enzymes and their pathophysiologies are then discussed, followed by conclusions and

  4. High-resolution neutron protein crystallography with radically small crystal volumes: Application of perdeuteration to human aldose reductase

    International Nuclear Information System (INIS)

    Neutron diffraction data have been collected to 2.2 (angstrom) resolution from a small (0.15 mm3) crystal of perdeuterated human aldose reductase (h-AR; MW = 36 kDa) in order to help to determine the protonation state of the enzyme. h-AR belongs to the aldo-keto reductase family and is implicated in diabetic complications. Its ternary complexes (h-AR-coenzyme NADPH-selected inhibitor) provide a good model to study both the enzymatic mechanism and inhibition. Here, the successful production of fully deuterated human aldose reductase (h-AR(D)), subsequent crystallization of the ternary complex h-AR(D)-NADPH-IDD594 and neutron Laue data collection at the LADI instrument at ILL using a crystal volume of just 0.15 mm3 are reported. Neutron data were recorded to 2 (angstrom) resolution, with subsequent data analysis using data to 2.2 (angstrom). This is the first fully deuterated enzyme of this size (36 kDa) to be solved by neutron diffraction and represents a milestone in the field, as the crystal volume is at least one order of magnitude smaller than those usually required for other high-resolution neutron structures determined to date. This illustrates the significant increase in the signal-to-noise ratio of data collected from perdeuterated crystals and demonstrates that good-quality neutron data can now be collected from more typical protein crystal volumes. Indeed, the signal-to-noise ratio is then dominated by other sources of instrument background, the nature of which is under investigation. This is important for the design of future instruments, which should take maximum advantage of the reduction in the intrinsic diffraction pattern background from fully deuterated samples.

  5. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  7. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  8. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  9. Conversion of Human Steroid 5[beta]-Reductase (AKR1D1) into 3[beta]-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: Example of Perfect Enzyme Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mo; Drury, Jason E.; Christianson, David W.; Penning, Trevor M. (UPENN)

    2012-10-10

    Human aldo-keto reductase 1D1 (AKR1D1) and AKR1C enzymes are essential for bile acid biosynthesis and steroid hormone metabolism. AKR1D1 catalyzes the 5{beta}-reduction of {Delta}{sup 4}-3-ketosteroids, whereas AKR1C enzymes are hydroxysteroid dehydrogenases (HSDs). These enzymes share high sequence identity and catalyze 4-pro-(R)-hydride transfer from NADPH to an electrophilic carbon but differ in that one residue in the conserved AKR catalytic tetrad, His120 (AKR1D1 numbering), is substituted by a glutamate in AKR1D1. We find that the AKR1D1 E120H mutant abolishes 5{beta}-reductase activity and introduces HSD activity. However, the E120H mutant unexpectedly favors dihydrosteroids with the 5{alpha}-configuration and, unlike most of the AKR1C enzymes, shows a dominant stereochemical preference to act as a 3{beta}-HSD as opposed to a 3{alpha}-HSD. The catalytic efficiency achieved for 3{beta}-HSD activity is higher than that observed for any AKR to date. High resolution crystal structures of the E120H mutant in complex with epiandrosterone, 5{beta}-dihydrotestosterone, and {Delta}{sup 4}-androstene-3,17-dione elucidated the structural basis for this functional change. The glutamate-histidine substitution prevents a 3-ketosteroid from penetrating the active site so that hydride transfer is directed toward the C3 carbonyl group rather than the {Delta}{sup 4}-double bond and confers 3{beta}-HSD activity on the 5{beta}-reductase. Structures indicate that stereospecificity of HSD activity is achieved because the steroid flips over to present its {alpha}-face to the A-face of NADPH. This is in contrast to the AKR1C enzymes, which can invert stereochemistry when the steroid swings across the binding pocket. These studies show how a single point mutation in AKR1D1 can introduce HSD activity with unexpected configurational and stereochemical preference.

  10. The role of aryl hydrocarbon receptor in regulation of enzymes involved in metabolic activation of polycyclic aromatic hydrocarbons in a model of rat liver progenitor cells

    Czech Academy of Sciences Publication Activity Database

    Vondráček, Jan; Krčmář, P.; Procházková, Jiřina; Trilecová, L.; Gavelová, M.; Skálová, L.; Szotáková, B.; Bunček, M.; Radilová, H.; Kozubík, Alois; Machala, M.

    2009-01-01

    Roč. 180, č. 2 (2009), s. 226-237. ISSN 0009-2797 R&D Projects: GA ČR(CZ) GA524/06/0517 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cytochromes P450 * PAHs * aldo-keto reductases Subject RIV: BO - Biophysics Impact factor: 2.457, year: 2009

  11. Probe data: 3426 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  12. Probe data: 779 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  13. Probe data: 3773 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. High-resolution structure of AKR1a4 in the apo form and its interaction with ligands

    International Nuclear Information System (INIS)

    Despite its high affinity for NADPH, AKR1a4 crystallized in the apo form, which is very rare for aldo-keto reductase enzymes. Aldo-keto reductase 1a4 (AKR1a4; EC 1.1.1.2) is the mouse orthologue of human aldehyde reductase (AKR1a1), the founding member of the AKR family. As an NADPH-dependent enzyme, AKR1a4 catalyses the conversion of d-glucuronate to l-gulonate. AKR1a4 is involved in ascorbate biosynthesis in mice, but has also recently been found to interact with SMAR1, providing a novel mechanism of ROS regulation by ATM. Here, the crystal structure of AKR1a4 in its apo form at 1.64 Å resolution as well as the characterization of the binding of AKR1a4 to NADPH and P44, a peptide derived from SMAR1, is presented

  16. Depressed Levels of Prostaglandin F2α in Mice Lacking Akr1b7 Increase Basal Adiposity and Predispose to Diet-Induced Obesity

    OpenAIRE

    Volat, Fanny E.; Pointud, Jean-Christophe; Pastel, Emilie; Morio, Béatrice; Sion, Benoit; Hamard, Ghislaine; Guichardant, Michel; Colas, Romain; Lefrançois-Martinez, Anne-Marie; Martinez, Antoine

    2012-01-01

    Negative regulators of white adipose tissue (WAT) expansion are poorly documented in vivo. Prostaglandin F2α (PGF2α) is a potent antiadipogenic factor in cultured preadipocytes, but evidence for its involvement in physiological context is lacking. We previously reported that Akr1b7, an aldo-keto reductase enriched in adipose stromal vascular fraction but absent from mature adipocytes, has antiadipogenic properties possibly supported by PGF2α synthase activity. To test whether lack of Akr1b7 c...

  17. Human brain aldehyde reductases: relationship to succinic semialdehyde reductase and aldose reductase.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-08-01

    Human brain contains multiple forms of aldehyde-reducing enzymes. One major form (AR3), as previously shown, has properties that indicate its identity with NADPH-dependent aldehyde reductase isolated from brain and other organs of various species; i.e., low molecular weight, use of NADPH as the preferred cofactor, and sensitivity to inhibition by barbiturates. A second form of aldehyde reductase ("SSA reductase") specifically reduces succinic semialdehyde (SSA) to produce gamma-hydroxybutyrate. This enzyme form has a higher molecular weight than AR3, and uses NADH as well as NADPH as cofactor. SSA reductase was not inhibited by pyrazole, oxalate, or barbiturates, and the only effective inhibitor found was the flavonoid quercetine. Although AR3 can also reduce SSA, the relative specificity of SSA reductase may enhance its in vivo role. A third form of human brain aldehyde reductase, AR2, appears to be comparable to aldose reductases characterized in several species, on the basis of its activity pattern with various sugar aldehydes and its response to characteristic inhibitors and activators, as well as kinetic parameters. This enzyme is also the most active in reducing the aldehyde derivatives of biogenic amines. These studies suggest that the various forms of human brain aldehyde reductases may have specific physiological functions. PMID:6778961

  18. Hepatitis B Virus X Protein Up-Regulates AKR1C1 Expression Through Nuclear Factor-Y in Human Hepatocarcinoma Cells

    OpenAIRE

    Kai LI; Ding, Shijia; Chen, Ke; Qin, Dongdong; Qu, Jialin; Wang, Sen; Sheng, Yanrui; Zou, Chengcheng; Chen, Limin; Tang, Hua

    2013-01-01

    Background The hepatitis B virus X (HBx) protein has long been recognized as an important transcriptional transactivator of several genes. Human aldo-keto reductase family 1, member C1 (AKR1C1), a member of the family of AKR1CS, is significantly increased in HBx-expressed cells. Objectives This study aimed to investigate the possible mechanism of HBx in regulating AKR1C1 expression in HepG2.2.15 cells and the role of AKR1C1 for HBV-induced HCC. Materials and Methods RT-PCR was performed to de...

  19. Drug interaction of boceprevir and amlodipine in a patient with hepatitis C: A cardiovascular follow-up

    Directory of Open Access Journals (Sweden)

    Çiğdem Kader

    2015-03-01

    Full Text Available Boceprevir is a NS3/4A hepatitis C virus (HCV protease inhibitor, used in combination with peginterferon and ribavirin to treat HCV. Boceprevir undergoes extensive metabolism via cytochrome P450-mediated oxidation and ketoreduction by cytosolic aldo-keto reductases. Amlodipine has been used for the treatment of patients with hypertension and also metabolised through cytochrome P450 pathway. Here, we presented a case of boceprevir and amlodipine interaction in a patient with chronic HCV and her echocardiography and electrocardiographic follow-up results. J Microbiol Infect Dis 2015;5(1: 32-35

  20. Modulation of cell metabolic pathways and oxidative stress signaling contribute to acquired melphalan resistance in multiple myeloma cells

    DEFF Research Database (Denmark)

    Zub, Kamila Anna; Sousa, Mirta Mittelstedt Leal de; Sarno, Antonio;

    2015-01-01

    of the AKR1C family involved in prostaglandin synthesis contribute to the resistant phenotype. Finally, selected metabolic and oxidative stress response enzymes were targeted by inhibitors, several of which displayed a selective cytotoxicity against the melphalan-resistant cells and should be further...... and pathways not previously associated with melphalan resistance in multiple myeloma cells, including a metabolic switch conforming to the Warburg effect (aerobic glycolysis), and an elevated oxidative stress response mediated by VEGF/IL8-signaling. In addition, up-regulated aldo-keto reductase levels...

  1. Genetics Home Reference: sepiapterin reductase deficiency

    Science.gov (United States)

    Skip to main content Your Guide to Understanding Genetic Conditions Enable Javascript for addthis links to activate. ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions sepiapterin reductase deficiency sepiapterin reductase ...

  2. Fatty acyl-CoA reductase

    Energy Technology Data Exchange (ETDEWEB)

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  3. Identification, Characterization, and Classification of Genes Encoding Perchlorate Reductase

    OpenAIRE

    Bender, Kelly S.; Shang, Ching; Chakraborty, Romy; Belchik, Sara M.; Coates, John D.; Achenbach, Laurie A.

    2005-01-01

    The reduction of perchlorate to chlorite, the first enzymatic step in the bacterial reduction of perchlorate, is catalyzed by perchlorate reductase. The genes encoding perchlorate reductase (pcrABCD) in two Dechloromonas species were characterized. Sequence analysis of the pcrAB gene products revealed similarity to α- and β-subunits of microbial nitrate reductase, selenate reductase, dimethyl sulfide dehydrogenase, ethylbenzene dehydrogenase, and chlorate reductase, all of which are type II m...

  4. Sepiapterin Reductase Deficiency: Mimic of Cerebral Palsy

    OpenAIRE

    J Gordon Millichap

    2012-01-01

    Researchers at University of California at San Diego, and 22 other US national and international centers studied the clinical, biochemical, and molecular findings in a cohort of 38 patients with sepiapterin reductase deficiency (SRD).

  5. Multiple aldehyde reductases of human brain.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-01-01

    Human brain contains four forms of aldehyde reducing enzymes. One major activity, designated AR3, has properties indicating its identity with the NADPH-dependent aldehyde reductase, EC 1.1.1.2. The other major form of human brain enzyme, AR1, which is also NADPH-dependent, reduces both aldehyde and ketone-containing substrates, including vitamin K3 (menadione) and daunorubicin, a cancer chemotherapeutic agent. This enzyme is very sensitive to inhibition by the flavonoids quercitrin and quercetine, and may be analogous to a daunorubicin reductase previously described in liver of other species. One minor form of human brain aldehyde reductase, AR2, demonstrates substrate specificity and inhibitor sensitivity which suggest its similarity to aldose reductases found in lens and other tissues of many species. This enzyme, which can also use NADH as cofactor to some extent, is the most active in reducing the aldehyde derivatives of the biogenic amines. The fourth human brain enzyme ("SSA reductase") differs from the other forms in its ability to use NADH as well as or better than NADPH as cofactor, and in its molecular weight, which is nearly twice that of the other forms. It is quite specific for succinic semialdehyde (SSA) as substrate, and was found to be significantly inhibited only by quercetine and quercitrin. AR3 can also reduce SSA, and both enzymes may contribute to the production of gamma-hydroxybutyric acid in vivo. These results indicate that the human brain aldehyde reductases can play relatively specific physiologic roles. PMID:7424738

  6. Structural and mechanistic insights on nitrate reductases.

    Science.gov (United States)

    Coelho, Catarina; Romão, Maria João

    2015-12-01

    Nitrate reductases (NR) belong to the DMSO reductase family of Mo-containing enzymes and perform key roles in the metabolism of the nitrogen cycle, reducing nitrate to nitrite. Due to variable cell location, structure and function, they have been divided into periplasmic (Nap), cytoplasmic, and membrane-bound (Nar) nitrate reductases. The first crystal structure obtained for a NR was that of the monomeric NapA from Desulfovibrio desulfuricans in 1999. Since then several new crystal structures were solved providing novel insights that led to the revision of the commonly accepted reaction mechanism for periplasmic nitrate reductases. The two crystal structures available for the NarGHI protein are from the same organism (Escherichia coli) and the combination with electrochemical and spectroscopic studies also lead to the proposal of a reaction mechanism for this group of enzymes. Here we present an overview on the current advances in structural and functional aspects of bacterial nitrate reductases, focusing on the mechanistic implications drawn from the crystallographic data. PMID:26362109

  7. Respiratory arsenate reductase as a bidirectional enzyme

    International Nuclear Information System (INIS)

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  8. Respiratory arsenate reductase as a bidirectional enzyme

    Science.gov (United States)

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

    2009-01-01

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  9. 21 CFR 864.7375 - Glutathione reductase assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Glutathione reductase assay. 864.7375 Section 864... reductase assay. (a) Identification. A glutathione reductase assay is a device used to determine the... fluorescence and photometry. The results of this assay are used in the diagnosis of liver disease,...

  10. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    NARCIS (Netherlands)

    Wolterink, A.F.W.M.; Schiltz, E.; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were al

  11. Dicty_cDB: Contig-U15201-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available . 117 4e-52 BT038384_1( BT038384 |pid:none) Zea mays full-length cDNA clone ZM... 110 5e-52 BC095647_1( BC095647 |pid:none) Danio...dium phytofermentans ISD... 100 9e-40 CP000764_2653( CP000764 |pid:none) Bacillus cer...ne) Pediococcus pentosaceus ATCC 2574... 103 7e-33 AB014493_1( AB014493 |pid:none) Gibberella zeae gen...base: CSM 8402 sequences; 8,075,542 total letters Score E Sequences producing significant al...e 2 ... 114 2e-53 BC092808_1( BC092808 |pid:none) Danio rerio aldo-keto reductase

  12. Fundamental roles of reactive oxygen species and protective mechanisms in the female reproductive system

    Directory of Open Access Journals (Sweden)

    Okada Futoshi

    2005-09-01

    Full Text Available Abstract Controlled oxidation, such as disulfide bond formation in sperm nuclei and during ovulation, plays a fundamental role in mammalian reproduction. Excess oxidation, however, causes oxidative stress, resulting in the dysfunction of the reproductive process. Antioxidation reactions that reduce the levels of reactive oxygen species are of prime importance in reproductive systems in maintaining the quality of gametes and support reproduction. While anti-oxidative enzymes, such as superoxide dismutase and peroxidase, play a central role in eliminating oxidative stress, reduction-oxidation (redox systems, comprised of mainly glutathione and thioredoxin, function to reduce the levels of oxidized molecules. Aldo-keto reductase, using NADPH as an electron donor, detoxifies carbonyl compounds resulting from the oxidation of lipids and proteins. Thus, many antioxidative and redox enzyme genes are expressed and aggressively protect gametes and embryos in reproductive systems.

  13. SCREENING OF HMG CO A REDUCTASE INHIBITOR PRODUCING MARINE ACTINOMYCETES

    OpenAIRE

    SRINU, PHANI BHUSHAN,MOGES, SRILAKSHMI, SANKAR, PRABHAKAR,LAKSHMINARAYANA

    2013-01-01

    The objective of the present study was screening of 3-hydroxy-3- methyl glutaryl Co A (HMG CoA) reductase inhibitor producing marine actinomycetes. A total of 65 morphologically different actinomycetes were screened for HMG CoA reductase inhibitor production in a two stage submerged fermentation and evaluated for HMG CoA reductase inhibitor activity by agar diffusion and thin layer chromatography technique using lovostatin as a control. Among 65 marine Actinomycete strains, only one strain pr...

  14. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    OpenAIRE

    Wolterink, A.F.W.M.; Schiltz, E; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  15. Characterization of the Chlorate Reductase from Pseudomonas chloritidismutans

    OpenAIRE

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  16. Structure and mechanism of dimethylsulfoxide reductase, a molybdopterin-containing enzyme of DMSO reductase family

    International Nuclear Information System (INIS)

    Full text: Apart from nitrogenase, enzymes containing molybdenum are members of a superfamily, the molybdopterin-containing enzymes. Most of these enzymes catalyse an oxygen atom transfer and two electron transfer reaction. During catalysis the Mo at the active site cycles between the Mo(VI) and Mo(IV) states. The DMSO reductase family of molybdopterin-containing enzymes all contain a bis(molybdopterin guanine dinucleotide)Mo cofactor and over thirty examples have now been described. Over the last five years crystal structures of dimethylsulfoxide (DMSO) reductase and four other enzymes of the DMSO reductase family have revealed that enzymes of this family have a similar tertiary structure. The Mo atom at the active site is coordinated by four thiolate ligands provided by the dithiolene side chains of the two MGD molecules of the bis(MGD)Mo cofactor as well as a ligand provided by an amino acid side chain. In addition, an oxygen atom in the form of an oxo, hydroxo or aqua group is also coordinated to the Mo atom. In the case of dimethylsulfoxide reductase X-ray crystallography of the product-reduced species and Raman spectroscopy has demonstrated that the enzyme contains a single exchangeable oxo group that is H-bonded to W116

  17. Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain

    International Nuclear Information System (INIS)

    NADPH-cytochrome P450 reductase (CPR) and the nitric oxide synthase (NOS) reductase domains are members of the FAD-FMN family of proteins. The FAD accepts two reducing equivalents from NADPH (dehydrogenase flavin) and FMN acts as a one-electron carrier (flavodoxin-type flavin) for the transfer from NADPH to the heme protein, in which the FMNH ·/FMNH2 couple donates electrons to cytochrome P450 at constant oxidation-reduction potential. Although the interflavin electron transfer between FAD and FMN is not strictly regulated in CPR, electron transfer is activated in neuronal NOS reductase domain upon binding calmodulin (CaM), in which the CaM-bound activated form can function by a similar mechanism to that of CPR. The oxygenated form and spin state of substrate-bound cytochrome P450 in perfused rat liver are also discussed in terms of stepwise one-electron transfer from CPR. This review provides a historical perspective of the microsomal mixed-function oxidases including CPR and P450. In addition, a new model for the redox-linked conformational changes during the catalytic cycle for both CPR and NOS reductase domain is also discussed

  18. Genetic identification of a respiratory arsenate reductase

    OpenAIRE

    Saltikov, Chad W.; Newman, Dianne K.

    2003-01-01

    For more than a decade, it has been recognized that arsenate [H2AsO41-; As(V)] can be used by microorganisms as a terminal electron acceptor in anaerobic respiration. Given the toxicity of arsenic, the mechanistic basis of this process is intriguing, as is its evolutionary origin. Here we show that a two-gene cluster (arrAB; arsenate respiratory reduction) in the bacterium Shewanella sp. strain ANA-3 specifically confers respiratory As(V) reductase activity. Mutants with in-frame deletions of...

  19. Membrane-associated chromate reductase activity from Enterobacter cloacae.

    OpenAIRE

    P. C. Wang; Mori, T.; Toda, K.; Ohtake, H

    1990-01-01

    Washed cells of Enterobacter cloacae HO1 reduced hexavalent chromium (chromate: CrO4(2-) anaerobically. Chromate reductase activity was preferentially associated with the membrane fraction of the cells. Right-side-out membrane vesicles prepared from E. cloacae cells showed high chromate reductase activities when ascorbate-reduced phenazine methosulfate was added as an electron donor.

  20. Canopy and seasonal profiles of nitrate reductase in soybeans

    Energy Technology Data Exchange (ETDEWEB)

    Harper, J.E.; Hageman, R.H.

    1972-01-01

    Nitrate reductase activity of soybeans (Glycine max L. Merr.) was evaluated in soil plots and outdoor hydroponic gravel culture systems throughout the growing season. Nitrate reductase profiles within the plant canopy were also established. Mean activity per gram fresh weight per hour of the entire plant canopy was highest in the seedling stage while total activity (activity per gram fresh weight per hour times the total leaf weight) reached a maximum when plants were in the full bloom to midpod fill stage. Nitrate reductase activity per gram fresh weight per hour was highest in the uppermost leaf just prior to full expansion and declined with leaf positions lower in the canopy. Total nitrate reductase activity per leaf was also highest in the uppermost fully expanded leaf during early growth stages. Maximum total activity shifted to leaf positions lower in the plant canopy with later growth stages. Nitrate reductase activity of soybeans grown in hydroponic systems was significantly higher than activity of adjacent soil grown plants at later growth stages, which suggested that under normal field conditions the potential for nitrate utilization may not be realized. Nitrate reductase activity per gram fresh weight per hour and nitrate content were positively correlated over the growing season with plants grown in either soil or solution culture. Computations based upon the nitrate reductase assay of plants grown in hydroponics indicated that from 1.7 to 1.8 grams N could have been supplied to the plant via the nitrate reductase process. 11 references, 9 figures, 3 tables.

  1. Structure and expression of human dihydropteridine reductase

    International Nuclear Information System (INIS)

    Dihydropteridine reductase catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin and is an essential component of the pterindependent aromatic amino acid hydroxylating systems. A cDNA for human DHPR was isolated from a human liver cDNA library in the vector λgt11 using a monospecific antibody against sheep DHPR. The nucleic acid sequence and amino acid sequence of human DHPR were determined from a full-length clone. A 112 amino acid sequence of sheep DHPR was obtained by sequencing purified sheep DHPR. This sequence is highly homologous to the predicted amino acid sequence of the human protein. Gene transfer of the recombinant human DHPR into COS cells leads to expression of DHPR enzymatic activity. These results indicate that the cDNA clone identified by antibody screening is an authentic and full-length cDNA for human DHPR

  2. Nitrite Reductase Activity in Engineered Azurin Variants.

    Science.gov (United States)

    Berry, Steven M; Strange, Jacob N; Bladholm, Erika L; Khatiwada, Balabhadra; Hedstrom, Christine G; Sauer, Alexandra M

    2016-05-01

    Nitrite reductase (NiR) activity was examined in a series of dicopper P.a. azurin variants in which a surface binding copper site was added through site-directed mutagenesis. Four variants were synthesized with copper binding motifs inspired by the catalytic type 2 copper binding sites found in the native noncoupled dinuclear copper enzymes nitrite reductase and peptidylglycine α-hydroxylating monooxygenase. The four azurin variants, denoted Az-NiR, Az-NiR3His, Az-PHM, and Az-PHM3His, maintained the azurin electron transfer copper center, with the second designed copper site located over 13 Å away and consisting of mutations Asn10His,Gln14Asp,Asn16His-azurin, Asn10His,Gln14His,Asn16His-azurin, Gln8Met,Gln14His,Asn16His-azurin, and Gln8His,Gln14His,Asn16His-azurin, respectively. UV-visible absorption spectroscopy, EPR spectroscopy, and electrochemistry of the sites demonstrate copper binding as well as interaction with small exogenous ligands. The nitrite reduction activity of the variants was determined, including the catalytic Michaelis-Menten parameters. The variants showed activity (0.34-0.59 min(-1)) that was slower than that of native NiRs but comparable to that of other model systems. There were small variations in activity of the four variants that correlated with the number of histidines in the added copper site. Catalysis was found to be reversible, with nitrite produced from NO. Reactions starting with reduced azurin variants demonstrated that electrons from both copper centers were used to reduce nitrite, although steady-state catalysis required the T2 copper center and did not require the T1 center. Finally, experiments separating rates of enzyme reduction from rates of reoxidation by nitrite demonstrated that the reaction with nitrite was rate limiting during catalysis. PMID:27055058

  3. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    OpenAIRE

    Patrizia Cesaro; Chiara Cattaneo; Elisa Bona; Graziella Berta; Maria Cavaletto

    2015-01-01

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5–8 were prepared in Escherichia coli...

  4. Regulation of ribonucleotide reductase by Spd1 involves multiple mechanisms

    DEFF Research Database (Denmark)

    Nestoras, Konstantinos; Mohammed, Asma Hadi; Schreurs, Ann-Sofie; Fleck, Oliver; Watson, Adam T; Poitelea, Marius; O'Shea, Charlotte; Chahwan, Charly; Holmberg, Christian; Kragelund, Birthe B; Nielsen, Olaf; Osborne, Mark; Carr, Antony M; Liu, Cong

    2010-01-01

    The correct levels of deoxyribonucleotide triphosphates and their relative abundance are important to maintain genomic integrity. Ribonucleotide reductase (RNR) regulation is complex and multifaceted. RNR is regulated allosterically by two nucleotide-binding sites, by transcriptional control, and...

  5. Structural features of the ribonucleotide reductase of Aujeszky's disease virus.

    Science.gov (United States)

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-01-01

    A gene construct of the Aujeszky's disease virus (ADV) genome was prepared and the DNA fragment encoding the ribonucleotide reductase was structurally characterized. We determined the entire DNA sequence of two adjacent open reading frames of the ribonucleotide reductase genes with the intergenic sequence of nine base pairs. From the sequence analysis we predict that Aujeszky's disease virus encodes a ribonucleotide reductase which comprises two polypeptides--large and small subunits, with sizes of 835 and 303 amino acids, respectively. Nucleotide and amino acid sequences of the large and small subunits of the Aujeszky's disease virus ribonucleotide reductase have been compared with that of other herpesviruses, and structural features of both proteins have been characterized. PMID:7810419

  6. Aldose reductase inhibitory activity and antioxidant capacity of pomegranate extracts

    OpenAIRE

    Karasu, Çimen; CUMAOĞLU, Ahmet; Gürpinar, Ali Rifat; Kartal, Murat; Kovacikova, Lucia; Milackova, Ivana; Stefek, Milan

    2012-01-01

    The pomegranate, Punica granatum L., has been the subject of current interest as a medicinal agent with wide-ranging therapeutic indications. In the present study, pomegranate ethanolic seed and hull extracts were tested, in comparison with a commercial sample, for the inhibition of aldose reductase, an enzyme involved in the etiology of diabetic complications. In vitro inhibition of rat lens aldose reductase was determined by a conventional method. Pomegranate ethanolic hull extract and comm...

  7. An overview on 5alpha-reductase inhibitors.

    Science.gov (United States)

    Aggarwal, Saurabh; Thareja, Suresh; Verma, Abhilasha; Bhardwaj, Tilak Raj; Kumar, Manoj

    2010-02-01

    Benign prostatic hyperplasia (BPH) is the noncancerous proliferation of the prostate gland associated with benign prostatic obstruction and lower urinary tract symptoms (LUTS) such as frequency, hesitancy, urgency, etc. Its prevalence increases with age affecting around 70% by the age of 70 years. High activity of 5alpha-reductase enzyme in humans results in excessive dihydrotestosterone levels in peripheral tissues and hence suppression of androgen action by 5alpha-reductase inhibitors is a logical treatment for BPH as they inhibit the conversion of testosterone to dihydrotestosterone. Finasteride (13) was the first steroidal 5alpha-reductase inhibitor approved by U.S. Food and Drug Administration (USFDA). In human it decreases the prostatic DHT level by 70-90% and reduces the prostatic size. Dutasteride (27) another related analogue has been approved in 2002. Unlike Finasteride, Dutasteride is a competitive inhibitor of both 5alpha-reductase type I and type II isozymes, reduced DHT levels >90% following 1 year of oral administration. A number of classes of non-steroidal inhibitors of 5alpha-reductase have also been synthesized generally by removing one or more rings from the azasteroidal structure or by an early non-steroidal lead (ONO-3805) (261). In this review all categories of inhibitors of 5alpha-reductase have been covered. PMID:19879888

  8. Binding of Fidarestat Stereoisomers with Aldose Reductase

    Directory of Open Access Journals (Sweden)

    Dae-Sil Lee

    2006-11-01

    Full Text Available The stereospecificity in binding to aldose reductase (ALR2 of two fidarestat {6-fluoro-2',5'-dioxospiro[chroman-4,4'-imidazolidine]-2-carboxamide} stereoisomers [(2S,4Sand (2R,4S] has been investigated by means of molecular dynamics simulations using freeenergy integration techniques. The difference in the free energy of binding was found to be2.0 ± 1.7 kJ/mol in favour of the (2S,4S-form, in agreement with the experimentalinhibition data. The relative mobilities of the fidarestats complexed with ALR2 indicate alarger entropic penalty for hydrophobic binding of (2R,4S-fidarestat compared to (2S,4S-fidarestat, partially explaining its lower binding affinity. The two stereoisomers differmainly in the orientation of the carbamoyl moiety with respect to the active site and rotationof the bond joining the carbamoyl substituent to the ring. The detailed structural andenergetic insights obtained from out simulations allow for a better understanding of thefactors determining stereospecific inhibitor-ALR2 binding in the EPF charges model.

  9. Aldose reductase inhibitory compounds from Xanthium strumarium.

    Science.gov (United States)

    Yoon, Ha Na; Lee, Min Young; Kim, Jin-Kyu; Suh, Hong-Won; Lim, Soon Sung

    2013-09-01

    As part of our ongoing search for natural sources of therapeutic and preventive agents for diabetic complications, we evaluated the inhibitory effects of components of the fruit of Xanthium strumarium (X. strumarium) on aldose reductase (AR) and galactitol formation in rat lenses with high levels of glucose. To identify the bioactive components of X. strumarium, 7 caffeoylquinic acids and 3 phenolic compounds were isolated and their chemical structures were elucidated on the basis of spectroscopic evidence and comparison with published data. The abilities of 10 X. strumarium-derived components to counteract diabetic complications were investigated by means of inhibitory assays with rat lens AR (rAR) and recombinant human AR (rhAR). From the 10 isolated compounds, methyl-3,5-di-O-caffeoylquinate showed the most potent inhibition, with IC₅₀ values of 0.30 and 0.67 μM for rAR and rhAR, respectively. In the kinetic analyses using Lineweaver-Burk plots of 1/velocity and 1/substrate, methyl-3,5-di-O-caffeoylquinate showed competitive inhibition of rhAR. Furthermore, methyl-3,5-di-O-caffeoylquinate inhibited galactitol formation in the rat lens and in erythrocytes incubated with a high concentration of glucose, indicating that this compound may be effective in preventing diabetic complications. PMID:23604720

  10. Aldose reductase mediates retinal microglia activation.

    Science.gov (United States)

    Chang, Kun-Che; Shieh, Biehuoy; Petrash, J Mark

    2016-04-29

    Retinal microglia (RMG) are one of the major immune cells in charge of surveillance of inflammatory responses in the eye. In the absence of an inflammatory stimulus, RMG reside predominately in the ganglion layer and inner or outer plexiform layers. However, under stress RMG become activated and migrate into the inner nuclear layer (INL) or outer nuclear layer (ONL). Activated RMG in cell culture secrete pro-inflammatory cytokines in a manner sensitive to downregulation by aldose reductase inhibitors. In this study, we utilized CX3CR1(GFP) mice carrying AR mutant alleles to evaluate the role of AR on RMG activation and migration in vivo. When tested on an AR(WT) background, IP injection of LPS induced RMG activation and migration into the INL and ONL. However, this phenomenon was largely prevented by AR inhibitors or in AR null mice, or was exacerbated in transgenic mice that over-express AR. LPS-induced increases in ocular levels of TNF-α and CX3CL-1 in WT mice were substantially lower in AR null mice or were reduced by AR inhibitor treatment. These studies demonstrate that AR expression in RMG may contribute to the proinflammatory phenotypes common to various eye diseases such as uveitis and diabetic retinopathy. PMID:27033597

  11. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    Directory of Open Access Journals (Sweden)

    Yeon Bok Kim

    2014-01-01

    Full Text Available Anthocyanidin reductase (ANR and leucoanthocyanidin reductase (LAR play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  12. Equine 5α-reductase activity and expression in epididymis.

    Science.gov (United States)

    Corbin, C J; Legacki, E L; Ball, B A; Scoggin, K E; Stanley, S D; Conley, A J

    2016-10-01

    The 5α-reductase enzymes play an important role during male sexual differentiation, and in pregnant females, especially equine species where maintenance relies on 5α-reduced progesterone, 5α-dihydroprogesterone (DHP). Epididymis expresses 5α-reductases but was not studied elaborately in horses. Epididymis from younger and older postpubertal stallions was divided into caput, corpus and cauda and examined for 5α-reductase activity and expression of type 1 and 2 isoforms by quantitative real-time polymerase chain reaction (qPCR). Metabolism of progesterone and testosterone to DHP and dihydrotestosterone (DHT), respectively, by epididymal microsomal protein was examined by thin-layer chromatography and verified by liquid chromatography tandem mass spectrometry (LC-MS/MS). Relative inhibitory potencies of finasteride and dutasteride toward equine 5α-reductase activity were investigated. Pregnenolone was investigated as an additional potential substrate for 5α-reductase, suggested previously from in vivo studies in mares but never directly examined. No regional gradient of 5α-reductase expression was observed by either enzyme activity or transcript analysis. Results of PCR experiments suggested that type 1 isoform predominates in equine epididymis. Primers for the type 2 isoform were unable to amplify product from any samples examined. Progesterone and testosterone were readily reduced to DHP and DHT, and activity was effectively inhibited by both inhibitors. Using epididymis as an enzyme source, no experimental evidence was obtained supporting the notion that pregnenolone could be directly metabolized by equine 5α-reductases as has been suggested by previous investigators speculating on alternative metabolic pathways leading to DHP synthesis in placenta during equine pregnancies. PMID:27466384

  13. The role of biliverdin reductase in colorectal cancer

    International Nuclear Information System (INIS)

    In recent years, the effects of biliverdin and bilirubin have been studied extensively, and an inhibitory effect of bile pigments in cancer progression has been proposed. In this study we focused on the effects of biliverdin reductase, the enzyme that converts biliverdin to bilirubin, in colorectal cancer. For in vitro experiments we used a human colorectal carcinoma cell line and transfected it with an expression construct of shRNA specific for biliverdin reductase, to create cells with stable knock-down of enzyme expression. Cell proliferation was analyzed using the CASY model TT cell counting device. Western blot protein analysis was performed to study intracellular signaling cascades. Samples of human colorectal cancer were analyzed using immunohistochemistry. We were able to confirm the antiproliferative effects of bile pigments on cancer cells in vitro. However, this effect was attenuated in biliverdin reductase knock down cells. ERK and Akt activation seen under biliverdin and bilirubin treatment was also reduced in biliverdin reductase deficient cells. Immunohistochemical analysis of tumor samples from patients with colorectal cancer showed elevated biliverdin reductase levels. High enzyme expression was associated with lower overall and disease free patient survival. We conclude that BVR is required for bile pigment mediated effects regarding cancer cell proliferation and modulation of intracellular signaling cascades. The role of BVR overexpression in vivo and its exact influence on cancer progression and patient survival need to be further investigated. (author)

  14. Intramolecular electron transfer in Pseudomonas aeruginosa cd(1) nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Brunori, Maurizio; Cutruzzolà, Francesca;

    2009-01-01

    The cd(1) nitrite reductases, which catalyze the reduction of nitrite to nitric oxide, are homodimers of 60 kDa subunits, each containing one heme-c and one heme-d(1). Heme-c is the electron entry site, whereas heme-d(1) constitutes the catalytic center. The 3D structure of Pseudomonas aeruginosa...... nitrite reductase has been determined in both fully oxidized and reduced states. Intramolecular electron transfer (ET), between c and d(1) hemes is an essential step in the catalytic cycle. In earlier studies of the Pseudomonas stutzeri enzyme, we observed that a marked negative cooperativity is...... controlling this internal ET step. In this study we have investigated the internal ET in the wild-type and His369Ala mutant of P. aeruginosa nitrite reductases and have observed similar cooperativity to that of the Pseudomonas stutzeri enzyme. Heme-c was initially reduced, in an essentially diffusion...

  15. Expression and site-directed mutagenesis of human dihydrofolate reductase

    International Nuclear Information System (INIS)

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 → Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by α-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme

  16. Effect of vanadium on nitrate reductase activity in tomato leaves

    OpenAIRE

    J. Buczek

    2015-01-01

    The activity of nitrate reductase in cell-free extracts from tomato leaves is completely inhibited by 100 μM NaVO3 or VOCl2. In experiments in vivo vanadium ions inhibit the activity of the enzyme in 50 to 60 per cent. Addition of l mM vanadium to the medium on which tomato seedlings are grown causes after 24 h almost complete inhibition of nitrate reductase activity in cell-free extracts of the enzyme. Inhibition with vanadium may be abolished in experiments in vitro if the extract is treate...

  17. The intramolecular electron transfer between copper sites of nitrite reductase

    DEFF Research Database (Denmark)

    Farver, O; Eady, R R; Abraham, Z H;

    1998-01-01

    The intramolecular electron transfer (ET) between the type 1 Cu(I) and the type 2 Cu(II) sites of Alcaligenes xylosoxidans dissimilatory nitrite reductase (AxNiR) has been studied in order to compare it with the analogous process taking place in ascorbate oxidase (AO). This internal process is......(I) and the trinuclear copper centre in ascorbate oxidase, and the characteristics of the internal ET processes of these enzymes are compared. The data are consistent with the faster ET observed in nitrite reductase arising from a more advantageous entropy of activation when compared with ascorbate...

  18. Artificial electron donors for nitrate and nitrite reductases usable as mediators in amperometric biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Strehlitz, B. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Gruendig, B. (Institut fuer Chemo- und Biosensorik, Muenster-Roxel (Germany)); Vorlop, K.D. (Bundesforschungsanstalt fuer Landwirtschaft, Braunschweig (Germany). Inst. fuer Technologie); Bartholmes, P. (Witten-Herdecke Univ., Witten (Germany). Inst. fuer Biochemie); Kotte, H. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Stottmeister, U. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany))

    1994-07-01

    Various nitrate and nitrite reductases are capable of accepting electrons from artificial donors. Combining these redox active donors with an amperometric redox electrode which is covered with an immobilized layer of such a nitrate or nitrite reductase, new enzyme sensors can be created for the detection of nitrate or nitrite, respectively. A range of suitable electron donors for nitrate reductases and nitrite reductase from different sources have been selected and characterized by electrochemical methods. (orig.)

  19. Inhibition of Albendazole and Oxfendazole on the Activity of Fumaric Reductase in Cysticercus cellulosae

    Institute of Scientific and Technical Information of China (English)

    GAO Xue-jun; LI Qing-zhang; LI Xia

    2004-01-01

    The activity of fumaric reductase in Cysticercus cellulosae tissue homogenate with albendazole and oxfendazole individually was detected. Results showed that the two kinds of drugs both could inhabite the activity of fumaric reductase. The results indicate that the mechanism of action of benzimidazole carbamate drugs is probably inhabiting the complex of fumaric reductase noncompetently, thus lead to the exhaostion of energy and death.

  20. Sepiapterin reductase deficiency an autosomal recessive DOPA-responsive dystonia

    NARCIS (Netherlands)

    N.G. Abeling; M. Duran; H.D. Bakker; L. Stroomer; B. Thony; N. Blau; J. Booij; B.T. Poll-The

    2006-01-01

    The diagnosis of a 14-year-old girl with a new homoallelic mutation in the sepiapterin reductase (SR) gene is reported. Initially she presented at the age of 2 with hypotonia and mild cognitive developmental delay, and was diagnosed as having mild methylmalonic aciduria, which was recently identifie

  1. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    Science.gov (United States)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.

    1987-01-01

    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC 1.1.1.82) more effectively than fructose-1,6-bisphosphatase (EC 3.1.3.11). NADP-thioredoxin reductase (EC 1.6.4.5) was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  2. Bidirectional catalysis by copper-containing nitrite reductase

    NARCIS (Netherlands)

    Wijma, HJ; Canters, GW; de Vries, S; Verbeet, MP

    2004-01-01

    The copper-containing nitrite reductase from Alcaligenes faecalis S-6 was found to catalyze the oxidation of nitric oxide to nitrite, the reverse of its physiological reaction. Thermodynamic and kinetic constants with the physiological electron donor pseudoazurin were determined for both directions

  3. Thioredoxin reductase from s. Coelicolor as a drug target

    Czech Academy of Sciences Publication Activity Database

    Koháryová, M.; Brynda, Jiří; Řezáčová, Pavlína; Kollárová, M.

    2015-01-01

    Roč. 282, Suppl 1 (2015), s. 396. ISSN 1742-464X. [Congress of the Federation of European Biochemical Societies (FEBS) - The Biochemical Basis of Life /40./. 04.07.2015-09.07.2015, Berlin] Institutional support: RVO:61388963 ; RVO:68378050 Keywords : thioredoxin reductase * protein structure * drugs Subject RIV: CE - Biochemistry

  4. Isolation and expression of the Pneumocystis carinii dihydrofolate reductase gene

    DEFF Research Database (Denmark)

    Edman, J C; Edman, U; Cao, Mi-Mi;

    1989-01-01

    Pneumocystis carinii dihydrofolate reductase (DHFR; 5,6,7,8-tetrahydrofolate: NADP+ oxidoreductase, EC 1.5.1.3) cDNA sequences have been isolated by their ability to confer trimethoprim resistance to Escherichia coli. Consistent with the recent conclusion that P. carinii is a member of the Fungi...

  5. Fatty Acyl-CoA Reductase 1 Deficiency

    Directory of Open Access Journals (Sweden)

    Charles N Swisher

    2015-01-01

    Full Text Available Investigators from Erlangen, Germany; Calgary, CA; and Kafranbel, Syria, identified mutations in the gene, fatty acyl-CoA reductase 1 (FAR1 deficiency, adding to three other genes involved in plasmalogen biosynthesis, in two families affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity.

  6. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    Science.gov (United States)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; Lewis, Norman G.; Kang, ChulHee

    2003-01-01

    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  7. Rapid Identification of Aldose Reductase Inhibitory Compounds from Perilla frutescens

    OpenAIRE

    Soon Sung Lim; Ji Hun Paek; Kuk Hyun Shin; Young-Hee Kang; Jae-Yong Lee

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural a...

  8. Determination of plasma gluthatione reductase enzyme activity in osteoporotic women

    OpenAIRE

    Sadeghi N; Oveisi M.R.; Jannat B.; Hajimahmoodi M; Jamshidi A.R; Sajadian Z.

    2008-01-01

    Background: Osteoporosis is a disease of high prevalence with increased bone loss. Free radicals have been proved to be involved in bone resorption. Glutathione reductase (GR) plays an essential role in cell defense against reactive oxygen metabolites by sustaining the reduced status of an important antioxidant, glutathione. In the present study GR activity of plasma as an antioxidant enzyme in relation to Bone Mineral Density (BMD) was investigated.Material and Method: GR activity was measur...

  9. Glutathione reductase: solvent equilibrium and kinetic isotope effects

    International Nuclear Information System (INIS)

    Glutathione reductase catalyzes the NADPH-dependent reduction of oxidized glutathione (GSSG). The kinetic mechanism is ping-pong, and we have investigated the rate-limiting nature of proton-transfer steps in the reactions catalyzed by the spinach, yeast, and human erythrocyte glutathione reductases using a combination of alternate substrate and solvent kinetic isotope effects. With NADPH or GSSG as the variable substrate, at a fixed, saturating concentration of the other substrate, solvent kinetic isotope effects were observed on V but not V/K. Plots of Vm vs mole fraction of D2O (proton inventories) were linear in both cases for the yeast, spinach, and human erythrocyte enzymes. When solvent kinetic isotope effect studies were performed with DTNB instead of GSSG as an alternate substrate, a solvent kinetic isotope effect of 1.0 was observed. Solvent kinetic isotope effect measurements were also performed on the asymmetric disulfides GSSNB and GSSNP by using human erythrocyte glutathione reductase. The Km values for GSSNB and GSSNP were 70 microM and 13 microM, respectively, and V values were 62 and 57% of the one calculated for GSSG, respectively. Both of these substrates yield solvent kinetic isotope effects greater than 1.0 on both V and V/K and linear proton inventories, indicating that a single proton-transfer step is still rate limiting. These data are discussed in relationship to the chemical mechanism of GSSG reduction and the identity of the proton-transfer step whose rate is sensitive to solvent isotopic composition. Finally, the solvent equilibrium isotope effect measured with yeast glutathione reductase is 4.98, which allows us to calculate a fractionation factor for the thiol moiety of GSH of 0.456

  10. Internal electron transfer within mitochondrial succinate-cytochrome C reductase

    International Nuclear Information System (INIS)

    Internal electron transfer within succinate-cytochrome C reductase from pigeon breast muscle mitochondria was followed by the pulse radiolytic technique. The electron equivalent is transferred from an unknown donor to b type cytochrome(s), in a first order process with a rate constant of: 660 +- 150s-1. This process might be the rate determining step of electron transfer in mitochondria, since it is similar in rate to the turnover number of the mitochondrial respiratory chain

  11. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase

    Science.gov (United States)

    Lay, Angelina J.; Jiang, Xing-Mai; Kisker, Oliver; Flynn, Evelyn; Underwood, Anne; Condron, Rosemary; Hogg, Philip J.

    2000-12-01

    Disulphide bonds in secreted proteins are considered to be inert because of the oxidizing nature of the extracellular milieu. An exception to this rule is a reductase secreted by tumour cells that reduces disulphide bonds in the serine proteinase plasmin. Reduction of plasmin initiates proteolytic cleavage in the kringle 5 domain and release of the tumour blood vessel inhibitor angiostatin. New blood vessel formation or angiogenesis is critical for tumour expansion and metastasis. Here we show that the plasmin reductase isolated from conditioned medium of fibrosarcoma cells is the glycolytic enzyme phosphoglycerate kinase. Recombinant phosphoglycerate kinase had the same specific activity as the fibrosarcoma-derived protein. Plasma of mice bearing fibrosarcoma tumours contained several-fold more phosphoglycerate kinase, as compared with mice without tumours. Administration of phosphoglycerate kinase to tumour-bearing mice caused an increase in plasma levels of angiostatin, and a decrease in tumour vascularity and rate of tumour growth. Our findings indicate that phosphoglycerate kinase not only functions in glycolysis but is secreted by tumour cells and participates in the angiogenic process as a disulphide reductase.

  12. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues.

    Science.gov (United States)

    Youngblut, Matthew D; Tsai, Chi-Lin; Clark, Iain C; Carlson, Hans K; Maglaqui, Adrian P; Gau-Pan, Phonchien S; Redford, Steven A; Wong, Alan; Tainer, John A; Coates, John D

    2016-04-22

    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO3 (2-) bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. PMID:26940877

  13. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  14. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    OpenAIRE

    Jolanta Marciniak; Grażyna Kłobus; Józef Buczek; Tadeusz Stefaniak; Jarosław Mazur

    2014-01-01

    Soluble nitrate reductase from cucumber roots (Cucumis sativus L.) was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR) from cotyledon roots and leaves.

  15. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    Directory of Open Access Journals (Sweden)

    Jolanta Marciniak

    2014-02-01

    Full Text Available Soluble nitrate reductase from cucumber roots (Cucumis sativus L. was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR from cotyledon roots and leaves.

  16. Histochemical Localization of Glutathione Dependent NBT-Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective Localization of the glutathione dependent Nitroblue tetrazolium (NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated. Methods The fresh frozen tissue sections (8m thickness) were prepared and incubated in medium containing NBT, reduced glutathione (GSH) and phosphate buffer. The staining for GSH was performed with mercury orange. Results  The activity of the NBT-reductase in mouse skin has been found to be localized in the areas rich in glutathione and actively proliferating area of the skin. Conclusion The activity of the NBT-reductase seems to be dependent on the glutathione contents.

  17. The effect of copper and gallium compounds on ribonucleotide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Narasimhan, J.

    1992-01-01

    The mode of action of copper complexes (CuL and CuKTS) and gallium compounds (gallium nitrate and citrate) in cytotoxicity was studied. The effects of these agents on the enzyme ribonucleotide reductase was investigated by monitoring the tyrosyl free radical present in the active site of the enzyme through electron spin resonance (ESR) spectroscopy. Ribonucleotide reductase, a key enzyme in cellular proliferation, consists of two subunits. M1, a dimer of molecular weight 170,000 contains the substrate and effector binding sites. M2, a dimer of molecular weight 88,000, contains non-heme iron and tyrosyl free radical essential for the activity of the enzyme. In studies using copper complexes, the cellular oxidative chemistry was examined by ESR studies on adduct formation with membranes, and oxidation of thiols. Membrane thiols were oxidized through the reduction of the ESR signal of the thiol adduct and the analysis of sulfhydryl content. Using the radiolabel [sup 59]Fe, the inhibitory action of copper thiosemicarbazones on cellular iron uptake was shown. The inhibitory action of CuL on ribonucleotide reductase was shown by the quenching of the tyrosyl free radical on the M2 subunit. The hypothesis that gallium directly interacts with the M2 subunit of the enzyme and displaces the iron from it was proven. The tyrosyl free radical signal from cell lysates was inhibited by the direct addition of gallium compounds. Gallium content in the cells was measured by a fluorimetric method, to ensure the presence of sufficient amounts of gallium to compete with the iron in the M2 subunit. The enzyme activity, measured by the conversion of [sup 14]C-CDP to the labeled deoxy CDP, was inhibited by the addition of gallium nitrate in a cell free assay system. The immunoprecipitation studies of the [sup 59]Fe labeled M2 protein using the monoclonal antibody directed against this subunit suggested that gallium releases iron from the M2 subunit.

  18. biliverdin. Is there a role for biliverdin reductase?

    Directory of Open Access Journals (Sweden)

    AndreasDaiber

    2012-03-01

    Full Text Available Reactive oxygen species (ROS and signaling events are involved in the pathogenesis of endothelial dysfunction and represent a major contribution to vascular regulation. Molecular signaling is highly dependent on reactive oxygen species. But depending on the amount of ROS production it might have toxic or protective effects. Despite a large number of negative outcomes in large clinical trials (e.g. HOPE, HOPE-TOO, antioxidant molecules and agents are important players to influence the critical balance between production and elimination of RONS. However, chronic systemic antioxidant therapy lacks clinical efficacy, probably by interfering with important physiological redox signaling pathways. Therefore, it may be a much more promising attempt to induce intrinsic antioxidant pathways in order to increase the antioxidants not systemically but at the place of oxidative stress and complications. Among others, heme oxygenase (HO has been shown to be important for attenuating the overall production of ROS in a broad range of disease states through its ability to degrade heme and to produce carbon monoxide (CO, biliverdin/bilirubin, and the release of free iron with subsequent ferritin induction. With the present review we would like to highlight the important antioxidant role of the heme oxygenase system and especially discuss the contribution of the biliverdin, bilirubin and biliverdin reductase to these beneficial effects. The bilierdin reductase was reported to confer an antioxidant redox amplification cycle by which low, physiological bilirubin concentrations confer potent antioxidant protection via recycling of biliverdin from oxidized bilirubin by the biliverdin reductase, linking this sink for oxidants to the NADPH pool. To date the existence and role of this antioxidant redox cycle is still under debate and we present and discuss the pros and cons as well as our own findings on this topic.

  19. Autoimmunity in Membranous Nephropathy Targets Aldose Reductase and SOD2

    OpenAIRE

    Prunotto, Marco; Carnevali, Maria Luisa; Candiano, Giovanni; Murtas, Corrado; Bruschi, Maurizio; Corradini, Emilia; Trivelli, Antonella; Magnasco, Alberto; Petretto, Andrea; Santucci, Laura; Mattei, Silvia; Gatti, Rita; Scolari, Francesco; Kador, Peter; Allegri, Landino

    2010-01-01

    Glomerular targets of autoimmunity in human membranous nephropathy are poorly understood. Here, we used a combined proteomic approach to identify specific antibodies against podocyte proteins in both serum and glomeruli of patients with membranous nephropathy (MN). We detected specific anti–aldose reductase (AR) and anti–manganese superoxide dismutase (SOD2) IgG4 in sera of patients with MN. We also eluted high titers of anti-AR and anti-SOD2 IgG4 from microdissected glomeruli of three biopsi...

  20. Applications of Carboxylic Acid Reductases in Oleaginous Microbes

    Energy Technology Data Exchange (ETDEWEB)

    Resch, Michael G.; Linger, Jeffrey; McGeehan, John; Tyo, Keith; Beckham, Gregg

    2016-04-24

    Carboxylic acid reductases (CARs) are recently emerging reductive enzymes for the direct production of aldehydes from biologically-produced carboxylic acids. Recent work has demonstrated that these powerful enzymes are able to reduce a very broad range of volatile- to long-chain fatty acids as well as aromatic acids. Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will inform metabolic engineering strategies to conduct mild biological reduction of carboxylic acids in situ, which is conventionally done via hydrotreating catalysis at high temperatures and hydrogen pressures.

  1. Mediated electrochemistry of dimethyl sulfoxide reductase promoted by carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    BERNHARDT; Paul; V

    2010-01-01

    Mediated electrochemistry of dimethyl sulfoxide reductase from Rhodobacter capsulatus (DMSOR) which is immobilized on a bare glassy carbon (GC) electrode and a carbon nanotube (CNT)-modified GC electrode was studied using the Co complex (trans-6,13-dimethyl-1,4,8,11-tetraazacyclotetradecane-6,13-diamine)cobalt(III) ([Co(trans-diammac)] +) as a mediator.The cyclic voltammograms of different electrodes were carried out at different substrate (DMSO) concentrations.The results demonstrated that the catalytic current was increased by employing CNT as a promoter.

  2. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    OpenAIRE

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared f...

  3. Pulse radiolysis studies on superoxide reductase from Treponema pallidum.

    OpenAIRE

    Nivière, V; Lombard, M.; Fontecave, M.; Houée-Levin, C

    2001-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the ...

  4. Methylenetetrahydrofolate reductase (MTHFR) deficiency presenting as a rash.

    LENUS (Irish Health Repository)

    Crushell, Ellen

    2012-09-01

    We report on the case of a 2-year-old girl recently diagnosed with Methylenetetrahydrofolate reductase (MTHFR) deficiency who originally presented in the neonatal period with a distinctive rash. At 11 weeks of age she developed seizures, she had acquired microcephaly and developmental delay. The rash deteriorated dramatically following commencement of phenobarbitone; both rash and seizures abated following empiric introduction of pyridoxine and folinic acid as treatment of possible vitamin responsive seizures. We postulate that phenobarbitone in combination with MTHFR deficiency may have caused her rash to deteriorate and subsequent folinic acid was helpful in treating the rash and preventing further acute neurological decline as commonly associated with this condition.

  5. Sulforaphane promotes murine hair growth by accelerating the degradation of dihydrotestosterone.

    Science.gov (United States)

    Sasaki, Mari; Shinozaki, Shohei; Shimokado, Kentaro

    2016-03-25

    Dihydrotestosterone (DHT) causes the regression of human hair follicles in the parietal scalp, leading to androgenic alopecia (AGA). Sulforaphane (SFN) increases the expression of DHT degrading enzymes, such as 3α-hydroxysteroid dehydrogenases (3α-HSDs), and, therefore, SFN treatment may improve AGA. To determine the effects of SFN on hair growth, we administered SFN (10 mg/kg BW, IP) or vehicle (DMSO) to ob/ob mice for six weeks and examined hair regeneration and the plasma levels of testosterone and DHT. We also tested the effects of SFN on the expression of two forms of 3α-HSD, aldo-keto reductase 1c21 and dehydrogenase/reductase (SDR family) member 9, both in vitro and in vivo. SNF significantly enhanced hair regeneration in ob/ob mice. The mice treated with SFN showed lower plasma levels of testosterone and DHT than those treated with vehicle. SFN increased the mRNA and protein levels of the two forms of 3α-HSD in the liver of the mice and in cultured murine hepatocyte Hepa1c1c7 cells. These results suggest that SFN treatment increases the amount of 3α-HSDs in the liver, accelerates the degradation of blood DHT, and subsequently blocks the suppression of hair growth by DHT. PMID:26923074

  6. Multiple abiotic stress tolerance in Vigna mungo is altered by overexpression of ALDRXV4 gene via reactive carbonyl detoxification.

    Science.gov (United States)

    Singh, Preeti; Kumar, Deepak; Sarin, Neera Bhalla

    2016-06-01

    Vigna mungo (blackgram) is an important leguminous pulse crop, which is grown for its protein rich edible seeds. Drought and salinity are the major abiotic stresses which adversely affect the growth and productivity of crop plants including blackgram. The ALDRXV4 belongs to the aldo-keto reductase superfamily of enzymes that catalyze the reduction of carbonyl metabolites in the cells and plays an important role in the osmoprotection and detoxification of the reactive carbonyl species. In the present study, we developed transgenic plants of V. mungo using Agrobacterium mediated transformation. The transgene integration was confirmed by Southern blot analysis whereas the expression was confirmed by RT-PCR, Western blot and enzyme activity. The T1 generation transgenic plants displayed improved tolerance to various environmental stresses, including drought, salt, methyl viologen and H2O2 induced oxidative stress. The increased aldose reductase activity, higher sorbitol content and less accumulation of the toxic metabolite, methylglyoxal in the transgenic lines under non-stress and stress (drought and salinity) conditions resulted in increased protection through maintenance of better photosynthetic efficiency, higher relative water content and less photooxidative damage. The accumulation of reactive oxygen species was remarkably decreased in the transgenic lines as compared with the wild type plants. This study of engineering multiple stress tolerance in blackgram, is the first report to date and this strategy for trait improvement is proposed to provide a novel germplasm for blackgram production on marginal lands. PMID:26956699

  7. Characterization of Emodin as a Therapeutic Agent for Diabetic Cataract.

    Science.gov (United States)

    Chang, Kun-Che; Li, Linfeng; Sanborn, Theresa M; Shieh, Biehuoy; Lenhart, Patricia; Ammar, David; LaBarbera, Daniel V; Petrash, J Mark

    2016-05-27

    Aldose reductase (AR) in the lens plays an important role in the pathogenesis of diabetic cataract (DC) by contributing to osmotic and oxidative stress associated with accelerated glucose metabolism through the polyol pathway. Therefore, inhibition of AR in the lens may hold the key to prevent DC formation. Emodin, a bioactive compound isolated from plants, has been implicated as a therapy for diabetes. However, its inhibitory activity against AR remains unclear. Our results showed that emodin has good selectively inhibitory activity against AR (IC50 = 2.69 ± 0.90 μM) but not other aldo-keto reductases and is stable at 37 °C for at least 7 days. Enzyme kinetic studies demonstrated an uncompetitive inhibition against AR with a corresponding inhibition constant of 2.113 ± 0.095 μM. In in vivo studies, oral administration of emodin reduced the incidence and severity of morphological markers of cataract in lenses of AR transgenic mice. Computational modeling of the AR-NADP(+)-emodin ternary complex indicated that the 3-hydroxy group of emodin plays an essential role by interacting with Ser302 through hydrogen bonding in the specificity pocket of AR. All the findings above provide encouraging evidence for emodin as a potential therapeutic agent to prevent cataract in diabetic patients. PMID:27140653

  8. Evaluation of 5α-reductase inhibitory activity of certain herbs useful as antiandrogens.

    Science.gov (United States)

    Nahata, A; Dixit, V K

    2014-08-01

    This study demonstrates 5α-reductase inhibitory activity of certain herbs useful in the management of androgenic disorders. Ganoderma lucidum (Curtis) P. Karst (GL), Urtica dioica Linn. (UD), Caesalpinia bonducella Fleming. (CB), Tribulus terrestris Linn. (TT), Pedalium murex Linn. (PM), Sphaeranthus indicus Linn. (SI), Cuscuta reflexa Roxb. (CR), Citrullus colocynthis Schrad. (CC), Benincasa hispida Cogn. (BH), Phyllanthus niruri Linn. (PN) and Echinops echinatus Linn. (EE) were included in the study. Petroleum ether, ethanol and aqueous extracts of these herbs were tested for their 5α-reductase inhibitory activity against the standard 5α-reductase inhibitor, finasteride. A biochemical method to determine the activity of 5α-reductase was used to evaluate the inhibition of different extracts to the enzyme. The optical density (OD) value of each sample was measured continuously with ultraviolet spectrophotometer for the reason that the substrate NADPH has a specific absorbance at 340 nm. As the enzyme 5α-reductase uses NADPH as a substrate, so in the presence of 5α-reductase inhibitor, the NADPH concentration will increase with the function of time. This method thus implicates the activity of 5α-reductase. The method proved to be extremely useful to screen the herbs for their 5α-reductase inhibitory potential. GL, UD, BH, SI and CR came out to be promising candidates for further exploring their antiandrogenic properties. PMID:23710567

  9. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis

    Science.gov (United States)

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4’-sulfonyl derivative of L-methionine (dabsyl Met), the ...

  10. Sucrose mimics the light induction of Arabidopsis nitrate reductase gene transcription

    DEFF Research Database (Denmark)

    Cheng, Chi-Lien; Acedo, Gregoria N; Kristensen, Michael;

    1992-01-01

    Nitrate reductase, the first enzyme in nitrate assimilation, is located at the crossroad of two energy-consuming pathways: nitrate assimilation and carbon fixation. Light, which regulates the expression of many higher-plant carbon fixation genes, also regulates nitrate reductase gene expression. ...

  11. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  12. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2

    OpenAIRE

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-01-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRN...

  13. The effect of ionic and non-ionic surfactants on the growth, nitrate reductase and nitrite reductase activities of Spirodela polyrrhiza (L. Schleiden

    Directory of Open Access Journals (Sweden)

    Józef Buczek

    2014-02-01

    Full Text Available Inclusion into the medium of 5 mg•dm-3 of non-ionic (ENF or ionic (DBST surfactant caused 50-60% inhibition of nitrite reductase MR activity in S. polyrrhiza. At the same time, increased accumulation of NO2- in the plant tissues and lowering of the total and soluble protein contents were found. DBST also lowered the nitrate reductase (NR activity and the dry mass of the plants.

  14. Co-Expression of Monodehydroascorbate Reductase and Dehydroascorbate Reductase from Brassica rapa Effectively Confers Tolerance to Freezing-Induced Oxidative Stress

    OpenAIRE

    Shin, Sun-Young; Kim, Myung-Hee; Kim, Yul-Ho; Park, Hyang-Mi; Yoon, Ho-Sung

    2013-01-01

    Plants are exposed to various environmental stresses and have therefore developed antioxidant enzymes and molecules to protect their cellular components against toxicity derived from reactive oxygen species (ROS). Ascorbate is a very important antioxidant molecule in plants, and monodehydroascorbate reductase (MDHAR; EC 1.6.5.4) and dehydroascorbate reductase (DHAR; EC 1.8.5.1) are essential to regeneration of ascorbate for maintenance of ROS scavenging ability. The MDHAR and DHAR genes from ...

  15. Optimisation of nitrate reductase enzyme activity to synthesise silver nanoparticles.

    Science.gov (United States)

    Khodashenas, Bahareh; Ghorbani, Hamid Reza

    2016-06-01

    Today, the synthesis of silver nanoparticles (Ag NPs) is very common since it has many applications in different areas. The synthesis of these nanoparticles is done by means of physical, chemical, or biological methods. However, due to its inexpensive and environmentally friendly features, the biological method is more preferable. In the present study, using nitrate reductase enzyme available in the Escherichia coli (E. coli) bacterium, the biosynthesis of Ag NPs was investigated. In addition, the activity of the nitrate reductase enzyme was optimised by changing its cultural conditions, and the effects of silver nitrate (AgNO3) concentration and enzyme amount on nanoparticles synthesis were studied. Finally, the produced nanoparticles were studied using ultraviolet -visible (UV-Vis) spectrophotometer, dynamic light scattering technique, and transmission electron microscopy. UV-Visible spectrophotometric study showed the characteristic peak for Ag NPs at wavelength 405-420 nm for 1 mM metal precursor solution (AgNO3) with 1, 5, 10, and 20 cc supernatant and 435 nm for 0.01M AgNO3 with 20 cc supernatant. In this study, it was found that there is a direct relationship between the AgNO3 concentration and the size of produced Ag NPs. PMID:27256897

  16. Azotobacter vinelandii NADPH:ferredoxin reductase cloning, sequencing, and overexpression.

    Science.gov (United States)

    Isas, J M; Yannone, S M; Burgess, B K

    1995-09-01

    Azotobacter vinelandii ferredoxin I (AvFdI) controls the expression of another protein that was originally designated Protein X. Recently we reported that Protein X is a NADPH-specific flavoprotein that binds specifically to FdI (Isas, J.M., and Burgess, B.K. (1994) J. Biol. Chem. 269, 19404-19409). The gene encoding this protein has now been cloned and sequenced. Protein X is 33% identical and has an overall 53% similarity with the fpr gene product from Escherichia coli that encodes NADPH:ferredoxin reductase. On the basis of this similarity and the similarity of the physical properties of the two proteins, we now designate Protein X as A. vinelandii NADPH:ferredoxin reductase and its gene as the fpr gene. The protein has been overexpressed in its native background in A. vinelandii by using the broad host range multicopy plasmid, pKT230. In addition to being regulated by FdI, the fpr gene product is overexpressed when A. vinelandii is grown under N2-fixing conditions even though the fpr gene is not preceded by a nif specific promoter. By analogy to what is known about fpr expression in E. coli, we propose that FdI may exert its regulatory effect on fpr by interacting with the SoxRS regulon. PMID:7673160

  17. Nitrate metabolism in tobacco leaves overexpressing Arabidopsis nitrite reductase.

    Science.gov (United States)

    Davenport, Susie; Le Lay, Pascaline; Sanchez-Tamburrrino, Juan Pablo

    2015-12-01

    Primary nitrogen assimilation in plants includes the reduction of nitrite to ammonium in the chloroplasts by the enzyme nitrite reductase (NiR EC:1.7.7.1) or in the plastids of non-photosynthetic organs. Here we report on a study overexpressing the Arabidopsis thaliana NiR (AtNiR) gene in tobacco plants under the control of a constitutive promoter (CERV - Carnation Etched Ring Virus). The aim was to overexpress AtNiR in an attempt to alter the level of residual nitrite in the leaf which can act as precursor to the formation of nitrosamines. The impact of increasing the activity of AtNiR produced an increase in leaf protein and a stay-green phenotype in the primary transformed AtNiR population. Investigation of the T1 homozygous population demonstrated elevated nitrate reductase (NR) activity, reductions in leaf nitrite and nitrate and the amino acids proline, glutamine and glutamate. Chlorophyl content of the transgenic lines was increased, as evidenced by the stay-green phenotype. This reveals the importance of NiR in primary nitrogen assimilation and how modification of this key enzyme affects both the nitrogen and carbon metabolism of tobacco plants. PMID:26447683

  18. Pinpointing a Mechanistic Switch Between Ketoreduction and "Ene" Reduction in Short-Chain Dehydrogenases/Reductases.

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M; Toogood, Helen S; Scrutton, Nigel S

    2016-08-01

    Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (-)-menthone:(-)-menthol reductase and (-)-menthone:(+)-neomenthol reductase, and the "ene" reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue-swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β-unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  19. Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design

    Directory of Open Access Journals (Sweden)

    M. Omar F. Khan

    2007-01-01

    Full Text Available Trypanosomiasis and leishmaniasis are two debilitating disease groups caused by parasites of Trypanosoma and Leishmania spp. and affecting millions of people worldwide. A brief outline of the potential targets for rational drug design against these diseases are presented, with an emphasis placed on the enzyme trypanothione reductase. Trypanothione reductase was identified as unique to parasites and proposed to be an effective target against trypanosomiasis and leishmaniasis. The biochemical basis of selecting this enzyme as a target, with reference to the simile and contrast to human analogous enzyme glutathione reductase, and the structural aspects of its active site are presented. The process of designing selective inhibitors for the enzyme trypanothione reductase has been discussed. An overview of the different chemical classes of inhibitors of trypanothione reductase with their inhibitory activities against the parasites and their prospects as future chemotherapeutic agents are briefl y revealed.

  20. Functional complementation of a nitrate reductase defective mutant of a green alga Dunaliella viridis by introducing the nitrate reductase gene.

    Science.gov (United States)

    Sun, Yu; Gao, Xiaoshu; Li, Qiyun; Zhang, Qingqi; Xu, Zhengkai

    2006-08-01

    Nitrate reductase (NR) catalyzes NAD (P) H dependent reduction of nitrate to nitrite. Transformation systems have been established in several species of green algae by nitrate reductase gene functional complementation. In this report, an endogenous NR cDNA (3.4 kb) and a genomic fragment (14.6 kb) containing the NR gene (DvNIA1) were isolated from the D. viridis cDNA and genomic libraries respectively. Southern blot and Northern blot analyses showed that this gene exists as a single copy in D. viridis and is induced by nitrate. To obtain a NR defective mutant as a recipient strain, D. viridis cells were treated with a chemical mutagen and then cultured on a chlorate-containing plate to enrich chlorate tolerant mutants. Southern analysis showed that one isolate, B14, had a deletion in the DvNIA1 gene region. Using electroporation conditions determined in this laboratory, plasmid pDVNR containing the intact DvNIA1 gene has been electroporated into the defective mutant B14. Strains retaining a nitrate assimilation phenotype were obtained from nitrate plates after spreading the electroporated cells. In some individual strains, transcription of the introduced gene was detected. NR activity in these strains was slightly higher than that in the defective B14 cell, but excretion of nitrite into culture media was almost as high as that of the wild-type cell. Possible episomal presence of the introduced DNA in D. viridis is discussed. PMID:16797881

  1. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    Science.gov (United States)

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared for their overproduction and easy purification. GST-EcNfsA, GST-EcNFsB, and GST-VhNFsA efficiently reduced nitrofurazone and 2,4,6-trinitrotoluene (TNT) as their nitro substrates. The Km values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 11.8, 23.5, and 5.4 μM, respectively. The Vmax values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA were 3.8, 3.9, and 10.7 nmol/min/mg of protein, respectively. GST-VhNfsA was the most effective of the three chromate reductases, as determined by each Vmax/Km value. The optimal temperatures of GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 55, 30, and 30°C, respectively. Thus, it is confirmed that nitroreductase can also act as a chromate reductase. Nitroreductases may be used in chromate remediation. GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA have a molecular mass of 50 kDa and exist as a monomer in solution. Thin-layer chromatography showed that GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA contain FMN as a cofactor. GST-VhNfsA reduced Cr(VI) to Cr(III). Cr(III) was much less toxic to E. coli than Cr(VI). PMID:12902220

  2. Structure of a bacterial homologue of vitamin K epoxide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.; Boyd, Dana; Beckwith, Jon; Rapoport, Tom A. (Harvard-Med); (HHMI)

    2010-03-19

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins to reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.

  3. Aspects of Ribonucleotide Reductase Regulation and Genome Stability

    DEFF Research Database (Denmark)

    Nielsen, Helena Berner Nedergaard

    In all living cells, synthesis of the DNA building blocks, deoxyribonucleoside triphosphates (dNTPs), is tightly regulated to ensure a precise DNA replication to maintain genomic stability. Ribonucleotide reductase (RNR) is the enzyme responsible for reducing ribonucleotides to their deoxy forms....... RNR consists of two subunits: R1 and R2, both of which are essential. The activity of RNR is strictly regulated to control the dNTP pool, both by allosteric feedback control and transcriptional and translational controls. Four inhibitory proteins of RNR have been identified in yeast: Spd1 in fission...... yeast, and Sml1, Hug1, and Dif1 in budding yeast. An elevated, as well as a reduced dNTP pool is shown to lead to an increase in spontaneous mutation rates, hence regulation of RNR is very important in order to maintain genomic stability. No human inhibitory proteins have yet been identified to regulate...

  4. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria;

    2008-01-01

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  5. Crystal structure of isoflavone reductase from alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Xiaoqiang; He, Xianzhi; Lin, Jianqiao; Shao, Hui; Chang, Zhenzhan; Dixon, Richard A

    2006-05-19

    Isoflavonoids play important roles in plant defense and exhibit a range of mammalian health-promoting activities. Isoflavone reductase (IFR) specifically recognizes isoflavones and catalyzes a stereospecific NADPH-dependent reduction to (3R)-isoflavanone. The crystal structure of Medicago sativa IFR with deletion of residues 39-47 has been determined at 1.6A resolution. Structural analysis, molecular modeling and docking, and comparison with the structures of other NADPH-dependent enzymes, defined the putative binding sites for co-factor and substrate and potential key residues for enzyme activity and substrate specificity. Further mutagenesis has confirmed the role of Lys144 as a catalytic residue. This study provides a structural basis for understanding the enzymatic mechanism and substrate specificity of IFRs as well as the functions of IFR-like proteins. PMID:16600295

  6. Pulse radiolysis studies on superoxide reductase from Treponema pallidum

    CERN Document Server

    Nivière, V; Fontecave, M; Houée-Levin, C

    2015-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the corresponding one previously reported in the case of SOR from Desulfoarculus baarsii. The reconstituted spectra for the two intermediates are consistent with formation of transient iron-peroxide species.

  7. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria; Hansen, Thomas; Wang, August G; Djurovic, Srdjan; Rønningen, Kjersti S; Andreassen, Ole A; Agartz, Ingrid; Werge, Thomas; Terenius, Lars; Hall, Håkan

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  8. Isolation and characterization of nitric oxide reductase from Paracoccus halodenitrificans.

    Science.gov (United States)

    Sakurai, N; Sakurai, T

    1997-11-11

    Nitric oxide reductase was isolated from the membrane fraction of a denitrifying bacterium, Paracoccus halodenitrificans, in the presence of n-dodecyl beta-D-maltoside. A relatively simple and effective procedure to purify NO reductase using DEAE-Toyopearl and hydroxyapatite (ceramic) chromatographies has been developed. The enzyme consisted of two subunits with molecular masses of 20 and 42 kDa associated with the c-type heme and two b-type hemes, respectively. The optical and magnetic circular dichroism (MCD) spectra of the oxidized (as isolated) and reduced enzymes indicated that the heme c is in the low-spin state and the hemes b are in the high- and low-spin states. The EPR spectrum also showed the presence of the split high-spin component (g perpendicular = 6.6, 6.0) and two low spin components (gz,y,x = 2.96, 2.26, 1.46, gz = 3.59). Although the presence of an extra iron was suggested from atomic absorption spectroscopy, a non-heme iron could not be detected by colorimetric titrations using ferene and 2-(5-nitro-2-pyridylazo)- 5-(N-propyl-N-sulfopropylamino)phenolate (PAPS). One of the extra signals at g = 4.3 and 2.00 might come from a non-heme iron, while they may originate from an adventitious iron and a certain nonmetallic radical, respectively. When CO acted on the reduced enzyme, both of the low-spin hemes were not affected, and when NO acted on the reduced enzyme, the optical and MCD spectra were of a mixture of the oxidized and reduced enzymes. Consequently, the reduction of NO was supposed to take place at the high-spin heme b. The heme c and the low-spin heme b centers were considered to function as electron mediators during the intermolecular and intramolecular processes. PMID:9374857

  9. Identification of imine reductase-specific sequence motifs.

    Science.gov (United States)

    Fademrecht, Silvia; Scheller, Philipp N; Nestl, Bettina M; Hauer, Bernhard; Pleiss, Jürgen

    2016-05-01

    Chiral amines are valuable building blocks for the production of a variety of pharmaceuticals, agrochemicals and other specialty chemicals. Only recently, imine reductases (IREDs) were discovered which catalyze the stereoselective reduction of imines to chiral amines. Although several IREDs were biochemically characterized in the last few years, knowledge of the reaction mechanism and the molecular basis of substrate specificity and stereoselectivity is limited. To gain further insights into the sequence-function relationships, the Imine Reductase Engineering Database (www.IRED.BioCatNet.de) was established and a systematic analysis of 530 putative IREDs was performed. A standard numbering scheme based on R-IRED-Sk was introduced to facilitate the identification and communication of structurally equivalent positions in different proteins. A conservation analysis revealed a highly conserved cofactor binding region and a predominantly hydrophobic substrate binding cleft. Two IRED-specific motifs were identified, the cofactor binding motif GLGxMGx5 [ATS]x4 Gx4 [VIL]WNR[TS]x2 [KR] and the active site motif Gx[DE]x[GDA]x[APS]x3 {K}x[ASL]x[LMVIAG]. Our results indicate a preference toward NADPH for all IREDs and explain why, despite their sequence similarity to β-hydroxyacid dehydrogenases (β-HADs), no conversion of β-hydroxyacids has been observed. Superfamily-specific conservations were investigated to explore the molecular basis of their stereopreference. Based on our analysis and previous experimental results on IRED mutants, an exclusive role of standard position 187 for stereoselectivity is excluded. Alternatively, two standard positions 139 and 194 were identified which are superfamily-specifically conserved and differ in R- and S-selective enzymes. Proteins 2016; 84:600-610. © 2016 Wiley Periodicals, Inc. PMID:26857686

  10. Fatty acyl-CoA reductases of birds

    Directory of Open Access Journals (Sweden)

    Hellenbrand Janine

    2011-12-01

    Full Text Available Abstract Background Birds clean and lubricate their feathers with waxes that are produced in the uropygial gland, a holocrine gland located on their back above the tail. The type and the composition of the secreted wax esters are dependent on the bird species, for instance the wax ester secretion of goose contains branched-chain fatty acids and unbranched fatty alcohols, whereas that of barn owl contains fatty acids and alcohols both of which are branched. Alcohol-forming fatty acyl-CoA reductases (FAR catalyze the reduction of activated acyl groups to fatty alcohols that can be esterified with acyl-CoA thioesters forming wax esters. Results cDNA sequences encoding fatty acyl-CoA reductases were cloned from the uropygial glands of barn owl (Tyto alba, domestic chicken (Gallus gallus domesticus and domestic goose (Anser anser domesticus. Heterologous expression in Saccharomyces cerevisiae showed that they encode membrane associated enzymes which catalyze a NADPH dependent reduction of acyl-CoA thioesters to fatty alcohols. By feeding studies of transgenic yeast cultures and in vitro enzyme assays with membrane fractions of transgenic yeast cells two groups of isozymes with different properties were identified, termed FAR1 and FAR2. The FAR1 group mainly synthesized 1-hexadecanol and accepted substrates in the range between 14 and 18 carbon atoms, whereas the FAR2 group preferred stearoyl-CoA and accepted substrates between 16 and 20 carbon atoms. Expression studies with tissues of domestic chicken indicated that FAR transcripts were not restricted to the uropygial gland. Conclusion The data of our study suggest that the identified and characterized avian FAR isozymes, FAR1 and FAR2, can be involved in wax ester biosynthesis and in other pathways like ether lipid synthesis.

  11. Evidence for a hexaheteromeric methylenetetrahydrofolate reductase in Moorella thermoacetica.

    Science.gov (United States)

    Mock, Johanna; Wang, Shuning; Huang, Haiyan; Kahnt, Jörg; Thauer, Rudolf K

    2014-09-01

    Moorella thermoacetica can grow with H₂ and CO₂, forming acetic acid from 2 CO₂ via the Wood-Ljungdahl pathway. All enzymes involved in this pathway have been characterized to date, except for methylenetetrahydrofolate reductase (MetF). We report here that the M. thermoacetica gene that putatively encodes this enzyme, metF, is part of a transcription unit also containing the genes hdrCBA, mvhD, and metV. MetF copurified with the other five proteins encoded in the unit in a hexaheteromeric complex with an apparent molecular mass in the 320-kDa range. The 40-fold-enriched preparation contained per mg protein 3.1 nmol flavin adenine dinucleotide (FAD), 3.4 nmol flavin mononucleotide (FMN), and 110 nmol iron, almost as predicted from the primary structure of the six subunits. It catalyzed the reduction of methylenetetrahydrofolate with reduced benzyl viologen but not with NAD(P)H in either the absence or presence of oxidized ferredoxin. It also catalyzed the reversible reduction of benzyl viologen with NADH (diaphorase activity). Heterologous expression of the metF gene in Escherichia coli revealed that the subunit MetF contains one FMN rather than FAD. MetF exhibited 70-fold-higher methylenetetrahydrofolate reductase activity with benzyl viologen when produced together with MetV, which in part shows sequence similarity to MetF. Heterologously produced HdrA contained 2 FADs and had NAD-specific diaphorase activity. Our results suggested that the physiological electron donor for methylenetetrahydrofolate reduction in M. thermoacetica is NADH and that the exergonic reduction of methylenetetrahydrofolate with NADH is coupled via flavin-based electron bifurcation with the endergonic reduction of an electron acceptor, whose identity remains unknown. PMID:25002540

  12. Nitrite and nitrous oxide reductase regulation by nitrogen oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106.

    Science.gov (United States)

    Sabaty, M; Schwintner, C; Cahors, S; Richaud, P; Verméglio, A

    1999-10-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N(2)O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored by the presence of a plasmid containing the genes encoding the nitrate reductase. This demonstrates that R. sphaeroides f. sp. denitrificans IL106 does not possess an efficient membrane-bound nitrate reductase and that nitrate is not the direct inducer for the nitrite and N(2)O reductases in this species. In contrast, we show that nitrite induces the synthesis of the nitrate reductase. PMID:10498715

  13. The use of 5-alpha reductase inhibitors for the prevention of prostate cancer.

    Science.gov (United States)

    Yu, Eun-mi; El-Ayass, Walid; Aragon-Ching, Jeanny B

    2010-07-01

    The use of 5-alpha-reductase inhibitors has been studied not only in benign prostatic hyperplasia, but as a chemopreventive strategy in prostate cancer. Both finasteride and dutasteride, 5 alpha-reductase inhibitors (5ARI), have been shown to decrease the risk of prostate cancer. The results of the REDUCE trial using the dual alpha-reductase isoenzyme inhibitor dutasteride, has recently been published by Andriole et al. in the New England Journal of Medicine. Certain considerations regarding its use and applicability to men with high risk of developing prostate cancer are herein discussed. PMID:20574153

  14. Characterization and regulation of Leishmania major 3-hydroxy-3-methylglutaryl-CoA reductase

    DEFF Research Database (Denmark)

    Montalvetti, A; Pena Diaz, Javier; Hurtado, R;

    2000-01-01

    In eukaryotes the enzyme 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase catalyses the synthesis of mevalonic acid, a common precursor to all isoprenoid compounds. Here we report the isolation and overexpression of the gene coding for HMG-CoA reductase from Leishmania major. The protein from...... Leishmania lacks the membrane domain characteristic of eukaryotic cells but exhibits sequence similarity with eukaryotic reductases. Highly purified protein was achieved by ammonium sulphate precipitation followed by chromatography on hydroxyapatite. Kinetic parameters were determined for the protozoan...

  15. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking.

    Science.gov (United States)

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using GOLD, AutoDock Vina, eHiTS, PatchDock and MEDock) followed by rank-sum technique identified compound allium38 with high binding affinity for aldose reductase. PMID:23275691

  16. Steroidal pyrazolines evaluated as aromatase and quinone reductase-2 inhibitors for chemoprevention of cancer.

    Science.gov (United States)

    Abdalla, Mohamed M; Al-Omar, Mohamed A; Bhat, Mashooq A; Amr, Abdel-Galil E; Al-Mohizea, Abdullah M

    2012-05-01

    The aromatase and quinone reductase-2 inhibition of synthesized heterocyclic pyrazole derivatives fused with steroidal structure for chemoprevention of cancer is reported herein. All compounds were interestingly less toxic than the reference drug (Cyproterone(®)). The aromatase inhibitory activities of these compounds were much more potent than the lead compound resveratrol, which has an IC(50) of 80 μM. In addition, all the compounds displayed potent quinone reductase-2 inhibition. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). The aromatase and quinone reductase-2 inhibitors resulting from this study have potential value in the treatment and prevention of cancer. PMID:22361454

  17. Association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and age of onset in schizophrenia

    DEFF Research Database (Denmark)

    Vares, Maria; Saetre, Peter; Deng, Hong;

    2010-01-01

    Different lines of evidence indicate that methylenetetrahydrofolate reductase (MTHFR) functional gene polymorphisms, causative in aberrant folate-homocysteine metabolism, are associated with increased vulnerability to several heritable developmental disorders. Opposing views are expressed...

  18. Histochemical Localization of Glutathione Dependent NBT—Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    YOESHWERSHUKLA

    2001-01-01

    Objective:Localization of the glutathione dependent Nitroblue tetrazolium(NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated.Methods:The fresh frozen tissue sections(8m thickness)were prepared and incuated in medium containing NBT,reduced glutathione(GSH) and Phosphate uffer,The staining for GSH was performed with mercury orange.Results:The activity of the NBT-reductase in mouse skin has een found to be localized in the areas rich in glutatione and actively proliferating area of the skin.Conclusion:The activity of the NBT-reductase seems to be dependent on the glutatione contents.

  19. Redesigning alcohol dehydrogenases/reductases for more efficient biosynthesis of enantiopure isomers.

    Science.gov (United States)

    Zhang, Rongzhen; Xu, Yan; Xiao, Rong

    2015-12-01

    Alcohol dehydrogenases/reductases predominantly catalyze the asymmetric biosynthesis of optically pure stereoisomers because of their unique chiral constitutions. The enantioselectivities of alcohol dehydrogenases/reductases are substrate- and cofactor-dependent, and therefore they usually catalyze specific reactions with high enantioselectivity under physiological conditions; this may not be suitable for asymmetric biosynthesis with non-natural substrates or non-natural cofactors, and under nonphysiological conditions. It is therefore necessary to modify alcohol dehydrogenases/reductases using various redesigning tools such as directed evolution and rational design, and their combinations, as well as engineering enzyme modules for more efficient production of "non-natural" products. In this article, progress in these aspects of alcohol dehydrogenase/reductase design is reviewed, and future challenges are discussed. PMID:26320091

  20. 5α-reductase inhibitors, antiviral and anti-tumor activities of some steroidal cyanopyridinone derivatives.

    Science.gov (United States)

    Al-Mohizea, Abdullah M; Al-Omar, Mohamed A; Abdalla, Mohamed M; Amr, Abdel-Galil E

    2012-01-01

    We herein report the 5α-reductase inhibitors, antiviral and anti-tumor activities of some synthesized heterocyclic cyanopyridone and cyanothiopyridone derivatives fused with steroidal structure. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). All the compounds, except 3b, were interestingly less toxic than the reference drug (Prednisolone(®)). Seventeen heterocyclic derivatives containing a cyanopyridone or cyanothiopyridone rings fused to a steroidal moiety were synthesized and screened for their 5α-reductase inhibitors, antiviral and anti-tumor activities comparable to that of Anastrozole, Bicalutamide, Efavirenz, Capravirine, Ribavirin, Oseltamivir and Amantadine as the reference drugs. Some of the compounds exhibited better 5α-reductase inhibitors, antiviral and anti-tumor activities than the reference drugs. The detailed 5α-reductase inhibitors, antiviral and anti-tumor activities of the synthesized compounds were reported. PMID:22057085

  1. Comparison of the Stereospecificity and Immunoreactivity of NADH-Ferricyanide Reductases in Plant Membranes

    OpenAIRE

    Fredlund, Kenneth M.; Struglics, André; Widell, Susanne; ASKERLUND, Per; Kader, Jean-Claude; Møller, Ian M.

    1994-01-01

    The substrate stereospecificity of NADH-ferricyanide reductase activities in the inner mitochondrial membrane and peroxisomal membrane of potato (Solanum tuberosum L.) tubers, spinach (Spinacea oleracea L.) leaf plasma membrane, and red beetroot (Beta vulgaris L.) tonoplast were all specific for the [beta]-hydrogen of NADH, whereas the reductases in wheat root (Triticum aestivum L.) endoplasmic reticulum and potato tuber outer mitochondrial membrane were both [alpha]-hydrogen specific. In all...

  2. Nucleotide sequence of a cyanobacterial nifH gene coding for nitrogenase reductase

    OpenAIRE

    Mevarech, Moshe; Rice, Douglas; Haselkorn, Robert

    1980-01-01

    The nucleotide sequence of nifH, the structural gene for nitrogenase reductase (component II or Fe protein of nitrogenase) from the cyanobacterium Anabaena 7120 has been determined. Also reported are 194 bases of the 5′-flanking sequence and 170 bases of the 3′-flanking sequence. The predicted amino acid sequence was compared with that determined for the complete nitrogenase reductase of Clostridium pasteurianum and the cysteine-containing peptides of the protein from Azotobacter vinelandii. ...

  3. Overexpression of Soybean Isoflavone Reductase (GmIFR) Enhances Resistance to Phytophthora sojae in Soybean

    OpenAIRE

    Cheng, Qun; Li, Ninghui; Dong, Lidong; Zhang, Dayong; Fan, Sujie; Jiang, Liangyu; Wang, Xin; Xu, Pengfei; Zhang, Shuzhen

    2015-01-01

    Isoflavone reductase (IFR) is an enzyme involved in the biosynthetic pathway of isoflavonoid phytoalexin in plants. IFRs are unique to the plant kingdom and are considered to have crucial roles in plant response to various biotic and abiotic environmental stresses. Here, we report the characterization of a novel member of the soybean isoflavone reductase gene family GmIFR. Overexpression of GmIFR transgenic soybean exhibited enhanced resistance to Phytophthora sojae. Following stress treatmen...

  4. Design and synthesis of hepatoselective, pyrrole-based HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Song, Yuntao; Sun, Kuai-Lin; Miller, Steven R; Trivedi, Bharat K; Choi, Chulho; Sorenson, Roderick J; Bratton, Larry D; Unangst, Paul C; Larsen, Scott D; Poel, Toni-Jo; Cheng, Xue-Min; Lee, Chitase; Erasga, Noe; Auerbach, Bruce; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Olsen, Karl; Mertz, Thomas; Sekerke, Catherine; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole; Chen, Huifen; Eberstadt, Matthias

    2007-08-15

    This manuscript describes the design and synthesis of a series of pyrrole-based inhibitors of HMG-CoA reductase for the treatment of hypercholesterolemia. Analogs were optimized using structure-based design and physical property considerations resulting in the identification of 44, a hepatoselective HMG-CoA reductase inhibitor with excellent acute and chronic efficacy in a pre-clinical animal models. PMID:17574412

  5. Protein Method for Investigating Mercuric Reductase Gene Expression in Aquatic Environments

    OpenAIRE

    Ogunseitan, O A

    1998-01-01

    A colorimetric assay for NADPH-dependent, mercuric ion-specific oxidoreductase activity was developed to facilitate the investigation of mercuric reductase gene expression in polluted aquatic ecosystems. Protein molecules extracted directly from unseeded freshwater and samples seeded with Pseudomonas aeruginosa PU21(Rip64) were quantitatively assayed for mercuric reductase activity in microtiter plates by stoichiometric coupling of mercuric ion reduction to a colorimetric redox chain through ...

  6. Molecular pharmacology and antitumor activity of palmarumycin based inhibitors of thioredoxin reductase.

    OpenAIRE

    Powis, Garth; Wipf, Peter; Lynch, Stephen M.; Birmingham, Anne; Kirkpatrick, D. Lynn

    2006-01-01

    The cytosolic thioredoxin (Trx) redox system comprising Trx-1 and the NADPH dependent thioredoxin reductase -1 reductase (TrxR-1) is an important regulator of cell growth and survival. Trx-1 is overexpressed in many human tumors where it is associated with increased cell proliferation, decreased apoptosis and decreased patient survival. We hypothesized that TrxR-1 provides a target to inhibit the activity of overexpressed Trx-1 for the development of novel anticancer agents. We found that the...

  7. Soil acidity as affecting micronutrients concentration, nitrato reductase enzyme activity and yield in upland rice plants

    OpenAIRE

    Edemar Moro; Carlos Alexandre Costa Crusciol; Heitor Cantarella; Adriano Stephan Nascente; Adriana Lima Moro; Fernando Broetto

    2013-01-01

    The lowest grain yield of rice under no-tillage system (NTS) in relation to the conventional system may be due to the predominance nitrate in the soil and the low nitrate reductase activity. Another reason may be caused by micronutrient deficiency because of superficially soil acidity corrections. Therefore, the objective of this study was to evaluate the changes caused by soil pH in the N forms in the soil, micronutrients concentration in rice plants, nitrate reductase activity, yield of ric...

  8. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    OpenAIRE

    M.T. Goodarzi; Zal, F; M. Malakooti; M. R. Safari S. Sadeghian

    2006-01-01

    Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that receiv...

  9. Glutathione Reductase/Glutathione Is Responsible for Cytotoxic Elemental Sulfur Tolerance via Polysulfide Shuttle in Fungi*

    OpenAIRE

    Sato, Ikuo; Shimatani, Kanami; Fujita, Kensaku; Abe, Tsuyoshi; Shimizu, Motoyuki; Fujii, Tatsuya; Hoshino, Takayuki; Takaya, Naoki

    2011-01-01

    Fungi that can reduce elemental sulfur to sulfide are widely distributed, but the mechanism and physiological significance of the reaction have been poorly characterized. Here, we purified elemental sulfur-reductase (SR) and cloned its gene from the elemental sulfur-reducing fungus Fusarium oxysporum. We found that NADPH-glutathione reductase (GR) reduces elemental sulfur via glutathione as an intermediate. A loss-of-function mutant of the SR/GR gene generated less sulfide from elemental sulf...

  10. Expression of the mouse dihydrofolate reductase complementary deoxyribonucleic acid in simian virus 40 vectors.

    OpenAIRE

    Subramani, S.; Mulligan, R.; Berg, P

    1981-01-01

    A mouse complementary deoxyribonucleic acid segment coding for the enzyme dihydrofolate reductase has been cloned in two general classes of vectors containing simian virus 40 deoxyribonucleic acid: (i) those that can be propagated as virions in permissive cells and (ii) those that can be introduced into and maintained stably in various mammalian cells. Both types of vectors express the mouse dihydrofolate reductase by using signals supplied by simian virus 40 deoxyribonucleic acid sequences. ...

  11. Interaction of Product Analogs with the Active Site of Rhodobacter sphaeroides Dimethylsulfoxide Reductase

    OpenAIRE

    George, Graham N.; Nelson, Kimberly Johnson; Harris, Hugh H.; Doonan, Christian J.; Rajagopalan, K V

    2007-01-01

    We report a structural characterization using X-ray absorption spectroscopy of Rhodobacter sphaeroides dimethylsulfoxide (DMSO) reductase reduced with trimethylarsine, and show that this is structurally analogous to the physiologically relevant dimethylsulfide-reduced DMSO reductase. Our data unambiguously indicate that these species should be regarded as formal MoIV species, and indicate a classical coordination complex of trimethylarsine oxide, with no special structural distortions. The si...

  12. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    OpenAIRE

    Muthuswamy Umamaheswari; C. S. Aji; Kuppusamy Asokkumar; Thirumalaisamy Sivashanmugam; Varadharajan Subhadradevi; Puliyath Jagannath; Arumugam Madeswaran

    2012-01-01

    New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard....

  13. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking

    OpenAIRE

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using ...

  14. Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues

    Institute of Scientific and Technical Information of China (English)

    JunichiFujii; YoshihitoIuchi; ShingoMatsuki; TatsuyaIshii

    2003-01-01

    Reactive oxygen species (ROS) are produced under oxidative stress, such as high oxygen concentration and during the metabolic consumption of oxygen molecules. Male reproductive tissues appear to be continuously exposed to ROS produced by active metabolism. In addition, spermatozoa must pass through a high oxygen environ-ment during the mating process. Thus, to maintain viable reproductive ability, a protective mechanism against oxida-tive stress is of importance. Here, we overview our current understanding of the cooperative function of antioxidative and redox systems that are involved in male fertility. Superoxide dismutase and glutathione peroxidase are major enzymes that scavenge harmful ROS in male reproductive organs. In turn, glutathione and thioredoxin systems constitute the main redox systems that repair oxidized and damaged molecules and also play a role in regulating a variety of cellular functions. While glutathione functions as an antioxidant by donating electrons to glutathione peroxidase and thioredoxin donates electrons to peroxiredoxin as a counterpart of glutathione peroxidase. In addition,aldo-keto reductases, which detoxify carbonyl compounds produced by oxidative stress, are present at high levels in the epithelia of the genital tract and Sertoli cells of the testis. Since these systems are involved in cross-talk, a comprehensive understanding will be required to maintain the physiological functions of male reproductive system.( Asian J Andro12003 Sep; 5: 231-242)

  15. DIFFERENTIAL PROTEOME ANALYSIS OF THE MALE AND FEMALE ANTENNAE FROM Holotrichia parallela.

    Science.gov (United States)

    Zhang, Ju-Hong; Wang, Shang; Yang, Shuang; Yi, Jiankun; Liu, Yan; Xi, Jing-Hui

    2016-08-01

    To understand the olfactory mechanisms of Holotrichia parallela antennae in detecting volatile compounds in the environment, protein profiles of H. parallela antennae were analyzed using two-dimensional electrophoresis followed by mass spectrometry and bioinformatics analyses. Approximately 1,100 protein spots in silver staining gel were detected. Quantitative image analysis revealed that in total 47 protein spots showed significant changes in different genders of adult antennae. Thirty-five differentially expressed proteins were identified by Matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF/TOF) tandem mass spectrometer, among which 65.7% are involved in carbohydrate and energy metabolism, antioxidant system, transport, and amino acid/nucleotide metabolism. Some proteins identified here have not been reported previously in insect antennae. Identified male-biased proteins included odorant-binding protein 4, pheromone-binding protein-related protein 2, odorant-binding protein 14, prophenoloxidase-I, acyl-CoA dehydrogenase, aldo-keto reductase-like, carbamoyl phosphate synthetase, etc. whereas some proteins are female biased, such as antennae-rich cytochrome P450, aldehyde dehydrogenase, and putative glutamine synthetase. Alterations in the levels of some proteins were further confirmed by real time polymerase chain reaction (RT-PCR). The proteomic resources displayed here are valuable for the discovery of proteins from H. parallela antennae. PMID:27396371

  16. Methyl Jasmonate: Putative Mechanisms of Action on Cancer Cells Cycle, Metabolism, and Apoptosis

    Directory of Open Access Journals (Sweden)

    Italo Mario Cesari

    2014-01-01

    Full Text Available Methyl jasmonate (MJ, an oxylipid that induces defense-related mechanisms in plants, has been shown to be active against cancer cells both in vitro and in vivo, without affecting normal cells. Here we review most of the described MJ activities in an attempt to get an integrated view and better understanding of its multifaceted modes of action. MJ (1 arrests cell cycle, inhibiting cell growth and proliferation, (2 causes cell death through the intrinsic/extrinsic proapoptotic, p53-independent apoptotic, and nonapoptotic (necrosis pathways, (3 detaches hexokinase from the voltage-dependent anion channel, dissociating glycolytic and mitochondrial functions, decreasing the mitochondrial membrane potential, favoring cytochrome c release and ATP depletion, activating pro-apoptotic, and inactivating antiapoptotic proteins, (4 induces reactive oxygen species mediated responses, (5 stimulates MAPK-stress signaling and redifferentiation in leukemia cells, (6 inhibits overexpressed proinflammatory enzymes in cancer cells such as aldo-keto reductase 1 and 5-lipoxygenase, and (7 inhibits cell migration and shows antiangiogenic and antimetastatic activities. Finally, MJ may act as a chemosensitizer to some chemotherapics helping to overcome drug resistant. The complete lack of toxicity to normal cells and the rapidity by which MJ causes damage to cancer cells turn MJ into a promising anticancer agent that can be used alone or in combination with other agents.

  17. Oxidative Stress and Carbonyl Lesions in Ulcerative Colitis and Associated Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Zhiqi Wang

    2016-01-01

    Full Text Available Oxidative stress has long been known as a pathogenic factor of ulcerative colitis (UC and colitis-associated colorectal cancer (CAC, but the effects of secondary carbonyl lesions receive less emphasis. In inflammatory conditions, reactive oxygen species (ROS, such as superoxide anion free radical (O2∙-, hydrogen peroxide (H2O2, and hydroxyl radical (HO∙, are produced at high levels and accumulated to cause oxidative stress (OS. In oxidative status, accumulated ROS can cause protein dysfunction and DNA damage, leading to gene mutations and cell death. Accumulated ROS could also act as chemical messengers to activate signaling pathways, such as NF-κB and p38 MAPK, to affect cell proliferation, differentiation, and apoptosis. More importantly, electrophilic carbonyl compounds produced by lipid peroxidation may function as secondary pathogenic factors, causing further protein and membrane lesions. This may in turn exaggerate oxidative stress, forming a vicious cycle. Electrophilic carbonyls could also cause DNA mutations and breaks, driving malignant progression of UC. The secondary lesions caused by carbonyl compounds may be exceptionally important in the case of host carbonyl defensive system deficit, such as aldo-keto reductase 1B10 deficiency. This review article updates the current understanding of oxidative stress and carbonyl lesions in the development and progression of UC and CAC.

  18. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    Science.gov (United States)

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both. © 2015 Japanese Society of Animal Science. PMID:26388291

  19. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  20. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses.

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  1. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network.

    Science.gov (United States)

    Couto, Narciso; Wood, Jennifer; Barber, Jill

    2016-06-01

    In this review article we examine the role of glutathione reductase in the regulation, modulation and maintenance of cellular redox homoeostasis. Glutathione reductase is responsible for maintaining the supply of reduced glutathione; one of the most abundant reducing thiols in the majority of cells. In its reduced form, glutathione plays key roles in the cellular control of reactive oxygen species. Reactive oxygen species act as intracellular and extracellular signalling molecules and complex cross talk between levels of reactive oxygen species, levels of oxidised and reduced glutathione and other thiols, and antioxidant enzymes such as glutathione reductase determine the most suitable conditions for redox control within a cell or for activation of programmed cell death. Additionally, we discuss the translation and expression of glutathione reductase in a number of organisms including yeast and humans. In yeast and human cells, a single gene expresses more than one form of glutathione reductase, destined for residence in the cytoplasm or for translocation to different organelles; in plants, however, two genes encoding this protein have been described. In general, insects and kinetoplastids (a group of protozoa, including Plasmodia and Trypanosoma) do not express glutathione reductase or glutathione biosynthetic enzymes. Instead, they express either the thioredoxin system or the trypanothione system. The thioredoxin system is also present in organisms that have the glutathione system and there may be overlapping functions with cross-talk between the two systems. Finally we evaluate therapeutic targets to overcome oxidative stress associated cellular disorders. PMID:26923386

  2. INHIBITION OF TYPE I 5α-REDUCTASE BY MEDICINAL PLANT EXTRACTS

    Directory of Open Access Journals (Sweden)

    Patil Vijaya

    2011-03-01

    Full Text Available Type I 5α-reductase has been implicated in skin disorders such as acne, hirsutism and male pattern baldness and its inhibition offers a potential treatment for these disorders. The aim of this study was to investigate the inhibition of type I 5α-reductase activity by extracts from Indian medicinal plants. Plant extracts were screened and selected based on their ability to inhibit Propionibacterium acnes and Staphylococcus epidermidis. Since type I 5α-reductase metabolises testosterone to Δ4-androstene-3, 17-dione, the activity of enzyme was determined using RIA for testosterone and Δ4-androstene-3, 17-dione. It was found that methanolic extract of Embelia ribes was a potent inhibitor of type I 5α-reductase (IC50:100μg/mL. Extracts of Vitex negundo, Terminalia chebula, and Terminalia bellerica which also inhibited type I 5α-reductase (IC50: 200-390 μg /mL. Therefore herbal formulation of these plant extracts may be used in the treatment of skin disorders involving type I 5α-reductase.

  3. Nitrate reductase activity and its relationship with applied nitrogen in soybean

    International Nuclear Information System (INIS)

    Field experiments were conducted to study the nitrate reductase activity and its relationship to nitrogen by using frame tests (pot without bottom), sand culture and 15N-urea at transplanting in soybean variety Suinong 14. Results showed that the activity of nitrate reductase in leaf changed as a signal peak curve with the soybean growth, lower in vegetative growth phase, higher in reproductive growth period and reached the peak in blooming period, then decreased gradually. Nitrogen application showed obvious effect on the nitrate reductase activity. The activities of nitrate reductase in leaves followed the order of N135 > N90 > N45 > N0 in vegetative growth stage, no clear regularity was found during the whole reproductive growth period. The activities of nitrate reductase in leaves were accorded with the order of upper leaves > mid leaves > lower leaves, and it was very significant differences (P15N labeling method during beginning seed stage and full seed stage shown that 15N abundance in various organs at different node position also followed the same order, suggesting that high level of nitrate reductase activity at upper leaves of soybean promoted the assimilation of NO3-. (authors)

  4. Isobutyraldehyde production from Escherichia coli by removing aldehyde reductase activity

    Directory of Open Access Journals (Sweden)

    Rodriguez Gabriel M

    2012-06-01

    Full Text Available Abstract Background Increasing global demand and reliance on petroleum-derived chemicals will necessitate alternative sources for chemical feedstocks. Currently, 99% of chemical feedstocks are derived from petroleum and natural gas. Renewable methods for producing important chemical feedstocks largely remain unaddressed. Synthetic biology enables the renewable production of various chemicals from microorganisms by constructing unique metabolic pathways. Here, we engineer Escherichia coli for the production of isobutyraldehyde, which can be readily converted to various hydrocarbons currently derived from petroleum such as isobutyric acid, acetal, oxime and imine using existing chemical catalysis. Isobutyraldehyde can be readily stripped from cultures during production, which reduces toxic effects of isobutyraldehyde. Results We adopted the isobutanol pathway previously constructed in E. coli, neglecting the last step in the pathway where isobutyraldehyde is converted to isobutanol. However, this strain still overwhelmingly produced isobutanol (1.5 g/L/OD600 (isobutanol vs 0.14 g/L/OD600 (isobutyraldehyde. Next, we deleted yqhD which encodes a broad-substrate range aldehyde reductase known to be active toward isobutyraldehyde. This strain produced isobutanol and isobutyraldehyde at a near 1:1 ratio, indicating further native isobutyraldehyde reductase (IBR activity in E. coli. To further eliminate isobutanol formation, we set out to identify and remove the remaining IBRs from the E. coli genome. We identified 7 annotated genes coding for IBRs that could be active toward isobutyraldehyde: adhP, eutG, yiaY, yjgB, betA, fucO, eutE. Individual deletions of the genes yielded only marginal improvements. Therefore, we sequentially deleted all seven of the genes and assessed production. The combined deletions greatly increased isobutyraldehyde production (1.5 g/L/OD600 and decreased isobutanol production (0.4 g/L/OD600. By assessing production by

  5. Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis

    Institute of Scientific and Technical Information of China (English)

    Mee-Kyung; Cha; Yoo-Jeen; Bae; Kyu-Jeong; Kim; Byung-Joon; Park; Il-Han; Kim

    2015-01-01

    AIM: To identify alkyl hydroperoxide reductase subunit C(AhpC) homologs in Bacillus subtilis(B. subtilis) and to characterize their structural and biochemical properties. AhpC is responsible for the detoxification of reactive oxygen species in bacteria.METHODS: Two AhpC homologs(AhpC_H1 and AhpC_H2) were identified by searching the B. subtilis database; these were then cloned and expressed in Escherichia coli. AhpC mutants carrying substitutions of catalytically important Cys residues(C37S, C47 S, C166 S, C37/47 S, C37/166 S, C47/166 S, and C37/47/166 S for AhpC_H1; C52 S, C169 S, and C52/169 S for AhpC_H2) were obtained by site-directed mutagenesis and purified, and their structure-function relationship was analyzed. The B. subtilis ahp C genes were disrupted by the short flanking homology method, and the phenotypes of the resulting AhpC-deficient bacteria were examined.RESULTS: Comparative characterization of AhpC homologs indicates that AhpC_H1 contains an extra C37, which forms a disulfide bond with the peroxidatic C47, and behaves like an atypical 2-Cys AhpC, while AhpC_H2 functions like a typical 2-Cys AhpC. Tryptic digestion analysis demonstrated the presence of intramolecular Cys37-Cys47 linkage, which could be reduced by thioredoxin, resulting in the association of the dimer into higher-molecular-mass complexes. Peroxidase activity analysis of Cys→Ser mutants indicated that three Cys residues were involved in the catalysis. AhpC_H1 was resistant to inactivation by peroxide substrates, but had lower activity at physiological H2O2 concentrations compared to AhpC_H2, suggesting that in B. subtilis, the enzymes may be physiologically functional at different substrate concentrations. The exposure to organic peroxides induced AhpC_H1 expression, while AhpC_H1-deficient mutants exhibited growth retardation in the stationary phase, suggesting the role of AhpC_H1 as an antioxidant scavenger of lipid hydroperoxides and a stress-response factor in B. subtilis

  6. Binding of Natural and Synthetic Polyphenols to Human Dihydrofolate Reductase

    Directory of Open Access Journals (Sweden)

    José Neptuno Rodríguez-López

    2009-12-01

    Full Text Available Dihydrofolate reductase (DHFR is the subject of intensive investigation since it appears to be the primary target enzyme for antifolate drugs. Fluorescence quenching experiments show that the ester bond-containing tea polyphenols (--epigallocatechin gallate (EGCG and (--epicatechin gallate (ECG are potent inhibitors of DHFR with dissociation constants (KD of 0.9 and 1.8 μM, respectively, while polyphenols lacking the ester bound gallate moiety [e.g., (--epigallocatechin (EGC and (--epicatechin (EC] did not bind to this enzyme. To avoid stability and bioavailability problems associated with tea catechins we synthesized a methylated derivative of ECG (3-O-(3,4,5-trimethoxybenzoyl-(--epicatechin; TMECG, which effectively binds to DHFR (KD = 2.1 μM. In alkaline solution, TMECG generates a stable quinone methide product that strongly binds to the enzyme with a KD of 8.2 nM. Quercetin glucuronides also bind to DHFR but its effective binding was highly dependent of the sugar residue, with quercetin-3-xyloside being the stronger inhibitor of the enzyme with a KD of 0.6 μM. The finding that natural polyphenols are good inhibitors of human DHFR could explain the epidemiological data on their prophylactic effects for certain forms of cancer and open a possibility for the use of natural and synthetic polyphenols in cancer chemotherapy.

  7. Rapid identification of aldose reductase inhibitory compounds from Perilla frutescens.

    Science.gov (United States)

    Paek, Ji Hun; Shin, Kuk Hyun; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural analyses of the active compounds were performed by LC-MS(n). The main AR inhibiting compounds were tentatively identified as chlorogenic acid and rosmarinic acid by LC-MS(n). A two-step high speed counter current chromatography (HSCCC) isolation method was developed with a solvent system of n-hexane-ethyl acetate-methanol-water at 1.5:5:1:5, v/v and 3:7:5:5, v/v. The chemical structures of the isolated compounds were determined by (1)H- and (13)C-nuclear magnetic resonance spectrometry (NMR). The main compounds inhibiting AR in the EtOAc fraction of methanol extracts of P. frutescens were identified as chlorogenic acid (2) (IC50 = 3.16 μ M), rosmarinic acid (4) (IC50 = 2.77 μ M), luteolin (5) (IC50 = 6.34 μ M), and methyl rosmarinic acid (6) (IC50 = 4.03 μ M). PMID:24308003

  8. Expression analysis of dihydroflavonol 4-reductase genes in Petunia hybrida.

    Science.gov (United States)

    Chu, Y X; Chen, H R; Wu, A Z; Cai, R; Pan, J S

    2015-01-01

    Dihydroflavonol 4-reductase (DFR) genes from Rosa chinensis (Asn type) and Calibrachoa hybrida (Asp type), driven by a CaMV 35S promoter, were integrated into the petunia (Petunia hybrida) cultivar 9702. Exogenous DFR gene expression characteristics were similar to flower-color changes, and effects on anthocyanin concentration were observed in both types of DFR gene transformants. Expression analysis showed that exogenous DFR genes were expressed in all of the tissues, but the expression levels were significantly different. However, both of them exhibited a high expression level in petals that were starting to open. The introgression of DFR genes may significantly change DFR enzyme activity. Anthocyanin ultra-performance liquid chromatography results showed that anthocyanin concentrations changed according to DFR enzyme activity. Therefore, the change in flower color was probably the result of a DFR enzyme change. Pelargonidin 3-O-glucoside was found in two different transgenic petunias, indicating that both CaDFR and RoDFR could catalyze dihydrokaempferol. Our results also suggest that transgenic petunias with DFR gene of Asp type could biosynthesize pelargonidin 3-O-glucoside. PMID:25966276

  9. 5alpha-reductase: history and clinical importance.

    Science.gov (United States)

    Marks, Leonard S

    2004-01-01

    The treatment of men with symptomatic benign prostatic hyperplasia (BPH) has shifted dramatically from surgery to drug therapy over the past decade. The revolution in BPH treatment began with the discovery of congenital 5alpha-reductase (5AR) deficiency, leading to the appreciation of 2 different androgenic hormones: testosterone, which mediates overt masculinization in the adult male, and dihydrotestosterone (DHT), which mediates prostatic growth, acne, facial beard, and male pattern baldness. Inhibition of DHT in adults results in prostatic shrinkage and symptomatic relief in many men, without the side effects seen with conventional androgen-deprivation therapy. The 5AR inhibitor drugs (finasteride and the dual inhibitor, dutasteride) are able to ablate the accumulation of intraprostatic DHT, the mechanism most responsible for prostate growth and maintenance. Not only may these drugs relieve symptoms, but they may also alter the natural history of the BPH process. Future indications for the 5ARI drugs could include chemoprevention of prostate cancer, prophylaxis of BPH-related complications, and treatment of BPH-associated hematuria. PMID:16985920

  10. Regulation and degradation of HMGCo-A reductase.

    Science.gov (United States)

    Panda, T; Devi, V Amutha

    2004-12-01

    The enzyme, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) controls the biosynthesis of cholesterol. Hypercholesterolemia and atherosclerosis are critical health risk factors. One way of controlling these risk factors is to manipulate regulation as well as degradation of HMGR. At present, a class of compounds called statins, which are HMGR inhibitors, are used for the treatment of hypercholesterolemia. However, statins suffer major setbacks as their use produces more adverse reactions than the desirable one of inhibiting the enzyme. Genetically engineered forms of HMGR are also studied in primitive life forms like bacteria, but detailed investigation of this enzyme in human systems is certainly required. Extensive studies have been made on the regulatory aspects of this enzyme, but no breakthrough is conspicuous in the clinical background to find an alternative treatment for hypercholesterolemia. The immediate need is to find an alternate way of regulating degradation of the enzyme. This review presents the importance of regulation and degradation of the HMGR enzyme in different systems to gain possible insight into alternative schemes for regulating this enzyme and, if these exist, the feasibility of extending them same to studies in mammalian systems. A high degree of similarity exists between mammalian and yeast HMGR. Detailed studies reported on the regulation and degradation of the yeast enzyme also throw more light on the mammalian system, leading to a better understanding of ways of controlling hypercholesterolemia. PMID:15558272

  11. Methylenetetrahydrofolate Reductase Genotypes, Dietary Habits and Susceptibility to Stomach Cancer

    Institute of Scientific and Technical Information of China (English)

    ChangmingGao; TakezakiToshiro; JianzhongWu; JianhuoDing; YantingLiu; SupingLi; PingSu; XuHu; TianliongXu; HamajimaNobuyuki; TajimaKazuo

    2004-01-01

    OBJECTIVE To study the relation among methylenetetrahydrofolate reductase (MTHFR) C677T genotypes, dietary habits and the risk of stomach cancer (SC).METHODS A case-control study was conducted with 107 cases of SC and 200 population-based controls in Chuzhou district, Huaian, Jiangsu province, China. The epidemiological data were collected, and DNA of peripheral blood leukocytes was obtained from all of the subjects..MTHFR genotypes were detected by PCR-RFLP. RESULTS (1) The prevalence of the MTHFR C/T or T/T genotypes was found to be significantly different between controls (68.5%) and SC cases (79.4%,P=0.0416), the increased risk had an adjusted OR of 1.79 (95%C1:1.01-3.19). (2) Among subjects who had a low intake of garlic or Chinese onion, MTHFR C/T or T/T genotypes significantly increased the risk of developing SC. Among non-tea drinkers or among subjects who had a frequent intakeof meat, the carriers of the MTHFR C/T or T/T genotypes had a higher risk of SC than individuals with the C/C type MTHFR. CONCLUSION The polymorphism of MTHFR C677T was associated with increased risk of developing SC, and that individuals with differing genotypes may have different susceptibilities to SC, based on their exposure level to environmental factors.

  12. Ribonucleotide reductase and cancer: biological mechanisms and targeted therapies.

    Science.gov (United States)

    Aye, Y; Li, M; Long, M J C; Weiss, R S

    2015-04-16

    Accurate DNA replication and repair is essential for proper development, growth and tumor-free survival in all multicellular organisms. A key requirement for the maintenance of genomic integrity is the availability of adequate and balanced pools of deoxyribonucleoside triphosphates (dNTPs), the building blocks of DNA. Notably, dNTP pool alterations lead to genomic instability and have been linked to multiple human diseases, including mitochondrial disorders, susceptibility to viral infection and cancer. In this review, we discuss how a key regulator of dNTP biosynthesis in mammals, the enzyme ribonucleotide reductase (RNR), impacts cancer susceptibility and serves as a target for anti-cancer therapies. Because RNR-regulated dNTP production can influence DNA replication fidelity while also supporting genome-protecting DNA repair, RNR has complex and stage-specific roles in carcinogenesis. Nevertheless, cancer cells are dependent on RNR for de novo dNTP biosynthesis. Therefore, elevated RNR expression is a characteristic of many cancers, and an array of mechanistically distinct RNR inhibitors serve as effective agents for cancer treatment. The dNTP metabolism machinery, including RNR, has been exploited for therapeutic benefit for decades and remains an important target for cancer drug development. PMID:24909171

  13. Alkyl hydroperoxide reductase: a candidate Helicobacter pylori vaccine.

    Science.gov (United States)

    O'Riordan, Avril A; Morales, Veronica Athie; Mulligan, Linda; Faheem, Nazia; Windle, Henry J; Kelleher, Dermot P

    2012-06-01

    Helicobacter pylori (H. pylori) is the most important etiological agent of chronic active gastritis, peptic ulcer disease and gastric cancer. The aim of this study was to evaluate the efficacy of alkyl hydroperoxide reductase (AhpC) and mannosylated AhpC (mAhpC) as candidate vaccines in the C57BL/6J mouse model of H. pylori infection. Recombinant AhpC was cloned, over-expressed and purified in an unmodified form and was also engineered to incorporate N and C-terminal mannose residues when expressed in the yeast Pichia pastoris. Mice were immunized systemically and mucosally with AhpC and systemically with mAhpC prior to challenge with H. pylori. Serum IgG responses to AhpC were determined and quantitative culture was used to determine the efficacy of vaccination strategies. Systemic prophylactic immunization with AhpC/alum and mAhpC/alum conferred protection against infection in 55% and 77.3% of mice, respectively. Mucosal immunization with AhpC/cholera toxin did not protect against infection and elicited low levels of serum IgG in comparison with systemic immunization. These data support the use of AhpC as a potential vaccine candidate against H. pylori infection. PMID:22512976

  14. Loss of quinone reductase 2 function selectively facilitates learning behaviors.

    Science.gov (United States)

    Benoit, Charles-Etienne; Bastianetto, Stephane; Brouillette, Jonathan; Tse, YiuChung; Boutin, Jean A; Delagrange, Philippe; Wong, TakPan; Sarret, Philippe; Quirion, Rémi

    2010-09-22

    High levels of reactive oxygen species (ROS) are associated with deficits in learning and memory with age as well as in Alzheimer's disease. Using DNA microarray, we demonstrated the overexpression of quinone reductase 2 (QR2) in the hippocampus in two models of learning deficits, namely the aged memory impaired rats and the scopolamine-induced amnesia model. QR2 is a cytosolic flavoprotein that catalyzes the reduction of its substrate and enhances the production of damaging activated quinone and ROS. QR2-like immunostaining is enriched in cerebral structures associated with learning behaviors, such as the hippocampal formation and the temporofrontal cortex of rat, mouse, and human brains. In cultured rat embryonic hippocampal neurons, selective inhibitors of QR2, namely S26695 and S29434, protected against menadione-induced cell death by reversing its proapoptotic action. S26695 (8 mg/kg) also significantly inhibited scopolamine-induced amnesia. Interestingly, adult QR2 knock-out mice demonstrated enhanced learning abilities in various tasks, including Morris water maze, object recognition, and rotarod performance test. Other behaviors related to anxiety (elevated plus maze), depression (forced swim), and schizophrenia (prepulse inhibition) were not affected in QR2-deficient mice. Together, these data suggest a role for QR2 in cognitive behaviors with QR2 inhibitors possibly representing a novel therapeutic strategy toward the treatment of learning deficits especially observed in the aged brain. PMID:20861374

  15. Determination of Nitrate Reductase Assay Depending on the Microbial Growth

    International Nuclear Information System (INIS)

    A rapid micro-dilution assay for determination of the antimicrobial susceptibility of different bacterial isolates was developed. This assay is based on the ability of the most of viable organisms to reduce nitrates. The MIC or MBC could be determined by nitrate reductase (NR) only after 30 to 90 min of incubation depending on the behaviour of microbial growth. Bacterial viability is detected by a positive nitrite reduction rather than visible turbidity. The nitrate reduction assay was compared with standard micro-assay using 250 isolates of different taxa against 10 antibiotics belonging to different classes. An excellent agreement of 82.5 % was found between the two methods and only 17.5 % of 1794 trials showed difference in the determined MIC by tow-dilution interval above or below the MIC determined by the turbidimetric method under the same test conditions. However, the nitrate reduction assay was more rapid and sensitive in detecting viable bacteria and so, established an accurate estimate of the minimal inhibitory concentration (MIC) or the minimal bacterial concentration (MBC). The nitrate reduction assay offers the additional advantage that it could be used to determine the MBC without having to subculture the broth. 232 cases of resistance were detected by NR and 4 different media were tested for susceptibility test. The bacterial isolates were exposed to ultra violet (UV) light for different period

  16. Aldose reductase inhibition improves nerve conduction velocity in diabetic patients.

    Science.gov (United States)

    Judzewitsch, R G; Jaspan, J B; Polonsky, K S; Weinberg, C R; Halter, J B; Halar, E; Pfeifer, M A; Vukadinovic, C; Bernstein, L; Schneider, M; Liang, K Y; Gabbay, K H; Rubenstein, A H; Porte, D

    1983-01-20

    To assess the potential role of polyol-pathway activity in diabetic neuropathy, we measured the effects of sorbinil--a potent inhibitor of the key polyol-pathway enzyme aldose reductase--on nerve conduction velocity in 39 stable diabetics in a randomized, double-blind, cross-over trial. During nine weeks of treatment with sorbinil (250 mg per day), nerve conduction velocity was greater than during a nine-week placebo period for all three nerves tested: the peroneal motor nerve (mean increase [+/- S.E.M.], 0.70 +/- 0.24 m per second, P less than 0.008), the median motor nerve (mean increase, 0.66 +/- 0.27, P less than 0.005), and the median sensory nerve (mean increase, 1.16 +/- 0.50, P less than 0.035). Conduction velocity for all three nerves declined significantly within three weeks after cessation of the drug. These effects of sorbinil were not related to glycemic control, which was constant during the study. Although the effect of sorbinil in improving nerve conduction velocity in diabetics was small, the findings suggest that polyol-pathway activity contributes to slowed nerve conduction in diabetics. The clinical applicability of these observations remains to be determined, but they encourage further exploration of this approach to the treatment or prevention of diabetic neuropathy. PMID:6401351

  17. Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice.

    Science.gov (United States)

    Hovatta, Iiris; Tennant, Richard S; Helton, Robert; Marr, Robert A; Singer, Oded; Redwine, Jeffrey M; Ellison, Julie A; Schadt, Eric E; Verma, Inder M; Lockhart, David J; Barlow, Carrolee

    2005-12-01

    Anxiety and fear are normal emotional responses to threatening situations. In human anxiety disorders--such as panic disorder, obsessive-compulsive disorder, post-traumatic stress disorder, social phobia, specific phobias and generalized anxiety disorder--these responses are exaggerated. The molecular mechanisms involved in the regulation of normal and pathological anxiety are mostly unknown. However, the availability of different inbred strains of mice offers an excellent model system in which to study the genetics of certain behavioural phenotypes. Here we report, using a combination of behavioural analysis of six inbred mouse strains with quantitative gene expression profiling of several brain regions, the identification of 17 genes with expression patterns that correlate with anxiety-like behavioural phenotypes. To determine if two of the genes, glyoxalase 1 and glutathione reductase 1, have a causal role in the genesis of anxiety, we performed genetic manipulation using lentivirus-mediated gene transfer. Local overexpression of these genes in the mouse brain resulted in increased anxiety-like behaviour, while local inhibition of glyoxalase 1 expression by RNA interference decreased the anxiety-like behaviour. Both of these genes are involved in oxidative stress metabolism, linking this pathway with anxiety-related behaviour. PMID:16244648

  18. Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha-reductase.

    OpenAIRE

    George, F W; Russell, D.W.; Wilson, J. D.

    1991-01-01

    Dihydrotestosterone, the primary mediator of prostate growth, is synthesized in target tissues from the circulating androgen testosterone through the action of steroid 5 alpha-reductase (EC 1.3.99.5). The expression of 5 alpha-reductase and the level of 5 alpha-reductase messenger RNA in rat ventral prostate are regulated by androgens. To determine whether this control is mediated by dihydrotestosterone or testosterone, we investigated the effect of finasteride, a potent inhibitor of steroid ...

  19. Nitrite and Nitrous Oxide Reductase Regulation by Nitrogen Oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106

    OpenAIRE

    Sabaty, Monique; Schwintner, Carole; Cahors, Sandrine; Richaud, Pierre; Verméglio, Andre

    1999-01-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N2O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored b...

  20. Structure-function of human 3 alpha-hydroxysteroid dehydrogenases: genes and proteins.

    Science.gov (United States)

    Penning, T M; Jin, Y; Steckelbroeck, S; Lanisnik Rizner, T; Lewis, M

    2004-02-27

    Four soluble human 3 alpha-hydroxysteroid dehydrogenase (HSD) isoforms exist which are aldo-keto reductase (AKR) superfamily members. They share 86% sequence identity and correspond to: AKR1C1 (20 alpha(3 alpha)-HSD); AKR1C2 (type 3 3 alpha-HSD and bile-acid binding protein); AKR1C3 (type 2 3 alpha-HSD and type 5 17 beta-HSD); and AKR1C4 (type 1 3 alpha-HSD). Each of the homogeneous recombinant enzymes are plastic and display 3-, 17- and 20-ketosteroid reductase and 3 alpha- 17 beta- and 20 alpha-hydroxysteroid oxidase activities with different k(cat)/K(m) ratios in vitro. The crystal structure of the AKR1C2.NADP(+).ursodeoxycholate complex provides an explanation for this functional plasticity. Ursodeoxycholate is bound backwards (D-ring in the A-ring position) and upside down (beta-face of steroid inverted) relative to the position of 3-ketosteroids in the related rat liver 3 alpha-HSD (AKR1C9) structure. Transient transfection indicates that in COS-1 cells, AKR1C enzymes function as ketosteroid reductases due to potent inhibition of their oxidase activity by NADPH. By acting as ketosteroid reductases they may regulate the occupancy of the androgen, estrogen and progesterone receptors. RT-PCR showed that AKRs are discretely localized. AKR1C4 is virtually liver specific, while AKR1C2 and AKR1C3 are dominantly expressed in prostate and mammary gland. AKR1C genes are highly conserved in structure and may be transcriptionally regulated by steroid hormones and stress. PMID:15026176

  1. Methylenetetrahydrofolate reductase gene polymorphism in Indian stroke patients

    Directory of Open Access Journals (Sweden)

    Kalita J

    2006-01-01

    Full Text Available Background and Aims: In view of the prevailing controversy about the role of Methylenetetrahydrofolate reductase (MTHFR C677T mutation in stroke and paucity of studies from India, this study has been undertaken to evaluate MTHFR C677T gene polymorphism in consecutive ischemic stroke patients and correlate these with folic acid, homocysteine (Hcy and conventional risk factors. Settings and Design: Ischemic stroke patients prospectively evaluated in a tertiary care teaching hospital. Materials and Methods: Computerized tomography proven ischemic stroke patients were prospectively evaluated including clinical, family history of stroke, dietary habits and addictions. Their fasting and postprandial blood sugar, lipid profile, vitamin B12, folic acid and MTHFR gene analysis were done. Statistical Analysis: MTHFR gene polymorphism was correlated with serum folic acid, Vitamin B12 and Hcy levels; family history of stroke in first-degree relatives; and dietary habits; employing Chi-square test. Results: There were 58 patients with ischemic stroke, whose mean age was 50 (4-79 years; among them, 10 were females. MTHFR gene polymorphism was present in 19 (32.8% patients, 3 were homozygous and 16 were heterozygous. Both serum folate and B12 levels were low in 29 (50% patients and Hcy in 48 (83%. Hypertension was present in 28 (48% patients, diabetes in 12 (21%, hyperlipidemia in 52 (90%, smoking in 17 (29%, obesity in 1 (1.7% and family history of stroke in first-degree relatives in 13 (22.4%. There was no significant relationship of MTHFR gene polymorphism with folic acid, B12, Hcy levels, dietary habits and number of risk factors. Vitamin B12 level was low in vegetarians ( P Conclusion: MTHFR gene polymorphism was found in one-third of patients with ischemic stroke and was insignificantly associated with higher frequency of elevated Hcy.

  2. Metabolism of bupropion by carbonyl reductases in liver and intestine.

    Science.gov (United States)

    Connarn, Jamie N; Zhang, Xinyuan; Babiskin, Andrew; Sun, Duxin

    2015-07-01

    Bupropion's metabolism and the formation of hydroxybupropion in the liver by cytochrome P450 2B6 (CYP2B6) has been extensively studied; however, the metabolism and formation of erythro/threohydrobupropion in the liver and intestine by carbonyl reductases (CR) has not been well characterized. The purpose of this investigation was to compare the relative contribution of the two metabolism pathways of bupropion (by CYP2B6 and CR) in the subcellular fractions of liver and intestine and to identify the CRs responsible for erythro/threohydrobupropion formation in the liver and the intestine. The results showed that the liver microsome generated the highest amount of hydroxybupropion (Vmax = 131 pmol/min per milligram, Km = 87 μM). In addition, liver microsome and S9 fractions formed similar levels of threohydrobupropion by CR (Vmax = 98-99 pmol/min per milligram and Km = 186-265 μM). Interestingly, the liver has similar capability to form hydroxybupropion (by CYP2B6) and threohydrobupropion (by CR). In contrast, none of the intestinal fractions generate hydroxybupropion, suggesting that the intestine does not have CYP2B6 available for metabolism of bupropion. However, intestinal S9 fraction formed threohydrobupropion to the extent of 25% of the amount of threohydrobupropion formed by liver S9 fraction. Enzyme inhibition and Western blots identified that 11β-dehydrogenase isozyme 1 in the liver microsome fraction is mainly responsible for the formation of threohydrobupropion, and in the intestine AKR7 may be responsible for the same metabolite formation. These quantitative comparisons of bupropion metabolism by CR in the liver and intestine may provide new insight into its efficacy and side effects with respect to these metabolites. PMID:25904761

  3. Short-chain dehydrogenases/reductases in cyanobacteria.

    Science.gov (United States)

    Kramm, Anneke; Kisiela, Michael; Schulz, Rüdiger; Maser, Edmund

    2012-03-01

    The short-chain dehydrogenases/reductases (SDRs) represent a large superfamily of enzymes, most of which are NAD(H)-dependent or NADP(H)-dependent oxidoreductases. They display a wide substrate spectrum, including steroids, alcohols, sugars, aromatic compounds, and xenobiotics. On the basis of characteristic sequence motifs, the SDRs are subdivided into two main (classical and extended) and three smaller (divergent, intermediate, and complex) families. Despite low residue identities in pairwise comparisons, the three-dimensional structure among the SDRs is conserved and shows a typical Rossmann fold. Here, we used a bioinformatics approach to determine whether and which SDRs are present in cyanobacteria, microorganisms that played an important role in our ecosystem as the first oxygen producers. Cyanobacterial SDRs could indeed be identified, and were clustered according to the SDR classification system. Furthermore, because of the early availability of its genome sequence and the easy application of transformation methods, Synechocystis sp. PCC 6803, one of the most important cyanobacterial strains, was chosen as the model organism for this phylum. Synechocystis sp. SDRs were further analysed with bioinformatics tools, such as hidden Markov models (HMMs). It became evident that several cyanobacterial SDRs show remarkable sequence identities with SDRs in other organisms. These so-called 'homologous' proteins exist in plants, model organisms such as Drosophila melanogaster and Caenorhabditis  elegans, and even in humans. As sequence identities of up to 60% were found between Synechocystis and humans, it was concluded that SDRs seemed to have been well conserved during evolution, even after dramatic terrestrial changes such as the conversion of the early reducing atmosphere to an oxidizing one by cyanobacteria. PMID:22251568

  4. Expression of 5α-Reductase Type 2 Gene in Human Testis, Epididymis and Vas Deferens

    Institute of Scientific and Technical Information of China (English)

    刘德瑜; 吴燕婉; 罗宏志; 张桂元

    2002-01-01

    Objectives To study the expression pattern of 5α-reductase type 2 gene in human malereproductive organsMethods The expression level of 5α-reductase type 2 gene inhuman testis, epididymisand vas deferens tissues was determined by in situ hybridization using Digoxin labeled5α-reductase type 2 cRNA probe.Results The brown granules of hybridizing signals distributed in the cytoplasm ofSertoli and Leydig cells of the testis, the principle cells of epididymis and the epithe-lial cells of vas deferens, but there was no positive signal in the nuclei of above-men-tioned cells. No positive signal was observed in germ cells, basement of the testis,interstium of epididymis and basement, as well as smooth muscle of vas deferens.Conclusion This study confirmed that the 5α-reductase type 2 gene expressed in Ser-toli, Leydig cells of the testis, and the principle cells of epididymis. The expressionpattern of the gene in these cells in human was similar to that of rat and monkey. Thepresence of 5a-reductase type 2 gene in epithelial cells of the vas deferens suggested itmight possess an important physiological role in human reproduction.

  5. Pseudomonas stutzeri N2O reductase contains CuA-type sites

    International Nuclear Information System (INIS)

    N2O reductase (N2O → N2) is the terminal enzyme in the energy-conserving denitrification pathway of soil and marine denitrifying bacteria. The protein is composed of two identical subunits and contains eight copper ions per enzyme molecule. The magnetic circular dichroism spectrum of resting (oxidized) N2O reductase is strikingly similar to the magnetic circular dichroism spectrum of the CuA site in mammalian cytochrome c oxidase and is unlike the magnetic circular dichroism spectra of all other biological copper chromophores obtained to data. Sulfur (or chlorine) scatterers are required to fit the copper extended x-ray absorption fine structure data of both the oxidized and reduced forms of N2O reductase. Satisfactory fits require a Cu-N or Cu-O interaction at 2.0 angstrom, a Cu-(S, Cl) interaction at 2.3 angstrom and an additional Cu-(S, Cl) interaction at ∼ 2.6 angstrom (oxidized) or ∼ 2.7 angstrom (reduced). Comparison of the N2O reductase sequence, determined by translating the structural NosZ gene, with cytochrome c oxidase subunit II sequences from several sources indicates that a Gly-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Ser-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-His stretch if high conserved. This sequence contains three of the probable ligands in a CuA-type site Collectively these data establish that Pseudomonas stutzeri N2O reductase contains CuA-type sites

  6. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    Directory of Open Access Journals (Sweden)

    M. T. Goodarzi

    2006-05-01

    Full Text Available Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that received water,quercetin and naringin, respectively. The fourth, fifth and sixth groups were streptozocin-induced diabetic rats that received water, quercetin and naringin, respectively. These rats were fed orally in a definite dose from each substance for 12 days. After this period rats were scarified and their lenses were separated and homogenized. The activity of aldose reductase was measured in each homogenized sample separately. The effect of feeding of these substances in blood sugar was also determined. Aldose reductase activity was reduced 73 and 69 percent in diabetic rats fed by quercetin and naringin, respectively, and the difference compared to control group was significant. In healthy rats this reduction was 63 and 59 percent, respectively, and the difference was significant compared to those who did not receive flavonoids. It was concluded that these substances were effective in reduction of aldose reductase activity in vivo and consequently could delay the progress of cataract.

  7. Current status of 5α-reductase inhibitors in the treatment of benign hyperplasia of prostate

    Directory of Open Access Journals (Sweden)

    Kumar Vijay

    2008-04-01

    Full Text Available Benign prostatic hyperplasia (BPH is a common problem in aging men, which is associated with lower urinary tract symptoms. This condition is dependent on the presence of androgens for its progression, and medical therapy is the first-line treatment for BPH patients with moderate-to-severe symptoms and includes the use of either alpha 1-adrenergic blockers or 5α-reductase inhibitors. Adrenergic blocking drugs reduce the dynamic component while the 5α-reductase inhibitors reduce the static component of bladder outlet obstruction in BPH. By inhibiting the generation of active form of testosterone, viz., dihydrotestosterone, the 5α-reductase inhibitors not only reduce the symptoms of BPH but also decrease the need for surgery and further progression of BPH. Besides, prolonged use of combination of 5α-reductase inhibitors and alpha 1-adrenergic blockers has been found to be more beneficial than either of the two drugs given alone. This review gives a brief account of rationale and efficacy of treatment by 5α-reductase inhibitors in the management of BPH.

  8. Structural and biochemical properties of cloned and expressed human and rat steroid 5α-reductases

    International Nuclear Information System (INIS)

    The microsomal enzyme steroid 5α-reductase is responsible for the conversion of testosterone into the more potent androgen dihydrotestosterone. In man, this steroid acts on a variety of androgen-responsive target tissues to mediate such diverse endocrine processes as male sexual differentiation in the fetus and prostatic growth in men. Here we describe the isolation, structure, and expression of a cDNA encoding the human steroid 5α-reductase. A rat cDNA was used as a hybridization probe to screen a human prostate cDNA library. A 2.1-kilobase cDNA was identified and DNA sequence analysis indicated that the human steroid 5α-reductase was a hydrophobic protein of 259 amino acids with a predicted molecular weight of 29,462. A comparison of the human and rat protein sequences revealed a 60% identity. Transfection of expression vectors containing the human and rat cDNAs into simian COS cells resulted in the synthesis of high levels of steroid 5α-reductase enzyme activity. Both enzymes expressed in COS cells showed similar substrate specificities for naturally occurring steroid hormones. However, synthetic 4-azasteroids demonstrated marked differences in their abilities to inhibit the human and rat steroid 5α-reductases

  9. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2.

    Science.gov (United States)

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-09-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRNA, dramatically decreased the serum-stimulated RNR activity. Moreover, p53R2 siRNA, but not R2 siRNA, significantly inhibits serum-stimulated RNR activity, indicating that p53R2 is specifically regulated by a MEK2-dependent pathway. Co-immunoprecipitation analyses revealed that the MEK2 segment comprising amino acids 65-171 is critical for p53R2-MEK2 interaction, and the binding domain of MEK2 is required for MEK2-mediated increased RNR activity. Phosphorylation of MEK1/2 was greatly augmented by ionizing radiation, and RNR activity was concurrently increased. Ionizing radiation-induced RNR activity was markedly attenuated by transfection of MEK2 or p53R2 siRNA, but not R2 siRNA. These data show that MEK2 is an endogenous regulator of p53R2 and suggest that MEK2 may associate with p53R2 and upregulate its activity. PMID:22895183

  10. Discovery and characterization of a xylose reductase from Zymomonas mobilis ZM4.

    Science.gov (United States)

    Agrawal, Manoj; Chen, Rachel Ruizhen

    2011-11-01

    Formation of xylitol, a byproduct from xylose fermentation, is a major limiting factor in ethanol production from xylose in engineered Zymomonas strains, yet the postulated xylose reductase remains elusive. We report here the discovery of xylose reductase in Zymomonas mobilis and, for the first time, to associate the enzyme function with its gene. Besides xylose and xylulose, the enzyme was active towards benzaldehyde, furfural, 5-hydroxymethyl furfural, and acetaldehyde, exhibiting nearly 150-times higher affinity with benzaldehyde than xylose. The discovery of xylose reductase paves the way for further improvement of xylose fermentation in Z. mobilis. The enzyme may also be used to mitigate toxicity of furfural and other inhibitors from plant biomass. PMID:21720846

  11. Biochemical predetermination of the NO synthase and nitrite reductase components of the nitric oxide cycle.

    Science.gov (United States)

    Reutov, V P

    1999-05-01

    This review presents some aspects of a concept of cellular evolution bearing a relationship to nitrate--nitrite respiration, the endosymbiosis theory, and the origin of NO synthase and nitrite reductase activity in heme-containing proteins. Analysis of structural and functional unity of the NO synthase and nitrite reductase systems suggests that these systems did not arise without any relation to evolutionarily ancient energetic systems of cells. The use of symmetry principles reveals commonalities among many electron transport chains which in the language of physics is called "invariance". This work also comparatively analyzes the nitric oxide cycle and the known nitrogen cycle. The ideas about evolution of the NO synthase and nitrite reductase systems developed here are clearly compatible with the endosymbiotic theory and the hypothesis that nitrate--nitrite respiration was a precursor of oxygen-dependent respiration. PMID:10381613

  12. Crystallization and preliminary X-ray crystallographic studies of pig heart carbonyl reductase

    International Nuclear Information System (INIS)

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P42, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P41212, with unit-cell parameters a = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution

  13. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    Energy Technology Data Exchange (ETDEWEB)

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  14. Alpha 1-blockers vs 5 alpha-reductase inhibitors in benign prostatic hyperplasia. A comparative review

    DEFF Research Database (Denmark)

    Andersen, J T

    1995-01-01

    During recent years, pharmacological treatment of symptomatic benign prostatic hyperplasia (BPH) has become the primary treatment choice for an increasing number of patients. The 2 principal drug classes employed are alpha 1-blockers and 5 alpha-reductase inhibitors. Current information from...... patients who will respond well to alpha 1-blockers have yet to be identified, and data concerning the long term effects of these drugs are not yet available. 5 alpha-Reductase inhibitors have a slow onset of effect, but treatment leads to improvement in symptoms, reduction of the size of the prostate gland...... and improvement in objective parameters for bladder outflow obstruction. Approximately 30 to 50% of patients will respond to treatment with 5 alpha-reductase inhibitors. The definitive role of pharmacological treatment in symptomatic BPH remains to be established, although it seems that patients unfit...

  15. Characterisation of a desmosterol reductase involved in phytosterol dealkylation in the silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Leonora F Ciufo

    Full Text Available Most species of invertebrate animals cannot synthesise sterols de novo and many that feed on plants dealkylate phytosterols (mostly C(29 and C(28 yielding cholesterol (C(27. The final step of this dealkylation pathway involves desmosterol reductase (DHCR24-catalysed reduction of desmosterol to cholesterol. We now report the molecular characterisation in the silkworm, Bombyx mori, of such a desmosterol reductase involved in production of cholesterol from phytosterol, rather than in de novo synthesis of cholesterol. Phylogenomic analysis of putative desmosterol reductases revealed the occurrence of various clades that allowed for the identification of a strong reductase candidate gene in Bombyx mori (BGIBMGA 005735. Following PCR-based cloning of the cDNA (1.6 kb and its heterologous expression in Saccharomyces cerevisae, the recombinant protein catalysed reduction of desmosterol to cholesterol in an NADH- and FAD-dependent reaction.Conceptual translation of the cDNA, that encodes a 58.9 kDa protein, and database searching, revealed that the enzyme belongs to an FAD-dependent oxidoreductase family. Western blotting revealed reductase protein expression exclusively in the microsomal subcellular fraction and primarily in the gut. The protein is peripherally associated with microsomal membranes. 2D-native gel and PAGE analysis revealed that the reductase is part of a large complex with molecular weight approximately 250 kDa. The protein occurs in midgut microsomes at a fairly constant level throughout development in the last two instars, but is drastically reduced during the wandering stage in preparation for metamorphosis. Putative Broad Complex transcription factor-binding sites detectable upstream of the DHCR24 gene may play a role in this down-regulation.

  16. Aldose reductase inhibition prevents metaplasia of airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Umesh C S Yadav

    Full Text Available BACKGROUND: Goblet cell metaplasia that causes mucus hypersecretion and obstruction in the airway lumen could be life threatening in asthma and chronic obstructive pulmonary disease patients. Inflammatory cytokines such as IL-13 mediate the transformation of airway ciliary epithelial cells to mucin-secreting goblet cells in acute as well as chronic airway inflammatory diseases. However, no effective and specific pharmacologic treatment is currently available. Here, we investigated the mechanisms by which aldose reductase (AR regulates the mucus cell metaplasia in vitro and in vivo. METHODOLOGY/FINDINGS: Metaplasia in primary human small airway epithelial cells (SAEC was induced by a Th2 cytokine, IL-13, without or with AR inhibitor, fidarestat. After 48 h of incubation with IL-13 a large number of SAEC were transformed into goblet cells as determined by periodic acid-schiff (PAS-staining and immunohistochemistry using antibodies against Mucin5AC. Further, IL-13 significantly increased the expression of Mucin5AC at mRNA and protein levels. These changes were significantly prevented by treatment of the SAEC with AR inhibitor. AR inhibition also decreased IL-13-induced expression of Muc5AC, Muc5B, and SPDEF, and phosphorylation of JAK-1, ERK1/2 and STAT-6. In a mouse model of ragweed pollen extract (RWE-induced allergic asthma treatment with fidarestat prevented the expression of IL-13, phosphorylation of STAT-6 and transformation of epithelial cells to goblet cells in the lung. Additionally, while the AR-null mice were resistant, wild-type mice showed goblet cell metaplasia after challenge with RWE. CONCLUSIONS: The results show that exposure of SAEC to IL-13 caused goblet cell metaplasia, which was significantly prevented by AR inhibition. Administration of fidarestat to mice prevented RWE-induced goblet cell metaplasia and AR null mice were largely resistant to allergen induced changes in the lung. Thus our results indicate that AR inhibitors

  17. GENERATION OF THE GLYCYL RADICAL OF THE ANAEROBIC ESCHERICHIA-COLI RIBONUCLEOTIDE REDUCTASE REQUIRES A SPECIFIC ACTIVATING ENZYME

    NARCIS (Netherlands)

    SUN, XY; ELIASSON, R; PONTIS, E; ANDERSSON, J; BUIST, G; SJOBERG, BM; REICHARD, P

    1995-01-01

    The anaerobic ribonucleotide reductase from Escherichia coli contains a glycyl radical as part of its polypeptide structure. The radical is generated by an enzyme system present in E. coli. The reductase is coded for by the nrdD gene located at 96 min. Immediately downstream, we now find an open rea

  18. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae

    Science.gov (United States)

    Aldehyde reductase gene ARI1 is a recently characterized member of intermediate subfamily under SDR (short-chain dehydrogenase/reductase) superfamily that revealed mechanisms of in situ detoxification of furfural and HMF for tolerance of Saccharomyces cerevisiae. Uncharacterized open reading frames ...

  19. Feedback regulation of cholesterol synthesis:sterol-accelerated ubiquitination and degradation of HMG CoA reductase

    Institute of Scientific and Technical Information of China (English)

    Russell A DeBose-Boyd

    2008-01-01

    3Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase produces mevalonate,an important intermediate in the synthesis of cholesterol and essential nonsterol isoprenoids.The reductase is subject to an exorbitant amount of feedback control through multiple mechanisms that are mediated by sterol and nonsterol end-products of mevalonate metabolism.Here,Ⅰwill discuss recent advances that shed light on one mechanism for control of reductase,which involves rapid degradation of the enzyme.Accumulation of certain sterols triggers binding of reductase to endoplasmic reticulum (ER) membrane proteins called Insig-1 and Insig-2.Reductase-Insig binding results in recruitment of a membrane-associated ubiquitin ligase called gp78,which initiates ubiquitination of reductase.This ubiquitination is an obligatory reaction for recognition and degradation of reductase from ER membranes by cytosolic 26S proteasomes.Thus,sterol-accelerated degradation of reductase represents an example of how a general cellular process (ER-associated degradation) is used to control an important metabolic pathway (cholesterol synthesis).

  20. Multiple Types of 8-Vinyl Reductases for (Bacterio)Chlorophyll Biosynthesis Occur in Many Green Sulfur Bacteria ▿

    OpenAIRE

    Liu, Zhenfeng; Bryant, Donald A.

    2011-01-01

    Two 8-vinyl reductases, BciA and BciB, have been identified in chlorophototrophs. The bciA gene of Chlorobaculum tepidum was replaced with genes similar to bciB from other green sulfur bacteria. Pigment analyses of the complemented strains showed that the bciB homologs encode 8-vinyl reductases similar to those of cyanobacteria.

  1. Studies on some characteristics of nitrate reductase from sugar beet (Beta vulgaris L.)leaves

    Institute of Scientific and Technical Information of China (English)

    LiWenhua; YanGuiping; 等

    1994-01-01

    Some characteristics of nitrate reductase from sugar beet leaves shown in this paper were as follows:The nitrate reductase from sugar beet leaves required NADH as an electron donor.Accordingly,the nitrate reductase was classified as NADH-dependent(E.C.1.6.61).The Km value of the nitrate reductase for NADH and NO3- were 0.86m mol and 0.18μ mol respectively.The optimum pH in reaction mixture solution for nitrate reduction activity was 7.5.The effect of variable concentrations of inorganic phosphorus in the reaction buffer on nitrate reductase activity was investigated.When the inorganic phosphorus concentration was below 35m mol,the nitrate reductase activity was increased with increase of inorganic phosphorus concentration.Conversely,when the inorganic phosphorus concentration was over 35m mol,the nitrate reductase activity was inhibited.The nitrate reductase activity assayed in vitro was 3.2 and 5.6times of that assayed in vivo under the condition of exogenous and endogenous ground substance respectively.

  2. The role of 5'-adenylylsulfate reductase in the sulfur assimilation pathway of soybean: molecular cloning, kinetic characterization, and gene expression

    Science.gov (United States)

    Soybean seeds are a major source of protein, but contain low levels of sulfur-containing amino acids. With the objective of studying the sulfur assimilation pathway of soybean, a full-length cDNA clone for 5’-adenylylsulfate reductase (APS reductase) was isolated and characterized. The cDNA clone ...

  3. Inverse relationship between age-dependent erythrocyte activity of methaemoglobin reductase and prilocaine-induced methaemoglobinaemia during infancy

    DEFF Research Database (Denmark)

    Nilsson, A; Engberg, G; Henneberg, S; Danielson, K; De Verdier, C H

    1990-01-01

    concentrations of local anaesthetics were low (maximum values: prilocaine 78 ng ml-1, lignocaine 412 ng ml-1). The activity of erythrocyte MetHb reductase (cytochrome b5 reductase) was analysed. Data from a previously studied group of infants aged 3-12 months were included also. Enzyme activity did not reach...

  4. Identification of the bchP gene, encoding geranylgeranyl reductase in Chlorobaculum tepidum

    DEFF Research Database (Denmark)

    Gomez Maqueo Chew, Aline; Frigaard, Niels-Ulrik; Bryant, Donald A

    2008-01-01

    The Chlorobaculum tepidum genome contains two paralogous genes, CT2256 and CT1232, whose products are members of the FixC dehydrogenase superfamily and have sequence similarity to geranylgeranyl reductases. Each gene was insertionally inactivated, and the resulting mutants were characterized. CT2......2256 encodes geranylgeranyl reductase (BchP); CT1232 is not involved in bacteriochlorophyll or chlorophyll biosynthesis....

  5. Synthesis and degradation of nitrate reductase during the cell cycle of Chlorella sorokiniana

    Science.gov (United States)

    Velasco, P. J.; Tischner, R.; Huffaker, R. C.; Whitaker, J. R.

    1989-01-01

    Studies on the diurnal variations of nitrate reductase (NR) activity during the life cycle of synchronized Chlorella sorokiniana cells grown with a 7:5 light-dark cycle showed that the NADH:NR activity, as well as the NR partial activities NADH:cytochrome c reductase and reduced methyl viologen:NR, closely paralleled the appearance and disappearance of NR protein as shown by sodium dodecyl sulfate gel electrophoresis and immunoblots. Results of pulse-labeling experiments with [35S]methionine further confirmed that diurnal variations of the enzyme activities can be entirely accounted for by the concomitant synthesis and degradation of the NR protein.

  6. Affinity purifications of aldose reductase and xylitol dehydrogenase from the xylose-fermenting yeast Pachysolen tannophilus

    Energy Technology Data Exchange (ETDEWEB)

    Bolen, P.L.; Roth, K.A.; Freer, S.N.

    1986-10-01

    Although xylose is a major product of hydrolysis of lignocellulosic materials, few yeasts are able to convert it to ethanol. In Pachysolen tannophilus, one of the few xylose-fermenting yeasts found, aldose reductase and xylitol dehydrogenase were found to be key enzymes in the metabolic pathway for xylose fermentation. This paper presents a method for the rapid and simultaneous purification of both aldose reductase and xylitol dehydrogenase from P. tannophilus. Preliminary studies indicate that this method may be easily adapted to purify similar enzymes from other xylose-fermenting yeasts.

  7. Glyphosate inhibition of ferric reductase activity in iron deficient sunflower roots

    OpenAIRE

    Öztürk, Levent; Ozturk, Levent; Yazıcı, Mustafa Atilla; Yazici, Mustafa Atilla; Eker, Selim; Gökmen, Özay Özgür; Gokmen, Ozay Ozgur; Römheld, Volker; Romheld, Volker; ÇAKMAK, İsmail; Cakmak, Ismail

    2007-01-01

    Iron (Fe) deficiency is increasingly being observed in cropping systems with frequent glyphosate applications. A likely reason for this is that glyphosate interferes with root uptake of Fe by inhibiting ferric reductase in roots required for Fe acquisition by dicot and nongrass species. This study investigated the role of drift rates of glyphosate (0.32, 0.95 or 1.89 mM glyphosate corresponding to 1, 3 and 6% of the recommended herbicidal dose, respectively) on ferric reductase activity of...

  8. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.

    Science.gov (United States)

    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J

    1996-12-15

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  9. Properties of a Thermostable Nitrate Reductase from the Hyperthermophilic Archaeon Pyrobaculum aerophilum

    OpenAIRE

    Afshar, Sepideh; Johnson, Eric; de Vries, Simon; Schröder, Imke

    2001-01-01

    The nitrate reductase of the hyperthermophilic archaeon Pyrobaculum aerophilum was purified 137-fold from the cytoplasmic membrane. Based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis, the enzyme complex consists of three subunits with apparent molecular weights of 130,000, 52,000, and 32,000. The enzyme contained molybdenum (0.8-mol/mol complex), iron (15.4-mol/mol complex) and cytochrome b (0.49-mol/mol complex) as cofactors. The P. aerophilum nitrate reductase disti...

  10. Imaging the activity of nitrate reductase by means of a scanning electrochemical microscope.

    Science.gov (United States)

    Zaumseil, J; Wittstock, G; Bahrs, S; Steinrücke, P

    2000-06-01

    Scanning electrochemical microscopy (SECM) was used to characterize immobilized nitrate reductase (NaR) from Pseudonomonas stutzeri (E.C. 1.7.99.4). Nitrate reductase with membrane fragment was embedded in a polyurethane hydrogel in a capillary and solubilized NaR without membrane fragment was covalently coupled to a diaminoethyl-cellulose-carbamitate film on glass. After systematic studies of possible mediators, SECM feedback imaging of both forms of immobilized NaR was accomplished with methylviologen as redox mediator. PMID:11225859

  11. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Alessandro S.; Ferrarezi, Thiago [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil); Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A. [Facultad de Ciencias Bioquímicas y Farmacéuticas, Molecular Biology Division, Instituto de Biología Molecular y Celular de Rosario (IBR), CONICET, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario (Argentina); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil)

    2006-07-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP{sup +} reductase. Ferredoxin-NADP{sup +} reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source.

  12. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    International Nuclear Information System (INIS)

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP+ reductase. Ferredoxin-NADP+ reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source

  13. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

    OpenAIRE

    Trigoso, Yvonne D.; Russell C Evans; Karsten, William E.; Lilian Chooback

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to i...

  14. Pinpointing a Mechanistic Switch Between Ketoreduction and “Ene” Reduction in Short‐Chain Dehydrogenases/Reductases

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M.; Toogood, Helen S.

    2016-01-01

    Abstract Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (−)‐menthone:(−)‐menthol reductase and (−)‐menthone:(+)‐neomenthol reductase, and the “ene” reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue‐swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β‐unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  15. Isolation, modification, and aldose reductase inhibitory activity of rosmarinic acid derivatives from the roots of Salvia grandifolia.

    Science.gov (United States)

    Kang, Jie; Tang, Yanbo; Liu, Quan; Guo, Nan; Zhang, Jian; Xiao, Zhiyan; Chen, Ruoyun; Shen, Zhufang

    2016-07-01

    To find aldose reductase inhibitors, two previously unreported compounds, grandifolias H and I, and five known compounds, including rosmarinic acid and rosmarinic acid derivatives, were isolated from the roots of Salvia grandifolia. A series of rosmarinic acid derivatives was obtained from rosmarinic acid using simple synthetic methods. The aldose reductase inhibitory activity of the isolated and synthesized compounds was assessed. Seven of the tested compounds showed moderate aldose reductase inhibition (IC50=0.06-0.30μM). The structure-activity relationship of aldose reductase inhibitory activity of rosmarinic acid derivatives was discussed for the first time. This study provided useful information that will facilitate the development of aldose reductase inhibitors. PMID:27233987

  16. Protective role of glutathione reductase in paraquat induced neurotoxicity.

    Science.gov (United States)

    Djukic, Mirjana M; Jovanovic, Marina D; Ninkovic, Milica; Stevanovic, Ivana; Ilic, Katarina; Curcic, Marijana; Vekic, Jelena

    2012-08-30

    Paraquat (PQ), a widely used herbicide is a well-known free radical producing agent. The mechanistic pathways of PQ neurotoxicity were examined by assessing oxidative/nitrosative stress markers. Focus was on the role of glutathione (GSH) cycle and to examine whether the pre-treatment with enzyme glutathione reductase (GR) could protect the vulnerable brain regions (VBRs) against harmful oxidative effect of PQ. The study was conducted on Wistar rats, randomly divided in five groups: intact-control group, (n = 8) and four experimental groups (n = 24). All tested compounds were administered intrastriatally (i.s.) in one single dose. The following parameters of oxidative status were measured in the striatum, hippocampus and cortex, at 30 min, 24 h and 7 days post treatment: superoxide anion radical (O₂·⁻), nitrate (NO₃⁻), malondialdehyde (MDA), superoxide dismutase (SOD), total GSH (tGSH) and its oxidized, disulfide form (GSSG) and glutathione peroxidase (GPx). Results obtained from the intact and the sham operated groups were not statistically different, confirming that invasive i.s. route of administration would not influence the reliability of results. Also, similar pattern of changes were observed between ipsi- and contra- lateral side of examined VBRs, indicating rapid spatial spreading of oxidative stress. Mortality of the animals (10%), within 24h, along with symptoms of Parkinsonism, after awakening from anesthesia for 2-3 h, were observed in the PQ group, only. Increased levels of O₂·⁻, NO₃⁻ and MDA, increased ratio of GSSG/GSH and considerably high activity of GPx were measured at 30 min after the treatment. Cytotoxic effect of PQ was documented by drastic drop of all measured parameters and extremely high peak of the ratio GSSG/GSH at 24th hrs after the PQ i.s. injection. In the GR+PQ group, markedly low activity of GPx and low content of NO₃⁻ (in striatum and cortex) were measured during whole experiment, while increase value was

  17. Identification and characterization of an inborn error of metabolism caused by dihydrofolate reductase deficiency

    NARCIS (Netherlands)

    Banka, S.; Blom, H.J.; Walter, J.; Aziz, M.; Urquhart, J.; Clouthier, C.M.; Rice, G.I.; Brouwer, A.P.M. de; Hilton, E.; Vassallo, G.; Will, A.; Smith, D.E.; Smulders, Y.M.; Wevers, R.A.; Steinfeld, R.; Heales, S.; Crow, Y.J.; Pelletier, J.N.; Jones, S.; Newman, W.G.

    2011-01-01

    Dihydrofolate reductase (DHFR) is a critical enzyme in folate metabolism and an important target of antineoplastic, antimicrobial, and antiinflammatory drugs. We describe three individuals from two families with a recessive inborn error of metabolism, characterized by megaloblastic anemia and/or pan

  18. Direct demonstration of genetic alterations at the dihydrofolate reductase locus after gamma irradiation.

    OpenAIRE

    Graf, L. H.; Chasin, L A

    1982-01-01

    Gamma ray-induced mutants of Chinese hamster ovary cells lacking dihydrofolate reductase activity were screened for DNA sequence changes at the locus specifying this activity by using a cloned cDNA probe. Two of nine mutants screened displayed an altered restriction fragment pattern suggesting the occurrence of DNA deletions or rearrangements.

  19. Low activity of superoxide dismutase and high activity of glutathione reductase in erythrocytes from centenarians

    DEFF Research Database (Denmark)

    Andersen, Helle Raun; Jeune, B; Nybo, H;

    1998-01-01

    aged between 60 and 79 years. MEASUREMENTS: enzyme activities of superoxide dismutase (CuZn-SOD), glutathione peroxidase, catalase and glutathione reductase (GR) in erythrocytes. Functional capacity among the centenarians was evaluated by Katz' index of activities of daily living, the Physical...

  20. A soluble 3-hydroxy-3-methylglutaryl-CoA reductase in the protozoan Trypanosoma cruzi

    DEFF Research Database (Denmark)

    Pena Diaz, Javier; Montalvetti, A; Camacho, A;

    1997-01-01

    We report the isolation and characterization of a genomic clone containing the open reading frame sequence for 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase from Trypanosoma cruzi, the causative agent of Chagas' disease. The protozoan gene encoded for a smaller polypeptide than the rest of the...

  1. Novel bacterial sulfur oxygenase reductases from bioreactors treating gold-bearing concentrates

    DEFF Research Database (Denmark)

    Chen, Z-W; Liu, Y-Y; Wu, J-F;

    2007-01-01

    The microbial community and sulfur oxygenase reductases of metagenomic DNA from bioreactors treating gold-bearing concentrates were studied by 16S rRNA library, real-time polymerase chain reaction (RT-PCR), conventional cultivation, and molecular cloning. Results indicated that major bacterial sp...... SOR gene in bioleaching reactors and Acidithiobacillus species....

  2. A Rational Approach to Identify Inhibitors of Mycobacterium tuberculosis Enoyl Acyl Carrier Protein Reductase

    Czech Academy of Sciences Publication Activity Database

    Chhabria, M. T.; Parmar, K. B.; Brahmkshatriya, Pathik

    2013-01-01

    Roč. 19, č. 21 (2013), s. 3878-3883. ISSN 1381-6128 Institutional support: RVO:61388963 Keywords : mycobacterium tuberculosis * enoyl acyl carrier protein reductase * pharmacophore modeling * molecular docking * binding interactions Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 3.288, year: 2013

  3. Relationships between nitrate uptake and nitrate reductase activity in Cucumis sativus L.

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus

    2014-02-01

    Full Text Available Anti-NR IgG fragments obtained after papain digestion of polyclonal antibodies gave the positive immunological reaction with both, a soluble and plasma membrane-bound nitrate reductase. Anti-NR antibody as well as IgG fragments almost totally inhibited the nitrate reductase activity in cytosol proving a crossreaction of antibody with the catalytic site of a soluble NR. Anti-NR IgG fragments, but not undigested polyclonal antibodies affected the activity of the nitrate reductase associated with plasma membranes. Discrepancy in the action of intact antibodies and fragments obtained after they digestion were interpreted as a consequence of same differences in the ability of those molecules to the penetration through the membrane. Undigested anti-NR antibody have no effect on the nitrate uptake by intact plants, as well as by the right-side plasma membrane vesicles. On the other hand, IgG fragments of polyclonal antibodies abolished almost totally the nitrate uptake in the case of intact seedlings, but have only slight effect on the N03 uptake in plasma membranes. On the basis of above findings, some relations between nitrate uptake and its assimilation inside the cell are suggested. Since IgG fragments only slightly changed the N03 absorption in vesicles whereas the activity of plasmalemma associated nitrate reductase was strongly repressed, we concluded that the PM-NR is not structurally involved in the nitrate transport through the membrane.

  4. Prevention of hemodynamic and vascular albumin filtration changes in diabetic rats by aldose reductase inhibitors

    International Nuclear Information System (INIS)

    This study investigated hemodynamic changes in diabetic rats and their relationship to changes in vascular albumin permeation and increased metabolism of glucose to sorbitol. The effects of 6 wk of streptozocin-induced diabetes and three structurally different inhibitors of aldose reductase were examined on (1) regional blood flow (assessed with 15-microns 85Sr-labeled microspheres) and vascular permeation by 125I-labeled bovine serum albumin (BSA) and (2) glomerular filtration rate (assessed by plasma clearance of 57Co-labeled EDTA) and urinary albumin excretion (determined by radial immunodiffusion assay). In diabetic rats, blood flow was significantly increased in ocular tissues (anterior uvea, posterior uvea, retina, and optic nerve), sciatic nerve, kidney, new granulation tissue, cecum, and brain. 125I-BSA permeation was increased in all of these tissues except brain. Glomerular filtration rate and 24-h urinary albumin excretion were increased 2- and 29-fold, respectively, in diabetic rats. All three aldose reductase inhibitors completely prevented or markedly reduced these hemodynamic and vascular filtration changes and increases in tissue sorbitol levels in the anterior uvea, posterior uvea, retina, sciatic nerve, and granulation tissue. These observations indicate that early diabetes-induced hemodynamic changes and increased vascular albumin permeation and urinary albumin excretion are aldose reductase-linked phenomena. Discordant effects of aldose reductase inhibitors on blood flow and vascular albumin permeation in some tissues suggest that increased vascular albumin permeation is not entirely attributable to hemodynamic change

  5. Purification and characterization of a novel carbonyl reductase isolated from Rhodococcus erythropolis.

    Science.gov (United States)

    Zelinski, T; Peters, J; Kula, M R

    1994-04-15

    During growth on n-tetradecane a novel NADH-dependent carbonyl reductase is induced in the Gram-positive bacterium Rhodococcus erythropolis (Peters, P., Zelinski, T. and Kula, M.R. (1992) Appl. Microbiol. Biotechnol. 38, 334-340). The enzyme has been purified to homogeneity using fractional pH precipitation, anion exchange chromatography and affinity chromatography. The isoelectric point of the oxidoreductase is 4.4. The apparent molecular mass of the native enzyme is 161 kDa, that of the subunits 40 kDa as determined by SDS gel electrophoresis. A tetrameric structure of the carbonyl reductase is consistent with these results. Important biochemical data concerning the application of the reductase are: a broad pH-optimum, temperature optimum at 40 degrees C and stability at room temperature for more than 5 days. The oxidoreductase accepted as substrate aliphatic and aromatic ketones, keto esters (esters of keto carboxylic acids) and halogenated carbonyl compounds and reduced them to the corresponding hydroxyl compounds with (S)-configuration with more than 98% enantiomeric excess. The NAD(+)-dependent oxidation of primary alcohols was not catalyzed by the carbonyl reductase, whereas secondary alcohols and hydroxy acid esters were oxidized to the corresponding carbonyl compounds at about 10-fold slower reaction rates compared to the reduction. PMID:7764739

  6. Design and synthesis of novel, conformationally restricted HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Choi, Chulho; Song, Yuntao; Trivedi, Bharat K; Larsen, Scott D; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Sekerke, Catherine; Auerbach, Bruce; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole

    2007-08-15

    Using structure-based design, a novel series of conformationally restricted, pyrrole-based inhibitors of HMG-CoA reductase were discovered. Leading analogs demonstrated potent inhibition of cholesterol synthesis in both in vitro and in vivo models and may be useful for the treatment of hypercholesterolemia and related lipid disorders. PMID:17574411

  7. Cloning and expression of Candida guilliermondii xylose reductase gene (xyl1) in Pichia pastoris.

    Science.gov (United States)

    Handumrongkul, C; Ma, D P; Silva, J L

    1998-04-01

    A xylose reductase gene (xyl1) of Candida guilliermondii ATCC 20118 was cloned and characterized. The open reading frame of xyl1 contained 954 nucleotides encoding a protein of 317 amino acids with a predicted molecular mass of 36 kDa. The derived amino acid sequence of C. guilliermondii xylose reductase was 70.4% homologous to that of Pichia stipitis. The gene was placed under the control of an alcohol oxidase promoter (AOX1) and integrated into the genome of a methylotrophic yeast, Pichia pastoris. Methanol induced the expression of the 36-kDa xylose reductase in both intracellular and secreted expression systems. The expressed enzyme preferentially utilized NADPH as a cofactor and was functional both in vitro and in vivo. The different cofactor specificity between P. pastoris and C. guilliermondii xylose reductases might be due to the difference in the numbers of histidine residues and their locations between the two proteins. The recombinant was able to ferment xylose, and the maximum xylitol accumulation (7.8 g/l) was observed when the organism was grown under aerobic conditions. PMID:9615481

  8. HMG-coenzyme A reductase inhibition, type 2 diabetes, and bodyweight

    DEFF Research Database (Denmark)

    Swerdlow, Daniel I; Preiss, David; Kuchenbaecker, Karoline B;

    2015-01-01

    BACKGROUND: Statins increase the risk of new-onset type 2 diabetes mellitus. We aimed to assess whether this increase in risk is a consequence of inhibition of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), the intended drug target. METHODS: We used single nucleotide polymorphisms in the HMGCR...

  9. Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1

    NARCIS (Netherlands)

    Mariela Serrano, L.; Molenaar, D.; Wels, M.; Teusink, B.; Bron, P.A.; Vos, W.M. de; Smid, E.J.

    2007-01-01

    ABSTRACT: BACKGROUND: Thioredoxin (TRX) is a powerful disulfide oxido-reductase that catalyzes a wide spectrum of redox reactions in the cell. The aim of this study is to elucidate the role of the TRX system in the oxidative stress response in Lactobacillus plantarum WCFS1. RESULTS: We have identifi

  10. The 5,10-methylenetetrahydrofolate reductase C677T polymorphism interacts with smoking to increase homocysteine.

    NARCIS (Netherlands)

    Brown, K.S.; Kluijtmans, L.A.J.; Young, I.S.; Murray, L.; McMaster, D.; Woodside, J.; Yarnell, J.W.; Boreham, C.A.; McNulty, H.; Strain, J.J.; McPartlin, J.; Scott, J.M.; Mitchell, L.E.; Whitehead, A.S.

    2004-01-01

    Elevated homocysteine is a risk marker for several human pathologies. Risk factors for elevated homocysteine include low folate and homozygosity for the T allele of the 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism. Because nitric oxide may inhibit folate catabolism and endothe

  11. REGULATION OF NITRATE REDUCTASE ACTIVITY IN RICE (ORYZA SATIVA L. BY GROWTH REGULATORS

    Directory of Open Access Journals (Sweden)

    S HEMALATHA

    2002-12-01

    Full Text Available The effect of three growth regulators, namely kinetin, 6 benzyl adenine, 2 chloro ethyl trimethyl ammonium chloride at three concentrations (10-6 M, 5 x 10-5 M 10-4 M was studied on the catalytic activity of nitrate reductase in green and etiolated seedlings. A concentration of 5 x 10-5 M was optimal for all the growth regulators treatments. All the growth regulators stimulated nitrate reductase activity effectively at 5 x 10-5M concentration in both etiolated and green seedlings and had an additive effect when supplemented by NO-3 up to 140% to 160%. The 99.2% and 93.4% inhibition of nitrate reductase activity resulted in development of etiolated and green seedlings, respectively when treated with eukaryotic 80S ribosome protein synthesis inhibitor cycloheximide. Prokaryotic 70S inhibitor chloromphenicol did not have any effect on measured parameters. Actinomycin D, a RNA synthesis inhibitor also inhibited the enzyme activity as 80s inhibitors (Green 80%, etiolated 98%. One may suggest from this that both DNA and protein synthesis are involved in the induction of nitrate reductase activity. The differential effect of aminoacids was observed on enzyme activity in combination with growth regulators.

  12. NADPH-dependent D-aldose reductases and xylose fermentation in Fusarium oxysporum

    DEFF Research Database (Denmark)

    Panagiotou, Gianni; Christakopoulos, P.

    2004-01-01

    Two aldose (xylose) reductases (ARI and ARII) from Fusarium oxysporum were purified and characterized. The native ARI was a monomer with M-r 41000, pI 5.2 and showed a 52-fold preference for NADPH over NADH, while ARII was homodimeric with a subunit of M-r 37000, pI 3.6 and a 60-fold preference...

  13. Sensing nitrite through a pseudoazurin-nitrite reductase electron transfer relay

    NARCIS (Netherlands)

    Astier, Y; Canters, GW; Davis, JJ; Hill, HAO; Verbeet, MP; Wijma, HJ

    2005-01-01

    Nitrite is converted to nitric oxide by haem or copper-containing enzymes in denitrifying bacteria during the process of denitrification. In designing an efficient biosensor, this enzymic turnover must be quantitatively assessed. The enzyme nitrite reductase from Alcaligenes faecalis contains a redo

  14. Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Kroneck, Peter M H; Zumft, Walter G;

    2003-01-01

    Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have...

  15. Kinetic properties and inhibition of Trypanosoma cruzi 3-hydroxy-3-methylglutaryl CoA reductase

    DEFF Research Database (Denmark)

    Hurtado-Guerrrero, Ramón; Pena Diaz, Javier; Montalvetti, Andrea; Ruiz-Pérez, Luis M; González-Pacanowska, Dolores

    2002-01-01

    A detailed kinetic analysis of the recombinant soluble enzyme 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) from Trypanosoma cruzi has been performed. The enzyme catalyzes the normal anabolic reaction and the reductant is NADPH. It also catalyzes the oxidation of mevalonate but at a lower propo...

  16. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    Directory of Open Access Journals (Sweden)

    Muthuswamy Umamaheswari

    2012-09-01

    Full Text Available New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard. Docking results showed that all the selected flavonoids showed binding energy ranging between -7.91 kcal/mol to - 5.08 kcal/mol when compared with that of the standard (-5.59 kcal/mol. Intermolecular energy (- 9.11 kcal/mol to -8.66 kcal/mol and inhibition constant (1.58 μM to 187.37 μM of the ligands also coincide with the binding energy. Xanthotoxin contributed better aldose reductase inhibitory activity because of its structural parameters. Further studies are required to develop potent aldose reductase inhibitors for the treatment of diabetes.

  17. EFFECT OF LINDANE ON INTESTINAL NITROREDUCTASE, AZO REDUCTASE, B-GLUCURONIDASE, DECHLORINASE AND DEHYDROCHLORINASE ACTIVITY

    Science.gov (United States)

    The effect of daily p.o. injections of 20 mg/kg lindane on nitroreductase, azo reductase, B-glucuronidase, dechlorinase and dehydrochlorinase enzyme activity in the rat intestinal tract vas investigated after 2 weeks and 5 weeks of treatment. Antibiotics were administered to half...

  18. Calorimetric and spectroscopic investigations of the thermal denaturation of wild type nitrite reductase

    NARCIS (Netherlands)

    Stirpe, A; Guzzi, R; Wijma, H; Verbeet, MP; Canters, GW; Sportelli, L

    2005-01-01

    Nitrite reductase (NiR) is a multicopper protein, with a trimeric structure containing two types of copper site: type I is present in each subunit whereas type 2 is localized at the subunits interface. The paper reports on the thermal behaviour of wild type NiR from Alcaligenes faecalis S-6. The tem

  19. Structural and transcriptional analysis of plant genes encoding the bifunctional lysine ketoglutarate reductase saccharopine dehydrogenase enzyme

    Science.gov (United States)

    The analysis of a wheat lysine ketoglutarate reductase – saccharopine dehydrogenase (LKR/SDH) gene and comparative structural and functional analyses among available plant genes provides new information on this important gene. Both the structure of the LKR/SDH gene and the immediately adjacent genes...

  20. Biliverdin Reductase-A correlates with inducible nitric oxide synthasein in atorvastatin treated aged canine brain

    Institute of Scientific and Technical Information of China (English)

    Fabio Di Domenico; Marzia Perluigi; Eugenio Barone

    2013-01-01

    Alzheimer’s disease is a neurodegenerative disorder characterized by progressive cognitive impairment and neuropathology. Recent preclinical and epidemiological studies proposed statins as a possible therapeutic drug for Alzheimer’s disease, but the exact mechanisms of action are stil unknown. Biliverdin reductase-A is a pleiotropic enzyme involved in cel ular stress responses. It not only transforms biliverdin-IX alpha into the antioxidant bilirubin-IX alpha but its serine/threonine/tyrosine kinase activity is able to modulate cel signaling networks. We previously reported the beneficial effects of atorvastatin treatment on biliverdin reductase-A and heme oxygenase-1 in the brains of a well characterized pre-clinical model of Alzheimer’s disease, aged beagles, together with observed improvement in cognition. Here we extend our knowledge of the effects of atorvastatin on inducible nitric oxide synthase in parietal cortex, cerebel um and liver of the same animals. We demonstrated that atorvastatin treatment (80 mg/day for 14.5 months) to aged beagles selectively increased inducible nitric oxide synthase in the parietal cortex but not in the cerebel um. In contrast, inducible nitric oxide synthase protein levels were significantly decreased in the liver. Significant positive correlations were found between biliverdin reductase-A and inducible nitric oxide synthase as wel as heme oxygenase-1 protein levels in the parietal cortex. The opposite was observed in the liver. Inducible nitric oxide synthase up-regulation in the parietal cortex was positively associated with improved biliverdin reductase-A functions, whereas the oxidative-induced impairment of biliverdin reductase-A in the liver negatively affected inducible nitric oxide synthase expression, thus suggesting a role for biliverdin reductase-A in atorvastatin-dependent inducible nitric oxide synthase changes. Interestingly, increased inducible nitric oxide synthase levels in the parietal cortex were not

  1. Biochemical and antitumor activity of trimidox, a new inhibitor of ribonucleotide reductase.

    Science.gov (United States)

    Szekeres, T; Gharehbaghi, K; Fritzer, M; Woody, M; Srivastava, A; van't Riet, B; Jayaram, H N; Elford, H L

    1994-01-01

    Trimidox (3,4,5-trihydroxybenzamidoxime), a newly synthesized analog of didox (N,3,4-trihydroxybenzamide) reduced the activity of ribonucleotide reductase (EC 1.17.4.1) in extracts of L1210 cells by 50% (50% growth-inhibitory concentration, IC50) at 5 microM, whereas hydroxyurea, the only ribonucleotide reductase inhibitor in clinical use, exhibited an IC50 of 500 microM. Ribonucleotide reductase activity was also measured in situ by incubating L1210 cells for 24 h with trimidox at 7.5 microM, a concentration that inhibits cell proliferation by 50% (IC50) or at 100 microM for 2 h; these concentrations resulted in a decrease in enzyme activity to 22% and 50% of the control value, respectively. Trimidox and hydroxyurea were cytotoxic to L1210 cells with IC50 values of 7.5 and 50 microM, respectively. Versus ribonucleotide reductase, trimidox and hydroxyurea yielded IC50 values of 12 and 87 microM, respectively. A dose-dependent increase in life span was observed in mice bearing intraperitoneally transplanted L1210 tumors. Trimidox treatment (200 mg/kg; q1dx9) significantly increased the life span of mice bearing L1210 leukemia (by 82% in male mice and 112% in female mice). The anti-tumor activity appeared more pronounced in female mice than in male mice. Viewed in concert, these findings suggest that trimidox is a new and potent inhibitor of ribonucleotide reductase and that it is a promising candidate for the chemotherapy of cancer in humans. PMID:8174204

  2. Respiratory detoxification of nitric oxide by the cytochrome c nitrite reductase of Escherichia coli.

    Science.gov (United States)

    Poock, Susannah R; Leach, Emily R; Moir, James W B; Cole, Jeffrey A; Richardson, David J

    2002-06-28

    Nitric oxide is a key element in host defense against invasive pathogens. The periplasmic cytochrome c nitrite reductase (NrfA) of Escherichia coli catalyzes the respiratory reduction of nitrite, but in vitro studies have shown that it can also reduce nitric oxide. The physiological significance of the latter reaction in vivo has never been assessed. In this study the reduction of nitric oxide by Escherichia coli was measured in strains active or deficient in periplasmic nitrite reduction. Nrf(+) cells, harvested from cultures grown anaerobically, possessed a nitric-oxide reductase activity with physiological electron donation of 60 nmol min(-1) x mg dry wt(-1), and an in vivo turnover number of NrfA of 390 NO* s(-1) was calculated. Nitric-oxide reductase activity could not be detected in Nrf(-) strains. Comparison of the anaerobic growth of Nrf(+) and Nrf(-) strains revealed a higher sensitivity to nitric oxide in the NrfA(-) strains. A higher sensitivity to the nitrosating agent S-nitroso-N-acetyl penicillamine (SNAP) was also observed in agar plate disk-diffusion assays. Oxygen respiration by E. coli was also more sensitive to nitric oxide in the Nrf(-) strains compared with the Nrf(+) parent strain. The results demonstrate that active periplasmic cytochrome c nitrite reductase can confer the capacity for nitric oxide reduction and detoxification on E. coli. Genomic analysis of many pathogenic enteric bacteria reveals the presence of nrf genes. The present study raises the possibility that this reflects an important role for the cytochrome c nitrite reductase in nitric oxide management in oxygen-limited environments. PMID:11960983

  3. Conversion of NfsA, the Major Escherichia coli Nitroreductase, to a Flavin Reductase with an Activity Similar to That of Frp, a Flavin Reductase in Vibrio harveyi, by a Single Amino Acid Substitution

    Science.gov (United States)

    Zenno, Shuhei; Kobori, Toshiro; Tanokura, Masaru; Saigo, Kaoru

    1998-01-01

    NfsA is the major oxygen-insensitive nitroreductase of Escherichia coli, similar in amino acid sequence to Frp, a flavin reductase of Vibrio harveyi. Here, we show that a single amino acid substitution at position 99, which may destroy three hydrogen bonds in the putative active center, transforms NfsA from a nitroreductase into a flavin reductase that is as active as the authentic Frp and a tartrazine reductase that is 30-fold more active than wild-type NfsA. PMID:9440535

  4. Involvement of nitrate reductase and pyoverdine in competitiveness of Pseudomonas fluorescens strain C7R12 in soil.

    Science.gov (United States)

    Mirleau, P; Philippot, L; Corberand, T; Lemanceau, P

    2001-06-01

    Involvement of nitrate reductase and pyoverdine in the competitiveness of the biocontrol strain Pseudomonas fluorescens C7R12 was determined, under gnotobiotic conditions, in two soil compartments (bulk and rhizosphere soil), with the soil being kept at two different values of matric potential (-1 and -10 kPa). Three mutants affected in the synthesis of either the nitrate reductase (Nar(-)), the pyoverdine (Pvd(-)), or both (Nar(-) Pvd(-)) were used. The Nar(-) and Nar(-) Pvd(-) mutants were obtained by site-directed mutagenesis of the wild-type strain and of the Pvd(-) mutant, respectively. The selective advantage given by nitrate reductase and pyoverdine to the wild-type strain was assessed by measuring the dynamic of each mutant-to-total-inoculant (wild-type strain plus mutant) ratio. All three mutants showed a lower competitiveness than the wild-type strain, indicating that both nitrate reductase and pyoverdine are involved in the fitness of P. fluorescens C7R12. The double mutant presented the lowest competitiveness. Overall, the competitive advantages given to C7R12 by nitrate reductase and pyoverdine were similar. However, the selective advantage given by nitrate reductase was more strongly expressed under conditions of lower aeration (-1 kPa). In contrast, the selective advantage given by nitrate reductase and pyoverdine did not differ in bulk and rhizosphere soil, indicating that these bacterial traits are not specifically involved in the rhizosphere competence but rather in the saprophytic ability of C7R12 in soil environments. PMID:11375173

  5. Glutathione Reductase of Vacuole. Comparison of Glutathione Reductase Activity of Vacuole and Tissue Extract of Red Beet Root (Beta vulgaris L.

    Directory of Open Access Journals (Sweden)

    E.V. Pradedova

    2016-02-01

    Full Text Available Glutathione reductase (GR, EC 1.8.1.7 is the enzyme that reduces oxidized glutathione (GSSG and thus regulates the redox state of glutathione (GSH/GSSG. GR has been studied in most plants. This enzyme has been identified in chloroplasts and cytosol, so these cellular compartments are considered to be the main place of the enzyme localization. In the same time, just a little is known about GR vacuoles. There are no conclusive evidences to prove the presence or absence of this enzyme in the vacuoles. GR activity was found in the vacuoles of red beet root cells (Beta vulgaris L.. The level of activity, the optimum pH and isoenzyme composition of GR were compared in the vacuoles and tissue extract of beet root. Vacuolar GR activity was quite high, it was 1.5-2 times higher than the activity of the tissue extract. Enzyme pH optimum of all the objects were identical. pH-optimum depend on the pyridine nucleotide nature: pH 7.0-8.0 was an optimal range with NADPH; pH 5.0 – with NADH. GR activity of the vacuoles and tissue extracts decreased in the presence of a noncompetitive inhibitor 1-chloro-2.4-dinitrobenzene (CDNB, indicating the specificity of this enzymatic reaction. Two bands with glutathione reductase activity have been identified in the vacuoles and tissue extracts using zymography method to determine the enzymatic activity in PAAG after electrophoresis of proteins. Belonging to the GR isoforms of these bands was confirmed by enzyme immunoassay (Western blotting. The electric mobility of isoforms of the study objects did not differ significantly. It is concluded that the biochemical characteristics of vacuolar glutathione reductase were substantially identical to the biochemical characteristics of other localization GR.

  6. Coenzyme A disulfide reductase, the primary low molecular weight disulfide reductase from Staphylococcus aureus. Purification and characterization of the native enzyme.

    Science.gov (United States)

    delCardayre, S B; Stock, K P; Newton, G L; Fahey, R C; Davies, J E

    1998-03-01

    The human pathogen Staphylococcus aureus does not utilize the glutathione thiol/disulfide redox system employed by eukaryotes and many bacteria. Instead, this organism produces CoA as its major low molecular weight thiol. We report the identification and purification of the disulfide reductase component of this thiol/disulfide redox system. Coenzyme A disulfide reductase (CoADR) catalyzes the specific reduction of CoA disulfide by NADPH. CoADR has a pH optimum of 7.5-8.0 and is a dimer of identical subunits of Mr 49,000 each. The visible absorbance spectrum is indicative of a flavoprotein with a lambdamax = 452 nm. The liberated flavin from thermally denatured enzyme was identified as flavin adenine dinucleotide. Steady-state kinetic analysis revealed that CoADR catalyzes the reduction of CoA disulfide by NADPH at pH 7.8 with a Km for NADPH of 2 muM and for CoA disulfide of 11 muM. In addition to CoA disulfide CoADR reduces 4,4'-diphosphopantethine but has no measurable ability to reduce oxidized glutathione, cystine, pantethine, or H2O2. CoADR demonstrates a sequential kinetic mechanism and employs a single active site cysteine residue that forms a stable mixed disulfide with CoA during catalysis. These data suggest that S. aureus employs a thiol/disulfide redox system based on CoA/CoA-disulfide and CoADR, an unorthodox new member of the pyridine nucleotide-disulfide reductase superfamily. PMID:9488707

  7. Glutathione Reductase of Vacuole. Comparison of Glutathione Reductase Activity of Vacuole and Tissue Extract of Red Beet Root (Beta vulgaris L.)

    OpenAIRE

    E.V. Pradedova; O.D. Nimaeva; Salyaev, R. K.

    2016-01-01

    Glutathione reductase (GR, EC 1.8.1.7) is the enzyme that reduces oxidized glutathione (GSSG) and thus regulates the redox state of glutathione (GSH/GSSG). GR has been studied in most plants. This enzyme has been identified in chloroplasts and cytosol, so these cellular compartments are considered to be the main place of the enzyme localization. In the same time, just a little is known about GR vacuoles. There are no conclusive evidences to prove the presence or absence of this enzyme in the ...

  8. Synthesis and accumulation of aromatic aldehydes in an engineered strain of Escherichia coli.

    Science.gov (United States)

    Kunjapur, Aditya M; Tarasova, Yekaterina; Prather, Kristala L J

    2014-08-20

    Aromatic aldehydes are useful in numerous applications, especially as flavors, fragrances, and pharmaceutical precursors. However, microbial synthesis of aldehydes is hindered by rapid, endogenous, and redundant conversion of aldehydes to their corresponding alcohols. We report the construction of an Escherichia coli K-12 MG1655 strain with reduced aromatic aldehyde reduction (RARE) that serves as a platform for aromatic aldehyde biosynthesis. Six genes with reported activity on the model substrate benzaldehyde were rationally targeted for deletion: three genes that encode aldo-keto reductases and three genes that encode alcohol dehydrogenases. Upon expression of a recombinant carboxylic acid reductase in the RARE strain and addition of benzoate during growth, benzaldehyde remained in the culture after 24 h, with less than 12% conversion of benzaldehyde to benzyl alcohol. Although individual overexpression results demonstrated that all six genes could contribute to benzaldehyde reduction in vivo, additional experiments featuring subset deletion strains revealed that two of the gene deletions were dispensable under the conditions tested. The engineered strain was next investigated for the production of vanillin from vanillate and succeeded in preventing formation of the byproduct vanillyl alcohol. A pathway for the biosynthesis of vanillin directly from glucose was introduced and resulted in a 55-fold improvement in vanillin titer when using the RARE strain versus the wild-type strain. Finally, synthesis of the chiral pharmaceutical intermediate L-phenylacetylcarbinol (L-PAC) was demonstrated from benzaldehyde and glucose upon expression of a recombinant mutant pyruvate decarboxylase in the RARE strain. Beyond allowing accumulation of aromatic aldehydes as end products in E. coli, the RARE strain expands the classes of chemicals that can be produced microbially via aldehyde intermediates. PMID:25076127

  9. Hydroxysteroid dehydrogenases (HSDs) in bacteria: a bioinformatic perspective.

    Science.gov (United States)

    Kisiela, Michael; Skarka, Adam; Ebert, Bettina; Maser, Edmund

    2012-03-01

    Steroidal compounds including cholesterol, bile acids and steroid hormones play a central role in various physiological processes such as cell signaling, growth, reproduction, and energy homeostasis. Hydroxysteroid dehydrogenases (HSDs), which belong to the superfamily of short-chain dehydrogenases/reductases (SDR) or aldo-keto reductases (AKR), are important enzymes involved in the steroid hormone metabolism. HSDs function as an enzymatic switch that controls the access of receptor-active steroids to nuclear hormone receptors and thereby mediate a fine-tuning of the steroid response. The aim of this study was the identification of classified functional HSDs and the bioinformatic annotation of these proteins in all complete sequenced bacterial genomes followed by a phylogenetic analysis. For the bioinformatic annotation we constructed specific hidden Markov models in an iterative approach to provide a reliable identification for the specific catalytic groups of HSDs. Here, we show a detailed phylogenetic analysis of 3α-, 7α-, 12α-HSDs and two further functional related enzymes (3-ketosteroid-Δ(1)-dehydrogenase, 3-ketosteroid-Δ(4)(5α)-dehydrogenase) from the superfamily of SDRs. For some bacteria that have been previously reported to posses a specific HSD activity, we could annotate the corresponding HSD protein. The dominating phyla that were identified to express HSDs were that of Actinobacteria, Proteobacteria, and Firmicutes. Moreover, some evolutionarily more ancient microorganisms (e.g., Cyanobacteria and Euryachaeota) were found as well. A large number of HSD-expressing bacteria constitute the normal human gastro-intestinal flora. Another group of bacteria were originally isolated from natural habitats like seawater, soil, marine and permafrost sediments. These bacteria include polycyclic aromatic hydrocarbons-degrading species such as Pseudomonas, Burkholderia and Rhodococcus. In conclusion, HSDs are found in a wide variety of microorganisms including

  10. The Molecular Biology, Biochemistry, and Physiology of Human Steroidogenesis and Its Disorders

    Science.gov (United States)

    Auchus, Richard J.

    2011-01-01

    Steroidogenesis entails processes by which cholesterol is converted to biologically active steroid hormones. Whereas most endocrine texts discuss adrenal, ovarian, testicular, placental, and other steroidogenic processes in a gland-specific fashion, steroidogenesis is better understood as a single process that is repeated in each gland with cell-type-specific variations on a single theme. Thus, understanding steroidogenesis is rooted in an understanding of the biochemistry of the various steroidogenic enzymes and cofactors and the genes that encode them. The first and rate-limiting step in steroidogenesis is the conversion of cholesterol to pregnenolone by a single enzyme, P450scc (CYP11A1), but this enzymatically complex step is subject to multiple regulatory mechanisms, yielding finely tuned quantitative regulation. Qualitative regulation determining the type of steroid to be produced is mediated by many enzymes and cofactors. Steroidogenic enzymes fall into two groups: cytochrome P450 enzymes and hydroxysteroid dehydrogenases. A cytochrome P450 may be either type 1 (in mitochondria) or type 2 (in endoplasmic reticulum), and a hydroxysteroid dehydrogenase may belong to either the aldo-keto reductase or short-chain dehydrogenase/reductase families. The activities of these enzymes are modulated by posttranslational modifications and by cofactors, especially electron-donating redox partners. The elucidation of the precise roles of these various enzymes and cofactors has been greatly facilitated by identifying the genetic bases of rare disorders of steroidogenesis. Some enzymes not principally involved in steroidogenesis may also catalyze extraglandular steroidogenesis, modulating the phenotype expected to result from some mutations. Understanding steroidogenesis is of fundamental importance to understanding disorders of sexual differentiation, reproduction, fertility, hypertension, obesity, and physiological homeostasis. PMID:21051590

  11. Role of DNA Methylation on the Expression of the Anthracycline Metabolizing Enzyme AKR7A2 in Human Heart.

    Science.gov (United States)

    Hoefer, Carrie C; Quiñones-Lombraña, Adolfo; Blair, Rachael Hageman; Blanco, Javier G

    2016-04-01

    The intracardiac synthesis of anthracycline alcohol metabolites by aldo-keto reductases (AKRs) contributes to the pathogenesis of anthracycline-related cardiotoxicity. AKR7A2 is the most abundant anthracycline reductase in hearts from donors with and without Down syndrome (DS), and its expression varies between individuals (≈tenfold). We investigated whether DNA methylation impacts AKR7A2 expression in hearts from donors with (n = 11) and without DS (n = 30). Linear models were used to test for associations between methylation status and cardiac AKR7A2 expression. In hearts from donors without DS, DNA methylation status at CpG site -865 correlated with AKR7A2 mRNA (Pearson's regression coefficient, r = -0.4051, P = 0.0264) and AKR7A2 protein expression (r = -0.5818, P = 0.0071). In heart tissue from donors with DS, DNA methylation status at CpG site -232 correlated with AKR7A2 protein expression (r = 0.8659, P = 0.0025). Multiple linear regression modeling revealed that methylation at several CpG sites is associated with the synthesis of cardiotoxic daunorubicinol. AKR7A2 methylation status in lymphoblastoid cell lines from donors with and without DS was examined to explore potential parallelisms between cardiac tissue and lymphoid cells. These results suggest that DNA methylation impacts AKR7A2 expression and the synthesis of cardiotoxic daunorubicinol. PMID:25962911

  12. Regulation of Escherichia coli fumarate reductase (frdABCD) operon expression by respiratory electron acceptors and the fnr gene product.

    OpenAIRE

    Jones, H. M.; Gunsalus, R P

    1987-01-01

    The fumarate reductase enzyme complex, encoded by the frdABCD operon, allows Escherichia coli to utilize fumarate as a terminal electron acceptor for anaerobic oxidative phosphorylation. To analyze the expression of fumarate reductase, protein and operon fusions were constructed between the frdA and the lacZ genes and introduced onto the E. coli chromosome at the lambda attachment site. Expression of beta-galactosidase from either fusion was increased 10-fold during anaerobic versus aerobic c...

  13. Involvement of Nitrate Reductase and Pyoverdine in Competitiveness of Pseudomonas fluorescens Strain C7R12 in Soil

    OpenAIRE

    Mirleau, Pascal; Philippot, Laurent; Corberand, Thérèse; Lemanceau, Philippe

    2001-01-01

    Involvement of nitrate reductase and pyoverdine in the competitiveness of the biocontrol strain Pseudomonas fluorescens C7R12 was determined, under gnotobiotic conditions, in two soil compartments (bulk and rhizosphere soil), with the soil being kept at two different values of matric potential (−1 and −10 kPa). Three mutants affected in the synthesis of either the nitrate reductase (Nar−), the pyoverdine (Pvd−), or both (Nar− Pvd−) were used. The Nar− and Nar− Pvd− mutants were obtained by si...

  14. Cancer metabolism and oxidative stress: Insights into carcinogenesis and chemotherapy via the non-dihydrofolate reductase effects of methotrexate

    OpenAIRE

    Joshua A. Hess; Mohamad K. Khasawneh

    2015-01-01

    Methotrexate has been in use as an anti-cancer agent for over 60 years. Though inhibition of dihydrofolate reductase is its best known mechanisms of action, its non-dihydrofolate reductase dependent mechanisms disrupt metabolic pathways resulting in a depletion of NAD(P)H and increasing oxidative stress. These mechanisms highlight a novel dependence of cancer cells on their metabolic abnormalities to buffer oxidative stress and chemotherapeutic agents interfere with these cellular abilities. ...

  15. A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar;

    2013-01-01

    The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer of r....... Overall, the findings suggest that NTR:Trx interactions in different biological systems are fine-tuned by multiple intermolecular contacts. Proteins 2014; 82:607-619. (c) 2013 Wiley Periodicals, Inc....

  16. Boletus edulis Nitrite Reductase Reduces Nitrite Content of Pickles and Mitigates Intoxication in Nitrite-intoxicated Mice

    OpenAIRE

    Weiwei Zhang; Guoting Tian; Shanshan Feng; Jack Ho Wong; Yongchang Zhao; Xiao Chen; Hexiang Wang; Tzi Bun Ng

    2015-01-01

    Pickles are popular in China and exhibits health-promoting effects. However, nitrite produced during fermentation adversely affects health due to formation of methemoglobin and conversion to carcinogenic nitrosamine. Fruiting bodies of the mushroom Boletus edulis were capable of inhibiting nitrite production during pickle fermentation. A 90-kDa nitrite reductase (NiR), demonstrating peptide sequence homology to fungal nitrite reductase, was isolated from B. edulis fruiting bodies. The optimum...

  17. Loss of the tyrosyl radical in mouse ribonucleotide reductase by (-)-epicatechin

    International Nuclear Information System (INIS)

    The flavonoid (-)-epicatechin was previously demonstrated to interfere with tyrosine nitration by peroxynitrite [Biochem. Biophys. Res. Commun. 285 (2001) 782]. This effect was hypothesized to be based upon an interaction of epicatechin with a transiently generated tyrosyl radical. In the present study, using electron paramagnetic resonance, we demonstrate that (-)-epicatechin is capable of destabilizing the tyrosyl radical of the mouse ribonucleotide reductase R2 component. First-order rate constants for the disappearance of tyrosyl radical signals were 1 x 10-4 and 2 x 10-4 s-1for epicatechin and hydroxyurea, a well-known tyrosyl radical scavenger, respectively. In keeping with scavenging the ribonucleotide reductase tyrosyl radical, cellular production of deoxyribonucleotides and DNA synthesis were impaired by (-)-epicatechin in normal human keratinocytes and in human squamous carcinoma cells

  18. Positive pleiotropic effects of HMG-CoA reductase inhibitor on vitiligo

    Directory of Open Access Journals (Sweden)

    Jobin Jean

    2004-05-01

    Full Text Available Abstract Background HMG-CoA reductase inhibitors (statins are commonly used in medicine to control blood lipid disorder. Large clinical trials have demonstrated that statins greatly reduces cardiovascular-related morbidity and mortality in patients with and without coronary artery disease. Also, the use of HMG-CoA reductase inhibitors has been reported to have immunosuppressive effects. Case presentation We describe an unusual case of regression of vitiligo in a patient treated with high dose simvastatin. The relation between simvastatin and regression of vitiligo in this case report may be related to the autoimmune pathophysiology of the disease. Conclusion This unexpected beneficial impact provides another scientific credence to the hypothesis that immune mechanisms play a role in the development of vitiligo and that the use of statins as immuno-modulator could be of use not only for treatment relative to organ transplant but in other pathologies such as vitiligo.

  19. Purification, crystallization and preliminary X-ray crystallographic analysis of xylose reductase from Candida tropicalis

    International Nuclear Information System (INIS)

    The crystallization of xylose reductase from C. tropicalis is reported. Xylose reductase (XR), which requires NADPH as a co-substrate, catalyzes the reduction of d-xylose to xylitol, which is the first step in the metabolism of d-xylose. The detailed three-dimensional structure of XR will provide a better understanding of the biological significance of XR in the efficient production of xylitol from biomass. XR of molecular mass 36.6 kDa from Candida tropicalis was crystallized using the hanging-drop vapour-diffusion method. According to X-ray diffraction data from C. tropicalis XR crystals at 2.91 Å resolution, the unit cell belongs to space group P31 or P32. Preliminary analysis indicated the presence of four XR molecules in the asymmetric unit, with 68.0% solvent content

  20. Expression Analysis of Dihydroflavonol 4-Reductase Genes Involved in Anthocyanin Biosynthesis in Purple Grains of Wheat

    Institute of Scientific and Technical Information of China (English)

    Mao-Sen LIU; Fang WANG; Yu-Xiu DONG; Xian-Sheng ZHANG

    2005-01-01

    The grain color of wheat (Triticum aestivum L.) is an important characteristic in crop production.Dihydroflavonol 4-reductase genes (DFR) encode the key enzyme dihydroflavonol 4-reductase, which is involved in the pigmentation of plant tissues. To investigate the molecular mechanism of anthocyanin deposition in grains of wheat, we determined the expression of the wheat DFR gene in purple grains of cultivar Heimai 76. The results showed that DFR transcripts were localized in the seed coat of purple grains rather than in the pericarp, whereas anthocyanins were accumulated in both tissues of purple grains,suggesting that anthocyanin deposition was mainly regulated at the transcriptional level. Overexpression of the TaDFR-A gene in Arabidopsis showed that TaDFR-A was responsible for the pigmentation of Arabidopsis plant tissues, indicating TaDFR-A gene has the same role in Arabidopsis.

  1. Discovery of pyrrole-based hepatoselective ligands as potent inhibitors of HMG-CoA reductase.

    Science.gov (United States)

    Bratton, Larry D; Auerbach, Bruce; Choi, Chulho; Dillon, Lisa; Hanselman, Jeffrey C; Larsen, Scott D; Lu, Gina; Olsen, Karl; Pfefferkorn, Jeffrey A; Robertson, Andrew; Sekerke, Catherine; Trivedi, Bharat K; Unangst, Paul C

    2007-08-15

    In an effort to identify hepatoselective inhibitors of HMG-CoA reductase, two series of pyrroles were synthesized and evaluated. Efforts were made to modify (3R,5R)-7-[3-(4-fluorophenyl)-1-isopropyl-4-phenyl-5-phenylcarbamoyl-1H-pyrrol-2-yl]-3,5-dihydroxy-heptanoic acid sodium salt 30 in order to reduce its lipophilicity and therefore increase hepatoselectivity. Two strategies that were explored were replacement of the lipophilic 3-phenyl substituent with either a polar function (pyridyl series) or with lower alkyl substituents (lower alkyl series) and attachment of additional polar moieties at the 2-position of the pyrrole ring. One compound was identified to be both highly hepatoselective and active in vivo. We report the discovery, synthesis, and optimization of substituted pyrrole-based hepatoselective ligands as potent inhibitors of HMG-CoA reductase for reducing low density lipoprotein cholesterol (LDL-c) in the treatment of hypercholesterolemia. PMID:17560788

  2. The properties of monoclonal antibody against sepiapterin reductase from fat body of the silkworm, Bombyx mori.

    Science.gov (United States)

    Iino, T; Sawada, H; Gyure, W L; Tsusué, M

    1992-12-01

    A specific monoclonal antibody prepared for the 29-kDa a subunit of silkworm fat body sepiapterin reductase (SPR) was able to recognize the subunit in crude extract of fat body after SDS treatment. Although SPR from the silkworm fat body has biochemical properties similar to those reported for SPR from mammalian sources, especially rat erythrocytes, the antibody failed to recognize the 28-kDa subunit of rat erythrocyte SPR. This result indicates that SPR from silkworm fat body has a different amino-acid sequence from that of the rat erythrocyte enzyme. Sepiapterin reductase activity has not been found in crude extract of fat body from the silkworm mutant lemon. Although the antibody recognized only 29-kDa protein in the crude extract of silkworm fat body from normal strain after SDS-treatment, the antibody recognized only an approximately 80-kDa protein in the crude extract of the lemon mutant after SDS-treatment. PMID:1292509

  3. 5alpha-Reductase inhibitor treatment of prostatic diseases: background and practical implications.

    Science.gov (United States)

    Dörsam, J; Altwein, J

    2009-01-01

    This literature review discusses the theoretical background of 5alpha-reductase inhibitor (5ARI) treatment and the resulting clinical implications. A Medline-based search for peer-reviewed articles addressing 5ARIs, benign prostatic hyperplasia and prostate cancer was performed. The 5ARIs Finasteride and Dutasteride, which specifically inhibit the production of dihydrotestosterone by acting as competitive inhibitors of 5alpha-reductase, are clinically well tolerated and represent an effective treatment option for benign prostatic obstruction. Finasteride is the first compound which has a proven efficacy in chemoprevention of prostate cancer. The aim of this review was to elucidate, if there are sufficient data available to point out clinically relevant differences between the drugs. Both compounds achieve a significant reduction of prostate volume, an improvement of symptoms and a lower risk of acute urinary retention. Whether the different pharmacokinetic and pharmacodynamic properties of Finasteride and Dutasteride are of clinical importance cannot be judged at this time. PMID:19030020

  4. Mechanism of biological denitrification inhibition: procyanidins induce an allosteric transition of the membrane-bound nitrate reductase through membrane alteration.

    Science.gov (United States)

    Bardon, Clément; Poly, Franck; Piola, Florence; Pancton, Muriel; Comte, Gilles; Meiffren, Guillaume; Haichar, Feth El Zahar

    2016-05-01

    Recently, it has been shown that procyanidins fromFallopiaspp. inhibit bacterial denitrification, a phenomenon called biological denitrification inhibition (BDI). However, the mechanisms involved in such a process remain unknown. Here, we investigate the mechanisms of BDI involving procyanidins, using the model strainPseudomonas brassicacearumNFM 421. The aerobic and anaerobic (denitrification) respiration, cell permeability and cell viability ofP. brassicacearumwere determined as a function of procyanidin concentration. The effect of procyanidins on the bacterial membrane was observed using transmission electronic microscopy. Bacterial growth, denitrification, NO3- and NO2-reductase activity, and the expression of subunits of NO3- (encoded by the genenarG) and NO2-reductase (encoded by the genenirS) under NO3or NO2were measured with and without procyanidins. Procyanidins inhibited the denitrification process without affecting aerobic respiration at low concentrations. Procyanidins also disturbed cell membranes without affecting cell viability. They specifically inhibited NO3- but not NO2-reductase.Pseudomonas brassicacearumresponded to procyanidins by over-expression of the membrane-bound NO3-reductase subunit (encoded by the genenarG). Our results suggest that procyanidins can specifically inhibit membrane-bound NO3-reductase inducing enzymatic conformational changes through membrane disturbance and thatP. brassicacearumresponds by over-expressing membrane-bound NO3-reductase. Our results lead the way to a better understanding of BDI. PMID:26906096

  5. The prenyltransferase UBIAD1 is the target of geranylgeraniol in degradation of HMG CoA reductase.

    Science.gov (United States)

    Schumacher, Marc M; Elsabrouty, Rania; Seemann, Joachim; Jo, Youngah; DeBose-Boyd, Russell A

    2015-01-01

    Schnyder corneal dystrophy (SCD) is an autosomal dominant disorder in humans characterized by abnormal accumulation of cholesterol in the cornea. SCD-associated mutations have been identified in the gene encoding UBIAD1, a prenyltransferase that synthesizes vitamin K2. Here, we show that sterols stimulate binding of UBIAD1 to the cholesterol biosynthetic enzyme HMG CoA reductase, which is subject to sterol-accelerated, endoplasmic reticulum (ER)-associated degradation augmented by the nonsterol isoprenoid geranylgeraniol through an unknown mechanism. Geranylgeraniol inhibits binding of UBIAD1 to reductase, allowing its degradation and promoting transport of UBIAD1 from the ER to the Golgi. CRISPR-CAS9-mediated knockout of UBIAD1 relieves the geranylgeraniol requirement for reductase degradation. SCD-associated mutations in UBIAD1 block its displacement from reductase in the presence of geranylgeraniol, thereby preventing degradation of reductase. The current results identify UBIAD1 as the elusive target of geranylgeraniol in reductase degradation, the inhibition of which may contribute to accumulation of cholesterol in SCD. PMID:25742604

  6. Nitrate reductase, nitrite reductase, glutamine synthetase, and glutamate synthase expression and activity in response to different nitrogen sources in nitrogen-starved wheat seedlings.

    Science.gov (United States)

    Balotf, Sadegh; Kavoosi, Gholamreza; Kholdebarin, Bahman

    2016-03-01

    The objective of this study was to examine the expression and activity of nitrate reductase (NR, EC 1.7.1.1), nitrite reductase (NiR, EC 1.7.2.2), glutamine synthetase (GS, EC 6.3.1.2), and glutamate synthase (GOGAT, EC 1.4.7.1) in response to potassium nitrate, ammonium chloride, and ammonium nitrate in nitrogen-starved wheat seedlings. Plants were grown in standard nutrient solution for 17 days and then subjected to nitrogen starvation for 7 days. The starved plants were supplied with potassium nitrate ammonium nitrate and ammonium chloride (50 mM) for 4 days and the leaves were harvested. The relative expression of NR, NiR, GS, and GOGAT as well as the enzyme activities were investigated. Nitrogen starvation caused a significant decrease both in transcript levels and in NR, NiR, GS, and GOGAT activities. Potassium nitrate and ammonium nitrate treatments restored NR, NiR, GS, and GOGAT expressions and activities. Ammonium chloride increased only the expressions and activities of GS and GOGAT in a dose-dependent manner. The results of our study highlight the differential effects between the type and the amount of nitrogen salts on NR, NiR, GS, and GOGAT activities in wheat seedlings while potassium nitrate being more effective. PMID:25676153

  7. Metal complexes with 2-acetylpyridine-N(4)-orthochlorophenylthiosemicarbazone: cytotoxicity and effect on the enzymatic activity of thioredoxin reductase and glutathione reductase.

    Science.gov (United States)

    Parrilha, Gabrieli L; Ferraz, Karina S O; Lessa, Josane A; de Oliveira, Kely Navakoski; Rodrigues, Bernardo L; Ramos, Jonas P; Souza-Fagundes, Elaine M; Ott, Ingo; Beraldo, Heloisa

    2014-09-12

    Metal complexes with 2-acetylpyridine-N(4)-orthochlorophenylthiosemicarbazone (H2Ac4oClPh) were assayed for their cytotoxicity against MCF-7 breast adenocarcinoma and HT-29 colon carcinoma cells. The thiosemicarbazone and most of the complexes were highly cytotoxic. H2Ac4oClPh and its gallium(III) and tin(IV) complexes did not show any inhibitory activity against thioredoxin reductase (TrxR) and glutathione reductase (GR). The palladium(II), platinum(II) and bismuth(III) complexes inhibited TrxR at micromolar concentrations but not GR. The antimony(III) and gold(III) complexes strongly inhibited TrxR at submicromolar doses with GR inhibition at higher concentrations. The selectivity of these complexes for TrxR suggests metal binding to a selenol residue in the active site of the enzyme. TrxR inhibition is likely a contributing factor to the mode of action of the gold and antimony derivatives. PMID:25058344

  8. Theoretical Calculations of the Catalytic Triad in Short-Chain Alcohol Dehydrogenases/Reductases

    OpenAIRE

    Gani, Osman A B S M; Adekoya, Olayiwola A; Giurato, Laura; Spyrakis, Francesca; Cozzini, Pietro; Guccione, Salvatore; Winberg, Jan-Olof; Sylte, Ingebrigt

    2007-01-01

    Three highly conserved active site residues (Ser, Tyr, and Lys) of the family of short-chain alcohol dehydrogenases/reductases (SDRs) were demonstrated to be essential for catalytic activity and have been denoted the catalytic triad of SDRs. In this study computational methods were adopted to study the ionization properties of these amino acids in SDRs from Drosophila melanogaster and Drosophila lebanonensis. Three enzyme models, with different ionization scenarios of the catalytic triad that...

  9. Sulfate reduction in higher plants: Molecular evidence for a novel 5′-adenylylsulfate reductase

    OpenAIRE

    SETYA, AMIT; Murillo, Michael; Leustek, Thomas

    1996-01-01

    Sulfate-assimilating organisms reduce inorganic sulfate for Cys biosynthesis. There are two leading hypotheses for the mechanism of sulfate reduction in higher plants. In one, adenosine 5′-phosphosulfate (APS) (5′-adenylylsulfate) sulfotransferase carries out reductive transfer of sulfate from APS to reduced glutathione. Alternatively, the mechanism may be similar to that in bacteria in which the enzyme, 3′-phosphoadenosine-5′-phosphosulfate (PAPS) reductase, catalyzes...

  10. Methylenetetrahydrofolate reductase homozygous mutation in a young boy with cerebellar infarction

    OpenAIRE

    Alberto Spalice; Francesca Del Balzo; Francesco Massimo Perla; Enrico Properzi; Carla Carducci; Italo Antonozzi; Paola Iannetti

    2009-01-01

    Posterior circulation vascular occlusive disease in children is a rare and uncommonly reported event. Among the numerous risk factors, the methylenetetrahydrofolate reductase (MTHFR) mutation is considered to be a common genetic cause of thrombosis in adults and children. Recently, a link between the MTHFR mutation and cerebrovascular disorders was reported in children. Diffusion tensor imaging (DTI) is a great improvement on magnetic resonance imaging (MRI), making the in vivo anatomical and...

  11. Lemierre's syndrome with double heterozygote status in the methylenetetrahydrofolate reductase gene

    Institute of Scientific and Technical Information of China (English)

    Mostafa Behpour-Oskooee; Abdollah Karimi; Shirin Sayyahfar

    2014-01-01

    Background: There are some risk factors being more vulnerable to Lemierre's syndrome such as a hypercoagulable state. Methods: We report a rare case of Lemierre's syndrome with ethmoid and maxillary sinusitis, bilateral mastoiditis, and sigmoid sinus thrombosis. Results: Genetic study revealed a double heterozygote status in the methylenetetrahydrofolate reductase gene including C677T and A1298C. Conclusion: It is suggested to screen patients with Lemierre's syndrome for a hypercoagulable state to consider anticoagulant therapy.

  12. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    OpenAIRE

    Endo, T.; Uratani, B; Freese, E.

    1983-01-01

    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic ch...

  13. The stability of the three transmembrane and the four transmembrane human vitamin K epoxide reductase models

    Science.gov (United States)

    Wu, Sangwook

    2016-04-01

    The three transmembrane and the four transmembrane helix models are suggested for human vitamin K epoxide reductase (VKOR). In this study, we investigate the stability of the human three transmembrane/four transmembrane VKOR models by employing a coarse-grained normal mode analysis and molecular dynamics simulation. Based on the analysis of the mobility of each transmembrane domain, we suggest that the three transmembrane human VKOR model is more stable than the four transmembrane human VKOR model.

  14. Dimethyl sulfoxide reductase activity by anaerobically grown Escherichia coli HB101.

    OpenAIRE

    Bilous, P T; Weiner, J H

    1985-01-01

    Escherichia coli grew anaerobically on a minimal medium with glycerol as the carbon and energy source and dimethyl sulfoxide (DMSO) as the terminal electron acceptor. DMSO reductase activity, measured with an artificial electron donor (reduced benzyl viologen), was preferentially associated with the membrane fraction (77 +/- 10% total cellular activity). A Km for DMSO reduction of 170 +/- 60 microM was determined for the membrane-bound activity. Methyl viologen, reduced flavin mononucleotide,...

  15. Nitrate reductase and acid phosphatase activities as affected by inorganic phosphate in corn roots

    OpenAIRE

    Marie Kummerova; Józef Buczek

    2014-01-01

    The deficieny of inorganic phosphate in nutrient solution reduces by about 50 per cent NO3- absorption in corn seedlings, it decreases both in vitro and in vivo nitrate reductase (NR) activity, as well the potential and actual NR level and has a very weak effect on NR induction. Acid phosphatases activities increase in corn roots when the plants are grown in nutrient solution without phosphorus. We suggest that inorganic phosphate is required mainly for maintenance of NR activity rather, than...

  16. Induction of Glutathione Synthesis and Glutathione Reductase Activity by Abiotic Stresses in Maize and Wheat

    OpenAIRE

    Gabor Kocsy; Gabriella Szalai; Gabor Galiba

    2002-01-01

    The effect of different abiotic stresses (extreme temperatures and osmotic stress) on the synthesis of glutathione and hydroxymethylglutathione, on the ratio of the reduced to oxidised forms of these thiols (GSH/GSSG, hmGSH/hmGSSG), and on the glutathione reductase (GR) activity was studied in maize and wheat genotypes having different sensitivity to low temperature stress. Cold treatment induced a greater increase in total glutathione (TG) content and in GR activity in tolerant genotypes of ...

  17. Thioredoxin reductase-1 (TxnRd1) mediates curcumin-induced radiosensitization of squamous carcinoma cells

    OpenAIRE

    Javvadi, Prashanthi; Hertan, Lauren; Kosoff, Rachelle; Datta, Tatini; Kolev, Johann; Mick, Rosemarie; Tuttle, Stephen W; Koumenis, Constantinos

    2010-01-01

    Curcumin, a plant polyphenol, is a widely studied chemopreventive agent with demonstrated antitumor activities in preclinical studies and low toxicity profiles in multiple clinical trials against human malignancies. We previously demonstrated that curcumin radiosensitizes cervical tumor cells without increasing the cytotoxic effects of radiation on normal human fibroblasts. Here we report that an inhibitory activity of curcumin on the anti-oxidant enzyme Thioredoxin Reductase-1 (TxnRd1) is re...

  18. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression.

    OpenAIRE

    Thigpen, A E; Silver, R I; Guileyardo, J M; Casey, M L; McConnell, J D; Russell, D W

    1993-01-01

    The synthesis of dihydrotestosterone is catalyzed by steroid 5 alpha-reductase isozymes, designated types 1 and 2. Mutation of type 2 results in male pseudohermaphroditism, in which the external genitalia are phenotypically female at birth. Two striking and unexplained features of this disorder are that external genitalia of affected males undergo virilization during puberty and that these individuals have less temporal hair regression. The tissue-specific and developmental expression pattern...

  19. Dicarbonyl L-Xylulose Reductase (DCXR), a “Moonlighting Protein” in the Bovine Epididymis

    OpenAIRE

    Akintayo, Ayodélé; Légaré, Christine; Sullivan, Robert

    2015-01-01

    During maturation and the acquisition of their fertilization potential, male germ cells are subjected to various sequential modifications that occur in the epididymis. Protein addition, reorganization or withdrawal, comprise some of these modifications. Dicarbonyl L-xylulose reductase (DCXR), a multifunctional protein involved in various enzymatic and protein interaction processes in different physiological systems, is one of the proteins added to spermatozoa in the epididymis. DCXR is a well...

  20. Methionine synthase reductase deficiency results in adverse reproductive outcomes and congenital heart defects in mice

    OpenAIRE

    Deng, Liyuan; Elmore, C. Lee; Lawrance, Andrea K.; Matthews, Rowena G.; Rozen, Rima

    2008-01-01

    Low dietary folate and polymorphisms in genes of folate metabolism can influence risk for pregnancy complications and birth defects. Methionine synthase reductase (MTRR) is required for activation of methionine synthase, a folate- and vitamin B12-dependent enzyme. A polymorphism in MTRR (p.I22M), present in the homozygous state in 25% of many populations, may increase risk for neural tube defects. To examine the impact of MTRR deficiency on early development and congenital heart defects, we u...

  1. Developmental expression of Xenopus short-chain dehydrogenase/reductase 3

    OpenAIRE

    Kam, Richard Kin Ting; Chen, Yonglong; Chan, Sun On; Chan, Wood Yee; Dawid, Igor B.; Hui ZHAO

    2010-01-01

    During early embryonic development, the retinoic acid signaling pathway coordinates with other signaling pathways to regulate body axis patterning and organogenesis. The production of retinoic acid requires two enzymatic reactions, the first of which is the oxidization of vitamin A (all-trans-retinol) to all-trans-retinal, mediated in part by the short-chain dehydrogenase/reductase. Through DNA microarrays, we have identified a gene in Xenopus laevis, which shares a high sequence similarity t...

  2. Differential expression of 5-alpha reductase isozymes in the prostate and its clinical implications

    OpenAIRE

    Kai Wang; Dong-Dong Fan; Song Jin; Nian-Zeng Xing; Yi-Nong Niu

    2014-01-01

    The development of human benign or malignant prostatic diseases is closely associated with androgens, primarily testosterone (T) and dihydrotestosterone (DHT). T is converted to DHT by 5-alpha reductase (5-AR) isozymes. Differential expression of 5-AR isozymes is observed in both human benign and malignant prostatic tissues. 5-AR inhibitors (5-ARI) are commonly used for the treatment of benign prostatic hyperplasia (BPH) and were once promoted as chemopreventive agents for prostate cancer (PC...

  3. Battling Prostate Cancer with 5-Alpha-Reductase Inhibitors: a Pyrrhic Victory?

    OpenAIRE

    Hoffman, Richard M.; Richard G. Roberts; Barry, Michael J.

    2011-01-01

    Given the relatively small impact of prostate cancer screening on cancer mortality, experts are now suggesting that chemoprevention with 5-alpha-reductase inhibitors (5-ARI) may be a more effective strategy for cancer control. Two large placebo-controlled randomized trials found that men receiving 5-ARI were about 25% less likely than controls to be detected with cancer. However, most cancers were detected on routine biopsies required by study protocols. The benefit from receiving 5-ARI was m...

  4. Clinical Effects of Discontinuing 5-Alpha Reductase Inhibitor in Patients With Benign Prostatic Hyperplasia

    OpenAIRE

    Kim, Won; Jung, Jae Hung; Kang, Tae Wook; Song, Jae Mann; Chung, Hyun Chul

    2014-01-01

    Purpose To assess changes in lower urinary tract symptoms (LUTS), prostate volume, and serum prostate-specific antigen (PSA) after discontinuation of 5-alpha reductase inhibitor (5ARI) combination therapy in patients with benign prostatic hyperplasia (BPH). Materials and Methods From December 2003 to December 2012, data were collected retrospectively from 81 men more than 40 years of age with moderate to severe BPH symptoms (International Prostate Symptom Score [IPSS]≥8). The men were classif...

  5. Targeting 5α-reductase for prostate cancer prevention and treatment

    OpenAIRE

    Nacusi, Lucas P.; Tindall, Donald J.

    2011-01-01

    Testosterone is the most abundant circulating androgen, and can be converted to dihydrotestosterone (DHT), a more potent androgen, by the 5α-reductase enzymes in target tissues. Current treatments for prostate cancer consist of reducing androgen levels by chemical or surgical castration or pure antiandrogen therapy that directly targets the androgen receptor (AR). Although these therapies reduce tumor burden and AR activity, the cancer inevitably recurs within 18–30 months. An approach target...

  6. 5-α reductase inhibitors and prostate cancer prevention: where do we turn now?

    OpenAIRE

    Hamilton Robert J; Freedland Stephen J

    2011-01-01

    Abstract With the lifetime risk of being diagnosed with prostate cancer so great, an effective chemopreventive agent could have a profound impact on the lives of men. Despite decades of searching for such an agent, physicians still do not have an approved drug to offer their patients. In this article, we outline current strategies for preventing prostate cancer in general, with a focus on the 5-α-reductase inhibitors (5-ARIs) finasteride and dutasteride. We discuss the two landmark randomized...

  7. Purification and Characterization of (Per)Chlorate Reductase from the Chlorate-Respiring Strain GR-1

    OpenAIRE

    Kengen, Servé W. M.; Rikken, Geoffrey B.; Hagen, Wilfred R.; van Ginkel, Cees G.; Stams, Alfons J. M.

    1999-01-01

    Strain GR-1 is one of several recently isolated bacterial species that are able to respire by using chlorate or perchlorate as the terminal electron acceptor. The organism performs a complete reduction of chlorate or perchlorate to chloride and oxygen, with the intermediate formation of chlorite. This study describes the purification and characterization of the key enzyme of the reductive pathway, the chlorate and perchlorate reductase. A single enzyme was found to catalyze both the chlorate-...

  8. Characterization of the Arsenate Respiratory Reductase from Shewanella sp. Strain ANA-3

    OpenAIRE

    Malasarn, Davin; Keeffe, Jennifer R.; Newman, Dianne K.

    2008-01-01

    Microbial arsenate respiration contributes to the mobilization of arsenic from the solid to the soluble phase in various locales worldwide. To begin to predict the extent to which As(V) respiration impacts arsenic geochemical cycling, we characterized the expression and activity of the Shewanella sp. strain ANA-3 arsenate respiratory reductase (ARR), the key enzyme involved in this metabolism. ARR is expressed at the beginning of the exponential phase and persists throughout the stationary ph...

  9. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization

    OpenAIRE

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon

    2014-01-01

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  10. Novel octaheme cytochrome c tetrathionate reductase (OTR) from Shewanella oneidensis MR-1

    OpenAIRE

    Wu, Fei

    2010-01-01

    Octa-heme cytochrome c tetrathionate reductase (OTR) from Shewanella oneidensis MR-1 is a periplasmic protein and shows several extraordinary structural features around its active-site heme. OTR has been found able to catalyse the in vitro reduction of tetrathionate, nitrite, hydroxylamine and hydrogen peroxide. However the physiological function of this novel protein remains unknown. The subject of this thesis is the in vitro catalytic mechanism and the in vivo function of OTR...

  11. The Effects of Acrolein on Peroxiredoxins, Thioredoxins, and Thioredoxin Reductase in Human Bronchial Epithelial Cells

    OpenAIRE

    Myers, Charles R.; Myers, Judith M.

    2008-01-01

    Inhalation is a common form of exposure to acrolein, a toxic reactive volatile aldehyde that is a ubiquitous environmental pollutant. Bronchial epithelial cells would be directly exposed to inhaled acrolein. The thioredoxin (Trx) system is essential for the maintenance of cellular thiol redox balance, and is critical for cell survival. Normally, thioredoxin reductase (TrxR) maintains the cytosolic (Trx1) and mitochondrial (Trx2) thioredoxins in the reduced state, and the thioredoxins keep the...

  12. Aldose reductase regulates acrolein-induced cytotoxicity in human small airway epithelial cells

    OpenAIRE

    Yadav, Umesh CS; Ramana, KV; Srivastava, SK

    2013-01-01

    Aldose reductase (AR), a glucose metabolizing enzyme, reduces lipid aldehydes and their glutathione conjugates with more than 1000-fold efficiency (Km aldehydes 5-30μM) than glucose. Acrolein, a major endogenous lipid peroxidation product as well as component of environmental pollutant and cigarette smoke, is known to be involved in various pathologies including atherosclerosis, airway inflammation, COPD, and age-related disorders but the mechanism of acrolein-induced cytotoxicity is not clea...

  13. Regulation of assimilatory nitrate reductase activity in soil by microbial assimilation of ammonium.

    OpenAIRE

    McCarty, G.W.; Bremner, J. M.

    1992-01-01

    It is well established that assimilatory nitrate reductase (ANR) activity in soil is inhibited by ammonium (NH4+). To elucidate the mechanism of this inhibition, we studied the effect of L-methionine sulfoximine (MSX), an inhibitor of NH4+ assimilation by microorganisms, on assimilatory reduction of nitrate (NO3-) in aerated soil slurries treated with NH4+. We found that NH4+ strongly inhibited ANR activity in these slurries and that MSX eliminated this inhibition. We also found that MSX indu...

  14. Identification and Characterization of Inhibitors of Bacterial Enoyl-Acyl Carrier Protein Reductase

    OpenAIRE

    Ling, Losee L.; Xian, Jun; Ali, Syed; Geng, Bolin; Fan, Jun; Mills, Debra M.; Arvanites, Anthony C.; Orgueira, Hernan; Ashwell, Mark A.; Carmel, Gilles; Xiang, Yibin; Moir, Donald T.

    2004-01-01

    Bacterial enoyl-acyl carrier protein reductase (ENR) catalyzes an essential step in fatty acid biosynthesis. ENR is an attractive target for narrow-spectrum antibacterial drug discovery because of its essential role in metabolism and its sequence conservation across many bacterial species. In addition, the bacterial ENR sequence and structural organization are distinctly different from those of mammalian fatty acid biosynthesis enzymes. High-throughput screening to identify inhibitors of Esch...

  15. Dihydropteroate Synthase and Novel Dihydrofolate Reductase Gene Mutations in Strains of Pneumocystis jirovecii from South Africa

    OpenAIRE

    Robberts, F. J. L.; Chalkley, L J; Weyer, K.; Goussard, P.; Liebowitz, L. D.

    2005-01-01

    Dihydropteroate synthase (DHPS) gene mutations have raised concerns about emerging sulfonamide resistance in Pneumocystis jirovecii. DHPS and dihydrofolate reductase (DHFR) gene products were amplified in clinical specimens from South African patients. One of 53 DHPS genes sequenced contained the double mutation Thr55Ala Pro57Ser. DHFR gene mutations detected were Ala67Val and the new mutations Arg59Gly and C278T.

  16. Dihydrofolate reductase amplification and sensitization to methotrexate of methotrexate-resistant colon cancer cells

    DEFF Research Database (Denmark)

    Morales Torres, Christina; García, Maria J; Ribas, Maria;

    2009-01-01

    have analyzed the structure and dynamics of dihydrofolate reductase (DHFR) gene amplification in HT29 cells treated with methotrexate (MTX). Analysis of the DHFR gene amplification process shows that the amplicon exhibits a complex structure that is consistently reproduced in independent treatments...... responsive to a second round of treatment if left untreated during a sufficient period of time. [Mol Cancer Ther 2009;8(2):424-32]....

  17. Role of 5 alpha-reductase inhibitors in the management of prostate cancer

    OpenAIRE

    Hudak, Steven J.; Hernandez, Javier; Thompson, Ian M

    2006-01-01

    Prostate cancer is one of the most complex and enigmatic oncologic problems in medicine. It is highly prevalent, particularly in elderly males. Unfortunately, its generally protracted and variable clinical course and high association with treatment-related morbidity raise serious questions about the ideal treatment strategy for the individual patient. 5 alpha-reductase (5AR) inhibitors have a dramatic effect on benign prostatic disease with low toxicity. Thus, there is much interest in the po...

  18. Current Status of 5α-Reductase Inhibitors in Prostate Disease Management

    OpenAIRE

    Kang, Dong Il; Chung, Jae Il

    2013-01-01

    The key enzyme in the androgen synthesis and androgen receptor pathways is 5α-reductase (5-AR), which occurs as three isoenzymes. Types I and II 5-ARs the most important clinically, and two different 5-AR inhibitors (5-ARIs), finasteride and dutasteride, have been developed. Several urology associations have recommended and upgraded the use of 5-ARIs for an enlarged prostate with lower urinary tract symptoms. In the Prostate Cancer Prevention Trial and the Reduction by Dutasteride of Prostate...

  19. Epalrestat, an aldose reductase inhibitor, in diabetic neuropathy: An Indian perspective

    OpenAIRE

    Sharma S; Sharma Nalini

    2008-01-01

    Background: A number of diabetic patients with diabetic neuropathy, in India, were treated with epalrestat, an aldose reductase inhibitor. In this study, more than 2000 patients with diabetic neuropathy, who were treated with epalrestat for 3-12 months, were analyzed to assess the efficacy and the adverse reactions of the drug. Method: We analyzed the subjective symptoms (spontaneous pain, numbness, coldness and hypoesthesia) and the nerve function tests (motor nerve conduction velocity, s...

  20. Association of Blood Lead Levels with Methylenetetrahydrofolate Reductase Polymorphisms among Chinese Pregnant Women in Wuhan City

    OpenAIRE

    Shen, Wei; Zhang, Bin; Liu, Shuyun; Wu, Hongling; Gu, Xue; Qin, Lingzhi; Tian, Ping; Zeng, Yun; Ye, Linxiang; Ni, Zemin; Wang, Qi

    2015-01-01

    Background Pregnancy is an important stimulus of bone lead release. Elevated blood lead levels (BLLs) may cause adverse pregnancy outcomes for mothers and harmful lead effects on fetuses. However, the reports about maternal BLL changes during pregnancy are conflicting to some extent. This article is to explore the variations in BLLs among pregnant women. The relationships of BLLs with methylenetetrahydrofolate reductase (MTHFR) gene C677T, A1298C, and G1793A polymorphisms, which are associate...

  1. Altered expression of thioredoxin reductase-1 in dysplastic bile ducts and cholangiocarcinoma in a hamster model

    OpenAIRE

    Yoon, Byung-Il; Kim, Dae-Yong; Jang, Ja-June; Han, Jeong-Hee

    2006-01-01

    Thioredoxin reductase 1 (TrxR) is a homodimeric selenoenzyme catalyzing thioredoxin (Trx) in an NADPH-dependent manner. With regard to carcinogenesis, these redox proteins have been implicated in cell proliferation, transformation and anti-apoptosis. In the present study, using a hamster cholangiocarcinoma (ChC) model, we evaluated the immunohistochemical expression pattern of TrxR in precancerous lesions and ChCs as well as in normal bile ducts. The goal of this study was to determine the po...

  2. Anxiety and Methylenetetrahydrofolate Reductase Mutation Treated With S-Adenosyl Methionine and Methylated B Vitamins.

    Science.gov (United States)

    Anderson, Shanna; Panka, Jacob; Rakobitsch, Robin; Tyre, Kaitlin; Pulliam, Kerry

    2016-04-01

    This case report highlights challenges faced in the clinical management of patients with methylenetetrahydrofolate reductase (MTHFR) gene mutations and the importance of precise dosage when recommending methylated B vitamins to compensate for deficiencies caused by the polymorphism or symptoms related to the polymorphism. It also underscores the importance of obtaining ongoing objective assessments of anxiety (eg, Patient Reported Outcomes Measurement Information System, or PROMIS) to help gauge patient response. PMID:27330489

  3. Influence of methylene tetrahydrofolate reductase polymorphisms and coadministration of antimetabolites on toxicity after high dose methotrexate

    DEFF Research Database (Denmark)

    Niekerk, P.B. van Kooten; Schmiegelow, K.; Schroeder, H.

    2008-01-01

    BACKGROUND AND OBJECTIVE: Through interruption of maintenance treatment with 6-mercaptopurine (6MP), toxicity after high-dose methotrexate (HDMTX) may compromise the efficiency of the treatment of children with acute lymphocytic leukaemia (ALL). We investigated the influence of polymorphisms in the...... methylene tetrahydrofolate reductase (MTHFR) gene and coadministration of antimetabolites on post-HDMTX toxicity. METHODS: Toxicity was retrospectively analysed after 656 HDMTX courses administered to 88 paediatric ALL patients at a single treatment centre. RESULTS: High-dose methotrexate with high...

  4. Astaxanthin prevents changes in the activities of thioredoxin reductase and paraoxonase in hypercholesterolemic rabbits

    OpenAIRE

    Paula R. Augusti; Quatrin, Andréia; Somacal, Sabrina; Conterato, Greicy MM; Sobieski, Rocheli; Ruviaro, Amanda R; Maurer, Luana H; Duarte, Marta MF; Roehrs, Miguel; Emanuelli, Tatiana

    2012-01-01

    This study explored the effects of the antioxidant astaxanthin on paraoxonase and thioredoxin reductase activities as well as on other oxidative stress parameters and on the lipid profile in hypercholesterolemic rabbits. Rabbits were fed a standard or a hypercholesterolemic diet alone or supplemented with 50, 100 and 500 mg/100 g of astaxanthin for 60 days. Antioxidant enzymes activities, lipid profile and oxidative stress markers were evaluated in the serum. The hypercholesterolemic diet inc...

  5. The Silkworm Mutant lemon (lemon lethal) Is a Potential Insect Model for Human Sepiapterin Reductase Deficiency*

    OpenAIRE

    Meng, Yan; Katsuma, Susumu; Daimon, Takaaki; Banno, Yutaka; Uchino, Keiro; Sezutsu, Hideki; Tamura, Toshiki; Mita, Kazuei; Shimada, Toru

    2009-01-01

    Tetrahydrobiopterin (BH4) is an essential cofactor for aromatic acid hydroxylases, which control the levels of monoamine neurotransmitters. BH4 deficiency has been associated with many neuropsychological disorders. An inherited defect in BH4 biosynthesis is caused by the deficiency of sepiapterin reductase (SPR), which catalyzes the biosynthesis of BH4 from guanosine triphosphate at the terminal step. The human SPR gene has been mapped at the PARK3 locus, which is rela...

  6. Diversity, abundance and expression of nitrite reductase (nirK)-like genes in marine thaumarchaea

    OpenAIRE

    Lund, Marie B; Smith, Jason M.; Francis, Christopher A.

    2012-01-01

    Ammonia-oxidizing archaea (AOA) are widespread and abundant in aquatic and terrestrial habitats and appear to have a significant impact on the global nitrogen cycle. Like the ammonia-oxidizing bacteria, AOA encode a gene homologous to copper-containing nitrite reductases (nirK), which has been studied very little to date. In this study, the diversity, abundance and expression of thaumarchaeal nirK genes from coastal and marine environments were investigated using two mutually excluding primer...

  7. Single-Cell Analysis of Ribonucleotide Reductase Transcriptional and Translational Response to DNA Damage

    OpenAIRE

    Mazumder, Aprotim; Tummler, Katja; Bathe, Mark; Samson, Leona D.

    2013-01-01

    The ribonucleotide reductase (RNR) enzyme catalyzes an essential step in the production of deoxyribonucleotide triphosphates (dNTPs) in cells. Bulk biochemical measurements in synchronized Saccharomyces cerevisiae cells suggest that RNR mRNA production is maximal in late G1 and S phases; however, damaged DNA induces RNR transcription throughout the cell cycle. But such en masse measurements reveal neither cell-to-cell heterogeneity in responses nor direct correlations between transcript and p...

  8. Serum total sialic acid, lipid peroxidation, and glutathione reductase levels in patients with rheumatoid arthritis

    OpenAIRE

    Mohan, Surapaneni Krishna; PRIYAV, Vishnu

    2010-01-01

    The changes in the serum sialic acid levels, total lipid peroxidation products (MDA), and glutathione reductase activity were estimated in patients with rheumatoid arthritis. Serum Sialic acid is known as a parameter of inflammation. This work was undertaken to assess the potential role of sialic acid as well as oxidative stress and antioxidant status in patients with rheumatoid arthritis. Materials and methods: The levels of these parameters in serum were studied in 52 subjects with rheuma...

  9. The anaerobic ribonucleoside triphosphate reductase from Escherichia coli requires S-adenosylmethionine as a cofactor.

    OpenAIRE

    Eliasson, R; Fontecave, M; Jörnvall, H; Krook, M; Pontis, E; Reichard, P

    1990-01-01

    Extracts from anaerobically grown Escherichia coli contain an oxygen-sensitive activity that reduces CTP to dCTP in the presence of NADPH, dithiothreitol, Mg2+ ions, and ATP, different from the aerobic ribonucleoside diphosphate reductase (2'-deoxyribonucleoside-diphosphate: oxidized-thioredoxin 2'-oxidoreductase, EC 1.17.4.1) present in aerobically grown E. coli. After fractionation, the activity required at least five components, two heat-labile protein fractions and several low molecular w...

  10. Menthofuran regulates essential oil biosynthesis in peppermint by controlling a downstream monoterpene reductase

    OpenAIRE

    Mahmoud, Soheil S.; Croteau, Rodney B.

    2003-01-01

    (+)-Pulegone is a central intermediate in the biosynthesis of (-)-menthol, the most significant component of peppermint essential oil. Depending on environmental conditions, this branch point metabolite may be reduced to (-)-menthone en route to menthol, by pulegone reductase (PR), or oxidized to (+)-menthofuran, by menthofuran synthase (MFS). To elucidate regulation of pulegone metabolism, we modified the expression of mfs under control of the CaMV 35S promoter in transformed peppermint plan...

  11. Disruption of the plr1+ gene encoding pyridoxal reductase of Schizosaccharomyces pombe.

    Science.gov (United States)

    Morita, Tomotake; Takegawa, Kaoru; Yagi, Toshiharu

    2004-02-01

    Pyridoxal (PL) reductase encoded by the plr1(+) gene practically catalyzes the irreversible reduction of PL by NADPH to form pyridoxine (PN). The enzyme has been suggested to be involved in the salvage synthesis of pyridoxal 5'-phosphate (PLP), a coenzyme form of vitamin B(6), or the excretion of PL as PN from yeast cells. In this study, a PL reductase-disrupted (plr1 Delta) strain was constructed and its phenotype was examined. The plr1 Delta cells showed almost the same growth curve as that of wild-type cells in YNB and EMM media. In EMM, the plr1 Delta strain became flocculent at the late stationary phase for an unknown reason. The plr1 Delta cells showed low but measurable PL reductase activity catalyzed by some other protein(s) than the enzyme encoded by the plr1(+) gene, which maintained the flow of "PL --> PN --> PNP --> PLP" in the salvage synthesis of PLP. The total vitamin B(6) and pyridoxamine 5'-phosphate contents in the plr1 Delta cells were significantly lower than those in the wild-type ones. The percentages of the PLP amount as to the other vitamin B(6) compounds were similar in the two cell types. The amount of PL in the culture medium of the disruptant was significantly higher than that in the wild-type. In contrast, PN was much higher in the latter than the former. The plr1 Delta cells accumulated a 6.1-fold higher amount of PL than the wild-type ones when they were incubated with PL. The results showed that PL reductase encoded by the plr1(+ )gene is involved in the excretion of PL after reducing it to PN, and may not participate in the salvage pathway for PLP synthesis. PMID:15047724

  12. Nitrate reductase assay using sodium nitrate for rapid detection of multidrug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Maíra Bidart Macedo

    2012-09-01

    Full Text Available We validated the nitrate reductase assay (NRA for the detection of multidrug-resistant Mycobacterium tuberculosis (MDR-TB using sodium nitrate (NaNO3 in replacement of potassium nitrate (KNO3 as nitrate source. NaNO3 is cheaper than KNO3 and has no restriction on use which facilitates the implementation of NRA to detect MDR-TB.

  13. Methyl-hydroxylamine as an efficacious antibacterial agent that targets the ribonucleotide reductase enzyme

    OpenAIRE

    Julián Gómez, Esther; Baelo, Aida; Gavaldà Santapau, Juan; Torrents Serra, Eduard

    2015-01-01

    The emergence of multidrug-resistant bacteria has encouraged vigorous efforts to develop antimicrobial agents with new mechanisms of action. Ribonucleotide reductase (RNR) is a key enzyme in DNA replication that acts by converting ribonucleotides into the corresponding deoxyribonucleotides, which are the building blocks of DNA replication and repair. RNR has been extensively studied as an ideal target for DNA inhibition, and several drugs that are already available on the market are used for ...

  14. Mutational analysis of the triclosan-binding region of enoyl-ACP reductase from Plasmodium falciparum

    OpenAIRE

    Kapoor, Mili; Gopalakrishnapai, Jayashree; Surolia, Namita; Surolia, Avadhesha

    2004-01-01

    Triclosan, a known antibacterial, acts by inhibiting enoyl-ACP (acyl-carrier protein) reductase (ENR), a key enzyme of the type II fatty acid synthesis (FAS) system. Plasmodium falciparum, the human malaria-causing parasite, harbours the type II FAS; in contrast. its human host utilizes type I FAS. Due to this striking difference, ENR has emerged as an important target for the development of new antimalarials. Modelling studies, and the crystal structure of P.falciparum ENR, have highlighted ...

  15. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots

    OpenAIRE

    Grażyna Kłobus

    2014-01-01

    Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC 1.6.6.4) activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides ...

  16. Major peptides from amaranth (Amaranthus cruentus) protein inhibit HMG-CoA reductase activity.

    Science.gov (United States)

    Soares, Rosana Aparecida Manólio; Mendonça, Simone; de Castro, Luíla Ívini Andrade; Menezes, Amanda Caroline Cardoso Corrêa Carlos; Arêas, José Alfredo Gomes

    2015-01-01

    The objective of this study was to identify the major peptides generated by the in vitro hydrolysis of Amaranthus cruentus protein and to verify the effect of these peptides on the activity of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA reductase), a key enzyme in cholesterol biosynthesis. A protein isolate was prepared, and an enzymatic hydrolysis that simulated the in vivo digestion of the protein was performed. After hydrolysis, the peptide mixture was filtered through a 3 kDa membrane. The peptide profile of this mixture was determined by reversed phase high performance chromatography (RP-HPLC), and the peptide identification was performed by LC-ESI MS/MS. Three major peptides under 3 kDa were detected, corresponding to more than 90% of the peptides of similar size produced by enzymatic hydrolysis. The sequences identified were GGV, IVG or LVG and VGVI or VGVL. These peptides had not yet been described for amaranth protein nor are they present in known sequences of amaranth grain protein, except LVG, which can be found in amaranth α‑amylase. Their ability to inhibit the activity of HMG-CoA reductase was determined, and we found that the sequences GGV, IVG, and VGVL, significantly inhibited this enzyme, suggesting a possible hypocholesterolemic effect. PMID:25690031

  17. Major Peptides from Amaranth (Amaranthus cruentus Protein Inhibit HMG-CoA Reductase Activity

    Directory of Open Access Journals (Sweden)

    Rosana Aparecida Manólio Soares

    2015-02-01

    Full Text Available The objective of this study was to identify the major peptides generated by the in vitro hydrolysis of Amaranthus cruentus protein and to verify the effect of these peptides on the activity of 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA reductase, a key enzyme in cholesterol biosynthesis. A protein isolate was prepared, and an enzymatic hydrolysis that simulated the in vivo digestion of the protein was performed. After hydrolysis, the peptide mixture was filtered through a 3 kDa membrane. The peptide profile of this mixture was determined by reversed phase high performance chromatography (RP-HPLC, and the peptide identification was performed by LC-ESI MS/MS. Three major peptides under 3 kDa were detected, corresponding to more than 90% of the peptides of similar size produced by enzymatic hydrolysis. The sequences identified were GGV, IVG or LVG and VGVI or VGVL. These peptides had not yet been described for amaranth protein nor are they present in known sequences of amaranth grain protein, except LVG, which can be found in amaranth α‑amylase. Their ability to inhibit the activity of HMG-CoA reductase was determined, and we found that the sequences GGV, IVG, and VGVL, significantly inhibited this enzyme, suggesting a possible hypocholesterolemic effect.

  18. A preliminary study on estimating extra-cellular nitrate reductase activities in estuarine systems

    Directory of Open Access Journals (Sweden)

    Pant H. K.

    2009-07-01

    Full Text Available Enzymes catalyzing ammonium (NH4+/nitrate (NO3– into nitrous oxide (N2O/molecular nitrogen (N2, play critical roles in water quality management. The objective of this paper was to investigate the role of extra-cellular enzymes in cycling of nitrogen (N in aquatic systems. It appears that N in estuaries, salt marshes, etc., does not stay long enough to be available for uptake, thus, creating N limited conditions. This study showed that indigenous extra-cellular nitrate reductase along with others involved in N transformations in the waters/sediments of estuarine systems can cause complete removal of NH4+ and NO3– from the waters and available NH4+ and NO3– from the sediments. These results indicate that due to high extra-cellular nitrate reductase and other enzymes associated with N transformations in sediments/waters, substantial amounts of NH4+ and NO3– can be quickly lost from the systems as N2O and/or nitric oxide (NO, in turn, creating N limited conditions in estuarine systems. Such high activities of indigenous nitrate reductase and others are useful in removing readily bioavailable N from the systems, thereby avoidance of eutrophic conditions. However, they might contribute in increasing the N2O, a potent greenhouse gas with global warming potential (GWP of 296, in the atmosphere.

  19. 5alpha-reductase inhibitors in benign prostatic hyperplasia and prostate cancer risk reduction.

    Science.gov (United States)

    Rittmaster, Roger S

    2008-04-01

    Androgens play an essential role in prostatic development and function, but are also involved in prostate disease pathogenesis. The primary prostatic androgen, dihydrotestosterone (DHT), is synthesized from testosterone by 5alpha-reductase types 1 and 2. Inhibition of the 5alpha-reductase isoenzymes therefore has potential therapeutic benefit in prostate disease. The two currently approved 5alpha-reductase inhibitors (5ARIs), finasteride and dutasteride, have demonstrated long-term efficacy and safety in the treatment of benign prostatic hyperplasia. Finasteride, a type-2 5ARI, has also been studied for its ability to reduce the incidence of biopsy-detectable prostate cancer in the Prostate Cancer Prevention Trial. Treatment with dutasteride, a dual 5ARI, has been shown to result in a greater degree and consistency of DHT suppression compared with finasteride. Two large-scale studies of dutasteride are currently investigating the role of near-maximal DHT suppression in the settings of prostate cancer risk reduction and expectant management of localized prostate cancer. PMID:18471794

  20. Inhibition of 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase (Ex Vivo by Morus indica (Mulberry

    Directory of Open Access Journals (Sweden)

    Vanitha Reddy Palvai

    2014-01-01

    Full Text Available Phytochemicals are the bioactive components that contribute to the prevention of cardiovascular and other degenerative diseases. Inhibition of 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA reductase would be an effective means of lowering plasma cholesterol in humans. The present study explores the HMG CoA reductase inhibitory effect of extracts from leaves of Morus indica varieties, M5, V1, and S36, compared with the statin, using an ex vivo method. The assay is based on the stoichiometric formation of coenzyme A during the reduction of microsomal HMG CoA to mevalonate. Dechlorophyllised extract of three varieties was studied at 300 µg. The coenzyme A released at the end of assay in control (100.31 nmoles and statins (94.46 nm was higher than the dechlorphyllised extracts of the samples. The coenzyme A released during the reduction of HMG CoA to mevalonate in dechlorophyllised extracts of the samples was as follows: S36 < M5 < V1. The results indicated that the samples were highly effective in inhibiting the enzyme compared to statins (standard drug. The results indicate the role of Morus varieties extracts in modulating the cholesterol metabolism by inhibiting the activity of HMG CoA reductase. These results provide scope for designing in vivo animal studies to confirm their effect.

  1. Glutathione reductase gsr-1 is an essential gene required for Caenorhabditis elegans early embryonic development.

    Science.gov (United States)

    Mora-Lorca, José Antonio; Sáenz-Narciso, Beatriz; Gaffney, Christopher J; Naranjo-Galindo, Francisco José; Pedrajas, José Rafael; Guerrero-Gómez, David; Dobrzynska, Agnieszka; Askjaer, Peter; Szewczyk, Nathaniel J; Cabello, Juan; Miranda-Vizuete, Antonio

    2016-07-01

    Glutathione is the most abundant thiol in the vast majority of organisms and is maintained in its reduced form by the flavoenzyme glutathione reductase. In this work, we describe the genetic and functional analysis of the Caenorhabditis elegans gsr-1 gene that encodes the only glutathione reductase protein in this model organism. By using green fluorescent protein reporters we demonstrate that gsr-1 produces two GSR-1 isoforms, one located in the cytoplasm and one in the mitochondria. gsr-1 loss of function mutants display a fully penetrant embryonic lethal phenotype characterized by a progressive and robust cell division delay accompanied by an aberrant distribution of interphasic chromatin in the periphery of the cell nucleus. Maternally expressed GSR-1 is sufficient to support embryonic development but these animals are short-lived, sensitized to chemical stress, have increased mitochondrial fragmentation and lower mitochondrial DNA content. Furthermore, the embryonic lethality of gsr-1 worms is prevented by restoring GSR-1 activity in the cytoplasm but not in mitochondria. Given the fact that the thioredoxin redox systems are dispensable in C. elegans, our data support a prominent role of the glutathione reductase/glutathione pathway in maintaining redox homeostasis in the nematode. PMID:27117030

  2. Influence of nitrogen supply on spring barley productivity and nitrate reductase activity

    Directory of Open Access Journals (Sweden)

    U. Wojcieska

    2013-12-01

    Full Text Available The aim of the present study was to obtain some informations on the productivity of four chosen barley varieties growing at low and high nitrogen level. Some parameters of the yield structure and nitrate reductase activity were taken into consideration. It was found that there exist some differences in the yield between the compared varieties and some differences in their reaction to a high N level in the soil. The grain yield increase of the plants treated with high nitrogen doses was above all the result of the increase in dry matter of the lateral shoots and in leaf area. Distinct increase in the number of grains per ear and 1000-grains weight was also observed. The amount of reduced nitrogen collected during the growth season depended, in part, on the nitrate reductase activity and in part on the amount of the enzyme present in the plant. A rise of the nitrogen level caused an increase in nitrate reductase activity, in all varieties. The different influence of nitrogen on the growth of green organs in the compared varieties caused differences in the amount of the enzyme present in the plants and in protein yields.

  3. Progesterone 5β-reductase genes of the Brassicaceae family as function-associated molecular markers.

    Science.gov (United States)

    Munkert, J; Costa, C; Budeanu, O; Petersen, J; Bertolucci, S; Fischer, G; Müller-Uri, F; Kreis, W

    2015-11-01

    This study aimed to define progesterone 5β-reductases (P5βR, EC 1.3.99.6, enone 1,4-reductases) as function-associated molecular markers at the plant family level. Therefore cDNAs were isolated from 25 Brassicaceae species, including two species, Erysimum crepidifolium and Draba aizoides, known to produce cardiac glycosides. The sequences were used in a molecular phylogeny study. The cladogram created is congruent to the existing molecular analyses. Recombinant His-tagged forms of the P5βR cDNAs from Aethionema grandiflorum, Draba aizoides, Nasturtium officinale, Raphanus sativus and Sisymbrium officinale were expressed in E. coli. Enone 1,4-reductase activity was demonstrated in vitro using progesterone and 2-cyclohexen-1-one as substrates. Evidence is provided that functional P5βRs are ubiquitous in the Brassicaceae. The recombinant P5βR enzymes showed different substrate preferences towards progesterone and 2-cyclohexen-1-one. Sequence comparison of the catalytic pocket of the P5βR enzymes and homology modelling using Digitalis lanata P5βR (PDB ID: 2V6G) as template highlighted the importance of the hydrophobicity of the binding pocket for substrate discrimination. It is concluded that P5βR genes or P5βR proteins can be used as valuable function-associated molecular markers to infer taxonomic relationship and evolutionary diversification from a metabolic/catalytic perspective. PMID:26108256

  4. Soil acidity as affecting micronutrients concentration, nitrato reductase enzyme activity and yield in upland rice plants

    Directory of Open Access Journals (Sweden)

    Edemar Moro

    2013-12-01

    Full Text Available The lowest grain yield of rice under no-tillage system (NTS in relation to the conventional system may be due to the predominance nitrate in the soil and the low nitrate reductase activity. Another reason may be caused by micronutrient deficiency because of superficially soil acidity corrections. Therefore, the objective of this study was to evaluate the changes caused by soil pH in the N forms in the soil, micronutrients concentration in rice plants, nitrate reductase activity, yield of rice and its components. The experiment was performed in a greenhouse conditions. The experimental design was a completely randomized in a factorial three (levels of soil acidity x five (micronutrients sources with four replications. The addition of micronutrients does not affect levels of nitrate and ammonium in the soil; soil acidity significantly affects levels of nitrate and ammonium in the soil, concentration of micronutrients in rice plants and crop yield and its components; medium soil acidity (pH 5.5 result in medium to high levels of Cu and Fe, medium level of Zn and Mn, high nitrate reductase activity, resulting in higher dry matter, tillers, panicles, spikelets, weight of 100 grains and hence grain yield.

  5. Overexpression of Soybean Isoflavone Reductase (GmIFR) Enhances Resistance to Phytophthora sojae in Soybean.

    Science.gov (United States)

    Cheng, Qun; Li, Ninghui; Dong, Lidong; Zhang, Dayong; Fan, Sujie; Jiang, Liangyu; Wang, Xin; Xu, Pengfei; Zhang, Shuzhen

    2015-01-01

    Isoflavone reductase (IFR) is an enzyme involved in the biosynthetic pathway of isoflavonoid phytoalexin in plants. IFRs are unique to the plant kingdom and are considered to have crucial roles in plant response to various biotic and abiotic environmental stresses. Here, we report the characterization of a novel member of the soybean isoflavone reductase gene family GmIFR. Overexpression of GmIFR transgenic soybean exhibited enhanced resistance to Phytophthora sojae. Following stress treatments, GmIFR was significantly induced by P. sojae, ethephon (ET), abscisic acid (placeCityABA), salicylic acid (SA). It is located in the cytoplasm when transiently expressed in soybean protoplasts. The daidzein levels reduced greatly for the seeds of transgenic plants, while the relative content of glyceollins in transgenic plants was significantly higher than that of non-transgenic plants. Furthermore, we found that the relative expression levels of reactive oxygen species (ROS) of transgenic soybean plants were significantly lower than those of non-transgenic plants after incubation with P. sojae, suggesting an important role of GmIFR might function as an antioxidant to reduce ROS in soybean. The enzyme activity assay suggested that GmIFR has isoflavone reductase activity. PMID:26635848

  6. Targeting 5α-reductase for prostate cancer prevention and treatment.

    Science.gov (United States)

    Nacusi, Lucas P; Tindall, Donald J

    2011-07-01

    Testosterone is the most abundant circulating androgen, and can be converted to dihydrotestosterone (DHT), a more potent androgen, by the 5α-reductase enzymes in target tissues. Current treatments for prostate cancer consist of reducing androgen levels by chemical or surgical castration or pure antiandrogen therapy that directly targets the androgen receptor (AR). Although these therapies reduce tumor burden and AR activity, the cancer inevitably recurs within 18-30 months. An approach targeting the androgen-AR axis at different levels could, therefore, improve the efficacy of prostate cancer therapy. Inhibition of 5α-reductase is one such approach; however, the two largest trials to investigate the use of the 5α-reductase inhibitors (5ARIs) finasteride and dutasteride in patients with prostate cancer have shown that, although the incidence of cancer was reduced by 5ARI treatment, those cancers that were detected were more aggressive than in patients treated with placebo. Thus, the best practice for using these drugs to prevent and treat prostate cancer remains unclear. PMID:21629218

  7. 5α-Reductase Type 2 Regulates Glucocorticoid Action and Metabolic Phenotype in Human Hepatocytes.

    Science.gov (United States)

    Nasiri, Maryam; Nikolaou, Nikolaos; Parajes, Silvia; Krone, Nils P; Valsamakis, George; Mastorakos, George; Hughes, Beverly; Taylor, Angela; Bujalska, Iwona J; Gathercole, Laura L; Tomlinson, Jeremy W

    2015-08-01

    Glucocorticoids and androgens have both been implicated in the pathogenesis of nonalcoholic fatty liver disease (NAFLD); androgen deficiency in males, androgen excess in females, and glucocorticoid excess in both sexes are associated with NAFLD. Glucocorticoid and androgen action are regulated at a prereceptor level by the enzyme 5α-reductase type 2 (SRD5A2), which inactivates glucocorticoids to their dihydrometabolites and converts T to DHT. We have therefore explored the role of androgens and glucocorticoids and their metabolism by SRD5A2 upon lipid homeostasis in human hepatocytes. In both primary human hepatocytes and human hepatoma cell lines, glucocorticoids decreased de novo lipogenesis in a dose-dependent manner. Whereas androgen treatment (T and DHT) increased lipogenesis in cell lines and in primary cultures of human hepatocytes from female donors, it was without effect in primary hepatocyte cultures from men. SRD5A2 overexpression reduced the effects of cortisol to suppress lipogenesis and this effect was lost following transfection with an inactive mutant construct. Conversely, pharmacological inhibition using the 5α-reductase inhibitors finasteride and dutasteride augmented cortisol action. We have demonstrated that manipulation of SRD5A2 activity can regulate lipogenesis in human hepatocytes in vitro. This may have significant clinical implications for those patients prescribed 5α-reductase inhibitors, in particular augmenting the actions of glucocorticoids to modulate hepatic lipid flux. PMID:25974403

  8. Aldose Reductase Inhibitory Activity of Compounds from  Zea mays L.

    Directory of Open Access Journals (Sweden)

    Tae Hyeon Kim

    2013-01-01

    Full Text Available Aldose reductase (AR inhibitors have a considerable therapeutic potential against diabetes complications and do not increase the risk of hypoglycemia. Through bioassay-guided fractionation of an EtOH extract of the kernel from purple corn (Zea mays L., 7 nonanthocyanin phenolic compounds (compound 1–7 and 5 anthocyanins (compound 8–12 were isolated. These compounds were investigated by rat lens aldose reductase (RLAR inhibitory assays. Kinetic analyses of recombinant human aldose reductase (rhAR were performed, and intracellular galactitol levels were measured. Hirsutrin, one of 12 isolated compounds, showed the most potent RLAR inhibitory activity (IC50, 4.78 μM. In the kinetic analyses using Lineweaver-Burk plots of 1/velocity and 1/substrate concentration, hirsutrin showed competitive inhibition against rhAR. Furthermore, hirsutrin inhibited galactitol formation in rat lens and erythrocytes sample incubated with a high concentration of galactose; this finding indicates that hirsutrin may effectively prevent osmotic stress in hyperglycemia. Therefore, hirsutrin derived from Zea mays L. may be a potential therapeutic agent against diabetes complications.

  9. Evaluation of the Activities of Pyrimethamine Analogs against Plasmodium vivax and Plasmodium falciparum Dihydrofolate Reductase-Thymidylate Synthase Using In Vitro Enzyme Inhibition and Bacterial Complementation Assays▿

    OpenAIRE

    Bunyarataphan, Sasinee ; Leartsakulpanich, Ubolsree; Taweechai, Supannee; Tarnchompoo, Bongkoch; Kamchonwongpaisan, Sumalee; Yuthavong, Yongyuth

    2006-01-01

    Pyrimethamine analogs were examined as potential agents against vivax malaria using a bacterial surrogate system carrying Plasmodium vivax dihydrofolate reductase-thymidylate synthase (PvDHFR-TS), in which the PvDHFR complemented chemically knocked out host dihydrofolate reductase. The system was initially tested with P. falciparum dihydrofolate reductase-thymidylate synthase and was found to have good correlation with the parasite-based system. The 50% inhibitory concentrations derived from ...

  10. Triclosan Resistance of Pseudomonas aeruginosa PAO1 Is Due to FabV, a Triclosan-Resistant Enoyl-Acyl Carrier Protein Reductase

    OpenAIRE

    Zhu, Lei; Lin, Jinshui; Ma, Jincheng; Cronan, John E.; Wang, Haihong

    2009-01-01

    Triclosan, a very widely used biocide, specifically inhibits fatty acid synthesis by inhibition of enoyl-acyl carrier protein (ACP) reductase. Escherichia coli FabI is the prototypical triclosan-sensitive enoyl-ACP reductase, and E. coli is extremely sensitive to the biocide. However, other bacteria are resistant to triclosan, because they encode triclosan-resistant enoyl-ACP reductase isozymes. In contrast, the triclosan resistance of Pseudomonas aeruginosa PAO1 has been attributed to active...

  11. Comparing the xylose reductase/xylitol dehydrogenase and xylose isomerase pathways in arabinose and xylose fermenting Saccharomyces cerevisiae strains

    Science.gov (United States)

    Bettiga, Maurizio; Hahn-Hägerdal, Bärbel; Gorwa-Grauslund, Marie F

    2008-01-01

    Background Ethanolic fermentation of lignocellulosic biomass is a sustainable option for the production of bioethanol. This process would greatly benefit from recombinant Saccharomyces cerevisiae strains also able to ferment, besides the hexose sugar fraction, the pentose sugars, arabinose and xylose. Different pathways can be introduced in S. cerevisiae to provide arabinose and xylose utilisation. In this study, the bacterial arabinose isomerase pathway was combined with two different xylose utilisation pathways: the xylose reductase/xylitol dehydrogenase and xylose isomerase pathways, respectively, in genetically identical strains. The strains were compared with respect to aerobic growth in arabinose and xylose batch culture and in anaerobic batch fermentation of a mixture of glucose, arabinose and xylose. Results The specific aerobic arabinose growth rate was identical, 0.03 h-1, for the xylose reductase/xylitol dehydrogenase and xylose isomerase strain. The xylose reductase/xylitol dehydrogenase strain displayed higher aerobic growth rate on xylose, 0.14 h-1, and higher specific xylose consumption rate in anaerobic batch fermentation, 0.09 g (g cells)-1 h-1 than the xylose isomerase strain, which only reached 0.03 h-1 and 0.02 g (g cells)-1h-1, respectively. Whereas the xylose reductase/xylitol dehydrogenase strain produced higher ethanol yield on total sugars, 0.23 g g-1 compared with 0.18 g g-1 for the xylose isomerase strain, the xylose isomerase strain achieved higher ethanol yield on consumed sugars, 0.41 g g-1 compared with 0.32 g g-1 for the xylose reductase/xylitol dehydrogenase strain. Anaerobic fermentation of a mixture of glucose, arabinose and xylose resulted in higher final ethanol concentration, 14.7 g l-1 for the xylose reductase/xylitol dehydrogenase strain compared with 11.8 g l-1 for the xylose isomerase strain, and in higher specific ethanol productivity, 0.024 g (g cells)-1 h-1 compared with 0.01 g (g cells)-1 h-1 for the xylose reductase

  12. Comparing the xylose reductase/xylitol dehydrogenase and xylose isomerase pathways in arabinose and xylose fermenting Saccharomyces cerevisiae strains

    Directory of Open Access Journals (Sweden)

    Hahn-Hägerdal Bärbel

    2008-10-01

    Full Text Available Abstract Background Ethanolic fermentation of lignocellulosic biomass is a sustainable option for the production of bioethanol. This process would greatly benefit from recombinant Saccharomyces cerevisiae strains also able to ferment, besides the hexose sugar fraction, the pentose sugars, arabinose and xylose. Different pathways can be introduced in S. cerevisiae to provide arabinose and xylose utilisation. In this study, the bacterial arabinose isomerase pathway was combined with two different xylose utilisation pathways: the xylose reductase/xylitol dehydrogenase and xylose isomerase pathways, respectively, in genetically identical strains. The strains were compared with respect to aerobic growth in arabinose and xylose batch culture and in anaerobic batch fermentation of a mixture of glucose, arabinose and xylose. Results The specific aerobic arabinose growth rate was identical, 0.03 h-1, for the xylose reductase/xylitol dehydrogenase and xylose isomerase strain. The xylose reductase/xylitol dehydrogenase strain displayed higher aerobic growth rate on xylose, 0.14 h-1, and higher specific xylose consumption rate in anaerobic batch fermentation, 0.09 g (g cells-1 h-1 than the xylose isomerase strain, which only reached 0.03 h-1 and 0.02 g (g cells-1h-1, respectively. Whereas the xylose reductase/xylitol dehydrogenase strain produced higher ethanol yield on total sugars, 0.23 g g-1 compared with 0.18 g g-1 for the xylose isomerase strain, the xylose isomerase strain achieved higher ethanol yield on consumed sugars, 0.41 g g-1 compared with 0.32 g g-1 for the xylose reductase/xylitol dehydrogenase strain. Anaerobic fermentation of a mixture of glucose, arabinose and xylose resulted in higher final ethanol concentration, 14.7 g l-1 for the xylose reductase/xylitol dehydrogenase strain compared with 11.8 g l-1 for the xylose isomerase strain, and in higher specific ethanol productivity, 0.024 g (g cells-1 h-1 compared with 0.01 g (g cells-1 h-1

  13. HMG-CoA reductase inhibitory activity and phytocomponent investigation of Basella alba leaf extract as a treatment for hypercholesterolemia

    Directory of Open Access Journals (Sweden)

    Baskaran G

    2015-01-01

    Full Text Available Gunasekaran Baskaran,1 Shamala Salvamani,1 Siti Aqlima Ahmad,1 Noor Azmi Shaharuddin,1 Parveen Devi Pattiram,2 Mohd Yunus Shukor1 1Department of Biochemistry, Faculty of Biotechnology and Biomolecular Sciences, 2Department of Food Technology, Faculty of Food Science and Technology, Universiti Putra Malaysia, Selangor, Malaysia Abstract: The enzyme 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA reductase is the key enzyme of the mevalonate pathway that produces cholesterol. Inhibition of HMG-CoA reductase reduces cholesterol biosynthesis in the liver. Synthetic drugs, statins, are commonly used for the treatment of hypercholesterolemia. Due to the side effects of statins, natural HMG-CoA reductase inhibitors of plant origin are needed. In this study, 25 medicinal plant methanol extracts were screened for anti-HMG-CoA reductase activity. Basella alba leaf extract showed the highest inhibitory effect at about 74%. Thus, B. alba was examined in order to investigate its phytochemical components. Gas chromatography with tandem mass spectrometry and reversed phase high-performance liquid chromatography analysis revealed the presence of phenol 2,6-bis(1,1-dimethylethyl, 1-heptatriacotanol, oleic acid, eicosyl ester, naringin, apigenin, luteolin, ascorbic acid, and a-tocopherol, which have been reported to possess antihypercholesterolemic effects. Further investigation of in vivo models should be performed in order to confirm its potential as an alternative treatment for hypercholesterolemia and related cardiovascular diseases. Keywords: HMG-CoA reductase, Basella alba, phytochemical, GC-MS/MS, RP-HPLC, hypercholesterolemia

  14. 5α—reductase type 2 gene expression in human testis,epididymis and vas deferens

    Institute of Scientific and Technical Information of China (English)

    LiuDY; WuYW

    2002-01-01

    Objective:To study the expression patterm of 5-α-reductase type 2 gene in human male reproductive organs.Methods:The expression level of 5α-reductase type 2 gene in human testis,epididymis and vas deferens tissues was determined by in situ hybridization using a digoxin-labeled 5α-reductase type 2 cRNA probe.Results:The brown granules of hybridizing signals distributed in the cytoplasm of the Sertoli and Leydig cells of the testis,the principle cells of epididymis and the epithelial cells of vas deferens,but there was no positive signal in the nuclei of these cellsNo positive signal was observed in the germ cells,basement of the testis, interstium of the epididymis and basement and the smooth muscle cells of vas deferens.conclusion:This study confirmed that the 5α-reductase type 2 gene expressed in the Sertoli and Leydig cells of the testis and the principle cells of the epididymis.The expression pattern of the gene in these cells in the human was similar to that in the rat and monkey.The presence of 5α-reductase type 2 gene in the epithelial cells of the vas deferens suggests that it may play a physiological role in human reproduction.

  15. Downregulation of thioredoxin reductase 1 expression in the substantia nigra pars compacta of Parkinson’s disease mice

    Institute of Scientific and Technical Information of China (English)

    Zihua Liu; Yuhong Jing; Jie Yin; Jiying Mu; Tingting Yao; Liping Gao

    2013-01-01

    Because neurons are susceptible to oxidative damage and thioredoxin reductase 1 is extensively distributed in the central nervous system and has antioxidant properties, we speculated that the enzyme may be involved in the pathogenesis of Parkinson’s disease. A Parkinson’s disease model was produced by intraperitoneal injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine into C57BL/6 mice. Real-time reverse transcription-PCR, western blot analysis and colorimetric assay showed that the levels of thioredoxin reductase 1 mRNA and protein were decreased, along with a significant reduction in thioredoxin reductase activity, in the midbrain of Parkinson’s disease mice compared with normal mice. Immunohistochemical staining revealed that the number of thioredoxin reductase 1-positive neurons in the substantia nigra pars compacta of Parkinson’s disease mice was significantly decreased compared with normal mice. These experimental findings suggest that the expression of thioredoxin reductase 1 in the substantia nigra pars compacta of Parkinson’s disease mice is significantly decreased, and that the enzyme may be associated with disease onset.

  16. Cdna cloning and expression analyses of the isoflavone reductase-like gene of dendrobium officinale

    International Nuclear Information System (INIS)

    The full length of the isoflavone reductase-like gene (IRL) cDNA of Dendrobium officinale was cloned by using reverse transcription (RT) PCR combined with cDNA library, the IRL function was identified by Bioinformatics and prokaryotic expression analyses, and the IRL expression levels in the organs and tissues of D. officinale plants with different ages were determined by using real-time quantitative PCR (RT-qPCR). The results indicated that the full length of the cDNA of D. officinale IRL, DoIRL, was 1238 bp (accession no. KJ661023). Its open reading frame (ORF) was 930 bp which encoded 309 amino acids with a predicted molecular mass of 34 kDa, the 5 untranslated region (UTR) was 61 bp and the 3 UTR containing a poly (A) tail was 247 bp. The deduced amino acid sequence of DoIRL, DoIRL, was forecast to contain a NAD(P)H-binding motif (GGTGYIG) in the N-terminal region, two conserved N-glycosylation sites, a conserved nitrogen metabolite repression regulator (NmrA) domain and a phenylcoumaran benzylic ether reductase (PCBER) domain, to hold the nearest phylogenetic relationship with the PCBER of Striga asiatica, and to share both 73% identity with the isoflavone reductases-like (IRLs) of Cucumis sativus and Striga asiatica. In Escherichia coli 'BL21' cells, the DoIRL cDNA expression produced a protein band holding the predicted molecular mass of 34 kDa. DoIRL expressed in all organs and tissues of D. officinale plants with different ages at comparatively low levels, and the expression level in the leaves of the two-year-old plants was the highest. (author)

  17. Mechanistic studies with solubilized rat liver steroid 5 alpha-reductase: Elucidation of the kinetic mechanism

    International Nuclear Information System (INIS)

    A solubilized preparation of steroid 5 alpha-reductase from rat liver has been used in studies focused toward an understanding of the kinetic mechanism associated with enzyme catalysis. From the results of analyses with product and dead-end inhibitors, a preferentially ordered binding of substrates and release of products from the surface of the enzyme is proposed. The observations from these experiments were identical with those using the steroid 5 alpha-reductase activity associated with rat liver microsomes. The primary isotope effects on steady-state kinetic parameters when [4S-2H]NADPH was used also were consistent with an ordered kinetic mechanism. Normal isotope effects were observed for all three kinetic parameters (Vm/Km for both testosterone and NADPH and Vm) at all substrate concentrations used experimentally. Upon extrapolation to infinite concentration of testosterone, the isotope effect on Vm/Km for NADPH approached unity, indicating that the nicotinamide dinucleotide phosphate is the first substrate binding to and the second product released from the enzyme. The isotope effects on Vm/Km for testosterone at infinite concentration of cofactor and on Vm were 3.8 +/- 0.5 and 3.3 +/- 0.4, respectively. Data from the pH profiles of these three steady-state parameters and the inhibition constants (1/Ki) of competitive inhibitors versus both substrates indicate that the binding of nicotinamide dinucleotide phosphate involves coordination of its anionic 2'-phosphate to a protonated enzyme-associated base with an apparent pK near 8.0. From these results, relative limits have been placed on several of the internal rate constants used to describe the ordered mechanism of the rat liver steroid 5 alpha-reductase

  18. Dicarbonyl L-xylulose reductase (DCXR), a "moonlighting protein" in the bovine epididymis.

    Science.gov (United States)

    Akintayo, Ayodélé; Légaré, Christine; Sullivan, Robert

    2015-01-01

    During maturation and the acquisition of their fertilization potential, male germ cells are subjected to various sequential modifications that occur in the epididymis. Protein addition, reorganization or withdrawal, comprise some of these modifications. Dicarbonyl L-xylulose reductase (DCXR), a multifunctional protein involved in various enzymatic and protein interaction processes in different physiological systems, is one of the proteins added to spermatozoa in the epididymis. DCXR is a well-conserved protein with multiple characteristics including enzymatic activities and mediation of cell-cell interaction. In this study, we characterized the DCXR gene and protein expression in the bovine epididymis. Dicarbonyl L-xylulose reductase mRNA is differentially expressed in the caput, corpus, and cauda epididymide epithelial cells with a higher level observed in the cauda region. Tissue protein expression follows the same pattern as the corresponding mRNA expression with a cytoplasmic and apical distribution in the corpus and cauda epithelial cells, respectively. The protein can also be found with a nuclear localization in cauda epididymidis epithelial cells. Dicarbonyl L-xylulose reductase is secreted in the epididymis luminal compartment in the soluble fraction and is associated with microvesicular elements named epididymosomes. In spermatozoa, the DCXR protein was found in the cytoplasmic and membranous fractions. Expression of the DCXR protein is higher on caput spermatozoa but finally shows a weak detection in semen. These data describe DCXR in the bovine epididymis and reveal that its behavior differs from that found in humans. It seems that, in this model, the DCXR protein might have a questionable involvement in the fertilization process. PMID:25815750

  19. Dicarbonyl L-xylulose reductase (DCXR, a "moonlighting protein" in the bovine epididymis.

    Directory of Open Access Journals (Sweden)

    Ayodélé Akintayo

    Full Text Available During maturation and the acquisition of their fertilization potential, male germ cells are subjected to various sequential modifications that occur in the epididymis. Protein addition, reorganization or withdrawal, comprise some of these modifications. Dicarbonyl L-xylulose reductase (DCXR, a multifunctional protein involved in various enzymatic and protein interaction processes in different physiological systems, is one of the proteins added to spermatozoa in the epididymis. DCXR is a well-conserved protein with multiple characteristics including enzymatic activities and mediation of cell-cell interaction. In this study, we characterized the DCXR gene and protein expression in the bovine epididymis. Dicarbonyl L-xylulose reductase mRNA is differentially expressed in the caput, corpus, and cauda epididymide epithelial cells with a higher level observed in the cauda region. Tissue protein expression follows the same pattern as the corresponding mRNA expression with a cytoplasmic and apical distribution in the corpus and cauda epithelial cells, respectively. The protein can also be found with a nuclear localization in cauda epididymidis epithelial cells. Dicarbonyl L-xylulose reductase is secreted in the epididymis luminal compartment in the soluble fraction and is associated with microvesicular elements named epididymosomes. In spermatozoa, the DCXR protein was found in the cytoplasmic and membranous fractions. Expression of the DCXR protein is higher on caput spermatozoa but finally shows a weak detection in semen. These data describe DCXR in the bovine epididymis and reveal that its behavior differs from that found in humans. It seems that, in this model, the DCXR protein might have a questionable involvement in the fertilization process.

  20. Functional properties and structural characterization of rice δ1-pyrroline-5-carboxylate reductase

    Science.gov (United States)

    Forlani, Giuseppe; Bertazzini, Michele; Zarattini, Marco; Funck, Dietmar; Ruszkowski, Milosz; Nocek, Bogusław

    2015-01-01

    The majority of plant species accumulate high intracellular levels of proline to cope with hyperosmotic stress conditions. Proline synthesis from glutamate is tightly regulated at both the transcriptional and the translational levels, yet little is known about the mechanisms for post-translational regulation of the enzymatic activities involved. The gene coding in rice (Oryza sativa L.) for δ1-pyrroline-5-carboxylate (P5C) reductase, the enzyme that catalyzes the second and final step in this pathway, was isolated and expressed in Escherichia coli. The structural and functional properties of the affinity-purified protein were characterized. As for most species, rice P5C reductase was able to use in vitro either NADH or NADPH as the electron donor. However, strikingly different effects of cations and anions were found depending on the pyridine nucleotide used, namely inhibition of NADH-dependent activity and stimulation of NADPH-dependent activity. Moreover, physiological concentrations of proline and NADP+ were strongly inhibitory for the NADH-dependent reaction, whereas the NADPH-dependent activity was mildly affected. Our results suggest that only NADPH may be used in vivo and that stress-dependent variations in ion homeostasis and NADPH/NADP+ ratio could modulate enzyme activity, being functional in promoting proline accumulation and potentially also adjusting NADPH consumption during the defense against hyperosmotic stress. The apparent molecular weight of the native protein observed in size exclusion chromatography indicated a high oligomerization state. We also report the first crystal structure of a plant P5C reductase at 3.40-Å resolution, showing a decameric quaternary assembly. Based on the structure, it was possible to identify dynamic structural differences among rice, human, and bacterial enzymes. PMID:26284087

  1. Functional properties and structural characterization of rice δ(1)-pyrroline-5-carboxylate reductase.

    Science.gov (United States)

    Forlani, Giuseppe; Bertazzini, Michele; Zarattini, Marco; Funck, Dietmar; Ruszkowski, Milosz; Nocek, Bogusław

    2015-01-01

    The majority of plant species accumulate high intracellular levels of proline to cope with hyperosmotic stress conditions. Proline synthesis from glutamate is tightly regulated at both the transcriptional and the translational levels, yet little is known about the mechanisms for post-translational regulation of the enzymatic activities involved. The gene coding in rice (Oryza sativa L.) for δ(1)-pyrroline-5-carboxylate (P5C) reductase, the enzyme that catalyzes the second and final step in this pathway, was isolated and expressed in Escherichia coli. The structural and functional properties of the affinity-purified protein were characterized. As for most species, rice P5C reductase was able to use in vitro either NADH or NADPH as the electron donor. However, strikingly different effects of cations and anions were found depending on the pyridine nucleotide used, namely inhibition of NADH-dependent activity and stimulation of NADPH-dependent activity. Moreover, physiological concentrations of proline and NADP(+) were strongly inhibitory for the NADH-dependent reaction, whereas the NADPH-dependent activity was mildly affected. Our results suggest that only NADPH may be used in vivo and that stress-dependent variations in ion homeostasis and NADPH/NADP(+) ratio could modulate enzyme activity, being functional in promoting proline accumulation and potentially also adjusting NADPH consumption during the defense against hyperosmotic stress. The apparent molecular weight of the native protein observed in size exclusion chromatography indicated a high oligomerization state. We also report the first crystal structure of a plant P5C reductase at 3.40-Å resolution, showing a decameric quaternary assembly. Based on the structure, it was possible to identify dynamic structural differences among rice, human, and bacterial enzymes. PMID:26284087

  2. X-ray structural studies of quinone reductase 2 nanomolar range inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Pegan, Scott D.; Sturdy, Megan; Ferry, Gilles; Delagrange, Philippe; Boutin, Jean A.; Mesecar, Andrew D. (IdRS); (Purdue); (Colorado); (UIC)

    2011-09-06

    Quinone reductase 2 (QR2) is one of two members comprising the mammalian quinone reductase family of enzymes responsible for performing FAD mediated reductions of quinone substrates. In contrast to quinone reductase 1 (QR1) which uses NAD(P)H as its co-substrate, QR2 utilizes a rare group of hydride donors, N-methyl or N-ribosyl nicotinamide. Several studies have linked QR2 to the generation of quinone free radicals, several neuronal degenerative diseases, and cancer. QR2 has been also identified as the third melatonin receptor (MT3) through in cellulo and in vitro inhibition of QR2 by traditional MT3 ligands, and through recent X-ray structures of human QR2 (hQR2) in complex with melatonin and 2-iodomelatonin. Several MT3 specific ligands have been developed that exhibit both potent in cellulo inhibition of hQR2 nanomolar, affinity for MT3. The potency of these ligands suggest their use as molecular probes for hQR2. However, no definitive correlation between traditionally obtained MT3 ligand affinity and hQR2 inhibition exists limiting our understanding of how these ligands are accommodated in the hQR2 active site. To obtain a clearer relationship between the structures of developed MT3 ligands and their inhibitory properties, in cellulo and in vitro IC{sub 50} values were determined for a representative set of MT3 ligands (MCA-NAT, 2-I-MCANAT, prazosin, S26695, S32797, and S29434). Furthermore, X-ray structures for each of these ligands in complex with hQR2 were determined allowing for a structural evaluation of the binding modes of these ligands in relation to the potency of MT3 ligands.

  3. Differential cytochrome content and reductase activity in Geospirillum barnesii strain SeS3

    Science.gov (United States)

    Stolz, J.F.; Gugliuzza, T.; Switzer, Blum J.; Oremland, R.; Martinez, Murillo F.

    1997-01-01

    The protein composition, cytochrome content, and reductase activity in the dissimilatory selenate-reducing bacterium Geospirillum barnesii strain SeS3, grown with thiosulfate, nitrate, selenate, or fumarate as the terminal electron acceptor, was investigated. Comparison of seven high-molecular-mass membrane proteins (105.3, 90.3, 82.6, 70.2, 67.4, 61.1, and 57.3 kDa) by SDS-PAGE showed that their detection was dependent on the terminal electron acceptor used. Membrane fractions from cells grown on thiosulfate contained a 70.2-kDa c-type cytochrome with absorbance maxima at 552, 522, and 421 nm. A 61.1-kDa c-type cytochrome with absorption maxima at 552, 523, and 423 nm was seen in membrane fractions from cells grown on nitrate. No c-type cytochromes were detected in membrane fractions of either selenate- or fumarate-grown cells. Difference spectra, however, revealed the presence of a cytochrome b554 (absorption maxima at 554, 523, and 422 nm) in membrane fractions from selenate-grown cells and a cytochrome b556 (absorption maxima at 556, 520, and 416 nm) in membrane fractions from fumarate-grown cells. Analysis of reductase activity in the different membrane fractions showed variability in substrate specificity. However, enzyme activity was greatest for the substrate on which the cells had been grown (e.g., membranes from nitrate-grown cells exhibited the greatest activity with nitrate). These results show that protein composition, cytochrome content, and reductase activity are dependent on the terminal electron acceptor used for growth.

  4. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

    Science.gov (United States)

    Trigoso, Yvonne D; Evans, Russell C; Karsten, William E; Chooback, Lilian

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification. PMID:26815040

  5. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

    Directory of Open Access Journals (Sweden)

    Yvonne D Trigoso

    Full Text Available The enzyme dihydrodipicolinate reductase (DHDPR is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(PH dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3. The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification.

  6. Evidence that the intra-amoebal Legionella drancourtii acquired a sterol reductase gene from eukaryotes

    Directory of Open Access Journals (Sweden)

    Fournier Pierre-Edouard

    2009-03-01

    Full Text Available Abstract Background Free-living amoebae serve as a natural reservoir for some bacteria that have evolved into «amoeba-resistant» bacteria. Among these, some are strictly intra-amoebal, such as Candidatus "Protochlamydia amoebophila" (Candidatus "P. amoebophila", whose genomic sequence is available. We sequenced the genome of Legionella drancourtii (L. drancourtii, another recently described intra-amoebal bacterium. By comparing these two genomes with those of their closely related species, we were able to study the genetic characteristics specific to their amoebal lifestyle. Findings We identified a sterol delta-7 reductase-encoding gene common to these two bacteria and absent in their relatives. This gene encodes an enzyme which catalyses the last step of cholesterol biosynthesis in eukaryotes, and is probably functional within L. drancourtii since it is transcribed. The phylogenetic analysis of this protein suggests that it was acquired horizontally by a few bacteria from viridiplantae. This gene was also found in the Acanthamoeba polyphaga Mimivirus genome, a virus that grows in amoebae and possesses the largest viral genome known to date. Conclusion L. drancourtii acquired a sterol delta-7 reductase-encoding gene of viridiplantae origin. The most parsimonious hypothesis is that this gene was initially acquired by a Chlamydiales ancestor parasite of plants. Subsequently, its descendents transmitted this gene in amoebae to other intra-amoebal microorganisms, including L. drancourtii and Coxiella burnetii. The role of the sterol delta-7 reductase in prokaryotes is as yet unknown but we speculate that it is involved in host cholesterol parasitism.

  7. Functional and structural aspects of poplar cytosolic and plastidial type A methionine sulfoxide reductases

    OpenAIRE

    Rouhier, Nicolas; Kauffmann, Brice; Tete-Favier, Frédérique; Palladino, Pasquale; Gans, Pierre; Branlant, Guy; Jacquot, Jean-Pierre; Boschi-Muller, Sandrine

    2007-01-01

    The genome of Populus trichocarpa contains five methionine sulfoxide reductase A genes. Here, both cytosolic (cMsrA) and plastidial (pMsrA) poplar MsrAs were analyzed. The two recombinant enzymes are active in the reduction of methionine sulfoxide with either dithiothreitol or poplar thioredoxin as a reductant. In both enzymes, five cysteines, at positions 46, 81, 100, 196, and 202, are conserved. Biochemical and enzymatic analyses of the cysteine-mutated MsrAs support a catalytic mechanism i...

  8. Methylenetetrahydrofolate reductase homozygous mutation in a young boy with cerebellar infarction

    Directory of Open Access Journals (Sweden)

    Alberto Spalice

    2009-11-01

    Full Text Available Posterior circulation vascular occlusive disease in children is a rare and uncommonly reported event. Among the numerous risk factors, the methylenetetrahydrofolate reductase (MTHFR mutation is considered to be a common genetic cause of thrombosis in adults and children. Recently, a link between the MTHFR mutation and cerebrovascular disorders was reported in children. Diffusion tensor imaging (DTI is a great improvement on magnetic resonance imaging (MRI, making the in vivo anatomical and pathological study of the brain and its fibers possible. In our patient cerebellar infarction was associated with MTHFR mutation and, in a standard neurological examination, DTI revealed normal white matter tracts.

  9. Methylenetetrahydrofolate reductase homozygous mutation in a young boy with cerebellar infarction.

    Science.gov (United States)

    Spalice, Alberto; Del Balzo, Francesca; Perla, Francesco Massimo; Properzi, Enrico; Carducci, Carla; Antonozzi, Italo; Iannetti, Paola

    2009-01-01

    Posterior circulation vascular occlusive disease in children is a rare and uncommonly reported event. Among the numerous risk factors, the methylenetetrahydrofolate reductase (MTHFR) mutation is considered to be a common genetic cause of thrombosis in adults and children. Recently, a link between the MTHFR mutation and cerebrovascular disorders was reported in children. Diffusion tensor imaging (DTI) is a great improvement on magnetic resonance imaging (MRI), making the in vivo anatomical and pathological study of the brain and its fibers possible. In our patient cerebellar infarction was associated with MTHFR mutation and, in a standard neurological examination, DTI revealed normal white matter tracts. PMID:21589820

  10. Differential expression of 5-alpha reductase isozymes in the prostate and its clinical implications

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2014-04-01

    Full Text Available The development of human benign or malignant prostatic diseases is closely associated with androgens, primarily testosterone (T and dihydrotestosterone (DHT. T is converted to DHT by 5-alpha reductase (5-AR isozymes. Differential expression of 5-AR isozymes is observed in both human benign and malignant prostatic tissues. 5-AR inhibitors (5-ARI are commonly used for the treatment of benign prostatic hyperplasia (BPH and were once promoted as chemopreventive agents for prostate cancer (PCa. This review discusses the role of the differential expression of 5-AR in the normal development of the human prostate and in the pathogenesis and progression of BPH and PCa.

  11. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    Science.gov (United States)

    Endo, T; Uratani, B; Freese, E

    1983-07-01

    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  12. Mutational reconstructed ferric chelate reductase confers enhanced tolerance in rice to iron deficiency in calcareous soil

    OpenAIRE

    Ishimaru, Yasuhiro; Kim, Suyeon; Tsukamoto, Takashi; Oki, Hiroyuki; Kobayashi, Takanori; Watanabe, Satoshi; Matsuhashi, Shinpei; Takahashi, Michiko; Nakanishi, Hiromi; Mori, Satoshi; Naoko K. Nishizawa

    2007-01-01

    Iron (Fe) deficiency is a worldwide agricultural problem on calcareous soils with low-Fe availability due to high soil pH. Rice plants use a well documented phytosiderophore-based system (Strategy II) to take up Fe from the soil and also possess a direct Fe2+ transport system. Rice plants are extremely susceptible to low-Fe supply, however, because of low phytosiderophore secretion and low Fe3+ reduction activity. A yeast Fe3+ chelate-reductase gene refre1/372, selected for better performance...

  13. Purification and characterization of a 15-ketoprostaglandin d-reductase from bovine lung

    DEFF Research Database (Denmark)

    Hansen, Harald S.

    1979-01-01

    15-Ketoprostaglandin d-reductase from bovine lung has been purified using affinity chromatography to apparent homogeneity, as judged from polyacrylamide gel electrophoresis with and without sodium dodecyl sulphate. Valine was identified as the N-terminal amino acid, and the isoelectric point was...... estimated at pH 7.8. Molecular weights of 56 000 and 39 500 were found by the use of gel filtration and SDS-polyacrylamide gel electrophoresis, respectively. The enzyme was found to be specific for the 15-keto group, thus 15-ketoprostaglandin E (apparent K = 10 µm) is a substrate, in contrast to...

  14. 3-hydroxy 3-methylglutaryl coenzyme A reductase: a new biomarker of fish exposure to water pollution.

    Science.gov (United States)

    Pallottini, Valentina; Scalici, Massimiliano; Gibertini, Giancarlo; Marino, Maria; Trentalance, Anna

    2010-10-01

    The aim of this study was to identify a new putative biomarker in Salmo trutta exposed to water pollution. Variations in the levels of hepatic 3-hydroxy 3-methylglutaryl Coenzyme A reductase (HMG-CoAR), the rate-limiting enzyme of cholesterol biosynthesis, were compared to heat shock protein 70 and hypoxia inducible factor α, biomarkers of pollution exposure and lowered O₂, respectively. The results confirm that HMG-CoAR levels increase in polluted water irrespective of water temperature or O₂ content, indicating that HMG-CoAR could be used as a specific biomarker for water pollution. PMID:20835703

  15. Activation of mitochondrial glycerophosphate cytochrome c reductase in regenerating rat liver by triiodothyronine

    Czech Academy of Sciences Publication Activity Database

    Lotková, H.; Rauchová, Hana; Drahota, Zdeněk

    2001-01-01

    Roč. 50, č. 3 (2001), s. 333-336. ISSN 0862-8408 R&D Projects: GA MŠk OC 918.50; GA ČR GA303/98/0473; GA ČR GA303/00/1658; GA MŠk LN00A069 Institutional research plan: CEZ:AV0Z5011922 Keywords : liver regeneration * triiodothyromine * glycerophosphate cytochrome c reductase Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.027, year: 2001

  16. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    OpenAIRE

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction se...

  17. The HMG-CoA reductase inhibitor fluvastatin inhibits insect juvenile hormone biosynthesis.

    Science.gov (United States)

    Debernard, S; Rossignol, F; Couillaud, F

    1994-07-01

    Fluvastatin (Sandoz Compound XU 62-320), a synthetic HMG-CoA reductase inhibitor, was assayed in vitro and in vivo for its ability to suppress juvenile hormone (JH) biosynthesis by corpora allata of Locusta migratoria migratorioides. Fluvastatin inhibited JH biosynthesis by corpora allata in vitro. Exogenous mevalonic acid lactone restored JH biosynthesis in corpora allata inhibited by fluvastatin. Fluvastatin injected into locusts in vivo inhibited JH biosynthesis, but maximal inhibition lasted for only 6 hr. There were no discernible effects on either JH-regulated metamorphosis or oocyte maturation. Lengthening of the fourth larval stadium was observed and increased doses (single or repeated injections) were fatal. PMID:7926659

  18. Multicenter evaluation of the nitrate reductase assay for drug resistance detection of Mycobacterium tuberculosis.

    Science.gov (United States)

    Martin, Anandi; Montoro, Ernesto; Lemus, Dihadenys; Simboli, Norberto; Morcillo, Nora; Velasco, Maritza; Chauca, José; Barrera, Lucía; Ritacco, Viviana; Portaels, Françoise; Palomino, Juan Carlos

    2005-11-01

    The performance of the nitrate reductase assay was evaluated in a multicenter laboratory study to detect resistance of Mycobacterium tuberculosis to the first-line anti-tuberculosis drugs rifampicin, isoniazid, ethambutol and streptomycin using a set of coded isolates. Compared with the gold standard proportion method on Löwenstein-Jensen medium, the assay was highly accurate in detecting resistance to rifampicin, isoniazid and ethambutol with an accuracy of 98%, 96.6% and 97.9%, respectively. For streptomycin, discrepant results were obtained with an overall accuracy of 85.3%. The assay proved easy to be implemented in countries with limited laboratory facilities. PMID:15893391

  19. 5-α reductase inhibitors, benign prostatic hyperplasia, and risk of male breast cancer

    OpenAIRE

    Robinson, David; Garmo, Hans; Holmberg, Lars; Stattin, Pär

    2015-01-01

    Purpose 5-α reductase inhibitors (5-ARI) have been suggested to increase the risk of male breast cancer. The aim of this study was to study the risk of breast cancer in men on 5-ARI, in men with benign prostatic hyperplasia (BPH) not on 5-ARI, and in men without BPH. Methods We performed a population-based cohort study in Sweden with data from The Prescribed Drug Register, The Patient Register, and The Cancer Register. Men on 5-ARI, men on α-blockers, or men who had undergone a transurethral ...

  20. 5-alpha reductase inhibitors, benign prostatic hyperplasia, and risk of male breast cancer

    OpenAIRE

    Robinson, David; Garmo, Hans; Holmberg, Lars; Stattin, Pär

    2015-01-01

    5-alpha reductase inhibitors (5-ARI) have been suggested to increase the risk of male breast cancer. The aim of this study was to study the risk of breast cancer in men on 5-ARI, in men with benign prostatic hyperplasia (BPH) not on 5-ARI, and in men without BPH. We performed a population-based cohort study in Sweden with data from The Prescribed Drug Register, The Patient Register, and The Cancer Register. Men on 5-ARI, men on alpha-blockers, or men who had undergone a transurethral resectio...

  1. Effect of 5-alpha Reductase Inhibitor on Storage Symptoms in Patients with Benign Prostatic Hyperplasia

    OpenAIRE

    Cho, Kang Jun; Kang, Se Hee; Kim, Hyo Sin; Koh, Jun Sung; Kim, Joon Chul

    2011-01-01

    Purpose Many patients with benign prostatic hyperplasia (BPH) have storage symptoms. The aim of this study was to evaluate the effects of treatment with a 5-alpha reductase inhibitor (5ARI) on storage symptoms in patients with BPH. Methods This study was conducted in 738 patients with lower urinary tract symptoms secondary to BPH. Patients with a prostate volume of higher than 30 mL on the transrectal ultrasound were classified into two groups: group A, in which an alpha blocker was solely ad...

  2. Identification of periplasmic nitrate reductase Mo(V) EPR signals in intact cells of Paracoccus denitrificans.

    Science.gov (United States)

    Sears, H J; Bennett, B; Spiro, S; Thomson, A J; Richardson, D J

    1995-08-15

    EPR spectroscopy has been successfully used to detect signals due to molybdenum (V) and ferric iron in intact cells of aerobically grown Paracoccus denitrificans. The signals are ascribed to the catalytic molybdenum centre and to the haem iron of the periplasmic nitrate reductase. These signals are absent from a mutant strain deficient in this enzyme. The Mo(V) signal is due to the High-g Split species which has been well characterized in the purified enzyme. This confirms that the High-g Split is the physiologically relevant signal of a number observed in the previous work on the purified enzyme. PMID:7646461

  3. Studies on the Iron-Sulfur clusters of hydrogenase, sulfite reductase, nitrogenase and the prismane protein.

    OpenAIRE

    Pierik, A.J.

    1993-01-01

    Iron-sulfur clusters are present in a large number of proteins. Sofar structures of four types of protein-bound iron-sulfur clusters have been determined by X-ray diffraction: rubredoxin-like, [2Fe-2S], [3Fe-4S] and [4Fe-4S] centers. The presence of any of these clusters in a protein can be predicted by comparison of spectroscopic properties. However a number of multiple-electron transferring enzymes, like the Fe-only hydrogenase, sulfite reductase and nitrogenase MoFe protein have enigmatic ...

  4. Tangled up in knots – Structures of inactivated forms of E. coli class Ia Ribonucleotide Reductase

    OpenAIRE

    Zimanyi, Christina M.; Ando, Nozomi; Brignole, Edward J; Asturias, Francisco J; Stubbe, JoAnne; Drennan, Catherine L.

    2012-01-01

    Successful targets for anti-cancer drugs such as clofarabine and gemcitabine, ribonucleotide reductases (RNRs) provide the precursors for DNA biosynthesis and repair. Recently, we reported that dATP inhibits E. coli class Ia RNR by driving formation of RNR subunits into α4β4 rings. Here, we present the first X-ray structure of gemcitabine-inhibited E. coli RNR and show that the previously described α4β4 rings can interlock to form an unprecedented (α4β4)2 megacomplex. This complex is also see...

  5. Normoxic and anoxic metabolism of Nicotiana tabacum transformants lacking root nitrate reductase

    OpenAIRE

    Stoimenova, Maria

    2002-01-01

    The aim of this work was to find out whether and how nitrate reduction in roots would facilitate survival of hypoxic and anoxic (flooding)-phases. For that purpose, we compared the response of roots of hydroponically grown tobacco wildtype (Nicotiana tabacum cv. Gatersleben) and of a transformant (LNR-H) with no nitrate reductase (NR) in the roots but almost normal NR in leaves (based on a nia2-double mutant). As an additional control we used occasionally a 35S-transformant of the same nia2-d...

  6. Caracemide, a site-specific irreversible inhibitor of protein R1 of Escherichia coli ribonucleotide reductase

    DEFF Research Database (Denmark)

    Larsen, I. K.; Cornett, Claus; Karlsson, M.; Sahlin, M.; Sjoberg, B. M.

    1992-01-01

    The anticancer drug caracemide, N-acetyl-N,O-di(methylcarbamoyl)hydroxylamine, and one of its degradation products, N-acetyl-O-methylcarbamoyl-hydroxylamine, were found to inhibit the enzyme ribonucleotide reductase of Escherichia coli by specific interaction with its larger component protein R1...... caracemide inactivation. These results indicate that caracemide inactivates R1 by covalent modification at the substrate-binding site. By analogy with the known interaction between caracemide and acetylcholinesterase or choline acetyltransferase, we propose that the modification of R1 occurs at an activated...... cysteine or serine residue in the active site of the enzyme....

  7. Vitamin K 2,3-epoxide reductase: the basis for stereoselectivity of 4-hydroxycoumarin anticoagulant activity.

    OpenAIRE

    Thijssen, H. H.; Baars, L. G.; Vervoort-Peters, H. T.

    1988-01-01

    1. The administration of S-warfarin (1 mg kg-1 i.v.) to rats that were pre-loaded 48 h before with tracer doses (6 micrograms) of 14C-labelled R- or S-warfarin caused the plasma levels of these compounds to increase. This is due to the substitution of the microsomal (vitamin K 2,3-epoxide (K0) reductase) bound R- or S-[14C]-warfarin by the unlabelled 4-hydroxycoumarin administered. The rate of reappearance was 3-4 fold higher for R- than for S-warfarin; t1/2 of release: 1.2 +/- 0.04 and 3.7 +...

  8. Effect of ammonium nutrition on the nitrate utilization, nitrate reductase actvity and growth of Spirodela polyrrhiza

    Directory of Open Access Journals (Sweden)

    Ewa Tatkowska

    2014-02-01

    Full Text Available The influence of NH4+ ions on nitrate assimilation and growth of sterile Spirodela polyrrhiza cultures was investigated. S. polyrrhiza utilises both the nitrate and the ammonium form of nitrogen, it prefers, however, NH4+. Ammonium ions present in the nitrate medium inhibit the activity of nitrate reductase (NR, but they do not affect enzyme 'induction and only slightly reduce N03- uptake. These results sugest that the inhibitory effect of NH4+ on the NR activity is the main cause of the decrease in N03- assimilation by S. polyrrhiza cultures growing in nitrate-ammonium medium.

  9. Hexavalent Chromate Reductase Activity in Cell Free Extracts of Penicillium sp.

    OpenAIRE

    Arévalo-Rangel, Damaris L.; Cárdenas-González, Juan F.; Víctor M. Martínez-Juárez; Ismael Acosta-Rodríguez

    2013-01-01

    A chromium-resistant fungus isolated from contaminated air with industrial vapors can be used for reducing toxic Cr(VI) to Cr(III). This study analyzes in vitro reduction of hexavalent chromium using cell free extract(s) of the fungus that was characterized based on optimal temperature, pH, use of electron donors, metal ions and initial Cr(VI) concentration in the reaction mixture. This showed the highest activity at 37°C and pH 7.0; there is an increase in Cr(VI) reductase activity with addi...

  10. Thioredoxin Reductase Was Nitrated in the Aging Heart After Myocardial Ischemia/Reperfusion

    OpenAIRE

    Wang, Ke; Zhang, Jie; Wang, Xiaoliang; Liu, Xin; Zuo, Lin; Bai, Kehua; Shang, Jianyu; Ma, Lu; Liu, Teng; Wang, Li; Wang, Wen; Ma, Xinliang; Liu, Huirong

    2013-01-01

    The age-related loss of anti-oxidant defense reduces recovery from myocardial ischemia/reperfusion injury (MI/R) in aged people. Our previous data showed that inactivation of thioredoxin (Trx) was involved in enhanced aging MI/R injury. Thioredoxin reductase (TrxR), the enzyme known to regulate Trx, is less efficient with age. The aim of the current study was to determine why TrxR activity was reduced and whether reduced TrxR activity contributed to enhanced aging MI/R injury. Both Trx and Tr...

  11. Glutamate recognition and hydride transfer by Escherichia coli glutamyl-tRNA reductase.

    OpenAIRE

    Lüer, Corinna; Schauer, Stefan; Virus, Simone; Schubert, Wolf-Dieter; Heinz, Dirk W.; Moser, Jürgen; Jahn, Dieter

    2007-01-01

    The initial step of tetrapyrrole biosynthesis in Escherichia coli involves the NADPH-dependent reduction by glutamyl-tRNA reductase (GluTR) of tRNA-bound glutamate to glutamate-1-semialdehyde. We evaluated the contribution of the glutamate moiety of glutamyl-tRNA to substrate specificity in vitro using a range of substrates and enzyme variants. Unexpectedly, we found that tRNA(Glu) mischarged with glutamine was a substrate for purified recombinant GluTR. Similarly unexpectedly, the substituti...

  12. Design of Deinococcus radiodurans thioredoxin reductase with altered thioredoxin specificity using computational alanine mutagenesis

    OpenAIRE

    Obiero, Josiah; Sanders, David AR

    2011-01-01

    In this study, the X-ray crystal structure of the complex between Escherichia coli thioredoxin reductase (EC TrxR) and its substrate thioredoxin (Trx) was used as a guide to design a Deinococcus radiodurans TrxR (DR TrxR) mutant with altered Trx specificity. Previous studies have shown that TrxRs have higher affinity for cognate Trxs (same species) than that for Trxs from different species. Computational alanine scanning mutagenesis and visual inspection of the EC TrxR–Trx interface suggested...

  13. Polymorphism in methylentetra-hydrofolate reductase gene: important role in diseases.

    Science.gov (United States)

    Kiseljaković, Emina; Jadrić, Radivoj; Hasić, Sabaheta; Skenderi, Faruk; Resić, Halima; Winterhalter-Jadrić, Mira

    2008-05-01

    It has been recognized that some people have a genetic variant which leads to elevated levels of homocysteine and impairs ability to process folate. This condition was recognized as independent risk factor of coronary heart disease. Recently, connection between this termolabile mutation of the methylenetetrahydrofolate reductase and numerous conditions and diseases has been established. Aim of this review is to draw attention to this interesting area in medicine. Additionally, well defined study about presence and frequency of gene polymorphism in our region will provide proper diagnosis and achieve possible delay of development of diseases with vitamin supplementation. PMID:18498269

  14. A structural account of substrate and inhibitor specificity differences between two Naphthol reductases

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Thompson, J.E.; Fahnestock, S.; Valent, B.; Jordan, D.B. (DuPont)

    2010-03-08

    Two short chain dehydrogenase/reductases mediate naphthol reduction reactions in fungal melanin biosynthesis. An X-ray structure of 1,3,6,8-tetrahydroxynaphthalene reductase (4HNR) complexed with NADPH and pyroquilon was determined for examining substrate and inhibitor specificities that differ from those of 1,3,8-trihydroxynaphthalene reductase (3HNR). The 1.5 {angstrom} resolution structure allows for comparisons with the 1.7 {angstrom} resolution structure of 3HNR complexed with the same ligands. The sequences of the two proteins are 46% identical, and they have the same fold. The 30-fold lower affinity of the 4HNR-NADPH complex for pyroquilon (a commercial fungicide that targets 3HNR) in comparison to that of the 3HNR-NADPH complex can be explained by unfavorable interactions between the anionic carboxyl group of the C-terminal Ile282 of 4HNR and CH and CH{sub 2} groups of the inhibitor that are countered by favorable inhibitor interactions with 3HNR. 1,3,8-Trihydroxynaphthalene (3HN) and 1,3,6,8-tetrahydroxynaphthalene (4HN) were modeled onto the cyclic structure of pyroquilon in the 4HNR-NADPH-pyroquilon complex to examine the 300-fold preference of the enzyme for 4HN over 3HN. The models suggest that the C-terminal carboxyl group of Ile282 has a favorable hydrogen bonding interaction with the C6 hydroxyl group of 4HN and an unfavorable interaction with the C6 CH group of 3HN. Models of 3HN and 4HN in the 3HNR active site suggest a favorable interaction of the sulfur atom of the C-terminal Met283 with the C6 CH group of 3HN and an unfavorable one with the C6 hydroxyl group of 4HN, accounting for the 4-fold difference in substrate specificities. Thus, the C-terminal residues of the two naphthol reductase are determinants of inhibitor and substrate specificities.

  15. Steroid 5 α-reductase inhibitors targeting BPH and prostate cancer.

    Science.gov (United States)

    Schmidt, Lucy J; Tindall, Donald J

    2011-05-01

    Steroid 5 alpha-reductase inhibitors (5ARIs) have been approved for use clinically in treatment of benign prostate hyperplasia (BPH) and accompanying lower urinary tract symptoms (LUTS) and have also been evaluated in clinical trials for prevention and treatment of prostate cancer. There are currently two steroidal inhibitors in use, finasteride and dutasteride, both with distinct pharmacokinetic properties. This review will examine the evidence presented by various studies supporting the use of these steroidal inhibitors in the prevention and treatment of prostate disease. Article from the Special issue on Targeted Inhibitors. PMID:20883781

  16. Dual-5α-reductase inhibition promotes hepatic lipid accumulation in man.

    OpenAIRE

    Hazlehurst, JM; Oprescu, AI; N. Nikolaou; Di Guida, R; Grinbergs, AEK; Davies, NP; Flintham, RB; Armstrong, MJ; Taylor, AE; Hughes, BA; Yu, J.; Hodson, L.; Dunn, WB; Tomlinson, JW

    2016-01-01

    5α-Reductase 1 and 2 (SRD5A1, SRD5A2) inactivate cortisol to 5α-dihydrocortisol in addition to their role in the generation of DHT. Dutasteride (dual SRD5A1 and SRD5A2 inhibitor) and finasteride (selective SRD5A2 inhibitor) are commonly prescribed, but their potential metabolic effects have only recently been identified.Our objective was to provide a detailed assessment of the metabolic effects of SRD5A inhibition and in particular the impact on hepatic lipid metabolism.We conducted a randomi...

  17. A preliminary study on estimating extra-cellular nitrate reductase activities in estuarine systems

    OpenAIRE

    Pant H. K.

    2009-01-01

    Enzymes catalyzing ammonium (NH4+)/nitrate (NO3–) into nitrous oxide (N2O)/molecular nitrogen (N2), play critical roles in water quality management. The objective of this paper was to investigate the role of extra-cellular enzymes in cycling of nitrogen (N) in aquatic systems. It appears that N in estuaries, salt marshes, etc., does not stay long enough to be available for uptake, thus, creating N limited conditions. This study showed that indigenous extra-cellular nitrate reductase along wit...

  18. Nitrate Uptake, Nitrate Reductase Distribution and their Relation to Proton Release in Five Nodulated Grain Legumes

    OpenAIRE

    Fan, X. H.; Tang, C; RENGEL, Z.

    2002-01-01

    Nitrate uptake, nitrate reductase activity (NRA) and net proton release were compared in five grain legumes grown at 0·2 and 2 mm nitrate in nutrient solution. Nitrate treatments, imposed on 22‐d‐old, fully nodulated plants, lasted for 21 d. Increasing nitrate supply did not significantly influence the growth of any of the species during the treatment, but yellow lupin (Lupinus luteus) had a higher growth rate than the other species examined. At 0·2 mm nitrate supply, nitrate uptake rates ran...

  19. Crystallographic investigation of the cooperative interaction between trimethoprim, reduced cofactor and dihydrofolate reductase

    International Nuclear Information System (INIS)

    The structure of the complex between E. coli form I dihydrofolate reductase, the antibacterial trimethoprim and NADPH has been determined by X-ray crystallography. The inhibitor and cofactor are in mutual contact. A flexible chain segment which includes Met 20 is in contact with the inhibitor in the presence of NADPH, but more distant in its absence. By contrast, the inhibitor conformation is little changed with NADPH present. The authors discuss these observations with regard to the mutually cooperative binding of these ligands to the protein, and to the associated enhancement of inhibitory selectivity shown by trimethoprim for bacterial as opposed to vertebrate enzyme. (Auth.)

  20. In vivo activation of methyl-coenzyme M reductase by carbon monoxide

    OpenAIRE

    Zhou, Yuzhen; Dorchak, Alexandria E.; Ragsdale, Stephen W.

    2013-01-01

    Methyl-coenzyme M reductase (MCR) from methanogenic archaea catalyzes the rate-limiting and final step in methane biosynthesis. Using coenzyme B as the two-electron donor, MCR reduces methyl-coenzyme M (CH3-SCoM) to methane and the mixed disulfide, CoBS-SCoM. MCR contains an essential redox-active nickel tetrahydrocorphinoid cofactor, Coenzyme F430, at its active site. The active form of the enzyme (MCRred1) contains Ni(I)-F430. Rapid and efficient conversion of MCR to MCRred1 is important fo...

  1. In vivo activation of methyl-coenzyme M reductase by carbon monoxide

    OpenAIRE

    StephenWileyRagsdale

    2013-01-01

    Methyl-coenzyme M reductase (MCR) from methanogenic archaea catalyzes the rate-limiting and final step in methane biosynthesis. Using coenzyme B (CoBSH) as the two-electron donor, MCR reduces methyl-coenzyme M (CH3-SCoM) to methane and the mixed disulfide, CoBS-SCoM. MCR contains an essential redox-active nickel tetrahydro¬corphinoid cofactor, Coenzyme F430, at its active site. The active form of the enzyme (MCRred1) contains Ni(I)-F430. Rapid and efficient conversion of MCR to MCRred1 i...

  2. STUDY OF THE RELATIONSHIP BETWEEN PSORIASIS AND THE POLYMORPHIC SITE C677T OF METHYLENETETRAHYDROFOLATE REDUCTASE

    Institute of Scientific and Technical Information of China (English)

    王柏秋; 傅松滨; 张贵寅; 李严璞

    2000-01-01

    Objective. In order to investigate 5, l0-methylenetetrahydrofolate reductase (MTHFR)'s polymorphic changes in psoriasis vulgaris. Methods. We detected mutation of site C677V of MTHFR in 39 psoriasfics by PCR-RFLP. Results. Genotype frequencies of the psoriasfics were C/C= 20.15%,C/T= 48.72% and T/T= 30.77%; the allelic frequencies were C = 0.4487 and T=0.5513. Homozygous mutant (TT) of the psoriastics was significantly different from the normal control goup by X2 test. Conclusion. C677V mutant of MTHFR might be related with psoriasis.

  3. STUDY OF THE RELATIONSHIP BETWEEN PSORIASIS AND THE POLYMORPHIC SITE C677T OF METHYLENETETRAHYDROFOLATE REDUCTASE

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective. In order to investigate 5,10-methylenetetrahydrofolate reductase (MTHFR)s polymorphic changes in psoriasis vulgaris.Methods.We detected mutation of site C677V of MTHFR in 39 psoriastics by PCR-RFLP.Results.Genotype frequencies of the psoriastics were C/C=20.15%,C/T=48.72% and T/T=30.77%; the allelic frequencies were C=0.4487 and T=0.5513. Homozygous mutant (TT) of the psoriastics was significantly different from the normal control group by X2 test.Conclusion.C677V mutant of MTHFR might be related with psoriasis.

  4. Cloning, expression and antigenicity of the L. donovani reductase

    DEFF Research Database (Denmark)

    Jensen, A T; Kemp, K; Theander, T G;

    2001-01-01

    The protozoan parasite Leishmania undergoes a morphological and biochemical transformation from the promastigote to the amastigote form during its life cycle, which is reflected in the expression of stage-specific proteins. One of these proteins shows homology to a superfamily of reductase proteins......, or not at all. The results indicate the presence of cross-reacting CD45R0 memory T-cells in individuals not exposed to Leishmania. Several previous studies have shown that T-cells from nonexposed individuals often respond to crude Leishmania antigen preparations. The present study suggests that this reactivity...

  5. Cytochrome P450 Reductase: A Harbinger of Diffusible Reduced Oxygen Species

    OpenAIRE

    Manoj, Kelath Murali; Gade, Sudeep Kumar; Mathew, Lazar

    2010-01-01

    The bi-enzymatic system of cytochrome P450 (CYP, a hemoprotein) and cytochrome P450 reductase (CPR, a diflavoenzyme) mediate the redox metabolism of diverse indigenous and xenobiotic molecules in various cellular and organ systems, using oxygen and NADPH. Curiously, when a 1∶1 ratio is seen to be optimal for metabolism, the ubiquitous CYP:CPR distribution ratio is 10 to 100∶1 or higher. Further, the NADPH equivalents consumed in these in vitro or in situ assemblies usually far exceeded the am...

  6. The energy-conserving nitric-oxide-reductase system in Paracoccus denitrificans. Distinction from the nitrite reductase that catalyses synthesis of nitric oxide and evidence from trapping experiments for nitric oxide as a free intermediate during denitrification.

    Science.gov (United States)

    Carr, G J; Page, M D; Ferguson, S J

    1989-02-15

    1. A Clark-type electrode that responds to nitric oxide has been used to show that cytoplasmic membrane vesicles of Paracoccus denitrificans have a nitric-oxide reductase activity. Nitrous oxide is the reaction product. NADH, succinate or isoascorbate plus 2,3,5,6-tetramethyl-1,4-phenylene diamine can act as reductants. The NADH-dependent activity is resistant to freezing of the vesicles and thus the NADH:nitric-oxide oxidoreductase activity of stored frozen vesicles provides a method for calibrating the electrode by titration of dissolved nitric oxide with NADH. The periplasmic nitrite reductase and nitrous-oxide reductase enzymes are absent from the vesicles which indicates that nitric-oxide reductase is a discrete enzyme associated with the denitrification process. This conclusion was supported by the finding that nitric-oxide reductase activity was absent from both membranes prepared from aerobically grown P. denitrificans and bovine heart submitochondrial particles. 2. The NADH: nitric-oxide oxidoreductase activity was inhibited by concentrations of antimycin or myxothiazol that were just sufficient to inhibit the cytochrome bc1 complex of the ubiquinol--cytochrome-c oxidoreductase. The activity was deduced to be proton translocating by the observations of: (a) up to 3.5-fold stimulation upon addition of an uncoupler; and (b) ATP synthesis with a P:2e ratio of 0.75. 3. Nitrite reductase of cytochrome cd1 type was highly purified from P. denitrificans in a new, high-yield, rapid two- or three-step procedure. This enzyme catalysed stoichiometric synthesis of nitric oxide. This observation, taken together with the finding that the maximum rate of NADH:nitric-oxide oxidoreductase activity catalysed by the vesicles was comparable with that of NADH:nitrate-oxidoreductase, is consistent with a role for nitric-oxide reductase in the physiological conversion of nitrate or nitrite to dinitrogen gas. 4. Intact cells of P. denitrificans also reduced nitric oxide in an

  7. Expression, purification, crystallization and preliminary X-ray analysis of maleylacetate reductase from Burkholderia sp. strain SJ98

    International Nuclear Information System (INIS)

    Purification and preliminary X-ray crystallographic analysis of maleylacetate reductase encoded by the pnpD gene is reported. Maleylacetate reductase (EC 1.3.1.32) is an important enzyme that is involved in the degradation pathway of aromatic compounds and catalyzes the reduction of maleylacetate to 3-oxoadipate. The gene pnpD encoding maleylacetate reductase in Burkholderia sp. strain SJ98 was cloned, expressed in Escherichia coli and purified by affinity chromatography. The enzyme was crystallized in both native and SeMet-derivative forms by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant at 293 K. The crystals belonged to space group P21212, with unit-cell parameters a = 72.91, b = 85.94, c = 53.07 Å. X-ray diffraction data for the native and SeMet-derivative crystal were collected to 2.7 and 2.9 Å resolution, respectively

  8. Crystal structure of the YffB protein from Pseudomonas aeruginosa suggests a glutathione-dependent thiol reductase function

    Directory of Open Access Journals (Sweden)

    Dauter Zbigniew

    2004-03-01

    Full Text Available Abstract Background The yffB (PA3664 gene of Pseudomonas aeruginosa encodes an uncharacterized protein of 13 kDa molecular weight with a marginal sequence similarity to arsenate reductase from Escherichia coli. The crystal structure determination of YffB was undertaken as part of a structural genomics effort in order to assist with the functional assignment of the protein. Results The structure was determined at 1.0 Å resolution by single-wavelength anomalous diffraction. The fold is very similar to that of arsenate reductase, which is an extension of the thioredoxin fold. Conclusion Given the conservation of the functionally important residues and the ability to bind glutathione, YffB is likely to function as a GSH-dependent thiol reductase.

  9. Sulforaphane Preconditioning Sensitizes Human Colon Cancer Cells towards the Bioreductive Anticancer Prodrug PR-104A.

    Science.gov (United States)

    Erzinger, Melanie M; Bovet, Cédric; Hecht, Katrin M; Senger, Sabine; Winiker, Pascale; Sobotzki, Nadine; Cristea, Simona; Beerenwinkel, Niko; Shay, Jerry W; Marra, Giancarlo; Wollscheid, Bernd; Sturla, Shana J

    2016-01-01

    The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy through the modulation of drug-metabolizing enzymes. To identify proteins modulated by a low concentration of SF, we treated HT29 colon cancer cells with 2.5 μM SF. Protein abundance changes were detected by stable isotope labeling of amino acids in cell culture. Among 18 proteins found to be significantly up-regulated, aldo-keto reductase 1C3 (AKR1C3), bioactivating the DNA cross-linking prodrug PR-104A, was further characterized. Preconditioning HT29 cells with SF reduced the EC50 of PR-104A 3.6-fold. The increase in PR-104A cytotoxicity was linked to AKR1C3 abundance and activity, both induced by SF in a dose-dependent manner. This effect was reproducible in a second colon cancer cell line, SW620, but not in other colon cancer cell lines where AKR1C3 abundance and activity were absent or barely detectable and could not be induced by SF. Interestingly, SF had no significant influence on PR-104A cytotoxicity in non-cancerous, immortalized human colonic epithelial cell lines expressing either low or high levels of AKR1C3. In conclusion, the enhanced response of PR-104A after preconditioning with SF was apparent only in cancer cells provided that AKR1C3 is expressed, while its expression in non-cancerous cells did not elicit such a response. Therefore, a subset of cancers may be susceptible to combined food-derived component and prodrug treatments with no harm to normal tissues. PMID:26950072

  10. The TyrR transcription factor regulates the divergent akr-ipdC operons of Enterobacter cloacae UW5.

    Science.gov (United States)

    Coulson, Thomas J D; Patten, Cheryl L

    2015-01-01

    The TyrR transcription factor regulates genes involved in the uptake and biosynthesis of aromatic amino acids in Enterobacteriaceae. Genes may be positively or negatively regulated depending on the presence or absence of each aromatic amino acid, all three of which function as cofactors for TyrR. In this report we detail the transcriptional control of two divergently transcribed genes, akr and ipdC, by TyrR, elucidated by promoter fusion expression assays and electrophoretic mobility shift assays to assess protein-DNA interactions. Expression of both genes was shown to be controlled by TyrR via interactions with two TyrR boxes located within the akr-ipdC intergenic region. Expression of ipdC required TyrR bound to the proximal strong box, and is strongly induced by phenylalanine, and to a lesser extent by tryptophan and tyrosine. Down-regulation of akr was reliant on interactions with the weak box, and may also require a second, as yet unidentified protein for further repression. Tyrosine enhanced repression of akr. Electrophoretic mobility shift assays demonstrated that TyrR interacts with both the strong and weak boxes, and that binding of the weak box in vitro requires an intact adjacent strong box. While the strong box shows a high degree of conservation with the TyrR binding site consensus sequence, the weak box has atypical spacing of the two half sites comprising the palindromic arms. Site-directed mutagenesis demonstrated sequence-specific interaction between TyrR and the weak box. This is the first report of TyrR-controlled expression of two divergent protein-coding genes, transcribed from independent promoters. Moreover, the identification of a predicted aldo-keto reductase as a member of the TyrR regulon further extends the function of the TyrR regulon. PMID:25811953

  11. The AKR gene family and modifying sex ratios in palms through abiotic stress responsiveness.

    Science.gov (United States)

    Somyong, Suthasinee; Poopear, Supannee; Jomchai, Nukoon; Uthaipaisanwong, Pichahpuk; Ruang-Areerate, Panthita; Sangsrakru, Duangjai; Sonthirod, Chutima; Ukoskit, Kittipat; Tragoonrung, Somvong; Tangphatsornruang, Sithichoke

    2015-05-01

    Sex ratio (SR), the ratio of female inflorescences to total inflorescences, is one of the main yield components of oil palm (Elaeis guineensis Jacq). The SR quantitative trait locus (QTL) was recently identified on linkage (LG) 8 with a phenotype variance explained (PVE) of 11.3 %. The use of both genetic and physical mapping is one strategy for uncovering the genetic basis of the traits. Here, we report the construction of bacterial artificial chromosome (BAC) and fosmid libraries, and their use for physical mapping in oil palm. Combined, the libraries consist of more than 200,000 clones, representing 6.35 genome equivalents. Physical mapping at the SR locus was implemented by incorporating the published oil palm genome sequence and positive BAC/fosmid clones as identified by colony PCR screening. Based on the previously published sequences, the interval (about 184 kb) was comprised of 19 contigs of the known sequences (~117 kb, 64 %). After, combining the 454 pyrosequences of 15 positive clones and the previously published sequences, the known sequences were revealed to cover about 82 % of the interval (~150 kb), and were used for identifying the new markers by designing 35 gene-based and 23 simple sequence repeat (SSR)-amplified primers. As a result, a putative aldo-keto reductase gene (named EgAKR1) was revealed to be a promising candidate for sex ratio determination, via controlling female inflorescence number (11 % of PVE). This was predicted from the two newly identified polymorphic marker loci (mEgSSRsr8-21LB and mEgAKR1-9) designing from EgAKR1. The functions of AKR gene families in other plant species and our promoter analysis suggested that EgAKR1 may contribute to the sex ratio through abiotic stress responsiveness. PMID:25504196

  12. Luteinizing hormone induces mouse vas deferens protein expression in the murine ovary.

    Science.gov (United States)

    Brockstedt, E; Peters-Kottig, M; Badock, V; Hegele-Hartung, C; Lessl, M

    2000-07-01

    The aim of our study was to isolate and identify novel proteins that are involved in the process of ovulation. To achieve this goal we used the technique of proteome analysis. Comparison of ovary protein patterns, obtained by high resolution two-dimensional gel electrophoresis from recombinant FSH (rFSH)- and rFSH + human CG (hCG)-treated mice, showed significant differences in protein spot positions and intensities. Subsequent analysis of one of these proteins was performed by mass spectrometry, resulting in the identification of the mouse vas deferens protein (MVDP). MVDP, which was absent in the two-dimensional gel electrophoresis protein pattern of rFSH-primed mice and appeared 3 h after the hCG surge, is a member of the aldo-keto reductase superfamily and was originally identified in the mouse vas deferens. This is the first study describing MVDP expression and regulation by LH in the ovary. Northern blot analysis of female mice tissues showed that mvdp messenger RNA (mRNA) was only present in adrenal glands and in hCG-treated ovaries. In situ hybridization studies localized the mvdp mRNA unequivocally to ovarian thecal and interstitial cells with an expression profile starting already 1.5 h, and decreasing 24 h, after LH treatment. In the adrenal glands, mvdp mRNA was not regulated by LH and localized in the cells of the zona fasciculata. In murine adrenocortical cells, a recent study proposed a detoxifying role of MVDP. MVDP might fulfill the same function in the ovary; however, because of its strong and early transcriptional induction by LH, it is also possible that MVDP catalyses another important step during the cascade of events occurring at the time of ovulation. PMID:10875260

  13. Comparative genomics of aldehyde dehydrogenase 5a1 (succinate semialdehyde dehydrogenase and accumulation of gamma-hydroxybutyrate associated with its deficiency

    Directory of Open Access Journals (Sweden)

    Malaspina Patrizia

    2009-01-01

    Full Text Available Abstract Succinic semialdehyde dehydrogenase (SSADH; aldehyde dehydrogenase 5A1 [ALDH5A1]; locus 6p22 occupies a central position in central nervous system (CNS neurotransmitter metabolism as one of two enzymes necessary for γ-aminobutyric acid (GABA recycling from the synaptic cleft. Its importance is highlighted by the neurometabolic disease associated with its inherited deficiency in humans, as well as the severe epileptic phenotype observed in Aldh5a1-/- knockout mice. Expanding evidence now suggests, however, that even subtle decreases in human SSADH activity, associated with rare and common single nucleotide polymorphisms, may produce subclinical pathological effects. SSADH, in conjunction with aldo-keto reductase 7A2 (AKR7A2, represent two neural enzymes responsible for further catabolism of succinic semialdehyde, producing either succinate (SSADH or γ-hydroxybutyrate (GHB; AKR7A2. A GABA analogue, GHB is a short-chain fatty alcohol with unusual properties in the CNS and a long pharmacological history. Moreover, SSADH occupies a further role in the CNS as the enzyme responsible for further metabolism of the lipid peroxidation aldehyde 4-hydroxy-2-nonenal (4-HNE, an intermediate known to induce oxidant stress. Accordingly, subtle decreases in SSADH activity may have the capacity to lead to regional accumulation of neurotoxic intermediates (GHB, 4-HNE. Polymorphisms in SSADH gene structure may also associate with quantitative traits, including intelligence quotient and life expectancy. Further population-based studies of human SSADH activity promise to reveal additional properties of its function and additional roles in CNS tissue.

  14. GENOMIC APPROACHES FOR IMPROVEMENT OF DROUGHT ADAPTATION IN WHEAT

    Directory of Open Access Journals (Sweden)

    Dénes Dudits

    2008-09-01

    Full Text Available Breeding for yield stability under water limited conditions plays an essential role in the reduction of economic and social consequences of global climate changes. We show that two exotic drought resistant genotypes (Kobomughi and Plainsmann differ in root growth rate, root/shoot ratio, and adaptation to low soil water content. These genotypes exhibit characteristic transcript profiles as shown by barley macroarray studies using 10500 unigenes. Reprogramming of gene expression primarily occurred during the 1-2 weeks of water stress, and 6,1% of tested genes were up-regulated in roots of the more adaptive Plainsmann plants. The time course for expression of gene clusters from Kobomughi genotype revealed a prompt and transient gene activation that can help the survival of plants through function of various defense mechanisms. The aldo-keto reductases (AKRs can detoxify lipid peroxidation products (4-hydroxynon-2-enal and glycolysis-derived reactive aldehydes (metylglyoxal that contribute significantly to cellular damages caused by variety of environmental stresses such as drought, high light intensity, UV-B irradiation, cold. Overproduction of AKRs in transgenic tobacco or wheat plants provides considerable stress tolerance and resistance to methylglyoxal. Several transgenic wheat genotypes have been produced with production of elevated level of AKR enzyme. The drought tolerance of these materials was tested by a complex stress diagnostic system, that integrates imaging of plants and monitoring the leaf temperature and fluorescence induction. Based on these parameters, we can conclude that this transgenic strategy that is based on detoxification of lipid aldehyde can result in improved stress adaptation and reduced yield loss.

  15. Genome-wide linkage analysis of global gene expression in loin muscle tissue identifies candidate genes in pigs.

    Directory of Open Access Journals (Sweden)

    Juan Pedro Steibel

    Full Text Available BACKGROUND: Nearly 6,000 QTL have been reported for 588 different traits in pigs, more than in any other livestock species. However, this effort has translated into only a few confirmed causative variants. A powerful strategy for revealing candidate genes involves expression QTL (eQTL mapping, where the mRNA abundance of a set of transcripts is used as the response variable for a QTL scan. METHODOLOGY/PRINCIPAL FINDINGS: We utilized a whole genome expression microarray and an F(2 pig resource population to conduct a global eQTL analysis in loin muscle tissue, and compared results to previously inferred phenotypic QTL (pQTL from the same experimental cross. We found 62 unique eQTL (FDR <10% and identified 3 gene networks enriched with genes subject to genetic control involved in lipid metabolism, DNA replication, and cell cycle regulation. We observed strong evidence of local regulation (40 out of 59 eQTL with known genomic position and compared these eQTL to pQTL to help identify potential candidate genes. Among the interesting associations, we found aldo-keto reductase 7A2 (AKR7A2 and thioredoxin domain containing 12 (TXNDC12 eQTL that are part of a network associated with lipid metabolism and in turn overlap with pQTL regions for marbling, % intramuscular fat (% fat and loin muscle area on Sus scrofa (SSC chromosome 6. Additionally, we report 13 genomic regions with overlapping eQTL and pQTL involving 14 local eQTL. CONCLUSIONS/SIGNIFICANCE: Results of this analysis provide novel candidate genes for important complex pig phenotypes.

  16. Combined bezafibrate and medroxyprogesterone acetate: potential novel therapy for acute myeloid leukaemia.

    Directory of Open Access Journals (Sweden)

    Farhat L Khanim

    Full Text Available BACKGROUND: The majority of acute myeloid leukaemia (AML patients are over sixty years of age. With current treatment regimens, survival rates amongst these, and also those younger patients who relapse, remain dismal and novel therapies are urgently required. In particular, therapies that have anti-leukaemic activity but that, unlike conventional chemotherapy, do not impair normal haemopoiesis. PRINCIPAL FINDINGS: Here we demonstrate the potent anti-leukaemic activity of the combination of the lipid-regulating drug bezafibrate (BEZ and the sex hormone medroxyprogesterone acetate (MPA against AML cell lines and primary AML cells. The combined activity of BEZ and MPA (B/M converged upon the increased synthesis and reduced metabolism of prostaglandin D(2 (PGD(2 resulting in elevated levels of the downstream highly bioactive, anti-neoplastic prostaglandin 15-deoxy Delta(12,14 PGJ(2 (15d-PGJ(2. BEZ increased PGD(2 synthesis via the generation of reactive oxygen species (ROS and activation of the lipid peroxidation pathway. MPA directed prostaglandin synthesis towards 15d-PGJ(2 by inhibiting the PGD(2 11beta -ketoreductase activity of the aldo-keto reductase AKR1C3, which metabolises PGD(2 to 9alpha11beta-PGF(2alpha. B/M treatment resulted in growth arrest, apoptosis and cell differentiation in both AML cell lines and primary AML cells and these actions were recapitulated by treatment with 15d-PGJ(2. Importantly, the actions of B/M had little effect on the survival of normal adult myeloid progenitors. SIGNIFICANCE: Collectively our data demonstrate that B/M treatment of AML cells elevated ROS and delivered the anti-neoplastic actions of 15d-PGJ(2. These observations provide the mechanistic rationale for the redeployment of B/M in elderly and relapsed AML.

  17. Effects of some analgesic anaesthetic drugs on human erythrocyte glutathione reductase: an in vitro study.

    Science.gov (United States)

    Senturk, Murat; Irfan Kufrevioglu, O; Ciftci, Mehmet

    2009-04-01

    Inhibitory effects of some analgesic and anaesthetic drugs on human erythrocyte glutathione reductase were investigated. For this purpose, human erythrocyte glutathione reductase was initially purified 2139-fold in a yield of 29% by using 2', 5'-ADP Sepharose 4B affinity gel and Sephadex G-200 gel filtration chromatography. SDS polyacrylamide gel electrophoresis confirmed the purity of the enzyme by sharing a single band. A constant temperature (+4 degrees C) was maintained during the purification process. Diclofenac sodium, ketoprofen, lornoxicam, tenoxicam, etomidate, morphine and propofol exhibited inhibitory effects on the enzyme in vitro using the Beutler assay method. K(i) constants and IC(50) values for drugs were determined from Lineweaver-Burk graphs and plotting activity % versus [I] graphs, respectively. The IC(50) values of diclofenac sodium, ketoprofen, lornoxicam, propofol, tenoxicam, etomidate and morphine were 7.265, 6.278, 0.3, 0.242, 0.082, 0.0523 and 0.0128 mM and the K(i) constants were 23.97 +/- 2.1, 22.14 +/- 7.6, 0.42 +/- 0.18, 0.418 +/- 0.056, 0.13 +/- 0.025, 0.0725 +/- 0.0029 and 0.0165 +/- 0.0013 mM, respectively. While diclofenac sodium, ketoprofen, lornoxicam, tenoxicam etomidate and morphine showed competitive inhibition, propofol displayed noncompetitive inhibition. PMID:18608753

  18. Domain motions and electron transfer dynamics in 2Fe-superoxide reductase.

    Science.gov (United States)

    Horch, Marius; Utesch, Tillmann; Hildebrandt, Peter; Mroginski, Maria Andrea; Zebger, Ingo

    2016-08-17

    Superoxide reductases are non-heme iron enzymes that represent valuable model systems for the reductive detoxification of reactive oxygen species. In the present study, we applied different theoretical methods to study the structural dynamics of a prototypical 2Fe-superoxide reductase and its influence on electron transfer towards the active site. Using normal mode and essential dynamics analyses, we could show that enzymes of this type are capable of well-defined, electrostatically triggered domain movements, which may allow conformational proofreading for cellular redox partners involved in intermolecular electron transfer. Moreover, these global modes of motion were found to enable access to molecular configurations with decreased tunnelling distances between the active site and the enzyme's second iron centre. Using all-atom classical molecular dynamics simulations and the tunnelling pathway model, however, we found that electron transfer between the two metal sites is not accelerated under these conditions. This unexpected finding suggests that the unperturbed enzymatic structure is optimized for intramolecular electron transfer, which provides an indirect indication of the biological relevance of such a mechanism. Consistently, efficient electron transfer was found to depend on a distinct route, which is accessible via the equilibrium geometry and characterized by a quasi conserved tyrosine that could enable multistep-tunnelling (hopping). Besides these explicit findings, the present study demonstrates the importance of considering both global and local protein dynamics, and a generalized approach for the functional analysis of these aspects is provided. PMID:27491757

  19. Crystallization and preliminary X-ray crystallographic studies of the alkanesulfonate FMN reductase from Escherichia coli

    International Nuclear Information System (INIS)

    Crystallization of the native and SeMet FMN reductase protein of the E. coli alkanesulfonate monooxygenase two-component enzyme system is reported. The alkanesulfonate FMN reductase (SsuE) from Escherichia coli catalyzes the reduction of FMN by NADPH to provide reduced flavin for the monooxygenase (SsuD) enzyme. The vapor-diffusion technique yielded single crystals that grow as hexagonal rods and diffract to 2.9 Å resolution using synchrotron X-ray radiation. The protein crystallizes in the primitive hexagonal space group P622. The SsuE protein lacks any cysteine or methionine residues owing to the role of the SsuE enzyme in the acquisition of sulfur during sulfate starvation. Therefore, substitution of two leucine residues (Leu114 and Leu165) to methionine was performed to obtain selenomethionine-containing SsuE for MAD phasing. The selenomethionine derivative of SsuE has been expressed and purified and crystals of the protein have been obtained with and without bound FMN. These preliminary studies should lead to the structure solution of SsuE. It is anticipated that this new protein structure will provide detailed structural information on specific active-site regions of the protein and insight into the mechanism of flavin reduction and transfer of reduced flavin

  20. Deletion of thioredoxin reductase and effects of selenite and selenate toxicity in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Christopher J Boehler

    Full Text Available Thioredoxin reductase-1 (TRXR-1 is the sole selenoprotein in C. elegans, and selenite is a substrate for thioredoxin reductase, so TRXR-1 may play a role in metabolism of selenium (Se to toxic forms. To study the role of TRXR in Se toxicity, we cultured C. elegans with deletions of trxr-1, trxr-2, and both in axenic media with increasing concentrations of inorganic Se. Wild-type C. elegans cultured for 12 days in Se-deficient axenic media grow and reproduce equivalent to Se-supplemented media. Supplementation with 0-2 mM Se as selenite results in inverse, sigmoidal response curves with an LC50 of 0.20 mM Se, due to impaired growth rather than reproduction. Deletion of trxr-1, trxr-2 or both does not modulate growth or Se toxicity in C. elegans grown axenically, and (75Se labeling showed that TRXR-1 arises from the trxr-1 gene and not from bacterial genes. Se response curves for selenide (LC50 0.23 mM Se were identical to selenite, but selenate was 1/4(th as toxic (LC50 0.95 mM Se as selenite and not modulated by TRXR deletion. These nutritional and genetic studies in axenic media show that Se and TRXR are not essential for C. elegans, and that TRXR alone is not essential for metabolism of inorganic Se to toxic species.

  1. The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase.

    Science.gov (United States)

    Alosi, M C; Melroy, D L; Park, R B

    1988-04-01

    The average glutathione equivalent concentration in phloem exudate collected from squash fruit (Cucurbita moschata [Duchesne] Poir. var Butternut) and pumpkin fruit (Cucurbita pepo [L.] var Jack-o-lattern) was 1.02 and 0.60 millimolar, respectively. Glutathione reductase (EC 1.6.4.2) activity in phloem exudate from squash and pumpkin fruit averaged 0.48 and 1.74 micromole NADPH oxidized per minute per milliliter, respectively. Protein concentrations in fruit phloem exudates averaged 67 milligrams per milliliter for squash and 57 milligrams per milliliter for pumpkin. The phloem-specific P-proteins account for most of the protein content of exudate. Pure exudate from fruit does not gel for hours or days, but when diluted with neutral or alkaline aqueous solutions, exudate gels rapidly. Exudate solutions undergo biphasic pH changes with dilution. We suggest that P-protein undergoes conformational change upon dilution, exposing titratable groups and sulfhydryl residues. Oxidation of the latter forms the intermolecular disulfide bridges of the gel. The gelation of diluted exudate is regulated by factors (oxygen, pH, glutathione, NADPH) which affect the maintenance of reduced sulfhydryl residues and the activity of glutathione reductase. While these factors may also act in vivo to regulate redox conditions in phloem, their relationship to hypothetical sol/gel transitions or motile and nonmotile phases in the transport conduit is unknown. PMID:16666036

  2. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis.

    Science.gov (United States)

    Uthus, Eric O

    2010-06-01

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4'-sulfonyl derivative of l-methionine (dabsyl Met), the product of the enzymatic reactions when either dabsyl l-methionine S-sulfoxide or dabsyl l-methionine R-sulfoxide is used as a substrate. The method provides baseline resolution of the substrates and, therefore, can be used to easily determine the purity of the substrates. The method is rapid ( approximately 20min sample to sample), requires no column regeneration, and uses very small amounts of buffers. Separation was performed by using a 75-mum internal diameter polyimide-coated fused silica capillary (no inside coating) with 60cm total length (50cm to the detector window). Samples were separated at 22.5kV, and the separation buffer was 25mM KH(2)PO(4) (pH 8.0) containing 0.9ml of N-lauroylsarcosine (sodium salt, 30% [w/v] solution) per 100ml of buffer. Prior to use, the capillary was conditioned with the same buffer that also contained 25mM sodium dodecyl sulfate. The CE method is compared with high-performance liquid chromatography (HPLC) as determined by comparing results from measurements of hepatic enzyme activities in mice fed either deficient or adequate selenium. PMID:20167203

  3. 15N studies on the in-vivo assay of nitrate reductase in leaves

    International Nuclear Information System (INIS)

    The reduction of nitrate and nitrite in the leaf disks of seven di- and two mono-cotyledonous species under the in-vivo assay conditions of nitrate reductase was studied using N-15 labeled substrates. The significant reduction of both nitrate and nitrite into ammonia and amino acids was detected in the atmosphere of air. In the atmosphere of N2 gas, anaerobic incubation enhanced the accumulation of nitrite, but the subsequent reduction to the basic nitrogen compounds was from 40 to 180 % of the aerobic rate. The present examination indicated that the in-vivo assay of nitrate reductase under aerobic condition may give greatly underestimated results due to nitrite reduction, and that the exclusion of oxygen from the in-vivo assay mixture is desirable. The addition of n- propanol may be desirable for the assay under aerobic condition. Significant difference was not observed in the reduction of nitrate supplied as sodium and potassium salts on the nitrite formation and on the incorporation of nitrate-N into basic fractions. The N-15 experiment on the dark assimilation of nitrate, nitrite and ammonia into amino acids in wheat leaves showed that these three nitrogen sources were assimilated through the same route, and that the glutamine synthetase/glutamate synthetase pathway was the main route. By anaerobic treatment, the incorporation of nitrogen into alanine and serine was relatively high. (Kako, I.)

  4. Arabidopsis nitrate reductase activity is stimulated by the E3 SUMO ligase AtSIZ1.

    Science.gov (United States)

    Park, Bong Soo; Song, Jong Tae; Seo, Hak Soo

    2011-01-01

    Small ubiquitin-related modifier (SUMO) is a small polypeptide that modulates protein activity and regulates hormone signalling, abiotic and biotic responses in plants. Here we show that AtSIZ regulates nitrogen assimilation in Arabidopsis through its E3 SUMO ligase function. Dwarf plants of siz1-2 flower early, show abnormal seed development and have high salicylic acid content and enhanced resistance to bacterial pathogens. These mutant phenotypes are reverted to wild-type phenotypes by exogenous ammonium but not by nitrate, phosphate or potassium. Decreased nitrate reductase activity in siz1-2 plants resulted in low nitrogen concentrations, low nitric oxide production and high nitrate content in comparison with wild-type plants. The nitrate reductases, NIA1 and NIA2, are sumoylated by AtSIZ1, which dramatically increases their activity. Both sumoylated and non-sumoylated NIA1 and NIA2 can form dimers. Our results indicate that AtSIZ1 positively controls nitrogen assimilation by promoting sumoylation of NRs in Arabidopsis. PMID:21772271

  5. Reduction of azo dyes by flavin reductase from Citrobacter freundii A1

    Directory of Open Access Journals (Sweden)

    Mohd Firdaus Abdul-Wahab

    2012-12-01

    Full Text Available Citrobacter freundii A1 isolated from a sewage treatment facility was demonstrated to be able to effectively decolorize azo dyes as pure and mixed culture. This study reports on the investigation on the enzymatic systems involved. An assay performed suggested the possible involvement of flavin reductase (Fre as an azo reductase. A heterologouslyexpressed recombinant Fre from C. freundii A1 was used to investigate its involvement in the azo reduction process. Three model dyes were used, namely Acid Red 27 (AR27, Direct Blue 15 (DB15 and Reactive Black 5 (RB5. AR27 was found to be reduced the fastest by Fre, followed by RB5, and lastly DB15. Redox mediators nicotinamide adenine dinucleotide (NADH and riboflavin enhance the reduction, suggesting the redox activity of the enzyme. The rate and extent of reduction of the model dyes correlate well with the reduction potentials (Ep. The data presented here strongly suggest that Fre is one of the enzymes responsible for azo reduction in C. freundii A1, acting via an oxidation-reduction reaction.

  6. Nitrite reductase activity and inhibition of H₂S biogenesis by human cystathionine ß-synthase.

    Directory of Open Access Journals (Sweden)

    Carmen Gherasim

    Full Text Available Nitrite was recognized as a potent vasodilator >130 years and has more recently emerged as an endogenous signaling molecule and modulator of gene expression. Understanding the molecular mechanisms that regulate nitrite metabolism is essential for its use as a potential diagnostic marker as well as therapeutic agent for cardiovascular diseases. In this study, we have identified human cystathionine ß-synthase (CBS as a new player in nitrite reduction with implications for the nitrite-dependent control of H₂S production. This novel activity of CBS exploits the catalytic property of its unusual heme cofactor to reduce nitrite and generate NO. Evidence for the possible physiological relevance of this reaction is provided by the formation of ferrous-nitrosyl (Fe(II-NO CBS in the presence of NADPH, the human diflavin methionine synthase reductase (MSR and nitrite. Formation of Fe(II-NO CBS via its nitrite reductase activity inhibits CBS, providing an avenue for regulating biogenesis of H₂S and cysteine, the limiting reagent for synthesis of glutathione, a major antioxidant. Our results also suggest a possible role for CBS in intracellular NO biogenesis particularly under hypoxic conditions. The participation of a regulatory heme cofactor in CBS in nitrite reduction is unexpected and expands the repertoire of proteins that can liberate NO from the intracellular nitrite pool. Our results reveal a potential molecular mechanism for cross-talk between nitrite, NO and H₂S biology.

  7. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    Energy Technology Data Exchange (ETDEWEB)

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish (UAB)

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  8. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  9. The effects of chemical and radioactive properties of Tl-201 on human erythrocyte glutathione reductase activity

    International Nuclear Information System (INIS)

    Aim: The aim of the study was to evaluate the inhibitory effects of thallium-201 (201Tl) solution on human erythrocyte glutathione reductase (GR) activity. Methods: Erythrocyte GR was initially purified by 2′,5′-adenosine diphosphate Sepharose-4B affinity and Sephadex G-200 gel filtration chromatography. The purification was monitored by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, which showed a single band for the final enzyme preparation. The in vitro and in vivo effects of the 201Tl solution including Tl+, Fe+3 and Cu+2 metals and the in vitro effects of the radiation effect of the 201Tl solution and nonradioactive Tl+, Fe+3 and Cu+2 metals on human erythrocyte GR enzyme were studied. Enzyme activity was determined with the Beutler method at 340 nm using a spectrophotometer. All purification procedures were carried out at +4°C. Results: Glutathione reductase was purified 2033-fold at a yield of 28.17%. 201Tl solution and radiation exposure had inhibitory effects on the enzyme activity. Besides, effects of nonradioactive Tl+, Fe+3 and Cu+2 were studied on enzyme activity in vitro. Furthermore, seven human patients were also used for in vivo studies of 201Tl solution. Conclusion: It was detected in in vitro and in vivo studies that the human erythrocyte GR enzyme is inhibited due to the radiation effect of 201Tl solution.

  10. Oxidative stress induced expression of monodehydroascorbate reductase gene in Eleusine coracana.

    Science.gov (United States)

    Sudan, Jebi; Negi, Bhawana; Arora, Sandeep

    2015-10-01

    Abiotic stresses constitute a serious threats to the world food security as they cause significant economic losses in terms of reduction in crop productivity and also greatly limit the geographical locations where crops can be grown. Exposure to abiotic stress causes over-production of reactive oxygen species, leading to oxidative stress in plants. Induction of oxidative stress is primarily responsible for a variety of detrimental changes in the cellular physiology. However, plants have evolved intricate anti-oxidative defence machinery, for their survival under stress. Plant defence strategies for stress tolerance rely on the expression of anti-oxidative genes required for scavenging the toxic reactive oxygen species. Monodehydroascorbate reductase is one of the key anti-oxidant enzyme responsible for scavenging reactive oxygen species. In the present study, efforts have been made to understand the role of monodehydroascorbate reductase in finger millet under different abiotic stresses (drought, salt and UV radiation). The study establishes a differential link between mdar gene expression and enzyme activity under oxidative stress that is validated under different types of imposed stresses. Alteration in correlation between gene expression and enzyme activities under varying magnitude of oxidative stress is elucidated. PMID:26600681

  11. Bee Venom Promotes Hair Growth in Association with Inhibiting 5α-Reductase Expression.

    Science.gov (United States)

    Park, Seeun; Erdogan, Sedef; Hwang, Dahyun; Hwang, Seonwook; Han, Eun Hye; Lim, Young-Hee

    2016-06-01

    Alopecia is an important issue that can occur in people of all ages. Recent studies show that bee venom can be used to treat certain diseases including rheumatoid arthritis, neuralgia, and multiple sclerosis. In this study, we investigated the preventive effect of bee venom on alopecia, which was measured by applying bee venom (0.001, 0.005, 0.01%) or minoxidil (2%) as a positive control to the dorsal skin of female C57BL/6 mice for 19 d. Growth factors responsible for hair growth were analyzed by quantitative real-time PCR and Western blot analysis using mice skins and human dermal papilla cells (hDPCs). Bee venom promoted hair growth and inhibited transition from the anagen to catagen phase. In both anagen phase mice and dexamethasone-induced catagen phase mice, hair growth was increased dose dependently compared with controls. Bee venom inhibited the expression of SRD5A2, which encodes a type II 5α-reductase that plays a major role in the conversion of testosterone into dihydrotestosterone. Moreover, bee venom stimulated proliferation of hDPCs and several growth factors (insulin-like growth factor 1 receptor (IGF-1R), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF)2 and 7) in bee venom-treated hDPCs dose dependently compared with the control group. In conclusion, bee venom is a potentially potent 5α-reductase inhibitor and hair growth promoter. PMID:27040904

  12. The effect of 5α-reductase-2 deficiency on human fertility.

    Science.gov (United States)

    Kang, Hey-Joo; Imperato-McGinley, Julianne; Zhu, Yuan-Shan; Rosenwaks, Zev

    2014-02-01

    A most interesting and intriguing male disorder of sexual differentiation is due to 5α-reductase-2 isoenzyme deficiency. These male infants are born with ambiguous external genitalia due to a deficiency in their ability to catalyze the conversion of T to dihydrotestosterone. Dihydrotestosterone is a potent androgen responsible for differentiation of the urogenital sinus and genital tubercle into the external genitalia, urethra, and prostate. Affected males are born with a clitoral-like phallus, bifid scrotum, hypospadias, blind shallow vaginal pouch from incomplete closure of the urogenital sinus, and a rudimentary prostate. At puberty, the surge in mainly T production prompts virilization, causing most boys to choose gender reassignment to male. Fertility is a challenge for affected men for several reasons. Uncorrected cryptorchidism is associated with low sperm production, and there is evidence of defective transformation of spermatogonia into spermatocytes. The underdeveloped prostate and consequent low semen volumes affect sperm transport. In addition, semen may not liquefy due to a lack of prostate-specific antigen. In the present review, we discuss the 5α-reductase-2 deficiency syndrome and its impact on human fertility. PMID:24412121

  13. Selective killing of methotrexate-resistant cells carrying amplified dihydrofolate reductase genes

    International Nuclear Information System (INIS)

    A method for the selective killing of methotrexate (MTX)-resistant cells has been developed. The selection is based on the incorporation of tritiated deoxyuridine into the DNA of MTX-resistant cells but not normal MTX-sensitive cells in the presence of the drug. A Chinese hamster ovary cell mutant that overproduces dihydrofolate reductase was used as an example of a MTX-resistant cell line. In this system, a 10,000-fold enrichment for wild-type MTX-sensitive cells could be achieved after 24 hr of exposure to the drug combination. This selection technique was applied to the isolation of MTX-sensitive segregants from hybrid cells formed between the MTX-resistant mutant and wild-type cells. The loss of MTX resistance and dihydrofolate reductase overproduction was always accompanied by the loss of a homogeneously staining region on chromosome 2 of the resistant parent that contains the amplified genes specifying this enzyme. While this region is always lost, other parts of chromosome 2 are almost always retained, suggesting that deletion rather than chromosome loss underlies marker segregation in this case. When the selection was applied to the resistant mutant itself, no MTX-sensitive revertants were obtained among 10(5) cells screened, attesting to the stability of gene amplification in this clone. It is suggested that this combination of drugs may be useful for the elimination of MTX-resistant tumor cells that develop after MTX chemotherapy

  14. Cloning, expression and enzymatic properties analysis of dihydrofolate reductase gene from the silkworm, Bombyx mori.

    Science.gov (United States)

    Wang, Wenjing; Gao, Junshan; Wang, Jing; Liu, Chaoliang; Meng, Yan

    2012-12-01

    Tetrahydrobiopterin (BH4) is an essential cofactor for aromatic acid hydroxylases, which control the levels of monoamine neurotransmitters. BH4 deficiency has been associated with many neuropsychological disorders. Dihydrofolate reductase (DHFR) can catalyze 7,8-dihydrobiopterin to 5,6,7,8-tetrahydrobiopterin (BH4) in the salvage pathway of BH4 synthesis from sepiapterin (SP), a major pigment component contained in the integument of silkworm Bombyx mori mutant lemon (lem) in high concentration. In this study, we report the cloning of DHFR gene from the silkworm B. mori (BmDhfr) and identification of enzymatic properties of BmDHFR. BmDhfr is located on scaffold Bm_199 with a predicted gene model BGIBMGA013340, which encodes a 185-aa polypeptide with a predicted molecular mass of about 21 kDa. Biochemical analyses showed that the recombinant BmDHFR protein exhibited high enzymatic activity and suitable parameters to substrate. Together with our previous studies on SP reductase of B. mori (BmSPR) and the lem mutant, it may be an effective way to industrially extract SP from the lem silkworms in large scale to produce BH4 in vitro by co-expressing BmSPR and BmDHFR and using the extracted SP as a substrate in the future. PMID:23065260

  15. Structural Insight into Dihydrodipicolinate Reductase from Corybebacterium glutamicum for Lysine Biosynthesis.

    Science.gov (United States)

    Sagong, Hye-Young; Kim, Kyung-Jin

    2016-02-28

    Dihydrodipicolinate reductase is an enzyme that converts dihydrodipicolinate to tetrahydrodipicolinate using an NAD(P)H cofactor in L-lysine biosynthesis. To increase the understanding of the molecular mechanisms of lysine biosynthesis, we determined the crystal structure of dihydrodipicolinate reductase from Corynebacterium glutamicum (CgDapB). CgDapB functions as a tetramer, and each protomer is composed of two domains, an Nterminal domain and a C-terminal domain. The N-terminal domain mainly contributes to nucleotide binding, whereas the C-terminal domain is involved in substrate binding. We elucidated the mode of cofactor binding to CgDapB by determining the crystal structure of the enzyme in complex with NADP(+) and found that CgDapB utilizes both NADH and NADPH as cofactors. Moreover, we determined the substrate binding mode of the enzyme based on the coordination mode of two sulfate ions in our structure. Compared with Mycobacterium tuberculosis DapB in complex with its cofactor and inhibitor, we propose that the domain movement for active site constitution occurs when both cofactor and substrate bind to the enzyme. PMID:26502738

  16. Nitrite reductase gene upregulated during conidiation is involved in macroconidium formation in Fusarium oxysporum.

    Science.gov (United States)

    Iida, Y; Kurata, T; Harimoto, Y; Tsuge, T

    2008-10-01

    Fusarium oxysporum produces three kinds of asexual spores, microconidia, macroconidia, and chlamydospores. We previously found that the transcript level of the nitrite reductase gene of F. oxysporum, named FoNIIA, was markedly upregulated during conidiation compared with during vegetative growth. FoNIIA was also found to be positively regulated by Ren1 that is a transcription regulator controlling development of microconidia and macroconidia. In this study, we analyzed the function of FoNIIA in conidiation of F. oxysporum. Conidiation cultures showed markedly higher level of accumulation of FoNiiA protein as well as FoNIIA mRNA than vegetative growth cultures. FoNIIA protein was significantly decreased in cultures of the REN1 disruption mutant compared with that of the wild type. These results confirmed that FoNIIA expression is upregulated during conidiation and is positively regulated by REN1. The FoNIIA disruption mutants produced microconidia, macroconidia, and chlamydospores, which were morphologically indistinguishable from those of the wild type. The mutants, however, produced significantly fewer macroconidia than the wild type, although the wild type and mutant strains produced similar numbers of microconidia and chlamydospores. These results demonstrate that nitrite reductase is involved in quantitative control of macroconidium formation as well as nitrate utilization in F. oxysporum. PMID:18943456

  17. Phytochemical analysis with the antioxidant and aldose reductase inhibitory capacities of Tephrosia humilis aerial parts' extracts.

    Science.gov (United States)

    Plioukas, Michael; Gabrieli, Chrysi; Lazari, Diamanto; Kokkalou, Eugene

    2016-06-01

    The aerial parts of Tephrosia humilis were tested about their antioxidant potential, their ability to inhibit the aldose/aldehyde reductase enzymes and their phenolic content. The plant material was exhaustively extracted with petroleum ether, dichloromethane and methanol, consecutively. The concentrated methanol extract was re-extracted, successively, with diethyl ether, ethyl acetate and n-butanol. All extracts showed significant antioxidant capacity, but the most effective was the ethyl acetate extract. As about the aldose reductase inhibition, all fractions, except the aqueous, were strong inhibitors of the enzyme, with the n-butanolic and ethyl acetate fractions to inhibit the enzyme above 75%. These findings provide support to the ethnopharmacological usage of the plant as antioxidant and validate its potential to act against the long-term diabetic complications. The phytochemical analysis showed the presence of 1,4-dihydroxy-3,4-(epoxyethano)-5-cyclohexene(1), cleroindicin E(2), lupeol(3), methyl p-coumarate(4), methyl 4-hydroxybenzoate(5), prunin(6), 5,7,2',5'-tetrahydroxyflavanone 7-rutinoside(7), protocatechuic acid(8), luteolin 7-glucoside(9), apigenin(10), naringin(11), rhoifolin(12) and luteolin 7-glucuronate(13). PMID:26209262

  18. The REDUCE trial: chemoprevention in prostate cancer using a dual 5alpha-reductase inhibitor, dutasteride.

    Science.gov (United States)

    Musquera, Mireia; Fleshner, Neil E; Finelli, Antonio; Zlotta, Alexandre R

    2008-07-01

    Dutasteride, a dual 5alpha-reductase inhibitor, is used in the treatment of benign prostatic hyperplasia (BPH). It reduces serum prostate-specific antigen levels by approximately 50% at 6 months and total prostate volume by 25% after 2 years. Randomized placebo-controlled trials in BPH patients have shown the efficacy of dutasteride in symptomatic relief, improvements in quality of life and peak urinary flow rate. Side effects occurring with dutasteride are decreased libido, erectile dysfunction, ejaculation disorders and gynecomastia. Preliminary data from placebo-controlled BPH trials have shown a decrease in the detection of prostate cancer in patients treated with dutasteride, although these studies were not designed to look at this issue. Dutasteride differs from finasteride in that it inhibits both isoenzymes of 5alpha-reductase, type I and type II. The landmark Prostate Cancer Prevention Trial at the end of the 7-year study demonstrated a 24.8% reduction in the incidence of prostate cancer in the finasteride group compared with placebo. However, a 25.5% increase in the prevalence of high-grade Gleason tumors has been observed, the clinical significance of which has been debated. Preliminary data suggest a decrease in prostate cancer incidence in dutasteride-treated patients and demonstrate type I alphareductase enzyme expression in prostate cancer. As a result, dutasteride is being investigated for prostate cancer prevention in the ongoing Reduction by Dutasteride of Prostate Cancer Events (REDUCE) trial, which is discussed here. PMID:18588452

  19. Nitrofuran drugs as common subversive substrates of Trypanosoma cruzi lipoamide dehydrogenase and trypanothione reductase.

    Science.gov (United States)

    Blumenstiel, K; Schöneck, R; Yardley, V; Croft, S L; Krauth-Siegel, R L

    1999-12-01

    Lipoamide dehydrogenase (LipDH), trypanothione reductase (TR), and glutathione reductase (GR) catalyze the NAD(P)H-dependent reduction of disulfide substrates. TR occurs exclusively in trypanosomatids which lack a GR. Besides their physiological reactions, the flavoenzymes catalyze the single-electron reduction of nitrofurans with the concomitant generation of superoxide anions. Here, we report on the interaction of clinically used antimicrobial nitrofurans with LipDH and TR from Trypanosoma cruzi, the causative agent of Chagas' disease (South American trypanosomiasis), in comparison to mammalian LipDH and GR. The compounds were studied as inhibitors and as subversive substrates of the enzymes. None of the nitrofurans inhibited LipDH, although they did interfere with the disulfide reduction of TR and GR. When the compounds were studied as substrates, T. cruzi LipDH showed a high rate of nitrofuran reduction and was even more efficient than its mammalian counterpart. Several derivatives were also effective subversive substrates of TR, but the respective reaction with human GR was negligible. Nifuroxazide, nifuroxime, and nifurprazine proved to be the most promising derivatives since they were redox-cycled by both T. cruzi LipDH and TR and had pronounced antiparasitic effects in cultures of T. cruzi and Trypanosoma brucei. The results suggest that those nitrofuran derivatives which interact with both parasite flavoenzymes should be revisited as trypanocidal drugs. PMID:10571254

  20. Expression, purification, crystallization and preliminary X-ray crystallographic studies of Deinococcus radiodurans thioredoxin reductase

    International Nuclear Information System (INIS)

    Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3221, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress

  1. Molecular dissection of a putative iron reductase from Desulfotomaculum reducens MI-1

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhi; Kim, David D.; Nelson, Ornella D.; Otwell, Annie E.; Richardson, Ruth E.; Callister, Stephen J.; Lin, Hening

    2015-10-08

    Desulfotomaculum reducens MI-1 is a Firmicute strain capable of reducing a variety of heavy metal ions and has a great potential in heavy metal bioremediation.We recently identified Dred_2421 as a potential iron reductase through proteomic study of D. reducens. The current study examines its iron-reduction mechanism. Dred_2421, like its close homolog from Escherichia coli (2, 4-dienoyl-CoA reductase), has an FMN-binding N-terminal domain (NTD), an FAD-binding C-terminal domain (CTD), and a 4Fee4S cluster between the two domains. To understand the mechanism of the iron-reduction activity and the role of each domain, we generated a series of variants for each domain and investigated their iron reduction activity. Our results suggest that CTD is the main contributor of the iron-reduction activity, and that NTD and the 4Fee4S cluster are not directly involved in such activity. This study provides a mechanistic understanding of the ironereductase activity of Dred_2421 and may also help to elucidate other physiological activities this enzyme may have.

  2. Influence of the enzyme dissimilatory sulfite reductase on stable isotope fractionation during sulfate reduction

    Science.gov (United States)

    Mangalo, Muna; Einsiedl, Florian; Meckenstock, Rainer U.; Stichler, Willibald

    2008-03-01

    The stable isotopes of sulfate are often used as a tool to assess bacterial sulfate reduction on the macro scale. However, the mechanisms of stable isotope fractionation of sulfur and oxygen at the enzymatic level are not yet fully understood. In batch experiments with water enriched in 18O we investigated the effect of different nitrite concentrations on sulfur isotope fractionation by Desulfovibrio desulfuricans. With increasing nitrite concentrations, we found sulfur isotope enrichment factors ranging from -11.2 ± 1.8‰ to -22.5 ± 3.2‰. Furthermore, the δ18O values in the remaining sulfate increased from approximately 50-120‰ when 18O-enriched water was supplied. Since 18O-exchange with ambient water does not take place in sulfate, but rather in intermediates of the sulfate reduction pathway (e.g. SO32-), we suggest that nitrite affects the steady-state concentration and the extent of reoxidation of the metabolic intermediate sulfite to sulfate during sulfate reduction. Given that nitrite is known to inhibit the production of the enzyme dissimilatory sulfite reductase, our results suggest that the activity of the dissimilatory sulfite reductase regulates the kinetic isotope fractionation of sulfur and oxygen during bacterial sulfate reduction. Our novel results also imply that isotope fractionation during bacterial sulfate reduction strongly depends on the cell internal enzymatic regulation rather than on the physico-chemical features of the individual enzymes.

  3. Identification of thioredoxin glutathione reductase inhibitors that kill cestode and trematode parasites.

    Directory of Open Access Journals (Sweden)

    Fabiana Ross

    Full Text Available Parasitic flatworms are responsible for serious infectious diseases that affect humans as well as livestock animals in vast regions of the world. Yet, the drug armamentarium available for treatment of these infections is limited: praziquantel is the single drug currently available for 200 million people infected with Schistosoma spp. and there is justified concern about emergence of drug resistance. Thioredoxin glutathione reductase (TGR is an essential core enzyme for redox homeostasis in flatworm parasites. In this work, we searched for flatworm TGR inhibitors testing compounds belonging to various families known to inhibit thioredoxin reductase or TGR and also additional electrophilic compounds. Several furoxans and one thiadiazole potently inhibited TGRs from both classes of parasitic flatworms: cestoda (tapeworms and trematoda (flukes, while several benzofuroxans and a quinoxaline moderately inhibited TGRs. Remarkably, five active compounds from diverse families possessed a phenylsulfonyl group, strongly suggesting that this moiety is a new pharmacophore. The most active inhibitors were further characterized and displayed slow and nearly irreversible binding to TGR. These compounds efficiently killed Echinococcus granulosus larval worms and Fasciola hepatica newly excysted juveniles in vitro at a 20 µM concentration. Our results support the concept that the redox metabolism of flatworm parasites is precarious and particularly susceptible to destabilization, show that furoxans can be used to target both flukes and tapeworms, and identified phenylsulfonyl as a new drug-hit moiety for both classes of flatworm parasites.

  4. Cloning, expression and crystallization of dihydrodipicolinate reductase from methicillin-resistant Staphylococcus aureus

    International Nuclear Information System (INIS)

    Given the recent rise in antimicrobial resistance, there is an urgent need to identify and characterize new antibiotic drug targets. One such target is dihydrodipicolinate reductase (DHDPR), which is an essential bacterial enzyme that catalyzes the second step in the lysine-biosynthesis pathway. In this paper, the cloning, expression, purification and crystallization of DHDPR from methicillin-resistant S. aureus are presented. Dihydrodipicolinate reductase (DHDPR; EC 1.3.1.26) catalyzes the nucleotide (NADH/NADPH) dependent second step of the lysine-biosynthesis pathway in bacteria and plants. Here, the cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DHDPR from methicillin-resistant Staphylococcus aureus (MRSA-DHDPR) are presented. The enzyme was crystallized in a number of forms, predominantly with ammonium sulfate as a precipitant, with the best crystal form diffracting to beyond 3.65 Å resolution. Crystal structures of the apo form as well as of cofactor (NADPH) bound and inhibitor (2,6-pyridinedicarboxylate) bound forms of MRSA-DHDPR will provide insight into the structure and function of this essential enzyme and valid drug target

  5. Crystallization and preliminary X-ray diffraction studies of maleylacetate reductase from Rhizobium sp. strain MTP-10005

    OpenAIRE

    FUJII, Tomomi; Goda, Yuko; Yoshida, Masahiro; Oikawa, Tadao; Hata, Yasuo

    2008-01-01

    Maleylacetate reductase from Rhizobium sp. strain MTP-10005 has been crystallized using the sitting-drop vapour-diffusion method and microseeding. The crystals contained one dimeric molecule per asymmetric unit and diffracted to 1.79 Å resolution.

  6. Quantitative Detection of Perchlorate-Reducing Bacteria by Real-Time PCR Targeting the Perchlorate Reductase Gene▿

    OpenAIRE

    Nozawa-Inoue, Mamie; Jien, Mercy; Hamilton, Nicholas S.; Stewart, Valley; Scow, Kate M.; Hristova, Krassimira R.

    2008-01-01

    A quantitative real-time PCR assay targeting the pcrA gene, encoding the catalytic subunit of perchlorate reductase, detected pcrA genes from perchlorate-reducing bacteria in three different genera and from soil microbial communities. Partial pcrA sequences indicated differences in the composition of perchlorate-reducing bacterial communities following exposure to different electron donors.

  7. Crystallization and preliminary X-ray diffraction analysis of salutaridine reductase from the opium poppy Papaver somniferum

    OpenAIRE

    Higashi, Yasuhiro; Smith, Thomas J.; Jez, Joseph M.; Kutchan, Toni M.

    2010-01-01

    Recombinant P. somniferum salutaridine reductase (SalR) was purified and crystallized with NADPH using the hanging-drop vapor-diffusion method. Crystals of the SalR–NADPH complex diffracted X-rays to a resolution of 1.9 Å.

  8. Contribution of thermolabile methylenetetrahydrofolate reductase variant to total plasma homocysteine levels in healthy men and women. Inter99 (2)

    DEFF Research Database (Denmark)

    Husemoen, Lise Lotte N; Thomsen, Troels F; Fenger, Mogens;

    2003-01-01

    Elevation in plasma total homocysteine (tHcy) is believed to be causally related to cardiovascular disease. Like age and sex, the thermolabile variant of methylenetetrahydrofolate reductase (MTHFR(C677T)) is an important nonmodifiable determinant of tHcy, which may be considered when describing...

  9. Alteration of the alkaloid profile in genetically modified tobacco reveals a role of methylenetetrahydrofolate reductase in nicotine N-demethylation

    Science.gov (United States)

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme of the tetrahydrofolate (THF)-mediated one-carbon (C1) metabolic network. This enzyme catalyzes reduction of 5,10-methylene-THF to 5-methyl-THF. The latter donates its methyl group to homocysteine forming Met, which is then used for the syn...

  10. Improving xylitol production through recombinant expression of xylose reductase in the white-rot fungus Phanerochaete sordida YK-624.

    Science.gov (United States)

    Hirabayashi, Sho; Wang, Jianqiao; Kawagishi, Hirokazu; Hirai, Hirofumi

    2015-07-01

    We generated an expression construct consisting of the xylose reductase (XR) gene (xr) from Phanerochaete chrysosporium. Transformant X7 exhibited increased xylitol production and markedly higher XR activities than the wild-type strain. RT-PCR analysis demonstrated that the increased XR activity was associated with constant expression of the recombinant xr gene. PMID:25547244

  11. HMG-CoA reductase inhibitory activity and phytocomponent investigation of Basella alba leaf extract as a treatment for hypercholesterolemia.

    Science.gov (United States)

    Baskaran, Gunasekaran; Salvamani, Shamala; Ahmad, Siti Aqlima; Shaharuddin, Noor Azmi; Pattiram, Parveen Devi; Shukor, Mohd Yunus

    2015-01-01

    The enzyme 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) reductase is the key enzyme of the mevalonate pathway that produces cholesterol. Inhibition of HMG-CoA reductase reduces cholesterol biosynthesis in the liver. Synthetic drugs, statins, are commonly used for the treatment of hypercholesterolemia. Due to the side effects of statins, natural HMG-CoA reductase inhibitors of plant origin are needed. In this study, 25 medicinal plant methanol extracts were screened for anti-HMG-CoA reductase activity. Basella alba leaf extract showed the highest inhibitory effect at about 74%. Thus, B. alba was examined in order to investigate its phytochemical components. Gas chromatography with tandem mass spectrometry and reversed phase high-performance liquid chromatography analysis revealed the presence of phenol 2,6-bis(1,1-dimethylethyl), 1-heptatriacotanol, oleic acid, eicosyl ester, naringin, apigenin, luteolin, ascorbic acid, and α-tocopherol, which have been reported to possess antihypercholesterolemic effects. Further investigation of in vivo models should be performed in order to confirm its potential as an alternative treatment for hypercholesterolemia and related cardiovascular diseases. PMID:25609924

  12. Nitrite reductase is critical for Pseudomonas aeruginosa survival during co-infection with the oral commensal Streptococcus parasanguinis.

    Science.gov (United States)

    Scoffield, Jessica A; Wu, Hui

    2016-02-01

    Pseudomonas aeruginosa is the major aetiological agent of chronic pulmonary infections in cystic fibrosis (CF) patients. However, recent evidence suggests that the polymicrobial community of the CF lung may also harbour oral streptococci, and colonization by these micro-organisms may have a negative impact on P. aeruginosa within the CF lung. Our previous studies demonstrated that nitrite abundance plays an important role in P. aeruginosa survival during co-infection with oral streptococci. Nitrite reductase is a key enzyme involved in nitrite metabolism. Therefore, the objective of this study was to examine the role nitrite reductase (gene nirS) plays in P. aeruginosa survival during co-infection with an oral streptococcus, Streptococcus parasanguinis. Inactivation of nirS in both the chronic CF isolate FRD1 and acute wound isolate PAO1 reduced the survival rate of P. aeruginosa when co-cultured with S. parasanguinis. Growth of both mutants was restored when co-cultured with S. parasanguinis that was defective for H2O2 production. Furthermore, the nitrite reductase mutant was unable to kill Drosophila melanogaster during co-infection with S. parasanguinis. Taken together, these results suggest that nitrite reductase plays an important role for survival of P. aeruginosa during co-infection with S. parasanguinis. PMID:26673783

  13. Purification and some properties of sulfur reductase from the iron-oxidizing bacterium Thiobacillus ferrooxidans NASF-1.

    Science.gov (United States)

    Ng, K Y; Sawada, R; Inoue, S; Kamimura, K; Sugio, T

    2000-01-01

    Thiobacillus ferrooxidans strain NASF-1 grown aerobically in an Fe2+ (3%)-medium produces hydrogen sulfide (H2S) from elemental sulfur under anaerobic conditions with argon gas at pH 7.5. Sulfur reductase, which catalyzes the reduction of elemental sulfur (S0) with NAD(P)H as an electron donor to produce hydrogen sulfide (H2S) under anaerobic conditions, was purified 69-fold after 35-65% ammonium sulfate precipitation and Q-Sepharose FF, Phenyl-Toyopearl 650 ML, and Blue Sepharose FF column chromatography, with a specific activity of 57.6 U (mg protein)(-1). The purified enzyme was quite labile under aerobic conditions, but comparatively stable in the presence of sodium hydrosulfite and under anaerobic conditions, especially under hydrogen gas conditions. The purified enzyme showed both sulfur reductase and hydrogenase activities. Both activities had an optimum pH of 9.0. Sulfur reductase has an apparent molecular weight of 120,000 Da, and is composed of three different subunits (M(r) 54,000 Da (alpha), 36,000 Da (beta), and 35,000 Da (gamma)), as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. This is the first report on the purification of sulfur reductase from a mesophilic and obligate chemolithotrophic iron-oxidizing bacterium. PMID:16232842

  14. Mutational Analysis of Pneumocystis jirovecii Dihydropteroate Synthase and Dihydrofolate Reductase Genes in HIV-Infected Patients in China

    OpenAIRE

    Deng, Xilong; Zhuo, Li; Lan, Yun; Dai, Zhaoxia; Chen, Wan-shan; Cai, Weiping; Kovacs, Joseph A.; Ma, Liang; Tang, Xiaoping

    2014-01-01

    We investigated Pneumocystis jirovecii dihydropteroate synthase (DHPS) and dihydrofolate reductase (DHFR) genes for mutations in 25 Chinese HIV-infected patients with P. jirovecii pneumonia. We identified DHPS mutations in 3 (12%) patients and DHFR mutations in 1 (4%) patient. The prevalence of DHPS and DHFR mutations in China remains low, as it does in other developing countries.

  15. Impacts of Elevated CO2 Concentration on Biochemical Composition,Carbonic Anhydrase, and Nitrate Reductase Activity of Freshwater Green Algae

    Institute of Scientific and Technical Information of China (English)

    Jian-Rong XIA; Kun-Shan GAO

    2005-01-01

    To investigate the biochemical response of freshwater green algae to elevated CO2 concentrations,Chlorella pyrenoidosa Chick and Chlamydomonas reinhardtii Dang cells were cultured at different CO2concentrations within the range 3-186 μmol/L and the biochemical composition, carbonic anhydrase (CA),and nitrate reductase activities of the cells were investigated. Chlorophylls (Chl), carotenoids, carbonhydrate,and protein contents were enhanced to varying extents with increasing CO2 concentration from 3-186μmol/L. The CO2 enrichment significantly increased the Chl a/Chl b ratio in Chlorella pyrenoidosa, but not in Chlamydomonas reinhardtii. The CO2 concentration had significant effects on CA and nitrate reductase activity. Elevating CO2 concentration to 186 μmol/L caused a decline in intracellular and extracellullar CA activity. Nitrate reductase activity, under either light or dark conditions, in C. reinhardtii and C. pyrenoidosa was also significantly decreased with CO2 enrichment. From this study, it can be concluded that CO2enrichment can affect biochemical composition, CA, and nitrate reductase activity, and that the biochemical response was species dependent.

  16. Enzymatic reduction of complex redox dyes using NADH-dependent reductase from Bacillus subtilis coupled with cofactor regeneration.

    Science.gov (United States)

    Bozic, Mojca; Pricelius, Sina; Guebitz, Georg M; Kokol, Vanja

    2010-01-01

    Conventional vat dyeing involves chemical reduction of dyes into their water-soluble leuco form generating considerable amounts of toxic chemicals in effluents. In the present study, a new beta-nicotinamide adenine dinucleotide disodium salt (NADH)-dependent reductase isolated from Bacillus subtilis was used to reduce the redox dyes CI Acid Blue 74, CI Natural Orange 6, and CI Vat Blue 1 into their water-soluble leuco form. Enzymatic reduction was optimized in relation to pH and temperature conditions. The reductase was able to reduce Acid Blue 74 and Natural Orange 6 in the presence of the stoichiometrically consumed cofactor NADH; meanwhile, Vat Blue 1 required the presence of mediator 1,8-dihydroxyanthraquinone. Oxygen from air was used to reoxidize the dyes into their initial forms. The enzymatic reduction of the dyes was studied and the kinetic constants determined, and these were compared to the chemically-reduced leuco form. The enzyme responsible for the reduction showed homology to a NADH-dependent reductase from B. subtilis based on results from the MS/MS peptide mass mapping of the tryptically digested protein. Additionally, the reduction of Acid Blue 74 to its leuco form by reductase from B. subtilis was confirmed using NADH regenerated by the oxidation of formic acid with formate dehydrogenase from Candida boidinii in the same solution. PMID:19662398

  17. Quantitative detection of perchlorate-reducing bacteria by real-time PCR targeting the perchlorate reductase gene.

    Science.gov (United States)

    Nozawa-Inoue, Mamie; Jien, Mercy; Hamilton, Nicholas S; Stewart, Valley; Scow, Kate M; Hristova, Krassimira R

    2008-03-01

    A quantitative real-time PCR assay targeting the pcrA gene, encoding the catalytic subunit of perchlorate reductase, detected pcrA genes from perchlorate-reducing bacteria in three different genera and from soil microbial communities. Partial pcrA sequences indicated differences in the composition of perchlorate-reducing bacterial communities following exposure to different electron donors. PMID:18245250

  18. Mechanistic studies on the flavin:NADH reductase (PrnF) from Pseudomonas fluorescens involved in arylamine oxygenation

    DEFF Research Database (Denmark)

    Tiwari, Manish Kumar; Singh, Raushan Kumar; Lee, Jung-Kul;

    2012-01-01

    We report the mechanistic studies of a FAD:NADH reductase (PrnF) involved in arylamine oxygenation. PrnF catalyzes the reduction of FAD via a sequential ordered bi-bi mechanism with NADH as the first substrate to bind and FADH(2) as the first product to be released. The residues Asp145 and His146...

  19. Kinetic mechanism of an aldehyde reductase of Saccharomyces cerevisiae that relieves toxicity of furfural and 5-hydroxymethylfurfural

    Science.gov (United States)

    An effective means of relieving the toxicity of furan aldehydes, furfural (FFA) and 5-hydroxymethylfurfural (HMF), on fermenting organisms is essential for achieving efficient fermentation of lignocellulosic biomass to ethanol and other products. Ari1p, an aldehyde reductase from Saccharomyces cerev...

  20. Cotton Benzoquinon Reductase: Up-Regulation During Early Fiber Development and Heterologous Expresson and Characterization in Pichia Pastoris

    Science.gov (United States)

    Benzoquinone reductase (BR) is an enzyme which catalyzes the bivalent redox reactions of quinones without the production of free radical intermediates. Using 2-D PAGE, two proteins were found to be up-regulated in wild-type cotton ovules during the fiber initiation stage. These proteins were excis...

  1. Long-term Use of 5α-Reductase Inhibitors and the Risk of Male Breast Cancer.

    NARCIS (Netherlands)

    Duijnhoven, R.G.; Straus, S.M.J.M.; Souverein, P.C.; de Boer, A.; Bosch, J.L.H.R.; Hoes, A.W.; De Bruin, M.L.; Sub Pharmacoepidemiology; Dep Farmaceutische wetenschappen; Sub Pharmacotherapy, Theoretical

    2014-01-01

    Background The 5α-reductase inhibitors (5-ARI) finasteride and dutasteride are indicated for the treatment of lower urinary tract symptoms caused by benign prostatic hyperplasia. Case reports have suggested that 5-ARIs increase the risk for male breast cancer, with no conclusive evidence. The object

  2. Long-term use of 5α-reductase inhibitors and the risk of male breast cancer

    DEFF Research Database (Denmark)

    Duijnhoven, Ruben G; Straus, Sabine M J M; Souverein, Patrick C;

    2014-01-01

    BACKGROUND: The 5α-reductase inhibitors (5-ARI) finasteride and dutasteride are indicated for the treatment of lower urinary tract symptoms caused by benign prostatic hyperplasia. Case reports have suggested that 5-ARIs increase the risk for male breast cancer, with no conclusive evidence...

  3. Crystallization of mitochondrial rhodoquinol-fumarate reductase from the parasitic nematode Ascaris suum with the specific inhibitor flutolanil

    International Nuclear Information System (INIS)

    Rhodoquinol-fumarate reductase is a key enzyme in the anaerobic respiratory chain of adult A. suum mitochondria. Its crystallization in the presence of a mixture of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a form suitable for X-ray structure analysis is reported. In adult Ascaris suum (roundworm) mitochondrial membrane-bound complex II acts as a rhodoquinol-fumarate reductase, which is the reverse reaction to that of mammalian complex II (succinate-ubiquinone reductase). The adult A. suum rhodoquinol-fumarate reductase was crystallized in the presence of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a 3:2 weight ratio. The crystals belonged to the orthorhombic space group P212121, with unit-cell parameters a = 123.75, b = 129.08, c = 221.12 Å, and diffracted to 2.8 Å resolution using synchrotron radiation. The presence of two molecules in the asymmetric unit (120 kDa × 2) gives a crystal volume per protein mass (VM) of 3.6 Å3 Da−1

  4. A random-sequential mechanism for nitrite binding and active site reduction in copper-containing nitrite reductase

    NARCIS (Netherlands)

    Wijma, HJ; Jeuken, LJC; Verbeet, MP; Armstrong, FA; Canters, GW

    2006-01-01

    The homotrimeric copper-containing nitrite reductase ( NiR) contains one type-1 and one type-2 copper center per monomer. Electrons enter through the type-1 site and are shuttled to the type-2 site where nitrite is reduced to nitric oxide. To investigate the catalytic mechanism of NiR the effects of

  5. Diversity of assimilatory nitrate reductase genes from plankton and epiphytes associated with a seagrass bed.

    Science.gov (United States)

    Adhitya, Anita; Thomas, Florence I M; Ward, Bess B

    2007-11-01

    Assimilatory nitrate reductase gene fragments were isolated from epiphytes and plankton associated with seagrass blades collected from Tampa Bay, Florida, USA. Nitrate reductase genes from diatoms (NR) and heterotrophic bacteria (nasA) were amplified by polymerase chain reaction (PCR) using two sets of degenerate primers. A total of 129 NR and 75 nasA clones from four clone libraries, two from each of epiphytic and planktonic components, were sequenced and aligned. In addition, genomic DNA sequences for the NR fragment were obtained from Skeletonema costatum and Thalassiosira weissflogii diatom cultures. Rarefaction analysis with an operational taxonomic unit cut-off of 6% indicated that diversity of the NR and nasA clone libraries were similar, and that sequencing of the clone libraries was not yet saturated. Phylogenetic analysis indicated that 121 of the 129 NR clones sequenced were similar to diatom sequences. Of the eight non-diatom sequences, four were most closely related to the sequence of Chlorella vulgaris. Introns were found in 8% of the Tampa Bay NR sequences; introns were also observed in S. costatum, but not T. weissflogii. Introns from within the same clone library exhibited close similarity in nucleotide sequence, position and length; the corresponding exon sequences were unique. Introns from within the same component were similar in position and length, but not in nucleotide sequence. These findings raise questions about the function of introns, and mechanisms or time evolution of intron formation. A large cluster of 14 of the 75 nasA sequences was similar to sequences from Vibrio species; other sequences were closely related to sequences from Alteromonas, alpha-proteobacteria and Marinomonas-like species. Biogeographically consistent patterns were observed for the nasA Tampa Bay sequences compared with sequences from other locations: for example, Tampa Bay sequences were similar to those from the South Atlantic Bight, but not the Barents Sea. The

  6. Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina.

    Science.gov (United States)

    Simpson, Philippa J L; Codd, Rachel

    2011-11-01

    The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity of periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap(Sgel)) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap(Sput)) was examined at varied temperature. Irreversible deactivation of Nap(Sgel) and Nap(Sput) occurred at 54.5 and 65°C, respectively. When Nap(Sgel) was preincubated at 21-70°C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54°C, which suggested that Nap(Sgel) was poised for optimal catalysis at modest temperatures and, unlike Nap(Sput), did not benefit from thermally-induced refolding. At 20°C, Nap(Sgel) reduced selenate at 16% of the rate of nitrate reduction. Nap(Sput) did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap(Sgel) that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap(Sgel) cold-adapted phenotype. Protein homology modeling of Nap(Sgel) using a mesophilic template with 66% amino acid identity showed the majority of substitutions occurred at the protein surface distal to the Mo-MGD cofactor. Two mesophilic↔psychrophilic substitutions (Asn↔His, Val↔Trp) occurred in a region close to the surface of the NapA substrate funnel resulting in potential interdomain π-π and/or cation-π interactions. Three mesophilic↔psychrophilic substitutions occurred within 4.5Å of the Mo-MGD cofactor (Phe↔Met, Ala↔Ser, Ser↔Thr) resulting in local regions that varied in hydrophobicity and hydrogen bonding

  7. THE IMPACT OF THE ENZYME STEROID 5α-REDUCTASE 2 DEFICIENCY ON UROGENITAL BIRTH DEFECT IN MALES

    Directory of Open Access Journals (Sweden)

    Livia-Irina Olaru

    2014-07-01

    Full Text Available This research work on 5α-reductase 2 is aiming to put into evidence how a mutation of the gene codifying for this enzyme can affect the phenotype of different males, leading at a partial female phenotype.  This type of research focuses on offering a scientific explanation on different health problems affecting the normal lives of some people, even from early stages of their evolution.The experiment is focused on studying the impact of an enzyme called “steroid 5α-reductase” on the development of male urogenital components during the embryological life.  In order to study the steroid 5α-reductase 2 activity, the following procedures were used: isolation of a 5α-reductase 2 gene, genomicDNAisolation, and polymerase chain reactions.Biochemical analysis put into evidence two mutations representing opposite poles of disease manifestation, i.e. feminization of external genitalia versus predominantly male development. It suggested a correlation between clinical expression and severity of the impairment of enzyme function.  As mentioned by Imperato-McGinley, Guerrero, Gautier, & Peterson (1974, one of the mutations is called “G196S mutation.”  This mutation consists of a serine substitution for a glycine at position 196.  In this case, the level of 5α-reductase activity was sufficient to induce partial virilization.  The second type of mutation is called “G34R mutation.”  This mutation consists of an arginine substitution for glycine at position 34.  The G34R enzyme is essentially inactive, thus giving rise to the female phenotype.Mutations in the type 2 gene are responsible for autosomal recessive genetic disease of 5α-reductase deficiency.

  8. 5α-reductase inhibition suppresses testosterone-induced initial regrowth of regressed xenograft prostate tumors in animal models.

    Science.gov (United States)

    Masoodi, Khalid Z; Ramos Garcia, Raquel; Pascal, Laura E; Wang, Yujuan; Ma, Hei M; O'Malley, Katherine; Eisermann, Kurtis; Shevrin, Daniel H; Nguyen, Holly M; Vessella, Robert L; Nelson, Joel B; Parikh, Rahul A; Wang, Zhou

    2013-07-01

    Androgen deprivation therapy (ADT) is the standard treatment for patients with prostate-specific antigen progression after treatment for localized prostate cancer. An alternative to continuous ADT is intermittent ADT (IADT), which allows recovery of testosterone during off-cycles to stimulate regrowth and differentiation of the regressed prostate tumor. IADT offers patients a reduction in side effects associated with ADT, improved quality of life, and reduced cost with no difference in overall survival. Our previous studies showed that IADT coupled with 5α-reductase inhibitor (5ARI), which blocks testosterone conversion to DHT could prolong survival of animals bearing androgen-sensitive prostate tumors when off-cycle duration was fixed. To further investigate this clinically relevant observation, we measured the time course of testosterone-induced regrowth of regressed LuCaP35 and LNCaP xenograft tumors in the presence or absence of a 5ARI. 5α-Reductase inhibitors suppressed the initial regrowth of regressed prostate tumors. However, tumors resumed growth and were no longer responsive to 5α-reductase inhibition several days after testosterone replacement. This finding was substantiated by bromodeoxyuridine and Ki67 staining of LuCaP35 tumors, which showed inhibition of prostate tumor cell proliferation by 5ARI on day 2, but not day 14, after testosterone replacement. 5α-Reductase inhibitors also suppressed testosterone-stimulated proliferation of LNCaP cells precultured in androgen-free media, suggesting that blocking testosterone conversion to DHT can inhibit prostate tumor cell proliferation via an intracrine mechanism. These results suggest that short off-cycle coupled with 5α-reductase inhibition could maximize suppression of prostate tumor growth and, thus, improve potential survival benefit achieved in combination with IADT. PMID:23671262

  9. Characterisation of PduS, the pdu metabolosome corrin reductase, and evidence of substructural organisation within the bacterial microcompartment.

    Directory of Open Access Journals (Sweden)

    Joshua B Parsons

    Full Text Available PduS is a corrin reductase and is required for the reactivation of the cobalamin-dependent diol dehydratase. It is one component encoded within the large propanediol utilisation (pdu operon, which is responsible for the catabolism of 1,2-propanediol within a self-assembled proteinaceous bacterial microcompartment. The enzyme is responsible for the reactivation of the cobalamin coenzyme required by the diol dehydratase. The gene for the cobalamin reductase from Citrobacter freundii (pduS has been cloned to allow the protein to be overproduced recombinantly in E. coli with an N-terminal His-tag. Purified recombinant PduS is shown to be a flavoprotein with a non-covalently bound FMN that also contains two coupled [4Fe-4S] centres. It is an NADH-dependent flavin reductase that is able to mediate the one-electron reductions of cob(IIIalamin to cob(IIalamin and cob(IIalamin to cob(Ialamin. The [4Fe-4S] centres are labile to oxygen and their presence affects the midpoint redox potential of flavin. Evidence is presented that PduS is able to bind cobalamin, which is inconsistent with the view that PduS is merely a flavin reductase. PduS is also shown to interact with one of the shell proteins of the metabolosome, PduT, which is also thought to contain an [Fe-S] cluster. PduS is shown to act as a corrin reductase and its interaction with a shell protein could allow for electron passage out of the bacterial microcompartment.

  10. Intracellular signal transduction of PBAN action in the silkworm, Bombyx mori: involvement of acyl CoA reductase.

    Science.gov (United States)

    Ozawa, R; Matsumoto, S

    1996-03-01

    In the silkworm, Bombyx mori, production of the sex pheromone bombykol is regulated by a neurohormone termed PBAN. We have detected the activity of acyl CoA reductase in the pheromone gland of B. mori by using palmitoyl CoA as a substrate. The acyl CoA reductase requires NADPH, but not NADH, as a proton dono. When the pheromone gland was incubated with the PBAN fragment peptide TKYFSPRLamide, palmitoyl CoA was incorporated and converted into the corresponding C16 alcohols. Radio HPLC analysis revealed that these C16 alcohols were hexadecan-1-ol (81.2%), (Z)-11-hexadecen-1-ol (12.3%), and (E, Z)-10, 12-hexadecadien-1-ol (= bombykol, 6.5%). The production of C16 alcohols in the pheromone gland was inhibited by the known bombykol biosynthesis inhibitors EDTA, LaCl3, W-7, trifluoperazine, p-nitrophenyl phosphate, NaF and compactin. By contrast, when the pheromone gland homogenate was incubated in the presence of palmitoyl CoA and NADPH, production of C16 alcohols was affected by compactin, W-7 and trifluoperazine, but not by EDTA, LaCl3, p-nitrophenyl phosphate and NaF. These results indicate that compactin, W-7 and trifluoperazine directly suppress the step catalyzed by acyl CoA reductase, whereas EDTA, LaCl3, pNPP, and NaF inhibit bombykol production by affecting other biochemical steps in the signal transduction of PBAN action. The present results also imply that PBAN regulates the step catalyzed by acyl CoA reductase and that palmitoyl CoA could be used as a substrate of the acyl CoA reductase that regulates bombykol biosynthesis. PMID:8900596

  11. The Thiol Reductase Activity of YUCCA6 Mediates Delayed Leaf Senescence by Regulating Genes Involved in Auxin Redistribution.

    Science.gov (United States)

    Cha, Joon-Yung; Kim, Mi R; Jung, In J; Kang, Sun B; Park, Hee J; Kim, Min G; Yun, Dae-Jin; Kim, Woe-Yeon

    2016-01-01

    Auxin, a phytohormone that affects almost every aspect of plant growth and development, is biosynthesized from tryptophan via the tryptamine, indole-3-acetamide, indole-3-pyruvic acid, and indole-3-acetaldoxime pathways. YUCCAs (YUCs), flavin monooxygenase enzymes, catalyze the conversion of indole-3-pyruvic acid (IPA) to the auxin (indole acetic acid). Arabidopsis thaliana YUC6 also exhibits thiol-reductase and chaperone activity in vitro; these activities require the highly conserved Cys-85 and are essential for scavenging of toxic reactive oxygen species (ROS) in the drought tolerance response. Here, we examined whether the YUC6 thiol reductase activity also participates in the delay in senescence observed in YUC6-overexpressing (YUC6-OX) plants. YUC6 overexpression delays leaf senescence in natural and dark-induced senescence conditions by reducing the expression of SENESCENCE-ASSOCIATED GENE 12 (SAG12). ROS accumulation normally occurs during senescence, but was not observed in the leaves of YUC6-OX plants; however, ROS accumulation was observed in YUC6-OX(C85S) plants, which overexpress a mutant YUC6 that lacks thiol reductase activity. We also found that YUC6-OX plants, but not YUC6-OX(C85S) plants, show upregulation of three genes encoding NADPH-dependent thioredoxin reductases (NTRA, NTRB, and NTRC), and GAMMA-GLUTAMYLCYSTEINE SYNTHETASE 1 (GSH1), encoding an enzyme involved in redox signaling. We further determined that excess ROS accumulation caused by methyl viologen treatment or decreased glutathione levels caused by buthionine sulfoximine treatment can decrease the levels of auxin efflux proteins such as PIN2-4. The expression of PINs is also reduced in YUC6-OX plants. These findings suggest that the thiol reductase activity of YUC6 may play an essential role in delaying senescence via the activation of genes involved in redox signaling and auxin availability. PMID:27242830

  12. Nitrogen and oxygen regulation of Bacillus subtilis nasDEF encoding NADH-dependent nitrite reductase by TnrA and ResDE.

    Science.gov (United States)

    Nakano, M M; Hoffmann, T; Zhu, Y; Jahn, D

    1998-10-01

    The nitrate and nitrite reductases of Bacillus subtilis have two different physiological functions. Under conditions of nitrogen limitation, these enzymes catalyze the reduction of nitrate via nitrite to ammonia for the anabolic incorporation of nitrogen into biomolecules. They also function catabolically in anaerobic respiration, which involves the use of nitrate and nitrite as terminal electron acceptors. Two distinct nitrate reductases, encoded by narGHI and nasBC, function in anabolic and catabolic nitrogen metabolism, respectively. However, as reported herein, a single NADH-dependent, soluble nitrite reductase encoded by the nasDE genes is required for both catabolic and anabolic processes. The nasDE genes, together with nasBC (encoding assimilatory nitrate reductase) and nasF (required for nitrite reductase siroheme cofactor formation), constitute the nas operon. Data presented show that transcription of nasDEF is driven not only by the previously characterized nas operon promoter but also from an internal promoter residing between the nasC and nasD genes. Transcription from both promoters is activated by nitrogen limitation during aerobic growth by the nitrogen regulator, TnrA. However, under conditions of oxygen limitation, nasDEF expression and nitrite reductase activity were significantly induced. Anaerobic induction of nasDEF required the ResDE two-component regulatory system and the presence of nitrite, indicating partial coregulation of NasDEF with the respiratory nitrate reductase NarGHI during nitrate respiration. PMID:9765565

  13. Effects of Elevated Cytosolic Glutathione Reductase Activity on the Cellular Glutathione Pool and Photosynthesis in Leaves under Normal and Stress Conditions.

    Science.gov (United States)

    Foyer, C; Lelandais, M; Galap, C; Kunert, K J

    1991-11-01

    Tobacco (Nicotiana tabacum var Samsun) was transformed using the bacterial gor gene coding for the enzyme glutathione reductase. Transgenic plants were selected by their kanamycin resistence and expression of the bacterial gor gene. After separation by isoelectric focusing techniques, leaf extracts from transgenic plants having both native and bacterial glutathione reductase activity gave, in addition to the six bands of the native enzyme, two further closely running isoenzymes. These additional bands originating from the expression of the bacterial gor gene were nonchloroplastic. Leaves from transgenic plants had two- to 10-fold higher glutathione reductase activity than non-transgenic controls. The amount of extractable glutathione reductase activity obtained in transgenic plants was dependent on leaf age and the conditions to which leaves were exposed. Both light and exposure to methylviologen increased leaf glutathione reductase activity. Elevated levels of cytosolic glutathione reductase activity in transgenic plants had no effect on the amount or reduction state of the reduced glutathione/oxidized glutathione pool under optimal conditions or oxidative conditions induced by methylviologen. The glutathione pool was unaltered despite the oxidation-dependent loss of CO(2) assimilation and oxidation of enzymes involved in photosynthesis. However, the reduction state of the ascorbate pool was greater in transgenic plants relative to nontransgenic controls following illumination of methylviologen-treated leaf discs. Therefore, we conclude that in the natural state glutathione reductase is present in tobacco at levels above those required for maximal operation of the ascorbate-glutathione pathway. PMID:16668524

  14. The NADPH thioredoxin reductase C functions as an electron donor to 2-Cys peroxiredoxin in a thermophilic cyanobacterium Thermosynechococcus elongatus BP-1

    International Nuclear Information System (INIS)

    An NADPH thioredoxin reductase C was co-purified with a 2-Cys peroxiredoxin by the combination of anion exchange chromatography and electroelution from gel slices after native PAGE from a thermophilic cyanobacterium Thermosynechococcus elongatus as an NAD(P)H oxidase complex induced by oxidative stress. The result provided a strong evidence that the NADPH thioredoxin reductase C interacts with the 2-Cys peroxiredoxin in vivo. An in vitro reconstitution assay with purified recombinant proteins revealed that both proteins were essential for an NADPH-dependent reduction of H2O2. These results suggest that the reductase transfers the reducing power from NADPH to the peroxiredoxin, which reduces peroxides in the cyanobacterium under oxidative stress. In contrast with other NADPH thioredoxin reductases, the NADPH thioredoxin reductase C contains a thioredoxin-like domain in addition to an NADPH thioredoxin reductase domain in the same polypeptide. Each domain contains a conserved CXYC motif. A point mutation at the CXYC motif in the NADPH thioredoxin reductase domain resulted in loss of the NADPH oxidation activity, while a mutation at the CXYC motif in the thioredoxin-like domain did not affect the electron transfer, indicating that this motif is not essential in the electron transport from NADPH to the 2-Cys peroxiredoxin.

  15. Stress defense mechanisms of NADPH-dependent thioredoxin reductases (NTRs) in plants.

    Science.gov (United States)

    Cha, Joon-Yung; Barman, Dhirendra Nath; Kim, Min Gab; Kim, Woe-Yeon

    2015-01-01

    Plants establish highly and systemically organized stress defense mechanisms against unfavorable living conditions. To interpret these environmental stimuli, plants possess communication tools, referred as secondary messengers, such as Ca(2+) signature and reactive oxygen species (ROS) wave. Maintenance of ROS is an important event for whole lifespan of plants, however, in special cases, toxic ROS molecules are largely accumulated under excess stresses and diverse enzymes played as ROS scavengers. Arabidopsis and rice contain 3 NADPH-dependent thioredoxin reductases (NTRs) which transfer reducing power to Thioredoxin/Peroxiredoxin (Trx/Prx) system for scavenging ROS. However, due to functional redundancy between cytosolic and mitochondrial NTRs (NTRA and NTRB, respectively), their functional involvements under stress conditions have not been well characterized. Recently, we reported that cytosolic NTRA confers the stress tolerance against oxidative and drought stresses via regulation of ROS amounts using NTRA-overexpressing plants. With these findings, mitochondrial NTRB needs to be further elucidated. PMID:26039478

  16. Enhanced Xylitol Production by Mutant Kluyveromyces marxianus 36907-FMEL1 Due to Improved Xylose Reductase Activity.

    Science.gov (United States)

    Kim, Jin-Seong; Park, Jae-Bum; Jang, Seung-Won; Ha, Suk-Jin

    2015-08-01

    A directed evolution and random mutagenesis were carried out with thermotolerant yeast Kluyveromyces marxianus ATCC 36907 for efficient xylitol production. The final selected strain, K. marxianus 36907-FMEL1, exhibited 120 and 39 % improvements of xylitol concentration and xylitol yield, respectively, as compared to the parental strain, K. marxianus ATCC 36907. According to enzymatic assays for xylose reductase (XR) activities, XR activity from K. marxianus 36907-FMEL1 was around twofold higher than that from the parental strain. Interestingly, the ratios of NADH-linked and NADPH-linked XR activities were highly changed from 1.92 to 1.30 when K. marxianus ATCC 36907 and K. marxianus 36907-FMEL1 were compared. As results of KmXYL1 genes sequencing, it was found that cysteine was substituted to tyrosine at position 36 after strain development which might cause enhanced XR activity from K. marxianus 36907-FMEL1. PMID:26043853

  17. Thioredoxin reductase: a novel, independent prognostic marker in patients with hepatocellular carcinoma.

    Science.gov (United States)

    Li, Chunyan; Peng, Yan; Mao, Binglang; Qian, Kun

    2015-07-10

    Here we found that hepatocellular carcinoma (HCC) patients with recurrence outcome and nonsurvivors had significantly increased thioredoxin reductase (TrxR) serum levels on reoperation (P risk factors showed that TrxR was an independent predictor of recurrence (hazard ratios [HR] = 4.19; 95% confidence intervals [CI]: 3.21-7.08) and overall survival (HR = 5.56; 95% CI: 3.42-10.21). The area under the receiver operating characteristic curve of TrxR was 0.837 (95% CI, 0.794-0.881) for recurrence outcome and 0.901 (95% CI, 0.869-0.933) for mortality, which was superior to high-sensitivity-C-reactive protein and a-fetoprotein (P indicator predictive of poor prognosis and early recurrence in patients with HCC, which offering reliable information for predicting survival. PMID:25970775

  18. Modulation of HMG-CoA reductase activity by pantetheine/pantethine.

    Science.gov (United States)

    Cighetti, G; Del Puppo, M; Paroni, R; Galli Kienle, M

    1988-11-25

    The ability of pantetheine/pantethine to modulate the activity of HMG-CoA reductase (EC 1.1.1.34) was determined in vitro with rat liver microsomes. The decay of the activity was obtained with pantethine in the 10(-5)-10(-4) M range, whereas stimulation by pantetheine occurred at 10(-3)-10(-2) M, as previously reported for GSSG and GSH, respectively. Inhibition of HMG-CoA by pantethine in isolated liver cells was also investigated by measuring the enzyme activity in microsomes isolated from hepatocytes incubated without or with 1 mM pantethine under conditions previously shown by us to induce inhibition of cholesterol synthesis from acetate. The enzyme amount was not modified by pantethine, but in cells treated with the disulphide, the relative amounts of the thiolic active forms of the enzyme, both phosphorylated and dephosphorylated, were decreased to about half compared to controls. PMID:3196742

  19. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  20. Structure-Guided Development of Efficacious Antifungal Agents Targeting Candida Glabrata Dihydrofolate Reductase

    Energy Technology Data Exchange (ETDEWEB)

    Liu, J.; Bolstad, D; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Candida glabrata is a lethal fungal pathogen resistant to many antifungal agents and has emerged as a critical target for drug discovery. Over the past several years, we have been developing a class of propargyl-linked antifolates as antimicrobials and hypothesized that these compounds could be effective inhibitors of dihydrofolate reductase (DHFR) from C. glabrata. We initially screened a small collection of these inhibitors and found modest levels of potency. Subsequently, we determined the crystal structure of C. glabrata DHFR bound to a representative inhibitor with data to 1.6 A resolution. Using this structure, we designed and synthesized second-generation inhibitors. These inhibitors bind the C. glabrata DHFR enzyme with subnanomolar potency, display greater than 2000-fold levels of selectivity over the human enzyme, and inhibit the growth of C. glabrata at levels observed with clinically employed therapeutics.

  1. Targeting the Large Subunit of Human Ribonucleotide Reductase for Cancer Chemotherapy

    Directory of Open Access Journals (Sweden)

    Prem Singh Kaushal

    2011-10-01

    Full Text Available Ribonucleotide reductase (RR is a crucial enzyme in de novo DNA synthesis, where it catalyses the rate determining step of dNTP synthesis. RRs consist of a large subunit called RR1 (α, that contains two allosteric sites and one catalytic site, and a small subunit called RR2 (β, which houses a tyrosyl free radical essential for initiating catalysis. The active form of mammalian RR is an anbm hetero oligomer. RR inhibitors are cytotoxic to proliferating cancer cells. In this brief review we will discuss the three classes of RR, the catalytic mechanism of RR, the regulation of the dNTP pool, the substrate selection, the allosteric activation, inactivation by ATP and dATP, and the nucleoside drugs that target RR. We will also discuss possible strategies for developing a new class of drugs that disrupts the RR assembly.

  2. Nitrite controls the release of nitric oxide in Pseudomonas aeruginosa cd1 nitrite reductase

    International Nuclear Information System (INIS)

    Nitrite reductase (cd1NIR) from Pseudomonas aeruginosa, which catalyses the reduction of nitrite to nitric oxide (NO), contains a c-heme as the electron acceptor and a d1-heme where catalysis occurs. Reduction involves binding of nitrite to the reduced d1-heme, followed by dehydration to yield NO; release of NO and re-reduction of the enzyme close the cycle. Since NO is a powerful inhibitor of ferrous hemeproteins, enzymatic turnover demands the release of NO. We recently discovered that NO dissociation from the ferrous d1-heme is fast, showing that cd1NIR behaves differently from other hemeproteins. Here we demonstrate for the first time that the physiological substrate nitrite displaces NO from the ferrous enzyme, which enters a new catalytic cycle; this reaction depends on the conserved His369 whose role in substrate stabilization is crucial for catalysis. Thus we suggest that also in vivo the activity of cd1NIR is controlled by nitrite

  3. Association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and age of onset in schizophrenia

    DEFF Research Database (Denmark)

    Vares, Maria; Saetre, Peter; Deng, Hong; Cai, Guiqing; Liu, Xiehe; Hansen, Thomas; Rasmussen, Henrik B; Werge, Thomas; Melle, Ingrid; Djurovic, Srdjan; Andreassen, Ole A; Agartz, Ingrid; Hall, Håkan; Terenius, Lars; Jönsson, Erik G

    Different lines of evidence indicate that methylenetetrahydrofolate reductase (MTHFR) functional gene polymorphisms, causative in aberrant folate-homocysteine metabolism, are associated with increased vulnerability to several heritable developmental disorders. Opposing views are expressed...... considering the possible association between MTHFR and susceptibility for schizophrenia. In order to evaluate if age of onset could explain some of this discrepancy we investigated the relationship between two functional MTHFR gene polymorphisms and age at onset in this disorder. Scandinavian patients (n...... = 820) diagnosed with schizophrenia, schizoaffective disorder, and schizophreniform disorder were investigated. Two functional MTHFR single nucleotide polymorphisms (SNPs; rs1801131 and rs1801133) were genotyped and the effect of MTHFR polymorphisms on the age of onset was examined with survival...

  4. Enantiocomplementary Yarrowia lipolytica Oxidoreductases: Alcohol Dehydrogenase 2 and Short Chain Dehydrogenase/Reductase

    Directory of Open Access Journals (Sweden)

    Margit Winkler

    2013-08-01

    Full Text Available Enzymes of the non-conventional yeast Yarrowia lipolytica seem to be tailor-made for the conversion of lipophilic substrates. Herein, we cloned and overexpressed the Zn-dependent alcohol dehydrogenase ADH2 from Yarrowia lipolytica in Escherichia coli. The purified enzyme was characterized in vitro. The substrate scope for YlADH2 mediated oxidation and reduction was investigated spectrophotometrically and the enzyme showed a broader substrate range than its homolog from Saccharomyces cerevisiae. A preference for secondary compared to primary alcohols in oxidation direction was observed for YlADH2. 2-Octanone was investigated in reduction mode in detail. Remarkably, YlADH2 displays perfect (S-selectivity and together with a highly (R-selective short chain dehydrogenase/ reductase from Yarrowia lipolytica it is possible to access both enantiomers of 2-octanol in >99% ee with Yarrowia lipolytica oxidoreductases.

  5. Large and small subunits of the Aujeszky's disease virus ribonucleotide reductase: nucleotide sequence and putative structure.

    Science.gov (United States)

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-09-13

    We determined the entire DNA sequence of two adjacent open reading frames of Aujeszky's disease virus encoding ribonucleotide reductase genes with the intergenic sequence of 9 bp. From the sequence analysis we deduce that ORFs encode large and small subunits, with sizes of 835 and 303 amino acids, respectively. Amino acid sequence comparison of ADV RR2 with that of equine herpesvirus type 1, bovine herpesvirus type 1, HSV-1 and varicella zoster virus revealed that 48% of amino acids represent clusters of residues conserved in all compared sequences. In the N-terminal part ADV RR1 shows low homology to the RR1 of other herpesviruses. Rest of the RR1 protein contains highly conserved amino acid sequences divided by blocks of low homology. PMID:8086454

  6. Methylenetetrahydrofolate reductase mutations, a genetic cause for familial recurrent neural tube defects

    Directory of Open Access Journals (Sweden)

    Laxmi V Yaliwal

    2012-01-01

    Full Text Available Methylenetetrahydrofolate reductase (MTHFR gene mutations have been implicated as risk factors for neural tube defects (NTDs. The best-characterized MTHFR genetic mutation 677C→T is associated with a 2-4 fold increased risk of NTD if patient is homozygous for this mutation. This risk factor is modulated by folate levels in the body. A second mutation in the MTHFR gene is an A→C transition at position 1298. The 1298A→C mutation is also a risk factor for NTD, but with a smaller relative risk than 677C→T mutation. Under conditions of low folate intake or high folate requirements, such as pregnancy, this mutation could become of clinical importance. We present a case report with MTHFR genetic mutation, who presented with recurrent familial pregnancy losses due to anencephaly/NTDs.

  7. The radical mechanism of biological methane synthesis by methyl-coenzyme M reductase.

    Science.gov (United States)

    Wongnate, Thanyaporn; Sliwa, Dariusz; Ginovska, Bojana; Smith, Dayle; Wolf, Matthew W; Lehnert, Nicolai; Raugei, Simone; Ragsdale, Stephen W

    2016-05-20

    Methyl-coenzyme M reductase, the rate-limiting enzyme in methanogenesis and anaerobic methane oxidation, is responsible for the biological production of more than 1 billion tons of methane per year. The mechanism of methane synthesis is thought to involve either methyl-nickel(III) or methyl radical/Ni(II)-thiolate intermediates. We employed transient kinetic, spectroscopic, and computational approaches to study the reaction between the active Ni(I) enzyme and substrates. Consistent with the methyl radical-based mechanism, there was no evidence for a methyl-Ni(III) species; furthermore, magnetic circular dichroism spectroscopy identified the Ni(II)-thiolate intermediate. Temperature-dependent transient kinetics also closely matched density functional theory predictions of the methyl radical mechanism. Identifying the key intermediate in methanogenesis provides fundamental insights to develop better catalysts for producing and activating an important fuel and potent greenhouse gas. PMID:27199421

  8. Sequential backbone resonance assignments of the E. coli dihydrofolate reductase Gly67Val mutant: folate complex.

    Science.gov (United States)

    Puthenpurackal Narayanan, Sunilkumar; Maeno, Akihiro; Wada, Yuji; Tate, Shin-Ichi; Akasaka, Kazuyuki

    2016-04-01

    Occasionally, a mutation in an exposed loop region causes a significant change in protein function and/or stability. A single mutation Gly67Val of E. coli dihydrofolate reductase (DHFR) in the exposed CD loop is such an example. We have carried out the chemical shift assignments for H(N), N(H), C(α) and C(β) atoms of the Gly67Val mutant of E. coli DHFR complexed with folate at pH 7.0, 35 °C, and then evaluated the H(N), N(H), C(α) and C(β) chemical shift changes caused by the mutation. The result indicates that, while the overall secondary structure remains the same, the single mutation Gly67Val causes site-specific conformational changes of the polypeptide backbone restricted around the adenosine-binding subdomain (residues 38-88) and not in the distant catalytic domain. PMID:26482924

  9. Role of 5α-reductase inhibitors in androgen-stimulated skin disorders.

    Science.gov (United States)

    Azzouni, Faris; Zeitouni, Nathalie; Mohler, James

    2013-02-01

    5α-reductase (5α-R) isozymes are ubiquitously expressed in human tissues. This enzyme family is composed of 3 members that perform several important biologic functions. 5α-R isozymes play an important role in benign prostate hyperplasia, prostate cancer, and androgen-stimulated skin disorders, which include androgenic alopecia, acne, and hirsutism. Discovery of 5α-R type 2 deficiency in 1974 sparked interest in development of pharmaceutical agents to inhibit 5α-R isozymes, and 2 such inhibitors are currently available for clinical use: finasteride and dutasteride. 5α-R inhibitors are US Food and Drug Administration (FDA)-approved for the treatment of benign prostate hyperplasia. Only finasteride is FDA-approved for treatment of male androgenic alopecia. This article reviews the pathophysiology of androgen-stimulated skin disorders and the key clinical trials using 5α-R inhibitors in the treatment of androgen-stimulated skin disorders. PMID:23377402

  10. Trapping of the Enoyl-Acyl Carrier Protein Reductase-Acyl Carrier Protein Interaction.

    Science.gov (United States)

    Tallorin, Lorillee; Finzel, Kara; Nguyen, Quynh G; Beld, Joris; La Clair, James J; Burkart, Michael D

    2016-03-30

    An ideal target for metabolic engineering, fatty acid biosynthesis remains poorly understood on a molecular level. These carrier protein-dependent pathways require fundamental protein-protein interactions to guide reactivity and processivity, and their control has become one of the major hurdles in successfully adapting these biological machines. Our laboratory has developed methods to prepare acyl carrier proteins (ACPs) loaded with substrate mimetics and cross-linkers to visualize and trap interactions with partner enzymes, and we continue to expand the tools for studying these pathways. We now describe application of the slow-onset, tight-binding inhibitor triclosan to explore the interactions between the type II fatty acid ACP from Escherichia coli, AcpP, and its corresponding enoyl-ACP reductase, FabI. We show that the AcpP-triclosan complex demonstrates nM binding, inhibits in vitro activity, and can be used to isolate FabI in complex proteomes. PMID:26938266

  11. Sulfur globule oxidation in green sulfur bacteria is dependent on the dissimilatory sulfite reductase system

    DEFF Research Database (Denmark)

    Holkenbrink, Carina; Ocón Barbas, Santiago; Mellerup, Anders;

    2011-01-01

    Green sulfur bacteria oxidize sulfide and thiosulfate to sulfate with extracellular globules of elemental sulfur as intermediate. Here we investigated which genes are involved in the formation and consumption of these sulfur globules in the green sulfur bacterium Chlorobaculum tepidum. We show that...... sulfur globule oxidation is strictly dependent on the dissimilatory sulfite reductase (DSR) system. Deletion of dsrM/CT2244 or dsrT/CT2245 or the two dsrCABL clusters (CT0851-CT0854, CT2247-2250) abolished sulfur globule oxidation and prevented formation of sulfate from sulfide, whereas deletion of dsr......:quinone oxidoreductases (sqrB/CT0117 and sqrD/CT1087) were deleted, exhibited a decreased sulfide oxidation rate (~50% of wild type), yet formation and consumption of sulfur globules were not affected. The observation that mutants lacking the DSR system maintain efficient growth, suggests that the DSR system is...

  12. Study on the violet LED-induced fluorescence spectra of thioredoxin reductase from human brain

    Institute of Scientific and Technical Information of China (English)

    Xiufeng Lan(兰秀风); Tao Yang(杨涛); Shumei Gao(高淑梅); Xiaosen Luo(骆晓森); Zhonghua Shen(沈中华); Jian Lu(陆建); Xiaowu Ni(倪晓武); Lin Xu(许琳)

    2003-01-01

    The technique of fluorescence spectroscopy is applied to study thioredoxin reductase (TrxR) in the ce;lsof human brain. Experimental results show that, by the violet light emitting diode (LED, λmax=407 nm)light irradiation, TrxR is able to emit three striking spectral bands (528 - 582 nm; 588 - 660 nm; 683 - 700nm). The fluorescence intensity is linear to the concentration of TrxR. The spectrum of denatured TrxR israther different from that of organized TrxR, which reflects the structure change between denatured TrxRand organized TrxR. Furthermore, physical and biochemical mechanisms of fluorescence production forLED light-induced TrxR spectra and its characteristics are analyzed. This paper may be useful to betterunderstand the structure of TrxR, and to provide new spectroscopic information to improve the resolutionfor this kind of biology structure.

  13. Electrochemical Single‐Molecule AFM of the Redox Metalloenzyme Copper Nitrite Reductase in Action

    DEFF Research Database (Denmark)

    Hao, Xian; Zhang, Jingdong; Christensen, Hans Erik Mølager;

    2012-01-01

    We studied the electrochemical behavior of the redox metalloenzyme copper nitrite reductase (CNiR, Achromobacter xylosoxidans) immobilized on a Au(111)‐electrode surface modified by a self‐assembled cysteamine molecular monolayer (SAM) using a combination of cyclic voltammetry and electrochemically......‐controlled atomic force microscopy (in situ AFM). The enzyme showed no voltammetric signals in the absence of nitrite substrate, whereas a strong reductive electrocatalytic signal appeared in the presence of nitrite. Such a pattern is common in protein film and monolayer voltammetry and points to conformational...... changes in the enzyme upon substrate binding. Binding thus either improves the enzyme/electrode contact, or opens intramolecular electron‐transfer channels between the redox center for electron inlet (a type I copper center) and the catalytic site for nitrite reduction (a type II copper center). The in...

  14. Evaluation of Enoyl-Acyl Carrier Protein Reductase Inhibitors as Pseudomonas aeruginosa Quorum-Quenching Reagents

    Directory of Open Access Journals (Sweden)

    Søren Molin

    2010-02-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic pathogen which is responsible for a wide range of infections. Production of virulence factors and biofilm formation by P. aeruginosa are partly regulated by cell-to-cell communication quorum-sensing systems. Identification of quorum-quenching reagents which block the quorum-sensing process can facilitate development of novel treatment strategies for P. aeruginosa infections. We have used molecular dynamics simulation and experimental studies to elucidate the efficiencies of two potential quorum-quenching reagents, triclosan and green tea epigallocatechin gallate (EGCG, which both function as inhibitors of the enoyl-acyl carrier protein (ACP reductase (ENR from the bacterial type II fatty acid synthesis pathway. Our studies suggest that EGCG has a higher binding affinity towards ENR of P. aeruginosa and is an efficient quorum-quenching reagent. EGCG treatment was further shown to be able to attenuate the production of virulence factors and biofilm formation of P. aeruginosa.

  15. Structural Mechanism of Allosteric Activity Regulation in a Ribonucleotide Reductase with Double ATP Cones.

    Science.gov (United States)

    Johansson, Renzo; Jonna, Venkateswara Rao; Kumar, Rohit; Nayeri, Niloofar; Lundin, Daniel; Sjöberg, Britt-Marie; Hofer, Anders; Logan, Derek T

    2016-06-01

    Ribonucleotide reductases (RNRs) reduce ribonucleotides to deoxyribonucleotides. Their overall activity is stimulated by ATP and downregulated by dATP via a genetically mobile ATP cone domain mediating the formation of oligomeric complexes with varying quaternary structures. The crystal structure and solution X-ray scattering data of a novel dATP-induced homotetramer of the Pseudomonas aeruginosa class I RNR reveal the structural bases for its unique properties, namely one ATP cone that binds two dATP molecules and a second one that is non-functional, binding no nucleotides. Mutations in the observed tetramer interface ablate oligomerization and dATP-induced inhibition but not the ability to bind dATP. Sequence analysis shows that the novel type of ATP cone may be widespread in RNRs. The present study supports a scenario in which diverse mechanisms for allosteric activity regulation are gained and lost through acquisition and evolutionary erosion of different types of ATP cone. PMID:27133024

  16. Inhibition of fumarate reductase in Leishmania major and L. donovani by chalcones

    DEFF Research Database (Denmark)

    Chen, M; Zhai, L; Christensen, S B;

    2001-01-01

    Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity of mitoch......Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity...... of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major....... Since FRD exists in the Leishmania parasite and does not exist in mammalian cells, it could be an excellent target for antiprotozoal drugs....

  17. Evidence for a plasma-membrane-bound nitrate reductase involved in nitrate uptake of Chlorella sorokiniana

    Science.gov (United States)

    Tischner, R.; Ward, M. R.; Huffaker, R. C.

    1989-01-01

    Anti-nitrate-reductase (NR) immunoglobulin-G (IgG) fragments inhibited nitrate uptake into Chlorella cells but had no affect on nitrate uptake. Intact anti-NR serum and preimmune IgG fragments had no affect on nitrate uptake. Membrane-associated NR was detected in plasma-membrane (PM) fractions isolated by aqueous two-phase partitioning. The PM-associated NR was not removed by sonicating PM vesicles in 500 mM NaCl and 1 mM ethylenediaminetetraacetic acid and represented up to 0.8% of the total Chlorella NR activity. The PM NR was solubilized by Triton X-100 and inactivated by Chlorella NR antiserum. Plasma-membrane NR was present in ammonium-grown Chlorella cells that completely lacked soluble NR activity. The subunit sizes of the PM and soluble NRs were 60 and 95 kDa, respectively, as determined by sodium-dodecyl-sulfate electrophoresis and western blotting.

  18. Sources of reducing equivalents for nitrite reductase in Pisum arvense roots

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus

    2014-02-01

    Full Text Available Glucose-6-phosphate and NADP+ as well as malic acid and NADP+ present in the incubation mixture enhanced nitrite reductase (EC 1.6.6.4 activity in Pisum arvense roots. This was manifested by a depression of the nitrite level in the tissues and an increased reduction of nitrites by plastids isolated from P. arvense roots. A marked stimulation of plastid malate dehydrogenase was also observed under the influence of nitrates present in the medium. These results suggest that pyridin nucleotides utilised by NiR during nitrite reduction may be formed not only in processes of glucose-6-phosphate oxidation in the pentosephosphate cycle, but also of malic acid by NADP+-dependent malate dehydrogenase.

  19. Scopoletin Inhibits Rat Aldose Reductase Activity and Cataractogenesis in Galactose-Fed Rats

    Directory of Open Access Journals (Sweden)

    Junghyun Kim

    2013-01-01

    Full Text Available Cataracts are a major cause of human blindness. Aldose reductase (AR is an important rate-limiting enzyme that contributes to cataract induction in diabetic patients. Scopoletin is the main bioactive constituent of flower buds from Magnolia fargesii and is known to inhibit AR activity. To assess scopoletin’s ability to mitigate sugar cataract formation in vivo, we studied its effects in a rat model of dietary galactose-induced sugar cataracts. Galactose-fed rats were orally dosed with scopoletin (10 or 50 mg/kg body weight once a day for 2 weeks. Administering scopoletin delayed the progression of the cataracts that were induced by dietary galactose. Scopoletin also prevented galactose-induced changes in lens morphology, such as lens fiber swelling and membrane rupture. Scopoletin’s protective effect against sugar cataracts was mediated by inhibiting both AR activity and oxidative stress. These results suggest that scopoletin is a useful treatment for sugar cataracts.

  20. Amperometric nitrate biosensor based on Carbon nanotube/Polypyrrole/Nitrate reductase biofilm electrode

    International Nuclear Information System (INIS)

    This study describes the construction and characterization of an amperometric nitrate biosensor based on the Polypyrrole (PPy)/Carbon nanotubes (CNTs) film. Nitrate reductase (NR) was both entrapped into the growing PPy film and chemically immobilized via the carboxyl groups of CNTs to the CNT/PPy film electrode. The optimum amperometric response for nitrate was obtained in 0.1 M phosphate buffer solution (PBS), pH 7.5 including 0.1 M lithium chloride and 7 mM potassium ferricyanide with an applied potential of 0.13 V (vs. Ag/AgCl, 3 M NaCl). Sensitivity was found to be 300 nA/mM in a linear range of 0.44–1.45 mM with a regression coefficient of 0.97. The biosensor response showed a higher linear range in comparison to standard nitrate analysis methods which were tested in this study and NADH based nitrate biosensors. A minimum detectable concentration of 0.17 mM (S/N = 3) with a relative standard deviation (RSD) of 5.4% (n = 7) was obtained for the biosensor. Phenol and glucose inhibit the electrochemical reaction strictly at a concentration of 1 μg/L and 20 mg/L, respectively. The biosensor response retained 70% of its initial response over 10 day usage period when used everyday. - Highlights: ► K3Fe(CN)6 has been used for the first time as mediator for nitrate reductase. ► Better performance was obtained in comparison to other nitrate biosensor studies operated with various mediators. ► Analytical parameters were better than standard nitrate analysis methods.